Accelerated marking of 5-formyl cytosine and use in nucleic acid methylation sequencing

EP4727953A2Pending Publication Date: 2026-04-22F HOFFMANN LA ROCHE & CO AG +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
F HOFFMANN LA ROCHE & CO AG
Filing Date
2024-06-11
Publication Date
2026-04-22

AI Technical Summary

Technical Problem

Current methods for detecting DNA methylation, such as bisulfite sequencing, are inefficient due to DNA degradation and inability to distinguish between 5-methylcytosine and 5-hydroxymethylcytosine, and require lengthy processing times for forming adducts of 5-formyl cytosine, hindering rapid clinical diagnostics.

Method used

A composition comprising copper salts, chelators like bipyridine or phenanthroline, and adduct-forming compounds accelerates the formation of 5-formyl cytosine adducts in nucleic acid molecules within one hour at lower temperatures, allowing for efficient detection of methylation status and differentiation from 5-hydroxymethylcytosine in a 'one pot' synthesis.

Benefits of technology

This approach enables rapid and efficient detection of DNA methylation with reduced DNA degradation, distinguishing between 5-methylcytosine and 5-hydroxymethylcytosine, and significantly shortens processing time for 5-formyl cytosine adduct formation, facilitating quicker clinical diagnostics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000005_0001
    Figure IMGF000005_0001
  • Figure IMGF000008_0001
    Figure IMGF000008_0001
  • Figure IMGF000010_0001
    Figure IMGF000010_0001
Patent Text Reader

Abstract

Disclosed herein are compositions for use in preparing target nucleic acid molecules including one or more 5-formyl cytosine bases or adducts of 5-formyl cytosine. Also disclosed herein are methods of efficiently synthesizing nucleic acid molecules including one or more 5-formyl cytosine bases from target nucleic acid molecules which include one or more 5-hydroxymethyl cytosine bases. The present disclosure also provides for methods of detecting epigenetic modifications in a target nucleic acid molecule, such as those epigenetic modifications characterized by methylation of cytosine at the 5-position position (e.g., 5-methyl cytosine; 5-hydroxymethyl cytosine).
Need to check novelty before this filing date? Find Prior Art

Description

ACCELERATED MARKING OF 5-FORMYL CYTOSINE AND USE IN NUCLEIC ACID METHYLATION SEQUENCINGFIELD OF THE INVENTION

[0001] The present disclosure relates to the field of nucleic acid-based diagnostics. More specifically, the invention related to a method of detecting epigenetic modifications in nucleic acid molecules, wherein the epigenetic modifications may have biological and clinical significance.BACKGROUND OF THE DISCLOSURE

[0002] DNA methylation plays a major role in regulating various physiological and pathological processes in mammals. DNA methylation is an important epigenetic event in modulating embryonic development, genomic imprinting, X inactivation, cellular differentiation, and proliferation. Abnormal patterns of DNA methylation, however, are correlated with DNA instability and will ultimately trigger a subsequent heritage or required diseases such as cancer, though increasingly DNA methylation is being reported as a potential biomarker for other psychiatric and metabolic diseases as well. DNA methylation, primarily occurring at the C5 position within the cytosine ring within cytosine-guanine (CpG) dinucleotides, is frequently found clustered at gene regulatory sites such as promoter regions. Dense methylation of CpGs in the gene promoter region is associated with a compacted chromatin structure resulting in transcriptional silencing of the affiliated gene. If DNA hypermethylation occurs at the promoter regions of certain critical cancer-related genes, it could lead to tumor suppressor gene silencing and ultimately tumorigenesis. It is believed that DNA methylation changes are present and detectable in tumors and in blood. Therefore, aberrant DNA methylation of specific oncogenes may be regarded as biomarkers for the early diagnosis of cancer.

[0003] Bisulfite genomic sequencing provides a qualitative, quantitative, and efficient approach to identify 5-methylcytosine at single base-pair resolution. This method is based on the finding that the deamination reactions of cytosine and 5- methylcytosine (5-mC) proceed with very different consequences after the treatment of sodium bisulfite. In bisulfite sequencing (also known as bisulfite conversion)target nucleic acids are first treated with bisulfite reagents that specifically convert un-methylated cytosines to uracil residues while having no impact of methylated cytosine. The resulting uracil residues are then recognized as thymine in subsequent PCR amplification and sequencing, however, 5-mCs are immune to this conversion and remain as cytosines allowing 5-mCs to be distinguished from unmethylated cytosines. A subsequent PCR process is necessary to determine the methylation status in the loci of interest by using specific methylation primers after the bisulfite treatment. The actual methylation status can be determined either through direct PCR product sequencing (e.g., detection of average methylation status) or subcloning sequencing (e.g., detection of single molecule distribution of methylation patterns). Moreover, bisulfite sequencing analysis can not only identify DNA methylation status along the DNA single strand, but also detect the DNA methylation patterns of DNA double strands since the converted DNA strands are no longer self- complementary and the amplification products can be measured individually.

[0004] Unfortunately, bisulfite treatment leads to degradation of a large portion of sample DNA. For instance, one unwanted consequence of bisulfite conversion is that the double-stranded conformation of the original target is disrupted due to loss of sequence complementarity. Additionally, bisulfite conversion can be incomplete unless it is done for long durations at high temperatures, and this can often degrade up to about 95% of the DNA input. Furthermore, and as alluded to above, bisulfite methods do not distinguish between 5-mC and the closely related 5- hydroxymethyl cytosine (5-hmC), another potential epigenetic biomarker.

[0005] Alternative, less harsh methods for the detection of methylated cytosines include enzymatic treatment with ten-eleven translocation (TET) dioxygenases and detecting any one of the oxidation products. One particular method called TAPS (TET-assisted pyridine-borane sequencing) involves oxidation of methylated cytosines in nucleic acid with TET and co-catalysts (e.g., Fe(II) ions and alpha-ketoglutarate) and treatment of oxidation products with borane derivatives to form dihydrouracil (DHU) which is read as T during sequencing, see Liu, Y., et al. (2019) Bi sulfite-free direct detection of 5-methylcytosine and 5- hydroxymethylcytosine at base resolution. Nat. Biotechnol. 37, 424-429.

[0006] Other detection methods also utilize TET but offer alternatives to borane reduction. In one example, oxidation products can be reacted withmalononitrile to form an adduct also read as T during sequencing, see Zhu C., et al., (2017) Single-Cell 5-Formylcytosine Landscapes of Mammalian Early Embryos and ESCs at Single-Base Resolution, Cell Stem Cell, 20:720-731. e5. Malononitrile reacts exclusively with 5-formyl cytosine (5-fC). See also United States Patent No. 10,519,184. Malononitrile adduct of 5-formyl cytosine acts like a thymidine nucleotide and can be differentiated from cytosines. The formation of the malononitrile adduct of 5-formyl cytosine is, however, time consuming, taking from 12 - 36 hours, thus elongating the processing time needed for the preparation of sequencing samples.

[0007] There is a need for a rapid and convenient methylation detection assay that could be deployed in clinical labs.BRIEF SUMMARY OF THE DISCLOSURE

[0008] Applicant has discovered that copper salts can be utilized to accelerate the addition of malononitrile or like compounds to 5-formyl cytosine. Applicant has unexpectedly discovered that a combination of a copper salt and a chelator selected from one of a bipyridine or a phenanthroline allowed for the efficient formation of adducts of 5-formyl cytosine in both single stranded and double stranded nucleic acid molecules in less than about 1 hour and at temperatures lower than that required by prior art methods. Applicant has also discovered that the conversion of 5-formyl cytosine to an adduct of 5-formyl cytosine may be performed efficiently with highly basic and denatured samples (e.g., those including about 10 to about 20 mM of NaOH) or with slightly alkaline samples including buffers (e.g., those including about 10 mM of TRIS at about pH 8). Additionally, Applicant has surprisingly discovered that adducts of 5-formyl cytosine may be formed from 5- hydroxymethyl cytosine in a "one pot" synthesis within about 3 hours, such as within about 2 hours, without requiring any purification of any intermediates. These and other aspects of the present disclosure will be described further herein.

[0009] A first aspect of the present disclosure is a composition comprising: (a) one or more nucleic acid molecules each having one or more 5-formyl cytosine bases, (b) a copper salt, (c) a chelator selected from one of a bipyridine or a phenanthroline, and (d) a compound having Formula (I):(i),

[0010] where

[0011] R is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl mono-substituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl; and

[0012] wherein the composition has a pH ranging from about 7 to about 12.

[0013] In some embodiments, R is cyano, nitro, Ci-Ce alkyl, carboxylic ester.In some embodiments, R is cyano or Ci-Ce alkyl. In some embodiments, the compound of Formula (I) is malononitrile.

[0014] In some embodiments, the chelator is a phenanthroline. In some embodiments, the chelator is a bipyridine.

[0015] In some embodiments, the copper salt is complexed with the chelator. In some embodiments, a ratio of the copper salt to the chelator within the composition ranges from between about 1 :3 to about 1 : 1.75. In some embodiments, a ratio of the copper salt to the chelator within the composition is about 1 :2.75. In some embodiments, a ratio of the copper salt to the chelator within the composition is about 1 :2.5. In some embodiments, a ratio of the copper salt to the chelator within the composition is about 1 :2.25.

[0016] In some embodiments, the chelator is a 2,2'-bipyridine or a derivative thereof. In some embodiments, the derivative of 2,2' -bipyridine is selected from the group consisting of 4,4'-dimethyl-2,2'-bipyridine, 5,5'-dimethyl-2,2'-bipyridine 4,4'- diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'-dimethoxy-2,2'-bipyridine,

[0017] In some embodiments, the copper salt is selected from the group consisting of Cu(ClC>4)2, CuSC>4, Cu(ACN)4 triflate, and Cu(OAc)2. In some embodiments, the copper salt is (Cu(ClC>4)2 and the chelator is a 2,2'-bipyridine.

[0018] In some embodiments, the one or more nucleic acid molecules are single stranded. In some embodiments, the one or more nucleic acid molecules are double stranded. In some embodiments, the pH ranges from between about 8 toabout 12. In some embodiments, the composition further comprises an N-oxide reagent.

[0010] A second aspect of the present disclosure is a composition comprising: (a) one or more nucleic acid molecules each having one or more 5- hydroxymethyl cytosine bases, (b) a copper salt, (c) a chelator selected from the group consisting of a bipyridine or a phenanthroline, and (d) an N-oxide reagent, wherein the composition has a pH ranging from about 7 to about 12, wherein the N- oxide reagent is selected from the group consisting of ABNO, AZADO, and Me- AZADO.

[0019] In some embodiments, the copper salt is complexed with the chelator. In some embodiments, a ratio of the copper salt to the chelator within the composition ranges from between about 1 :3 to about 1 : 1. In some embodiments, a ratio of the copper salt to the chelator within the composition is about 1:2.5. In some embodiments, a ratio of the copper salt to the chelator within the composition is about 1 :2.2. In some embodiments, a of the copper salt to the chelator within the composition is about 1 :2.

[0020] In some embodiments, the chelator is a 2,2'-bipyridine or a derivative thereof. In some embodiments, the bipyridine is selected from the group consisting of 4,4'-dimethyl-2,2'-bipyridine, 5,5'-dimethyl-2,2'-bipyridine, 4,4'-diethyl-2,2'- bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'-dimethoxy-2,2'-bipyridine, and 5,5'- dimethoxy-2,2'-bipyridine.

[0021] In some embodiments, in the copper salt is selected from the group consisting of Cu(C104)2, CuSCh, Cu(ACN)4 triflate, and Cu(OAc)2. In some embodiments, the N-oxide reagent is AZADO. In some embodiments, the N-oxide reagent is Me-AZADO. In some embodiments, the N-oxide reagent comprises ABNO. In some embodiments, a ratio of the copper salt to the N-oxide within the composition ranges from about 1 :0.5 to about 1 :0.1. In some embodiments, a ratio of the copper salt to the N-oxide within the composition is about 1 :0.2.

[0022] In some embodiments, the composition further comprises a solvent. In some embodiments, the solvent is acetonitrile.

[0023] In some embodiments, the composition comprises a base selected from the group consisting of NaOH, KOH, and LiOH. In some embodiments, the composition comprises TRIS, TAPSO, TEA, EPPS, Tricine, Gly-Gly, Bicine,TABS, AMPSO, CHES, CAPSO, AMP, CAPS. In some embodiments, the pH of the composition ranges from between about 8 to about 12.

[0024] In some embodiments, the one or more nucleic acid molecules are single stranded. In some embodiments, the one or more nucleic acid molecules are double stranded.

[0025] A third aspect of the present disclosure is a method for preparing one or more nucleic acid molecules each having one or more 5-formyl cytosine bases, comprising: (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5 -hydroxymethyl cytosine bases; and (b) reacting the obtained sample with a first composition comprising a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide reagent, wherein the N-oxide reagent is selected from the group consisting of ABNO, AZADO, and Me- AZADO. In some embodiments, the first composition further comprises at least one of a base or buffer.

[0026] In some embodiments, the reaction occurs at a pH ranging from between about 7 to about 12.5. In some embodiments, the reaction occurs at a pH ranging from between about 8 to about 12. In some embodiments, the reaction occurs at a temperature ranging from between about 20°C to about 35°C. In some embodiments, the temperature ranges from between about 20°C to about 30°C. In some embodiments, the temperature ranges from between about 25°C to about 30°C. In some embodiments, the reaction occurs for a time period ranging from between about 30 minutes to about 90 minutes. In some embodiments, the time period is about 60 minutes.

[0027] In some embodiments, a ratio of the copper salt to the chelator within the first composition is about 1 :2.75. In some embodiments, a ratio of the copper salt to the chelator within the first composition is about 1 :2.5. In some embodiments, a ratio of the copper salt to the chelator within the first composition is about 1 :2.25. In some embodiments, the chelator is a 2,2'-bipyridine or a derivative thereof. In some embodiments, the bipyridine is selected from the group consisting of 4, d'dimethyl^, 2'-bipyri dine, 5,5'-dimethyl-2,2'-bipyridine, 4,4'-diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'-dimethoxy-2,2'-bipyridine, 5,5'-dimethoxy-2,2'- bipyridine.

[0028] In some embodiments, the copper salt is selected from the group consisting of Cu(ClC>4)2, CuSC>4, Cu(ACN)4 tritiate, and Cu(OAc)2. In some embodiments, the N-oxide is ABNO. In some embodiments, the copper salt is Cu(ACN)4 tritiate or Cu(OAc)2; the chelator is a 2,2'-bipyridine; and the N-oxide is ABNO.

[0029] In some embodiments, the method further comprises monitoring the reaction by liquid chromatography and / or mass spectroscopy. In some embodiments, the method further comprises performing at least one additional downstream reaction following the reaction between the obtained sample and the first composition. In some embodiments, the at least one additional downstream reaction comprises converting the 5-formyl cytosine bases in the one or more nucleic acid molecules to an adduct of 5-formyl cytosine, thereby producing one or more nucleic acid molecules having one or more adducts of 5-formyl cytosine. In some embodiments, the adduct of 5-formyl cytosine is a malononitrile adduct of 5-formyl cytosine.

[0030] In some embodiments, the method further comprises contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with a polymerase to provide one or more amplified nucleic acid molecules, wherein the one or more amplified nucleic acid molecules have a thymine base at a position corresponding to the position of the adduct of 5-formyl cytosine in each of the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine.

[0031] In some embodiments, the method further comprises sequencing the one or more amplified nucleic acid molecules. In some embodiments, the sequencing comprises next-generation sequencing.

[0032] A fourth aspect of the present disclosure is a method for preparing one or more nucleic acid molecules each having one or more adducts of 5-formyl cytosine, comprising: (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5-formyl cytosine bases; and (b) reacting the obtained sample with a composition comprising a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and a compound having Formula (I):

[0033] where

[0034] R is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl mono-substituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl. In some embodiments, R is cyano or Ci-Ce alkyl. In some embodiments, the compound of Formula (I) is malononitrile.

[0035] In some embodiments, the reaction occurs at a pH ranging from between about 7 to about 12.5. In some embodiments, the reaction occurs at a pH ranging from between about 8 to about 12. In some embodiments, the reaction occurs at a temperature ranging from between about 20°C to about 35°C. In some embodiments, the temperature ranges from between about 20°C to about 30°C. In some embodiments, the temperature ranges from between about 25°C to about 30°C. In some embodiments, the reaction occurs for a time period ranging from between about 30 minutes to about 90 minutes. In some embodiments, the time period is about 60 minutes.

[0036] In some embodiments, the chelator is a phenanthroline. In some embodiments, the chelator is a bipyridine. In some embodiments, a ratio of the copper salt to the chelator within the first composition is about 1 :2.75. In some embodiments, a ratio of the copper salt to the chelator within the first composition is about 1 :2.5. In some embodiments, a ratio of the copper salt to the chelator within the first composition is about 1 :2.25. In some embodiments, the chelator is a 2,2'- bipyridine or a derivative thereof. In some embodiments, the bipyridine is selected from the group consisting of 4,4'-dimethyl-2,2'-bipyridine, 5,5'-dimethyl-2,2'- bipyridine, 4,4'-diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'-dimethoxy- 2,2'-bipyridine, and 5,5'-dimethoxy-2,2'-bipyridine.

[0037] In some embodiments, the copper salt is selected from the group consisting of Cu(C104)2, CuSCh, Cu(ACN)4 triflate, and Cu(OAc)2. In some embodiments, the method further comprises monitoring the reaction by liquid chromatography and / or mass spectroscopy.

[0038] In some embodiments, the method further comprises contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with a polymerase to provide one or more amplified nucleic acid molecules, wherein the one or more amplified nucleic acid molecules have a thymine base at a position corresponding to the position of the adduct of 5-formyl cytosine in each of the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine.

[0039] In some embodiments, the method further comprises sequencing the one or more amplified nucleic acid molecules. In some embodiments, the sequencing comprises next-generation sequencing.

[0040] In some embodiments, the obtained sample is prepared by: (i) obtaining a solution comprising one or more nucleic acid molecules each having one or more 5 -hydroxymethyl cytosine bases; and (ii) oxidizing the 5 -hydroxymethyl cytosine bases of the one or more nucleic acid molecules in the solution to provide the sample comprising the one or more nucleic acid molecules each having one or more 5-formyl cytosine bases. In some embodiments, the oxidizing comprises exposing the solution to a formulation comprising a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide.

[0041] A fifth aspect of the present disclosure is a method for synthesizing one or more nucleic acid molecules each comprising one or more adducts of 5-formyl cytosine, the method comprising: (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5 -hydroxymethyl cytosine bases; (b) contacting the obtained sample with a first composition at a first temperature and for a first time period to provide a mixture comprising one or more nucleic acid molecules each having one or more 5-formyl cytosine bases, wherein the first composition comprises a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide reagent; and (c) contacting the resulting mixture with a second composition at a second temperature for a second time period, wherein the second composition comprises a compound having Formula (I):(i),

[0042] where

[0043] R is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl mono-substituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl,

[0044] thereby providing the one or more nucleic acid molecules each comprising the one or more adducts of 5-formyl cytosine.

[0045] In some embodiments, the resulting mixture is contacted with the second composition without first purifying the resulting mixture. In some embodiments, the obtained sample is contacted with the first composition at a pH ranging from between about 8 and about 12. In some embodiments, the obtained sample is contacted with the second composition at a pH ranging from between about 8 and about 12.

[0046] In some embodiments, the first temperature ranges from between about 20°C to about 35°C. In some embodiments, the second temperature ranges from between about 20°C to about 35°C. In some embodiments, the first and second temperatures are about the same. In some embodiments, the first duration is between about 30 minutes and about 90 minutes; and wherein the second duration is between about 30 minutes and about 90 minutes.

[0047] In some embodiments, the copper salt is Cu(ACN)4 triflate or CU(OAC)2; and the chelator is a 2,2'-bipyridine. In some embodiments, a ratio of an amount of the Cu(ACN)4 triflate or the Cu(OAc)2 to an amount of the 2,2'-bipyridine present in the first composition ranges from between about 1 : 1 to about 1 :3.

[0048] In some embodiments, the compound having Formula (I) is malononitrile.

[0049] In some embodiments, the bipyridine is selected from the group consisting of 4,4'-dimethyl-2,2'-bipyridine, 5,5'-dimethyl-2,2'-bipyridine, 4,4'- diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'-dimethoxy-2,2'-bipyridine, and 5,5'-dimethoxy-2,2'-bipyridine.

[0050] In some embodiments, the one or more nucleic acid molecules in the obtained sample are single stranded nucleic acid molecules. In some embodiments, the one or more nucleic acid molecules in the obtained sample are double strandednucleic acid molecules. In some embodiments, the one or more nucleic acid molecules in the obtained sample are ligated to one or more adapters. In some embodiments, the one or more nucleic acid molecules in the obtained sample include one or more barcodes. In some embodiments, the one or more barcodes are unique molecular identifiers.

[0051] In some embodiments, the obtained sample is prepared by: (i) obtaining a solution comprising one or more nucleic acid molecules each having one or more 5-methyl cytosine bases; and (ii) oxidizing the 5-methyl cytosine bases of the one or more nucleic acid molecules in the solution to provide the sample comprising the one or more nucleic acid molecules each having one or more 5- hydroxymethyl cytosine bases.

[0052] In some embodiments, the method further comprises contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with a polymerase to provide one or more amplified nucleic acid molecules, wherein the one or more amplified nucleic acid molecules have a thymine base at a position corresponding to the position of the adduct of 5-formyl cytosine in each of the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine. In some embodiments, the adduct of 5-formyl cytosine is a malononitrile adduct of 5-formyl cytosine.

[0053] In some embodiments, the method further comprises ligating one or more adapters to the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine prior to contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with the polymerase. In some embodiments, polymerase is a DNA polymerase. In some embodiments, the DNA polymerase is an uracil-tolerant polymerase.

[0054] In some embodiments, the method further comprises sequencing the one or more amplified nucleic acid molecules. In some embodiments, the sequencing comprises next-generation sequencing.

[0055] In some embodiments, the obtained sample is obtained from a tumor. In some embodiments, the obtained sample is obtained from a specimen suspected of having a tumor.

[0056] A sixth aspect of the present disclosure is kit comprising: (i) a first container including a copper salt and a chelator selected from one of a bipyridine ora phenanthroline; and (n) a second container including a polymerase. In some embodiments, the kit further comprises a third container including an adduct forming reagent having Formula (I),(i),

[0057] where

[0058] R is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl mono-substituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl.

[0059] In some embodiments, a ratio of an amount of chelator to an amount of copper salt in the first container ranges from about 2: 1. In some embodiments, the polymerase is a thermostable polymerase.

[0060] In some embodiments, the kit further comprises at least one of a buffer or a strong base.

[0061] A seventh aspect of the present disclosure is a method for detecting one or more epigenetic changes in a target nucleic acid molecule, comprising: (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5 -hydroxymethyl cytosine bases; (b) contacting the obtained sample with a first composition at a first temperature and for a first time period to provide a mixture comprising one or more nucleic acid molecules each having one or more 5-formyl cytosine bases, wherein the first composition comprises a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide reagent; (c) contacting the resulting mixture with a second composition at a second temperature for a second time period, wherein the second composition comprises a compound having Formula (I):(i),

[0062] where

[0063] R is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl mono-substituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl,

[0064] thereby providing the one or more nucleic acid molecules each comprising the one or more adducts of 5 -formyl cytosine; (d) contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with a polymerase to provide one or more amplified nucleic acid molecules, wherein the one or more amplified nucleic acid molecules have a thymine base at a position corresponding to the position of the adduct of 5-formyl cytosine in each of the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine; and (e) sequencing the one or more amplified nucleic acid molecules.

[0065] In some embodiments, the adduct of 5-formyl cytosine is a malononitrile adduct of 5-formyl cytosine.

[0066] In some embodiments, the method further comprises ligating one or more adapters to the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine prior to contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with the polymerase. In some embodiments, the polymerase is a DNA polymerase. In some embodiments, the DNA polymerase is an uracil-tolerant polymerase. In some embodiments, the sequencing comprises next-generation sequencing.BRIEF DESCRIPTION OF THE FIGURES

[0067] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0068] For a general understanding of the features of the disclosure, reference is made to the drawings. In the drawings, like reference numerals have been used throughout to identify identical elements.

[0069] FIG. 1 provides LC-MS traces of the conversion of a 5-formyl cytosine nucleotide in a nucleic acid molecule to its respective malononitrile adduct under different reaction conditions.

[0070] FIG. 2 provides LC-MS traces of the conversion of a 5-formyl cytosine nucleotide in a nucleic acid molecule to its respective malononitrile adduct under different reaction conditions.

[0071] FIG. 3 provides LC-MS traces of the conversion of a 5-formyl cytosine nucleotide in a nucleic acid molecule to its respective malononitrile adduct under different reaction conditions.

[0072] FIG. 4 provides LC-MS traces of the conversion of a 5-formyl cytosine nucleotide in a nucleic acid molecule to its respective malononitrile adduct under different reaction conditions.

[0073] FIG. 5 sequencing data of the conversion rate of oligo containing a single 5-formyl cytosine base treated with standard malononitrile in Tris compared to Cu2+ / 2,2'-bipyridine complex added with lOOmM malononitrile.

[0074] FIG. 6 provides an LC-MS trace of the conversion of a 5- hydroxymethyl cytosine nucleotide in a nucleic acid molecule to its respective malononitrile adduct in a tandem reaction.DETAILED DESCRIPTION

[0075] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0076] As used herein, the singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. The term "includes" is defined inclusively, such that "includes A or B" means including A, B, or A and B.

[0077] As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of anumber or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e., "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0078] The terms "comprising," "including," "having," and the like are used interchangeably and have the same meaning. Similarly, "comprises," "includes," "has," and the like are used interchangeably and have the same meaning. Specifically, each of the terms is defined consistent with the common United States patent law definition of "comprising" and is therefore interpreted to be an open term meaning "at least the following," and is also interpreted not to exclude additional features, limitations, aspects, etc. Thus, for example, "a device having components a, b, and c" means that the device includes at least components a, b, and c. Similarly, the phrase: "a method involving steps a, b, and c" means that the method includes at least steps a, b, and c. Moreover, while the steps and processes may be outlined herein in a particular order, the skilled artisan will recognize that the ordering steps and processes may vary.

[0079] As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and / or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B,with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0080] As used herein, the term "adapter" refers to a nucleotide sequence that may be added to another sequence so as to import additional properties to that sequence. An adapter can be single- or double-stranded or may have both a singlestranded portion and a double-stranded portion.

[0081] As used herein "amplification" refers to a process in which a copy number increases. Amplification may be a process in which replication occurs repeatedly over time to form multiple copies of a template. Amplification can produce an exponential or linear increase in the number of copies as amplification proceeds. Exemplary amplification strategies include polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), rolling circle replication (RCA), cascade-RCA, nucleic acid-based amplification (NASBA), and the like. Also, amplification can utilize a linear or circular template. Amplification can be performed under any suitable temperature conditions, such as with thermal cycling or isothermally. Furthermore, amplification can be performed in an amplification mixture (or reagent mixture), which is any composition capable of amplifying a nucleic acid target, if any, in the mixture. PCR amplification relies on repeated cycles of heating and cooling (i.e., thermal cycling) to achieve successive rounds of replication. PCR can be performed by thermal cycling between two or more temperature setpoints, such as a higher denaturation temperature and a lower annealing / extension temperature, or among three or more temperature setpoints, such as a higher denaturation temperature, a lower annealing temperature, and an intermediate extension temperature, among others. PCR can be performed with a thermostable polymerase, such as Taq DNA polymerase. PCR produces an exponential increase in the amount of a product amplicon over successive cycles. PCR is described, for example, in U.S. Pat. No. 4,683,202; U.S. Pat. No. 4,683,195; U.S. Pat. No. 4,000,159; U.S. Pat. No. 4,965,188; U.S. Pat. No. 5,176,995), the disclosures of each are hereby incorporated by reference herein in their entirety.

[0082] As used herein, the term "biological sample," "tissue sample," "specimen" or the like refers to any sample including a biomolecule (such as a protein, a peptide, a nucleic acid, a lipid, a carbohydrate, or a combination thereof)that is obtained from any organism including viruses. Other examples of organisms include mammals (such as humans; veterinary animals like cats, dogs, horses, cattle, and swine; and laboratory animals like mice, rats, and primates), insects, annelids, arachnids, marsupials, reptiles, amphibians, bacteria, and fungi. Biological samples include tissue samples (such as tissue sections and needle biopsies of tissue), cell samples (such as cytological smears such as Pap smears or blood smears or samples of cells obtained by microdissection), or cell fractions, fragments, or organelles (such as obtained by lysing cells and separating their components by centrifugation or otherwise). Other examples of biological samples include blood, serum, urine, semen, fecal matter, cerebrospinal fluid, interstitial fluid, mucous, tears, sweat, pus, biopsied tissue (for example, obtained by a surgical biopsy or a needle biopsy), nipple aspirates, cerumen, milk, vaginal fluid, saliva, swabs (such as buccal swabs), or any material containing biomolecules that is derived from a first biological sample. In certain embodiments, the term "biological sample" as used herein refers to a sample (such as a homogenized or liquefied sample) prepared from a tumor or a portion thereof obtained from a subject.

[0083] As used herein, "Ca to Cb" in which "a" and "b" are integers refer to the number of carbon atoms in an alkyl, alkenyl or alkynyl group, or the number of carbon atoms in the ring of a cycloalkyl, cycloalkenyl, cycloalkynyl or aryl group, or the total number of carbon atoms and heteroatoms in a heteroalkyl, heterocyclyl, heteroaryl or heteroalicyclyl group. That is, the alkyl, alkenyl, alkynyl, ring of the cycloalkyl, ring of the cycloalkenyl, ring of the cycloalkynyl, ring of the aryl, ring of the heteroaryl or ring of the heteroalicyclyl can contain from "a" to "b", inclusive, carbon atoms. Thus, for example, a "Ci to C4 alkyl" group refers to all alkyl groups having from 1 to 4 carbons, that is, CH3 — , CH3CH2 — , CH3CH2CH2 — , (CH3)2CH — , CH3CH2CH2CH2, CH3CH2CH(CH3)— and (CH3)3C— . If no "a" and "b" are designated with regard to an alkyl, alkenyl, alkynyl, cycloalkyl cycloalkenyl, cycloalkynyl, aryl, heteroaryl or heteroalicyclyl group, the broadest range described in these definitions is to be assumed.

[0084] As used herein, the term "alkyl" includes saturated aliphatic groups, including straight-chain alkyl groups (e.g., methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc.), branched-chain alkyl groups (isopropyl, tertbutyl, isobutyl, etc.), cycloalkyl (alicyclic) groups (cyclopropyl, cyclopentyl,cyclohexyl, cycloheptyl, cyclooctyl), alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. The term alkyl further includes alkyl groups, which can further include oxygen, nitrogen, sulfur, or phosphorous atoms replacing one or more carbons of the hydrocarbon backbone. In certain embodiments, a straight chain or branched chain alkyl has 50 or fewer carbon atoms in its backbone (e.g., Ci-Cso for straight chain, C1-C50 for branched chain).

[0085] As used herein, the terms "cycloalkyl" and "heterocycloalkyl," by themselves or in combination with other terms, mean, unless otherwise stated, cyclic versions of "alkyl" and "heteroalkyl," respectively. In some embodiments, a " heterocycloalkyl" is also referred as a "heterocyclic" group or moiety. Cycloalkyl and heterocycloalkyl are not aromatic. Cycloalkyls and heterocycloalkyl can be further substituted, e.g., with any of the substituents described herein.

[0086] As used herein, the term "derivative" is used in accordance with its plain ordinary meaning within chemistry and biology and refers to a chemical compound that is structurally similar to another compound (i.e., a so-called "reference" compound) but differs in composition, e.g., in the replacement of one atom by an atom of a different element, or in the presence of a particular functional group, or the replacement of one functional group by another functional group, or the absolute stereochemistry of one or more chiral centers of the reference compound. Accordingly, a derivative is a compound that is similar or comparable in function and appearance but not in structure or origin to a reference compound.

[0087] As used herein, the term "next generation sequencing" refers to sequencing technologies having high-throughput sequencing as compared to traditional Sanger- and capillary electrophoresis-based approaches, wherein the sequencing process is performed in parallel, for example producing thousands or millions of relatively small sequence reads at a time. Some examples of next generation sequencing techniques include, but are not limited to, sequencing by synthesis, sequencing by ligation, and sequencing by hybridization. These technologies produce shorter reads (anywhere from about 25 - about 500 bp) but many hundreds of thousands or millions of reads in a relatively short time. Examples of such sequencing devices available from Illumina (San Diego, CA) include, but are not limited to iSEQ, MiniSEQ, MiSEQ, NextSEQ, NoveSEQ.

[0088] It is believed that the Illumina next-generation sequencing technology uses clonal amplification and sequencing by synthesis (SBS) chemistry to enable rapid sequencing. The process simultaneously identifies DNA bases while incorporating them into a nucleic acid chain. Each base emits a unique fluorescent signal as it is added to the growing strand, which is used to determine the order of the DNA sequence. A non-limiting example of a sequencing device available from ThermoFisher Scientific (Waltham, MA) includes the Ion Personal Genome Machine™ (PGM™) System.

[0089] It is believed that Ion Torrent sequencing measures the direct release of H+ (protons) from the incorporation of individual bases by DNA polymerase. A non-limiting example of a sequencing device available from Pacific Biosciences (Menlo Park, CA) includes the PacBio Sequel Systems. A non-limiting example of a sequencing device available from Roche (Pleasanton, CA) is the Roche 454. Nextgeneration sequencing methods may also include nanopore sequencing methods. In general, three nanopore sequencing approaches have been pursued: strand sequencing in which the bases of DNA are identified as they pass sequentially through a nanopore, exonuclease-based nanopore sequencing in which nucleotides are enzymatically cleaved one-by-one from a DNA molecule and monitored as they are captured by and pass through the nanopore, and a nanopore sequencing by synthesis (SBS) approach in which identifiable polymer tags are attached to nucleotides and registered in nanopores during enzyme-catalyzed DNA synthesis. Common to all these methods is the need for precise control of the reaction rates so that each base is determined in order.

[0090] Strand sequencing requires a method for slowing down the passage of the DNA through the nanopore and decoding a plurality of bases within the channel; ratcheting approaches, taking advantage of molecular motors, have been developed for this purpose. Exonuclease-based sequencing requires the release of each nucleotide close enough to the pore to guarantee its capture and its transit through the pore at a rate slow enough to obtain a valid ionic current signal. In addition, both methods rely on distinctions among the four natural bases, two relatively similar purines and two similar pyrimidines.

[0091] The nanopore SBS approach utilizes synthetic polymer tags attached to the nucleotides that are designed specifically to produce unique and readilydistinguishable ionic current blockade signatures for sequence determination. In some embodiments, sequencing of nucleic acid molecules via nanopore sequencing comprises preparing nanopore sequencing complexes and determining polynucleotide sequences. Methods of preparing nanopores and nanopore sequencing are described in U.S. Patent Application Publication No. 2017 / 0268052, and PCT Publication Nos. WO2014 / 074727, W02006 / 028508, WO2012 / 083249, and WO / 2014 / 074727, the disclosures of which are hereby incorporated by reference herein in their entireties. In some embodiments, tagged nucleotides may be used in the determination of the polynucleotide sequences (see, e.g., PCT Publication No. WO / 2020 / 131759, WO / 2013 / 191793, and WO / 2015 / 148402, the disclosures of which are hereby incorporated by reference herein in their entireties).

[0092] Analysis of the data generated by sequencing is generally performed using software and / or statistical algorithms that perform various data conversions, e.g., conversion of signal emissions into base calls, conversion of base calls into consensus sequences for a nucleic acid template, etc. Such software, statistical algorithms, and the use of such are described in detail, in U.S. Patent Application Publication Nos. 2009 / 0024331 2017 / 0044606 and in PCT Publication No. WO / 2018 / 034745, the disclosures of which are hereby incorporated by reference herein in their entireties.

[0093] As used herein, the terms "nucleic acid" or "nucleic acid molecule" as used herein, refer to a high-molecular-weight biochemical macromolecule composed of nucleotide chains that convey genetic information. The most common nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The monomers from which nucleic acids are constructed are called nucleotides. Each nucleotide consists of three components: a nitrogenous heterocyclic base, either a purine or a pyrimidine (also known as a nucleobase); and a pentose sugar. Different nucleic acid types differ in the structure of the sugar in their nucleotides; DNA contains 2-deoxyribose while RNA contains ribose.

[0094] As used herein, the "polymerase" as used herein, refers to an enzyme that catalyzes the process of replication of nucleic acids. More specifically, DNA polymerase catalyzes the polymerization of deoxyribonucleotides alongside a DNA strand, which the DNA polymerase "reads" and uses as a template. The newlypolymerized molecule is complementary to the template strand and identical to the template's partner strand.

[0095] As used herein, the term "sequencing" refers to the determination of the order and position of bases in a nucleic acid molecule. More particularly, the term "sequencing" refers to biochemical methods for determining the order of the nucleotide bases, adenine, guanine, cytosine, and thymine, in a DNA oligonucleotide. Sequencing, as the term is used herein, can include without limitation parallel sequencing or any other sequencing method known of those skilled in the art, for example, chain-termination methods, rapid DNA sequencing methods, wandering-spot analysis, Maxam-Gilbert sequencing, dye- terminator sequencing, or using any other modern automated DNA sequencing instruments.

[0096] OVERVIEW

[0097] The present disclosure provides compositions for converting 5- hydroxymethyl cytosine bases in target nucleic acid molecules to 5-formyl cytosine bases. The present disclosure also provides compositions for converting 5-formyl cytosine bases in target nucleic acid molecules to the respective adduct of 5-formyl cytosine, such as a malononitrile adduct of 5-formyl cytosine. Each of the compositions of the present disclosure utilize a mixture of a copper salt and a chelator selected from one of a bipyridine or a phenanthroline.

[0098] The present disclosure provides for methods of efficiently synthesizing nucleic acid molecules including one or more 5-formyl cytosine bases from target nucleic acid molecules which include one or more 5 -hydroxymethyl cytosine bases. The present disclosure also provides methods for efficiently synthesizing nucleic acid molecules including one or more adducts of 5-formyl cytosine from target nucleic acid molecules including one or more 5-formyl cytosine bases. Additionally, the present disclosure provides an efficient "one pot" synthetic method for forming nucleic acid molecules including one or more adducts of 5- formyl cytosine from target nucleic acid molecules including one or more 5- hydroxymethyl cytosine bases. Advantageously, the "one pot" synthetic method of the present disclosure does not require any purification of any intermediates, allowing for nucleic acid libraries to be built rapidly. Additionally, the "one pot" synthetic method is quick, allowing for formation of the 5-formyl cytosine adductwithin about three hours or less, such as within about two hours or less, such as within about 90 minutes or less, etc.

[0099] The present disclosure also provides for methods of detecting epigenetic modifications in a target nucleic acid molecule, such as those epigenetic modifications characterized by methylation of cytosine at the 5-position position (e.g., 5-methyl cytosine; 5 -hydroxymethyl cytosine). In some embodiments, the methods of detecting the epigenetic modifications comprises converting those cytosine bases in a nucleic acid molecule characterized by a methylation at the 5- position to an adduct of 5-formyl cytosine, followed by amplification of the nucleic acid molecule including the adduct of 5-formyl cytosine in the presence of a polymerase, wherein the polymerase reads the one or more adducts of 5-formyl cytosine as thymine during amplification. The amplification product may then be sequenced, such as with next-generation sequencing. Diagnostic decisions may then be made based on the data from the sequencing.

[0100] The present disclosure also provides for methods of amplifying and / or sequencing a target nucleic acid molecule including one or more epigenetic modifications. In some embodiments, the amplification method first requires converting the target nucleic acid molecule including the one or more epigenetic modifications to a nucleic acid molecule including one or more 5-formyl cytosine bases. In some embodiments, the amplification method next requires that the one or more 5-formyl cytosine bases of the nucleic acid molecule be converted into an adduct of 5-formyl cytosine. In some embodiments, one or more adapters are ligated to the nucleic acid molecule prior to amplification, wherein the adapters may include one or more molecular barcodes, one or more multiplex identifiers (MIDs), and / or one or more unique molecular identifier (UIDs). Amplification of the nucleic acid molecule including the one or more adducts of 5-formyl cytosine in the presence of a polymerase causes the polymerase to read the one or more adducts of 5-formyl cytosine as a thymine. The amplified target nucleic acid molecule may then be sequenced, such as with a next-generation sequencing technique.

[0100] These and other embodiments are described herein.

[0101] COMPOSITIONS

[0102] As noted above, the present disclosure is directed to compositions for use in preparing target nucleic acid molecules including one or more 5-formylcytosine bases or adducts of 5-formyl cytosine. In general, the compositions of the present disclosure include components selected from: target nucleic acid molecules, copper salts, a chelator selected from one of a bipyridine or a phenanthroline, N- oxide reagents, adduct forming reagents, bases, buffers, solvents, etc.

[0103] Target Nucleic Acid Molecules

[0104] In some embodiments, the compositions of the present disclosure include one or more target nucleic acid molecules derived from a biological sample. In some embodiments, the target nucleic acid molecules include one or more 5- hydroxymethyl cytosine bases. In some embodiments, the target nucleic acid molecules include one or more 5-formyl cytosine bases.

[0105] In some embodiments, the target nucleic acid molecules are single stranded. In some embodiments, the target nucleic acid molecules are single stranded and include one or more 5 -hydroxymethyl cytosine (5-hmC) bases, such as one 5-hydroxymethylcytosine base, such as two 5-hydroxymethylcytosine bases, such three 5-hydroxymethylcytosine bases, such as four 5-hydroxymethylcytosine bases, such as 5 or more 5-hydroxymethylcytosine bases. In some embodiments, the target nucleic acid molecules are single stranded and include one or more 5-formyl cytosine (5-fC) bases such as one 5-formyl cytosine base, such as two 5- hydroxymethylcytosine bases, such three 5-formyl cytosine bases, such as four 5- formyl cytosine bases, such as 5 or more 5-formyl cytosine bases.

[0106] In some embodiments, the target nucleic acid molecules are double stranded. In some embodiments, the target nucleic acid molecules are double stranded and include one or more 5-hydroxymethylcytosine bases, such as one 5- hydroxymethylcytosine base, such as two 5-hydroxymethylcytosine bases, such three 5-hydroxymethylcytosine bases, such as four 5-hydroxymethylcytosine bases, such as 5 or more 5-hydroxymethylcytosine bases. In some embodiments, the target nucleic acid molecules are double stranded and include one or more 5-formyl cytosine bases such as one 5-formyl cytosine base, such as two 5- hydroxymethylcytosine bases, such three 5-formyl cytosine bases, such as four 5- formyl cytosine bases, such as 5 or more 5-formyl cytosine bases. In some embodiments, the 5-hydroxymethylcytosine bases are on one or both strands of the double stranded target nucleic acid molecule.

[0107] In some embodiments, samples may be obtained from any source including a target nucleic acid sequence having one or more cytosine residues of interest, e.g., tissue (including tumor tissue or FFPE tissue), blood, skin, swab (e.g., buccal, vaginal), urine, saliva, etc. In some embodiments, the sample is derived from a subject or a patient. In some embodiments the sample may comprise a fragment of a solid tissue or a tumor sample derived from the subject or the patient, e.g., by biopsy. As used herein, the term "tumor sample" encompasses samples prepared from a tumor or from a sample potentially comprising or suspected of comprising cancer cells, or to be tested for the potential presence of cancer cells, such as a lymph node. As used herein, the term "tumor" refers to a mass or a neoplasm, which itself is defined as an abnormal new growth of cells that usually grow more rapidly than normal cells and will continue to grow if not treated, sometimes resulting in damage to adjacent structures. Tumor sizes can vary widely. A tumor may be solid, or fluid filled. A tumor can refer to benign (not malignant, generally harmless), or malignant (capable of metastasis) growths. Some tumors can contain neoplastic cells that are benign (such as carcinoma in situ) and, simultaneously, contain malignant cancer cells (such as adenocarcinoma). This should be understood to include neoplasms located in multiple locations throughout the body. Therefore, for purposes of the disclosure, tumors include primary tumors, lymph nodes, lymphatic tissue, and metastatic tumors.

[0108] Methods for isolating nucleic acids from biological samples and / or purifying the samples are known, e.g., as described in Sambrook, and several kits are commercially available (e.g., High Pure RNA Isolation Kit, High Pure Viral Nucleic Acid Kit, and MagNA Pure LC Total Nucleic Acid Isolation Kit, DNA Isolation Kit for Cells and Tissues, DNA Isolation Kit for Mammalian Blood, High Pure FFPET DNA Isolation Kit, available from Roche). In the context of the presently disclosed methods, genomic DNA can be collected, purified, and / or isolated.

[0109] It will be appreciated that nucleic acid molecules may be isolated from biological samples using any of a variety of procedures known in the art, for example, MagMAX™ DNA Multi-Sample Ultra Kit (Applied Biosystems, Thermo Fisher Scientific), the MagMAX™ Express-96 Magnetic Particle Processor and the KingFisher™ Flex Magnetic Particle Processor (Thermo Fisher Scientific), a RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE and PureLink™ FFPERNA Isolation Kit (Ambion™, Thermo Fisher Scientific), the ABI Prism™ 6100 Nucleic Acid PrepStation and the ABI Prism™ 6700 Automated Nucleic Acid Workstation (Applied Biosystems, Thermo Fisher Scientific), and the like. It will be appreciated that nucleic acid molecules from the biological samples may be cut or sheared prior to analysis, including the use of such procedures as mechanical force, sonication, restriction endonuclease cleavage, or any method known in the art.

[0110] In some embodiments, the target nucleic acid molecules have a length ranging from between about 10 mer to about 5000 mer. In some embodiments, the target nucleic acid molecules have a length ranging from between about 10 mer to about 2500 mer. In some embodiments, the target nucleic acid molecules have a length ranging from between about 10 mer to about 2000 mer. In some embodiments, the target nucleic acid molecules have a length ranging from between about 10 mer to about 1000 mer. In some embodiments, the target nucleic acid molecules have a length ranging from between about 10 mer to about 500 mer. In some embodiments, the target nucleic acid molecules have a length ranging from between about 10 mer to about 250 mer. In other embodiments, the target nucleic acid molecules have a length ranging from between about 15 mer to about 150 mer. In yet other embodiments, the target nucleic acid molecules have a length ranging from between about 15 mer to about 100 mer. In further embodiments, the target nucleic acid molecules have a length ranging from between about 15 mer to about 60 mer.[OHl] In some embodiments, the target nucleic acid molecule includes at least one analog of cytosine per strand, e.g., one or more 5 -hydroxymethyl cytosines or one or more 5-formyl cytosines. In some embodiments, the target nucleic acid molecule includes at least two analogs of cytosine per strand. In some embodiments, the target nucleic acid molecule includes at least three analogs of cytosines per strand. In some embodiments, the target nucleic acid molecule includes at least four analogs of cytosines per strand.

[0112] Copper Salts

[0113] In some embodiments, the compositions of the present disclosure include one or more copper salts. In some embodiments, the copper salt may be any salt of copper in any of its common oxidation states, including cuprous salts, Cu(I), and cupric salts, Cu(II). In some embodiments, the copper salt is selected from acopper halide, a copper nitrate, a copper acetate, a copper sulfate, copper formate, and copper oxide. Examples of copper salts include, but are not limited to, Copper(I) oxide, Copper(I) chloride, Copper(I) iodide, Copper(I) cyanide, Copper(I) thiocyanate, Copper(I) sulfate, Copper(I) sulfide, Copper(I) acetylide, Copper(I) bromide, Copper(I) fluoride, Cu(ACN)4 tritiate, Copper(I) hydroxide, Copper(I) hydride, Copper(I) nitrate, Copper(I) phosphide, Copper(I) thiophene-2-carboxylate, Copper(I) t-butoxide, Copper(II) sulfate, Copper(II) chloride, Copper(II) hydroxide, Copper(II) nitrate, Copper(II) oxide, Copper(II) acetate, Copper(II) fluoride, Copper(II) bromide, Copper(II) carbonate, Copper(II) carbonate hydroxide, Copper(II) chlorate, Copper(II) arsenate, Copper(II) azide, Copper(II) acetylacetonate, Copper(II) aspirinate, Copper(II) cyanurate, Copper(II) glycinate, Copper(II) phosphate, Copper(II) perchlorate, Copper(II) selenite, Copper(II) sulfide, Copper(II) thiocyanate, Copper(II) tritiate, Copper(II) tetrafluorob orate, Copper(II) acetate triarsenite, Copper(II) benzoate, Copper(II) arsenite, Copper(II) chromite, Copper(II) gluconate, Copper(II) peroxide, Copper(II) usnate, and Copper(II) oxychloride.

[0114] In some embodiments, the copper salt is a copper (II) perchlorate (Cu(C104)2), a copper (II) CuSCh, a copper (II) Cu(OAc)2, a copper (II) CuCh, a copper (I) Cu(ACN)4 tritiate, a copper (I) CuBr, or a copper (I) CuCl.

[0115] Oxidants

[0116] In some embodiments, the compositions of the present disclosure also include one or more oxidants. The oxidation of alcohols to their corresponding carbonyl compounds is a fundamental transformation in organic chemistry. In the present disclosure, an alcohol moiety of a 5 -hydroxymethyl cytosine base is converted into its respective carbonyl, thereby providing a 5-formyl cytosine base. In some embodiments, the oxidant used to achieve this transformation is an amine oxide, also known as amine N-oxides or N-oxides.

[0117] In some embodiments, the N-oxide is 2, 2,6,6- Tetramethylpiperidinyloxy or 2,2,6,6-tetramethylpiperidine-l-oxyl (TEMPO). In other embodiments, the N-oxide is 9-Azabicyclo[3.3.1]nonane N-Oxyl (ABNO). In yet other embodiments, the N-oxide is 2-Azaadamantane N-Oxyl (AZADO) or a derivative or analog thereof (e.g., 1-Me-AZADO, 2-azaadamantane N-oxyl-AZ ADO, 1,3-dimethyl-AZADO, 1,3-dimethyl-AZADO, 9- azabicyclo[3.3.1]nonane-N-oxyl, and 9-azanoradamantane N-oxyl-AZADO).

[0118] Adduct Forming Reagent

[0119] In some embodiments, the compositions of the present disclosure also include a compound (referred to herein as an "adduct forming reagent") having Formula (I):(i),

[0120] where

[0121] R is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl mono-substituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl.

[0122] In some embodiments, R is cyano. In some embodiments, R is a methyl or ethyl. In yet other embodiments, R is a carboxylic ester.

[0123] Yet other suitable "adduct forming reagents" are described in U.S. Patent No. 11,293,050, the disclosure of which is hereby incorporated by reference in its entirety.

[0124] Chelators

[0125] In some embodiments, the compositions of the present disclosure utilize a chelator selected from one of a bipyridine or a phenanthroline. Suitable bipyridines include 2,2'-bipyridine and derivatives thereof. In some embodiments, suitable bipyridines include one substituent or two substituents. In other embodiments, suitable bipyridines include two or more substituents. In some embodiments, disubstituted bipyridines may be symmetrical or unsymmetrical and have Formula (II A):

[0126] wherein Ri, R2, R3, and R4 are independently H, methyl, -CHR7, - OH, -OMe, -OCH2R7, -NH2, -NHR7, -NR7R7, and -SO3, where each R7is independently a C1-C4 alkyl group.

[0127] In some embodiments the chelator is a phenanthroline having Formula (IIB):

[0128] wherein Ri, R2, R3, R4, Rs, and Re are independently H, methyl, - CHR7, -OH, -OMe, -OCH2R7, -NH2, -NHR7, -NR7R7, and -SO3, where each R7is independently a C1-C4 alkyl group.

[0129] Non-limiting examples of derivatives of 2,2'-bipyridine include, but are not limited to, 4,4'-dimethyl-2,2'-bipyridine, 5,5'-dimethyl-2,2'-bipyridine 4,4'- diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'-dimethoxy-2,2'-bipyridine, 5,5'-dimethoxy-2,2'-bipyridine.

[0130] In some embodiments, the phenanthroline is 1,10-Phenanthroline.

[0131] Buffers

[0132] In some embodiments, the compositions of the present disclosure include one or more buffers. Non-limiting examples of suitable buffers include TRIS ((tri s(hydroxymethyl)aminom ethane, or2-amino-2-(hydroxymethyl)propane-l,3-diol); HEPES ((4-(2 -hydroxy ethyl)- 1- piperazineethanesulfonic acid); MOPS (3-(N-morpholino)propanesulfonic acid); TAPS (([tris(hydroxymethyl)methylamino]propanesulfonic acid); TEST (2-[[l,3-dihydroxy -2-(hydroxymethyl)propan-2-yl]amino]ethanesulfonic acid); and phosphate.

[0133] Bases

[0134] Suitable bases include strong bases including, but not limited to, NaOH, LiOH, KOH, RbOH, CsOH, Ca(OH)2, Sr(OH)2, and Ba(OH)2. In some embodiments, the base is NaOH.

[0135] Compositions for Converting 5-fC Bases to Their Respective Adduct

[0136] A first composition (referred to herein as a "5-fC adduct forming composition") of the present disclosure is adapted for preparing nucleic acid molecules including one or more adducts of 5-formyl cytosine (hereinafter referred to as "5-formyl cytosine adducts" or "5-fC adducts") from nucleic acid molecules including one or more 5-formyl cytosine bases.

[0137] In some embodiments, the 5-fC adduct forming composition includes one or more nucleic acid molecules each having one or more 5-formyl cytosine bases, a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an adduct forming reagent having Formula (I), wherein the copper salt, the chelator, and adduct forming reagent having Formula (I) may be selected from any of those enumerated herein. In some embodiments, the copper salt is complexed with the chelator. In some embodiments, the 5-fC adduct forming composition includes a solvent, such as acetonitrile.

[0138] In some embodiments, the target nucleic acid molecules in the 5-fC adduct forming compositions are single stranded or double stranded and include one 5-formyl cytosine base, at least two 5-formyl cytosine bases, at least three 5-formyl cytosine bases, at least four 5-formyl cytosine bases, at least five 5-formyl cytosine bases, at least six 5-formyl cytosine bases, etc.

[0139] In some embodiments, the 5-fC adduct forming composition has a pH ranging from between about 7 to about 12.5. In some embodiments, the 5-fC adduct forming composition has a pH ranging from between about 8 to about 12.0. In some embodiments, the 5-fC adduct forming composition has a pH of about 8. In some embodiments, the 5-fC adduct forming composition has a pH of about 8.5. In some embodiments, the 5-fC adduct forming composition has a pH of about 9. In some embodiments, the 5-fC adduct forming composition has a pH of about 9.5. In someembodiments, the 5-fC adduct forming composition has a pH of about 10. In some embodiments, the 5-fC adduct forming composition has a pH of about 10.5. In some embodiments, the 5-fC adduct forming composition has a pH of about 11. In some embodiments, the 5-fC adduct forming composition has a pH of about 11.5. In some embodiments, the 5-fC adduct forming composition has a pH of about 12. In some embodiments, the 5-fC adduct forming composition has a pH of about 12.5.

[0140] In some embodiments, the 5-fC adduct forming composition comprises a strong base. In some embodiments, the strong base is selected from the group consisting of NaOH, KOH, and Li OH. In some embodiments, an amount of base is added such that the composition has a pH ranging from about 7 to about 12.5, such as from about 8 to about 12.5. By way of example, a suitable composition for converting one or more 5-fC bases to 5-formyl cytosine bases includes between about 2mM to about 20 mM of NaOH. In some embodiments, a suitable composition for converting one or more 5-fC bases to 5-fC adducts includes about 2 mM to about 10 mM NaOH.

[0141] In other embodiments, the 5-fC adduct forming composition comprises a buffer. In some embodiments, the buffer is TRIS. By way of example, a suitable composition for converting one or more 5 -hydroxymethyl cytosine bases to 5-formyl cytosine bases includes between about 0 mM to about 50 mM of TRIS. By way of another example, a suitable composition for converting one or more 5- hydroxymethyl cytosine bases to 5-formyl cytosine bases includes between about 1 mM to about 50 mM of TRIS. By way of yet another example, a suitable composition for converting one or more 5 -hydroxymethyl cytosine bases to 5-formyl cytosine bases includes between about 10 mM to about 50 mM of TRIS. By way of yet another example, a suitable composition for converting one or more 5- hydroxymethyl cytosine bases to 5-formyl cytosine bases includes between about 20 mM to about 50 mM of TRIS.

[0142] In some embodiments, an amount of copper salt in the 5-fC adduct forming composition ranges from between about 0.5 mM to about 8 mM. In some embodiments, an amount of copper salt in the 5-fC adduct forming composition ranges from between about 0.5 mM to about 6 mM. In some embodiments, an amount of copper salt in the 5-fC adduct forming composition ranges from between about 0.5 mM to about 4 mM. In some embodiments, an amount of copper salt inthe 5-fC adduct forming composition ranges from between about 1 mM to about 3 mM. In some embodiments, an amount of copper salt in the 5-fC adduct forming composition is about 1 mM. In some embodiments, an amount of copper salt in the 5-fC adduct forming composition is about 1.5 mM. In some embodiments, an amount of copper salt in the 5-fC adduct forming composition is about 1.75 mM. In some embodiments, an amount of copper salt in the 5-fC adduct forming composition is about 2 mM. In some embodiments, an amount of copper salt in the 5-fC adduct forming composition is about 2.25 mM. In some embodiments, an amount of copper salt in the 5-fC adduct forming composition is about 2.5 mM. In some embodiments, an amount of copper salt in the 5-fC adduct forming composition is about 3 mM.

[0143] In some embodiments, an amount of chelator in the 5-fC adduct forming composition ranges from between about 1 mM to about 20 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition ranges from between about 1 mM to about 15 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition ranges from between about 1 mM to about 10 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition ranges from between about 2 mM to about 8 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition ranges from between about 2 mM to about 6 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 1 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 2 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 2.5 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 3 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 3.5 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 4 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 4.5 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 5 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 5.5 mM. In some embodiments, an amount of chelator in the 5-fC adduct forming composition is about 6 mM.

[0144] In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition ranges from between about 1 :5 to about 1 : 1. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition ranges from between about 1 :4 to about 1 : 1. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition ranges from between about 1 :3 to about 1 : 1. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 :2.8. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5- fC adduct forming composition is about 1 :2.7. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 :2.6. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 :2.5. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 :2.4. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 :2.3. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 :2.2. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 :2. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 : 1.8. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 : 1.6. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 : 1.4. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC adduct forming composition is about 1 : 1.2. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the composition for converting is about 1 : 1.

[0145] In some embodiments, the copper salt in the 5-fC adduct forming composition is selected from Cu(C104)2, Cu(OAc)2, CuSCh, Cu(ACN)4triflate; and the chelator is 2,2'-bipyridine or a derivative thereof. In other embodiments, the copper salt is selected from Cu(C104)2, Cu(OAc)2, CuSCh, Cu(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of anamount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt in the 5-fC adduct forming composition is selected from Cu(C104)2, Cu(OAc)2, CuSCh, Cu(ACN)4 tritiate; and the chelator is 2,2'- bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt in the 5-fC adduct forming composition is selected from Cu(C104)2, Cu(OAc)2, CuSO4, Cu(ACN)4 tritiate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0146] In some embodiments, the copper salt in the 5-fC adduct forming composition is Cu(C104)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt in the 5-fC adduct forming composition is Cu(C104)2; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt in the 5-fC adduct forming composition is Cu(C104)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt in the 5-fC adduct forming composition is Cu(C104)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0147] In some embodiments, the copper salt in the 5-fC adduct forming composition is Cu(ACN)4 triflate; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt in the 5-fC adduct forming composition is Cu(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt in the 5-fC adduct forming composition is Cu(ACN)4 triflate; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt in the 5-fC adduct forming composition is Cu(ACN)4 triflate; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0148] In some embodiments, the copper salt in the 5-fC adduct forming composition is Cu(OAc)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt in the 5-fC adduct forming composition is Cu(OAc)2; and the chelatoris 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt in the 5-fC adduct forming composition is Cu(OAc)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt in the 5-fC adduct forming composition is Cu(OAc)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0149] As noted above, in some embodiments the compositions for converting one or more 5-fC bases to one or more 5-fC adducts comprises an adduct forming reagent having Formula (I),(i),

[0150] where

[0151] R is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl mono-substituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl.

[0152] In some embodiments, an amount of adduct forming reagent having Formula (I) in the composition for converting one or more 5-fC bases to one or more 5-fC adducts ranges from about 50 mM to about 2500 mM. In some embodiments, an amount of adduct forming reagent having Formula (I) in the composition for converting one or more 5-fC bases to one or more 5-fC adducts ranges from about 50 mM to about 2000 mM. In some embodiments, an amount of adduct forming reagent having Formula (I) in the composition for converting one or more 5-fC bases to one or more 5-fC adducts ranges from about 50 mM to about 1000 mM. In some embodiments, an amount of adduct forming reagent having Formula (I) in the composition for converting one or more 5-fC bases to one or more 5-fC adducts ranges from about 50 mM to about 500 mM. In some embodiments, an amount of adduct forming reagent having Formula (I) in the composition for converting one or more 5-fC bases to one or more 5-fC adducts ranges from about 50 mM to about 200 mM. In other embodiments, an amount of adduct forming reagent having Formula(I) in the composition for converting one or more 5-fC bases to one or more 5-fC adducts ranges from about 75 mM to about 100 mM.

[0153] In some embodiments, the adduct forming reagent in the compositions for converting one or more 5-fC bases to one or more 5-fC adducts is malononitrile (i.e., where R is cyano). In some embodiments, an amount of malononitrile in the composition for converting one or more 5-fC bases to one or more 5-fC adducts ranges from about 50 mM to about 200 mM. In other embodiments, an amount of malononitrile in the composition for converting one or more 5-fC bases to one or more 5-fC adducts ranges from about 75 mM to about 100 mM.

[0154] Exemplary compositions for converting 5-fC bases to 5-fC adducts in single stranded or double stranded nucleic acids are set forth below:

[0155] Compositions for Converting 5-hmC Bases to 5-fC Bases

[0156] A second composition of the present disclosure is adapted for preparing nucleic acid molecules (such as single stranded and double stranded nucleic acid molecules) having one or more 5-formyl cytosine bases from nucleic acid molecules including one or more 5-hydroxymethyl cytosine bases (referred to herein as "5-fC forming compositions").

[0157] In some embodiments, the 5-fC forming composition includes one or more nucleic acid molecules (such as single stranded and double stranded nucleic acid molecules) each having one or more 5-hydroxymethyl cytosine bases, a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide reagent, wherein the copper salt, the chelator, and the N-oxide reagent may be selected from any of those enumerated herein. In some embodiments, the N-oxide reagent is not TEMPO. In some embodiments, the N-oxide reagent is selected from ABNO, AZADO, and Me-AZADO. In some embodiments, the 5-fC forming composition includes a solvent, such as acetonitrile.

[0158] In some embodiments, the target nucleic acid molecules in the 5-fC forming compositions are single stranded or double stranded and include one 5- hydroxymethyl cytosine base, at least two 5-hydroxymethyl cytosine bases, at least three 5-hydroxymethyl cytosine bases, at least four 5-hydroxymethyl cytosine bases, at least five 5-hydroxymethyl cytosine bases, at least six 5-hydroxymethyl cytosine bases, etc.

[0159] In some embodiments, the 5-fC forming composition has a pH ranging from between about 7 to about 12.5. In some embodiments, the 5-fC forming composition has a pH ranging from between about 8 to about 12.0. In some embodiments, the 5-fC forming composition has a pH of about 8. In some embodiments, the 5-fC forming composition has a pH of about 8.5. In some embodiments, the 5-fC forming composition has a pH of about 9. In some embodiments, the 5-fC forming composition has a pH of about 9.5. In some embodiments, the 5-fC forming composition has a pH of about 10. In some embodiments, the 5-fC forming composition has a pH of about 10.5. In some embodiments, the 5-fC forming composition has a pH of about 11. In some embodiments, the 5-fC forming composition has a pH of about 11.5. In someembodiments, the 5-fC forming composition has a pH of about 12. In some embodiments, the 5-fC forming composition has a pH of about 12.5.

[0160] In some embodiments, the 5-fC forming composition comprises a strong base. In some embodiments, the strong base is selected from the group consisting of NaOH, KOH, and Li OH. In some embodiments, an amount of base is added such that the composition has a pH ranging from about 7 to about 12, such as from about 8 to about 12. By way of example, a suitable composition for converting one or more 5 -hydroxymethyl cytosine bases to 5-formyl cytosine bases includes between about 5mM to about 20 mM of NaOH. In some embodiments, a suitable composition for converting one or more 5 -hydroxymethyl cytosine bases to 5-formyl cytosine bases includes about 10 mM of NaOH.

[0161] In other embodiments, the 5-fC forming composition comprises a buffer. In some embodiments, the buffer is TRIS. By way of example, a suitable composition for converting one or more 5 -hydroxymethyl cytosine bases to 5-formyl cytosine bases includes between about 0 mM to about 50 mM of TRIS. By way of another example, a suitable composition for converting one or more 5- hydroxymethyl cytosine bases to 5-formyl cytosine bases includes between about 1 mM to about 50 mM of TRIS. By way of yet another example, a suitable composition for converting one or more 5 -hydroxymethyl cytosine bases to 5-formyl cytosine bases includes between about 5 mM to about 50 mM of TRIS. By way of yet another example, a suitable composition for converting one or more 5- hydroxymethyl cytosine bases to 5-formyl cytosine bases includes between about 10 mM to about 50 mM of TRIS.

[0162] In some embodiments, an amount of copper salt in the 5-fC forming composition ranges from between about 0.5 mM to about 8 mM. In some embodiments, an amount of copper salt in the 5-fC forming composition ranges from between about 0.5 mM to about 6 mM. In some embodiments, an amount of copper salt in the 5-fC forming composition ranges from between about 0.5 mM to about 4 mM. In some embodiments, an amount of copper salt in the 5-fC forming composition ranges from between about 1 mM to about 3 mM. In some embodiments, an amount of copper salt in the 5-fC forming composition is about 1 mM. In some embodiments, an amount of copper salt in the 5-fC forming composition is about 1.5 mM. In some embodiments, an amount of copper salt inthe 5-fC forming composition is about 1.75 mM. In some embodiments, an amount of copper salt in the 5-fC forming composition is about 2 mM. In some embodiments, an amount of copper salt in the 5-fC forming composition is about 2.25 mM. In some embodiments, an amount of copper salt in the 5-fC forming composition is about 2.5 mM. In some embodiments, an amount of copper salt in the 5-fC forming composition is about 3 mM.

[0163] In some embodiments, an amount of chelator in the 5-fC forming composition ranges from between about 1 mM to about 20 mM. In some embodiments, an amount of chelator in the 5-fC forming composition ranges from between about 1 mM to about 15 mM. In some embodiments, an amount of chelator in the 5-fC forming composition ranges from between about 1 mM to about 10 mM. In some embodiments, an amount of chelator in the 5-fC forming composition ranges from between about 2 mM to about 8 mM. In some embodiments, an amount of chelator in the 5-fC forming composition ranges from between about 2 mM to about 6 mM. In some embodiments, an amount of chelator in the 5-fC forming composition is about 1 mM. In some embodiments, an amount of chelator in the 5- fC forming composition is about 2 mM. In some embodiments, an amount of chelator in the 5-fC forming composition is about 2.5 mM. In some embodiments, an amount of chelator in the 5-fC forming composition is about 3 mM. In some embodiments, an amount of chelator in the 5-fC forming composition is about 3.5 mM. In some embodiments, an amount of chelator in the 5-fC forming composition is about 4 mM. In some embodiments, an amount of chelator in the 5-fC forming composition is about 4.5 mM. In some embodiments, an amount of chelator in the 5-fC forming composition is about 5 mM. In some embodiments, an amount of chelator in the 5-fC forming composition is about 5.5 mM. In some embodiments, an amount of chelator in the 5-fC forming composition is about 6 mM.

[0164] In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition ranges from between about 1 :5 to about 1 : 1. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition ranges from between about 1 :4 to about 1 : 1. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition ranges from between about 1 :3 to about 1 : 1. In some embodiments, a ratio of an amount of copper salt to an amount ofchelator in the 5-fC forming composition is about 1 :2.8. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 :2.7. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 :2.6. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5- fC forming composition is about 1 :2.5. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 :2.4. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 :2.3. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 :2.2. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 :2. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5- fC forming composition is about 1 : 1.8. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 : 1.6. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 :1.4. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 : 1.2. In some embodiments, a ratio of an amount of copper salt to an amount of chelator in the 5-fC forming composition is about 1 : 1.

[0165] In some embodiments, the copper salt is selected from Cu(C104)2, CU(OAC)2, CuSCh, CU(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof. In other embodiments, the copper salt is selected from Cu(C104)2, CU(OAC)2, CUSO4, CU(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is selected from Cu(C104)2, CU(OAC)2, CUSO4, CU(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is selected from Cu(C104)2, Cu(OAc)2, CuSCh, Cu(ACN)4 triflate; and the chelator is 2,2'- bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0166] In some embodiments, the copper salt is Cu(C104)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu(C104)2; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu(C104)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu(C104)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0167] In some embodiments, the copper salt is Cu(ACN)4 triflate; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu(ACN)4 triflate; and the chelator is 2,2'- bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu(ACN)4 triflate; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0168] In some embodiments, the copper salt is Cu(OAc)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu(OAc)2; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu(OAc)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu(OAc)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0169] In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition ranges from between about 1 : 1 to about 1 :0.1. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition ranges from between about 1 :0.5 to about 1 :0.1. In some embodiments, a ratio of an amount of copper salt to anamount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition is about 1 :0.5. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition is about 1 :0.4. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition is about 1 :0.3. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition is about 1 :0.2. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me- AZADO) in the 5-fC forming composition is about 1 :0.1.

[0170] In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu(C104)2, Cu(OAc)2, CuSO4, Cu(ACN)4triflate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof. In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu(C104)2, CU(OAC)2, CUSO4, Cu(ACN)4triflate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof, and wherein a ratio of an amount of copper salt to an amount of N-oxide in the composition is about 1 :0.4. In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu(C104)2, CU(OAC)2, CUSO4, Cu(ACN)4triflate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof, and wherein a ratio of an amount of copper salt to an amount of N-oxide in the composition is about 1 :0.3. In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu(C104)2, CU(OAC)2, CUSO4, Cu(ACN)4triflate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof, and wherein a ratio of an amount of copper salt to an amount of N-oxide in the composition is about 1 :0.2. In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu(C104)2, CU(OAC)2, CUSO4, Cu(ACN)4triflate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof, and wherein a ratio of an amount of copper salt to an amount of N-oxide in the composition is about 1 :0.1.

[0171] Exemplary compositions for converting 5-hmC bases to 5-fC bases in single stranded or double stranded nucleic acids are set forth below:

[0172] METHODS OF SYNTHESIS

[0173] The present disclosure is also directed to methods of preparing target nucleic acid molecules including one or more 5-formyl cytosine bases or adducts thereof. In some embodiments, the present disclosure provides a "one pot" synthetic method of forming adducts of the 5-formyl cytosine bases.

[0174] Methods of Preparing One or More Nucleic Acid Molecules Including One or More 5-fC Adducts

[0175] In some embodiments, the methods of the present disclosure comprise converting one or more 5-fC bases within one or more nucleic acid molecules to one or more 5-fC adducts. The conversion of the one or more 5-fC bases to the one or more 5-fC adducts takes place in the presence of a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, an adduct forming reagent (such as theadduct forming reagent having Formula (I), such as set forth in Scheme 1 below). In some embodiments, the product of the reaction, i.e., the one or more 5-fC adducts, may be used in one or more downstream processes, but not limited to, one or more amplification and / or one or more sequencing processes (such as to detect epigenetic changes in one or more target nucleic acid molecules).Malo nonitrile : R - -CNScheme 1

[0176] In some embodiments, the conversion of the one or more 5-fC based to their respective adduct takes place using any one of the 5-fC adduct forming compositions described herein including, but not limited to, any of those set forth in Composition Examples 1 - 3. In this regard, in some embodiments, the method comprises contacting a sample comprising one or more nucleic acid molecules each having one or more 5-fC bases with any one of the 5-fC adduct forming compositions described herein, such as for a predetermined amount of time and at a predetermined temperature. In some embodiments, the sample is contacted with any one of the 5- fC adduct forming compositions described herein, wherein the 5-fC adduct forming composition has a pH ranging from between about 7 to about 12.5, such as a pH ranging from between about 8 to about 12.0.

[0177] In some embodiments, the conversion is allowed to proceed at a temperature ranging from between about 20°C to about 35°C, such as between about 25°C to about 30°C. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 1 minute to about 120 minutes. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 1 minute to about 90 minutes. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 1 minute to about 60 minutes. In some embodiments, the conversion is allowed to proceed for a timeperiod ranging from about 1 minute to about 45 minutes. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 1 minute to about 30 minutes. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 1 minute to about 15 minutes.

[0178] In some embodiments, the present disclosure provides methods of preparing one or more nucleic acid molecules each having one or more 5-fC adducts, wherein the method comprises (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5-formyl cytosine bases; and (b) reacting the obtained sample, for a predetermined amount of time and at a predetermined temperature, with a composition comprising a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an adduct forming. In some embodiments, the adduct forming reagent is any compound capable of forming an adduct of a 5-fC base incorporated within a nucleic acid molecule. In other embodiments, the adduct forming agent has Formula (I) as set forth herein. In yet other embodiments, the adduct forming agent is malononitrile.

[0179] In some embodiments, the reaction occurs at a pH ranging from between about 7 to about 12.5, such as between about 8 to about 12. In some embodiments, the reaction is performed at room temperature. In other embodiments, the reaction is performed at a temperature ranging from about 20°C to about 35°C, such as between about 25°C to about 30°C. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 120 minutes. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 90 minutes. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 60 minutes. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 45 minutes. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 30 minutes. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 15 minutes.

[0180] In some embodiments, the copper salt is selected from Cu(C104)2, CU(OAC)2, CuSCh, CU(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof. In other embodiments, the copper salt is selected from Cu(C104)2, CU(OAC)2, CUSO4, CU(ACN)4 triflate; and the chelator is 2,2'-bipyridine or aderivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is selected from Cu(C104)2, CU(OAC)2, CuSCh, Cu(ACN)4 tritiate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is selected from Cu (C1O4)2, CU(OAC)2, CUSO4, CU(ACN)4 tritiate; and the chelator is 2,2'- bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0181] In some embodiments, the copper salt is Cu (ACN)4 tritiate; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu (ACN)4 tritiate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (ACN)4 tritiate; and the chelator is 2,2'- bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (ACN)4 tritiate; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the bipyridine is about 1 : 1.8.

[0182] In some embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the bipyridine is about 1 : 1.8.

[0183] In some embodiments, the copper salt is Cu (004)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu (004)2; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (004)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (004)2; and the chelator is 2,2'-bipyridine; andwherein a ratio of an amount of the copper salt to an amount of the bipyridine is about 1 : 1.8.

[0184] In some embodiments, an amount of adduct forming reagent ranges from about 50 mM to about 200 mM. In other embodiments, an amount of adduct forming reagent ranges from about 75 mM to about 100 mM. In some embodiments, an amount of the adduct forming reagent is about 100 mM. In other embodiments, an amount of the adduct forming reagent is about 125 mM. In yet other embodiments, an amount of the adduct forming reagent is about 150 mM.

[0185] In some embodiments, the adduct forming reagent is malononitrile (i.e., where R is cyano). In some embodiments, an amount of malononitrile ranges from about 50 mM to about 200 mM. In other embodiments, an amount of malononitrile is about 100 mM. In other embodiments, an amount of malononitrile is about 125 mM. In other embodiments, an amount of malononitrile is about 150 mM. In other embodiments, an amount of malononitrile is about 175 mM. In other embodiments, an amount of malononitrile is about 200 mM. It is believed that the reaction is complete within about 45 minutes to about 60 minutes when using malononitrile in an amount ranging from between about 125 mM to about 150 mM and using a copper salt in an amount of about 2 mM. It is also believed that the reaction is complete within 70 minutes when using malononitrile in an amount of about 100 mM.

[0186] In some embodiments, the copper salt is Cu (CICh)?; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile. In other embodiments, the copper salt is Cu (CICh)?; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (CICh)?; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (C1O4)2; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1: 1.8.

[0187] In some embodiments, the copper salt is Cu (OAc)?; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile. In otherembodiments, the copper salt is Cu (OAc)?; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (OAc)?; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (OAc)?; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1: 1.8.

[0188] In some embodiments, the copper salt is Cu (ACN)4 triflate; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile. In other embodiments, the copper salt is Cu (ACN)4 triflate; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (ACN)4 triflate; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (ACN)4 triflate; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1: 1.8.

[0189] Applicant has surprisingly discovered that both single stranded and double stranded nucleic acid molecules including one or more 5-fC bases are modified with high efficiencies in less than about 1 hour at about 25°C in the presence of about 2mM of a copper salt, about 3 mM to about 4 mM of a bipyridine, and 150 mM of an adduct forming reagent (e.g., malononitrile). It is believed that the reaction can be carried out with highly basic and denatured samples (e.g., about 10 to about 20 mM of NaOH) or with slightly alkaline samples including buffers such as about 10 mM TRIS at a pH of about 8 (see Example 2, FIG. 1). It is believed that the presence of both a copper salt and a bipyridine is important to “speed up” the reaction (see Example 3, FIG. 2). It is believed that the reaction rate is proportional to the concentration of copper (see Example 4, FIG. 3). For instance, the reaction utilizing about 4 mM of copper is about twice as fast as compared with using only about 2 mM of copper and adduct forming reagent (see Examples 4 and5, FIGS. 3 and 4). The reaction utilizing about 150 mM malononitrile is about twice as fast as compared with using only about 75 mM of malononitrile. It is believed that the reaction may be accelerated even further (such as to a few minutes) by introducing additional amounts of copper (see FIG. 3). Applicant has also confirmed the formation of the 5-fC adducts and its conversion to thymine during PCR (see Example 6, FIG. 5, herein).

[0190] Methods of Preparing One or More Nucleic Acid Molecules Including One or More 5-fC Bases

[0191] In some embodiments, the methods of the present disclosure comprise converting one or more 5-hmC bases within one or more nucleic acid molecules to one or more 5-fC bases. The conversion of the one or more 5-hmC bases to the one or more 5-fC bases takes place in the presence of a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an oxidant (such as an N-oxide, preferably ABNO, AZADO, and Me-AZADO), such as set forth in Scheme 2 below. In some embodiments, the conversion of the one or more 5-hmC bases to the one or more 5-fC bases is free from TEMPO.Copper salt BipyridineN-oxideBase or BufferScheme 2

[0192] In some embodiments, the conversion of the one or more 5-hmC to one or more 5-fC bases takes place using any one of the 5-fC forming compositions described herein including, but not limited to, any of those set forth in Composition Examples 4 - 6. In this regard, in some embodiments, the method comprises contacting a sample comprising one or more nucleic acid molecules each having one or more 5-hmC bases with any one of the 5-fC forming compositions described herein (such as for a predetermined about of time and at a predetermined temperature). In some embodiments, the sample is contacted with any one of the 5- fC forming compositions described herein, wherein the 5-fC forming compositionhas a pH ranging from between about 7 to about 12.5, such as a pH ranging from between about 8 to about 12.5. In some embodiments, the conversion is allowed to proceed at a temperature ranging from about 20°C to about 35°C, such as between about 25°C to about 30°C.

[0193] In some embodiments, the conversion is allowed to proceed for a time period ranging from about 10 minutes to about 200 minutes. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 10 minutes to about 120 minutes. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 10 minutes to about 90 minutes. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 10 minutes to about 60 minutes. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 10 minutes to about 45 minutes. In some embodiments, the conversion is allowed to proceed for a time period ranging from about 10 minutes to about 30 minutes.

[0194] In some embodiments, the product of the reaction (the one or more formed 5-fC bases) may be used as a starting material for a further downstream reaction, such as in a one-pot synthesis.

[0195] In some embodiments, the present disclosure provides methods of preparing one or more nucleic acid molecules each having one or more 5-fC bases, wherein the method comprises (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5 -hydroxymethyl cytosine bases; and (b) reacting the obtained sample, for a predetermined amount of time and at a predetermined temperature, with a composition comprising a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide (e.g., preferably ABNO, AZADO, and Me-AZADO). In some embodiments, the composition including the N-oxide is free from TEMPO. In some embodiments, the reaction occurs at a pH ranging from between about 7 to about 12.5, such as between about 8 to about 12.0.

[0196] In some embodiments, the reaction is performed at room temperature. In other embodiments, the reaction is performed at a temperature ranging from about 20°C to about 35°C, such as between about 25°C to about 30°C. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 120 minutes. In some embodiments, the reaction is allowed toproceed for a time period ranging from about 1 minute to about 90 minutes. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 60 minutes. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 45 minutes. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 30 minutes. In some embodiments, the reaction is allowed to proceed for a time period ranging from about 1 minute to about 15 minutes.

[0197] In some embodiments, the copper salt is selected from Cu (CICh CU(OAC)2, CuSCh, CU(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof. In other embodiments, the copper salt is selected from Cu (004)2, CU(OAC)2, CUSO4, CU(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is selected from Cu (004)2, CU(OAC)2, CUSO4, CU(ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is selected from Cu (004)2, CU(OAC)2, 1SO4, Cu(ACN)4 triflate; and the chelator is 2,2'- bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0198] In some embodiments, the copper salt is Cu (ACN)4 triflate; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu (ACN)4 triflate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (ACN)4 triflate; and the chelator is 2,2'- bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (ACN)4 triflate; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0199] In some embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine; and wherein a ratioof an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (OAc)?; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0200] In some embodiments, the copper salt is Cu (004)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu (CICh)?; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (CICh)?; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (CICh)?; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0201] In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition ranges from between about 1 :0.5 to about 1 :0.1. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition is about 1 :0.5. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition is about 1 :0.4. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition is about 1 :0.3. In some embodiments, a ratio of an amount of copper salt to an amount of N- oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition is about 1 :0.2. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide (e.g., ABNO, AZADO, and Me-AZADO) in the 5-fC forming composition is about 1 :0.1.

[0202] In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu (C1O4)2, Cu(OAc)2, CuSO4, Cu(ACN)4triflate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof. In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu (004)2, CU(OAC)2, CUSO4, CU(ACN)4 triflate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof, and wherein a ratio of an amount ofcopper salt to an amount of N-oxide in the composition is about 1 :0.4. In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu (004)2, CU(OAC)2, Q1SO4, CU(ACN)4 tritiate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof, and wherein a ratio of an amount of copper salt to an amount of N-oxide in the composition is about 1 :0.3. In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu (C1O4)2, CU(OAC)2, CUSO4, CU(ACN)4 tritiate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof, and wherein a ratio of an amount of copper salt to an amount of N-oxide in the composition is about 1 :0.2. In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu (C1O4)2, CU(OAC)2, CUSO4, CU(ACN)4 tritiate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof, and wherein a ratio of an amount of copper salt to an amount of N-oxide in the composition is about 1 :0.1.

[0203] In some embodiments, the product of the reaction, i.e., one or more target nucleic acid molecules each having one or more 5-fC bases, is used as a starting material for a downstream reaction. In some embodiments, the product of the reaction is used as a starting material for a downstream reaction without first purifying the product. For instance, the product of the reaction, i.e., one or more target nucleic acid molecules each having one or more 5-fC bases, may be further reacted, with or without first purifying the product, an adduct forming reagent, such as an adduct forming reagent having Formula (I) (described herein).

[0204] 2 One Pot" Synthesis for Preparing One or More Nucleic AcidMolecules Including One or More 5-fC Adducts.

[0205] In some embodiments, the methods of the present disclosure comprise a "one pot" method of converting one or more 5-hmC bases of one or more nucleic acid molecules to one or more 5-fC adducts. It is believed that the "one pot" synthesis allows for tandem oxidation from a 5-hmC base to a 5-fC adduct, through a 5-fC intermediate in less than about three hours, such as less than about two hours. This, it is believed, is highly valuable, particularly for reducing sample preparation time for nucleic acid methylation sequencing reactions.

[0206] In some embodiments, the product of the reaction, i.e., the one or more 5-fC adducts, may be used in one or more downstream processing steps including, but not limited to, one or more amplification and / or one or moresequencing processes (such as to detect epigenetic changes in one or more target nucleic acid molecules).

[0207] The "one pot" conversion of the one or more 5-hmC bases to the one or more 5-fC adducts takes place in a two-step reaction. In a first step, the one or more 5-hmC bases are reacted in the presence of a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an oxidant (such as an N-oxide) to provide a reaction mixture including one or more nucleic acid molecules having one or more 5-fC bases. In a second step, an adduct forming reagent (such as an adduct forming reagent having Formula (I)) is then introduced to the mixture including the one or more nucleic acid molecules including the one or more 5-fC bases to provide one or more nucleic acid molecules including one or more 5-fC adducts. In some embodiments, the second step takes place without first purifying the reaction mixture produced following the first step.

[0208] It is believed that the two-step process may produce one or more target nucleic acid molecules including one or more 5-fC adducts in a time period of less than about 3 hours, such about 2 hours, or such as less than about 2 hours (e.g., about 90 minutes or less, about 60 minutes or less, etc.). In some embodiments, the "one pot" synthesis follows that of Scheme 3 (where the group R is that of Formula (I) herein), below.Copper saltBipyridineN-oxide baseScheme 3

[0209] In some embodiments, the "one pot" synthesis first comprises contacting a sample including one or more nucleic acid molecules having one or more 5-hmC bases with a 5-fC forming composition, including any of the 5-fC forming compositions disclosed herein, to provide a reaction mixture including one or more nucleic acid molecules having one or more 5-fC bases. In some embodiments, the first step is allowed to proceed for about 90 minutes, such as about 60 minutes, such as about 30 minutes, depending, of course, on reaction conditions and the concentrations of reagents utilized (such as noted herein). Subsequently, in some embodiments, the resulting reaction mixture is then contacted with a 5-fC adducing forming composition, including any of the 5-fC adduct forming compositions disclosed herein, to provide one or more nucleic acid molecules including one or more 5-fC adducts. In some embodiments, the second step is allowed to proceed for about 90 minutes, such as about 60 minutes, such as about 30 minutes, depending, of course, on reaction conditions and the concentrations ofreagents utilized (such as noted herein). In some embodiments, the reaction mixture is not purified prior to the second step.

[0210] In some embodiments, the present disclosure provides a method of synthesizing one or more nucleic acid molecules each comprising one or more adducts of 5-formyl cytosine, the method comprising: (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5- hydroxymethyl cytosine bases; (b) contacting the obtained sample with a first composition at a first temperature and for a first time period, wherein the first composition comprises a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide reagent (e.g., TEMPO, ABNO, AZ ADO, and Me- AZADO) to the sample to provide a mixture comprising one or more nucleic acid molecules each having one or more 5-formyl cytosine bases; and (c) contacting the resulting mixture with a second composition at a second temperature for a second time period, wherein the second composition includes an adduct forming reagent. In some embodiments, the adduct forming reagent is any compound capable of forming an adduct of a 5-fC base incorporated within a nucleic acid molecule. In other embodiments, the adduct forming agent has Formula (I) as set forth herein. In yet other embodiments, the adduct forming agent is malononitrile.

[0211] In some embodiments, the first predetermined time period ranges from about 10 minutes to about 48 hours (if using the N-oxide TEMPO). In some embodiments, the first predetermined time period ranges from about 10 minutes to about 24 hours (if using the N-oxide TEMPO). In other embodiments, the first predetermined time period ranges from about 10 minutes to about 4 hours, such as about 10 minutes to about 3 hours, such as about 10 minutes to about 2 hours, such as about 10 minutes to about 1 hour, if using an N-oxide reagent selected from ABNO, AZADO, and Me-AZADO.

[0212] In some embodiments, the second predetermined time period ranges from between about 1 minute to about 120 minutes, such as from about 5 minutes to about 90 minutes, such as from about 5 minutes to about 60, such as about 50 minutes, such as about 40 minutes, such as about 30 minutes.

[0213] In some embodiments, the first and second predetermined temperatures independently range from between about 20 °C to about 35 °C, such as between about 25 °C to about 30°C.

[0214] In some embodiments, the copper salt is selected from Cu (ClCh)?, CU(OAC)2, CuSCh, CU(ACN)4 tritiate; and the chelator is 2,2'-bipyridine or a derivative thereof. In other embodiments, the copper salt is selected from Cu (004)2, CU(OAC)2, CUSO4, CU(ACN)4 tritiate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is selected from Cu (004)2, CU(OAC)2, CUSO4, CU(ACN)4 tritiate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is selected from Cu (004)2, CU(OAC)2, O1SO4, Cu(ACN)4 tritiate; and the chelator is 2,2'- bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0215] In some embodiments, the copper salt is Cu (ACN)4 tritiate; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu (ACN)4 tritiate; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (ACN)4 tritiate; and the chelator is 2,2'- bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (ACN)4 tritiate; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0216] In some embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (OAc)2; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0217] In some embodiments, the copper salt is Cu (004)2; and the chelator is 2,2'-bipyridine. In other embodiments, the copper salt is Cu (004)2; and the chelator is 2,2'-bipyridine or a derivative thereof; and wherein a ratio of an amountof the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu (CICh)?; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu (CICh)?; and the chelator is 2,2'-bipyridine; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 : 1.8.

[0218] In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide reagent (e.g., TEMPO, ABNO, AZADO, and Me-AZADO) ranges from between about 1 :0.5 to about 1 :0.1. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide reagent (e.g., TEMPO, ABNO, AZADO, and Me-AZADO) is about 1 :0.5. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide reagent (e.g., TEMPO, ABNO, AZADO, and Me-AZADO) is about 1 :0.4. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide reagent (e.g., TEMPO, ABNO, AZADO, and Me-AZADO) is about 1 :0.3. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide reagent (e.g., TEMPO, ABNO, AZADO, and Me-AZADO) is about 1 :0.2. In some embodiments, a ratio of an amount of copper salt to an amount of N-oxide reagent (e.g., TEMPO, ABNO, AZADO, and Me-AZADO) is about 1 :0.1. In some embodiments, the copper salt in the 5-fC forming composition is selected from Cu(C104)2, Cu(OAc)2, CuSO4, Cu(ACN)4 triflate; and the N-oxide reagent is ABNO or AZADO or a derivative or analog thereof.

[0219] In some embodiments, an amount of adduct forming reagent ranges from about 50 mM to about 200 mM. In other embodiments, an amount of adduct forming reagent ranges from about 75 mM to about 100 mM. In some embodiments, an amount of the adduct forming reagent is about 100 mM. In other embodiments, an amount of the adduct forming reagent is about 125 mM. In yet other embodiments, an amount of the adduct forming reagent is about 150 mM.

[0220] In some embodiments, the adduct forming reagent is malononitrile (i.e., where R is cyano). In some embodiments, an amount of malononitrile ranges from about 50 mM to about 200 mM. In other embodiments, an amount of malononitrile is about 100 mM. In other embodiments, an amount of malononitrile is about 125 mM. In other embodiments, an amount of malononitrile is about 150mM. In other embodiments, an amount of malononitrile is about 175 mM. In other embodiments, an amount of malononitrile is about 200 mM. It is believed that the reaction is complete within about 45 minutes to about 60 minutes when using malononitrile in an amount ranging from between about 125 mM to about 150 mM. It is also believed that the reaction is complete within 70 minutes when using malononitrile in an amount of about 100 mM.

[0221] In some embodiments, the copper salt is Cu(C104)2; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile. In other embodiments, the copper salt is Cu(C104)2; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2.2. In other embodiments, the copper salt is Cu(C104)2; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1 :2. In other embodiments, the copper salt is Cu(C104)2; the chelator is 2,2'-bipyridine; and the adduct forming reagent is malononitrile; and wherein a ratio of an amount of the copper salt to an amount of the chelator is about 1: 1.8.

[0222] METHODS OF AMPLIFYING AND / OR SEQUENCING TARGET NUCLEIC ACID SEQUENCES INCLUDING AT LEAST ONE MODIFIED CYSTINE

[0223] The present disclosure also provides for methods of amplifying and / or sequencing nucleic acid sequences including at least one modified cysteine base. In some embodiments, the present disclosure provides methods of detecting epigenetic modification in nucleic acids. In some embodiments, the method comprises obtaining one or more target nucleic acid molecules including one or more 5-hmC bases or one or more 5-fC bases and converting the one or more 5-hmC bases or the one or more 5-fC bases to one or more 5-fC adducts. Methods of converting the one or more 5-hmC bases or the one or more 5-fC bases to one or more 5-fC adducts are described herein. In some embodiments, the 5-fC adducts are 5-fC malononitrile adducts.

[0224] Once the sample comprising the one or more nucleic acid molecules having the one or more 5-fC adducts is obtained, the sample is contacted with a polymerase to provide one or more amplified nucleic acid molecules. Thepolymerase is believed to read the 5-fC adduct as a thymine during amplification. As such, in some embodiments the one or more amplified nucleic acid molecules have a thymine base at a position corresponding to the position of the 5-fC adduct in each of the one or more nucleic acid molecules having the one or more adducts of 5- formyl cytosine.

[0225] In some embodiments, the polymerase can copy a strand comprising a 5-fC adduct by recognizing the adduct as T (i.e., incorporating an A opposite the adduct). Polymerases able to accommodate the 5-fC adduct described herein include DNA polymerases known to accommodate uracil (U) in a DNA strand. In some embodiments, polymerase may be a naturally-occurring or an engineered polymerase.

[0226] Non-limiting examples of polymerases include prokaryotic DNA polymerases (e.g., Pol I, Pol II, Pol III, Pol IV, and Pol V), eukaryotic DNA polymerase, archaeal DNA polymerase, telomerase, reverse transcriptase, and RNA polymerase. Reverse transcriptase is an RNA-dependent DNA polymerase which synthesizes DNA from an RNA template. The reverse transcriptase family contains both DNA polymerase functionality and RNase H functionality, which degrades RNA base-paired to DNA. RNA polymerase is an enzyme that synthesizes RNA using DNA as a template during the process of gene transcription. RNA polymerase polymerizes ribonucleotides at the 3' end of an RNA transcript.

[0227] In some embodiments, suitable polymerases may be derived from: archaea (e.g., Thermococcus litoralis (Vent, GenBank: AAA72101), Pyrococcus furiosus (Pfu, GenBank: DI 2983, BAA02362), Pyrococcus woesii, Pyrococcus GB- D (Deep Vent, GenBank: AAA67131), Thermococcus kodakaraensis KODI (KOD, GenBank: BD175553, BAA06142; Thermococcus sp. strain KOD (Pfx, GenBank: AAE68738)), Thermococcus gorgonarius (Tgo, Pdb: 4699806), Sulfolobus solataricus (GenBank: NC002754, P26811), Aeropyrum pernix (GenBank: BAA81109), Archaeglobus fulgidus (GenBank: 029753), Pyrobaculum aerophilum (GenBank: AAL63952), Pyrodictium occultum (GenBank: BAA07579, BAA07580), Thermococcus 9 degree Nm (GenBank: AAA88769, Q56366), Thermococcus fumicolans (GenBank: CAA93738, P74918), Thermococcus hydrothermalis (GenBank: CAC 18555), Thermococcus sp. GE8 (GenBank: CAC12850), Thermococcus sp. JDF-3 (GenBank: AX135456; WO0132887),Thermococcus sp. TY (GenBank: CAA73475), Pyrococcus abyssi (GenBank: P77916), Pyrococcus glycovorans (GenBank: CAC12849), Pyrococcus horikoshii (GenBank: NP 143776), Pyrococcus sp. GE23 (GenBank: CAA90887), Pyrococcus sp. ST700 (GenBank: CAC 12847), Thermococcus pacificus (GenBank: AX411312.1), Thermococcus zilligii (GenBank: DQ3366890), Thermococcus aggregans, Thermococcus barossii, Thermococcus celer (GenBank: DD259850.1), Thermococcus profundus (GenBank: E14137), Thermococcus siculi (GenBank: DD259857.1), Thermococcus thioreducens, Thermococcus onnurineus NA1, Sulfolobus acidocaldarium, Sulfolobus tokodaii, Pyrobaculum calidifontis, Pyrobaculum islandicum (GenBank: AAF27815), Methanococcus jannaschii (GenBank: Q58295), Desulforococcus species TOK, Desulforococcus, Pyrolobus, Pyrodictium, Staphylothermus, Vulcanisaetta, Methanococcus (GenBank: P52025) and other archaeal B polymerases, such as GenBank AAC62712, P956901, BAAA07579)), thermophilic bacteria Thermus species (e.g., flavus, ruber, thermophilus, lacteus, rubens, aquaticus), Bacillus stearothermophilus, Thermotoga maritima, Methanothermus fervidus, KOD polymerase, TNA1 polymerase, Thermococcus sp. 9 degrees N-7, T4, T7, phi29, Pyrococcus furiosus, P. abyssi, T. gorgonarius, T. litoralis, T. zilligii, T. sp. GT, P. sp. GB-D, KOD, Pfu, T. gorgonarius, T. zilligii, T. litoralis and Thermococcus sp. 9N-7 polymerases.

[0228] In some embodiments, the method of amplifying and / or sequencing (or detecting epigenetic changes) further comprises ligating one or more adapters to the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine prior to contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with the polymerase. Adaptors of various shapes and functions are known in the art (see e.g., PCT / EP2019 / 05515 filed on February 28, 2019, US8822150 and US8455193, the disclosures of which are hereby incorporated by reference herein in their entireties). In some embodiments, the function of an adaptor is to introduce desired elements into a nucleic acid.

[0229] In some embodiments, adaptor-borne elements include at least one of nucleic acid barcode, multiplex identifier, a unique molecular identifier, primer binding site, or a ligation-enabling site. As used herein, the term "barcode" refers to a nucleic acid sequence that can be detected and identified. In some embodiments, the barcodes comprise between about 5 and about 20 nucleotides, such that in asample, the nucleic acids incorporating the barcodes can be distinguished or grouped according to the barcodes. In some embodiments, the barcodes comprise between about 5 and about 15 nucleotides. In some embodiments, the barcodes comprise between about 5 and about 10 nucleotides. In some embodiments, the barcodes comprise between about 10 and about 15 nucleotides. In some embodiments, the barcodes comprise about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 nucleotides.

[0230] In some embodiments, the barcode would have the Formula:

[0231] (W)(N)(N)(N)(N)(N)(W)(N)(N)(N)(N)(N)(W), or

[0232] (N)(W)(N)(N)(N)(W)(N)(N)(N),

[0233] where N includes (in the aggregate) about 25% adenosine; about 25% guanine; about 25% cytosine; and about 25% thymine; and W includes (in the aggregate) about 50% adenosine and about 50% thymine.

[0234] As used herein, the term "multiplex identifier" or "MID" refers to a barcode that identifies a source of a target nucleic acid (e.g., a sample from which the nucleic acid is derived). In some embodiments, all or substantially all the target nucleic acids from the same sample will share the same MID. In some embodiments, nucleic acids from different sources or samples can be mixed and sequenced simultaneously. In some embodiments, by using the MIDs the sequence reads (obtained during a sequencing step, such as described herein) can be assigned to individual samples from which the target nucleic acids originated.

[0235] As used herein, the term "unique molecular identifier" or "UID" refers to a barcode that identifies a nucleic acid to which it is attached. In some embodiments, all or substantially all the target nucleic acids from the same sample will have different UIDs. In some embodiments, all or substantially all the progeny (e.g., amplicons) derived from the same original target nucleic acid will share the same UID.

[0236] Examples of barcodes, MIDs, and UIDs are described in U.S. Publication No. 2020 / 0032244, and in U.S. Patent Nos. 7,393,665, 8,168,385, 8,481,292, 8,685,678, and 8,722,368, and in PCT Publication No. WO / 2018 / 138237, the disclosures of which are hereby incorporated by reference herein in their entireties.

[0237] Following the preparation of one or more amplified nucleic acid molecules (with or without the step of adapter ligation), the one or more amplified nucleic acid molecules are sequenced. In some embodiments, the sequencing comprises next-generation sequencing.

[0238] In some embodiments, the sequencing step involves sequence alignment. In some embodiments, aligning is used to determine a consensus sequence from a plurality of sequences, e.g., a plurality having the same unique molecular ID (UID). The molecular ID is a barcode that can be added to each molecule prior to sequencing or if an amplification step is included, prior to the amplification step. In some embodiments, a UID is present in the 5'-portion of the RT primer. Similarly, a UID can be present in the 5'-end of the last barcode subunit to be added to the compound barcode. In other embodiments, a UID is present in an adaptor and is added to one or both ends of the target nucleic acid by ligation.

[0239] In some embodiments, a consensus sequence is determined from a plurality of sequences all having an identical UID. The sequences having an identical UID are presumed to derive from the same original molecule through amplification. In other embodiments, UID is used to eliminate artifacts, i.e., variations existing in the progeny of a single molecule (characterized by a particular UID). Such artifacts resulting from PCR errors or sequencing errors can be eliminated using UIDs.

[0240] In some embodiments, the number of each sequence in the sample can be quantified by quantifying relative numbers of sequences with each UID among the population having the same MID. In some embodiments, each UID represents a single molecule in the original sample and counting different UIDs associated with each sequence variant can determine the fraction of each sequence variant in the original sample, where all molecules share the same MID. A person skilled in the art will be able to determine the number of sequence reads necessary to determine a consensus sequence. In some embodiments, the relevant number is reads per UID ("sequence depth") necessary for an accurate quantitative result. In some embodiments, the desired depth is 5 - 50 reads per UID.

[0241] KITS

[0242] In some embodiments, the present disclosure provides a kit including components for detecting epigenetic changes and / or performing amplification. Insome embodiments, the kit includes components for detecting cytosine methylation in nucleic acids by detecting 5-fC.

[0243] In some embodiments, a kit comprises (i) a copper salt; (ii) a chelator selected from one of a bipyridine or a phenanthroline; (iii) an adduct forming reagent; (iv) a polymerase; and (v) optionally one or more PCR reagents. In some embodiments, the copper salt and the chelator are included in a single container and mixed in a predetermined ratio. In some embodiments, the pre-determined ratio is about 1 :2.5 (chelator : copper). In some embodiments, the pre-determined ratio is about 1 :2.25 (chelator : copper). In some embodiments, the pre-determined ratio is about 1 :2 (chelator : copper). In some embodiments, the pre-determined ratio is about 1 : 1.75 (chelator : copper). In some embodiments, the pre-determined ratio is about 1 : 1.5 (chelator : copper). In some embodiments, the adduct forming reagent is malononitrile.

[0100] In some embodiments, the polymerase is selected from those described herein. One example of a polymerase is a Taq or Taq-derived polymerase (e.g., KAPA 2G polymerase from KAPA BIOSYSTEMS). Another example polymerase is a B-family DNA polymerase (e.g., KAPA HIFI polymerase from KAPA BIOSYSTEMS).

[0244] In some embodiments, the PCR reagents comprise nucleotides. In some embodiments, the PCR reagents include deoxynucleoside triphosphates (dNTPs), all the four naturally occurring deoxynucleoside triphosphates (dNTPs). In some embodiments, the PCR reagents include deoxyribonucleoside triphosphate molecules, including all dATP, dCTP, dGTP, dTTP. In some embodiments, the PCR reagents also include compounds useful in assisting the activity of the nucleic acid polymerase. For example, in some embodiments, the PCR reagent include a divalent cation, e.g., magnesium ions. In some embodiments, the magnesium ions are provided in the form of magnesium chloride, magnesium acetate, or magnesium sulfate. In some embodiments, the PCR reagents further include a buffer or buffer solution. In some embodiments, each of the PCR reagents are provided alone. In other embodiments, each of the PCR reagents are provided in admixture.

[0245] In some embodiments, the kit includes one or more adapter molecules and / or a ligase.

[0246] In some embodiments, the kit further includes one or more bases, buffers, and / or oxidants.

[0247] In some embodiments, a kit is provided that includes a chelator and a copper salt pre-mixed in a first container and an N-oxide reagent (e.g., TEMPO, ABNO, AZADO, and Me-AZADO) in a second container. In some embodiments, the kit further includes one or more buffers and / or bases.

[0248] In some embodiments, a kit is provided that includes a chelator and a copper salt pre-mixed in a first container and an adduct forming reagent (such as any of those of Formula (I) in a second container. In some embodiments, the kit further includes one or more buffers and / or bases.

[0249] EXAMPLES

[0250] Example 1 - General Procedure to Accelerate Mal-fC Formation idine Complex

[0251] A solution of the complex was prepared as follows:25 pL of about 100 mM CU(OAC)2 in water or about 100 mM Cu(ACN)4 triflate in acetonitrile was added to about 50 pL of about 100 mM 2,2'-bipyridine (Bpy) in acetonitrile followed with about 15 pL water and about 10 pL of about 100 mM aq NaOH (about 25 mM Cu / about 50 mM Bpy). It was vortexed for about 30 seconds. In an Eppendorf tube, about 4 pL of the complex was added to about 50 to about 2000 ng of fC oligo in about 39 pL of about 10 to about 20 mM of about 100 mM aq NaOH and vortexed for about 10 seconds. To the mixture was added about 7.5 pL of a about IM solution of malononitrile in acetonitrile, and the reaction was shaken at about 25°C for about 60 minutes. (2 mM Cu / 4 mM Bpy / 150 mM Malononitrile). The reaction was then purified using Zymo DNA clean filters according to the corresponding instructions.

[0252] Example 2 - Comparison of the Rate of Mal-fC Formation with and without Bipyridine Complex

[0253] Studies were conducted to compare the condition using Cu / 2,2'- bipyridine (Bpy) complex for malononitrile forming adduct on a fC oligo with other known conditions. In these experiments, 500 ng fC oligo (SEQ ID NO: 1 5'-Phos- CACGTCCAGATCAAT(fC)GACTATGAGCAGTACA) underwent reaction with 150 mM malononitrile for 1 hour at 25 C. These reactions contained 15-20% acetonitrile and had 50 pL total volume. The reactions were purified using Zymo DNA clean, and the obtained product was analyzed by LC-MS to compare the progress of the reaction. Mass of fC oligo is 9894 and mass of the reacted product is 9942. FIG. 1 (trace SO) shows the mass of the unreacted oligo. FIG. 1 (trace SI) shows the reaction in 10 mM tris pH 8. FIG. 1 (trace S2) shows the reaction in 10 mM NaOH. FIG. 1 (trace S3) shows the reaction in presence of about 2 mM Cu(OAc)2, about 4 mM Bpy and about 10 mM NaOH, FIG. 1 (trace S4) shows the reaction in presence of 2 mM Cu(OAc)2, about 4mM Bpy and about 10 mM tris pH about 8. As seen in FIG. 1, the reactions were only partially completed when no Cu / Bpy complex was used, but they were complete within 1 hour when the complex was used.

[0254] Example 3 - Effect of Different Additives on the Rate of Mal-fC Formation

[0255] Studies were conducted to determine the effect of different additives commonly used in Cu / TEMPO oxidation of hmC oligos to fC on the progress of malononitrile adduct formation on fC oligos. In these experiments, about 500 ng of a 30-mer ds-DNA double stranded DNA oligo, with one strand containing one fC nucleotide (SEQ ID NO: 2 GTACTGCTCATAGT(fC)GATTGATCTGGACGTGA) and the complementary strand (SEQ ID NO: 3 5’-Phos- TCACGTCCAGATCAATCGACTATGAGCAGTAC) were subjected to treatment with about 150 mM malononitrile in presence of a Cu(II) salt, 2,2'-bipyridine (Bpy) , Cu(II) / Bpy complex, or Cu(II) / Bpy / TEMPO for about 1 hour at about 25°C. The reactions contained 20 mM aq NaOH, 15-20% acetonitrile, and had a total volume of 50 pL. The reactions were purified using Zymo DNA clean, and the obtained product was analyzed by LC-MS to compare the progress of the reaction. Molecularweights of starting fC oligo, complementary oligo, and Mal-fC oligo were 9978, 9866, and 10026 Da, respectively.

[0256] FIG. 2 (trace SI) shows the reaction with about 2mM Cu(C104)2. FIG. 2 (trace S2) shows the reaction with about 3 mM Bpy. FIG. 2 (trace S3) shows the reaction with about 2 mM Cu(C104)2 and about 3 mM Bpy. FIG. 2 (trace S4) shows the reaction with about 2 mM Cu(C104)2 and about 3 mM Bpy, 2 mM TEMPO. As seen in FIG. 2, only the conditions that at least had both Cu(II) salt and Bpy went to completion in about 1 hour, indicating that the Cu / Bpy complex was more effective in catalyzing the malononitrile adduct formation than individual components.

[0257] Example 4 - Effect of the Concentration of Cu / 2,2,-Bipyridine Complex on the Rate of Mal-fC Formation

[0258] Studies were conducted to determine the effect of the concentration of Cu(I or II) / 2,2'-bipyridine (Bpy) complex on the progress of malononitrile adduct formation on fC oligos and to choose an optimal concentration. In these experiments, 350 ng of a 30-mer ds-DNA double stranded DNA oligo, with one strand containing one fC nucleotide (SEQ ID NO: 2GTACTGCTCATAGT(fC)GATTGATCTGGACGTGA) and the complementary strand (SEQ ID NO: 3 5’-Phos-TCACGTCCAGATCAATCGACTATGAGCAGTAC) were subjected to treatment with about 150 mM malononitrile in presence of about 2 to about 5 mM Cu(ACN)4 triflate and about 1.25 eq of Bpy at about 25°C. The reactions contained about 10 mM aq NaOH, about 15 to about 20% acetonitrile, and had a total volume of about 50 pL. The reaction time decreased as the concentration of the copper complex increased. The reactions were purified using Zymo DNA clean, and the obtained product was analyzed by LC-MS to compare the progress of the reaction. The molecular weights of starting fC oligo, complementary oligo, and Mal-fC oligo were 9978, 9866, and 10026 Da, respectively.

[0259] FIG. 3 (trace SI) shows the adduct formation completed within 45 minutes with 2mM Cu(ACN)4 triflate and 2.5 mM Bpy. FIG. 3 (trace S2) shows the reaction completed within 30 minutes with 3 mM Cu(ACN)4 triflate and 3.75 mM Bpy. FIG. 3 (trace S3) shows the reaction completed within 22 minutes with 4mMCU(ACN)4 triflate and 5 mM Bpy. FIG. 3 (trace S4) shows the reaction completed within about 15 minutes with 6mM Cu(ACN)4 triflate and about 7.5 mM Bpy. As seen in FIG. 3, the time needed for the competition of the adduct formation is inversely correlated with the concentration of copper / Bpy complex. On the other hand, the rate of the adduct formation is proportional to the concentration of copper complex. Higher concentrations of copper however reduced the recovery of the DNA oligos due to some precipitate formation during the reaction. It was decided that about 2 mM copper was enough to allow the adduct formation to be completed within about 1 hour without causing a significant loss of DNA oligo during the reaction.

[0260] Example 5 - Effect of the Concentration of Malononitrile on the Rate of Mal-fC Formation

[0261] Studies were conducted to determine the effect of the concentration of malononitrile on the progress of malononitrile adduct formation on fC oligos. In these experiments, 350 ng of a 30-mer double stranded DNA oligo, with one strand containing one fC nucleotide (SEQ ID NO:2 GTACTGCTCATAGT(fC)GATTGATCTGGACGTGA) and the complementary strand (SEQ ID NO:3 5'-Phos-TCACGTCCAGATCAATCGACTATGAGCAGTAC) were subjected to treatment with 75-150 mM malononitrile in presence of about 2 to about 4 mM Cu(ACN)4 triflate / 1.25 eq of Bpy at about 25°C. The reactions contained about 10 mM aq NaOH, about 15 to about 20% acetonitrile, and had a total volume of about 50 pL. In one experiment, the ds-DNA oligo was treated with the usual about 150 mM of malononitrile with about 2 mM Cu(I) as shown in FIG. 4 (trace SI). In the other experiment, the oligo was treated with half the amount of malononitrile (about 75 mM) but in presence of twice as much concentration (about 4 mM) of Cu(I) as shown in FIG. 4 (trace S2). Both reactions took about 45 minutes to complete. Molecular weights of starting fC oligo, complementary oligo, and Mal-fC oligo were 9978, 9866, and 10026 Da, respectively.

[0262] As seen in FIG. 4 and based on the result from experiment 4, the time needed for the competition of the adduct formation increased about twice when themalononitrile concentration decreased to half. The rate of the malononitrile adduct formation is proportional to the concentration of malononitrile.

[0263] Example 6 - Conversion Rate of Oligonucleotide Containing 1 fC Base Treated with Standard 150 mM malononitrile in TRIS versus Cu / 2,2’- Bipyridine complex Added 100 mM Malononitrile Studied by sequencing

[0264] Sequencing studies were conducted to compare malononitrile adduct formation on oligo containing 1 fC base treated with standard procedure in tris buffer vs the current procedure catalyzed by Cu(I or II) / 2,2'-bipyridine (Bpy) complex. About 50 ng of adapter ligated 5-fC modified oligo (SEQ ID NO: 1 5'-Phos- CACGTCCAGATCAAT(fC)GACTATGAGCAGTACA) was treated with either about 150 mM malononitrile in about 10 mM tris, pH about 8.0 at about 37°C, for about 20 hours or in the accelerated condition: lOmM NaOH, about 2 mM Cu(C104)2 and about 4 mM Bpy, about 100 mM malononitrile, about 15% acetonitrile at room temperature for about 70 mins. The products were purified, and PCR amplified with KAPA 2G for either about 30s or about 2 min extension. The samples were subsequently sequenced. The results as shown in FIG. 5 demonstrates the conversion rates for the accelerated condition were comparable to the standard overnight condition.

[0265] Example 7 - Tandem Oxidation of a 5hmC-Containing Oligonucleotide to an fC Oligonucleotide Followed with Malononitrile Adduct Formation

[0266] This example describes a general procedure for performing a tandem oxidation / Malononitrile adduct formation on hmC oligos using copper / 2,2'- bipyridine (Bpy) complex. A solution of the complex was prepared as follows:25 pL 100 mM Cu(C104)2 in water was added to about 50 pL of about 100 mM Bpy in acetonitrile followed by about 25 pL water (about 25 mM Cu / about 50 mM Bpy). This was vortexed for about 30 seconds. In an Eppendorf tube, about 4 pL of the complex was diluted with about 34 pL of water and mixed with about 2 pL of about 10 mM ABNO in acetonitrile. To the solution was added about 5 pL of about 100 mM NaOH followed with about 0.1 to about 2 pg of hmC DNA oligo in about 1 pL water (or about 10 mM sodium hydroxide, or about 10 mM tris buffer about pH 8). Overall, the reaction was supposed to be about 45 pL. If the oligo was dilute andmore than about 1 pL is used, the volume of the water used to dilute the complex should be reduced accordingly. The reaction was vortexed for about 5 seconds and then incubated at about 25°C without shaking for about 50 to about 60 minutes. The reaction was then immediately treated with about 7.5 pL of about 1 M malononitrile in acetonitrile. This was shaken at about 25°C for about 60 minutes and then purified using Zymo DNA clean filters according to the corresponding instructions.

[0267] Example 8

[0268] About 1 pg 5-hmC oligo (SEQ ID NO: 4 5'-Phos- CACGTCCAGATCAAT(hmC)GACTATGAGCAGTACA) was treated with about 2.2 mM Cu(C104)2, about 4.4 mM Bpy, about 2.2 mM proline, about 0.44mM ABNO, and about 10 mM NaOH for about 1 hour followed with reaction with about 150 mM Malononitrile for about 60 min. The reaction was purified using Zymo DNA clean filters. The LC-MS result is shown in FIG. 6.

[0269] All the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and / or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications, and publications to provide yet further embodiments.

[0270] Although the present disclosure has been described with reference to a number of illustrative embodiments, it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this disclosure. More particularly, reasonable variations and modifications are possible in the component parts and / or arrangements of the subject combination arrangement within the scope of the foregoing disclosure, the drawings, and the appended claims without departing from the spirit of the disclosure. In addition to variations and modifications in the component parts and / or arrangements, alternative uses will also be apparent to those skilled in the art.

Claims

PATENT CLAIMS1. A composition comprising one or more nucleic acid molecules each having: (a) one or more 5 -hydroxymethyl cytosine bases, (b) a copper salt, (c) a chelator selected from the group consisting of a bipyridine or a phenanthroline, and (d) an N-oxide reagent, wherein the composition has a pH ranging from about 7 to about 12, wherein the N-oxide reagent is selected from the group consisting of ABNO, AZADO, and Me-AZADO.

2. The composition of claim 1, wherein the copper salt is complexed with the chelator.

3. The composition of claim 1, wherein a ratio of the copper salt to the chelator within the composition ranges from between about 1 :3 to about 1 : 1.

4. The composition of claim 1, wherein a ratio of the copper salt to the chelator within the composition is about 1 :2.5.

5. The composition of claim 1, wherein a ratio of the copper salt to the chelator within the composition is about 1 :2.2.

6. The composition of claim 1, wherein a ratio of the copper salt to the chelator within the composition is about 1 :2.

7. The composition of claim 1, wherein the chelator is a 2,2'-bipyridine or a derivative thereof.

8. The composition of claim 1, wherein the bipyridine is selected from the group consisting of 4,4'-dimethyl-2,2'-bipyridine, 5,5'-dimethyl-2,2'-bipyridine, 4,4'-diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'-dimethoxy-2,2'- bipyridine, and 5,5'-dimethoxy-2,2'-bipyridine.

9. The composition of claim 1, wherein the copper salt is selected from the group consisting of Cu(C104)2, CuSCh, Cu(ACN)4 tritiate, and Cu(OAc)2.

10. The composition of claim 1, wherein the N-oxide reagent is AZADO.

11. The composition of claim 1, wherein the N-oxide reagent is Me-AZADO.

12. The composition of claim 1, wherein the N-oxide reagent comprises ABNO.

13. The composition of claim 1, wherein a ratio of the copper salt to the N-oxide within the composition ranges from about 1 :0.5 to about 1 :0.1.

14. The composition of claim 1, wherein a ratio of the copper salt to the N-oxide within the composition is about 1 :to about 0.2.

15. The composition of claim 1, further comprising a solvent.

16. The composition of claim 15, wherein the solvent is acetonitrile.

17. The composition of claim 1, wherein the composition comprises a base selected from the group consisting of NaOH, KOH, and LiOH.

18. The composition of claim 1, wherein the composition comprises TRIS, TAPSO, TEA, EPPS, Tricine, Gly-Gly, Bicine, TABS, AMPSO, CHES, CAPSO, AMP, CAPS.

19. The composition of claim 1, wherein the one or more nucleic acid molecules are single stranded.

20. The composition of claim 1, wherein the one or more nucleic acid molecules are double stranded.

21. The composition of claim 1, wherein the pH of the composition ranges from between about 8 to about 12.

22. A composition comprising one or more nucleic acid molecules each having: (a) one or more 5-formyl cytosine bases, (b) a copper salt, (c) a chelator selected from one of a bipyridine or a phenanthroline, and (d) a compound having Formula (I):whereR is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl monosubstituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl; and wherein the composition has a pH ranging from about 7 to about 12.

23. The composition of claim 22, wherein R is cyano, nitro, Ci-Ce alkyl, carboxylic ester.

24. The composition of claim 22, wherein R is cyano or Ci-Ce alkyl.

25. The composition of claim 22, wherein the compound of Formula (I) is malononitrile.

26. The composition of claim 22, wherein the chelator is a phenanthroline.

27. The composition of claim 22, wherein the chelator is a bipyridine.

28. The composition of claim 22, wherein the copper salt is complexed with the chelator.

29. The composition of claim 22, wherein a ratio of the copper salt to the chelator within the composition ranges from between about 1 :3 to about 1 : 1.75.

30. The composition of claim 22, wherein a ratio of the copper salt to the chelator within the composition is about 1 :2.75.

31. The composition of claim 22, wherein a ratio of the copper salt to the chelator within the composition is about 1 :2.5.

32. The composition of claim 22, wherein a ratio of the copper salt to the chelator within the composition is about 1 :2.25.

33. The composition of claim 22, wherein the chelator is a 2,2'-bipyridine or a derivative thereof.

34. The composition of claim 22, wherein the derivative of 2,2' -bipyridine is selected from the group consisting of 4,4'-dimethyl-2,2'-bipyridine, 5,5'- dimethyl-2,2'-bipyridine 4,4'-diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'- bipyridine, 4,4'-dimethoxy-2,2'-bipyridine, and 5,5'-dimethoxy-2,2'- bipyridine.

35. The composition of claim 22, wherein the copper salt is selected from the group consisting of Cu(C104)2, CuSCh, Cu(ACN)4 tritiate, and Cu(OAc)2.

36. The composition of claim 22, wherein the copper salt is (Cu(C104)2 and the chelator is a 2,2'-bipyridine.

37. The composition of claim 22, wherein the one or more nucleic acid molecules are single stranded.

38. The composition of claim 22, wherein the one or more nucleic acid molecules are double stranded.

39. The composition of claim 22, wherein the pH ranges from between about 8 to about 12.

40. The composition of claim 22, wherein the composition further comprises an N-oxide reagent.

41. A method for preparing one or more nucleic acid molecules each having one or more 5-formyl cytosine bases, comprising: (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5-hydroxymethyl cytosine bases; and (b) contacting the obtained sample with a first composition comprising a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide reagent, wherein the N- oxide reagent is selected from the group consisting of ABNO, AZADO, and Me-AZADO.

42. The method of claim 41, wherein the first composition further comprises at least one of a base or buffer.

43. The method of claim 41, wherein the reaction occurs at a pH ranging from between about 7 to about 12.5.

44. The method of claim 41, wherein the reaction occurs at a pH ranging from between about 8 to about 12.

45. The method of claim 41, wherein the reaction occurs at a temperature ranging from between about 20°C to about 35°C.

46. The method of claim 45, wherein the temperature ranges from between about 20°C to about 30°C.

47. The method of claim 45, wherein the temperature ranges from between about 25°C to about 30°C.

48. The method of claim 41, wherein the reaction occurs for a time period ranging from between about 30 minutes to about 90 minutes.

49. The method of claim 48, wherein the time period is about 60 minutes.

50. The method of claim 41, wherein a ratio of the copper salt to the chelator within the first composition is about 1 :2.75.

51. The method of claim 41, wherein a ratio of the copper salt to the chelator within the first composition is about 1 :2.5.

52. The method of claim 41, wherein a ratio of the copper salt to the chelator within the first composition is about 1 :2.25.

53. The method of claim 41, wherein the chelator is a 2,2'-bipyridine or a derivative thereof.

54. The method of claim 41, wherein the bipyridine is selected from the group consisting of 4,4'-dimethyl-2,2'-bipyridine, 5,5'-dimethyl-2,2'-bipyridine, 4,4'-diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'-dimethoxy-2,2'- bipyridine, 5,5'-dimethoxy-2,2'-bipyridine.

55. The method of claim 41, wherein the copper salt is selected from the group consisting of Cu(C104)2, CuSCN, Cu(ACN)4 tritiate, and Cu(OAc)2.

56. The method of claim 41, wherein the N-oxide is ABNO.

57. The method of claim 41, wherein the copper salt is Cu(ACN)4 tritiate or CU(OAC)2; the chelator is a 2,2'-bipyridine; and the N-oxide is ABNO.

58. The method of claim 41, wherein the method further comprises monitoring the reaction by liquid chromatography and / or mass spectroscopy.

59. The method of claim 41, further comprising performing at least one additional downstream reaction following the reaction between the obtained sample and the first composition.

60. The method of claim 59, wherein the at least one additional downstream reaction comprises converting the 5-formyl cytosine bases in the one or more nucleic acid molecules to an adduct of 5-formyl cytosine, thereby producing one or more nucleic acid molecules having one or more adducts of 5-formyl cytosine.

61. The method of claim 60, wherein the adduct of 5-formyl cytosine is a malononitrile adduct of 5-formyl cytosine.

62. The method of claim 60, further comprising contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with a polymerase to provide one or more amplified nucleic acid molecules, wherein the one or more amplified nucleic acid molecules have a thymine base at a position corresponding to the position of the adduct of 5-formyl cytosine in each of the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine.

63. The method of claim 62, further comprising sequencing the one or more amplified nucleic acid molecules.

64. The method of claim 63, wherein the sequencing comprises next-generation sequencing.

65. A method for preparing one or more nucleic acid molecules each having one or more adducts of 5-formyl cytosine, comprising: (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5- formyl cytosine bases; and (b) reacting the obtained sample with acomposition comprising a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and a compound having Formula (I):(i), whereR is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl monosubstituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl.

66. The method of claim 65, wherein R is cyano or Ci-Ce alkyl.

67. The method of claim 65, wherein the compound of Formula (I) is malononitrile.

68. The method of claim 65, wherein the reaction occurs at a pH ranging from between about 7 to about 12.5.

69. The method of claim 65, wherein the reaction occurs at a pH ranging from between about 8 to about 12.

70. The method of claim 65, wherein the reaction occurs at a temperature ranging from between about 20°C to about 35°C.

71. The method of claim 70, wherein the temperature ranges from between about 20°C to about 30°C.

72. The method of claim 70, wherein the temperature ranges from between about 25°C to about 30°C.

73. The method of claim 65, wherein the reaction occurs for a time period ranging from between about 30 minutes to about 90 minutes.

74. The method of claim 73, wherein the time period is about 60 minutes.

75. The method of claim 65, wherein the chelator is a phenanthroline.

76. The method of claim 65, wherein the chelator is a bipyridine.

77. The method of claim 65, wherein a ratio of the copper salt to the chelator within the first composition is about 1 :2.75.

78. The method of claim 65, wherein a ratio of the copper salt to the chelator within the first composition is about 1 :2.5.

79. The method of claim 65, wherein a ratio of the copper salt to the chelator within the first composition is about 1 :2.25.

80. The method of claim 65, wherein the chelator is a 2,2'-bipyridine or a derivative thereof.

81. The method of claim 65, wherein the bipyridine is selected from the group consisting of 4,4'-dimethyl-2,2'-bipyridine, 5,5'-dimethyl-2,2'-bipyridine, 4,4'-diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'-dimethoxy-2,2'- bipyridine, and 5,5'-dimethoxy-2,2'-bipyridine.

82. The method of claim 65, wherein the copper salt is selected from the group consisting of Cu(C104)2, CuSCh, Cu(ACN)4 tritiate, and Cu(OAc)2.

83. The method of claim 65, wherein the method further comprises monitoring the reaction by liquid chromatography and / or mass spectroscopy.

84. The method of claim 65, further comprising contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with a polymerase to provide one or more amplified nucleic acid molecules, wherein the one or more amplified nucleic acid molecules have a thymine base at a position corresponding to the position of the adduct of 5-formyl cytosine in each of the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine.

85. The method of claim 84, further comprising sequencing the one or more amplified nucleic acid molecules.

86. The method of claim 85, wherein the sequencing comprises next-generation sequencing.

87. The method of claim 65, wherein the obtained sample is prepared by: (i) obtaining a solution comprising one or more nucleic acid molecules each having one or more 5 -hydroxymethyl cytosine bases; and (ii) oxidizing the 5 -hydroxymethyl cytosine bases of the one or more nucleic acid molecules in the solution to provide the sample comprising the one or more nucleic acid molecules each having one or more 5-formyl cytosine bases.

88. The method of claim 87, wherein the oxidizing comprises exposing the solution to a formulation comprising a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide.

89. A method for synthesizing one or more nucleic acid molecules each comprising one or more adducts of 5 -formyl cytosine, the method comprising: (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5 -hydroxymethyl cytosine bases; (b) contacting the obtained sample with a first composition at a first temperature and for a first time period to provide a mixture comprising one or more nucleic acid molecules each having one or more 5-formyl cytosine bases, wherein the first composition comprises a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N-oxide reagent; and (c) contacting the resulting mixture with a second composition at a second temperature for a second time period, wherein the second composition comprises a compound having Formula (I):whereR is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl monosubstituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl, thereby providing the one or more nucleic acid molecules each comprising the one or more adducts of 5-formyl cytosine.

90. The method of claim 89, wherein the resulting mixture is contacted with the second composition without first purifying the resulting mixture.

91. The method of claim 89, wherein the obtained sample is contacted with the first composition at a pH ranging from between about 8 and about 12.

92. The method of claim 89, wherein the obtained sample is contacted with the second composition at a pH ranging from between about 8 and about 12.

93. The method of claim 89, wherein the first temperature ranges from between about 20°C to about 35°C.

94. The method of claim 89, wherein the second temperature ranges from between about 20°C to about 35°C.

95. The method of claim 89, wherein the first and second temperatures are about the same.

96. The method of claim 89, wherein the first duration is between about 30 minutes and about 90 minutes; and wherein the second duration is between about 30 minutes and about 90 minutes.

97. The method of claim 89, wherein the copper salt is Cu(ACN)4 tritiate or CU(OAC)2; and the chelator is a 2,2'-bipyridine.

98. The method of claim 97, wherein a ratio of an amount of the Cu(ACN)4 tritiate or the Cu(OAc)2 to an amount of the 2,2'-bipyridine present in the first composition ranges from between about 1 : 1 to about 1 :3.

99. The method of claim 89, wherein the compound having Formula (I) is malononitrile.

100. The method of claim 89, wherein the bipyridine is selected from the group consisting of 4,4'-dimethyl-2,2'-bipyridine, 5,5'-dimethyl-2,2'- bipyridine, 4,4'-diethyl-2,2'-bipyridine, 5,5'-diethyl-2,2'-bipyridine, 4,4'- dimethoxy-2,2'-bipyridine, and 5,5'-dimethoxy-2,2'-bipyridine.

101. The method of claim 89, wherein the one or more nucleic acid molecules in the obtained sample are single stranded nucleic acid molecules.

102. The method of claim 89, wherein the one or more nucleic acid molecules in the obtained sample are double stranded nucleic acid molecules.

103. The method of claim 89, wherein the one or more nucleic acid molecules in the obtained sample are ligated to one or more adapters.

104. The method of claim 89, wherein the one or more nucleic acid molecules in the obtained sample include one or more barcodes.

105. The method of claim 104, wherein the one or more barcodes are unique molecular identifiers.

106. The method of claim 89, wherein the obtained sample is prepared by: (i) obtaining a solution comprising one or more nucleic acid molecules each having one or more 5-methyl cytosine bases; and (ii) oxidizing the 5-methylcytosine bases of the one or more nucleic acid molecules in the solution to provide the sample comprising the one or more nucleic acid molecules each having one or more 5 -hydroxymethyl cytosine bases.

107. The method of claim 89, further comprising contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with a polymerase to provide one or more amplified nucleic acid molecules, wherein the one or more amplified nucleic acid molecules have a thymine base at a position corresponding to the position of the adduct of 5- formyl cytosine in each of the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine.

108. The method of claim 107, wherein the adduct of 5-formyl cytosine is a malononitrile adduct of 5-formyl cytosine.

109. The method of claim 107, further comprising ligating one or more adapters to the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine prior to contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with the polymerase.

110. The method of claim 107, wherein the polymerase is a DNA polymerase.

111. The method of claim 110, wherein the DNA polymerase is an uracil- tolerant polymerase.

112. The method of claim 107, further comprising sequencing the one or more amplified nucleic acid molecules.

113. The method of claim 112, wherein the sequencing comprises nextgeneration sequencing.

114. The method of claim 89, wherein the obtained sample is obtained from a tumor.

115. The method of claim 89, wherein the obtained sample is obtained from a specimen suspected of having a tumor.

116. A kit comprising: (i) a first container including a copper salt and a chelator selected from one of a bipyridine or a phenanthroline; and (ii) a second container including a polymerase.

117. The kit of claim 116, further comprising a third container including an adduct forming reagent having Formula (I):(i), whereR is an electron- withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl mono-substituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl.

118. The kit of claim 116, wherein a ratio of an amount of chelator to an amount of copper salt in the first container ranges from about 2: 1.

119. The kit of claim 1, wherein the polymerase is a thermostable polymerase.

120. The kit of claim 116, further comprising at least one of a buffer or a strong base.

121. A method for detecting one or more epigenetic changes in a target nucleic acid molecule, comprising: (a) obtaining a sample comprising one or more nucleic acid molecules each having one or more 5 -hydroxymethyl cytosine bases; (b) contacting the obtained sample with a first composition at a first temperature and for a first time period reagent to provide a mixture comprising one or more nucleic acid molecules each having one or more 5- formyl cytosine bases, wherein the first composition comprises a copper salt, a chelator selected from one of a bipyridine or a phenanthroline, and an N- oxide; (c) contacting the resulting mixture with a second composition at a second temperature for a second time period, wherein the second composition comprises a compound having Formula (I):(i),whereR is an electron-withdrawing group selected from cyano, nitro, Ci-Ce alkyl, carboxylic ester, unsubstituted carboxamide, Ci-Ce alkyl monosubstituted carboxamide, Ci-Ce alkyl disubstituted carboxamide, a substituted carbonyl moiety, and a substituted sulfonyl moiety, wherein the substitution is selected from a Ci-Ce linear or branched alkyl group, a C4-C6 cycloalkyl group, phenyl, 5- or 6-membered heteroaryl, and benzannulated 5- or 6-membered heteroaryl, thereby providing the one or more nucleic acid molecules each comprising the one or more adducts of 5 -formyl cytosine; (d) contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with a polymerase to provide one or more amplified nucleic acid molecules, wherein the one or more amplified nucleic acid molecules have a thymine base at a position corresponding to the position of the adduct of 5-formyl cytosine in each of the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine; and (e) sequencing the one or more amplified nucleic acid molecules.

122. The method of claim 121, wherein the adduct of 5-formyl cytosine is a malononitrile adduct of 5-formyl cytosine.

123. The method of claim 121, further comprising ligating one or more adapters to the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine prior to contacting the one or more nucleic acid molecules having the one or more adducts of 5-formyl cytosine with the polymerase.

124. The method of claim 121, wherein the polymerase is a DNA polymerase.

125. The method of claim 121, wherein the DNA polymerase is an uracil- tolerant polymerase.

126. The method of claim 121, wherein the sequencing comprises nextgeneration sequencing.