5-htr1b modulator for use in the treatment of solid tumours

Abstract

This invention relates to a new potent and selective compound that modulates serotonin receptor 1B (5-HTR1B) also known as 5-hydroxytryptamine receptor 1B (5-HT1B). The compound is of utility in the treatment of cancer, in particular solid tumors.

Description

[0001] 5-HTR1B MODULATOR FOR USE IN THE TREATMENT OF SOLID TUMOURS

[0002] FIELD OF THE INVENTION

[0003] This invention relates to a new potent and selective compound that modulates serotonin receptor IB (5-HTR1B) also known as 5-hydroxytryptamine receptor IB (5-HT1B) or simply HTR1B. The compound is of utility in the treatment of cancer, in particular solid tumors.

[0004] BACKGROUND OF THE INVENTION

[0005] Serotonin (5-hydroxytryptamine, 5-HT) is a biogenic monoamine that acts as a neurotransmitter in the central nervous system (CNS), local mediator in the gut and vasoactive agent in the blood. It is synthesized by a two-step pathway from the essential amino-acid tryptophan. Most of the serotonin of the body is located in the periphery (Sarrouilhe D. et al., Serotonin and Cancer: What Is the Link?, Current Molecular Medicine 2015, 15, 62-77).

[0006] Serotonin has been linked to a variety of CNS functions such as brain development, circadian rhythm, thermoregulation, cognition, pain, appetite, sexual drive, fear, mood, violent behavior, motor function and neuroendocrine secretion. Moreover, serotonin is implicated in many CNS and psychiatric disorders: Parkinson's disease, depression, hallucination, schizophrenia, bulimia, anxiety, addiction, chronic stress. Consequently, serotoninergic systems are targets for a large array of psychoactive compounds including antidepressants, antipsychotics and hallucinogens (Marin P. et al., 5-HT Receptor-Associated Protein Networks: New Targets for Drug Discovery in Psychiatric Disorders?, Current Drug Targets, 2012,13, 28-52).

[0007] Part of the ability of 5-HT to mediate a wide range of actions arises from the imposing number of 5-HT receptors, which are divided into 7 families, all but one of which are members of the G-protein coupled receptor (GPCR) superfamily. The exception is the 5-HT3 receptor, a Cysloop ligand-gated ion channel.

[0008] Particularly, the 5-HT receptor family consists of five separate gene products: 5-HT1A, 5- HT1B, 5-HT1D, 5-HT1E, and 5-HT1F receptors. Each is encoded by a single, intron-less reading frame and they share considerable sequence homology. All of these receptors couple to Gi / o to inhibit adenylyl cyclase and reduce cAMP levels, but additional signal transduction mechanisms have also been described. Several of these receptors are well known as autoreceptors that regulate the excitability of serotonin neurons and the release of serotonin, but also they are expressed in nonserotonergic neurons, where they can have analogous effects on other neurotransmitters.

[0009] In the present invention, the 5-HT1B (also known as and referred to herein interchangeably as 5-HTR1B) receptor is of particular interest. 5-HT1B is distributed broadly in the CNS in serotonergic and nonserotonergic neurons. This autoreceptor has been found to reduce serotonin synthesis and release and enhance reuptake via the serotonin transporter. Also, it inhibits the release of a range of different neurotransmitters, depending on the neuron types that express it.

[0010] Systemic administration of 5-HT1B receptor agonists have several behavioral effects including increased locomotion, changes in brain reward mechanisms, and decreased aggression, whereas selective antagonists may have some procognitive potential. The expression of this receptor in diverse and potentially competing sets of neurons may impact its utility as a clinical target, although several 5-HT1B / D receptor agonists are effective as antimigraine treatments. 5-HTB receptor knockout mice have been tested extensively and have a distinct phenotype characterized by increased aggression and, in most cases, predisposition for addiction-like behaviors (Barnes N. M. et al., Neuronal 5-HT Receptors and SERT, Tocris Scientific Review Series, https: / / www.tocris.com / literature / scientific-reviews / 5- ht-receptors).

[0011] 5-HT has been involved in autocrine loops of growth factors contributing to cell proliferation in aggressive tumors, but several studies have shown that serotonin can also exert an antineoplastic effect via inhibition of angiogenesis. An in silica screening was performed to search for small molecules that induce terminal differentiation and apomorphine, an HTR1 / 2 antagonist, was identified. A study was conducted in immunodeficient mice, which were transplanted with human acute myeloid leukemia (AML) cells and left for 7 days for leukemia to be established. Afterwards, mice were treated every 2 days with apomorphine (5 mg / kg weight) or methiothepin (0.1 mg / kg weight) for 14 days. Both HTR1 antagonists produced a significant reduction in AML burden in bone marrow (BM) as compared to vehicle treated mice. Similarly, the clonogenic capacity of engrafted AML cells was impaired in both treated mice, stressing the effect of HTR inhibition in the selfrenewal capacity of AML cells. The results indicate that AML cells express HTR1A and HTR1B and their inhibition induces terminal differentiation and cell death. Interestingly, leukemia stem cells (LSCs) are more sensitive to HTR1 antagonists than more mature AML blasts. Therefore, HTR1A and HTR1B may constitute an interesting target for AML therapy. This study demonstrated the implication of HTR1 in cancer stem cells, and results highlight the biological role of HTRls on leukemia maintenance, suggesting that HTR1 signalling is involved in survival of AML blasts and in LSC functionality. (Etxabe, A. et al, Inhibition of serotonin receptor type 1 in acute myeloid leukemia impairs leukemia stem-cell functionality: A promising novel therapeutic target, Leukemia, 2017,1-15).

[0012] However, as outlined above, the application of the antitumor effect of these HTR1B antagonists has so far been limited to haematological conditions (see also Castro-Palomino Laria et al. WO 2022 / 074103). In fact, very limited and contradictory literature was available on the actual presence of HTR1B in other cancers, in particular in any solid tumor.

[0013] At the same time, there remains a need to develop further therapies for the treatment of other cancers, in particular solid tumors.

[0014] SUMMARY OF THE INVENTION

[0015] The inventors address this need by providing a novel HTR1B antagonist. The compound is referred to as "Compound A" in the present disclosure:

[0016] Compound A

[0017] The compound is efficient in treating cancers, in particular solid tumors.

[0018] The advantageous properties of the compound are further described in detail hereinbelow and in the example. In particular, the inventors screened the NCI panel of cell lines of representative tumors (in particular solid tumors such as those tumors associated with lung, kidney, ovarian, breast and colon cancer) and generated data with Compound A. Throughout the application and in the associated examples SB224289 (short SB9, Selkirk, J.V., et al., British Journal of Pharmacology (1998) 125: 202-208) and SB216641 (short SB41, Price, G.W., Naunyn Schiedebergs Arch. Parmacol. (1997) 356(3): 312-320) are used as references. SB224289 (short SB9) and SB216641 (SB41) are known HTR1B receptor antagonists. Therefore, these experiments highlight that the claimed compound of the invention not only provides a highly active compound, but is also surprisingly more active than other HTR1B antagonists: Compound A was shown to be the most highly active compound in a wide variety of tumors, in particular solid tumors.

[0019] In more detail, the inventors showed that Compound A was efficacious also on spheroids of tumoral cell lines derived from solid tumors. This highlights the potential of the compound to avoid relapses by treating the tumoral stem cells, of which spheroids can be considered a surrogate model. A surprising observation is that HTR1B is actually overexpressed when spheroids are derived from 2D cultures.

[0020] Further, the inventors surprisingly found that there were unexpected synergies between the HTR1B antagonists of the invention with standard of care products used to treat solid tumors. Synergistic effect with compounds having different mechanism of action were evaluated, such as paclitaxel or sorafenib.

[0021] Finally, the inventors also showed Compound A antitumoral activity in solid tumors, triple negative breast cancer and ovarian cancer. In triple negative breast cancer, they observed very good efficacy as standalone and strong in vivo synergistic effect with paclitaxel, as anticipated by the in vitro data.

[0022] In a first aspect, the present invention thus provides a compound of the formula:

[0023] Compound A or a pharmaceutically acceptable salt thereof for use in a method of treating cancer. The present disclosure also provides a corresponding method for treatment of the human or animal body wherein the method comprises administration of a therapeutically effective amount of said compound or a pharmaceutically acceptable salt thereof to a subject in need thereof.

[0024] In a second aspect, the compound of the first aspect is provided in a composition together with at least one pharmaceutically acceptable excipient. In a further aspect, the composition is a pharmaceutical composition.

[0025] In a third aspect, the cancer is a solid tumour. The present disclosure also provides a corresponding method for treatment of the human or animal body wherein the method comprises administration of a therapeutically effective amount of said compound or a pharmaceutically acceptable salt thereof to a subject with a solid tumor.

[0026] In a fourth aspect, the cancer is selected from breast cancer, colon cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer or melanoma.

[0027] In a fifth aspect, the cancer is preferably breast cancer or ovarian cancer.

[0028] In a sixth aspect, the method comprises administration of Compound A or a pharmaceutically acceptable salt thereof at a dose of 30 mg / kg per administration, more preferably 90 mg / kg at 10 ml / kg.

[0029] In a seventh aspect, the method comprises once daily administration of Compound A or a pharmaceutically acceptable salt thereof.

[0030] In an eight aspect, the method comprises administration of Compound A or a pharmaceutically acceptable salt thereof for at least 20 consecutive days, optionally wherein administration lasts for at least 28 consecutive days.

[0031] In a ninth aspect, the method comprises oral administration of Compound A or a pharmaceutically acceptable salt thereof, preferably wherein Compound A is exclusively administered orally.

[0032] In a tenth aspect the method of any of the preceding aspects additionally comprises administration of paclitaxel or a pharmaceutically acceptable salt thereof.

[0033] In an eleventh aspect, the method of any of the preceding aspects additionally comprises administration of sorafenib or a pharmaceutically acceptable salt thereof. In a twelfth aspect, the method of the tenth or 11th aspect comprises once weekly administration of paclitaxel or a pharmaceutically acceptable salt thereof and / or sorafenib or a pharmaceutically acceptable salt thereof.

[0034] In a thirteenth aspect, the method of any one of the tenth to the twelfth aspect comprises administration of paclitaxel or a pharmaceutically acceptable salt thereof at a dose of 15mg / kg per administration.

[0035] In a fourteenth aspect, the method of any one of the tenth to the thirteenth aspect comprises administration of sorafenib or a pharmaceutically acceptable salt thereof at a dose of 15mg / kg per administration.

[0036] In a fifteenth aspect, the method of any one of the tenth to the fourteenth aspect comprises subcutaneous administration of paclitaxel or a pharmaceutically acceptable salt thereof and / or sorafenib or a pharmaceutically acceptable salt thereof, preferably wherein all administrations are subcutaneous.

[0037] BRIEF DESCRIPTION OF FIGURES

[0038] Figure 1: NCI-60 human tumor cell lines

[0039] Figure 2: Method for Example 1

[0040] Figure 3: Cell viability, measured by 7-AAD exclusion by flow cytometry, in breast cancer cell lines after 48 h of DMSO, SB224289 (5 pM), SB216641 (5 pM) and Compound A (1 / 2.5 / 5 / 10 / 20 pM) treatments. Data are represented as mean s.e.m.

[0041] Figure 4: Cell viability measured by 7-AAD exclusion by flow cytometry in colon cancer cell lines after 48 h of DMSO, SB224289 (5 pM) and SB216641 (5 pM), Compound A (1 / 2.5 / 5 / 10 / 20 pM) treatments. Data are represented as mean s.e.m.

[0042] Figure 5: Cell viability measured by 7-AAD exclusion by flow cytometry in kidney cancer cell lines after 48 h of DMSO, SB224289 (5 pM), SB216641 (5 pM) and Compound A (1 / 2.5 / 5 / 10 / 20 pM) treatments. Data are represented as mean s.e.m.

[0043] Figure 6: Cell viability measured by 7-AAD exclusion by flow cytometry in lung cancer cell lines after 48 h of DMSO, SB224289 (5 pM), SB216641 (5 pM) and Compound A (1 / 2.5 / 5 / 10 / 20 pM) treatments. Data are represented as mean s.e.m. Figure 7: Cell viability measured by 7-AAD exclusion by flow cytometry in melanoma cancer cell lines after 48 h of DMSO, SB224289 (5 pM), SB216641 (5 pM) and Compound A (1 / 2.5 / 5 / 10 / 20 pM) treatments. Data are represented as mean s.e.m.

[0044] Figure 8: Cell viability measured by 7-AAD exclusion by flow cytometry in ovary cancer cell lines after 48 h of DMSO, SB224289 (5 pM), SB216641 (5 pM) and Compound A (1 / 2.5 / 5 / 10 / 20 pM) treatments. Data are represented as mean s.e.m.

[0045] Figure 9: Cell viability measured by 7-AAD exclusion by flow cytometry in prostate cancer cell lines after 48 h of DMSO, SB224289 (5 pM), SB216641 (5 pM) and Compound A (1 / 2.5 / 5 / 10 / 20 pM) treatments. Data are represented as mean s.e.m.

[0046] Figure 10: Cell viability of spheroids derived from MCF-7 breast cancer cell line after 72 h of DMSO, SB224289 (1, 2.5 and 5 pM), SB216641 (1, 2.5 and 5 pM), Compound A (1, 2.5 and 5 pM pM), and SWAY1001 (5 and 10 pM) treatments. Data are represented as mean s.e.m.

[0047] Figure 11: Cell viability of spheroids derived from colon cancer cell lines after 72 h of DMSO, SB224289 (1, 2.5 and 5 pM), SB216641 (1, 2.5 and 5 pM), Compound A (1, 2.5 and 5 pM pM), and SWAY1001 (5 and 10 pM) treatments. Data are represented as mean s.e.m.

[0048] Figure 12: Cell viability of spheroids derived from A549 lung cancer cell line after 72 h of DMSO, SB224289 (1, 2.5 and 5 pM), SB216641 (1, 2.5 and 5 pM), Compound A (1, 2.5 and 5 pM pM), and SWAY1001 (5 and 10 pM) treatments. Data are represented as mean s.e.m.

[0049] Figure 13: Cell viability of spheroids derived from melanoma cancer cell lines after 72 h of DMSO, SB224289 (1, 2.5 and 5 pM), SB216641 (1, 2.5 and 5 pM), Compound A (1, 2.5 and 5 pM pM), and SWAY1001 (5 and 10 pM) treatments. Data are represented as mean s.e.m.

[0050] Figure 14: Cell viability of spheroids derived from ovary cancer cell lines after 72 h of DMSO, SB224289 (1, 2.5 and 5 pM), SB216641 (1, 2.5 and 5 pM), Compound A (1, 2.5 and 5 pM pM), and SWAY1001 (5 and 10 pM) treatments. Data are represented as mean s.e.m.

[0051] Figure 15: Cell viability of spheroids derived from prostate cancer cell lines after 72 h of DMSO, SB224289 (1, 2.5 and 5 pM), SB216641 (1, 2.5 and 5 pM), Compound A (1, 2.5 and 5 pM pM), and SWAY1001 (5 and 10 pM) treatments. Data are represented as mean s.e.m. Figure 16: Gene expression of 2D cultures and spheroids derived from MCF-7 breast cancer cell line. Data are represented as mean±s.e.m.

[0052] Figure 17: Gene expression of 2D cultures and spheroids derived from MCF-7 breast cancer cell line after 72 h of DMSO or Compound A (5 pM) treatments. Data are represented as mean±s.e.m.

[0053] Figure 18: Gene expression of 2D cultures and spheroids derived from MDA-MB-231 breast cancer cell line after 72 h of DMSO or Compound A (5 pM) treatments. Data are represented as mean±s.e.m.

[0054] Figure 19: Gene expression of 2D cultures and spheroids derived from T47D breast cancer cell line after 72 h of DMSO or Compound A (5 pM) treatments. Data are represented as mean±s.e.m.

[0055] Figure 20: Study design of Example 4

[0056] Figure 21: Xenograft study testing Compound A efficacy to delay subcutaneous SK-OV-3 tumor growth. Test article was administered per schedule described in Table 1 (note that from day 16 until finalization the dose of Compound A was 45 mg / kg). A) Relative tumor volume to animal weight (%). B) Body weight (g).

[0057] Figure 22: Synergism matrix and volume-based scoring of the EOBA method.

[0058] Figure 23: Cell viability, measured by 7-AAD exclusion and Hoechst33342 dim staining by flow cytometry, in BT-549, Hs578T, and MDA-MB-231 cell lines after 48 h of vehicle control or L Compound A (at the indicated concentrations range 2-15 pM) and / or Sorafenib (at the indicated concentrations range 2 / 10 pM) treatments. A synergism analysis was performed. Bliss synergy score is represented.

[0059] Figure 24: Cell viability, measured by 7-AAD exclusion and Hoechst33342 dim staining by flow cytometry, in BT-549, Hs578T, and MDA-MB-231 cell lines after 48 h of vehicle control or Compound A (at the indicated concentrations range 2-15 pM) and / or paclitaxel (at the indicated concentrations range 0.01 / 0.05 pM) treatments. A synergism analysis was performed. Bliss synergy score is represented.

[0060] Figure 25: Cell viability, measured by 7-AAD exclusion and Hoechst33342 dim staining by flow cytometry, in SK-OV-3 cell line after 48 h of vehicle control or Compound A (at the indicated concentrations range 2-15 p.M) and / or paclitaxel (at the indicated concentrations range 0.01 / 0.05 pM) or sorafenib (at the indicated concentrations range 5-9 pM) treatments. A synergism analysis was performed. Bliss synergy score is represented.

[0061] Figure 26: Most synergistic score from Figure 23-25. Max Bliss synergy score corresponds to the maximum percentage of effect not explained by the combination of the effect of both drugs individually (thus, not explained based on additivism). Dotted line corresponds to the additivism score.

[0062] Figure 27: Study design of Example 6.

[0063] Figure 28: Xenograft study testing compounds of interest efficacy to delay subcutaneous MDA-MB-231 tumor growth. Compound A were administered per schedule described in Example 6.

[0064] Figure 29: Body weight development corresponding to study of Example 6, Figure 28.

[0065] BRIEF DESCRIPTION OF SEQUENCES

[0066] SEQ ID NO.: 1: Human CD24 forward

[0067] SEQ ID NO.: 2: Human CD24 reverse

[0068] SEQ ID NO.: 3: Human CD44 forward

[0069] SEQ ID NO.: 4: Human CD44 reverse

[0070] SEQ ID NO.: 5: Human OCT4 forward

[0071] SEQ ID NO.: 6: Human OCT4 reverse

[0072] SEQ ID NO.: 7: Human NANOG forward

[0073] SEQ ID NO.: 8: Human NANOG reverse

[0074] SEQ ID NO.: 9: Human SOX2 forward

[0075] SEQ ID NO.: 10: Human SOX reverse

[0076] SEQ ID NO.: 11: Human HTR1B forward

[0077] SEQ ID NO.: 12: Human HTR1B reverse

[0078] DETAILED DESCRIPTION

[0079] Definitions and abbreviations

[0080] All terms as used herein, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions for certain terms as used in the present application are as set forth below and are intended to apply uniformly throughout the description and claims unless an otherwise expressly set out definition provides a broader definition.

[0081] Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word "comprise" encompasses the case of "consisting of'. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. Furthermore, the present invention covers all possible combinations of particular aspects and embodiments described herein.

[0082] In this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

[0083] If the term "about" as used in connection with a numerical value throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art. In general, such interval of accuracy is ± 15 %.

[0084] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form.

[0085] Numeric ranges are inclusive of the numbers defining the range.

[0086] The headings provided herein are not limitations of the various aspects or embodiments of the disclosure.

[0087] The following abbreviations are used throughout the description:

[0088] ADC antibody drug conjugate

[0089] BWL body weight loss

[0090] CFR Code of Federal Regulations d day D5W 5% dextrose in water (278 mmol / L dextrose) g gram

[0091] GLP Good Laboratory Practice h or hr hour

[0092] IP intraperitoneal

[0093] IV intravenous kg kilogram

[0094] LC lethal concentration

[0095] LC50 concentration causing death in 50%

[0096] LD lethal dose

[0097] LPX lipoplex min minute ml millilitre mg milligram mg / kg milligram per kilogram

[0098] MTD maximum tolerated dose pL microlitre pM micromolar ng / mL nanogram per milliliter

[0099] OG Oral gavage

[0100] OSHA Occupational Safety and Health Administration ppm parts per million

[0101] SP SP Spheroid

[0102] Subq subcutaneous

[0103] 2D monolayer culture

[0104] 3D three-dimensional

[0105] Serotonin receptor antagonists

[0106] "Serotonin receptors", also known as HTR, 5-hydroxytryptamine receptors, 5-HT receptors or 5-HTR, as used herein, are a group of G protein coupled receptors (GPCRs) and ligandgated ion channels (LGICs) mostly found in the central and peripheral nervous systems. "Serotonin receptor (HTR) antagonist" refers to a compound that binds to the 5-HT receptor and lacks any substantial ability to activate the receptor itself. An antagonist can thereby prevent or reduce the functional activation or occupation of the receptor by an agonist or the natural ligand when the agonist is present.

[0107] The term "antagonist of the 5-HT receptor", as used herein, is intended to encompass both "neutral antagonists" and "inverse agonists".

[0108] A "neutral antagonist" is a compound that blocks the action of the agonist but has no effect on intrinsic or spontaneous receptor activity.

[0109] An "inverse agonist" is able to both block the action of the agonist at the receptor and attenuates the constitutive activity of the receptor.

[0110] The term "antagonist" also includes competitive antagonists, which are drugs that bind to the same site as the natural ligand; non-competitive antagonists which bind to a different site on the receptor than the natural ligand; reversible antagonists which bind and unbind the receptor at rates determined by receptor-ligand kinetics; and irreversible antagonists which bind permanently to the receptor either by forming a covalent bond to the active site or just by binding so tightly that the rate of dissociation is effectively zero.

[0111] The term "HTR1" or "type 1 HTR" or "type 1 5-HT receptor" or "type 1 5- HTR" or "5-HT1 receptor" or "5-HTR1", as used herein, relates to a subfamily of 5-HT receptors that bind the endogenous neurotransmitter serotonin (5- hydroxytryptamine, 5-HT). The 5-HT1 receptor subfamily consists of five G protein-coupled receptors (GPCRs) that are coupled to Gi / Go and the term includes HTR1A, HTR1B, HTR1D, HTR1E, and HTR1F. These receptors mediate inhibitory neurotransmission by decreasing cellular levels of cAMP. The complete protein sequence for human type 1A 5-HT receptor has sthe UniProt accession number P08908 (November 30, 2016). The complete protein sequence for human type IB 5-HT receptor has the UniProt accession number P28222 (November 30, 2016). The complete protein sequence for human type ID 5-HT receptor has the UniProt accession number P28221 (November 2, 2016). The complete protein sequence for human type IE 5-HT receptor has the UniProt accession number P28566 (November 2, 2016). The complete protein sequence for human type IF 5-HT receptor has the UniProt accession number P30939 (November 2, 2016).

[0112] The person skilled in the art knows how to determine the affinity of a particular molecule for a type 1 HTR and also to determine if this particular molecule is an antagonist of said receptor. Particular suitable assays are radioligand binding assays to determine the binding affinity, and functional studies of the mobilization of second messengers. For example, the HTR affinity of a molecule can be determined using the methodology described by Millan et al. (Millan et al. J Pharmacol Exp Ther. 2002;303(2):791-804) (radioligand binding assay) An assay to assess if a compound is a type 1 HTR antagonist is the determination of the Gi activation status and measuring the cAMP production and activation of adenylyl cyclase (Nichols D.E. and Nichols C.E. Chem Rev, 2008;108(5):1614-41). The activity of type 1 HTR can be determined by detecting decreasing levels of cAMP (Williams C. Nat Rev Drug Discovery, 2004;3(2):125-35) and increasing levels of phosphor-Akt (Suni MA. and Maino VC. Methods Mol Biol 2011 ;717:155-69).

[0113] Compound of the invention

[0114] At its core, the present invention provides a compound of the following formula:

[0115] Compound A

[0116] The compound is an HTR1B antagonist. In the present disclosure, the compound of the formula shown above is frequently referred to by "the compound" or "Compound A".

[0117] Polymorph crystal forms, solvates, hydrates

[0118] The individual crystalline forms of the compound of the invention (Compound A) may exist as polymorphs and as such are intended to be included in the present invention.

[0119] In addition, the compound of the invention may form solvates with water (i.e. hydrates) or common organic solvents, and such solvates are also intended to be encompassed within the scope of this invention. The compound of the invention, including its salts, can also be obtained in the form of its hydrate, or include other solvents used for crystallization. In view of the close relationship between the free compound of the invention and the compound in the form of its salt, hydrates or solvates, whenever a compound is referred to in this context, a corresponding salt, solvate or polymorph is also intended, provided such is possible or appropriate under the circumstances.

[0120] Tautomers

[0121] As used herein, the term "tautomer" refers to the migration of protons between adjacent single and double bonds. The tautomerization process is reversible. The compound described herein can undergo any possible tautomerization that is within the physical characteristics of the compound.

[0122] Pharmaceutically acceptable salts

[0123] As used herein, the term "pharmaceutically acceptable" embraces both human and veterinary use. For example, the term "pharmaceutically acceptable" embraces a veterinary acceptable compound or a compound acceptable in human medicine and health care.

[0124] Salts, hydrates and solvates of the compounds of the invention and physiologically functional derivatives thereof which are suitable for use in medicine are those wherein the counter-ion or associated solvent is pharmaceutically acceptable. However, salts, hydrates and solvates having non-pharmaceutically acceptable counter-ions or associated solvents are within the scope of the present invention, for example, for use as intermediates in the preparation of other compounds and their pharmaceutically acceptable salts, hydrates and solvates.

[0125] Suitable salts according to the invention include those formed with either organic and inorganic acids or bases.

[0126] Pharmaceutically acceptable acid addition salts include those formed from hydrochloric, hydrobromic, sulfuric, nitric, citric, tartaric, phosphoric, lactic, pyruvic, acetic, trifluoroacetic, triphenylacetic, sulfamic, sulfanilic, succinic, oxalic, fumaric, maleic, malic, mandelic, glutamic, aspartic, oxaloacetic, methanesulfonic, ethanesulfonic, arylsulfonic (for example p- toluenesulfonic, benzenesulfonic, naphthalenesulfonic or naphthalenedisulfonic), salicylic, glutaric, gluconic, tricarballylic, cinnamic, substituted cinnamic (for example, phenyl, methyl, methoxy or halo substituted cinnamic, including 4-methyl and 4-methoxycinnamic acid), ascorbic, oleic, naphthoic, hydroxynaphthoic (for example 1- or 3-hydroxy-2-naphthoic), naphthaleneacrylic (for example naphthalenes-acrylic), benzoic, 4-methoxybenzoic, 2- or 4- hydroxybenzoic, 4-chlorobenzoic, 4-phenylbenzoic, benzeneacrylic (for example 1 ,4- benzenediacrylic), isethionic acids, perchloric, propionic, glycolic, hydroxyethanesulfonic, pamoic, cyclohexanesulfamic, salicylic, saccharinic and trifluoroacetic acid.

[0127] Pharmaceutically acceptable base salts include ammonium salts, alkali metal salts such as those of sodium and potassium, alkaline earth metal salts such as those of calcium and magnesium and salts with organic bases such as dicyclohexylamine and N-methyl-D- glucamine.

[0128] All pharmaceutically acceptable acid addition salt forms of the compound of the present invention are intended to be embraced by the scope of the present invention.

[0129] Preparation of the compound

[0130] Preparation of the class of compounds to which the compound of the present invention belongs has been described in detail in previous publications. For example, synthetic pathways are outlined in Castro-Palomino Laria et al. (WO 2022 / 074109 Al).

[0131] A synthetic pathway from well-known starting materials is the following coupling reaction:

[0132] Pharmaceutical composition

[0133] The pharmaceutical composition according to the present invention comprises the compound as described above (Compound A) and a pharmaceutically acceptable excipient (further described below). The pharmaceutical composition according to the present invention may comprise a pharmaceutically acceptable salt, tautomer, polymorph crystal form, solvate or hydrate of the compound of the invention (Compound A).

[0134] As used herein, the term "pharmaceutical composition" is intended to encompass a product comprising the claimed compound in the therapeutically effective amounts. More specifically, the term "pharmaceutical composition" as used herein refers to a preparation which is in such form as to permit the biological activity of the active ingredient (i.e., the HTR1B antagonist as claimed and optionally further active compounds, such as paclitaxel and / or sorafenib) to be effective, and physiologically tolerable, that is, which contains no additional components which are unacceptably toxic to a subject to which the composition would be administered. Such composition can be sterile.

[0135] Particularly, the term "pharmaceutically acceptable" means it is approved by a regulatory agency of a state or federal government or is included in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in animals, and more particularly in humans. Appropriate amounts of a compound of the of the invention as defined above can be formulated with pharmaceutically acceptable excipients and / or carriers to obtain a pharmaceutical composition for use in medicine, particularly in preventing and / or treating cancer, more particularly in preventing and / or treating a solid tumor.

[0136] The pharmaceutical compositions containing the compound of the invention as defined above can occur at any pharmaceutical form of administration (e.g. in the form of, lyophilized powders, slurries, aqueous solutions, lotions, or suspensions) considered appropriate for the selected administration route, including, but not limited to, systemic (e.g. intravenous, subcutaneous, intramuscular injection) intradermal, intraperitoneal, intranasal, epidural, topical, and oral routes, for which it will include the pharmaceutically acceptable excipients necessary for formulation of the desired method of administration. Routes of administration are further described hereinbelow.

[0137] Pharmaceutically acceptable excipients

[0138] The term "excipient" refers to a vehicle, diluent or adjuvant that is administered with the active ingredient. Such pharmaceutical excipients can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and similars. Water or saline aqueous solutions and aqueous dextrose and glycerol solutions, particularly for injectable solutions, are particularly used as vehicles. Suitable pharmaceutical vehicles are described in "Remington's Pharmaceutical Sciences" by E.W. Martin, 21st Edition, 2005; or "Handbook of Pharmaceutical Excipients", Rowe C. R.; Paul J. S.; Marian E. Q., sixth Edition. Suitable pharmaceutically acceptable vehicles include, e.g., water, salt solutions, alcohol, vegetable oils, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, perfume oil, monoglycerides and diglycerides of fatty acids, fatty acid esters petroetrals, hydroxymethyl cellulose, polyvinylpyrrolidone and similars. Medical uses

[0139] In one aspect, the invention provides a compound of the formula:

[0140] Compound A or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention for use in a method of prevention or treating cancer. Alternatively, the invention relates to the use of the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention for the preparation of a medicament for the prevention and / or treatment of cancer. Alternatively, the invention relates to a method for preventing and / or treating cancer comprising administering the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention of the invention to a subject in need thereof.

[0141] In another aspect, the invention provides a compound of the formula:

[0142] Compound A or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention for use in the prevention and / or treatment of a solid tumor. Alternatively, the invention relates to the use of the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention for the preparation of a medicament for the prevention and / or treatment of a solid tumor. Alternatively, the invention relates to a method for preventing and / or treating a solid tumor comprising administering the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention in a subject in need thereof.

[0143] As used herein the terms "treat," "treatment," or "treatment of" refers to reducing the potential for a certain disease or disorder, reducing the occurrence of a certain disease or disorder, and / or a reduction in the severity of a certain disease or disorder, preferably, to an extent that the subject no longer suffers discomfort and / or altered function due to it. For example, "treating" can refer to the ability of a therapy (i.e., the HTR1B antagonist of the invention) when administered to a subject, to prevent a certain disease or disorder from occurring and / or to cure or to alleviate a certain disease symptoms, signs, or causes.

[0144] "Treating" also refers to mitigating or decreasing at least one clinical symptom and / or inhibition or delay in the progression of the condition and / or prevention or delay of the onset of a disease or illness. Thus, the terms "treat," "treating" or "treatment of (or grammatically equivalent terms) refer to both prophylactic and therapeutic treatment regimes. Particularly, "treatment", as used herein, relates to the administration of the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention to a subject suffering from a solid tumor including the administration in an initial or early stage of a disease, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder.

[0145] The present disclosure provides methods and compositions generally providing a therapeutic benefit or desired clinical results. A therapeutic benefit is not necessarily a cure for a particular disease or disorder, but rather encompasses a result which most typically includes alleviation of the disease or disorder or increased survival, elimination of the disease or disorder, reduction or alleviation of a symptom associated with the disease or disorder, prevention or alleviation of a secondary disease, disorder or condition resulting from the occurrence of a primary disease or disorder, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable and / or prevention of the disease or disorder. Treatment also means prolonging survival as compared to expected survival if not receiving the treatment.

[0146] The term "prevention", "preventing" or "prevent", as used herein, relates to the administration of the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention to a subject who has not been diagnosed as possibly having a cancer or, in particular, a solid tumor at the time of administration, but who would normally be expected to develop said disease or be at increased risk for said disease. The prevention intends to avoid the appearance of said disease. The prevention can be complete (e.g. the total absence of a disease). The prevention can also be partial, such that for example the occurrence of a disease in a subject is less than that which would have occurred without the administration of the combination or composition of the present invention. Prevention also refers to reduced susceptibility to a clinical condition.

[0147] The term "subject" or "individual" or "animal" or "patient" includes any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired. Mammalian subjects include humans, domestic animals, farm animals, and zoo or pet animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows, and so on. In a particular embodiment of the invention, the subject is a mammal. In a more particular embodiment of the invention, the subject is a human, particularly a human of any race and sex.

[0148] In some embodiments, a subject is a naive subject. A naive subject is a subject that has not been administered a therapy, e.g. an antineoplastic agent. In another embodiment, a subject has received therapy and / or one or more doses of a therapeutic agent.

[0149] Combinations

[0150] The compound or pharmaceutically acceptable salt thereof or pharmaceutical composition of the invention may be combined with other therapeutic agents.

[0151] The further therapeutic agents are not particularly limited but are preferably therapeutic agents for the same particular cancer to be treated, preferably chemotherapeutic agents for the treatment of solid tumors.

[0152] Particularly favourable is combination with paclitaxel and / or sorafenib.

[0153] Paclitaxel (CAS number: 33069-62-4) is a type of chemotherapy called a taxane. It blocks cell growth by stopping mitosis (cell division). Taxanes interfere with microtubules (cellular structures that help move chromosomes during mitosis).

[0154]

[0155] Sorafenib (CAS number: 284461-73-0) is a kinase inhibitor drug approved for the treatment of primary kidney cancer (advanced renal cell carcinoma), advanced primary liver cancer (hepatocellular carcinoma), FLT3-ITD positive AML and radioactive iodine resistant advanced thyroid carcinoma

[0156] Both paclitaxel and sorafenib are known, FDA approved chemotherapy drugs for the treatment of cancer, in particular solid tumors. They can be combined with the compound or pharmaceutically acceptable salt thereof or pharmaceutical composition of the invention in dosage, schedule and administration regime as known to the skilled person.

[0157] The combination of paclitaxel and / or sorafenib with the compound or pharmaceutically acceptable salt thereof or pharmaceutical composition of the invention is particularly favourable in the treatment of breast cancer, ovarian cancer, kidney cancer, liver cancer and non-small cell lung cancer.

[0158] Solid tumor

[0159] In one embodiment of the present invention, the compound of the invention is used in a method of treating a solid tumor. A solid tumor is an abnormal mass of tissue that usually does not contain cysts or liquid areas. Solid tumors may be benign, or malignant. Different types of solid tumors are named for the type of cells that form them. Examples of solid tumors are sarcomas, carcinomas, and lymphomas. Leukemias (cancers of the blood) generally do not form solid tumors.

[0160] Examples of solid tumors are carcinomas, sarcomas, germinomas and blastomas.

[0161] Carcinomas are cancers derived from epithelial cells and account for 80% to 90% of all cancer cases since epithelial tissues are most abundantly found in the body.

[0162] This group includes many of the most common cancers, particularly in the aged, and include lung cancer, colorectal cancer, pancreatic cancer, larynx cancer, tongue cancer, prostate cancer, breast cancer, ovarian cancer, liver cancer, head and neck cancer, esophageal cancer, renal cancer, endometrial cancer, gall bladder cancer, bladder cancer and gastric cancer.

[0163] Carcinomas are of two types: adenocarcinoma and squamous cell carcinoma.

[0164] Adenocarcinoma develops in an organ or gland and squamous cell carcinoma originates in squamous epithelium. Adenocarcinomas may affect mucus membranes and are first seen as a thickened plaque-like white mucosa. These are rapidly spreading cancers.

[0165] Sarcomas are cancers arising from connective tissue including muscles, bones, cartilage and fat. Examples of sarcomas include osteosarcoma (of the bone), chondrosarcoma (of the cartilage), leiomyosarcoma (smooth muscles), rhabdomyosarcoma (skeletal muscles), mesothelial sarcoma or mesothelioma (membranous lining of body cavities), fibrosarcoma (fibrous tissue), angiosarcoma or hemangioendothelioma (blood vessels), liposarcoma (adipose or fatty tissue), glioma or astrocytoma (neurogenic connective tissue found in the brain), myxosarcoma (primitive embryonic connective tissue) and mesenchymous or mixed mesodermal tumor (mixed connective tissue types).

[0166] Germinomas refer to germ cell tumors, derived from pluripotent cells, most often presenting in the testicle or the ovary (seminoma and dysgerminoma, respectively).

[0167] Blastomas are cancers derived from immature precursor cells or embryonic tissue.

[0168] Blastomas are more common in children than in older adults. Examples of blastomas include hepatoblastoma, medulloblastoma, nephroblastoma, pancreatoblastoma, pleruropulmonary blastoma, retinoblastoma and glioblastoma multiforme.

[0169] Cancers of particular interest for the medical uses of the present invention are the solid tumors: breast cancer, colon cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer or melanoma. Most preferred are breast cancer or ovarian cancer.

[0170] Administration

[0171] The compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention may be administered as a liquid solution, suspension, emulsion, gel, polymer, or sustained release formulation. The compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention can be formulated with traditional binders and carriers, as would be known in the art.

[0172] Formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharide, cellulose, magnesium carbonate, etc., inert carriers having well established functionality in the manufacture of pharmaceuticals. Various delivery systems are known and can be used to administer the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention including encapsulation in liposomes, microparticles, microcapsules and the like.

[0173] In the context of the present invention, oral administration of the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention is particularly preferred.

[0174] Solid dosage forms for oral administration can include conventional capsules, sustained release capsules, conventional tablets, sustained-release tablets, chewable tablets, sublingual tablets, effervescent tablets, pills, suspensions, powders, granules and gels. At these solid dosage forms, the active compounds can be mixed with at least one inert excipient such as sucrose, lactose or starch. Such dosage forms can also comprise, as in normal practice, additional substances other than inert diluents, e.g. lubricating agents such as magnesium stearate. In the case of capsules, tablets, effervescent tablets and pills, the dosage forms can also comprise buffering agents. Tablets and pills can be prepared with enteric coatings. Liquid dosage forms for oral administration can include emulsions, solutions, suspensions, syrups and elixirs pharmaceutically acceptable containing inert diluents commonly used in the technique, such as water. Those compositions can also comprise adjuvants such as wetting agents, emulsifying and suspending agents, and sweetening agents, flavoring and perfuming agents.

[0175] In a particular embodiment, the further therapeutic agent (preferably paclitaxel and / or sorafenib) combined with the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention is administered intravenously or subcutaneously.

[0176] Dosage and schedule

[0177] The appropriate dosage of the active principle or principles within the combination or pharmaceutical composition will depend on the type of cancer to be treated, the severity and course of the disease, whether the composition is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the compounds, and the discretion of the attending physician.

[0178] The amount of the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention is suitably administered to the patient at one time or over a series of treatments.

[0179] Depending on the type and severity of the disease, an appropriate dosage level will generally be about 0.01 to 500 mg per kg patient body weight per day which can be administered in single or multiple doses.

[0180] A particularly preferred dose of the compound or a pharmaceutically acceptable salt thereof of the present invention is 30 mg / kg, more preferably 90 mg / kg per administration.

[0181] In one aspect, the compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of the invention is administered daily at the appropriate dose.

[0182] In a further aspect, the administration lasts for at least 20 days, more preferably 28 days.

[0183] In a further aspect, sorafenib or paclitaxel are administered at a dose of 15 mg / kg.

[0184] In cases of co-administration of sorafenib and / or paclitaxel, the preferred dose of the compound or a pharmaceutically acceptable salt thereof is 30 mg / kg.

[0185] In a further aspect of the invention, sorafenib and / or paclitaxel are administered weekly. EXAMPLES

[0186] The present invention will be further illustrated by the following examples. The following are given by way of illustration and do not limit the scope of the invention in any way.

[0187] Example 1: Compound A treatments efficacy in NCI-60 human tumor cell lines.

[0188] Study objective

[0189] The objective of this study is to precli nica I ly evaluate the in vitro therapeutic efficacy of the test compound Compound A in NCI-60 Human Tumor Cell Lines (Figure 1).

[0190] The NCI-60 cancer cell line panel is a group of 60 human cancer cell lines used by the National Cancer Institute (NCI) for the screening of compounds to detect potential anticancer activity.

[0191] Study design

[0192] 37 different NCI-60 Human Tumor Cell lines were treated for 48 h with Compound A and compared to controls DMSO, SB224289 (short SB9), SB216641 (short SB41) and non-treated cells in order to analyze cell viability. In all cell types, SB9 and SB41 were used at 5 pM. Compound A was used at 1, 2.5, 5, 10 and 20 pM:

[0193]

[0194] Materials and methods

[0195] A total of 4 x 104cells per ml were cultured during 24 h in 96-well plates in complete medium (RPMI 1640 + 10% HI-FBS) and all drugs were added at the indicated concentration. After 48 h, the cell viability was measured by 7- aminoactinomycin D (7-AAD) (eBioscience, San Diego, CA, USA) exclusion and Hoechst33342 (Sigma-Aldrich) positivity staining by flow cytometry, and cell count was obtained by volume in a FACSCanto II cytometer (Becton Dickinson, Franklin Lakes, NJ, USA), Figure 2.

[0196] Conclusion

[0197] Compound A decreases viability of the analyzed cell lines derived from the NCI-60 cancer cell line panel. Compound A Lower viability correlates with higher concentration of Compound A. Results are shown in Figures 3-9.

[0198] Table 2: Summary of IC50 values for Compound A, SB9 and SB41

[0199] Example 2: Compound A treatments efficacy in NCI-60 Human Tumor Cell Lines derived spheroids

[0200] Study objective:

[0201] The objective of this study is to precli nica I ly evaluate the in vitro therapeutic efficacy of the test compounds Compound A in 3D cultured NCI-60 Human Tumor Cell Lines. Three- dimensional (3D) systems mimic key factors of tissue in a much more representative way of the in vivo environment than two-dimensional (2D) monolayers, favouring the maintenance of sternness.

[0202] Study design:

[0203] 10 different NCI-60 Human Tumor Cell lines were three-dimensionally cultured as spheroids and treated for 72 h with Compound A and compared to DMSO, SB224289, SB216641, SWAY1001 and vehicle-treated cells in order to analyze cell viability, following the protocol published by Friedrich et al. Nat Protocol 2009. In all cell types, SB9, SB41 and Compound A were used at 1, 2.5, and 5 pM. SWAY1001 was used at 5 and 10 pM:

[0204] Table 2: study design of example 2

[0205] Materials and methods:

[0206] For each cell line, 5000 cells were transferred per well of an agarose-coated microtiter plate. After 96 h of incubation spheroids were treated and incubated for extra 72 h. Then, cell viability was assessed by acid phosphatase assay (APH). 100 pL of 3D culture were mixed with 100 pL of APH assay buffer (0.1M sodium acetate; 0.1% Triton X-100; 2 mg / mL PNPP) and incubated for 90 min at 37°C in an incubator. Following incubation, each well was supplemented with 10 pL of IN NaOH and the absorption was measured at 405 nm on a microplate reader.

[0207] Conclusions:

[0208] Compound A decreases the tumor spheroid volume in a dose-response manner and their anti-neoplastic effect is significantly higher than SB224289 or SB214461 (Figures 10-15).

[0209] Example 3: Gene expression profile of Breast NCI-60 Human Tumor Cell Lines derived Spheroids after Compound A treatment

[0210] Study objective:

[0211] The objective of this study is to precli nica I ly evaluate the in vitro therapeutic efficacy of the test compound Compound A in 3D cultured NCI-60 Human Tumor Cell Lines. Three- dimensional (3D) systems mimic key factors of tissue in a much more representative way of the in vivo environment than two-dimensional (2D) monolayers, favoring the maintenance of sternness.

[0212] Study design:

[0213] 3 different representative breast cancer cell lines from the NCI-60 Human Tumor panel were three-dimensionally cultured as spheroids and treated for 72 h with Compound A or DMSO in order to analyze gene expression:

[0214] Table 3: Cells used in Example 3.

[0215] Materials and methods:

[0216] For each cell line, 5000 cells were transferred per well of an agarose-coated microtiter plate. After 96 h of incubation spheroids were treated and incubated for extra 72 h. RNA was isolated using the Total RNA Purification Kit (Norgen Biotek, Thorold, ON, Canada) according to the manufacturer's instructions and reverse transcriptase-PCR was performed using the qScript cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA, USA). Quantitative PCR was performed a Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with a Power SYBR Green PCR mastermix (Applied Biosystems) according to the manufacturer's instructions and using specific primers for the following genes: Human CD24 Fw. CTCCTACCCACGCAGATTTATTC

[0217] Human CD24 Rv. AGAGTGAGACCACGAAGAGAC

[0218] Human CD44 Fw. CTGCCGCTTTGCAGGTGTA

[0219] Human CD44 Rv. CATTGTGGGCAAGGTGCTATT

[0220] Human 0CT4 Fw. GTGGAGGAAGCTGACAACAA

[0221] Human 0CT4 Rv. ATTCTCCAGGTTGCCTCTCA

[0222] Human NANOG Fw. CCCCAGCCTTTACTCTTCCTA

[0223] Human NANOG Rv. CCAGGTTGAATTGTTCCAGGTC

[0224] Human SOX2 Fw. GAGCTTTGCAGGAAGTTTGC

[0225] Human SOX2 Rv. GCAAGAAGCCTCTCCTTGAA

[0226] Human HTR IB Fw. GGGTTCCTCAAGCCAACTTATC

[0227] Human HTR1B Rv. GCCAATAGCATAACCAGCAGT

[0228] Conclusion:

[0229] Expression of sternness genes are increased in spheroids versus monolayer cultures from derived breast cancer cell lines. Expression of HTR1B gene is increased in spheroids versus monolayer cultures from derived breast cancer cell lines. Expression of sternness genes and HTR1B decrease in spheroids after treatment with Compound A (Figures 16-19).

[0230] Example 4: Efficacy of Compound A in ovarian cancer xenograft model

[0231] Study objective:

[0232] The objective of this study is to preclinica lly evaluate the in vivo therapeutic efficacy of the test compound Compound A in an ovarian cancer xenograft model.

[0233] Study design:

[0234] SK-OV-3 cells (human ovary carcinoma) were injected subcutaneously to lateral flank of 30 Athymic Nude-Foxnlnu mice (females) and, after detection of tumors of around 120 mm3, daily treatment (oral gavage) with vehicle or Compound A during 20 consecutive days was administrated (Figure 20).

[0235] The administration of the test articles and the animal numbers in each study group are shown in the following experimental design table:

[0236] * Study deviation: from day 16 to 20 the dose was 45 mg / kg at 10 ml / Kg, due to weight loss

[0237] Materials and methods:

[0238] Species: Mus Musculus

[0239] Strain: Hsd:Athymic Nude-Foxnlnu

[0240] Age: 6-7 weeks old (estimated age at inoculation)

[0241] Sex: Female

[0242] Total number: 30 mice (20 plus 10 additional mice to account for tumor take rate)

[0243] Test acompound:

[0244] Test compound Compound A was received as dry powder. Final formulation: 5% NMP, 5% solutol, 10% PEG y 80% NaCI 0.9%.

[0245] Each mouse was inoculated subcutaneously at the flank region with SK-OV-3 (1 xlO7) in 0.1 ml for tumor development. Treatments, following the experimental design Table 1, were initiated when tumor volume reached around 120 mm3. Twenty (20) animals with 120 mm3tumors were selected for SK-OV-3 follow up xenograft experiment and randomly placed into Groups 1 and 2.

[0246] Tumor was monitored twice a week after cell inoculation. Scoring of primary tumor size was determined by caliper.

[0247] Conclusion:

[0248] Compound A treatment reduced tumor growth in an ovarian cancer xenograft mice model. There was no animal body weight loss with BWL>20% observed within the study (Figure 21).

[0249] Example 5: Combination of compound A and paclitaxel / sorafenib treatment efficacy in ovarian and breast cancer cell lines

[0250] Study objective:

[0251] The objective of this study is to precli nica I ly evaluate the in vitro therapeutic efficacy of the test compound Compound A in combination with sorafenib and paclitaxel in BT-549, Hs578T, MDA-MB-231 (breast cancer cell lines), and SK-OV-3 (ovarian cancer cell line).

[0252] Study design: 3 different breast cancer cell lines, BT-549, Hs578T and MDA-MB-231, and the SK-OV-3 ovarian cancer cell line were treated for 48 h with Compound A / sorafenib / paclitaxel and compared to vehicle-treated cells in order to analyze cell viability by flow cytometry.

[0253] Materials and methods:

[0254] A total of 4 x 104cancer cells per ml were cultured in complete medium (RPMI 1640 + 10% HI-FBS) and treatments were added at the indicated concentration. After 48 h, the cell viability was measured by 7- aminoactinomycin D (7-AAD) (eBioscience, San Diego, CA, USA) exclusion and Hoechst33342 (Sigma-Aldrich) positivity staining by flow cytometry, and cell count was obtained by volume in a FACSCanto II cytometer (Becton Dickinson, Franklin Lakes, NJ, USA). Synergism study was performed with http: / / synergyfinder.org / .

[0255] Conclusion:

[0256] Combination of Compound A and sorafenib or paclitaxel causes a synergic effect on breast cancer cells (BT-549, Hs578T, MDA-MB-231) and SK-OV-3 ovarian cancer cells (Figures 22- 26).

[0257] Example 6: Evaluation of Efficacy of Compound A in the Treatment of Subcutaneous MDA- MB-231 Xenograft Model (NOD / SCID)

[0258] Study objective

[0259] The objective of this study is to evaluate preclinically the in vivo therapeutic efficacy of Compound A in the treatment of subcutaneous MDA-MB-231 cancer xenograft model in NOD / SCID mice. Compound A tested alone and in combination with paclitaxel using different dosing regimens and associated Compound A concentrations.

[0260] Study animals and IACUC review

[0261] IACUC study protocol approval was received on September 17, 2021 (IACUC protocol 410075). Sixty (60) NOD / SCID mice (15-18 weeks old, female) were obtained from the Harlan Laboratories (Envigo, Inc) and went through mandatory 1-week acclimatization per IACUC guidelines. All animal procedures and maintenance were conducted in accordance with the institutional guidelines. Mice were housed at Altogen Labs animal facility and carcasses frozen and disposed at the end of the study per institutional guidelines.

[0262] Study design

[0263] The administration of the test articles and the animal numbers in each study group are shown in the following experimental design table. Table 4: Experimental design table for Example 6

[0264] Note: n = animal number

[0265] Total of 35 tumor-bearing animals (MDA-MB-231) were generated for the study. Tumor inoculation was performed on September 30, 2021 (Day 0). Treatments were initiated on October 5, 2021 (Day 5) when tumor volume reached 50-150 mm3. Treatments started on Day 5. Tumor size (volume) measurements were performed 2 times a week with electronic caliper.

[0266] Study endpoints

[0267] 2,000 mm3tumor volume or 45 days after xenotransplantation, whichever comes first BWL over 20% (per Altogen Labs IACUC).

[0268] Materials and equipment

[0269] Animals:

[0270] Species: Mus Musculus

[0271] Strain: NOD / SCID immunocompromised mice

[0272] Age: 16-18 weeks (estimated age at inoculation)

[0273] Sex: Female

[0274] Total number: 60 mice (35 plus 25 additional mice to account for tumor take rate)

[0275] Animal supplier: Harlan Laboratories (Envigo, Inc)

[0276] The animals were housed in individual ventilated cages (3-4 mice per cage) under the following conditions:

[0277] Temperature: 22-25^C

[0278] Humidity: 40-60%

[0279] Light cycle: 12 hours light and 12 hours darkness

[0280] Irradiated sterile IVC cages Bedding material: irradiated corncob bedding

[0281] Diet: Immunocompromised mouse diet, irradiation sterilized dry granule food

[0282] Water: sterile water, autoclaved before using

[0283] Cage identification label: per Altogen Labs IACUC

[0284] Animal identification: per Altogen Labs IACUC

[0285] Test article:

[0286] Compound A was received as dry powder in good condition. Final formulation: 5% NMP, 5% Solutol HS-5, 10% PEG-400 and 80% IX PBS (normal saline).

[0287] Experimental methods

[0288] Cell Culture

[0289] The MDA-MB-231 tumor cells were maintained in vitro as a monolayer culture in Leibovitz's L-15 medium (ATCC) supplemented with 0.01 mg / ml insulin, 12% fetal bovine serum, sodium pyruvate (1 mM), and 10 nM estrogen; free gas exchange with atmospheric air. The tumor cells were routinely subcultured twice weekly by trypsin-EDTA treatment (0.05% Trypsin- EDTA). The cells in an exponential growth phase were harvested and counted for tumor inoculation. Sixty (60) million MDA-MB-231 cells were generated. Cells were grown under aseptic conditions. MDA-MB-231 cells were analyzed by Guava PCA flow cytometry for cell count and cell viability (99%) prior to xenotransplantation.

[0290] Tumor Inoculation

[0291] Each mouse was inoculated subcutaneously at the flank region with MDA-MB-231 cells (1 x 106) in 0.1 ml of lxPBS mixed with Matrigel (1:1) for tumor development (50% matrigel protocol per Altogen Labs SOP 6.012). Xenotransplantation was performed on September 30, 2021 (denoted as Day 0). T reatments were initiated when tumor volume reached 50-150 mm3(October 5, 2021). Thirty five (35) animals with 50-150 mm3tumors were selected for MDA-MB-231 follow up xenograft experiment and randomly placed into Groups 1 - 5. The test article administration and the animal numbers in each study group are shown in the experimental design Table.

[0292] Group assignment

[0293] Before grouping and treatment, all animals were weighed and the tumor volumes were confirmed (50-150 mm3) using electronic caliper. Since the tumor volume can affect the effectiveness of any given treatment, mice were assigned into groups using randomized block design as following: First, the experimental animals were divided into homogeneous blocks based on their tumor volume. Secondly, within each block, randomization of experimental animals to different groups were conducted. By using randomized block design to assign experimental animals, we ensure that each animal has the same probability of being assigned to any given treatment groups and therefore systematic error is minimized.

[0294] Observation and data collection

[0295] After tumor cells inoculation, the animals were checked daily for morbidity and mortality. At the time of routine monitoring, the animals were checked for any adverse effects of tumor growth and treatments on normal behavior such as mobility, visual estimation of food and water consumption, body weight gain / loss, eye / hair matting and any other abnormal effects. Death and observed clinical signs were recorded per Altogen Labs IACUC .

[0296] Tumor volumes were measured every 3 - 4 days in two dimensions using an electronic caliper, and the volume data are expressed in mm3 using the formula: V = 0.5 a x b2 where a and b are the long and short diameters of the tumor, respectively. Dosing and tumor volume measurement procedures were conducted in a Laminar Flow Cabinet according to Altogen Labs IACUC regulations.

[0297] Statistics

[0298] Summary statistics, the mean and the standard error of the mean (SEM), are provided for the tumor volume of each group at each time point. Statistical analysis of difference in tumor volume among the groups and the analysis of drug interaction were conducted on the data obtained after the final dose.

[0299] Results

[0300] There was no animal death observed within the study. There was no clinical signs or behavioral phenotype observed within the study (daily cage intensive observation for adverse effect were performed). No animals were observed to have >20% BWL within the study period. There was no animal body weight loss with BWL>20% observed within the study. An overview of the study design, results of tumour volume and body weight are shown in Figures 27-29.

[0301] REFERENCES

[0302] Barnes N. M. et al, Neuronal 5-HT Receptors and SERT, Tocris Scientific Review Series, https: / / www.tocris.com / literature / scientific-reviews / 5-ht-receptors.

[0303] Castro-Palomino Laria et al. WO 2022 / 074103

[0304] Etxabe, A. et al, Inhibition of serotonin receptor type 1 in acute myeloid leukemia impairs leukemia stem-cell functionality: A promising novel therapeutic target, Leukemia, 2017,1-15

[0305] Friedrich et al. Nat Protocol 2009

[0306] Juo, Pei-Show, Concise Dictionary of Biomedicine and Molecular Biology, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press

[0307] Marin P. et al, 5-HT Receptor-Associated Protein Networks: New Targets for Drug Discovery in Psychiatric Disorders?, Current Drug Targets, 2012,13, 28-52

[0308] E.W. Martin, Remington's Pharmaceutical Sciences, 21st Edition, 2005

[0309] Millan et al. J Pharmacol Exp Ther. 2002;303(2):791-804

[0310] Nichols D.E. and Nichols C.E. Chem Rev, 2008;108(5):1614-41

[0311] Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press

[0312] Rowe C. R.; Paul J. S.; Marian E. Q., Handbook of Pharmaceutical Excipients", sixth Edition

[0313] Sarrouilhe D. et al, Serotonin and Cancer: What Is the Link?, Current Molecular Medicine 2015, 15, 62-77

[0314] Selkirk, J.V., et al., British Journal of Pharmacology (1998) 125: 202-208

[0315] Suni MA. and Maino VC. Methods Mol Biol 2011 ;717:155-69

[0316] Williams C. Nat Rev Drug Discovery, 2004;3(2):125-35

Claims

CLAIMS1. A compound of the following formula:Compound A or a pharmaceutically acceptable salt thereof for use in a method of treating cancer.

2. The compound for use of claim 1, wherein Compound A or a pharmaceutically acceptable salt thereof is provided in a composition together with at least one pharmaceutically acceptable excipient.

3. The compound for use according to claim to any one of claims 1 or 2, wherein the cancer is a solid tumour.

4. The compound for use according to any one of claims 1 to 3, wherein the cancer is selected from breast cancer, colon cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer or melanoma.

5. The compound for use according to claim 4, wherein the cancer is breast cancer or ovarian cancer.

6. The compound for use according to any one of claims 1-5, wherein the method comprises administration of Compound A or a pharmaceutically acceptable salt thereof at a dose of 30 mg / kg per administration, more preferably 90 mg / kg at 10 ml / kg.

7. The compound for use according to any one of claims 1-6, wherein the method comprises once daily administration of Compound A or a pharmaceutically acceptable salt thereof.

8. The compound for use according to any one of claims 1-7, wherein the method comprises administration of Compound A or a pharmaceutically acceptable salt thereof for at least 20 consecutive days, optionally wherein administration lasts for at least 28 consecutive days.

9. The compound for use according to any one of claims 1-8, wherein the method comprises oral administration of Compound A or a pharmaceutically acceptable salt thereof, preferably wherein Compound A or a pharmaceutically acceptable salt thereof is exclusively administered orally.

10. The compound for use according to any one of claims 1-9, wherein the method comprises administration of paclitaxel or a pharmaceutically acceptable salt thereof.

11. The compound for use according to any one of claims 1-10, wherein the method comprises administration of sorafenib or a pharmaceutically acceptable salt thereof.

12. The compound for use according to any one of claims 10 or 11, wherein the method comprises once weekly administration of paclitaxel or a pharmaceutically acceptable salt thereof and / or sorafenib or a pharmaceutically acceptable salt thereof.

13. The compound for use according to any one of claims 10-12, wherein the method comprises administration of paclitaxel or a pharmaceutically acceptable salt thereof at a dose of 15mg / kg per administration.

14. The compound for use according to any one of claims 10-13, wherein the method comprises administration of sorafenib or a pharmaceutically acceptable salt thereof at a dose of 15mg / kg per administration.

15. The compound for use according to any one of claims 10-14, wherein the method comprises subcutaneous or intravenous administration of paclitaxel or a pharmaceutically acceptable salt thereof and / or sorafenib or a pharmaceutically acceptable salt thereof, preferably wherein all administrations are subcutaneous.

Images