Selective multiplexed electrochemical platform for detection of HIV infection

EP4731795A2Pending Publication Date: 2026-04-29UNIV OF MARYLAND +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
UNIV OF MARYLAND
Filing Date
2024-06-26
Publication Date
2026-04-29

AI Technical Summary

Technical Problem

Current HIV diagnostic tests face challenges in accurately distinguishing between true HIV infection and vaccine-induced sero-reactivity (VISR/VISP), particularly due to the complexity and randomness of immune responses, which can lead to false positive results, and require expensive and labor-intensive nucleic acid tests like RT-PCR.

Method used

A multiplexed electrochemical platform that uses detecting agents specific for biomarkers such as p24 antigen, anti-p24 antibody, HIV-1 RNA, and MS2 RNA, with sensors that employ cyclic voltammetry to detect these markers in a sample, allowing for rapid and accurate diagnosis of HIV infection.

Benefits of technology

The platform provides high accuracy and sensitivity in differentiating active HIV infection from vaccine-induced seropositivity, offering a rapid, cost-effective, and user-friendly point-of-care solution suitable for resource-limited settings, with the ability to detect HIV infection across various stages of the disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000098_0000
    Figure 00000098_0000
  • Figure 00000099_0000
    Figure 00000099_0000
  • Figure 00000099_0001
    Figure 00000099_0001
Patent Text Reader

Abstract

The present application provides a multiplex detecting platform for diagnosing HIV infection in a subject, as well as methods for diagnosing HIV infection with the multiplex detecting platform described herein.
Need to check novelty before this filing date? Find Prior Art

Description

SELECTIVE MULTIPLEXED ELECTROCHEMICAL PLATFORM FOR DETECTION OF HIV INFECTIONCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 510,202, filed on June 26, 2023, which is hereby incorporated by reference in its entirety.BACKGROUND

[0002] An infection with HIV (human immunodeficiency virus) can lead to AIDS (acquired immunodeficiency syndrome), a condition in which advanced failure of the immune system permits life-threatening infections and cancers to thrive. Global statistics show that there were >37 million people across the globe with HIV in 2020 and out of these >35 million were adults and 1.7 million were children (<15 years old). Approximately 1.2 million people in the U.S. have HIV and 13% of them are unaware of their condition, which can be avoided by testing. Significant progress has been made to develop effective prophylactic HIV vaccines. However, recent clinical trials have shown that some HIV vaccines can elicit long -lasting (>15 years) serological immune responses. These immune responses, known as vaccine-induced sero-reactivity or sero-positivity (VISR / VISP), unfortunately can be confused with HIV infection in common diagnostic tests. False positive results due to VISR / VISP can severely impact several aspects of life for clinical trial participants. Interestingly, VISR / VISP seems to be more widespread with vaccines that involve the incorporation of a complete or partial segment of the gp41 region of the HIV envelope. However, a positive case of VISP induced false positive results can be discriminated from a true HIV infection by nucleic acid tests (NAT) (e.g., RT-PCR). However, RT-PCR based tests are expensive, only available at major hospitals or diagnostic centers and must be run by skilled personnel. Although VISR / VISP may be viewed as a straightforward task that can easily be addressed with currently available technologies, the random nature of this phenomenon, its potentially long duration, and the complexity of social interactions associated with HIV testing make this a significant challenge for trial participants, researchers, and physicians.SUMMARY

[0003] Accordingly, there is an urgent clinical need for diagnostic HIV tests with high accuracy, sensitivity and specificity, which must be in place to avoid the problems associated with VISR / VISP in HIV vaccine recipients.

[0004] In accordance with some embodiments, the present disclosure provides herein a detector for diagnosing human immunodeficiency virus (HIV) infection status in a subject, the detector comprising: a. a plurality of detecting agents, wherein each respective detecting agent in the plurality of detecting agents is specific for a corresponding biomarker in a sample of the subject in a plurality of biomarkers comprising p24, anti-P24 antibody, HIV-1 RNA and MS2 RNA; b. a respective sensor, in a plurality of sensors, for each corresponding biomarker in the plurality of biomarkers; wherein each respective sensor in the plurality of sensors is in contact with the respective detecting agent in the plurality of detecting agents; and c. one or more reaction vessels that contain the plurality of detecting agents.

[0005] In some embodiments, the detection by the plurality of detecting agents of at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample indicates HIV infection in the subject.

[0006] In some embodiments, MS2 RNA is used as a control, wherein HIV infection is indicated only when MS2 RNA and at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA are detected by the plurality of detecting agents in the sample.

[0007] In some embodiments, the detection of less than two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample by the plurality of detecting agents indicates no HIV infection.

[0008] In some embodiments, the sample is selected from the group consisting of a plasma sample, a serum sample, and a whole blood sample.

[0009] In some embodiments, the detector further comprises a sample collection unit, wherein the sample collection unit is configured to collect the sample from the subject and dispense the collected sample into the one or more reaction vessels.

[0010] In some embodiments, the sample collection unit comprises a finger prick unit.

[0011] In some embodiments, the sample is diluted before being received into the one or more reaction vessels.

[0012] In some embodiments, the sample is diluted after being received into the one or more reaction vessels.

[0013] In some embodiments, the respective sensor comprises an electrode comprising one or more materials selected from the group consisting of gold, conductive carbon, platinum, palladium, stainless steel, tin, tungsten, titanium, or any combination thereof.

[0014] In some embodiments, the respective detecting agent for the corresponding biomarker is conjugated to the respective sensor.

[0015] In some embodiments, the respective sensor detects the presence or absence of the corresponding biomarker by using cyclic voltammetry (CV) scan; wherein the concentration of the corresponding biomarker is measured as a function of change in CV current peak.

[0016] In some embodiments, each sensor in the plurality of sensors is an electrochemical sensor strip.

[0017] In some embodiments, the detector further comprises an embedded sensor chip and wherein each sensor in the plurality of sensors is in the embedded sensor chip.

[0018] In some embodiments, the embedded sensor chip analyzes CV scan data for each corresponding biomarker in the plurality of biomarkers collected from the respective sensor in the plurality of sensors, wherein the CV scan data comprises a set of CV currents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

[0019] In some embodiments, the respective sensor for p24 has a limit of detection (LOD) of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml.

[0020] In some embodiments, the respective sensor for p24 has a linear detection range of 0 to l * 105pg / ml.

[0021] In some embodiments, the respective sensor for anti-p24 antibody has an LOD of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml.

[0022] In some embodiments, the respective sensor for anti-p24 antibody has a linear detection range of 0 to 1 x 105pg / ml.

[0023] In some embodiments, the respective sensor for HIV-1 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml.

[0024] In some embodiments, the respective sensor for HIV-1 RNA has a linear detection range of 0 to 1 x 107copies / ml.

[0025] In some embodiments, the respective sensor for MS2 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml.

[0026] In some embodiments, the respective sensor for MS2 RNA has a linear detection range of 0 to 1 x 107copies / ml.

[0027] In some embodiments, the detector further comprises a potentiostat reader, wherein the potentiostat reader is configured to communicate with each respective sensor in the plurality of sensors to collect CV scan data for the corresponding biomarker in the plurality of biomarkers, wherein the CV scan data comprises a set of CV currents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

[0028] In some embodiments, the one or more reaction vessels consist of a single reaction vessel that contains the plurality of detecting agents.

[0029] In some embodiments, the one or more reactive vessels comprise a plurality of reaction vessels, wherein each reaction vessel in the plurality of reaction vessels contains a subset of the plurality of detecting agents.

[0030] In some embodiments, the one or more reaction vessels consists of two reaction vessels, wherein the detecting agents in the first reaction vessel are specific for protein biomarkers in the plurality of biomarkers and the detecting agents in the second reaction vessel are specific for RNA biomarkers in the plurality of biomarkers.

[0031] In some embodiments, the detecting agents in the first reaction vessel are specific for p24 and anti-p24 antibody and the detecting agents in the second reaction vessel are specific for HIV-1 RNA and MS2 RNA.

[0032] In some embodiments, the first reaction vessel comprises a suspension buffer.

[0033] In some embodiments, the suspension buffer comprises about 0.5% triton X-100.

[0034] In some embodiments, the second reaction vessel comprises an RNA lysis buffer.

[0035] In some embodiments, the RNA lysis buffer is selected from the group consisting of a buffer comprising about 1 mg / ml proteinase K, about 0.5 % sodium dodecyl sulfate, and about 10 mM dithiothreitol; a radioimmunoprecipitation assay (RIP A) lysis buffer; and a buffer comprising guanidine isothiocyanate.

[0036] In some embodiments, the subject is diagnosed by the detector within about 0.1 hours, about 0.5 hours, or about 1 hour, after the detector receives the sample.

[0037] In some embodiments, when the sample was obtained from the subject during eclipse period since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0038] In some embodiments, when the sample was obtained from the subject during acute HIV infection period since the initiation of the HIV infection, at least p24 and HIV- 1 RNA are detected by the detector in the sample.

[0039] In some embodiments, when the sample was obtained from the subject during early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0040] In some embodiments, when the sample was obtained from the subject after early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0041] In some embodiments, when the sample was obtained from the subject between about Day 0 and about Day 28, or between about Day 10 and about Day 28, since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0042] In some embodiments, when the sample was obtained from the subject between about Day 28 and about Day 70, or after about Day 70, since the initiation of the HIVinfection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0043] In some embodiments, the detecting agent for p24 is an extraneous anti-p24 antibody or a variant thereof.

[0044] In some embodiments, the detecting agent for p24 is an extraneous anti-p24 IgG antibody or a variant thereof.

[0045] In some embodiments, the detecting agent for p24 is conjugated to the respective sensor.

[0046] In some embodiments, the conjugating comprises incubating the sensor with about 5 pg / ml of the detecting agent for p24.

[0047] In some embodiments, the detecting agent for anti-p24 antibody is extraneous p24 or a variant thereof.

[0048] In some embodiments, the detecting agent for anti-p24 antibody is conjugated to the respective sensor.

[0049] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent for anti-p24 antibody.

[0050] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises one or two nucleic acid probes.

[0051] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA is conjugated to the respective sensor.

[0052] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent(s) for HIV-1 RNA.

[0053] In some embodiments, the conjugating the conjugating is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for HIV-1 RNA.

[0054] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for HIV-1 RNA..

[0055] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a 5 ’-thiol moiety and a 3 ’-methylene blue (MB) redox reporter moiety.

[0056] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA hybridizes to, or is complementary with, a segment of an HIV-1 RNA molecule.

[0057] In some embodiments, the HIV-1 RNA molecule encodes protein R or envelope surface protein of HIV- 1.

[0058] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a nucleic acid probe comprising the sequence of CCAAGGCCCAGCCCTCACACA (SEQ ID NO:1).

[0059] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a first nucleic acid probe comprising the sequence of CCAAGGCCCAGCCCTCACACA (SEQ ID NO:1) and a second nucleic acid probe comprising the sequence of CTTGTATTGTTGTTGGGTCT (SEQ ID NO:2).

[0060] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises one or two nucleic acid probes.

[0061] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA antibody is conjugated to the respective sensor.

[0062] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent(s) for MS2 RNA.

[0063] In some embodiments, the conjugating the conjugating is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for MS2 RNA.

[0064] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for MS2 RNA.

[0065] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises a 5 ’-thiol moiety and a 3 ’-methylene blue (MB) redox reporter moiety.

[0066] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA hybridizes to, or is complementary with, a segment of an MS2 RNA molecule.

[0067] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises a nucleic acid probe comprising the sequence of TCTGGAAGTTTGCAGCTGGA (SEQ ID NO:3).

[0068] In another aspect, the present invention provides for a method for diagnosing human immunodeficiency virus (HIV) infection status in a subject, the method comprising using the detector as described herein.

[0069] In some embodiments, the method for diagnosing human immunodeficiency virus (HIV) infection status in a subject includes detecting a plurality of biomarkers in a sample of the subject comprising p24 antigen, anti-p24 antibody, HIV-1 RNA, and MS2 RNA.

[0070] In some embodiments, the method comprises: a) receiving, into a detector, the sample of the subject; wherein the detector comprises a plurality of detecting agents, wherein each respective detecting agent in the plurality of detecting agents is specific for a corresponding biomarker in a plurality of biomarkers, a respective sensor for each corresponding biomarker in the plurality of biomarkers, and one or more reaction vessels that contain the plurality of detecting agents; b) contacting, in the detector, the sample with the plurality of detecting agents under suitable conditions wherein each respective detecting agent in the plurality of detecting agents is configured to specifically bind to the corresponding biomarker in the plurality of biomarkers; c) detecting the plurality of biomarkers in the sample by the plurality of detecting agents; and d) determining the HIV infection status of the subject; wherein the detection of at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample by the detecting c) indicates HIV infection in the subject.

[0071] In some embodiments, the biomarker MS2 RNA is used as a control, wherein HIV infection is indicated only when MS2 RNA and at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA are detected in the sample by the plurality of detecting agents.

[0072] In some embodiments, the detection of less than two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample by the plurality of detecting agents indicates no HIV infection.

[0073] In some embodiments, the subject having no HIV infection has previously received HIV vaccination and has vaccine-induced sero-reactivity (VISR) or vaccine- induced sero-positivity (VISP).

[0074] In some embodiments, the subject is human.

[0075] In some embodiments, the sample is selected from the group consisting of a plasma sample, a serum sample, and a whole blood sample.

[0076] In some embodiments, the sample is collected from the subject by using a finger prick unit, wherein the finger prick unit is configured to dispense the collected sample into the one or more reaction vessels in the detector.

[0077] In some embodiments, the method comprises diluting the sample.

[0078] In some embodiments, the method comprises diluting the sample prior to step a).

[0079] In some embodiments, the respective sensor comprises an electrode comprising one or more materials selected from the group consisting of gold, conductive carbon, platinum, palladium, stainless steel, tin, tungsten, titanium, or any combination thereof.

[0080] In some embodiments, the respective detecting agent for the corresponding biomarker is conjugated to the respective sensor.

[0081] In some embodiments, the respective sensor detects the presence or absence of the corresponding biomarker by using cyclic voltammetry (CV) scan; wherein the concentration of the corresponding biomarker is measured as a function of change in CV current peak.

[0082] In some embodiments, each sensor in the plurality of sensors is an electrochemical sensor strip.

[0083] In some embodiments, the detector further comprises an embedded sensor chip and wherein each sensor in the plurality of sensors is in the embedded sensor chip.

[0084] In some embodiments, the embedded sensor chip analyzes CV scan data for each corresponding biomarker in the plurality of biomarkers collected from the respective sensor in the plurality of sensors, wherein the CV scan data comprises a set of CVcurrents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

[0085] In some embodiments, the respective sensor for p24 has a limit of detection (LOD) of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml.

[0086] In some embodiments, the respective sensor for p24 has a linear detection range of 0 to l * 105pg / ml.

[0087] In some embodiments, the respective sensor for anti-p24 antibody has an LOD of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml.

[0088] In some embodiments, the respective sensor for anti-p24 antibody has a linear detection range of 0 to 1 x 105pg / ml.

[0089] In some embodiments, the respective sensor for HIV-1 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml.

[0090] In some embodiments, the respective sensor for HIV-1 RNA has a linear detection range of 0 to 1 x 107copies / ml.

[0091] In some embodiments, the respective sensor for MS2 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml.

[0092] In some embodiments, the respective sensor for MS2 RNA has a linear detection range of 0 to 1 x 107copies / ml.

[0093] In some embodiments, the detector further comprises a potentiostat reader, wherein the potentiostat reader is configured to communicate with each respective sensor in the plurality of sensors to collect CV scan data for the corresponding biomarker, wherein the CV scan data comprises a set of CV currents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

[0094] In some embodiments, during step a) or b), the sample is dispensed into a single reaction vessel in the detector that contains the plurality of the detecting agents.

[0095] In some embodiments, during step a) or b), the sample is dispensed into a plurality of reaction vessels in the detector, wherein each reaction vessel in the plurality of reaction vessels contains a sub-set of the plurality of detecting agents.

[0096] In some embodiments, the sample is dispensed into two reaction vessels, wherein the detecting agents in the first reaction vessel are specific for protein biomarkers in the plurality of biomarkers and the detecting agents in the second reaction vessel are specific for RNA biomarkers in the plurality of biomarkers.

[0097] In some embodiments, the detecting agents in the first reaction vessel are specific for p24 and anti-p24 antibody and the detecting agents in the second reaction vessel are specific for HIV-1 RNA and MS2 RNA.

[0098] In some embodiments, the method comprises suspending protein biomarkers in the plurality of biomarkers in the sample, the suspending comprising treating the sample with a suspension buffer.

[0099] In some embodiments, the suspension buffer comprises about 0.5% triton X-100.

[0100] In some embodiments, the suspending is performed prior to step a).

[0101] In some embodiments, the suspending is performed during any of the steps through a) to c).

[0102] In some embodiments, the suspending is performed in a respective reaction vessel in the one or more reaction vessels, wherein the respective reaction vessel comprises the detecting agents in the plurality of detecting agents specific for protein biomarkers in the plurality of biomarkers.

[0103] In some embodiments, the method comprises extracting RNA biomarkers in the plurality of biomarkers in the sample, the extracting comprising treating the sample with an RNA lysis buffer.

[0104] In some embodiments, the RNA lysis buffer is selected from the group consisting of: a buffer comprising about 1 mg / ml proteinase K, about 0.5 % sodium dodecyl sulfate, and about 10 mM dithiothreitol; a radioimmunoprecipitation assay (RIP A) lysis buffer; and a buffer comprising guanidine isothiocyanate.

[0105] In some embodiments, the extracting is performed prior to step a).

[0106] In some embodiments, the extracting is performed during any of the steps through a) to c).

[0107] In some embodiments, the extracting is performed in a respective reaction vessel in the one or more reaction vessels, wherein the respective reaction vessel comprises the detecting agents in the plurality of detecting agents specific for RNA biomarkers in the plurality of biomarkers.

[0108] In some embodiments, steps a) through d) are performed within about 0.1 hours, about 0.5 hours, or about 1 hour.

[0109] In some embodiments, when the sample was obtained from the subject during eclipse period since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0110] In some embodiments, when the sample was obtained from the subject during acute HIV infection period since the initiation of the HIV infection, at least p24 and HIV- 1 RNA are detected by the detector in the sample.

[0111] In some embodiments, when the sample was obtained from the subject during early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0112] In some embodiments, when the sample was obtained from the subject after early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0113] In some embodiments, when the sample was obtained from the subject between about Day 0 and about Day 28, or between about Day 10 and about Day 28, since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0114] In some embodiments, when the sample was obtained from the subject between about Day 28 and about Day 70, or after about Day 70, since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0115] In some embodiments, the detecting agent for p24 is an extraneous anti-p24 antibody or a variant thereof.

[0116] In some embodiments, the detecting agent for p24 is an extraneous anti-p24 IgG antibody or a variant thereof.

[0117] In some embodiments, the detecting agent for p24 is conjugated to the respective sensor.

[0118] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent for p24.

[0119] In some embodiments, the detecting agent for anti-p24 antibody is extraneous p24 or a variant thereof.

[0120] In some embodiments, the detecting agent for anti-p24 antibody is conjugated to the respective sensor.

[0121] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent for anti-p24 antibody.

[0122] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises one or two nucleic acid probes.

[0123] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA is conjugated to the respective sensor.

[0124] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent(s) for HIV-1 RNA.

[0125] In some embodiments, the conjugating the conjugating is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for HIV-1 RNA.

[0126] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for HIV-1 RNA.

[0127] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a 5 ’-thiol moiety and a 3 ’-methylene blue (MB) redox reporter moiety.

[0128] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA hybridizes to, or is complementary with, a segment of an HIV-1 RNA molecule.

[0129] In some embodiments, wherein the HIV-1 RNA molecule encodes protein R or envelope surface protein of HIV- 1.

[0130] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a nucleic acid probe comprising the sequence of CCAAGGCCCAGCCCTCACACA (SEQ ID NO:1).

[0131] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a first nucleic acid probe comprising the sequence of CCAAGGCCCAGCCCTCACACA (SEQ ID NO:1) and a second nucleic acid probe comprising the sequence of CTTGTATTGTTGTTGGGTCT (SEQ ID NO:2).

[0132] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises one or two nucleic acid probes.

[0133] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA antibody is conjugated to the respective sensor.

[0134] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent(s) for MS2 RNA.

[0135] In some embodiments, the conjugating the conjugating is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for MS2 RNA.

[0136] In some embodiments, the conjugating is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for MS2 RNA.

[0137] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises a 5 ’-thiol moiety and a 3 ’-methylene blue (MB) redox reporter moiety.

[0138] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA hybridizes to, or is complementary with, a segment of an MS2 RNA molecule.

[0139] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises a nucleic acid probe comprising the sequence of TCTGGAAGTTTGCAGCTGGA (SEQ ID NO:3).BRIEF DESCRIPTION OF THE DRAWINGS

[0140] Figure la-lc. (a) Window of detection of various HIV markers from the day of transmission up to 70 days and beyond. Eclipse period (up to 10 days): time after HIV acquisition when HIV RNA may be present in very small quantities but is undetectable. Acute HIV infection (10-28 days): phase of early HIV infection when HIV RNA and p24 antigen are detectable but HIV antibodies are not detectable. Early HIV infection (28-70 days and beyond): stage of infection with HIV seroconversion. HIV infection can be detected using fourth-generation anti-p24 IgG antibodies along with HIV RNA. (b,c) multiplexed detection of p24 antigen, anti-p24 antibody and HIV-1 RNA directly from blood plasma covering the whole infection period. This unique and novel strategy can efficiently differentiate the active HIV infection from the HIV-VISP samples.

[0141] Figure 2a-2d. Change in cyclic voltammetry (CV) curve with different concentrations of (a) p24 antigen and (c) anti-p24 antibody. Inset shows the zoom-in image. Standard curve for the detection of (b) p24 antigen and (d) anti-p24 antibody as a function of change in CV current peak.

[0142] Figure 3a-3f. (a) Selected oligonucleotides targeted towards viral protein R and envelope surface protein of HIV- 1 genome, (b) Schematic representation of organization of oligonucleotides over electrode surface with the addition of their target RNA. (c) Comparative change in current for both the 3 ’-methylene blue (MB) functionalized oligonucleotides when tested against HIV-1 RNA suspended in plasma, (d) Representative change in current with potential with the addition of increasing concentration of RNA. (e) Standard curve demonstrating the limit of detection for HIV-1 RNA and (f) Change in current of the MS2 targeted oligonucleotide functionalized electrodes with increasing addition of MS2 RNA.

[0143] Figure 4. Schematic representation of the integrated multiplexed electrochemical platform to differentiate active HIV-1 infection from vaccine induce seropositivity (VISP). Steps: (1) plasma will be isolated using a one-step device from the patient blood;(2) plasma will flow and mix either with the suspension or lysis buffer media; (3) selective electrochemical detection of p24 antigen, anti-p24 antibody and HIV-1 RNA mediated by portable potentiostat.

[0144] Figure 5. The sensor output before and after the addition of the analyte (HIV-1 RNA).

[0145] Figure 6. Representative change in current with potential with the addition of RNA over the functionalized sensor surface.

[0146] Figure 7. Normalization of the sensor current by subtracting the sensor output in the presence of the target from the baseline signal.

[0147] Figure 8. Normalization of the sensor current by subtracting the sensor output in the presence of the target from the baseline signal.

[0148] Figure 9. Representative C-V curve with 5 pM of ASO-MB tested against 0.5 HIV-1 RNA.

[0149] Figure 10. The schematic representation of the sensor functionalization using P24 antibodies and antigens, a) EDC / NHS chemistry was used to conjugate the sensor surface with p24 antibodies or antigens, b) Fourier transform spectroscopy signal used to confirm the successful conjugation of the P24 antibodies or antigens to the surface.

[0150] Figure 11. The stability of the electrode conjugated with 10 pg / mL P24 Ab as seen through cyclic voltammetry.

[0151] Figure 12. Comparative response (CV curves) between the sensors when functionalized with MB labelled HIV ASOs with 5 pM (A) & 10 pM (B) ASO concentrations. 5 pM ASO functionalized sensors had stable response compared to 10 pM ASO functionalized sensors.

[0152] Figure 13. The CV curves of MB labelled HIV ASO conjugated on the sensor surface at different scan rates with constant voltage range and current. 32 p A current range was found to be giving much stable response at a scan rate of 0.1 V / s with a voltage range of -0.1 V - 0.1 V.

[0153] Figure 14. Agarose gel electrophoresis demonstrates the efficacy of lysis buffer in extracting RNA. Channel 1,2,3 - 50 pl plasma sample + 100 pl RNA shield; Channel 4,5,6 - 50 pl plasma sample + 100 pl viral RNA buffer; Channel 7,8,9 - 50 pl plasma sample + 25 pl SDS buffer + 75 pl RNA shield; Channel 10,11,12 - 50 pl plasma sample+ 50 pl SDS buffer + 50 pl RNA shield; Channel 13,14,15 - 50 pl plasma sample + 100 pl SDS buffer.

[0154] Figure 15. The cross-reactivity of the p24 functionalized sensors using a combination of gpl20 antibodies with 100 ng / mL concentration.

[0155] Figure 16. Cyclic voltammetry curves of the sensor functionalized with HIV ASO-MB (methylene blue) as a response to AcroMetrix sample.

[0156] Figure 17. The current peak of the sensor response towards the targets (P24 protein and antibody) as compared to the plasma lacking the targets. A student’s t-test was performed on the data, and it was found that the sensor’ s response toward the target is significantly different from the response to the plasma.

[0157] Figure 18. CV curves recorded as a response to HIV Positive (placebo), HIV Positive (vaccinated), HIV Negative (placebo), and HIV Negative (vaccinated) using sensors (N=8) functionalized with P24 Ab to capture the P24 antigens.

[0158] Figure 19. The peak values of the current recorded as a response to HIV Positive (placebo), HIV Positive (vaccinated), HIV Negative (placebo), and HIV Negative (vaccinated) using sensors (N=8) functionalized with P24 antigens to capture the P24 antibodies.

[0159] Figure 20. The values of the current peaks recorded as a response to HIV Positive (placebo), HIV Positive (vaccinated), HIV Negative (placebo), and HIV Negative (vaccinated) using sensors (N=12) functionalized with HIV ASO.

[0160] Figure 21. Summary information about the samples.

[0161] Figure 22. Scattered plots of the tested samples using sensors (a) targeted towards P24 antigen or (b) antibodies. The results show the relative current value of the sensors as a response to the samples in four different groups.

[0162] Figure 23. Confusion matrix and related classification performance rates for (a) 100 samples tested with p24 antigen functionalized sensors targeting anti-p24 antibody and (b) 97 samples tested with anti-p24 antibody functionalized sensors targeting p24 antigen.

[0163] Figure 24. Scattered plots of the tested samples using sensors (a) targeted towards HIV-1 viral RNA. The results show the relative current value of the sensors as a response to the samples in four different groups.

[0164] Figure 25. The confusion matrix obtained from the studied electrochemical sensor when compared against the gold standard technique PCR. The calculated parameters are indicated on the right-hand side. The electrochemical sensor (EC) had a sensitivity = 96.15, specificity = 98.07, PPV = 98.03, NPV = 96.22 and an accuracy of 97.11 in detecting the HIV-1 viral RNA.DETAILED DESCRIPTIONI. Introduction

[0165] HIV infection can be diagnosed by serologic tests that detect antibodies against HIV-1 and HIV-2 and by virologic tests that can detect HIV antigens or ribonucleic acid (RNA). The four main functions of HIV testing are (1) screening of donated blood and organs, (2) epidemiological surveillance of HIV prevalence or trends, (3) diagnosis of infection in individuals, and (4) companion diagnostic tests to rule out true infection from VISR / VISP induced false positives.

[0166] Serological tests: some attempts have been made to develop serological tests agnostic to responses elicited by HIV vaccine candidates. However, these tests failed to reach the stringent regulatory requirement, e.g., >99% sensitivity and specificity. Furthermore, dependence on multiple tests is also time consuming, expensive, and not affordable for low-resource settings. Virologic tests: nucleic acid amplification tests (NAAT) (e.g., viral load tests) can be either RNA- or DNA-based (DNA comes from integrated provirus) with a mandatory amplification and purification step. The fundamental limitations of current diagnostic assays for differentiating VISR / VISP from a true positive HIV infection stem from their reliance upon PCR analysis, which requires labor-intensive and laboratory-based protocols for viral isolation, lysis, and removal of inhibiting materials. The situation is further complicated as the highly active antiretroviral therapy (HAART) or pre-exposure prophylaxis (PrEP) therapies can cause false-negative results due to very low undetectable viral load. Previous attempts to develop a serological test agnostic to responses elicited by HIV vaccine candidates failed to reach the aforementioned high sensitivity and specificity demanded by the regulatory agency (>99% sensitivity and specificity). The parallel detection and / or quantification of IgM andIgG antibodies against antigens absent in HIV vaccines, such as peptides of gp41, and systemically circulating HIV antigens, such as p24, are promising approaches.

[0167] On the other hand, electrochemical biosensors are advantageous for sensing biomolecules because of their ability to detect biomarkers with accuracy, specificity, and high sensitivity. Furthermore, potentiostat based measurements are attractive because of their wide availability in miniaturized and accessible formats, enabling the possibility for on-the-spot or point-of-care applications. Further, the electrochemical biosensors can easily be designed to comply with the ASSURED criteria, defined by WHO, z.e., (i) Affordable, (ii) Sensitive, (iii) Specific, (iv) User-friendly, (v) Rapid and robust, (vi) minimal Equipment involvement, and (vii) Delivered to the end-users.

[0168] Although antibody tests have dominated the rapid diagnostics market for HIV, p24 has emerged as an alternative virological biomarker. The p24 antigen is a 25 kDa protein encoded by the gag gene, which is present at high copy number in HIV-1 virions. Similar to RNA, it can be detected before seroconversion. The p24 antigen is found in serum in either free form or bound by anti-p24 antibody. Free p24 can be measured with enzyme immunoassays whereas detection of bound p24 requires pre-treatment with an acid to dissociate the complex. Antibodies to p24 are produced during seroconversion, rendering p24 antigen undetectable after seroconversion in most cases. As the preferred method of screening for HIV, the current WHO guidelines recommend 4th generation combination antibody-antigen assays, which detect p24 antigen and anti-p24 antibody response to the virus. This combination approach offers the advantage of reducing the time between infection and testing HIV positivity to 28 days which is one to two weeks earlier than with sensitive third generation (antibody-only detection) assays. Further, in order to capture the window between 28 days post infection to 70 days and beyond, simultaneous detection of RNA and anti p24 IgG can be envisioned (Figure 1). It is noteworthy to mention that simultaneous targeting of p24 antigen, anti-p24 antibody, and HIV-1 RNA is the only pathway to screen VISP populations from the active HIV infection and hence these three targets were selected to meet the proposal criterion. Moreover, an internal positive control, like MS2 bacteriophage RNA, is also required in the assay to monitor the efficiency of extraction, stability of RNA and the control of decapsulation of the viral RNA during the extraction procedure. This marker will also be sensitive to the assay inhibitors. The use of MS2 phage RNA as an internal control has been proven to be cost-effective, flexible and adaptable to various technical procedures ofreal-time detection in virology. It represents a valuable strategy for enhancing the quality of routine molecular diagnosis in laboratories that use in-house or POC designed diagnostic systems.

[0169] Clinical Significance and Need. In some embodiments, a novel nanotechnology- enabled multiplexed electrochemical assay is provided herein for the selective detection of active HIV-1 infection using a rapid, point-of-care (POC) platform. The simultaneous monitoring of serological markers and HIV-1 RNA is intended to accurately detect active HIV infection and differentiate it from vaccine-induced seropositivity. Thus, fourth generation EIA targets, z.e., p24 antigen and anti-p24 antibody as serological markers are used. For the nucleic acid test, either pro-viral DNA or viral RNA can be targeted in various embodiments of the present disclosure, but HIV-1 RNA was selected in one embodiment of the present disclosure because of its capability for better integration with the serological markers within one single platform. Finally, on the same platform, an internal positive control sensitive to assay inhibitors is used (e.g., MS2 bacteriophage RNA). The maximum benefit of this multiplexed testing is realized when the diagnosis is available in rapid format compatible with the ASSURED criteria and suitable for use in resource-limited settings and self-testing. One challenge of detection by rapid tests is the detection limit of p24 and anti-p24 antibody in blood is 0.5-1 pg / ml. It was observed that p24 antigen levels above 5 pg / mL (infants) and 200 pg / mL (adults) are highly associated with mortality. On the other hand, plasma HIV-1 RNA levels are known to decrease significantly from 5.46 logio copies / mL (range 4.40-5.97 logio copies / mL) to 3.07 logio copies / mL (range 2.57-3.79 logio copies / mL; P = .03) after 8 weeks of treatment. Thus, for a robust and sensitive detection, the nucleic acid tests should achieve a sensitivity of 5.46 logio copies / mL (316,228 copies / mL = 0.17 pM, before treatment) to 3.07 logio copies / mL (1,259 copies / mL = 0.7 fM after treatment).

[0170] In one aspect, the present invention disclosed herein is based on the development of a microfluidic-based multianalyte, multiplex detection approach that utilizes electrochemical sensing techniques to develop a panel of four different biomarkers, i.e., 1) p24 antigen, 2) anti-HIV-1 p24 antibody, 3) viral HIV-1 RNA and 4) MS2 bacteriophage RNA. The multiplexed biomarkers are selected in such a way that the sensor will be able to provide true-positive HIV infection information without any interference from VISP / VISR throughout the period from its viral transmission to day 70 and beyond. While the assay will show positive response for HIV-1 RNA and p24 antigenduring the period from transmission to day 28, HIV-1 RNA and anti-p24 IgG antibody will show positive response from day 28 to day 70 and beyond. The unique features of the multiplexed assay are modularity, portability, requirement of low reagent, and high sensitivity. These qualities make the proposed integrated system suitable for point of care (POC) applications. High-affinity antibodies are used for specific sensing of p24 antigen. In addition, in some embodiments, to achieve molecular targeting for the HIV-1 RNA, antisense oligonucleotides (ODNs) are designed in silico to target 5131 ®5151 and 6662®6681 segments of the HIV-1 genome. In another aspect, some embodiments of the present invention further include an RNA extraction-free technique that utilizes a lysis buffer solution to disrupt the viral membrane and elute the RNA directly from the biological samples into the test medium. In some embodiments, the sensor can detect the specific target p24 antigen, anti-p24 antibody and HIV-1 RNA without any signal crosstalk with a detection limit of 1 pg / mL, 0.5 pg / ml and 3.07 logio copies / mL respectively. Thus, the present invention is able to support the development of a next-generation multiplexed combinatorial serological and nucleic acid assay that can identify HIV-1 infection while avoiding false-positive results due to VISP, with high sensitivity and specificity.II. Definitions

[0171] As used herein, the term “about” or “approximately” can mean within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which can depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. “About” can mean a range of ±20%, ±10%, ±5%, or ±1% of a given value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” means within an acceptable error range for the particular value. The term “about” can have the meaning as commonly understood by one of ordinary skill in the art. The term “about” can refer to ±10%. The term “about” can refer to ±5%. As used herein, the term “agent” refers to any molecule, compound, methodology and / or substance for use in the prevention, treatment, management and / or diagnosis of a disease or condition.

[0172] As used herein, the term “agent” or “reagent” refers to any molecule, compound, methodology and / or substance for use in the diagnosis, prevention, treatment, and / or management of a disease or condition. The term “detecting agent” refers to an agent or reagent used for detecting the direct or indirect binding between an analyte such as a biomarker in a sample and said agent.

[0173] As used herein, the term “antibody” or “antigen-binding polypeptide” refers to a polypeptide or a polypeptide complex that specifically recognizes and binds to an antigen. An antibody can be a whole antibody and any antigen binding fragment or a single chain thereof. For example, “antibody” can include any protein or peptide containing molecule that comprises at least a portion of an immunoglobulin molecule having biological activity of binding to the antigen. Non-limiting examples a complementarity determining region (CDR) of a heavy or light chain or a ligand binding portion thereof, a heavy chain or light chain variable region, a heavy chain or light chain constant region, a framework (FR) region, or any portion thereof, or at least one portion of a binding protein. As used herein, the term “antibody” can refer to an immunoglobulin molecule and immunologically active portions of an immunoglobulin (Ig) molecule, z.e., a molecule that contains an antigen binding site that specifically binds (immunoreacts with) an antigen.

[0174] As used herein, the term the term “a plurality” or “multiple” refer to two or more species or features, for example, two, three, four, five, or more. Moreover, the terms “first” and “second” are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated. Thus, elements referred to as “first” and “second” may include one or more of the features either explicitly or implicitly.

[0175] As used herein, the term “biological sample,” “patient sample,” or “sample” interchangeably refers to any sample taken from a subject. Examples of biological samples include, but are not limited to, blood samples (such as a plasma sample, a serum sample, and a whole blood sample), saliva samples, buccal cell samples, and the like.

[0176] As used herein, the term “complementary” or “complementarity” refers to a property of a nucleotide (e.g., A, C, G, T, U) in a nucleic acid (e.g., RNA, DNA) in a strand (e.g., oligonucleotide) to pair with another particular nucleotide in a nucleic acid strand of the opposite orientation (e.g, strands running parallel, but in the reverse direction (z.e., 5 '-3'aligns with 3 '-5', and 3 '-5' with 5 '-3')) (z.e., Watson-Crick base-pairing rules). With respect to deoxyribonucleic acids (DNA) the base pairings which are complementary are adenine (A) and thymine (T) (e.g. , A with T, T with A) and guanine (G) and Cytosine (C) (e.g , G with C, C with G) and with respect to ribonucleic acid (RNA) the base pairings which are complementary are A and uracil (U) (e.g, A with U, U with A) and G and C (e.g., G with C, C with G). This occurs because of the ability of each base pair to form an equivalent number of hydrogen bonds with its complementary base (e.g., A-T / U, T / U-A, C-G, G-C), for example the bond between guanine and cytosine shares three hydrogen bonds compared to the A-T / U bond which always shares two hydrogen bonds.

[0177] As used herein, the term “control” or “control experiment” is used in accordance with its plain ordinary meaning and refers to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment except for omission of a procedure, reagent, or variable of the experiment. In some instances, the control is used as a standard of comparison in evaluating experimental effects.

[0178] As used herein, the term “conjugate” or “conjugation” refers to any of the wide variety of methods to physically attach one molecule to another, or a molecule to a solid surface or particle. Such methods typically involve forming covalent or non-covalent chemical bonds (ionic, H-bonding), but may also rely on protein-protein interactions, protein-metal interactions, or chemical or physical adsorption via intermolecular (e.g., Van der Waals) forces.

[0179] As used herein, the term “contact” or “contacting” is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species or objects (e.g. chemical compounds including biomolecules or cells) to become sufficiently proximal to react, interact or physically touch. It should be appreciated; however, the resulting reaction can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents that can be produced in the reaction mixture.

[0180] As used herein, the term “cyclic voltammetry” or “CV” refers herein to a type of potentiodynamic electrochemical measurement. In a cyclic voltammetry experiment, the working electrode potential is ramped linearly versus time. When cyclic voltammetry reaches a set potential, the working electrode’s potential ramp is inverted. This inversion can happen multiple times during a single experiment. The current at the workingelectrode is plotted versus the applied voltage to give the cyclic voltammogram trace. The cyclic voltammetry method uses a reference electrode, working electrode, and / or counter electrode which in combination are sometimes referred to as a three-electrode setup. Electrolyte is usually added to the test solution to ensure sufficient conductivity. The combination of the solvent, electrolyte and specific working electrode material determines the range of the potential.

[0181] As used herein, the term “detect” or “detecting” means any of a variety of methods known in the art for determining the presence, absence, or amount of one or more characteristics such as a biomarker associated with a condition or a disease, e.g., a nucleic acid, an antigen or an antibody generated in response to the antigen. As used throughout the specification, the term “detect” or “detecting” includes either qualitative or quantitative detection.

[0182] As used herein, the term “detector” as used herein refers to a hardware device or platform configured to detect the presence or absence of a particular condition, disease, event, object, substance, or a change in its environment, and to emit a signal in response. The detector may be a stationary device or a mobile device. Further, the detector may be a stand-alone device or may form part of another device, such as a computer, a diagnostic equipment or any other device. Further, the detector may be a hand-held device. Other embodiments of the detector are feasible.

[0183] As used herein, the term “functionalized surface” as used herein refers to the surface of the electrode according to the present disclosure which has certain desired physical and / or chemical properties. The surface of the electrode according to the present disclosure shall be functionalized in that it comprises at least one polymer capable of mediating a salting-out effect and at least one detecting agent that specifically binds to an analyte such as a corresponding biomarker comprised in the fluid sample. Moreover, the said polymer and detecting agent shall be distributed on the surface of the electrode such that a suitable condition can be created to allow for specific binding between the detecting agent and the analyte in the fluid sample. The distribution, typically, may be a continuous layer or may be a cluster arrangement, such as a spot-like arrangement around each detecting agent.

[0184] As used herein, the term “HIV” refers to human immunodeficiency virus. HIV can be classified into two major subtypes (HIV-1 and HIV-2), each of which has many subtypes. In some embodiments, a subject is infected with the HIV-1 or HIV-2 subtypes.

[0185] As used herein, the term “HIV-1” refers to the human immunodeficiency virus-1, a retrovirus that infects CD4+ T cells and causes acquired immunodeficiency syndrome (AIDS). The HIV-1 can be a group M, group N, group O, or group P type. The HIV-1 group M type can be a subtype A, subtype B, subtype C, subtype D, subtype E, subtype F, subtype G, subtype H, subtype I, subtype J or subtype K.

[0186] As used herein, the term “hybridize” or “hybridization,” as used herein refers to the process of joining two complementary strands of DNA or one each of DNA and RNA to form a double-stranded molecule through Watson and Crick base-pairing or pairing of a universal nucleobase with one of the four natural nucleobases of DNA (adenine, guanine, thymine and cytosine).

[0187] As used herein, the term “limit of detection” or “LOD” refers to the lowest quantity or concentration of a component or an analyte that can be distinguished from the absence of that component or analyte and can be measured or detected with statistical significance. For example, LOD can be defined as the lowest concentration of a protein or nucleic acid (e.g., DNA or RNA) biomarker detected at least 80%, 85%, 90%, or 95% of the times among the replicates of that specific concentration.

[0188] As used herein, the term “linear detection range” refers to a concentration or quantity range of an analyte such as a biomarker in the sample, the detection of which within said linear detection range by the corresponding sensor generates a signal that is predominantly linear to the concentration.

[0189] As used herein, the term “nucleic acid” refers to a high-molecular-weight biochemical macromolecule composed of nucleotide chains that convey genetic information. The most common nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The monomers from which nucleic acids are constructed are called nucleotides. Each nucleotide consists of three components: a nitrogenous heterocyclic base, either a purine or a pyrimidine (also known as a nucleobase); and a pentose sugar. Different nucleic acid types differ in the structure of the sugar in their nucleotides; DNA contains 2-deoxyribose while RNA contains ribose.

[0190] As use herein, the term “patient” or “subject” refers to a living organism suffering from or prone to a disease or condition that can be diagnosed in accordance with the methods provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, and deer. A patient may be human.

[0191] As used herein, the term “potentiostat” or “potentiostat reader” refers to an electronic device which is adapted for adjusting and / or measuring the electrical potential difference between the working electrode or the interferent electrode and the further electrode, in particular the counter electrode or the counter / reference electrode, in the electrochemical cell. Alternatively or in addition, a galvanostatic method may be used. For this purpose, a galvanostat may be employed to maintain and measure the current through the electrochemical cell constant.

[0192] As used herein, the term “RNA” or “RNA molecule” or “ribonucleic acid molecule” refers to a polymer of ribonucleotides; the term “DNA” or “DNA molecule” or “deoxyribonucleic acid molecule” refers to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally, e.g., by DNA replication and transcription of DNA, respectively; or be chemically synthesized. DNA and RNA can be single-stranded (z.e., ssRNA or ssDNA, respectively) or multi-stranded (e.g., double stranded, z.e., dsRNA and dsDNA, respectively). The term “mRNA” or “messenger RNA”, as used herein, refers to a single stranded RNA that encodes the amino acid sequence of one or more polypeptide chains.

[0193] As use herein, the term “sensor” refers to any measuring, detecting or sensing device mounted on a detector or any of its components including new sensors mounted in conjunction with the diagnostic module in accordance with the invention.

[0194] As use herein, the term “subject” is defined herein to include animals such as mammals, including, but not limited to, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice and the like. In some embodiments, the subject is a human.

[0195] As use herein, the term “unit” can have conventional meaning in the field of electronics, electrical devices and / or electronic devices and may include, for example, electrical and / or electronic circuitry, devices, modules, processors, memories, logic solid state and / or discrete devices, computer programs or instructions for carrying outrespective tasks, procedures, computations, outputs, and / or displaying functions, and so on, as such as those that are described herein.

[0196] As used herein, the term “vaccine” refers to a substance administered to trigger or stimulate an immune response against a particular disease, such as HIV infection. The term vaccine comprises preventative vaccines and therapeutic vaccines. Preventative vaccines are designed to prevent a subject from acquiring a particular disease, such as HIV or SIV infection, or to only have a mild case of the disease. Therapeutic vaccines are intended to improve immune response to or alleviate symptoms of specific diseases.

[0197] As used herein, the term “variant” as used in the context of molecules, e.g., nucleic acids, or proteins, refers to a molecule that shows significant structural identity with a reference molecule but differs structurally from the reference molecule, e.g., in the presence or absence or in the level of one or more chemical moieties as compared to the reference entity. In some embodiments, a variant also differs functionally from its reference molecule. In general, whether a particular molecule is properly considered to be a “variant” of a reference molecule is based on its degree of structural identity with the reference molecule. As will be appreciated by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. A variant, by definition, is a distinct molecule that shares one or more such characteristic structural elements but differs in at least one aspect from the reference molecule.

[0198] In some embodiments, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently components of the polypeptide or nucleic acid (e.g., that are attached to the polypeptide or nucleic acid backbone). In some embodiments, a variant polypeptide or nucleic acid shows an overall sequence identity with a reference polypeptide or nucleic acid that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, a variant polypeptide or nucleic acid does not share at least one characteristic sequence element with a reference polypeptide or nucleic acid. In some embodiments, a reference polypeptide or nucleic acid has one or more biological activities. In some embodiments, a variant polypeptide or nucleic acid shares one or more of the biological activities of the reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid lacks one or more of the biologicalactivities of the reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid shows a reduced level of one or more biological activities as compared to the reference polypeptide or nucleic acid. In some embodiments, a polypeptide or nucleic acid of interest is considered to be a “variant” of a reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence that is identical to that of the reference but for a small number of sequence alterations at particular positions. Typically, fewer than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in a variant are substituted, inserted, or deleted, as compared to the reference. In some embodiments, a variant polypeptide or nucleic acid comprises about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residues as compared to a reference. Often, a variant polypeptide or nucleic acid comprises a very small number (e.g., fewer than about 5, about 4, about 3, about 2, or about 1) number of substituted, inserted, or deleted, functional residues (z.e., residues that participate in a particular biological activity) relative to the reference. In some embodiments, a variant polypeptide or nucleic acid comprises not more than about 5, about 4, about 3, about 2, or about 1 addition or deletion, and, in some embodiments, comprises no additions or deletions, as compared to the reference. In some embodiments, a variant polypeptide or nucleic acid comprises fewer than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and commonly fewer than about 5, about 4, about 3, or about 2 additions or deletions as compared to the reference. In some embodiments, a reference polypeptide or nucleic acid is one found in nature. In some embodiments, a reference polypeptide or nucleic acid is a human polypeptide or nucleic acid.III. Multiplex detecting platform for diagnosing HIV infection

[0199] In one aspect, the present disclosure herein provides a multiplex detecting platform for diagnosing human immunodeficiency virus (HIV) infection status in a subject. In some embodiments, the platform is a detector. The detector includes a plurality of detecting agents, wherein each respective detecting agent in the plurality of detecting agent is specific for a corresponding biomarker in a sample of the subject in a plurality of biomarkers, a respective sensor for each corresponding biomarker, and one or morereaction vessels. In some embodiments the multiplex detecting platform comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more reaction vessels.

[0200] In some embodiments, the detector of the present invention includes at least one reaction vessel for receiving a biological sample, e.g., a liquid biopsy sample, such as a blood, a urine or a saliva sample, and a plurality of sensors, each sensor being specific for a corresponding biomarker in a plurality of biomarkers in the sample and comprises at least one respective detecting agent for the corresponding biomarker. In some embodiments, the sample is a plasma sample, a serum sample, or a whole blood sample.

[0201] In some embodiments, the detector is an electrochemical detector for detecting an electrochemical signal in response to specific binding of a detecting agent and a corresponding biomarker in the sample of the subject. In some embodiments, the sensor is an electrochemical sensor in fluid contact with said biological sample after it is received into the detector, said sensor comprising an electrode. In some embodiments, the electrode in the electrochemical sensor is functionalized with one or more detecting agent exhibiting specific binding to the same corresponding biomarker.

[0202] In some embodiments, the electrochemical signal is a cyclic voltammetry (CV) signal, a differential pulse voltammetry signal or chronoamperometry signal. In some embodiments, the electrochemical signal is a CV signal, for example a redox current flowing through said at least one electrode and / or an electrical impedance across said electrodes, in response to specific binding of a detecting agent and a corresponding biomarker, and generating signals in response to said detection.

[0203] In some embodiments, the detector can include a plurality of sensors, each sensor configured for detecting a different HIV biomarker in the sample as described herein. In some embodiments, the detector comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more sensors. The HIV biomarkers can be multiplexed with other relevant biomarkers for determining the HIV infection status of the subject.

[0204] In some embodiments, the detecting agents can be any of an antibody, an antigen, an oligonucleotide, an aptamer, a SOMAmer, and / or a raptomer, a megastar or any combination thereof.

[0205] The detector can further include an analysis module that is in communication with each respective sensor for receiving the signals generated by the sensor and processing those signals to determine the level of the HIV infection biomarkers in thebiological sample. The detection signals are processed to determine whether the corresponding biomarkers are present in the biological sample at a concentration level above a limit of detection (LOD) of the sensor.

[0206] In some embodiments, each respective sensor in the plurality of sensors according to an embodiment for the detection of target biomarkers can include an electrode that is functionalized in a manner discussed herein to configure the electrode for detection of a corresponding biomarker in the plurality of biomarkers. In some embodiments, the electrode includes a working electrode and a reference electrode. More specifically, at least one detecting agent is conjugated to the surface of the working electrode, where said detecting agent is configured to specifically bind to the corresponding biomarker.

[0207] In some embodiments, each respective sensor can further include an analysis module that is in communication with the electrode to receive the detection signals generated by the respective electrode and process those detection signals to determine whether a target biomarker is present in the sample. In some embodiments, when detection signals exceed certain predefined thresholds, the analysis module can indicate that the target biomarker is present in the sample.

[0208] In some embodiments, the sample is selected from the group consisting of a plasma sample, a serum sample, and a whole blood sample.

[0209] In some embodiments, the detector further comprises a sample collection unit, wherein the sample collection unit is configured to collect the sample from the subject and dispense the collected sample into one or more reaction vessels in the detector. In some embodiments, the sample collection unit comprises a finger prick unit. In some embodiments, the finger prick unit is a POC one-step plasma separation device that collects blood from the subject via finger prick. In some embodiments, the sample collection unit is connected to the detector via a plasma inlet.

[0210] In some embodiments, the sample is diluted before being received into one or more reaction vessels. In some embodiments, the sample is diluted after being received into one or more reaction vessels.

[0211] In some embodiments, when the sample is received into the detector and dispensed into one or more reaction vessels, the sample comes into fluid contact with the plurality of detecting agent. In some embodiments, the one or more reaction vesselsconsists of 2, 3, 4, or more reaction vessels. In some embodiments, each reaction vessel is a microfluidic channel. In some embodiments, the detector contains more than one reaction vessels in a multi-channel chamber, each reaction vessel is a chamber in a channel. In some embodiments, each reaction vessel contains a reaction chamber and a detection chamber, where the sample is admixed with a corresponding buffer in the reaction chamber first, then dispensed into the detection chamber for detection of the corresponding biomarker(s).

[0212] In some embodiments, the detector contains a single reaction vessel that contains the plurality of detecting agents. In some embodiments, the detector contains a plurality of reaction vessels, wherein each reaction vessel in the plurality of reaction vessels contains a subset of the plurality of detecting agents. In some embodiments, the detector contains two reaction vessels, wherein the detecting agents in the first reaction vessel are specific for biomarkers that are proteins (e.g., antigens and antibodies) and the detecting agents in the second reaction vessel are specific for biomarkers that are RNAs.

[0213] In some embodiments, the detector contains two separate reaction vessels. The detecting agents in the first reaction vessel are specific for p24 and anti-p24 antibody and the detecting agents in the second reaction vessel are specific for HIV-1 RNA and MS2 RNA.

[0214] In some embodiments, the first reaction vessel comprises a suspension buffer. In some embodiments, the suspension buffer comprises about 0.5% triton X-100. In some embodiments, the suspension buffer further includes ferricyanide or ferrocyanide salts to improve the electron transfer in the suspension buffer in presence of the target analyte and eventually improve the sensitivity of the respective sensor(s).

[0215] In some embodiments, the second reaction vessel comprises an RNA lysis buffer. In some embodiments, the RNA lysis buffer is selected from the group consisting of: a buffer comprising about 1 mg / ml proteinase K, about 0.5 % sodium dodecyl sulfate, and about 10 mM dithiothreitol; a radioimmunoprecipitation assay (RIP A) lysis buffer; and a buffer comprising guanidine isothiocyanate.1. Biomarker

[0216] In some embodiments, the detector detects the presence or absence in a sample a plurality of biomarkers associated with HIV infection. In some embodiments, one or morebiomarkers in the plurality of biomarkers can be detected prior to seroconversion in response to HIV infection. In some embodiments, one or more biomarkers in the plurality of biomarkers can be detected during seroconversion in response to HIV infection. In some embodiments, one or more biomarkers in the plurality of the biomarkers can be detected subsequent to seroconversion in response to HIV infection. In some embodiments, the plurality of biomarkers include corresponding biomarkers that can be detected prior to, during, and subsequent to seroconversion.

[0217] In some embodiments, the plurality of biomarkers of the present invention includes about 3, 4, 5, 6, 7, or more biomarkers. In some embodiments, the plurality of biomarkers includes about 3 biomarkers. In some embodiments, the plurality of biomarkers includes about 4 biomarkers. In some embodiments, the plurality of biomarkers includes about 5 biomarkers. In some embodiments, the plurality of biomarkers includes about 6 biomarkers. In some embodiments, the plurality of biomarkers includes about 7 or more biomarkers.

[0218] In some embodiments, the plurality of biomarkers includes protein biomarkers and / or genetic material biomarkers. The genetic material biomarkers can be RNA biomarkers. In some embodiments, the plurality of biomarkers includes one or more protein biomarkers. In some embodiments, the plurality of biomarkers includes about 2 protein biomarkers. In some embodiments, the plurality of biomarkers includes about 3 protein biomarkers. In some embodiments, the plurality of biomarkers includes about 4 protein biomarkers. In some embodiments, the plurality of biomarkers includes one or more RNA biomarkers. In some embodiments, the plurality of biomarkers includes about 2 RNA biomarkers. In some embodiments, the plurality of biomarkers includes about 3 RNA biomarkers. In some embodiments, the plurality of biomarkers includes about 4 RNA biomarkers. In one embodiment, the plurality of biomarkers includes 2 protein biomarkers and 2 RNA biomarkers.

[0219] In some embodiments, the plurality of biomarkers includes proteins and / or RNAs originate from the HIV or generated in response to HIV immune response that are indicative of HIV infection in a subject. In some embodiments, the plurality of biomarkers comprises proteins and / or RNAs that do not originate from the HIV or not generated in response to HIV immune response and as such are not indicative of HIV infection. In some embodiments, the protein and / or RNA biomarkers not indicative of HIV infection are used as an internal control for monitoring efficiency of sampleprocessing. In some embodiments, the plurality of biomarkers includes biomarkers indicative of HIV infection and biomarkers not indicative of HIV infection.

[0220] In some embodiments, the plurality of biomarkers includes one or more serological biomarkers. In some embodiments, one or more serological biomarker in the plurality of biomarkers is encoded by the genetic material of HIV. In some embodiments, the plurality of biomarkers includes one or more biomarkers encoded by the genome of the subject in response to HIV infection. In some embodiments, one or more biomarker is an antibody or variant thereof.

[0221] The biomarker used as internal control described herein includes, but is not limited to, RNA oligonucleotide (e.g. Influenza A & B 2 Test, Abbott, Abbott Park, Ill. 60064, U.S.A.), encapsulated (armored) RNA pseudovirus (e.g. Xpert® Flu / RSV XC Assay, Cepheid, Sunnyvale, Calif. 94089, U.S.A.), encapsulated RNA (e.g. cobas® Liat® Influenza A / B & RSV, Roche, Basel, Switzerland), in vitro transcribed RNA (e.g. ProFlu+™ Assay Test), armored RNA (e.g. Simplexa™ Influenza A H1N1 (2009) Kit, Focus Diagnostics), encapsulated RNA (e.g. Simplexa™ Flu A / B & RSV Direct Kit, Focus Diagnostics), mengovirus (e.g. encephalomyocarditis virus (EMCV) RT-PCR kit), bacteriophage (e.g. Adenovirus R-GENE®, adenovirus species (A, B, C, D, E, F and G)), noninfectious armored RNA (e.g. in vitro PCR based assay for HCV RNA detection), bacteriophage MS2 (e.g. RIDA® GENE Norovirus GI / GII, Clinical Diagnostics), tobacco mosaic virus (TMV), phocine distemper virus, brome mosaic virus (BMV), and so on. MS2 RNA, an ssRNA bacteriophage, is commonly used as an internal control in biological experiments and virus / pathogen detections after a preliminary reverse transcription process. In some embodiments, the application of internal control is included for monitoring the adequate processing of the biological sample and the presence of inhibition factors in the RT-PCR reactions to prevent false-negative results due to inhibition or human error. Therefore, in some embodiments, MS2 RNA is used as an internal control biomarker.

[0222] In some embodiments, the plurality of biomarkers includes p24, anti-P24 antibody, HIV-1 RNA and MS2 RNA. In some embodiments, MS2 RNA is used as a control to monitor the efficiency of the extraction of RNA biomarkers, stability of RNA biomarkers. And the control of decapsulation of the viral RNA during the extraction procedure.

[0223] In some embodiments, the detection of at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample in the plurality of biomarkers indicates HIV infection in the subject. In some embodiments, HIV infection is indicated only when MS2 RNA and at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA are detected by the plurality of detecting agents in the sample.

[0224] In some embodiments, the detector reports HIV infection in the subject when MS2 RNA and at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA are detected in the sample. In another embodiment, the detector reports no HIV infection in the subject when less than two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the plurality of biomarkers are detected in the sample. In another embodiment, the detector reports no HIV infection in the subject when MS2 RNA and less than two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the plurality of biomarkers are detected in the sample. In yet another embodiments, the detector reports no definitive conclusion can be made as to the HIV infection status of the subject when less than two of p24 antigen, anti- p24 antibody, and HIV-1 RNA are detected in the sample. In yet another embodiments, the detector reports no definitive conclusion can be made as to the HIV infection status of the when MS2 RNA is not detected in the sample.

[0225] In some embodiments, when the sample was obtained from the subject during eclipse period (about 10 days post infection) since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0226] In some embodiments, when the sample was obtained from the subject during acute HIV infection period (about 10 to 28 days post infection) since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0227] In some embodiments, when the sample was obtained from the subject during early HIV infection period (about 28 to 70 days and beyond post infection) since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0228] In some embodiments, when the sample was obtained from the subject after early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0229] In some embodiments, when the sample was obtained from the subject between about Day 0 and about Day 28, or between about Day 10 and about Day 28, since theinitiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0230] In some embodiments, when the sample was obtained from the subject between about Day 28 and about Day 70, or after about Day 70, since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.2. Detecting agents

[0231] In some embodiments, each respective detecting agent in the plurality of detecting agents described herein is for electrochemical detection of a corresponding biomarker in the sample of a subject. In some embodiments, the respective detecting agent is an aptamer. An aptamer may be defined as an oligonucleotide or polypeptide configured to bind the analyte. Such an aptamer may, for example, be configured to interact with, for example bind, various analyte types, such as proteins, RNAs and DNAs. In some non-limiting examples, the detecting agent is conjugated to an electro-active moiety, for example a redox-active moiety, and is configured such that a conformational change of the detecting agent upon selectively interacting with, for example binding, the analyte causes a change in the proximity of the electro-active moiety with respect to the surface of the respective test electrode. Particularly in examples in which the electrodes are configured for determining a change in current associated with the selective interaction with the analyte, such a change in proximity of the electro-active moiety with respect to the surface of the respective test electrode can cause, or at least contribute to, the determined current change. Thus, the detecting agent being functionalized with such an electro-active moiety can assist with amperometric sensing of the analyte.

[0232] In some embodiments, the proximity / di stance change resulting from the detecting agent binding the biomarker could result in the electro-active moiety moving closer to the surface of the respective working electrode in the respective sensor than when the detecting agent is not interacting with the biomarker. In such examples, electron transfer between the electro-active moiety and the respective test electrode may become faster, such as to contribute to an increase in current in the respective test electrode upon interaction between the biomarker and the detecting agent. In alternative non-limiting examples, the proximity change resulting from the detecting agent interacting with, for example binding, the biomarker could result in the electro-active moiety moving furtherfrom the surface of the respective test electrode than when the detecting agent is not interacting with the biomarker. In such examples, the detecting agent may be regarded as being conformationally configured in the absence of the biomarker such that the electroactive moiety, for example redox-active moiety, is proximal to, or even in contact with, the working electrode surface, thereby providing a baseline signal. In such cases, a decrease in current in the respective test electrode upon interaction between the biomarker and the detecting agent may be observed. Thus, in some embodiments, the greater the concentration of biomarker, the greater the decrease in the current. Any suitable electroactive moiety may be included in the detecting agent for this purpose.

[0233] In some embodiments, the detector provided in the present disclosures includes a plurality of detecting agents. Each respective detecting agent is specific for a corresponding biomarker in a sample of the subject in a plurality of biomarkers, a respective sensor for each corresponding biomarker, and one or more reaction vessels. In some embodiments, each respective detecting agent in the plurality of detecting agents is immobilized on a fluid-contact surface of the respective sensor for the corresponding biomarker in the plurality of biomarkers. In some embodiments, each respective detecting agent is covalently or non-covalently conjugated to the surface of an electrode in the respective sensor for the conrresonding biomarker.

[0234] In some embodiments, the detector contains one respective detecting agent for each corresponding biomarker in the plurality of biomarkers. In some embodiments, the detector contains more than one respective detecting agent for a corresponding biomarker in the plurality of biomarkers. In some embodiments, the detector contains more than one respective detecting agent for each biomarker in a subset of the plurality of biomarkers. In some embodiments, the detector contains one detecting agent for each protein biomarker in the plurality of biomarkers. In some embodiments, the detector contains one detecting agent for each RNA biomarker in the plurality of biomarkers. In some embodiments, the detector contains more than one detecting agent for each RNA biomarker in the plurality of biomarkers. In some embodiments, the detector contains two detecting agents for each RNA biomarker in the plurality of biomarkers.

[0235] In some embodiments, the detector contains a plurality of detecting agents, of which each respective detecting agent is specific for a corresponding biomarker in a plurality of biomarkers consisting of p24, anti-p24 antibody, HIV-1 RNA and MS2 RNA.

[0236] In some embodiments, the detecting agent for p24 is an extraneous anti-p24 antibody or a variant thereof. In some embodiments, the detecting agent for p24 comprises an antigen binding domain that specifically binds to p24. In some embodiments, the detecting agent for p24 is an extraneous anti-p24 IgG antibody or a variant thereof.

[0237] In some embodiments, the detecting agent for anti-p24 antibody is extraneous p24 or a variant thereof. In some embodiments, the detecting agent for anti-p24 antibody is a fragment of p24 that specifically binds to an anti-p24 antibody. In some embodiments, the detecting agent for anti-p24 antibody is a p24 variant comprising one or more amino acid substitutions from the wild type p24. In some embodiments, the detecting agent for anti-p24 antibody is a p24 variant having at least 80%, 85%, 90%, or 95% sequence identity to the wild type p24.

[0238] In some embodiments, the detecting agents in the plurality of detecting agents specific for corresponding biomarkers include one or more nucleic acid probe. In some embodiments, a portion of the nucleic acid probe is an oligonucleotide. In some embodiments, one or more oligonucleotide is designed in silico to specifically recognize one or more corresponding RNA biomarker in the sample in the plurality of biomarkers. Methods for designing oligonucleotides in silico is known in the art. Exemplary disclosures for designing and synthesizing oligonucleotides can be found in Gait, M. J. (ed.) Oligonucleotide synthesis: a practical approach, Oxford [Oxfordshire], Washington, D.C.: TRL Press, 1984; and Herdewijn, P. (ed.) Oligonucleotide synthesis: methods and applications, Methods in Molecular Biology, v. 288 (Clifton, N.J.) Totowa, N.J.: Humana Press, 2005, which are incorporated herein by reference in their entireties.

[0239] An skilled person in the art would appreciate that the length of the oligonucleotide in the nucleic acid probe is critical to the binding between the oligonucleotide and its target. In some embodiments, the oligonucleotide contains about 10-20 nucleotides, about 20 to 30 nucleotides, or about 30 to 40 nucleotides. In one particular embodiment, the oligonucleotide in the nucleic acid probe is about 20 nucleotides long. It is also critical that the oligonucleotide in the nucleic acid probe does not bind, even partially, to a non-target RNA and therefore the following criteria primarily depend either on the tertiary structure of the oligonucleotide or on the binding and disruption energies of the oligonucleotides with their target sequences at 37 °C and 1 M NaCl condition. These criteria further include: 2. GC content - in some embodiments,the GC content will be around: 40% <= GC % <= 60%. 3. Formation of Tetraplexes within the oligonucleotide - No GGGG in the target sequence as an oligonucleotide containing either single GGGG runs or repeated GG or GGG runs in close proximity can form intra-strand tetraplexes (single structures of four strands). 4. Antisense Activity - The sequences are subsequently analyzed according to their binding affinity and disruption energy to the genetic sequences of choice. In some embodiments, the oligonucleotides having optimum GC content with better binding and disruption energy are selected.

[0240] In some embodiments, the oligonucleotides targeting viral protein R and envelope surface protein of HIV- 1 are selected. Protein R (vpr gene) of HIV is known to play an important role in regulating nuclear import of the HIV-1 pre-integration complex and is required for virus replication in non-dividing cells such as macrophages, while envelope surface protein (Env gene) of HIV- 1 is crucial to viral infectivity for binding to the CD4 and chemokine receptors present on T cells and for driving membrane fusion.

[0241] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA includes one or two nucleic acid probes. In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA hybridizes to, or is complementary with, a segment of an HIV-1 RNA sequence. In some embodiments, the HIV-1 RNA molecule encodes protein R or envelope surface protein of HIV-1. In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA is a nucleic acid probe comprising the sequence of CCAAGGCCCAGCCCTCACACA (SEQ ID NO: 1). In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA are a first nucleic acid probe comprising the sequence of CCAAGGCCCAGCCCTCACACA (SEQ ID NO:1) and a second nucleic acid probe comprising the sequence of CTTGTATTGTTGTTGGGTCT (SEQ ID NO:2).

[0242] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA includes one or two nucleic acid probes. In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA hybridizes to, or is complementary with, a segment of an MS2 RNA molecule. In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA is a nucleic acid probe comprising the sequence of TCTGGAAGTTTGCAGCTGGA (SEQ ID NO:3).

[0243] In some embodiments, one or more detecting agent in the plurality of detecting agents in the detector is labeled with a reporter moiety. In some embodiments, a redox reporter is used to label one or more detecting agent in the plurality of detecting agents. Non-limiting examples of redox reporter include methylene blue, methylene blue succinymide, methylene blue maleimide, Atto MB2 maleimide (Sigma Aldrich) and other methylene blue derivatives; 3, 7-Bis- [(2- Ammonium ethyl) (methyl)amino]phenothiazin-5- ium trifluoroacetate; 3,7-Bis-(piperazin-4-ium-l-yl)phenothiazin-5-ium trifluoroacetate; 3,7-Bis-[(2-ammoniumethyl)(methyl)amino]phenothiazin-5-ium chloride; and 3,7-Bis- (piperazin-4-ium-l-yl)phenothiazin-5-ium chloride. In some embodiments, one or more detecting agent in the plurality of detecting agents in the detector is labeled with methylene blue reporter moiety.

[0244] In some embodiments, one or more detecting agent in the plurality of detecting agents in the detector is further labeled with linking moiety that is capable of attaching to the surface of an electrode. In some embodiments, exemplary linking moieties include but are not limited to thiol, diazonium, alkyne, carbene, adenosine oligonucleotide, dithioester, isonitrile, isothiocyanate, carboxyl, amine, nitrile, nitro, and trialkylsilyl, one or more detecting agent in the plurality of detecting agents in the detector is further labeled with thiol.

[0245] In some embodiments, one or more detecting agent in the plurality of detecting agents in the detector is labeled with both a methylene blue reporter moiety and a thiol.

[0246] In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a 5 ’-thiol moiety. In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a 3 ’-methylene blue (MB) redox reporter moiety. In some embodiments, the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a 5 ’-thiol moiety and a 3 ’-methylene blue (MB) redox reporter moiety.

[0247] In some embodiments, the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises a 5 ’ -thiol moiety and a 3’-methylene blue (MB) redox reporter moiety.

[0248] In some embodiments, the detector contains one or two detecting agent(s) for HIV-1 RNA selected from the following sequences:• 5ThioMC6-D / CCAAGGCCCAGCCCTCACACA (SEQ ID NO: 1) / 3MEBLN / • / 5ThioMC6-D / CTTGTATTGTTGTTGGGTCT (SEQ ID NO:2) / 3MEBLN /

[0249] In some embodiments, the detector contains a detect agent for MS2 RNA having the sequence of / 5ThioMC6-D / TCTGGAAGTTTGCAGCTGGA (SEQ ID NO: 3) / 3MEBLN / .3. Sensor

[0250] In some embodiments, the detector of the present invention includes a plurality of sensors contained in one or reaction vessels for receiving a fluid sample from a subject, of which each sensor is specific for a target biomarker in a plurality of biomarkers as described herein. In some embodiments, the sensor is an electrochemical electrode comprising a working electrode and a reference electrode. In some embodiments, the working electrode in the electrochemical sensor is functionalized with at least one detecting agent specific for binding to a corresponding biomarker. In some embodiments, the sensor is configured for detecting a cyclic voltammetry (CV) signal flowing through the working electrode and / or an electrical impedance across said working electrode and the reference electrode, in response to interaction of the functionalized electrode with the target biomarker in the fluid sample, and generating signals in response to said detection. In some embodiments, the cyclic voltammetry signal is a redox current flowing through the functionalized working electrode and the reference electrode. In some embodiments, the detector further includes at least one embedded sensor chip and wherein each sensor in the plurality of sensors is configured to be in communication with the embedded sensor chip(s).

[0251] In some embodiments, the respective sensor contains an electrode comprising one or more materials selected from the group consisting of gold, conductive carbon, platinum, palladium, stainless steel, tin, tungsten, titanium, copper, nickel, or any combination thereof. In some embodiments, a coating layer made of gold is formed on the surface of the electrode.

[0252] In some embodiments, the detector comprises a readily available off-the-shelf sensor strip with a gold working electrode (Z&P) that has been used for the conjugation of at least one specific detecting agent, i.e., an antibody, an antigen or an antisense oligonucleotide probe. In some embodiments, the sensor strip includes a screen-printed electrode that includes at least two electrodes including a sensing electrode and areference electrode. The first electrode is a sensing electrode made from gold electrode coated with the molecular probes and the second Ag / AgCl electrode acts as a reference electrode. In some embodiments, the electrode is in communication with a potentiostat reader for analysing signals received by the electrode. In some embodiments, a readily available SensitSmart potentiostat reader (PalmSens) is disclosed herein for point-of-care (POC) voltammogram reading.

[0253] In some embodiments, the detector can include one or more reaction vessels containing a plurality of sensors, each of which is configured for detecting a different biomarker, such as the p24, p24 antibody, HIV-1 RNA and MS2 RNA disclosed herein. The detection of the HIV biomarkers can be multiplexed with relevant biomarkers for determining the HIV infection status of the subject.

[0254] In some embodiments, the respective sensor detects the presence or absence of the corresponding biomarker by using cyclic voltammetry (CV) scan; wherein the concentration of the corresponding biomarker is measured as a function of change in CV current peak.

[0255] In some embodiments, the embedded sensor chip analyzes CV scan data for each corresponding biomarker in the plurality of biomarkers collected from the respective sensor in the plurality of sensors, wherein the CV scan data comprises a set of CV currents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

[0256] In some embodiments, the respective sensor for p24 has a limit of detection (LOD) of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml. In some embodiments, the respective sensor for p24 has a linear detection range of 0 to 1 x 105pg / ml.

[0257] In some embodiments, the respective sensor for anti-p24 antibody has an LOD of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml. In some embodiments, the respective sensor for anti-p24 antibody has a linear detection range of 0 to 1 x 105pg / ml.

[0258] In some embodiments, the respective sensor for HIV-1 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml. In some embodiments, the respective sensor for HIV-1 RNA has a linear detection range of 0 to 1 x 107copies / ml.

[0259] In some embodiments, the respective sensor for MS2 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml. In some embodiments, the respective sensor for MS2 RNA has a linear detection range of 0 to 1 x 107copies / ml.

[0260] In some embodiments, the detector further comprises a potentiostat reader, wherein the potentiostat reader is configured to communicate with each respective sensor in the plurality of sensors to collect CV scan data for the corresponding biomarker in the plurality of biomarkers, wherein the CV scan data comprises a set of CV currents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

[0261] In some embodiments, the surface of a working electrode in a sensor is functionalized to be conjugated to at least one specific detecting agent for a corresponding biomarker in the fluid sample. In some embodiments, various concentrations of the detecting agent(s) including antigens, antibodies and nucleic acid probes and various incubation times are used for the sensor conjugation to provide the best electrochemical signal or response during detecting. A variety of techniques known in the art can be employed for conjugating detecting agents to an electrode. Non-limiting examples of the conjugation techniques include surface activation with moieties such as thiol functional groups followed by EDC / NHS coupling, click chemistry, conjugation linkers such as DSSTP, biotin-streptavidin, or thiol substitution. In some embodiments, the EDC coupling is used for conjugating a detecting agent to the surface of an electrode. Exemplary disclosures of the conjugation techniques including the EDC coupling are provided in US 20020081588 Al; US 20220229010 Al; US 20230036979 Al; and Gilles, M. A. et al., Analytical Biochemistry, 1990, 184(2): 244-248; each of which is incorporated herein by reference in its entirety.

[0262] In some embodiments, the functionalization of the working electrode is accomplished by chemical treatment of the surface of the working electrode using a hydrophilic agent having a hydrophilic group. When the material of the working electrode is gold or platinum, examples of the hydrophilic agent include 2-mercaptoethanesulfonic acid, 2-amino-l -ethanethiol, and 3 -mercaptopropionic acid. These hydrophilic agents have in a molecule a functional group that can be selectively combined with gold orplatinum, and thus by only applying a solution containing these hydrophilic agents to the bottom surface of the liquid bath, it is possible to selectively apply chemical treatment to only the surface of the working electrode.

[0263] When the hydrophilic agent is, for instance, 2-amino-l -ethanethiol or 3- mercaptopropionic acid, it is also possible to use the active amino group or the carboxyl group introduced onto the working electrode as anchor molecules in the process of binding treatment of a capture detecting agents such as polypeptides or nucleic acid probes onto the working electrode, which will be performed later.

[0264] In some embodiments, a gold electrode is incubated with 5 mM concentration of 3 -mercaptopropionic acid and then with 5 pg / ml concentration of a detecting agent.

[0265] In some embodiments, each of the detecting agents specific for p24, anti-p24 antibody, HIV-RNA and MS2 RNA is conjugated to the surface of a working electrode in the respective sensor.

[0266] In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with from about 1 pg / ml to about 10 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 1 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 2 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 3 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 4 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 6 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 7 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 8 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 9 pg / ml of the detecting agent. Insome embodiments, the conjugation of the detecting agent for p24 is accomplished by incubating the sensor with about 10 pg / ml of the detecting agent.

[0267] In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with from about 1 pg / ml to about 10 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 1 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 2 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 3 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 4 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 6 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 7 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 8 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 9 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for anti-p24 antibody is accomplished by incubating the sensor with about 10 pg / ml of the detecting agent.

[0268] In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with from about 1 pg / ml to about 10 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 1 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 2 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 3 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating thesensor with about 4 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 6 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 7 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 8 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 9 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 10 pg / ml of the detecting agent.

[0269] In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with from about 1 pM to about 5 pM of the detecting agent(s) for HIV-1 RNA. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with from about 5 pM to about 10 pM of the detecting agent(s) for HIV-1 RNA. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with from about 10 pM to about 15 pM of the detecting agent(s) for HIV-1 RNA. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with from about 15 pM to about 20 pM of the detecting agent(s) for HIV-1 RNA.

[0270] In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for HIV-1 RNA.

[0271] In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for HIV-1 RNA. In some embodiments, the conjugation of the detecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 5 pM of the detecting agent(s) for HIV-1 RNA. In some embodiments, the conjugation of thedetecting agent for HIV-1 RNA is accomplished by incubating the sensor with about 10 pM of the detecting agent(s) for HIV-1 RNA. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with from about 1 pg / ml to about 10 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 1 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 2 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 3 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 4 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 6 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 7 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 8 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 9 pg / ml of the detecting agent. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 10 pg / ml of the detecting agent.

[0272] In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with from about 1 pM to about 5 pM of the detecting agent(s) for MS2 RNA. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with from about 5 pM to about 10 pM of the detecting agent(s) for MS2 RNA. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with from about 10 pM to about 15 pM of the detecting agent(s) for MS2 RNA. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with from about 15 pM to about 20 pM of the detecting agent(s) for MS2 RNA.

[0273] In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for MS2 RNA.

[0274] In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for MS2 RNA. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 5 pM of the detecting agent(s) for MS2 RNA. In some embodiments, the conjugation of the detecting agent for MS2 RNA is accomplished by incubating the sensor with about 10 pM of the detecting agent(s) for MS2 RNA.

[0275] Binding of a specific target analyte, z.e., a corresponding biomarker, to the respective detecting agent on the sensor surface is referred to as specific binding. By contrast, binding of a interfering species other than the target analyte to the detecting agent on the sensor surface is referred to as non-specific binding. In some embodiments, the cross-reactivity response resulting from the non-specific binding is subtracted out of the specific binding response through appropriate logic circuits or algorithms. In some embodiments, the sensors of the detector are optimized and configured to minimize nonspecific binding between the respective detecting agent(s) and the corresponding target biomarker. In some embodiments, the detector as well as protocol for functionalization of sensors has to be empirically tested for non-specific binding and cross-reactivity and the response of the sensor should be characterized in order to optimize the sensitivity, specificity and accuracy of the detection.IV. Method for diagnosing HIV infection in a subject

[0276] In one aspect, the multiplex detecting platform and detector described herein can be used in methods for diagnosing human immunodeficiency virus (HIV) infection status in a subject.

[0277] In some embodiments, the methods of the present invention provide for diagnosing the HIV infection status in a subject, comprising:a) receiving, into the detector, the sample of the subject; wherein the detector comprises a plurality of detecting agents, wherein each respective detecting agent in the plurality of detecting agents is specific for a corresponding biomarker in a plurality of biomarkers, a respective sensor for each corresponding biomarker in the plurality of biomarkers, and one or more reaction vessels that contain the plurality of detecting agents; b) contacting, in the detector, the sample with the plurality of detecting agents under suitable conditions wherein each respective detecting agent in the plurality of detecting agents is configured to specifically bind to the corresponding biomarker in the plurality of biomarkers; c) detecting the plurality of biomarkers in the sample by the plurality of detecting agents; and d) determining the HIV infection status of the subject.

[0278] In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. Exemplary non-human mammals include but are not limited to bovines, rats, mice, dogs, monkeys, goat, sheep, cows, and deer.

[0279] In some embodiments, the sample is a liquid biopsy sample, such as a blood, a urine or a saliva sample. In some embodiments, the sample is a plasma sample, a serum sample, or a whole blood sample.

[0280] In one aspect, the plurality of biomarkers including p24 antigen, anti-p24 antibody, HIV-1 RNA, and MS2 RNA are used in a method for diagnosing HIV infection status in a subject, when MS2 RNA is used as a control for monitoring efficiency of sample processing. In some embodiments, the detection of at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample indicates HIV infection in the subject.

[0281] In some embodiments, HIV infection in the subject is indicated when MS2 RNA and at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA are detected in the sample. In another embodiment, no HIV infection is indicated when less than two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the plurality of biomarkers are detected in the sample. In another embodiment, no HIV infection is indicated when MS2 RNA and less than two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the plurality of biomarkers are detected in the sample. In yet another embodiments, no definitive conclusion can be drawn on the HIV infection status of the subject when less than two of p24 antigen, anti-p24 antibody, and HIV-1 RNA are detected in the sample. In yetanother embodiments, no definitive conclusion can be drawn on the HIV infection status when MS2 RNA is not detected in the sample.

[0282] In some embodiments, when the sample was obtained from the subject during eclipse period (about 10 days post infection) since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0283] In some embodiments, when the sample was obtained from the subject during acute HIV infection period (about 10 to 28 days post infection) since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0284] In some embodiments, when the sample was obtained from the subject during early HIV infection period (about 28 to 70 days and beyond post infection) since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0285] In some embodiments, when the sample was obtained from the subject after early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0286] In some embodiments, when the sample was obtained from the subject between about Day 0 and about Day 28, or between about Day 10 and about Day 28, since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

[0287] In some embodiments, when the sample was obtained from the subject between about Day 28 and about Day 70, or after about Day 70, since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

[0288] In some embodiments, the fluid sample is diluted before being received into the detector and dispensed into at least one reaction vessel in the detector. In some embodiments, the sample is not diluted before being received into the detector.

[0289] In some embodiments, once collected, the sample is dispensed directly into at least one reaction vessel in the detector for biomarker detection without being pre- processed outside the detector. In some embodiments, the sample is divided and dispensed into more than one reaction vessels in the detector, each reaction vessel being for detecting a subset of the plurality of the biomarkers.

[0290] In some embodiments, in order to isolate the RNA biomarkers for detection, the sample undergoes viral lysis treatment in a reaction vessel(s) of the detector such that the genetic materials of the target virus including RNA biomarkers can be in fluid contact with their respective detecting agents. In some embodiments, the sample is treated with at least one RNA lysis buffer in the reaction vessel(s) to extract and isolate the RNA in the sample. The lysis buffer disrupts any viral membrane and elute the RNA directly from the sample into the test solution.

[0291] In some embodiments, the viral lysis treatment further includes treating the sample with proteinase K. Proteinase K treatment can break the proteinaceous viral capsid membrane leading to the extraction of the viral genetic materials for subsequent analyses. In some embodiments, the RNA lysis buffer for the viral lysis treatment is selected from the group consisting of: a buffer comprising about 1 mg / ml proteinase K, about 0.5 % sodium dodecyl sulfate, and about 10 mM dithiothreitol; a radioimmunoprecipitation assay (RIP A) lysis buffer; and a buffer comprising guanidine isothiocyanate.

[0292] In some embodiments, in order to isolate the protein biomarkers for detection, the sample is admixed with a suspension buffer in a different reaction vessel(s) from the reaction vessel(s) for RNA biomarker detection . In some embodiments, the suspension buffer comprises about 0.5% triton X-100. In some embodiments, the suspension buffer further includes ferricyanide / ferrocyanide salts to improve the electron transfer in the suspension buffer in presence of the target analyte and eventually improve the sensitivity of the sensor.EXAMPLESEXAMPLE 1 - ELECTROCHEMICAL SENSING PLATFORM FOR SELECTIVE AND SENSITIVE MULTIPLEXED DETECTION OF ACTIVE HIV-1 INFECTION

[0293] Rationale. In order to efficiently differentiate active HIV infected samples from the VISP populations, molecular detection of HIV is of utmost importance. However, the highly active antiretroviral therapy (HAART) and pre-exposure prophylaxis (PrEP) therapies can lead to very low and undetectable viral loads which can cause false negative results in molecular test. Most HIV tests, therefore, rely on fourth generation EIA targets, z.e., p24 antigen and anti-p24 IgG antibody, to detect HIV as they are directly linked tothe active infection and are not related to HIV vaccine peptides / proteins. Although the fourth generation EIA targets give promising results in differentiating VISP populations from the actively infected ones in some cases, these tests often are misleading during the eclipse and early period of the viral transmission. Hence, the urgent and unmet clinical need is in the multiplexed detection of viral antigen, antibody and RNA which will have the ability to efficiently differentiate active HIV infection from the VISP populations. The tests should have high sensitivity and specificity to determine the condition even during the eclipse period.

[0294] Methods. To accelerate the commercialization of the technology, a readily available off-the-shelf sensor strip with a gold working electrode (Z&P) was used for the conjugation of specific capturing probes, z.e., antibodies, antigen and antisense oligonucleotides (ODNs). Here the screen-printed electrode that includes at least two electrodes was used to develop the biosensor strip. The first electrode was a sensing electrode made from gold electrode coated with the molecular probes and the second Ag / AgCl electrode acted as a reference electrode. A readily available SensitSmart potentiostat (PalmSens) was used for POC voltammogram reading.

[0295] (Objective la) Suitable functionalization of the gold electrodes towards the detection of p24 antigen: As illustrated in the data, the gold surface of the electrodes was first functionalized with 5 mM concentration of 3 -mercaptopropionic acid and then with 5 pg / ml concentration of anti-HIV-1 p24 IgG antibody (abeam) via a l-ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDC) coupling method. These sensors were then used to detect p24 antigen suspended in IX PBS buffer at different concentrations ranging from 100 ng / mL to 1 pg / mL (Figure 2a). Figure 2b shows the standard curve for detecting p24 protein using cyclic voltammetry. The p24 protein was found to be linearly proportional with the change in CV current with an R2 value of 0.933. This sensor was capable of detecting p24 antigen with a LOD of 1 pg / mL.

[0296] (Objective lb) Optimum functionalization of the gold electrodes towards the detection of anti-p24 antibody: In a similar fashion, the gold electrodes were functionalized with 5 mM concentration of 3 -mercaptopropionic acid and then with 5 pg / ml concentration of p24 antigen (abeam) via an EDC coupling method. The same promising results were achieved in detecting the anti-p24 antibody in IX PBS buffer with LOD <1 pg / mL (Figure 2c). Figure 2d depicts the standard curve for detecting the anti- p24 antibody with an R2 value of 0.907.

[0297] (Objective 1c) Suitable modification of gold electrodes with HIV-1 RNA selective antisense oligonucleotide: Separately, to target the HIV-1 RNA selectively from blood plasma pool, antisense oligonucleotide (ODN) functionalized sensor strips were used. In this regard, complete genome sequence of HIV-1 (NCBI AF033819.3) were selected and predicted multiple ODN sequences. It has already been discovered that the ODNs targeting towards viral protein R and envelope surface protein of HIV- 1 have the optimum binding and disruption energies (Figure 3a). These ODNs were then custom synthesized with a 5 ’-thiol group and 3 ’-methylene blue redox reporter and functionalized with the gold electrode at 10 pM concentration. A change in distance of the redox molecule from gold electrodes was anticipated post ODN hybridization with its target RNA which will bring change in its cyclic voltammogram (Figure 3b). The results demonstrated that 0DN1 labeled with MB has better response as compared to 0DN2 labeled with MB when tested against the clinically relevant range of HIV-1 RNA (1259 copies / ml - 316,228 copies / ml) (Figure 3c). Representative change in current with change in potential with the addition of different concentrations of HIV RNA has been shown in Figure 3d. The proposed technology has the LOD of ~1.5 copies / ml when tested with different dilutions of AcroMetrix HIV-1 control sample sourced from heat inactivated HIV-1 positive plasma (Figure 3e). Thus, through a screen-printed electrochemical-based platform HIV-1 genetic material was successfully measured.

[0298] (Objective Id) Functionalization of gold electrodes with phage MS2 RNA selective ODN: In a similar approach, the phage MS2 genome (NC_001417.2) and selected the best ODN was selected for the study. MS2 RNA acted as an internal control for the assay to monitor the stability of RNA and the control of decapsulation of the viral RNA during the extraction procedure. This marker is also sensitive to the assay inhibitors. The sensor was tested, functionalized with 10 pM of MB conjugated ODN, for MS2 phage RNA with a LOD of 0.3 copies / mL (Figure 3f). Overall, this multiplexed assay has been designed to provide a robust and unbiased diagnosis of active HIV infection without any cross-interference from VISP.

[0299] (Objective le) Standardization of functionalization parameters: In this aim, the conjugation protocol was optimized by functionalizing the sensor surface with varying concentrations of antibody, antigen and ODN to generate the most consistent, stable and optimum current response using cyclic voltammetry. Additional optimization factors during functionalization of the gold electrodes included incubation time and depositionvolume of antibody, antigen and ODN. The successful conjugation of the molecular probes on the sensor surface was determined using Fourier Transform infrared (FT-IR), X-ray photoelectron spectroscopy (XPS), and Raman spectroscopy. The amount of the ODN conjugated to the sensor surface was detected using the Quantifluor ssDNA kit. The standardized functionalization parameters were used for the detection of p24 antigen, anti-p24 antibody, HIV-1 RNA and MS2 RNA as illustrated in objective la- Id.

[0300] (Objective If) Optimization of the cyclic voltammetry parameters: optimize scan rate, amplitude of the voltage signal and duration, range of the detected current, equilibrium time, and the number of scans is optimized and the parameters selected that provide the best response in the presence of p24 antigen, anti -HIV- 1 p24 antibody and HIV-1 RNA respectively. Once the sensor was optimized and the CV protocol was established, the sensor performance in terms of LOD, limit of quantification (LOQ), sensitivity, time of response, co-efficient of determination (R2), linear dynamic range and reproducibility was evaluated. It was expected that the system would show varying current changes from the baseline CV measurement when reacted with samples of different RNA concentrations. To establish a scale, the experiment was performed multiple times and all the test pads to be kept treated with a particular concentration of HIV in a single row for comparison. To perform the linearity test, an HIV viral RNA sample of varying concentrations was taken and pipetted out on the tube containing the sensor strip that is immersed in the lysis buffer solution.

[0301] (Objective 1g) Optimization of suspension / lysis buffer solution for sensitive detection of HIV- 1 from direct samples: As part of this aim, suitable suspension / lysis buffer solutions were developed for rapid detection of p24 antigen, anti-p24 antibody and HIV-1 RNA directly from the blood plasma samples. Optimization of this process was performed by adopting four processes. 1. Proteinase K treatment: In this process, samples were treated with an optimized concentration of proteinase K to break the proteinaceous viral capsid membrane leading to the extraction of the viral genetic materials for subsequent analyses. 2. Lysis buffer treatment: Plasma samples were treated either with RIPA (radioimmunoprecipitation assay) lysis buffer or lysis buffer containing guanidine isothiocyanate. The charged assembly for rupturing the viral membrane and exposing viral genetic materials for further analysis. The procedure providing the most desired outcome was followed. The concentration of each component of lysis buffer was optimized to achieve the maximum RNA release performance. The time of incubation ofthe sample with the lysis buffer as well as the ratio of the lysis buffer to the sample was optimized to achieve maximum RNA yields. Gel electrophoresis was performed to confirm the release of RNA after the lysis buffer treatment. The RNA extracted using the optimized lysis buffer was compared with the yield from commercially available RNA extraction methods, such as sequential centrifugation and spin column-based RNA extraction protocols. Utilizing the optimized lysis solution, a plasma sample containing HCV was tested with results available in less than five minutes.

[0302] For example, towards the estimation of protein (p24 antigen and anti-p24 Ab) concentration, plasma samples are diluted with requisite amount of 0.5% Triton X-100 (suspension buffer), whereas for estimation of RNA concentration, plasma samples are diluted with a lysis buffer solution having 0.5% sodium dodecyl sulfate, 1 mg / ml of proteinase K and 10 mM dithiothreitol. Given the contents of the suspension / lysis buffer solution, it is possible that the high salt content could interfere with the sensor stability and cyclic voltammetry measurements. Hence, the time required for baseline stabilization through multiple CV scans in the given buffer solution will be first investigated. A stable baseline measurement is required for accurate differentiation of the current change on the addition of target analyte. Suitable ratio of lysis buffer and plasma sample was therefore optimized to get the optimum RNA release performance and to achieve the best change in cyclic voltammetry response. The time of incubation of the plasma sample with lysis buffer was further investigated to achieve maximum change in voltammetry.

[0303] (Objective Ih) Cross-reactivity of the sensor against other interfering agents: The specificity of the functionalized sensors was determined against common interfering agents. While the specificity of the anti-p24 antibody functionalized sensor was tested against different clade proteins including gp41, gpl20 etc. those are commonly present in HIV vaccines, the selectivity of p24 antigen functionalized sensor was tested against other bodily produced antibodies after their seroconversion, like anti-gp41 IgM, anti- gpl20 IgG etc. On the other hand, the cross-reactivity of the ODN conjugated sensor was determined while testing the sensor against other viral RNAs, like hepatitis A / B / C, SARS-CoV-2 viruses etc. These cross-interfering agents was spiked in the control plasma samples with or without the presence of target analytes and the response of the functionalized sensors will be monitored. Due to the high selectivity of studied antigen, antibody and ODN towards their target analytes, insignificant cross-reactivity was expected from this study.

[0304] Summary of Objective 1 : This aim optimized a highly sensitive, selective and quantitative electrochemical biosensor for the diagnosis of p24 antigen, anti-p24 antibody and HIV-1 RNA directly from plasma samples. The concentration of the conjugated antibodies, antigens and ODNs to the sensor surface was first optimized to obtain reliable and stable results. The sensor was fully characterized in terms of LOD, response time, sensitivity, stability, and repeatability. This part of the study led to the optimum lysis buffer formula and sample treatment condition for RNA-extraction-free protocol for direct sample testing. The cross-reactivity study validated the sensor platform for providing robust and unbiased results.

[0305] Criteria of success: The success of constructing and optimizing the antibody, antigen and ODN conjugated sensor strips involved stable CV baseline curves through multiple scans, high repeatability, short turn-around time, and high response in the presence of the target analyte. The sensor exhibited wide dynamic range, low LOD and high sensitivity. The design of selective ODN would be the primary step behind the RNA sensing experiments for HIV-1 and MS2 phage.EXAMPLE 2 - CLINICAL DEMONSTRATION OF THE ASSAY IN DIFFERENTIATING VISP SAMPLES FROM THE ACTIVE HIV INFECTED SAMPLES

[0306] Rationale: The developed assay will be validated with clinical samples. The efficiency of the assay in differentiating VISP samples from the active HIV infected ones will be determined. The cooperativity of the assay will be determined and validated with the commercially available standard kits.

[0307] Methods: the ability of the sensing platform to accurately and reproducibly determine the presence of HIV- 1 RNA and proteins will be tested in 100 clinical blood samples obtained from vaccine trial participants, HIV-infected and uninfected individuals, and healthy controls (N=25 / group). The robustness and accuracy of the platform towards the detection of active HIV-1 will be tested in four separate groups of clinical samples: HIV positive non -treated patients, HIV positive patients receiving antiretroviral therapy (ART), HIV-negative non-vaccinated healthy controls and HIV negative undergoing vaccination trial participants. At least 25 samples from each group is to be tested to validate the multiplexed electrochemical sensing platform.

[0308] Benchmarking of obtained results. Relevant clinical data will be extracted from the de-identified subjects’ medical records, including results for HIV testing using the commercially available kits. The changes in the cyclic voltammetry current output is to be recorded to diagnose the samples. To estimate the test accuracy, sensitivity and specificity, the results with the commercially available serological kits as well as gold standard RT-PCR kits will be benchmarked. G* Power will be employed for sample size estimation and Bland-Altman analysis will be used to determine the: (1) agreement between “biosensor” and markedly available tests, (2) bias between methods as a function of viral load and (3) reproducibility of “biosensor” methods for identical samples. The statistical significance, reproducibility, sensitivity, LOD, TOR, coefficient of determination (R2) and linear detection range will be calculated using clinical samples.

[0309] Statistical Analysis: TPR (true positive rate), TNR (true negative rate), FPR (false positive rate), FNR (false negative rate) will be calculated according to the following equations: TPR=TP / (TP+FN). TNR=TN / (FP+TN). FNR=FN / (TP+FN).FPR=FP / (FP+TN) where, TP: total number of true positives. TN: total number of true negatives. TN: total number of true negatives. FN: total number of false negatives.

[0310] Summary of Objective: the accuracy, sensitivity and specificity of the multiplexed electrochemical biosensor in diagnosing active HIV-1 from direct clinical samples differentiating them from the VISP populations will be evaluated. SOPs for all the assays demonstrated herein will be developed.

[0311] Criteria of Success: The multiplexed electrochemical biosensor is expected to demonstrate high sensitivity and specificity of >99%, Pearson’s coefficient>0.9, and R2>0.85 when the results are benchmarked to the commercially available serological tests and gold standard RT-PCR. The test is expected to show no cross-reactivity to other proteins, antibodies, viral RNAs related to other pathogens those might be available in the clinical samples.EXAMPLE 3 - ELECTROCHEMICAL SENSOR FOR SELECTIVE AND SENSITIVE MULTIPLEXED DETECTION OF ACTIVE HIV-1 INFECTION

[0312] A readily available off-the-shelf sensor strip with a gold working electrode (Z&P) was used for the conjugation of specific capturing probes, z.e., antibodies, antigen and antisense oligonucleotides (ODNs). The gold sensor strips were first functionalized with 3 -mercaptopropionic acid and then EDC coupled either with anti -HIV p24 antibody or p-24 antigen. The anti-HIV p24 antibody functionalized sensors were used for the detection of p24 antigen in plasma samples, whereas the p-24 antigen functionalized sensors strips were utilized for the detection of anti-HIV p24 antibodies in the plasma samples after the seroconversion of p24 antigens within 28 days of infection. Figure 2b shows the standard curve for detecting p24 protein using cyclic voltammetry. The p24 protein was found to be linearly proportional with the change in CV current with an R2 value of 0.933. The sensor was capable of detecting p24 protein with a limit of detection (LOD) of 1 pg / mL. The same promising results were achieved in detecting the anti-p24 antibody with LOD <1 pg / mL. Figure 2d depicts the standard curve for detecting the anti-p24 antibody with an R2 value of 0.907.

[0313] Separately, to target the HIV-1 RNA selectively from blood plasma pool, antisense oligonucleotide (ODN) functionalized sensor strips were used. In this regard, the complete genome sequence of HIV-1 (NCBI AF033819.3) were selected and multiple ODN sequences were predicted through Soligo software. The choice of anti-sense oligo design has been guided by the following filter criteria: 1. Oligo length - Anti-sense oligos typically should be about 20 nucleobases long. It is critical that the anti-sense oligo does not bind, even partially, to a non-target RNA and therefore the following criteria primarily depend either on the tertiary structure of the ODN or on the binding and disruption energies of the ODNs with their target sequences at 37 °C and 1 M NaCl condition. These criteria are: 2. GC content - Ideally it will be around: 40% <= GC % <= 60%. 3. Formation of Tetraplexes within Anti-Sense Oligo - No GGGG in the target sequence as anti-sense oligos containing either single GGGG runs or repeated GG or GGG runs in close proximity can form intra-strand tetraplexes (single structures of four strands). 4. Antisense Activity - The sequences will then be analyzed according to their binding affinity and disruption energy to the genetic sequences of choice. The ODNs which will have optimum GC content with better binding and disruption energy will be selected. In this study, it has been found the ODNs targeted towards viral protein R and envelope surface protein of HIV- 1 have the optimum binding and disruption energies (Figure 3a). It is important to note that while 0DN1 targets viral protein R (vpr gene) of HIV, which plays an important role in regulating nuclear import of the HIV-1 preintegration complex and is required for virus replication in non-dividing cells such as macrophages, the other 0DN2 targets the envelope surface protein (Env gene) of HIV- 1 which is crucial to viral infectivity for binding to the CD4 and chemokine receptorspresent on T cells and for driving membrane fusion. These ODNs are then be custom synthesized with a 5 ’-thiol group and 3 ’-methylene blue redox reporter. The ODN sequences are:

[0314] ODN1 : / 5ThioMC6-D / CCAAGGCCCAGCCCTCACACA (SEQ ID NO:1) / 3MEBLN /

[0315] ODN2: / 5ThioMC6-D / CTTGTATTGTTGTTGGGTCT (SEQ ID NO:2) / 3MEBLN /

[0316] In a similar approach, the phage MS2 genome (NC_001417.2) was considered and the best ODN was selected for the study. MS2 RNA will act as an internal control for the assay to monitor the stability of RNA and the control of decapsulation of the viral RNA during the extraction procedure. This marker is also sensitive to the assay inhibitors. The 0DN3 sequence for MS2 RNA is:

[0317] 0DN3 : / 5ThioMC6-D / TCTGGAAGTTTGCAGCTGGA (SEQ ID NO:3) / 3MEBLN /

[0318] These were subsequently used for sensing purposes using an electrochemical sensor strip. Change in distance of the redox molecule from gold electrodes post ODN hybridization with its target RNA is expected, which will result in change in its cyclic voltammogram. The change in the cyclic voltammetry (CV) curve response of the sensor before and after the conjugation with the molecular probe confirms the successful conjugation of the ODN-MB to the sensor surface (Figure 3b). It is hypothesized that on sample addition, HIV-1 viral RNA binds to the ODN and stretches out its structure, thus increasing the distance between methylene blue and the sensor electrodes which affects the flow of current. This decrease in current due to increased distance between the charged redox molecule and the gold electrodes is measured using cyclic voltammetry (CV). The experiment results demonstrated that 0DN1 labeled with MB has a better response compared to 0DN2 labeled with MB when tested against the clinically relevant range of HIV-1 RNA as illustrated above (1259 copies / ml - 316,228 copies / ml) (Figure 3c). The subject technology had the limit of detection of ~1.5 copies / mL when tested with different dilutions of AcroMetrix HIV-1 high control sample sourced from heat inactivated HIV-1 positive plasma (Figure 3e). Therefore, using a screen-printed electrochemical -based platform was successful in quantitatively measuring HIV-1 genetic material. A linear fall in current change was observed with increased addition of RNAconcentration which is represented by the CV curve measured by the potentiostat reader device (Figure 3d). The sensor for MS2 phage RNA was tested with a limit of detection of 0.3 copies / mL (Figure 3f). The POC device thus includes a sensor configured to measure the HIV-1 viral RNA and MS2 RNA in a sample and a communication module configured to report the output from the sensor.EXAMPLE 4 - ELECTROCHEMICAL DETECTOR FOR HIV INFECTION

[0319] The invention of the present disclosure herein lies in the development of a multianalyte detection approach that utilizes electrochemical sensing techniques to develop a panel of four different biomarkers, z.e., 1) p24 antigen, 2) anti-HIV-1 p24 antibody, 3) viral HIV-1 RNA and 4) MS2 bacteriophage RNA. The multiplexed biomarkers are selected in such a way that the sensor will be able to provide true-positive HIV infection information without any interference from VISP / VISR patient samples undergoing HIV vaccination trials. Because of the unique design and through choice of the biomarkers, the assay is expected to be sensitive enough to monitor active HIV infection throughout the period from its viral transmission to day 70 and beyond. While the assay will show positive response for HIV-1 RNA and p24 antigen during the period from transmission to day 28, HIV-1 RNA and anti-p24 IgG antibody will show positive response from day 28 to day 70 and beyond. As such, for a true infection, this multiplexed assay, as demonstrated in Figure 4, will be able to provide positive responses from two biomarkers at a time, z.e., p24 antigen and viral RNA (for window 0 to 28 days) and viral RNA and anti-p24-IgG (for window 28 to 70 days). The unique features of the multiplexed assay are modularity, portability, requirement of low reagent, and high sensitivity. These qualities make the integrated system suitable for POC applications. The detection method utilizes high-affinity antibodies for specific sensing of p24 antigen. The change in electron transport in presence of the complementary antigen and antibody affects the current flow and demonstrates a change in cyclic voltammetry peak measured by a handheld potentiostat reader device (Figure 2). The detection limit of p24 antigen and anti-p24 antibody for the assay has been found to be 1 pg / ml and 0.5 pg / ml respectively which is well within the expected clinical range for HIV infected populations. To achieve molecular targeting, antisense oligonucleotides (ODNs) were designed in silico to target 5131 ®5151 and 6662®6681 segments of the HIV-1 genome. An RNA extraction-free technique was also developed that utilized a lysis buffer solutionto disrupt the viral membrane and elute the RNA directly from the biological samples into the test medium. The detection method utilizes a unique combination of highly specific ODNs and cyclic voltammetry for the selective and sensitive detection of the HIV-1 viral RNA and MS2 bacteriophage RNA as an internal control sensitive to assay inhibitors. The thiolated ODN binds to the gold electrodes on the sensor surface which are preconjugated with methylene blue (MB), acting as a redox reporter molecule. The ODNs undergo stretching in the presence of its target HIV-1 RNA sequence due to RNA-DNA hybridization thus increasing the distance between the redox molecule and the gold electrode (Figure 3b). This increase in distance inversely affects the current flow and demonstrates a decrease in the cyclic voltammetry peak measured by the potentiostat reader device. Preliminary data showed that the sensor can detect the specific target nucleic acid sequence without any signal crosstalk with a detection limit of 3.07 logio copies / mL. Thus, the overarching goal of this project is to support the development of a next-generation multiplexed combinatorial serological and nucleic acid assay that can identify HIV-1 infection while avoiding false-positive results due to VISP, with high sensitivity and specificity.

[0320] To the best of the inventors’ knowledge, there have been no reports to date of a commercial POC multiplexed molecular and serological test that is based on selective electrochemical sensing of HIV-1 RNA and protein markers respectively. The present invention has the potential for rapid translation as the base sensor and the reader are off- the-shelf and available commercially. The sensing platform is envisioned to be translated into a potential rapid home-based molecular test that will consist of (1) a collection tube that will collect the blood sample directly taken from a patient; (2) plasma will be isolated with a one-step isolation device. Commercially available membranes will be used for one-step plasma separation from whole blood without the need for centrifugation. Blood samples will be added to the commercially available membrane for one-step plasma separation; (3) Plasma sample will be automatically divided into two different channels having two different buffers: (a) for estimation of protein concentration, plasma samples will be diluted with requisite amount of 0.5% triton X-100 suspension buffer, whereas (b) for estimation of RNA concentration, plasma samples will be diluted with a lysis buffer solution having 0.5% sodium dodecyl sulfate, 1 mg / ml of proteinase K and 10 mM dithiothreitol; (4) a embedded sensor chip will then analyze the cyclic voltammogram of the suitably functionalized sensors in absence and presence of their target analyte, (5) abattery-operated base reader will display the real-time results to the user in numeric format which can be wirelessly transmitted to an app installed in a mobile device (Figure 4). Overall, it is envisaged that with the device prototype can easily be translated from the laboratory to the commercial arena to successfully differentiate active HIV populations from the VISP ones.

[0321] The present invention further includes a Bluetooth-enabled sensing kit and the user interface as demonstrated in Figure 4. The kit is a reader kit consisting of the portable potentiostat and a disposable sample kit consisting of the blood pricking device, plasma isolation device, cassette containing suspension and lysis buffer and electrochemical strips. It is envisaged that the blood samples will undergo the plasma isolation device where plasma will be isolated from blood in one-step and added to the multi-channel chamber. The plasma will then be automatically divided into four channels where two of them will be mixed with suspension buffer and the other two will be admixed with lysis buffer for RNA isolation. Two sensor strips, those are inserted into the suspension buffer chamber, will be used to monitor the levels of p24 antigen and anti-p24 antibody. The other two sensor strips, those are inserted into the lysis buffer chamber, will be used to monitor the RNA level. The MS2 RNA will be used as an internal control for the study envisioned herein. The change in cyclic voltammogram will then be read by a portable potentiostat which will wirelessly transmit the data to the healthcare facilities. The reader will also be integrated with a user-friendly smartphone app that can auto populate kit specific details such as unique device ID, lot number, manufacturing date etc., by scanning the QR code on the sample kit. The app will be designed to display the final test report with patient ID, test date, p24 antigen concentration, anti-p24 IgG antibody quantity, viral copy number (RNA) and a qualitative (Positive / Negative) result within a few minutes while differentiating the VISP populations from the actively infected ones.References

[0322] (1) Bonacci, R. A.; Holtgrave, D. R. U.S. HIV Incidence and TransmissionGoals, 2020 and 2025. American Journal of Preventive Medicine 2017, 53 (3), 275-281. https: / / doi.Org / 10.1016 / j.amepre.2017.03.012.

[0323] (2) Bhaskaran, K.; Rentsch, C. T.; MacKenna, B.; Schultze, A.; Mehrkar, A.;Bates, C. J.; Eggo, R. M.; Morton, C. E.; Bacon, S. C. J.; Inglesby, P.; Douglas, I. J.;Walker, A. J.; McDonald, H. I.; Cockbum, J.; Williamson, E. J.; Evans, D.; Forbes, H. J.; Curtis, H. J.; Hulme, W. J.; Parry, J.; Hester, F.; Harper, S.; Evans, S. J. W.; Smeeth, L.; Goldacre, B. HIV Infection and COVID-19 Death: A Population-Based Cohort Analysis of UK Primary Care Data and Linked National Death Registrations within the OpenSAFELY Platform. The Lancet HIV 2021, 8 (1), e24-e32. https: / / doi.org / 10.1016 / S2352-3018(20)30305-2.

[0324] (3) Gbeasor-Komlanvi, F. A.; Zida-Compaore, W. I. C.; Sadio, A. J.;Tchankoni, M. K.; Kadangha, B. M.; Salou, M.; Dagnra, A. C.; Ekouevi, D. K. HIV Testing Uptake and Prevalence among Hospitalized Older Adults in Togo: A Cross- Sectional Study. PLOS ONE 2021, 16 (2), e0246151. http s : / / doi . org / 10.1371 / j ournal .pone.0246151.

[0325] (4) Onyango, D. O.; van der Sande, M. A. B.; Musingila, P.; Kinywa, E.;Opollo, V.; Oyaro, B.; Nyakeriga, E.; Waruru, A.; Waruiru, W.; Mwangome, M.; Macharia, T.; Young, P. W .; Junghae, M.; Ngugi, C.; de Cock, K. M.; Rutherford, G. W. High HIV Prevalence among Decedents Received by Two High-Volume Mortuaries in Kisumu, Western Kenya, 2019. PLOS ONE 2021, 16 (7), e0253516. https: / / doi.org / 10.1371 / journal.pone.0253516.

[0326] (5) Ng’uni, T.; Chasara, C.; Ndhlovu, Z. M. Major Scientific Hurdles in HIVVaccine Development: Historical Perspective and Future Directions. Frontiers in Immunology 2020, 11. https: / / doi.org / 10.3389 / fimmu.2020.590780.

[0327] (6) Pitisuttithum, P.; Marovich, M. A. Prophylactic HIV Vaccine: VaccineRegimens in Clinical Trials and Potential Challenges. Expert Review of Vaccines 2020, 79 (2), 133-142. https: / / doi.org / 10.1080 / 14760584.2020.1718497.

[0328] (7) Ward, A. R.; Mota, T. M.; Jones, R. B. Immunological Approaches to HIVCure. Seminars in Immunology 2021, 57, 101412. https: / / doi.Org / 10.1016 / j.smim.2020.101412.

[0329] (8) Palli, R.; Seaton, K. E.; Piepenbrink, M. S.; Hural, J.; Goepfert, P. A.;Laher, F.; Buchbinder, S. P.; Churchyard, G.; Gray, G. E.; Robinson, H. L.; Huang, Y.; Janes, H.; Kobie, J. J.; Keefer, M. C.; Tomaras, G. D.; Thakar, J. Impact of Vaccine Type on HIV-1 Vaccine Elicited Antibody Durability and B Cell Gene Signature. Scientific Reports 2020, 10 (1), 13031. https: / / doi.org / 10.1038 / s41598-020-69007-w.

[0330] (9) Kerneis, S.; Launay, O.; Turbelin, C.; Batteux, F.; Hanslik, T.; Boelle, P -Y. Long-Term Immune Responses to Vaccination in HIV-Infected Patients: A Systematic Review and Meta-Analysis. Clinical Infectious Diseases 2014, 58 (8), 1130-1139. https: / / doi.org / 10.1093 / cid / cit937.

[0331] (10) Fearon, M. The Laboratory Diagnosis of HIV Infections. Canadian Journal of Infectious Diseases and Medical Microbiology 2005, 16 (1), 26-30. https: / / d0i.0rg / l 0.1155 / 2005 / 515063.

[0332] (11) Voronin, Y.; Zinszner, H.; Karg, C.; Brooks, K.; Coombs, R.; Hural, J.;Holt, R.; Fast, P.; Allen, M.; Allen, M.; Busch, M.; Fast, P.; Fruth, U.; Golding, H.; Khurana, S.; Mulenga, J.; Peel, S.; Schito, M.; Voronin, Y.; Barnabas, N.; Bentsen, C.; Graham, B.; Gray, G.; Levin, A.; McCluskey, M.; O’Connell, R.; Snow, B.; Ware, M. HIV Vaccine-Induced Sero-Reactivity: A Challenge for Trial Participants, Researchers, and Physicians. Vaccine 2015, 33 (10), 1243-1249. https: / / doi.Org / 10.1016 / j.vaccine.2014.10.040.

[0333] (12) Hauser, J. R.; Hong, H.; Babady, N. E.; Papanicolaou, G. A.; Tang, Y.-W.False-Positive Results for Human Immunodeficiency Virus Type 1 Nucleic Acid Amplification Testing in Chimeric Antigen Receptor T Cell Therapy. Journal of Clinical Microbiology 2019, 58 (1). https: / / doi.org / 10.1128 / JCM.01420-19.

[0334] (13) Khurana, S.; Needham, J.; Park, S.; Mathieson, B.; Busch, M. P.; Nemo,G.; Nyambi, P.; Zolla-Pazner, S.; Laal, S.; Mulenga, J.; Chomba, E.; Hunter, E.; Allen, S.; McIntyre, J.; Hewlett, I.; Lee, S.; Tang, S.; Cowan, E.; Beyrer, C.; Altfeld, M.; Yu, X. G.; Tounkara, A.; Koita, O.; Kamali, A.; Nguyen, N.; Graham, B. S.; Todd, D.; Mugenyi, P.; Anzala, O.; Sanders, E.; Ketter, N.; Fast, P.; Golding, H. Novel Approach for Differential Diagnosis of HIV Infections in the Face of Vaccine-Generated Antibodies. J AIDS Journal of Acquired Immune Deficiency Syndromes 2006, 43 (3), 304-312. https: / / doi.Org / 10.1097 / 01.qai.0000242465.50947.5f

[0335] (14) Christine Durier, C. D. Long-Term Persistence of Vaccine-Induced HIVSeropositivity in Healthy Volunteers. Journal of AIDS & Clinical Research 2014, 05 (02). https: / / doi.org / 10.4172 / 2155-6113.1000275.

[0336] (15) Ackerman, M. E.; Barouch, D. H.; Alter, G. Systems Serology forEvaluation of HIV Vaccine Trials. Immunological Reviews 2017, 275 (1), 262-270. https: / / doi.org / 10.! 11 l / imr.12503.

[0337] (16) Alexander, T. S. Human Immunodeficiency Virus Diagnostic Testing: 30Years of Evolution. Clinical and Vaccine Immunology 2016, 23 (4), 249-253. https: / / doi.org / 10.1128 / CVI.00053-16.

[0338] (17) Giinthard, H. F.; Saag, M. S.; Benson, C. A.; del Rio, C.; Eron, J. J.;Gallant, J. E.; Hoy, J. F.; Mugavero, M. J.; Sax, P. E.; Thompson, M. A.; Gandhi, R. T.; Landovitz, R. J.; Smith, D. M.; Jacobsen, D. M.; Volberding, P. A. Antiretroviral Drugs for Treatment and Prevention of HIV Infection in Adults. JAMA 2016, 316 (2), 191. https: / / doi.org / 10.1001 / jama.2016.8900.

[0339] (18) Albert, J.; Berglund, T.; Gisslen, M.; Grbbn, P.; Sonnerborg, A.; Tegnell,A.; Al exanders son, A.; Berggren, I.; Blaxhult, A.; Brytting, M.; Carlander, C.; Carlson, J.; Flamholc, L.; Follin, P.; Haggar, A.; Hansdotter, F.; Josephson, F.; Karlstrbm, O.; Liljeros, F.; Naver, L.; Pettersson, K.; Johansson, V. S.; Svennerholm, B.; Tunback, P.; Widgren, K. Risk of HIV Transmission from Patients on Antiretroviral Therapy: A Position Statement from the Public Health Agency of Sweden and the Swedish Reference Group for Antiviral Therapy. Scandinavian Journal of Infectious Diseases 2014, 46 (10), 673-677. https: / / doi.org / 10.3109 / 00365548.2014.926565.

[0340] (19) Sekaly, R.-P. The Failed HIV Merck Vaccine Study: A Step Back or aLaunching Point for Future Vaccine Development? Journal of Experimental Medicine 2008, 205 (1), 7-12. https: / / doi.org / 10.1084 / jem.20072681.

[0341] (20) Moodie, Z.; Walsh, S. R.; Laher, F.; Maganga, L.; Herce, M. E.; Naidoo,S.; Hosseinipour, M. C.; Innes, C.; Bekker, L.-G.; Grunenberg, N.; Mann, P.; Yu, C.; DeCamp, A. C.; Miner, M. D.; Yates, N. L.; Heptinstall, J.; Mkhize, N. N.; Dintwe, O.; Frahm, N.; Cohen, K. W.; Allen, M.; Hutter, J.; Wagner, R.; Pantaleo, G.; McElrath, M. J.; Tomaras, G. D.; Morris, L.; Montefiori, D. C.; Andersen-Nissen, E.; Gray, G. E.;Gilbert, P. B.; Kublin, J. G. Antibody and Cellular Responses to HIV Vaccine Regimens with DNA Plasmid as Compared with ALVAC Priming: An Analysis of Two Randomized Controlled Trials. PLOS Medicine 2020, 17 (5), el003117. https : / / doi . org / 10.1371 / j ournal .pmed.1003117.

[0342] (21) Barouch, D. H. Challenges in the Development of an HIV-1 Vaccine.Nature 2008, 455 (7213), 613-619. https: / / doi.org / 10.1038 / nature07352.

[0343] (22) Tiwari, R. P.; Jain, A.; Khan, Z.; Kumar, P.; Bhrigu, V.; Bisen, P. S.Designing of Novel Antigenic Peptide Cocktail for the Detection of Antibodies to HIV-1 / 2 by ELISA. Journal of Immunological Methods 2013, 387 (1-2), 157-166. https: / / doi.Org / 10.1016 / j.jim.2012.10.009.

[0344] (23) Pastori, C.; Tudor, D.; Diomede, L.; Drillet, A. S.; Jegerlehner, A.; Rohn,T. A.; Bomsel, M.; Lopalco, L. Virus like Particle Based Strategy to Elicit HIV- Protective Antibodies to the Alpha-Helic Regions of Gp41. Virology 2012, 431 (1-2), 1- 11. https: / / doi.Org / 10.1016 / j.virol.2012.05.005.

[0345] (24) Bayon, E.; Morlieras, J.; Dereuddre-Bosquet, N.; Gonon, A.; Gosse, L.;Courant, T.; le Grand, R.; Marche, P. N.; Navarro, F. P. Overcoming Immunogenicity Issues of HIV P24 Antigen by the Use of Innovative Nanostructured Lipid Carriers as Delivery Systems: Evidences in Mice and Non-Human Primates, npj Vaccines 2018, 3 (1), 46. https: / / doi.org / 10.1038 / s41541-018-0086-0.

[0346] (25) Kim, J. H.; Suh, Y. J.; Park, D.; Yim, H.; Kim, H.; Kim, H. J.; Yoon, D. S.;Hwang, K. S. Technological Advances in Electrochemical Biosensors for the Detection of Disease Biomarkers. Biomedical Engineering Letters 2021, 11 (4), 309-334. https: / / doi.org / 10.1007 / sl3534-021-00204-w.

[0347] (26) Huang, Y.; Xu, J.; Liu, J.; Wang, X.; Chen, B. Disease-Related Detection with Electrochemical Biosensors: A Review. Sensors 2017, 17 (10), 2375. https: / / doi.org / 10.3390 / sl7102375.

[0348] (27) Bhalla, N.; Jolly, P.; Formisano, N.; Estrela, P. Introduction to Biosensors.Essays in Biochemistry 2016, 60 (1), 1-8. https: / / doi.org / 10.1042 / EBC20150001.

[0349] (28) Quinchia, J.; Echeverri, D.; Cruz-Pacheco, A.; Maldonado, M.; Orozco, J.Electrochemical Biosensors for Determination of Colorectal Tumor Biomarkers. Micromachines 2020, 11 (4), 411. https: / / doi.org / 10.3390 / mil l040411.

[0350] (29) LaBarre, P.; Boyle, D.; Hawkins, K.; Weigl, B. Instrument-Free NucleicAcid Amplification Assays for Global Health Settings; Southern, S. O., Montgomery, K. N., Taylor, C. W ., Weigl, B. H., Vijaya Kumar, B. V. K., Prabhakar, S., Ross, A. A., Eds.; 2011; p 802902. https: / / doi.org / 10.1117 / 12.882868.

[0351] (30) Gray, E. R.; Bain, R.; Varsaneux, O.; Peeling, R. W .; Stevens, M. M.;McKendry, R. A. P24 Revisited. ATOS 2018, 32 (15), 2089-2102. https: / / doi.org / 10.1097 / QAD.0000000000001982.

[0352] (31) Ran, X.; Ao, Z.; Trajtman, A.; Xu, W.; Kobinger, G.; Keynan, Y.; Yao, X.HIV-1 Envelope Glycoprotein Stimulates Viral Transcription and Increases the Infectivity of the Progeny Virus through the Manipulation of Cellular Machinery. Scientific Reports 2017, 7 (1), 9487. https: / / doi.org / 10.1038 / s41598-017-10272-7.

[0353] (32) Iroegbu, J.; Birk, M.; Lazdina, U.; Sonnerborg, A.; Sallberg, M. Variability and Immunogenicity of Human Immunodeficiency Virus Type 1 P24 Gene Quasispecies. Clinical Diagnostic Laboratory Immunology 2000, 7 (3), 377-383. https: / / doi.Org / 10.1128 / CDLI.7.3.377-383.2000.

[0354] (33) Bystryak, S.; Acharya, C. Detection of HIV-1 P24 Antigen in Patients withVarying Degrees of Viremia Using an ELISA with a Photochemical Signal Amplification System. Clinica Chimica Acta 2016, 456. 128-136. https: / / doi.Org / 10.1016 / j.cca.2016.02.022.

[0355] (34) Bystryak, S.; Santockyte, R. Increased Sensitivity of HIV- 1 P24 ELISAUsing a Photochemical Signal Amplification System. JAIDS Journal of Acquired Immune Deficiency Syndromes 2015, 70 (2), 109-114. https: / / doi.Org / 10.1097 / QAI.0000000000000726.

[0356] (35) Cohen, M. S.; Gay, C. L.; Busch, M. P.; Hecht, F. M. The Detection ofAcute HIV Infection. The Journal of Infectious Diseases 2010, 202 (S2), S270-S277. https: / / doi.org / 10.1086 / 655651.

[0357] (36) Muthukumar, A.; Alatoom, A.; Burns, S.; Ashmore, J.; Kim, A.; Emerson,B.; Bannister, E.; Ansari, M. Q. Comparison of 4th-Generation HIV Antigen / Antibody Combination Assay With 3rd-Generation HIV Antibody Assays for the Occurrence of False-Positive and False-Negative Results. Laboratory Medicine 2015, 46 (2), 84-89. https: / / doi.org / 10.1309 / LMM3X37NSWUCMVRS.

[0358] (37) Liu, P.; Jackson, P.; Shaw, N.; Heysell, S. Spectrum of False Positivity for the Fourth Generation Human Immunodeficiency Virus Diagnostic Tests. AIDS Research and Therapy 2016, 13 (1), 1. https: / / doi.org / 10.1186 / sl2981-015-0086-3.

[0359] (38) Saz, J.; Dalmau-Bueno, A.; Meulbroek, M.; Pujol, F.; Coll, J.; Herraiz-Tomey, A.; Perez, F.; Marazzi, G.; Taboada, H.; Culqui, D. R.; Cayla, J. A. Use of Fourth-Generation Rapid Combined Antigen and Antibody Diagnostic Tests for the Detection of Acute HIV Infection in a Community Centre for Men Who Have Sex withMen, between 2016 and 2019. PLOS ONE 2021, 16 (7), e0255065. https: / / doi.org / 10.1371 / journal.pone.0255065.

[0360] (39) Dreier, J.; Stormer, M.; Kleesiek, K. Use of Bacteriophage MS2 as anInternal Control in Viral Reverse Transcription-PCR Assays. Journal of Clinical Microbiology 2005, 43 (9), 4551-4557. https: / / doi.Org / 10.l 128 / JCM.43.9.4551- 4557.2005.

[0361] (40) Ninove, L.; Nougairede, A.; Gazin, C.; Thirion, L.; Delogu, I.; Zandotti, C.;Charrel, R. N.; de Lamballerie, X. RNA and DNA Bacteriophages as Molecular Diagnosis Controls in Clinical Virology: A Comprehensive Study of More than 45,000 Routine PCR Tests. PLoS ONE 2011, 6 (2), el6142. https: / / doi.org / 10.1371 / journal.pone.0016142.

[0362] (41) Sutthent, R.; Gaudart, N.; Chokpaibulkit, K.; Tanliang, N.;Kanoksinsombath, C.; Chaisilwatana, P. P24 Antigen Detection Assay Modified with a Booster Step for Diagnosis and Monitoring of Human Immunodeficiency Virus Type 1 Infection. Journal of Clinical Microbiology 2003, 41 (3), 1016-1022. https: / / doi.Org / 10.1128 / JCM.41.3.1016-1022.2003.

[0363] (42) Ellaurie, M.; Rubinstein, A. Correlation of Serum Antigen and AntibodyConcentration with Clinical Features in HIV Infection. Archives of Disease in Childhood 1991, 66 (2), 200-203. https: / / doi.Org / 10.1136 / adc.66.2.200.

[0364] (43) Siikosd, Z.; Andersen, E. S.; Seemann, S. E.; Jensen, M. K.; Hansen, M.;Gorodkin, J.; Kjems, J. Full-Length RNA Structure Prediction of the HIV-1 Genome Reveals a Conserved Core Domain. Nucleic Acids Research 2015, gkvl039. https: / / doi.org / 10.1093 / nar / gkvl039.

[0365] (44) Human Immunodeficiency Virus (HIV). Transfusion Medicine andHemotherapy 2016, 43 (3), 203-222. https: / / doi.org / 10.1159 / 000445852.

[0366] (45) Enting, R. H.; Prins, J. M.; Jurriaans, S.; Brinkman, K.; Portegies, P.;Lange, J. M. A. Concentrations of Human Immunodeficiency Virus Type 1 (HIV-1) RNA in Cerebrospinal Fluid after Antiretroviral Treatment Initiated during Primary HIV-1 Infection. Clinical Infectious Diseases 2001, 32 (7), 1095-1099. https: / / doi.org / 10.1086 / 319602.

[0367] (46) Bukrinsky, M.; Adzhubei, A. Viral Protein R of HIV-1. Reviews in MedicalVirology 1999, 9 (1), 39-49. https: / / doi.org / 10.1002 / (SICI)1099- 1654(199901 / 03)9: l<39::AID-RMV235>3.0.CO;2-3.

[0368] (47) Gonzalez, M. The HIV-1 Vpr Protein: A Multifaceted Target forTherapeutic Intervention. International Journal of Molecular Sciences 2017, 18 (1), 126. https: / / doi.org / 10.3390 / ijmsl8010126.

[0369] (48) Andersen, J. L.; Planelles, V. The Role of Vpr in HIV-1 Pathogenesis.Current HIV Research 2005, 3 (1), 43-51. https: / / doi.org / 10.2174 / 1570162052772988.

[0370] (49) Miranda, L. R.; Schaefer, B. C.; Kupfer, A.; Hu, Z.; Franzusoff, A. CellSurface Expression of the HIV-1 Envelope Glycoproteins Is Directed from Intracellular CTLA-4-Containing Regulated Secretory Granules. Proceedings of the National Academy of Sciences 2002, 99 (12), 8031-8036. https: / / doi.org / 10.1073 / pnas.122696599.

[0371] (50) Voronin, Y.; Zinszner, H.; Karg, C.; Brooks, K.; Coombs, R.; Hural, J.;Holt, R.; Fast, P.; Allen, M.; Allen, M.; Busch, M.; Fast, P.; Fruth, U.; Golding, H.; Khurana, S.; Mulenga, J.; Peel, S.; Schito, M.; Voronin, Y.; Barnabas, N.; Bentsen, C.; Graham, B.; Gray, G.; Levin, A.; McCluskey, M.; O’Connell, R.; Snow, B.; Ware, M. HIV Vaccine-Induced Sero-Reactivity: A Challenge for Trial Participants, Researchers, and Physicians. Vaccine 2015, 33 (10), 1243-1249. https: / / doi.Org / 10.1016 / j.vaccine.2014.10.040.

[0372] (51) Palli, R.; Seaton, K. E.; Piepenbrink, M. S.; Hural, J.; Goepfert, P. A.;Laher, F.; Buchbinder, S. P.; Churchyard, G.; Gray, G. E.; Robinson, H. L.; Huang, Y.; Janes, H.; Kobie, J. J.; Keefer, M. C.; Tomaras, G. D.; Thakar, J. Impact of Vaccine Type on HIV-1 Vaccine Elicited Antibody Durability and B Cell Gene Signature. Scientific Reports 2020, 10 (1), 13031. https: / / doi.org / 10.1038 / s41598-020-69007-w.

[0373] (52) Cooper, C. J. Vaccine-Induced HIV Seropositivity / Reactivity inNoninfected HIV Vaccine Recipients. JAMA 2010, 304 (3), 275. https: / / doi.org / 10.1001 / jama.2010.926.

[0374] (53) Wong, E. Y.; Hewlett, I. K. HIV Diagnostics: Challenges andOpportunities. HIV Therapy 2010, 4 (4), 399-412. https: / / doi.org / 10.2217 / hiv.10.29.

[0375] (54) Khurana, S.; Needham, J.; Park, S.; Mathieson, B.; Busch, M. P.; Nemo,G.; Nyambi, P.; Zolla-Pazner, S.; Laal, S.; Mulenga, J.; Chomba, E.; Hunter, E.; Allen,S.; McIntyre, J.; Hewlett, I.; Lee, S.; Tang, S.; Cowan, E.; Beyrer, C.; Altfeld, M.; Yu, X. G.; Tounkara, A.; Koita, O.; Kamali, A.; Nguyen, N.; Graham, B. S.; Todd, D.; Mugenyi, P.; Anzala, O.; Sanders, E.; Ketter, N.; Fast, P.; Golding, H. Novel Approach for Differential Diagnosis of HIV Infections in the Face of Vaccine-Generated Antibodies.J AIDS Journal of Acquired Immune Deficiency Syndromes 2006, 43 (3), 304-312. https: / / doi.Org / 10.1097 / 01.qai.0000242465.50947.5f.

[0376] (55) Khurana, S.; Norris, P. J.; Busch, M. P.; Haynes, B. F.; Park, S.; Sasono,P.; Mlisana, K.; Salim, A. K.; Hecht, F. M.; Mulenga, J.; Chomba, E.; Hunter, E.; Allen, S.; Nemo, G.; Rodriguez-Chavez, I. R.; Margolick, J. B.; Golding, H. HIV-Selectest Enzyme Immunoassay and Rapid Test: Ability To Detect Seroconversion Following HIV-1 Infection. Journal of Clinical Microbiology 2010, 48 (1), 281-285. https: / / doi.org / 10.1128 / JCM.01573-09.

[0377] (56) Penezina, O.; Krueger, N. X.; Rodriguez-Chavez, I. R.; Busch, M. P.;Hural, J.; Kim, J. H.; O’Connell, R. J.; Hunter, E.; Aboud, S.; Higgins, K.; Kovalenko, V.; Clapham, D.; Crane, D.; Levin, A. E. Performance of a Redesigned HIV Selectest Enzyme-Linked Immunosorbent Assay Optimized To Minimize Vaccine-Induced Seropositivity in HIV Vaccine Trial Participants. Clinical and Vaccine Immunology 2014, 21 (3), 391-398. https: / / doi.org / 10.1128 / CVI.00748-13.

[0378] (57) Ledergerber, B.; Flepp, M.; Boni, J.; Tomasik, Z.; Cone, R. W .; Liithy, R.;Schiipbach, J. Human Immunodeficiency Virus Type 1 P24 Concentration Measured by Boosted ELISA of Heat-Denatured Plasma Correlates with Decline in CD4 Cells, Progression to AIDS, and Survival: Comparison with Viral RNA Measurement. The Journal of Infectious Diseases 2000, 181 (4), 1280-1287. https: / / doi.org / 10.1086 / 315366.

[0379] (58) Bender, A. T.; Sullivan, B. P.; Zhang, J. Y.; Juergens, D. C.; Lillis, L.;Boyle, D. S.; Posner, J. D. HIV Detection from Human Serum with Paper-Based Isotachophoretic RNA Extraction and Reverse Transcription Recombinase Polymerase Amplification. The Analyst 2021, 146 (9), 2851-2861. https: / / doi.org / 10.1039 / D0AN02483J.EXAMPLE 5 - OPTIMIZE ELECTROCHEMICAL SENSING PLATFORM FOR SELECTIVE AND SENSITIVE MULTIPLEXED DETECTION OF ACTIVE HIV-1 INFECTION.

[0380] Major Task la. As part of Aim la, molecular DNA probes were designed and optimized to target the HIV-1 RNA selectively from the blood plasma pool. In this regard, complete genome sequence of HIV-1 (NCBI AF033819.3) were selected and multiple DNA sequences were predicted through Soligo software. It is important to note that while ASO1 targets viral protein R (vpr gene) of HIV, which plays an important role in regulating the nuclear import of the HIV-1 pre-integration complex and is required for virus replication in non-dividing cells such as macrophages, the other ASO2 targets the envelope surface protein (Env gene) of HIV- 1 which is crucial to viral infectivity for binding to the CD4 and chemokine receptors present on T cells and for driving membrane fusion. These ASOs are then custom synthesized with a 5 ’-thiol group and 3 ’-methylene blue redox reporter. The ASO sequences selected here are:• ASO1 : / 5ThioMC6-D / CCAAGGCCCAGCCCTCAC AC A (SEQ ID N0: l) / 3MEBLN / • ASO2: / 5ThioMC6-D / CTTGTATTGTTGTTGGGTCT (SEQ ID NO:2) / 3MEBLN /

[0381] In a similar approach, the phage MS2 genome (NC_001417.2) was considered and the best ASO was selected for the current study. MS2 RNA acts as an internal control for the assay to monitor the stability of RNA and the control of decapsulation of the viral RNA during the extraction procedure. This marker is also sensitive to the assay inhibitors. The ASO3 sequence for MS2 RNA is:• ASO3: / 5ThioMC6-D / TCTGGAAGTTTGCAGCTGGA (SEQ ID NO:3) / 3MEBLN / Major Task la and b. Optimum functionalization of the gold electrodes towards the detection of anti-p24 antibody and oligos.

[0382] Results and Methods. Functionalization of the sensor with antibody and ASOs. The sensors were functionalized with p24 antigen and anti-p24 antibody using the EDC / NHS coupling. Separately, the sensors were also functionalized with ASOs targeted towards HIV-1 and MS2 bacteriophage. The ASOs were custom synthesized with a 5’-thiol group and 3 ’-methylene blue redox reporter. Capillary electrophoresis (CE) was used as a purity measurement utilizing a gel filled capillary to assess the proportion of full-length products to truncated products present in the final oligo sample. HPLC purified oligos (21 base pairs) in length showed excellent CE trace to further confirm the final purity. The ASOs were used for functionalization with the gold electrode at 10 pM concentration. The electrodes were divided into several groups and functionalized by varying different parameters. ASOs were either first treated with a reducing agent, TCEP, to cleave the disulfide linkage and then added onto the gold electrodes or added directly on top of the gold electrodes for conjugation. For direct addition, it was expected that the surface electrons over gold surface would be sufficient to reduce the disulfide linkage followed by its conjugation. Some of the electrodes were also treated with 6- mercaptohexanol after their conjugation with the ASOs. 6-mercaptohexanol is known to inhibit cross-reactivity of the target with the analyte. Several concentrations of the P24 antigen were tested using sensors functionalized with P24 antibody.

[0383] Objective 1c. Suitable modification of gold electrodes with HIV-1 RNA selective antisense oligonucleotide: The sensors were functionalized with 5 pM HIV-1 ASO labelled with MB, for HIV-1 RNA. Once the sensors were cleaned, they were then incubated with 20 pL of 5 pM methylene blue (MB) labeled oligonucleotides for HIV-1 RNA. The sensors were kept at 4 °C overnight. Before using the sensors for testing they were again rinsed with phosphate buffered saline (PBS IX) and then RNase-free water to remove any excess unbound ASOs from the surface. The sensors were again gently airdried using Nitrogen gas. Several concentrations of the HIV-1 RNA were tested using sensors functionalized with HIV-1 ASO labeled with MB. Figure 5 summarizes the value of the current for the baseline in the presence of HIV- 1 RNA. For confirming the successful conjugation of the MB labeled ASO probes, CV traces of the sensors before and after conjugation was tested and was found to be significantly different from the baseline CV curve. Figure 6 represents a representative curve before and after addition of HIV-1 RNA on the functionalized sensor surface. Figure 7 represents the sensor response normalized with respect to the baseline current by calculating the absolute change and, Al. Al is the best statistical measure where its linearly correlated with the target concentrations and represents the desired change.

[0384] Objective Id. Functionalization of gold electrodes with phage MS2 RNA selective ASO: Once the sensors were cleaned, they were then incubated with 20 pL of10 pM MB labeled oligonucleotides for MS2 phage RNA. The sensors were kept at 4 °C overnight. Before using the sensors for testing they were again rinsed with phosphate buffered saline (PBS IX) and then RNase-free water to remove any excess unbound ASOs from the surface. The sensors were again gently air-dried using gas Nitrogen gas. Several concentrations of the MS2 phage RNA were tested using sensors functionalized with MS 2 ASO labelled with MB. Figure 8 represents the sensor response normalized with respect to the baseline current by calculating the absolute change (Al), for MS2 phage RNA. Al is the best statistical measure where its linearly correlated with the target concentrations and represents the desired change.

[0385] Objective le. Standardization of functionalization parameters: the conjugation protocol was optimized by functionalizing the sensor surface with varying concentrations of ASO to generate the most consistent, stable, and optimum current response using cyclic voltammetry. Below are the representative figures. Two concentrations of the ASO probe were tested. Figure 9 represents the CV data with 5 pM of ASO-MB and 0.5 HIV-1 RNA.

[0386] Protein: 1, 5, and 10 pg / mL of the p24 antibodies were investigated. The Fourier transform infrared (FT-IR) spectra (not shown here) confirmed the successful conjugation of the probe to the surface in different conditions. (Figure 10) The cyclic voltammetry data further supported the successful functionalization of the electrode surface as shown in Figure 11. The sensor functionalized with different P24 Ab showed different current values, with the electrode with 10 pg / mL showing the maximum response.

[0387] Objective If. Optimization of the cyclic voltammetry parameters: Extensive optimization of the electrochemical parameters in terms of the scan rate, the voltage range, and the potential step. This was achieved after functionalizing the surface with oligo sequence containing methylene blue on the 5’ end. To optimize the CV parameters for ASO functionalized sensors HIV ASO was conjugated using the same protocol as described in the previous report. Briefly, 5 pM methylene blue (MB) labelled HIV ASOs were conjugated on to the sensor surface. The CV curves were then recorded by varying different parameters such as current, voltage range and scanning rates.

[0388] Antisense Oligonucleotides (ASO): The sensors were functionalized with methylene blue (MB) labelled HIV ASOs as per the protocol mentioned in the previous report. Sensors with two different concentrations were functionalized (5 pM & 10 pM). Itwas observed that the sensors functionalized with 5 pM ASOs showed better response in comparison with sensors functionalized with 10 pM ASOs. (Figure 12 & 13)

[0389] The outcome of this task is complete optimization of CV parameter. The CV parameters were thus optimized. The optimized parameters are listed below: Voltage range: -0.1 V - 0.1 V; Scan rate: 0.1 V / s; Current: 32 pA.

[0390] Objective 1g. Optimization of suspension / lysis buffer solution for direct samples. In this task, it was demonstrated that the lysis buffer containing 0.5% SDS + 1 mg / ml proteinase K + 10 mM DTT at 1 : 1 v / v ratio is the optimum one which maintains similar RNA stability like the commercial kit. Here it was confirmed this further by agarose gel electrophoresis. Data showed that SDS buffer either at 1 :0.5 (7,8,9 channel) or 1 : 1 (10,11,12 channel) v / v ratio matches closely with the original sample (1,2,3 channel) where RNA has been extracted with commercial kit. Thus, the lysis buffer ready to be tested was optimized with clinical samples for the detection of active HIV-1 RNA. (Figure 14).

[0391] Objective Ih. Cross-reactivity of the sensor against other interfering agents. The cross-reactivity of the sensors functionalized with P24 antigens was tested using gpl20 antibodies with two different concentrations including lOOng / mL and 10 pg / mL. Figure 15 shows that there is minimal cross-reactivity with lOOng / mL of gpl20 Ab. (Figure 15)

[0392] Outcome: The outcome of this specificity of the functionalized sensors was determined against common interfering agents. While the specificity of the anti-p24 antibody functionalized sensor was tested against different clade proteins including gp 1, and gpl20 which are commonly present in HIV vaccines. Further, the selectivity of the p24 antigen functionalized sensor was tested against other bodily-produced antibodies after their seroconversion, like anti-gpl20 IgG with two different concentrations. The cross-reactivity of the sensors were tested using anti-gp41 IgG. A minimal change in the CV signal has been seen as a response to the gp41 Ab, confirming the specificity of the sensors.

[0393] The outcome of Objective 1: A highly sensitive, selective, and quantitative electrochemical biosensor was designed to diagnose HIV-1 RNA directly from plasma samples, in conjunction with p24 antigens and anti-p24 antibodies. To obtain reliable and stable results, the concentration of conjugated antibodies, antigens, and ASOs on thesensor surface was optimized. Sensor sensitivity, repeatability, stability, and LOD were fully characterized. The direct sample testing protocol for RNA-extraction-free lysis buffer formula and sample treatment conditions was determined from this part of the proposal. It was validated that the sensor platform provided robust, unbiased results through the cross-reactivity study.EXAMPLE 6 - CLINICAL DEMONSTRATION OF THE ASSAY IN DIFFERENTIATING VISP SAMPLES FROM THE ACTIVE HIV INFECTED ONES.

[0394] A comprehensive evaluation of the current sensing platform’s ability to detect HIV proteins accurately and consistently in clinical plasma samples was conducted. These samples were obtained from participants in a vaccine trial, including HIV-infected and uninfected individuals, as well as healthy controls. To assess the platform's robustness and accuracy in detecting active HIV-1, the clinical samples were divided into four distinct groups: HIV-positive non-vaccinated patients (HIV Positive placebo), HIVpositive vaccinated individuals, HIV-negative non-vaccinated healthy controls (HIV Negative placebo), and HIV-negative participants undergoing a vaccination trial (HIV Negative Abbott reactive samples). To perform the testing, 200 sensors that were functionalized with either P24 antigen or antibody were utilized. The allocation of samples in each test group is outlined in Figure 21.

[0395] Clinical samples. 280 number of clinical samples were received from HIV Vaccine Trial Network (HTVN) Protocol 505 (NIH Vaccine Research Center’s DNA- AdV5 vaccine) which showed VISP in only 50% of participants as opposed to almost 100% in the J&J study.

[0396] Material type: Plasma

[0397] Material modifier: EDTA

[0398] HIV Negative Abbott reactive - R2023000060 (100 samples)

[0399] HIV Negative Placebo - R2023000062 (100 samples)

[0400] HIV Positive Placebo - R2023000063 (40 samples)

[0401] HIV Positive Vaccinated - R2023000064 (40 samples)

[0402] To perform the testing, >400 sensors were utilized that were functionalized with either P24 antigen or antibody. For the RNA detection 386 sensors that werefunctionalized with HIV-1 antisense oligonucleotide were utilized. The allocation of samples in each test group is outlined in Figure 21. Prior to testing, the samples (for antigen and antibody) were treated with suspension buffer at a 2: 1 ratio based on the findings from objective 1g. For RNA studies the samples were treated with lysis buffer at a 2: 1 ratio based on the findings from objective 1g.

[0403] The cyclic voltammetry (CV) signal was captured using the optimized CV parameters established throughout the study. Subsequently, the data was analyzed by normalizing the CV peak of each sample to the plasma signal, and the resulting CV peak values were plotted for further analysis.

[0404] Nucleic Acid Experiment Rationale: To evaluate the ability of the sensing platform to determine the presence / absence of HIV-1 RNA accurately and reproducibly in clinical samples AcroMetrix HIV-1 high control sample sourced from heat inactivated HIV-1 positive plasma was utilized. (Figure 16)

[0405] Proteins: The peaks of the recorded CV curves were analyzed and it was found that the sensor factionalized with P24 protein showed a high response to its target (P24 Ab) compared to the plasma alone (Figure 17). The response is significantly different from the value recorded for the plasma alone (P<0.0004). The same holds true for the sensors functionalized with Ab. The sensor response towards the P24 proteins was significantly different from the value recorded for the plasma alone (P<0.0001).

[0406] Outcome: The statistical significance of the sensor performance was confirmed as shown by the data above. The test showed a good responsiveness to the target, whereas the plasma lacking the target showed negligible responses. As hypothesized, the sensors showed expected results when tested with AcroMetrix HIV-1 high control samples. The target concentration of the high control sample was approximately 1.70E+06 lU / mL. The sensors conjugated with HIV ASO-MB probes had minimal interference from blood plasma.

[0407] Clinical sample analysis.

[0408] Proteins. Antigen and Antibody Conjugated Sensors. The ability of the sensing platform to determine the presence of HIV proteins accurately and reproducibly in clinical plasma samples obtained from vaccine trial participants, HIV-infected and uninfected individuals, and healthy controls was tested. It was decided to test the robustness and accuracy of the platform towards the detection of active HIV-1 in fourseparate groups of clinical samples: HIV-positive non-vaccinated patients (HIV Positive placebo), HIV-positive vaccinated, HIV-negative non-vaccinated healthy controls (HIV Negative placebo) and HIV negative undergoing vaccination trial participants (HIV Negative Abbott reactive samples). To do so, sensors functionalized with either P24 antibodies (Ab) or P24 antigen were used to test the clinical sample. The sample was treated with lysis buffer in a ratio of 1 :5 based on the current finding in objective 1g. The cyclic voltammetry signal was recorded using the optimum CV parameters as reported throughout the terms of the study. Finally, a one-way ANOVA statistical test was performed between the groups to evaluate the sensor response toward the various HIV groups under investigation.

[0409] Both HIV-positive samples showed a significant change in current, whereas the negative samples, both vaccinated and non-vaccinated showed a minimal change close to the control sample, plasma in this case (Figure 18).

[0410] The one-way ANOVA showed that the groups showed a response that was significantly different with p<0.0001. The CV curves recorded for detecting the p24 antigen recorded for the sensor functionalized with p24 Ab are shown in Figure 10. The positive samples showed a significant change when compared to the negative samples including the VISP one (Figure 19).

[0411] Nucleic Acid. The ability of the sensing platform to determine the presence of HIV-1 viral RNA accurately and reproducibly in a clinical plasma sample obtained from vaccine trial participants, HIV-infected and uninfected individuals, and healthy controls was tested. The samples used in this experiment are the same as mentioned above. To differentiate VISP subjects with HIV positive patients, sensors were functionalized with the antisense oligonucleotide based on the previously described optimized protocol. The plasma sample was treated with lysis buffer in a ratio of 1 :5 based on the current finding in objective 1g. The cyclic voltammetry signal using the optimum CV parameters as reported throughout the terms of the study was recorded. (Figure 20)

[0412] Discussion: The low value of HIV p24 antigen is expected in HIV -ve placebo and HIV -ve vaccinated cases as these samples should be devoid of this protein. Now, low p24 antigen value in the HIV +ve groups, i.e., HIV +ve placebo and HIV +ve vaccinated, indicates late infection staged samples where p24 concentration should be low and anti-p24 antibody concentration should be high. The high p24 antigen value in 10 ofthe 30 samples in HIV +ve vaccinated case possibly indicate early staged HIV-infected samples, i.e., preferably within 28 days of infection. This result was correlated with the HIV anti-p24 antibody ELISA data.

[0413] Outcome: The sensors effectively distinguished between HIV-positive and negative samples. Furthermore, it accurately detected the presence of the virus (HIV viral RNA) in infected subjects, while not producing a significant response in vaccinated subjects. Additionally, the sensors conjugated with ASOs showed similar trend as seen with sensors conjugated with P24 Ab and antigen (Fig 22). These results suggest that the sensor holds potential for addressing the problem of Vaccine-Induced Seropositivity (VISP) by distinguishing between infected and non-infected individuals who have been vaccinated.

[0414] Major Task 2b: Statistical analyses

[0415] Figure 23 accompanies this data and provides the corresponding confusion matrix and related performance rates. Samples tested with p24 antigen functionalized sensors targeting anti-p24 antibody (n=100) resulted in sensitivity = 96.00%, specificity = 98.00%, and accuracy of 97.00%. Samples tested with anti-p24 antibody functionalized sensors targeting p24 antigen resulted in sensitivity = 96.00%, specificity = 97.87%, and accuracy of 96.91%. These results support previous findings of robust classification performance. The following parameters were calculated using the confusion matrix and the following equations:• Sensitivity = True Positive (TP) / (True Positive (TP) / False Negative (FN))• Specificity = True Negative (TN) / (True Negative (TN) / False Positive (FP))• Positive Predictive Value (PPV) = True Positive (TP) / (True Positive (TP) / False Positive (FP))• Negative Predictive Value (NPV) = True Negative (TN) / (True Negative (TN) / False Negative (FN))• Accuracy = (True Positive (TP) + True Negative (TN)) / (Positive + Negative)

[0416] Figure 24 depicts the scattered distribution of the sensor current response for detection of HIV- 1 viral RNA in the four different groups described above. The current values collected from sensors functionalized with HIV ASO targeted towards HIV viral RNA as a response to the four HIV groups, i.e., HIV Positive (placebo), HIV Positive(vaccinated), and HIV Negative (placebo). Both HIV-positive samples showed a significant change in current, whereas the negative sample showed a minimal change close to the control sample, plasma in this case. A one-way ANOVA statistical test was performed between the groups to evaluate the assay response. The one-way ANOVA showed that the groups showed a response that was significantly different with p = p<0.0001 for the following:• HIV Negative (Placebo) vs. HIV Positive (Placebo)• HIV Negative (Placebo) vs. HIV Positive (Vaccinated)• HIV Negative (Vaccinated) vs. HIV Positive (Placebo)• HIV Negative (Vaccinated) vs. HIV Positive (Vaccinated)• HIV Positive (Placebo) vs. HIV Positive (Vaccinated)

[0417] However, the assay response was not significant (ns) with p = 0.1070 in case of negative placebo vs. negative vaccinated. This indicated the sensor was able to effectively able to distinguish between the four different groups of the HIV samples.

[0418] Figure 25 shows the confusion matrix of the tested clinical samples (using HIV-1 conjugated antisense oligonucleotides (ASOs) by benchmarking the test results to the gold standard PCR. The validated test results against gold standard PCR revealed good agreement with accuracy, sensitivity, and specificity of -97.11, -96.15% and -99.07% respectively.

[0419] Project Outcome. A rapid, point-of-care (POC) platform was developed that enables nanotechnology-enabled multiplexed electrochemical assays for the selective detection of HIV- 1 infection. Without wishing to bound by any theory, the hypothesis was to detect HIV infection accurately and differentiate it from vaccine-induced seropositivity by monitoring serological markers and HIV-1 RNA simultaneously. For this purpose, p24 antigen and anti-p24 antibody were used as serological markers for the 4th generation EIA. The nucleic acid test can target either pro-viral DNA or viral RNA, but HIV-1 RNA was chosen because it can be integrated more easily with the serological markers. A positive control was performed using MS2 bacteriophage RNA as an internal control using the same platform. P24 and anti-p24 antibodies are detected in blood at 0.5- 1 pg / ml, which presents a significant challenge. On the other hand, plasma HIV-1 RNA levels are known to decrease significantly from 5.46 loglO copies / mL (range 4.40-5.97loglO copies / mL) to 3.07 loglO copies / mL (range 2.57-3.79 loglO copies / mL; P = .03) after 8 weeks of treatment. In 120 clinical samples from HVTN, sensitive detection was demonstrated, with a sensitivity of 1,259 copies / mL = 0.7 fM for nucleic acid tests.

[0420] 120 clinical samples were analyzed. The sensors effectively distinguished between HIV-positive and negative samples. Furthermore, it accurately detected the presence of the virus (HIV viral RNA) in infected subjects, while not producing a significant response in vaccinated subjects. Additionally, the sensors conjugated with ASOs showed similar trend as seen with sensors conjugated with P24 antibody and antigen. These results suggest that the sensor holds potential for addressing the problem of Vaccine-Induced Seropositivity (VISP) by distinguishing between infected and noninfected individuals who have been vaccinated. Moreover, the data from confusion matrix indicated good agreement between the developed EC sensor and the gold standard technique PCR.

[0421] Summary:

[0422] Chemistry of molecular probes (antigen, antibody and ASOs); functionalization of sensors is optimized and functioning as intended.

[0423] A highly sensitive, selective, and quantitative electrochemical biosensor was developed for the diagnosis of p24 antigen, anti-p24 antibody and HIV-1 RNA directly from plasma samples with the addition of either suspension or lysis buffer.

[0424] The sensor was fully optimized in terms of LOD, response time, sensitivity, stability, and repeatability.

[0425] The cross-reactivity study validated the sensor platform for providing robust and unbiased results.

[0426] The accuracy, sensitivity, and specificity of the multiplexed electrochemical biosensor in diagnosing active HIV-1 infection from direct clinical samples differentiating them from the VISP populations was determined in 100 clinical samples.

[0427]

[0428] All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[0429] Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are offered by way of example only. The embodiments were chosen and described in order to best explain the principles of the invention and its practical applications, to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated. The invention is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled.

Claims

WHAT IS CLAIMED1. A detector for diagnosing human immunodeficiency virus (HIV) infection status in a subject, the detector comprising: a. a plurality of detecting agents, wherein each respective detecting agent in the plurality of detecting agents is specific for a corresponding biomarker in a sample of the subject in a plurality of biomarkers comprising p24, anti-P24 antibody, HIV-1 RNA and MS2 RNA; b. a respective sensor, in a plurality of sensors, for each corresponding biomarker in the plurality of biomarkers; wherein each respective sensor in the plurality of sensors is in contact with the respective detecting agent in the plurality of detecting agents; and c. one or more reaction vessels that contain the plurality of detecting agents.

2. The detector according to claim 2, wherein the detection by the plurality of detecting agents of at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample indicates HIV infection in the subject.

3. The detector according to claim 1 or 2, wherein MS2 RNA is used as a control, wherein HIV infection is indicated only when MS2 RNA and at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA are detected by the plurality of detecting agents in the sample.

4. The detector according to any one of claims 1 to 3, wherein the detection of less than two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample by the plurality of detecting agents indicates no HIV infection.

5. The detector according to any one of claims 1 to 4, wherein the sample is selected from the group consisting of a plasma sample, a serum sample, and a whole blood sample.

6. The detector according to any one of claims 1 to 5, wherein the detector further comprises a sample collection unit, wherein the sample collection unit is configuredto collect the sample from the subject and dispense the collected sample into the one or more reaction vessels.

7. The detector according to claim 6, wherein the sample collection unit comprises a finger prick unit.

8. The detector according to any one of claims 1 to 7, wherein the sample is diluted before being received into the one or more reaction vessels.

9. The detector according to any one of claims 1 to 7, wherein the sample is diluted after being received into the one or more reaction vessels.

10. The detector according to any one of claims 1 to 9, wherein the respective sensor comprises an electrode comprising one or more materials selected from the group consisting of gold, conductive carbon, platinum, palladium, stainless steel, tin, tungsten, titanium, or any combination thereof.

11. The detector according to any one of claims 1 to 10, wherein the respective detecting agent for the corresponding biomarker is conjugated to the respective sensor.

12. The detector according to any one of claims 1 to 11, wherein the respective sensor detects the presence or absence of the corresponding biomarker by using cyclic voltammetry (CV) scan; wherein the concentration of the corresponding biomarker is measured as a function of change in CV current peak.

13. The detector according to any one of claims 1 to 12, wherein each sensor in the plurality of sensors is an electrochemical sensor strip.

14. The detector according to any one of claims 1 to 12, wherein the detector further comprises an embedded sensor chip and wherein each sensor in the plurality of sensors is in the embedded sensor chip.

15. The detector according to claim 14, wherein the embedded sensor chip analyzes CV scan data for each corresponding biomarker in the plurality of biomarkers collected from the respective sensor in the plurality of sensors, wherein the CV scan datacomprises a set of CV currents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

16. The detector according to any one of claims 1 to 15, wherein the respective sensor for p24 has a limit of detection (LOD) of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml.

17. The detector according to any one of claims 1 to 16, wherein the respective sensor for p24 has a linear detection range of 0 to 1 x 105pg / ml.

18. The detector according to any one of claims 1 to 17, wherein the respective sensor for anti-p24 antibody has an LOD of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml.

19. The detector according to any one of claims 1 to 18, wherein the respective sensor for anti-p24 antibody has a linear detection range of 0 to 1 x 105pg / ml.

20. The detector according to any one of claims 1 to 19, wherein the respective sensor for HIV-1 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml.

21. The detector according to any one of claims 1 to 20, wherein the respective sensor for HIV-1 RNA has a linear detection range of 0 to lx 107copies / ml.

22. The detector according to any one of claims 1 to 21, wherein the respective sensor for MS2 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml.

23. The detector according to any one of claims 1 to 22, wherein the respective sensor for MS2 RNA has a linear detection range of 0 to 1 x 107copies / ml.

24. The detector according to any one of claims 1 to 23, wherein the detector further comprises a potentiostat reader, wherein the potentiostat reader is configured tocommunicate with each respective sensor in the plurality of sensors to collect CV scan data for the corresponding biomarker in the plurality of biomarkers, wherein the CV scan data comprises a set of CV currents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

25. The detector according to any one of claims 1 to 24, wherein the one or more reaction vessels consist of a single reaction vessel that contains the plurality of detecting agents.

26. The detector according to any one of claims 1 to 24, wherein the one or more reactive vessels comprise a plurality of reaction vessels, wherein each reaction vessel in the plurality of reaction vessels contains a subset of the plurality of detecting agents.

27. The detector according to any one of claims 1 to 24, wherein the one or more reaction vessels consists of two reaction vessels, wherein the detecting agents in the first reaction vessel are specific for protein biomarkers in the plurality of biomarkers and the detecting agents in the second reaction vessel are specific for RNA biomarkers in the plurality of biomarkers.

28. The detector according to claims 27, wherein the detecting agents in the first reaction vessel are specific for p24 and anti-p24 antibody and the detecting agents in the second reaction vessel are specific for HIV-1 RNA and MS2 RNA.

29. The detector according to claim 28, wherein the first reaction vessel comprises a suspension buffer.

30. The detector according to claim 29, wherein the suspension buffer comprises about 0.5% triton X-100.

31. The detector according to claim 28, wherein the second reaction vessel comprises an RNA lysis buffer.

32. The detector according to claim 31, wherein the RNA lysis buffer is selected from the group consisting of: a buffer comprising about 1 mg / ml proteinase K, about 0.5 % sodium dodecyl sulfate, and about 10 mM dithiothreitol; a radioimmunoprecipitation assay (RIP A) lysis buffer; and a buffer comprising guanidine isothiocyanate.

33. The detector according to any one of claims 1 to 32, wherein the subject is diagnosed by the detector within about 0.1 hours, about 0.5 hours, or about 1 hour, after the detector receives the sample.

34. The detector according to any one of claims 1 to 33, wherein, when the sample was obtained from the subject during eclipse period since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

35. The detector according to any one of claims 1 to 33, wherein, when the sample was obtained from the subject during acute HIV infection period since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

36. The detector according to any one of claims 1 to 33, wherein, when the sample was obtained from the subject during early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

37. The detector according to any one of claims 1 to 33, wherein, when the sample was obtained from the subject after early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

38. The detector according to any one of claims 1 to 33, wherein, when the sample was obtained from the subject between about Day 0 and about Day 28, or between about Day 10 and about Day 28, since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

39. The detector according to any one of claims 1 to 33, wherein, when the sample was obtained from the subject between about Day 28 and about Day 70, or after about Day 70, since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

40. The detector according to any one of claims 1 to 39, wherein the detecting agent for p24 is an extraneous anti-p24 antibody or a variant thereof.

41. The detector according to any one of claims 1 to 40, wherein the detecting agent for p24 is an extraneous anti-p24 IgG antibody or a variant thereof.

42. The detector according to any one of claims 1 to 41, wherein the detecting agent for p24 is conjugated to the respective sensor.

43. The detector according to claim 42, wherein the conjugating comprises incubating the sensor with about 5 pg / ml of the detecting agent for p24.

44. The detector according to any one of claims 1 to 43, wherein the detecting agent for anti-p24 antibody is extraneous p24 or a variant thereof.

45. The detector according to any one of claims 1 to 44, wherein the detecting agent for anti-p24 antibody is conjugated to the respective sensor.

46. The detector according to claim 45, wherein the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent for anti-p24 antibody.

47. The detector according to any one of claims 1 to 46, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises one or two nucleic acid probes.

48. The detector according to any one of claims 1 to 47, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA is conjugated to the respective sensor.

49. The detector according to claim 48, wherein the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent(s) for HIV-1 RNA.

50. The detector according to claim 48, wherein the conjugating is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for HIV-1 RNA.

51. The detector according to claim 48, wherein the conjugating is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for HIV-1 RNA.

52. The detector according to any one of claims 1 to 51, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a 5 ’ -thiol moiety and a 3’- methylene blue (MB) redox reporter moiety.

53. The detector according to any one of claims 1 to 52, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA hybridizes to, or is complementary with, a segment of an HIV-1 RNA molecule.

54. The detector according to claim 53, wherein the HIV-1 RNA molecule encodes protein R or envelope surface protein of HIV- 1.

55. The detector according to any one of claims 1 to 54, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a nucleic acid probe comprising the sequence of CC AAGGCCCAGCCCTCAC ACA (SEQ ID NO:1).

56. The detector according to any one of claims 1 to 55, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a first nucleic acid probe comprising the sequence of CCAAGGCCCAGCCCTCAC ACA (SEQ ID NO:1) and a second nucleic acid probe comprising the sequence of CTTGTATTGTTGTTGGGTCT (SEQ ID NO:2).

57. The detector according to any one of claims 1 to 56, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises one or two nucleic acid probes.

58. The detector according to any one of claims 1 to 57, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA antibody is conjugated to the respective sensor.

59. The detector according to claim 58, wherein the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent(s) for MS2 RNA.

60. The detector according to claim 58, wherein the conjugating is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for MS2 RNA.

61. The detector according to claim 58, wherein the conjugating is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for MS2 RNA.

62. The detector according to any one of claims 1 to 61, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises a 5 ’-thiol moiety and a 3’- methylene blue (MB) redox reporter moiety.

63. The detector according to any one of claims 1 to 62, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA hybridizes to, or is complementary with, a segment of an MS2 RNA molecule.

64. The detector according to any one of claims 1 to 63, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises a nucleic acid probe comprising the sequence of TCTGGAAGTTTGCAGCTGGA (SEQ ID NO:3).

65. A method for diagnosing human immunodeficiency virus (HIV) infection status in a subject, the method comprising using the detector according to any one of claims 1 to 60.

66. A method for diagnosing human immunodeficiency virus (HIV) infection status in a subject, the method comprising detecting a plurality of biomarkers in a sample of the subject comprising p24 antigen, anti-p24 antibody, HIV-1 RNA, and MS2 RNA.

67. The method according to claim 66, comprising: a) receiving, into a detector, the sample of the subject; wherein the detector comprises a plurality of detecting agents, wherein each respective detecting agent in the plurality of detecting agents is specific for a corresponding biomarker in a plurality of biomarkers, a respective sensor for each corresponding biomarker in the plurality of biomarkers, and one or more reaction vessels that contain the plurality of detecting agents; b) contacting, in the detector, the sample with the plurality of detecting agents under suitable conditions wherein each respective detecting agent in the plurality of detecting agents is configured to specifically bind to the corresponding biomarker in the plurality of biomarkers; c) detecting the plurality of biomarkers in the sample by the plurality of detecting agents; and d) determining the HIV infection status of the subject; wherein the detection of at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample by the detecting c) indicates HIV infection in the subject.

68. The method according to claim 67, wherein the biomarker MS2 RNA is used as a control, wherein HIV infection is indicated only when MS2 RNA and at least two of p24 antigen, anti-p24 antibody, and HIV-1 RNA are detected in the sample by the plurality of detecting agents.

69. The method according to claim 67 or 68, wherein the detection of less than two of p24 antigen, anti-p24 antibody, and HIV-1 RNA in the sample by the plurality of detecting agents indicates no HIV infection.

70. The method according to claim 69, wherein the subject having no HIV infection has previously received HIV vaccination and has vaccine-induced sero-reactivity (VISR) or vaccine-induced sero-positivity (VISP).

71. The method according to any one of claims 66 to 71, wherein the subject is human.

72. The method according to any one of claims 67 to 72, wherein the sample is selected from the group consisting of a plasma sample, a serum sample, and a whole blood sample.

73. The method according to any one of claims 67 to 72, wherein the sample is collected from the subject by using a finger prick unit, wherein the finger prick unit is configured to dispense the collected sample into the one or more reaction vessels in the detector.

74. The method according to any one of claims 67 to 73, wherein the method comprises diluting the sample.

75. The method according to any one of claims 67 to 74, wherein the method comprises diluting the sample prior to step a).

76. The method according to any one of claims 67 to 75, wherein the respective sensor comprises an electrode comprising one or more materials selected from the group consisting of gold, conductive carbon, platinum, palladium, stainless steel, tin, tungsten, titanium, or any combination thereof.

77. The method according to any one of claims 67 to 76, wherein the respective detecting agent for the corresponding biomarker is conjugated to the respective sensor.

78. The method according to any one of claims 67 to 77, wherein the respective sensor detects the presence or absence of the corresponding biomarker by using cyclic voltammetry (CV) scan; wherein the concentration of the corresponding biomarker is measured as a function of change in CV current peak.

79. The method according to any one of claims 67 to 78, wherein each sensor in the plurality of sensors is an electrochemical sensor strip.

80. The method according to any one of claims 67 to 79, wherein the detector further comprises an embedded sensor chip and wherein each sensor in the plurality of sensors is in the embedded sensor chip.

81. The method according to claim 80, wherein the embedded sensor chip analyzes CV scan data for each corresponding biomarker in the plurality of biomarkers collected from the respective sensor in the plurality of sensors, wherein the CV scan data comprises a set of CV currents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

82. The method according to any one of claims 67 to 81, wherein the respective sensor for p24 has a limit of detection (LOD) of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml.

83. The method according to any one of claims 67 to 82, wherein the respective sensor for p24 has a linear detection range of 0 to 1 x 105pg / ml.

84. The method according to any one of claims 67 to 83, wherein the respective sensor for anti-p24 antibody has an LOD of about 0.1-1 pg / ml, about 0.5-1 pg / ml, or about 1 pg / ml.

85. The method according to any one of claims 67 to 84, wherein the respective sensor for anti-p24 antibody has a linear detection range of 0 to 1 x 105pg / ml.

86. The method according to any one of claims 67 to 85, wherein the respective sensor for HIV-1 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml.

87. The method according to any one of claims 67 to 86, wherein the respective sensor for HIV-1 RNA has a linear detection range of 0 to lx 107copies / ml.

88. The method according to any one of claims 67 to 87, wherein the respective sensor for MS2 RNA has an LOD of less than about 1 copies / ml, about 1 copies / ml, about 2 copies / ml, about 3 copies / ml, about 4 copies / ml, or about 5 copies / ml.

89. The method according to any one of claims 67 to 88, wherein the respective sensor for MS2 RNA has a linear detection range of 0 to 1 x 107copies / ml.

90. The method according to any one of claims 67 to 89, wherein the detector further comprises a potentiostat reader, wherein the potentiostat reader is configured to communicate with each respective sensor in the plurality of sensors to collect CV scan data for the corresponding biomarker, wherein the CV scan data comprises a set of CV currents, comprising a respective CV current peak, measured by the respective sensor versus a range of electrical potentials applied by the respective sensor, wherein the concentration of the corresponding biomarker is measured as a function of change in the respective CV current peak.

91. The method according to any one of claims 67 to 90, wherein during step a) or b), the sample is dispensed into a single reaction vessel in the detector that contains the plurality of the detecting agents.

92. The method according to any one of claims 67 to 90, wherein during step a) or b), the sample is dispensed into a plurality of reaction vessels in the detector, wherein each reaction vessel in the plurality of reaction vessels contains a sub-set of the plurality of detecting agents.

93. The method according to claim 92, wherein the sample is dispensed into two reaction vessels, wherein the detecting agents in the first reaction vessel are specific for protein biomarkers in the plurality of biomarkers and the detecting agents in the second reaction vessel are specific for RNA biomarkers in the plurality of biomarkers.

94. The method according to claim 93, wherein the detecting agents in the first reaction vessel are specific for p24 and anti-p24 antibody and the detecting agents in the second reaction vessel are specific for HIV-1 RNA and MS2 RNA.

95. The method according to any one of claims 67 to 94, wherein the method comprises suspending protein biomarkers in the plurality of biomarkers in the sample, the suspending comprising treating the sample with a suspension buffer.

96. The method according to claim 95, wherein the suspension buffer comprises about 0.5% triton X-100.

97. The method according to claim 95 or 96, wherein the suspending is performed prior to step a).

98. The method according to claim 95 or 96, wherein the suspending is performed during any of the steps through a) to c).

99. The method according to any one of claims 95 to 98, wherein the suspending is performed in a respective reaction vessel in the one or more reaction vessels, wherein the respective reaction vessel comprises the detecting agents in the plurality of detecting agents specific for protein biomarkers in the plurality of biomarkers.

100. The method according to any one of claims 67 to 99, wherein the method comprises extracting RNA biomarkers in the plurality of biomarkers in the sample, the extracting comprising treating the sample with an RNA lysis buffer.

101. The method according to claim 100, wherein the RNA lysis buffer is selected from the group consisting of: a buffer comprising about 1 mg / ml proteinase K, about 0.5 % sodium dodecyl sulfate, and about 10 mM dithiothreitol; a radioimmunoprecipitation assay (RIP A) lysis buffer; and a buffer comprising guanidine isothiocyanate.

102. The method according to claim 100 or 101, wherein the extracting is performed prior to step a).

103. The method according to claim 100 or 101, wherein the extracting is performed during any of the steps through a) to c).

104. The method according to any one of claims 100 to 103, wherein the extracting is performed in a respective reaction vessel in the one or more reaction vessels, whereinthe respective reaction vessel comprises the detecting agents in the plurality of detecting agents specific for RNA biomarkers in the plurality of biomarkers.

105. The method according to any one of claims 67 to 104, wherein steps a) through d) are performed within about 0.1 hours, about 0.5 hours, or about 1 hour.

106. The method according to any one of claims 67 to 105, wherein, when the sample was obtained from the subject during eclipse period since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

107. The method according to any one of claims 67 to 105, wherein, when the sample was obtained from the subject during acute HIV infection period since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

108. The method according to any one of claims 67 to 105, wherein, when the sample was obtained from the subject during early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

109. The method according to any one of claims 67 to 105, wherein, when the sample was obtained from the subject after early HIV infection period since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

110. The method according to any one of claims 67 to 105, wherein, when the sample was obtained from the subject between about Day 0 and about Day 28, or between about Day 10 and about Day 28, since the initiation of the HIV infection, at least p24 and HIV-1 RNA are detected by the detector in the sample.

111. The method according to any one of claims 67 to 105, wherein, when the sample was obtained from the subject between about Day 28 and about Day 70, or after about Day 70, since the initiation of the HIV infection, at least HIV-1 RNA and anti-p24 antibody are detected by the detector in the sample.

112. The method according to any one of claims 67 to 111, wherein the detecting agent for p24 is an extraneous anti-p24 antibody or a variant thereof.

113. The method according to any one of claims 67 to 112, wherein the detecting agent for p24 is an extraneous anti-p24 IgG antibody or a variant thereof.

114. The method according to any one of claims 67 to 113, wherein the detecting agent for p24 is conjugated to the respective sensor.

115. The method according to claim 114, wherein the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent for p24.

116. The method according to any one of claims 67 to 115, wherein the detecting agent for anti-p24 antibody is extraneous p24 or a variant thereof.

117. The method according to any one of claims 67 to 116, wherein the detecting agent for anti-p24 antibody is conjugated to the respective sensor.

118. The method according to claim 117, wherein the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent for anti-p24 antibody.

119. The method according to any one of claims 67 to 118, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises one or two nucleic acid probes.

120. The method according to any one of claims 67 to 119, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA is conjugated to the respective sensor.

121. The method according to claim 120, wherein the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent(s) for HIV-1 RNA.

122. The method according to claim 120, wherein the conjugating is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM,about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for HIV-1 RNA.

123. The method according to claim 120, wherein the conjugating is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for HIV-1 RNA.

124. The method according to any one of claims 67 to 123, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a 5 ’-thiol moiety and a 3 ’-methylene blue (MB) redox reporter moiety.

125. The method according to any one of claims 67 to 124, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA hybridizes to, or is complementary with, a segment of an HIV-1 RNA molecule.

126. The method according to claim 125, wherein the HIV-1 RNA molecule encodes protein R or envelope surface protein of HIV- 1.

127. The method according to any one of claims 67 to 126, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a nucleic acid probe comprising the sequence of CC AAGGCCCAGCCCTCAC ACA (SEQ ID NO:1).

128. The method according to any one of claims 67 to 127, wherein the detecting agent(s) in the plurality of detecting agents for HIV-1 RNA comprises a first nucleic acid probe comprising the sequence of CCAAGGCCCAGCCCTC ACACA (SEQ ID NO: 1) and a second nucleic acid probe comprising the sequence of CTTGTATTGTTGTTGGGTCT (SEQ ID NO:2).

129. The method according to any one of claims 67 to 128, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises one or two nucleic acid probes.

130. The method according to any one of claims 67 to 129, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA antibody is conjugated to the respective sensor.

131. The method according to claim 130, wherein the conjugating is accomplished by incubating the sensor with about 5 pg / ml of the detecting agent(s) for MS2 RNA.

132. The method according to claim 130, wherein the conjugating is accomplished by incubating the sensor with about 1 pM, about 2 pM, about 3 pM, about 4 pM, about 5 pM, about 6 pM, about 7 pM, about 8 pM, about 9 pM, about 10 pM, about 11 pM, about 12 pM, about 13 pM, about 14 pM, about 15 pM, about 16 pM, about 17 pM, about 18 pM, about 19 pM, or about 20 pM of the detecting agent(s) for MS2 RNA.

133. The method according to claim 130, wherein the conjugating is accomplished by incubating the sensor with about 5 pM, or about 10 pM of the detecting agent(s) for MS2 RNA.

134. The method according to any one of claims 67 to 133, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises a 5 ’-thiol moiety and a3 ’-methylene blue (MB) redox reporter moiety.

135. The method according to any one of claims 67 to 134, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA hybridizes to, or is complementary with, a segment of an MS2 RNA molecule.

136. The method according to any one of claims 67 to 135, wherein the detecting agent(s) in the plurality of detecting agents for MS2 RNA comprises a nucleic acid probe comprising the sequence of TCTGGAAGTTTGCAGCTGGA (SEQ ID NO:3).