Lipid nanoparticle formulations for cell therapy and related methods
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- GLOBAL LIFE SCI SOLUTIONS CANADA ULC
- Filing Date
- 2023-12-22
- Publication Date
- 2026-05-06
AI Technical Summary
Current cell therapy delivery methods, such as electroporation, face challenges with safety, manufacturability, stability, and efficacy, particularly in efficiently transfecting T cells without impairing their survival, and existing lipid nanoparticle formulations often rely on cholesterol and PEG for stability and cell entry, which can be limiting.
The development of lipid formulations comprising an ionizable lipid, a phospholipid, and a sterol like cholesteryl hemisuccinate, optionally with a stabilizer, that form lipid-based nanoparticles capable of transfecting nucleic acid cargo into hematopoietic lineage cells, including T cells, without the need for cholesterol and PEG, enhancing encapsulation efficiency and expression of nucleic acid cargos.
These formulations demonstrate effective transfection and increased encapsulation efficiency compared to traditional methods, allowing for the successful delivery of therapeutic agents like CAR-encoded mRNA and gene editing tools, while maintaining cell viability and scalability for pharmaceutical applications.
Smart Images

Figure US2023085852_02012025_PF_FP_ABST
Abstract
Description
Leydig 770158 / US DHR P2023-3706-WO01 1 LIPID NANOPARTICLE FORMULATIONS FOR CELL THERAPY AND RELATED METHODS CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This patent application claims priority to International Application No. PCT / US2023 / 069303, filed June 28, 2023, which claims the benefit of U.S. Provisional Application 63 / 357,094, filed June 30, 2022, which are incorporated by reference in their entireties herein. BACKGROUND
[0002] Nucleic-acid-based cell therapy reagents offer advantages over electroporation and traditional oncological treatments in terms of safety and efficacy. In particular, RNA cell therapies are subject to degradation by exonucleases and endonucleases in vivo without a delivery system, so they need a carrier.
[0003] Lipid nanoparticles (also referred to herein as “LNP”) generally consist of different lipids, each serving distinct functions. LNP can have a lipidic or aqueous core and may contain bilayer structures depending on the abundance of each type of lipids.
[0004] Generally, the components of LNP formulations include: ionizable cationic lipids, which spontaneously encapsulate negatively-charged nucleic acids by a combination of attractive electrostatic interactions with and hydrophobic interactions; neutral phospholipids to reduce charge-related toxicity and to maintain structure of the LNP; and cholesterol to stabilize the LNP and help with cell entry, and a lipid-conjugated polyethylene glycol (PEG).
[0005] Recognized challenges to creating successful LNP cell therapy are safety, manufacturability, stability, and efficacy. There is a continued need in the art to provide additional solutions to a better cell therapy delivery agent with both high efficiency and high live cell yield. The present disclosure provides for ameliorating at least some of the disadvantages of the prior art. These and other advantages of the present disclosure will be apparent from the description as set forth below.
[0006] It will be appreciated that this background description has been created to aid the reader and is not to be taken as an indication that any of the indicated problems were themselves appreciated in the art. While the described principles can, in some aspects and embodiments, alleviate the problems inherent in other systems, it will be appreciated that theLeydig 770158 / US DHR P2023-3706-WO01 2 scope of the protected innovation is defined by the attached claims and not by the ability of any disclosed feature to solve any specific problem noted herein. BRIEF SUMMARY
[0007] The disclosure provides, e.g., lipid formulations and related methods suitable for forming nucleic acid-based cell therapy reagents in lipid nanoparticles. In an aspect, the disclosure provides a lipid formulation for forming a lipid-based nanoparticle suitable for transfecting nucleic acid cargo into cells of hematopoietic lineage comprising an ionizable lipid, a phospholipid, a sterol, and optionally a stabilizer.
[0008] In another aspect, the disclosure provides a lipid formulation comprising an ionizable lipid, a phospholipid, a sterol, and optionally a stabilizer, for forming a lipid-based nanoparticle suitable for transfecting a nucleic acid cargo into T cells, Jurkat cells, hematopoietic stem cells, natural killer cells, or antigen presenting cells.
[0009] In a further aspect, the disclosure provides a method for screening lipid composition of lipid nanoparticles for preferential delivery of RNA to T cells. The method comprises: (a) preparing a plurality of lipid nanoparticles with different lipid compositions and a reporter RNA, (b) administering the lipid nanoparticles to Jurkat cells, (c) measuring the relative abundance of reporter RNA, (d) comparing the relative abundance of reporter RNA to a threshold, and (e) identifying lipid compositions above threshold as candidates for preferential delivery of RNA to T cells.
[0010] Further and alternative aspects and features of the disclosed principles will be appreciated from the following detailed description and the accompanying drawings. Other aspects and features of the present invention will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments of the invention in conjunction with the accompanying figures. Accordingly, it is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and do not restrict the scope of the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] The figure is graphical representation of the half maximal effective concentration (EC50) dose for transfection in BHK cells of lipid formulations containing cholesterol (gray bars) and cholesteryl hemisuccinate (black bars) as discussed in Example 4.Leydig 770158 / US DHR P2023-3706-WO01 3
[0012] It should be understood that the drawings are not necessarily to scale and that the disclosed embodiments are sometimes illustrated diagrammatically and in partial views. In certain instances, details which are not necessary for an understanding of this disclosure or which render other details difficult to perceive may have been omitted. It should be understood that this disclosure is not limited to the particular embodiments illustrated herein. DETAILED DESCRIPTION
[0013] Embodiments of the present disclosure provide lipid formulations comprising an ionizable lipid, a phospholipid, a sterol, and optionally a stabilizer. The lipid formulations are useful for forming a lipid-based nanoparticle suitable for transfecting nucleic acid cargo into cells of hematopoietic lineage. The lipid formulations as provided herein can include cholesteryl hemisuccinate as a sterol. Surprisingly, the lipid formulations with cholesteryl hemisuccinate demonstrate effective transfection, even though the conventional understanding in the art was that cholesteryl hemisuccinate would be a poor substitute for cholesterol in these applications. The lipid formulations as provided herein can exclude cholesterol, instead substituting cholesteryl hemisuccinate, and exclude a lipid-conjugated polyethylene glycol (PEG) in some embodiments, which have both conventionally been believed to be important components, particularly for stability. Unexpectedly, the lipid formulations in accordance with embodiments of the present disclosure demonstrate effective transfection, even with cholesteryl hemisuccinate substituting for cholesterol and without the presence of PEG.
[0014] The lipid nanoparticles disclosed herein can further comprise therapeutic agents such as nucleic acid cargos, which can comprise chimeric antigen receptor (CAR) encoded mRNA, a gene editing nuclease and a guide RNA to perform permanent gene knockout and / or insertion, or an mRNA encoding a protein to correct a genetic deficiency. Advantageously, such therapeutic agents can be used for cell therapy. Some of the lipid formulations disclosed herein lack cholesterol, known to provide stability and assist in cell entry, but comprise cholesteryl hemisuccinate as a cholesterol substitute, and surprisingly the lipid nanoparticles they form are able to effectively transfect target cells. While cholesteryl hemisuccinate can be negatively charged at pHs>5.6, which can interfere with negatively charged nucleic acids, advantageously, the lipid nanoparticles disclosed herein with cholesteryl hemisuccinate as a sterol and without PEG, do not exhibit a decreased encapsulation efficiency. The lipid nanoparticles disclosed herein beneficially exhibitLeydig 770158 / US DHR P2023-3706-WO01 4 increased encapsulation efficiency and comparable expression of nucleic acid cargos compared to other methods of transfection, such as lipid particles containing cholesterol and PEG. Advantageously, the lipid nanoparticles described herein also demonstrate the ability to be produced at batch scale with saRNAs as a nucleic acid cargo, which is beneficial for pharmaceutical applications.
[0015] The lipid formulations are useful for forming a lipid-based nanoparticle, e.g., suitable for transfecting nucleic acid cargo into cells of hematopoietic lineage. In embodiments, lipid mix formulations are provided for use in generating more effective lipid- based formulations of nucleic acid cargo (including, e.g., vaccine, gene editing tools, and protein replacement mRNA) and other oligomers such as peptides, and methods for using these lipid mixes and resulting formulations to prepare vaccines. Surprisingly and unexpectedly, the lipid mixes can exclude cholesterol, which is known in the art to stabilize LNPs and assist in cell entry, but by substituting cholesteryl hemisuccinate still remain effective at transfection.
[0016] In embodiments, the disclosure provides a lipid formulation comprising an ionizable lipid, a phospholipid, a sterol, and optionally a stabilizer, for forming a lipid-based nanoparticle suitable for, e.g., transfecting a nucleic acid cargo into T cells, Jurkat cells, hematopoietic stem cells, natural killer cells, or antigen presenting cells.
[0017] In accordance with some embodiments, the lipid formulation forms part of a composition for cell therapy, which include a nucleic acid cargo. In accordance with aspects of the disclosure, the lipid formulation can further comprise a nucleic acid cargo. As described herein, the term “cargo,” or “payload,” refers to a substance intended to have a direct effect in the mitigation or prevention of disease, i.e., to act as a therapeutic agent, or to act as a research reagent. As described herein, the term “therapeutic agents” includes nucleic acids, as herein described, or nucleic acid therapeutics (“NAT”), oligopeptides, polypeptides, and small molecules.
[0018] The therapeutic agent, in accordance with some embodiments, is a nucleic acid therapeutic, such as an RNA polynucleotide. In embodiments, the therapeutic agent is messenger RNA (mRNA) or self-amplifying RNA (saRNA). In further embodiments, the therapeutic agent is double stranded small interfering RNA (siRNA), circular DNA (plasmid), linearized plasmid DNA, minicircles, or msDNA (multicopy single stranded DNA).
[0019] As used herein, the term “nucleic acid cargoes” includes deoxyribonucleic acid, complementary deoxyribonucleic acid, complete genes, ribonucleic acid, oligonucleotidesLeydig 770158 / US DHR P2023-3706-WO01 5 and ribozymes, acting as a nucleic acid therapeutic (NAT) for gene therapies targeting a variety of diseases, such as cancer, infectious diseases, genetic disorders and neurodegenerative diseases. The nucleic acid cargo, in accordance with some embodiments, comprises chimeric antigen receptor (CAR) encoded mRNA. In embodiments, the nucleic acid cargo comprises a gene editing nuclease and a guide RNA to perform permanent gene knockout and / or insertion. The nucleic acid cargo comprises, in accordance with further embodiments, an mRNA encoding a protein to correct a genetic deficiency. Embodiments of the present disclosure provide wherein the nucleic acid cargo comprises an mRNA encoding a protein to treat disease and wherein the nucleic acid cargo comprises two or more nucleic acids. For example, in some embodiments, the nucleic acid cargo comprises at least two nucleic acids, such as 3 nucleic acids, 4 nucleic acids, 5 nucleic acids, 6 nucleic acids, 7 nucleic acids, 8 nucleic acids, 9 nucleic acids, 10 nucleic acids, etc. In some embodiments, wherein the nucleic acid cargo comprises two or more nucleic acids, the two or more nucleic acids are packaged in separate nanoparticles.
[0020] As described herein, the NAT is incorporated into lipid particle during its formation with compounds of the invention. More than one nucleic acid therapeutic may be incorporated in this way. They may be derived from natural sources, or more commonly, synthesized or grown in culture. Examples of nucleic acid cargo include, but are not limited to, antisense oligonucleotides, ribozymes, microRNA, mRNA, ribozyme, tRNA, tracrRNA, sgRNA, snRNA, siRNA, shRNA, ncRNA, miRNA, mRNA, pre-condensed DNA, plasmid or pDNA, or an aptamer. Nucleic acid reagents are used to silence genes (with for example siRNA), express genes (with for example mRNA), edit genomes (with for example CRISPR / Cas9), and reprogram cells for return to the originating organism (for example ex vivo cell therapy to reprogram immune cells for cancer therapy; autologous transfer or allogenic transfer).
[0021] As described herein, the term “nucleic acid” refers to ribonucleotides, deoxynucleotides, modified ribonucleotides, modified deoxyribonucleotides, modified phosphate-sugar-backbone oligonucleotides, other nucleotides, nucleotide analogs, and combinations thereof, and can be single stranded, double stranded, or contain portions of both double stranded and single stranded sequence, as appropriate. Nucleic acids are meant to include any oligonucleotide or polynucleotide whose delivery into a cell causes a desirable effect. Messenger RNA (mRNA) can be modified or unmodified, base modified, and may include different type of capping structures, such as Cap1. As described herein, nucleic acids includes diagnostic agents and research reagents which follow the same physicalLeydig 770158 / US DHR P2023-3706-WO01 6 principles afforded by aspects of the invention. In some embodiments, nucleic acid refers to self-amplifying RNA (“saRNA”). Nucleic acid, in further embodiments, refers to a plasmid including self-amplifying RNA.
[0022] As described herein, the terms “polynucleotide” and “oligonucleotide” are used interchangeably and refer to single-stranded and double-stranded polymers of nucleotide monomers, including 2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bond linkages, e.g., 3'-5' and 2'-5', inverted linkages, e.g., 3'- 3' and 5'-5', branched structures, or internucleotide analogs. Polynucleotides have associated counter ions, such as H+, NH4+, trialkylammonium, Mg2+, Na+, and the like. A polynucleotide may be composed entirely of deoxyribonucleotides, entirely of ribonucleotides, or chimeric mixtures thereof. Polynucleotides may include internucleotide, nucleobase and / or sugar analogs. Fragments containing up to 50 nucleotides are generally termed oligonucleotides, and longer RNA are called polynucleotides. In embodiments, oligonucleotides of the present invention are 20-50 nucleotides in length. In further embodiments of the present disclosure, polynucleotides are 996 to 4500 nucleotides in length, as in the case of messenger RNA. Further, polynucleotides of the invention can include up to 14,000 nucleotides, in accordance with embodiments of the present disclosure.
[0023] The nucleic acid that is present in a lipid particle according to the present disclosure includes any form of nucleic acid that is known. The nucleic acids used herein can be single-stranded DNA or RNA, or double-stranded DNA or RNA, or DNA-RNA hybrids. Examples of double-stranded DNA include structural genes, genes including control and termination regions, and self-replicating systems such as viral or plasmid DNA. Examples of double-stranded RNA include siRNA and other RNA interference reagents. Single-stranded nucleic acids include antisense oligonucleotides, guide RNA, including CRISPR-Cas9 gRNA, ribozymes, microRNA, mRNA, and triplex-forming oligonucleotides. More than one nucleic acid may be incorporated into the lipid particle, for example mRNA and guide RNA together, or different types of each, or in combination with protein.
[0024] In some cases, a nucleic acid encodes a genetically engineered receptor that specifically binds to a ligand, such as a recombinant receptor, and a molecule involved in a metabolic pathway, or functional portion thereof. Alternately, the molecule involved in a metabolic pathway is a recombinant molecule, including an exogenous entity. A genetically engineered receptor and the molecule involved in a metabolic pathway may be encoded by one nucleic acid or two or more different nucleic acids. In some examples, a first nucleicLeydig 770158 / US DHR P2023-3706-WO01 7 acid might encode a genetically engineered receptor that specifically binds to a ligand and a second nucleic acid might encode the molecule involved in a metabolic pathway.
[0025] The term “polypeptides,” as described herein, encompasses the terms “oligopeptides” and “proteins” as well as tertiary and quaternary structures thereof, that are therapeutic agents in some embodiments. Further, the term “polypeptide” refers to a single linear chain of many amino acids of any length held together by amide bonds and the term “oligopeptide” generally consists of from two to twenty amino acids, as used herein. The term “protein,” as described herein, refers to one or more polypeptide and may include structural proteins, energy catalysts, albumin, hemoglobin, immunoglobulins, and enzymes.
[0026] As referred to herein, the recitation of numerical ranges by endpoints includes all numbers subsumed within that range including all whole numbers, all integers and all fractional intermediates (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, and 5 etc.). The singular forms an “an”, and “the” include plural referents unless the content clearly dictates otherwise, as used herein. Thus, for example, reference to a composition containing “a compound” includes a mixture of two or more compounds. In addition, the term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise.
[0027] The term “about,” as used herein, refers to 12.5% plus or minus the recited number, unless otherwise indicated. It is used to signify that the desired target concentration might be, for example, 40 Mol%, but that through mixing inconsistencies or additional components not in the Mol% calculation, the actual percentage might differ by + / - 5 Mol%.
[0028] The term “substantially,” as described herein, refers to being 5% plus or minus the recited number. It is used to signify that the desired target concentration might be, for example, 40 Mol%, but that through mixing inconsistencies, the actual percentage might differ by + / - 2 Mol%.
[0029] As described herein, cell therapy refers to transferring cells into the body to replace diseased or damaged cells. The transferred cells may be a patient’s own cells, and by using cell therapy, one of ordinary skill in the art can rectify disease processes in these cells and restore them to the patient.
[0030] Currently, electroporation is considered the most feasible way to genetically modify T cells. Electroporation physically disrupts the cell membrane to force genetic material into cells, and results in some T cells being “irreversibly electroporated” or killed. Electroporation may cause some risk to the genetic materials being damaged before or during transfer. In addition, electroporated cells can take a long time to proliferate and aLeydig 770158 / US DHR P2023-3706-WO01 8 recent study showed that the viability of T Cells after electroporation was 31% as opposed to LNP mediated mRNA delivery. As known in the art, T cells are well-known as difficult to transfect without impairing their survival, even with lipid nanoparticles as carriers.
[0031] As described herein, one cell therapy is CAR T cell therapy. CAR T cell therapy uses cells from the subject being treated, selects and enriches for T cells, and then engineers these cells using a viral vector to express a chimeric antigen receptor (CAR). The cells are returned to the subject, resulting in immunotherapy. Despite the success of CAR treatment, there are issues: a) not all the treated T cells have CAR, b) there is variability in the amount of CARs expressed on the T cells that are transfected, c) patients undergoing CAR have often had multiple rounds of chemotherapy which means less healthy T cells which are harder to enrich, and 4) there is a high incidence (46% or more) in patients of Cytokine Release Syndrome (CRS). Patients with CRS require intensive care unit level care, and treatment with powerful and expensive immunotherapies such as tocilizumab (Actemra™).
[0032] Viral based to T-cell transformation has been tried, but is labor intensive, expensive and pose manufacturing and regulatory challenges. Vector design and development takes time as suitable vectors determine the efficiency of transduction. Also, virus manufacturing methods are expensive because they are highly regulated, need a lot of equipment, and are labor intensive (one batch for each patient). Viral based transfection also poses the risk that viral genome may randomly insert into the human genome, and requires that the patient leave the hospital to have T cells harvested and treated at a specialized viral manufacturing facility.
[0033] The present disclosure provides methods for introducing a nucleic acid into a cell (i.e., transfection) in accordance with some embodiments. In embodiments, the disclosure provides a method of preferentially transfecting cells of hematopoietic lineage using the lipid nanoparticles disclosed herein, the method comprising contacting the cells with lipid nanoparticles, wherein the cells maintain at least 50 percent immune cell viability post contact. As described herein, the term “transfection” refers to the transfer of nucleic acid into cells for the purpose of inducing the expression of a specific gene(s) of interest in both laboratory and clinical settings. It typically includes an ionizable lipid to associate with nucleic acid, cholesterol, polyethylene glycol-conjugated lipid, and phospholipids. LIPOFECTIN™ and LIPOFECTAMINE™ are established commercial transfecting reagents sold by ThermoFisher Scientific. These research reagents contain permanently cationic lipid / s and are not suitable for clinical use. In some embodiments, the transfected cells of hematopoietic lineage are T cells, Jurkat cells, hematopoietic stem cells, natural killer cells,Leydig 770158 / US DHR P2023-3706-WO01 9 or antigen presenting cells. Transfection is a technique commonly used in molecular biology for the introduction of nucleic acid cargo (or NATs) from the extracellular to the intracellular space for the purpose of transcription, translation, and expression of the delivered nucleic acid therapeutic (NAT)cargo for production of some gene product or for down regulating the expression of a disease-related gene.
[0034] Transfection efficiency is commonly defined as either the i) percentage of cells in the total treated population showing positive expression of the delivered gene, as measured by live or fixed cell imaging (for detection of fluorescent protein), and flow cytometry or ii) the intensity or amount of protein expressed by treated cell(s) as analyzed by live or fixed cell imaging or flow cytometry or iii) using protein quantification techniques such as ELISA, or western blot. These methods may be carried out by contacting the lipid particles or lipid mix formulations of the present disclosure with the cells for a period of time sufficient for intracellular delivery to occur. Typical applications include using well-known procedures to provide intracellular delivery of siRNA to knock down or silence specific cellular targets in vitro and in vivo. Alternatively, applications include delivery of DNA or mRNA sequences that code for therapeutically useful polypeptides. In this manner, therapy is provided for genetic diseases by supplying deficient or absent gene products.
[0035] As described herein, the term “lipid” refers to a structurally diverse group of organic compounds that are fatty acid derivatives or sterols or could be lipid like materials as in lipidoids (example C12-200) and are characterized by being insoluble in water but soluble in many organic solvents.
[0036] The term “lipid mix formulations,” as described herein, refer to the types of components, ratios of components, and the ratio of the total lipid components. Typically, lipid mix formulations for the manufacture of lipid nanoparticles for nucleic acid delivery comprise cationic or ionizable lipid, phospholipid, cholesterol, and a stabilizer such as polyethylene glycol conjugated lipids. In embodiments, the lipid mix formulation comprises an ionizable lipid, a phospholipid, a sterol, and optionally a stabilizer. In some embodiments, the sterol is cholesteryl hemisuccinate. In some embodiments, the lipid mix formulation is substantially free of cholesterol. Lipid mix formulations are supplied to customers preparing their own LNP on instruments in their facilities. The lipid mixes described may be used to deliver a therapeutic agent to a cell, in vitro, ex vivo, or in vivo.
[0037] As described herein, the term “lipid particles” refers to generally spherical assemblies of lipids, which can include nucleic acid, cholesterol, and stabilizing agents. The lipid particle represents the physical organization of the lipid mix formulation with theLeydig 770158 / US DHR P2023-3706-WO01 10 therapeutic agent among the components. Positive and negative charges, ratios, as well as hydrophilicity and hydrophobicity dictate the physical structure of the lipid particles in terms of size and orientation of components. The structural organization of these lipid particles may lead to an aqueous interior with one or more bilayers as in liposomes or it may have a solid interior as in a solid nucleic acid lipid nanoparticle. There may be phospholipid monolayers or bilayers in single or multiple forms. Lipid particles are between 1 and 1000 microns in diameter. The present disclosure provides lipid particles manufactured from the lipid mix formulations described herein.
[0038] As described herein, the term “lipid nanoparticle” or “LNP” refers to a lipid particle about 300 nm or less in diameter, such as from about 200 nm or less, e.g., from about 15 nm to about 300 nm, from about 25 nm to about 300 nm, from about 50 nm to about 300 nm, from about 75 nm to about 300 nm, from about 100 nm to about 300 nm, from about 125 nm to about 300 nm, from about 150 nm to about 300 nm, from about 175 nm to about 300 nm, from about 200 nm to about 300 nm, from about 225 nm to about 300 nm, from about 250 nm to about 300 nm, from about 275 nm to about 300 nm, from about 15 nm to about 275 nm, from about 15 nm to about 250 nm, from about 15 nm to about 225 nm, from about 15 nm to about 200 nm, from about 15 nm to about 175 nm, from about 15 nm to about 150 nm, from about 15 nm to about 125 nm, from about 15 nm to about 100 nm, from about 15 nm to about 75 nm, from about 15 nm to about 50 nm, from about 15 nm to about 25 nm, from about 50 nm to about 250 nm, from about 75 nm to about 200 nm, from about 100 nm to about 180 nm, from about 125 nm to about 175 nm, from about 150 nm to about 175 nm, from about 175 nm to about 275 nm, from about 200 nm to about 250 nm, etc..
[0039] The present disclosure provides lipid nanoparticles manufactured from the lipid mix formulations described herein.
[0040] As described herein, the term “viability” refers the ability to continue to grow, divide, and continue to grow and divide, as is normal for the cell type or tissue culture strain, when referring to cells in vitro. Cell viability is affected by harsh conditions or treatments. Cell viability is critical in ex vivo therapy or parenteral administration.
[0041] The term “ionizable lipid,” as described herein, refers to a lipid that is cationic or becomes ionizable (protonated) as the pH is lowered below the pKa, also referred to as the acid dissociation constant or acid ionization constant, of the ionizable group of the lipid but is more neutral at higher pH values. At pH values below the pKa, the lipid is then able to associate with negatively charged nucleic acids (e.g., oligonucleotides). As described herein,Leydig 770158 / US DHR P2023-3706-WO01 11 the term “ionizable lipid” includes lipids that assume a positive charge on pH decrease from physiological pH, and any of a number of lipid species that carry a net positive charge at a selective pH. Examples of suitable ionizable lipids are found in PCT Pub. Nos. WO20252589 and WO21000041. In some embodiments the ionizable lipid has a jasmonic acid headgroup. In other embodiments, the ionizable lipid has a tetrahydrofuran head group. The ionizable lipid is present in lipid formulations according to other embodiments of the present disclosure, preferably in a ratio of about 1 to about 85 Mol%, (“Mol%” means the percentage of the total moles that is of a particular component). The term “about” in this paragraph signifies a plus or minus range of 5 Mol% at increments of 0.1. For example, 28.7 Mol% would be in the claimed range of embodiments. DODMA, or 1,2-dioleyloxy-3- dimethylaminopropane, is an alternative ionizable lipid, as is DLin-MC3-DMA or O- (Z,Z,Z,Z-heptatriaconta-6,9,26,29-tetraen-19-yl)-4-(N,N-dimethylamino) (“MC3”). The compositions of the present disclosure comprise ionizable lipids as a component. In embodiments, the ionizable lipid comprises a mixture of ionizable lipids. In embodiments, LNPs can be generated from the lipid formulations including the ionizable lipids of the present disclosure.
[0042] Exemplary ionizable lipids include, but are not limited to of (Z)-3-(2-((1,17- bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2-oxoethyl)-2-(pent-2-en-1-yl)cyclopentyl 4- (dimethylamino)butanoate (PNI 516), 3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9- yl)oxy)-2-oxoethyl)cyclopentyl 4-(dimethylamino)butanoate (PNI 550), Z)-3-(2-((1,17- bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2-oxoethyl)-2-(pent-2-en-1-yl)cyclopentyl 1,4- dimethylpiperidine-4-carboxylate (PNI 560), (2R,3S,4S)-2-(((1,4-dimethylpiperidine-4- carbonyl)oxy)methyl)tetrahydrofuran-3,4-diyl (9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12- dienoate) (PNI 127), (2R,3S,4S)-2-(((4- (dimethylamino)butanoyl)oxy)methyl)tetrahydrofuran-3,4-diyl bis(2-hexyldecanoate) (PNI 580), ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4- (dimethylamino)butanoate (PNI 659), (2R,3S,4S)-2-((((2- (dimethylamino)ethyl)carbamoyl)oxy)methyl)tetrahydrofuran-3,4-diyl bis(2- hexyldecanoate) (PNI 721), 2-(((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2- yl)methoxy)-N,N-dimethylethan-1-amine (PNI 722), ((2R,3R,4S)-3,4-bis((2- hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4-(diethylamino)butanoate (PNI 723), (2R,3S,4S)-2-((3-(dimethylamino)propoxy)methyl)tetrahydrofuran-3,4-diyl bis(2- hexyldecanoate) (PNI 726), ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-Leydig 770158 / US DHR P2023-3706-WO01 12 yl)methyl (2-(dimethylamino)ethyl)carbamate (PNI 728), and (2R,3S,4S)-2-((2- (dimethylamino)ethoxy)methyl)tetrahydrofuran-3,4-diyl bis(2-hexyldecanoate) (PNI 730).
[0043] As described herein, the terms ”phospholipids” or “helper lipids” or “neutral lipids” refer to any one of several lipid species that exist in either in an anionic, uncharged or neutral zwitterionic form at physiological pH. Phospholipids are incorporated into lipid formulations and lipid particles in embodiments of the present disclosure. The lipid formulations and lipid particles of embodiments of the present disclosure include one or more phospholipids at about 0.1 to about 85 Mol% of the composition, e.g., from about 0.2 to about 85 Mol%, about 0.3 to about 85 Mol%, about 0.4 to about 85 Mol%, about 0.5 to about 85 Mol%, about 0.6 to about 85 Mol%, about 0.7 to about 85 Mol%, about 0.8 to about 85 Mol%, about 0.9 to about 85 Mol%, about 1 to about 85 Mol%, about 2 to about 85 Mol%, about 3 to about 85 Mol%, about 4 to about 85 Mol%, about 5 to about 85 Mol%, about 6 to about 85 Mol%, about 7 to about 85 Mol%, about 8 to about 85 Mol%, about 9 to about 85 Mol%, about 10 to about 85 Mol%, about 20 to about 85 Mol%, about 30 to about 85 Mol%, about 40 to about 85 Mol%, about 50 to about 85 Mol%, about 60 to about 85 Mol%, about 70 to about 85 Mol%, about 80 to about 85 Mol%, about 0.1 to about 80 Mol%, about 0.1 to about 70 Mol%, about 0.1 to about 60 Mol%, about 0.1 to about 50 Mol%, about 0.1 to about 40 Mol%, about 0.1 to about 30 Mol%, about 0.1 to about 20 Mol%, about 0.1 to about 10 Mol%, about 0.1 to about 9 Mol%, about 0.1 to about 8 Mol%, about 0.1 to about 7 Mol%, about 0.1 to about 6 Mol%, about 0.1 to about 5 Mol%, about 0.1 to about 4 Mol%, about 0.1 to about 3 Mol%, about 0.1 to about 2 Mol%, about 0.1 to about 1 Mol%, about 0.1 to about 0.9 Mol%, about 0.1 to about 0.8 Mol%, about 0.1 to about 0.7 Mol%, about 0.1 to about 0.6 Mol%, about 0.1 to about 0.5 Mol%, etc. Suitable phospholipids support the formation of particles during manufacture. Representative phospholipids include but are not limited to diacylphosphatidylcholines, diacylphosphatidylethanolamines, diacylphosphatidylglycerols, and although not strictly “phospholipids” in a technical sense, is intended to include sphingomyelins (SM), dihydrosphingomyelins, cephalins, and cerebrosides.
[0044] Exemplary phospholipids include but are not limited to zwitterionic lipids, for example, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1- carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE),Leydig 770158 / US DHR P2023-3706-WO01 13 dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl- phosphatidyethanol amine (SOPE), and 1,2-dielaidoyl-sn-glycero-3-phophoethanolamine (trans DOPE). In some embodiments, the phospholipid is distearoylphosphatidylcholine (DSPC), DOPE, or DSPC.
[0045] In an embodiment, the phospholipid is any lipid that is negatively charged at physiological pH. These lipids include phosphatidylglycerols such as dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleyolphosphatidylglycerol (POPG), cardiolipin, phosphatidylinositol, diacylphosphatidylserine, diacylphosphatidic acid, and other anionic modifying groups joined to neutral lipids. Other suitable phospholipids include, e.g., glycolipids (e.g., monosialoganglioside GM1).
[0046] As described herein, the term “stabilizer” or “stabilizing agent” refers to an agent that is added to the ionizable lipid, the phospholipid, and the optional sterol that form the lipid formulation according to embodiments of the present disclosure. Examples of non- ionic stabilizing agents include but are not limited to: Polyethyleneglycol (PEG), DMG- PEG2000 (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-200), Polysorbates (Tweens), DMPE-PGA-diol(30), DMPE-PSar(50)-H-acetyl,TPGS (Vitamin E polyethylene glycol succinate), Brij™ S20 (polyoxyethylene (20) stearyl ether), Brij™35 (Polyoxyethylene lauryl ether, Polyethyleneglycol lauryl ether), Brij™S10 (Polyethylene glycol octadecyl ether, Polyoxyethylene (10) stearyl ether), and Myrj™52 (polyoxyethylene (40) stearate), sucrose monolaurate, Kolliphor(r) HS 15.
[0047] In some embodiments, the stabilizing agent includes PEGylated lipids including PEG-DMG 2000, also known as DMG PEG 2000 (“PEG-DMG”). Other polyethylene glycol conjugated lipids may also be used in some embodiments, such as DPE-PEG, DOPE- PEG, DMPG-PEG, PEG-PE, PEG Ceramide, DPPG-PEG, four armed PEGs, and many more. Variations are sold by Broadpharm (San Diego, CA) and CreativePEGworks (Chapel Hill, NC). The stabilizing agent may be used alone or in combinations with each other.
[0048] In embodiments, there is no stabilizing agent. In other embodiments, the stabilizing agent comprises about 0.1 to about 10 Mol% of the overall lipid mixture, such as from about 0.1 to about 10 Mol%, from about 0.5 to about 10 Mol%, from about 1 to about 10 Mol%, from about 1.5 to about 10 Mol%, from about 2 to about 10 Mol%, from about 2.5 to about 10 Mol%, from about 3 to about 10 Mol%, from about 3.5 to about 10 Mol%, from about 4 to about 10 Mol%, from about 4.5 to about 10 Mol%, from about 5 to about 10Leydig 770158 / US DHR P2023-3706-WO01 14 Mol%, from about 5.5 to about 10 Mol%, from about 6 to about 10 Mol%, from about 6.5 to about 10 Mol%, from about 7 to about 10 Mol%, from about 7.5 to about 10 Mol%, from about 8 to about 10 Mol%, from about 8.5 to about 10 Mol%, from about 9 to about 10 Mol%, from about 9.5 to about 10 Mol%, from about 0.5 to about 9 Mol%, from about 0.5 to about 8.5 Mol%, from about 0.5 to about 8 Mol%, from about 0.5 to about 7.5 Mol%, from about 0.5 to about 7 Mol%, from about 0.5 to about 6.5 Mol%, from about 0.5 to about 5.5 Mol%, from about 0.5 to about 5 Mol%, from about 0.5 to about 4.5 Mol%, from about 0.5 to about 4 Mol%, from about 0.5 to about 3.5 Mol%, from about 0.5 to about 3 Mol%, from about 0.5 to about 2.5 Mol%, from about 0.5 to about 2 Mol%, from about 0.5 to about 1.5 Mol%, from about 0.5 to about 1 Mol%, from about 3 to about 10 Mol%, etc. In other embodiments, the stabilizing agent is present at greater than about 10 Mol% of the lipid mixture.
[0049] In embodiments, lipid formulations can be substantially cholesterol-free. Lipid formulations that are considered “substantially free” of cholesterol are formulations that contain either (i) 0 wt.%, or no cholesterol, or (ii) an ineffective or (iii) an immaterial amount of cholesterol. An example of an ineffective amount is an amount below the threshold amount to achieve the intended purpose of using cholesterol for stability and improve cell entry of the LNP, as one of ordinary skill in the art will appreciate. An immaterial amount may be, e.g., below about 1 wt.%, e.g., from about 1 wt.% or less, such as from about 0.9 wt.% or less, from about 0.8 wt.% or less, from about 0.7 wt.% or less, from about 0.6 wt.% or less, from about 0.5 wt.% or less, from about 0.4 wt.% or less, from about 0.3 wt.% or less, from about 0.2 wt.% or less, from about 0.1 wt.% or less, etc.
[0050] Examples of suitable lipid formulations substantially free of cholesterol are also found in commonly owned, co-assigned International Application No. _____, filed on December 22, 2023, titled “LIPID NANOPARTICLE FORMULATIONS FOR CELL THERAPY AND RELATED METHODS,” Attorney Docket No.769770, herein incorporated by reference.
[0051] As described herein, the term “sterol” refers to a lipid with a hydroxy group substituted at position 3 of gonane, that is added to the ionizable lipid and the phospholipid that form the lipid formulation according to embodiments of the present disclosure. Sterols can provide stability to lipid membranes. In some embodiments, the sterol is cholesteryl hemisuccinate. As described herein, the term “cholesteryl hemisuccinate” or “CHEMS” refers to an acidic ester that is an analog of cholesterol. In some embodiments, the sterol is cholesteryl hemisuccinate and the lipid formulation is substantially free of cholesterol. InLeydig 770158 / US DHR P2023-3706-WO01 15 some embodiments, the sterol is cholesterol. In other embodiments, the sterol is not cholesterol. In embodiments, a sterol includes about 0.1 to about 85 Mol% of the overall lipid mixture, e.g., such as from about 0.2 to about 85 Mol%, about 0.3 to about 85 Mol%, about 0.4 to about 85 Mol%, about 0.5 to about 85 Mol%, about 0.6 to about 85 Mol%, about 0.7 to about 85 Mol%, about 0.8 to about 85 Mol%, about 0.9 to about 85 Mol%, about 1 to about 85 Mol%, about 2 to about 85 Mol%, about 3 to about 85 Mol%, about 4 to about 85 Mol%, about 5 to about 85 Mol%, about 6 to about 85 Mol%, about 7 to about 85 Mol%, about 8 to about 85 Mol%, about 9 to about 85 Mol%, about 10 to about 85 Mol%, about 20 to about 85 Mol%, about 30 to about 85 Mol%, about 40 to about 85 Mol%, about 50 to about 85 Mol%, about 60 to about 85 Mol%, about 70 to about 85 Mol%, about 80 to about 85 Mol%, about 0.1 to about 80 Mol%, about 0.1 to about 70 Mol%, about 0.1 to about 60 Mol%, about 0.1 to about 50 Mol%, about 0.1 to about 40 Mol%, about 0.1 to about 30 Mol%, about 0.1 to about 20 Mol%, about 0.1 to about 10 Mol%, about 0.1 to about 9 Mol%, about 0.1 to about 8 Mol%, about 0.1 to about 7 Mol%, about 0.1 to about 6 Mol%, about 0.1 to about 5 Mol%, about 0.1 to about 4 Mol%, about 0.1 to about 3 Mol%, about 0.1 to about 2 Mol%, about 0.1 to about 1 Mol%, about 0.1 to about 0.9 Mol%, about 0.1 to about 0.8 Mol%, about 0.1 to about 0.7 Mol%, about 0.1 to about 0.6 Mol%, about 0.1 to about 0.5 Mol%, etc.. Sterol can include, in some embodiments, about 20 Mol% of the overall lipid mixture. In some embodiments, sterol includes about 40 Mol% of the overall lipid mixture.
[0052] The following table illustrates examples of the ratios of the three different lipid elements contemplated by embodiments of the present disclosure. The variations within these listed ranges are also contemplated.Leydig 770158 / US DHR P2023-3706-WO01 16
[0053] In some embodiments of the lipid formulation, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 40 to about 60 %Mol (e.g.48 %Mol), the phospholipid is DSPC at from about 5 to about 20 %Mol (e.g.13 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 30 to about 50 %Mol (e.g.39 %Mol). In other embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 45 to about 55 %Mol (e.g.48 %Mol), the phospholipid is DSPC at from about 10 to about 15 %Mol (e.g.13 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 35 to about 45 %Mol (e.g.39 %Mol). In still other embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721at from about 50 to about 70 %Mol (e.g.61.1 %Mol), the phospholipid is DSPC at from about 0.1 to about 10 %Mol (e.g.0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 30 to about 50 %Mol (e.g.38.4 %Mol). In further embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 55 to about 65 %Mol (e.g.61.1 %Mol), the phospholipid is DSPC at from about 0.1 to about 1.0 %Mol (e.g.0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 35 to about 45 %Mol (e.g.38.4 %Mol). In yet other embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 1 to about 20 %Mol (e.g.10.5 %Mol), the phospholipid is DSPC at from about 65 to about 85 %Mol (e.g.75.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 5 to about 25 %Mol (e.g.14 %Mol). In some embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 5 to about 15 %Mol (e.g.10.5 %Mol), the phospholipid is DSPC at from about 70 to about 80 %Mol (e.g.75.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 10 to about 20 %Mol (e.g.14 %Mol). In other embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 30 to about 50 %Mol (e.g.37.9 %Mol), the phospholipid is DSPC at from about 1 to about 20 %Mol (e.g.10.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 40 to about 60 %Mol (e.g.51.6 %Mol). In some embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 35 to aboutLeydig 770158 / US DHR P2023-3706-WO01 17 45 %Mol (e.g.37.9 %Mol), the phospholipid is DSPC at from about 5 to about 15 %Mol (e.g.10.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 45 to about 55 %Mol (e.g.51.6 %Mol). In other embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 15 to about 35 %Mol (e.g.24 %Mol), the phospholipid is DSPC at from about 0.1 to about 10 %Mol (e.g.0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 65 to about 85 %Mol (e.g.75.5 %Mol). In embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 20 to about 30 %Mol (e.g.24 %Mol), the phospholipid is DSPC at from about 0.1 to about 1.0 %Mol (e.g.0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 70 to about 80 %Mol (e.g.75.5 %Mol). In other embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 30 to about 50 %Mol (e.g.39.1 %Mol), the phospholipid is DSPC at from about 20 to about 40 %Mol (e.g.30.4 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 20 to about 40 %Mol (e.g.30.5 %Mol). In some embodiments, the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 35 to about 45 %Mol (e.g.39.1 %Mol), the phospholipid is DSPC at from about 25 to about 35 %Mol (e.g.30.4 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 25 to about 35 %Mol (e.g.30.5 %Mol). The foregoing various ingredients and amounts can be combined in various combinations, e.g., such as those listed herein.
[0054] The particle size of the lipid particles can be increased and / or decreased, in accordance with embodiments of the present disclosure. The change in particle size may be able to help counter biological reaction such as, but not limited to, inflammation or may increase the biological effect of the NAT delivered to mammals by changing biodistribution. Size can also be used to determine target tissue, with larger particles being cleared quickly and smaller one reaching different organ systems.
[0055] The lipid particles of the present disclosure can be assessed for size using devices that size particles in solution, such as the Wyatt Technology Nanostar™ or the Malvern™ Zetasizer™. The particles generally have a mean particle diameter of from 15nm to 1000nm. A subgroup of lipid particles is “lipid nanoparticles” or “LNP” with a mean diameter of from about 15 to about 300 nm. In some embodiments, the mean particle diameter is greater than 300 nm. In some embodiments, the lipid particle has a diameter of about 300 nm or less, 250 nm or less, 200 nm or less, 150 nm or less, 100 nm or less, or 50 nm or less. In embodiments, the lipid particle has a diameter of from about 50 to about 150 nm. Smaller particles generally exhibit increased circulatory lifetime in vivo compared to larger particles and can have an increased ability to reach tumor sites than largerLeydig 770158 / US DHR P2023-3706-WO01 18 nanoparticles. In embodiments, the lipid particle has a diameter from about 15 to about 50 nm.
[0056] The lipid particles according to embodiments of the present disclosure can be prepared by standard T-tube mixing techniques, turbulent mixing, trituration mixing, agitation promoting orders self-assembly, or passive mixing of all the elements with self- assembly of elements into nanoparticles. A variety of methods have been developed to formulate lipid nanoparticles (LNP) containing genetic drugs. Suitable methods are disclosed in U.S. Pat. No.5,753,613, U.S. Pat. No.6,734,171, and U.S. Pat. No.7,901,708, by way of example. These methods include mixing preformed lipid particles with NAT in the presence of ethanol or mixing lipid dissolved in ethanol with an aqueous media containing NAT and result in lipid particles with NAT encapsulation efficiencies of 65-99%. All of these methods rely on the presence of ionizable lipid to achieve encapsulation of NAT and a stabilizing agent to inhibit aggregation and the formation of large structures. The properties of the lipid particle systems produced, including size and NAT encapsulation efficiency, are sensitive to a variety of lipid mix formulation parameters such as ionic strength, lipid and ethanol concentration, pH, NAT concentration, and mixing rates.
[0057] Microfluidic two-phase droplet techniques have been applied to produce monodisperse polymeric microparticles for drug delivery or to produce large vesicles for the encapsulation of cells, proteins, or other biomolecules. The use of hydrodynamic flow focusing to create monodisperse liposomes of controlled size has also been demonstrated.
[0058] Parameters such as the relative lipid and NAT concentrations at the time of mixing, as well as the mixing rates are difficult to control using current formulation procedures, resulting in variability in the characteristics of NAT produced, both within and between preparations. The lipid mix formulation disclosed herein is unique in that the ratio of ionizable lipid to phospholipid is surprisingly low. Automated micro-mixing instruments such as the NanoAssemblr® instruments (Precision NanoSystems ULC, Vancouver, Canada) enable the rapid and controlled manufacture of nanomedicines (liposomes, lipid nanoparticles, and polymeric nanoparticles). NanoAssemblr® instruments accomplish controlled molecular self-assembly of nanoparticles via microfluidic mixing cartridges that allow millisecond mixing of nanoparticle components at the nanoliter, microliter, or larger scale with customization or parallelization. Rapid mixing on a small scale allows reproducible control over particle synthesis and quality that is not possible in larger instruments.Leydig 770158 / US DHR P2023-3706-WO01 19
[0059] Certain methods incorporate instruments such as the microfluidic mixing devices like the NanoAssemblr® Spark™, Ignite™, Benchtop™ and NanoAssemblr® Blaze™ in order to achieve nearly 100% encapsulation of the nucleic acid used in the formation process of the particles in one step. In embodiments, the lipid particles are prepared by a process by which from about 75 to about 100% of the nucleic acid used in the formation process is encapsulated in the particles.
[0060] U.S. Pat. Nos.9,758,795 and 9,943,846 describe methods of using small volume mixing technology and novel formulations derived thereby. U.S. Pat. No.10,159,652 describes more advanced methods of using small volume mixing technology and products to formulate different materials. U.S. Pat. No.9,943,846 discloses microfluidic mixers with different paths and wells to elements to be mixed. PCT Pub. No. WO 2017117647 discloses microfluidic mixers with disposable sterile paths. U.S. Pat. No.10,076,730 discloses bifurcating toroidal micro mixing geometries and their application to microfluidic mixing. PCT Pub. No. WO2018006166 discloses a programmable automated micromixer and mixing chips therefore. U.S. Design Nos. D771834, D771833, D772427, D803416, D800335, D800336 and D812242 disclose mixing cartridges having microchannels and mixing geometries for mixer instruments sold by Precision NanoSystems ULC.
[0061] In accordance with embodiments of the present disclosure, devices for biological microfluidic mixing are used to prepare the lipid particles. The devices include a first and second stream of reagents, which feed into the microfluidic mixer, and lipid particles are collected from the outlet, or emerge into a sterile environment.
[0062] The first stream includes a therapeutic agent in a first solvent. Suitable first solvents include solvents in which the therapeutic agents are soluble and that are miscible with the second solvent. Suitable first solvents include aqueous buffers. Representative first solvents include citrate and acetate buffers, or optionally other low pH buffers.
[0063] The second stream includes lipid mix materials in a second solvent. Suitable second solvents include solvents in which the ionizable lipids according to embodiments of the present disclosure are soluble, and that are miscible with the first solvent. Suitable second solvents include 1,4-dioxane, tetrahydrofuran, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide, acids, and alcohols. Representative second solvents include aqueous ethanol 90%, or anhydrous ethanol.
[0064] In one embodiment of the present disclosure, a suitable device includes one or more microchannels (i.e., a channel having its greatest dimension less than 2 millimeters). In one example, the microchannel has a diameter from about 15 to about 300μm, e.g., fromLeydig 770158 / US DHR P2023-3706-WO01 20 about 20 to about 300μm, from about 25 to about 300μm, from about 50 to about 300μm, from about 75 to about 300μm, from about 100 to about 300μm, from about 125 to about 300μm, from about 150 to about 300μm, from about 175 to about 300μm, from about 200 to about 300μm, from about 225 to about 300μm, from about 250 to about 300μm, from about 275 to about 300μm, from about 15 to about 275μm, from about 15 to about 250μm, from about 15 to about 225μm, from about 15 to about 200μm, from about 15 to about 175μm, from about 15 to about 150μm, from about 15 to about 125μm, from about 15 to about 100μm, from about 15 to about 75μm, from about 15 to about 50μm, from about 15 to about 25μm, from about 50 to about 250μm, from about 75 to about 200μm, from about 100 to about 180μm, from about 125 to about 175μm, from about 150 to about 175μm, from about 175 to about 275μm, from about 200 to about 250μm, etc. In another example, the microchannel has a diameter from about 300 to about 1000μm, e.g., from about 350 to about 1000μm, from about 400 to about 1000μm, from about 450 to about 1000μm, from about 500 to about 1000μm, from about 550 to about 1000μm, from about 600 to about 1000μm, from about 650 to about 1000μm, from about 700 to about 1000μm, from about 750 to about 1000μm, from about 800 to about 1000μm, from about 850 to about 1000μm, from about 900 to about 1000μm, from about 950 to about 1000μm, from about 300 to about 950μm, from about 300 to about 900μm, from about 300 to about 850μm, from about 300 to about 800μm, from about 300 to about 750μm, from about 300 to about 700μm, from about 300 to about 650μm, from about 300 to about 600μm, from about 300 to about 550μm, from about 300 to about 500μm, from about 300 to about 450μm, from about 300 to about 400μm, from about 300 to about 350μm, etc. In examples, at least one region of the microchannel has a principal flow direction and one or more surfaces having at least one groove or protrusion defined therein, the groove or protrusion having an orientation that forms an angle with the principal direction (e.g., a staggered herringbone mixer), as described in U.S. Pat. No.9,943,846, or a bifurcating toroidal flow as described in U.S. Pat. No.10,076,730. To achieve maximal mixing rates, it is advantageous to avoid undue fluidic resistance prior to the mixing region. Thus, one example of a device has non-microfluidic channels having dimensions greater than 1000μm, to deliver the fluids to a single mixing channel.
[0065] Less complex mixing methods and instruments such as those disclosed in, for example, U.S. Published Patent Application No.20040262223, are also useful in creating lipid particle formulations of the present disclosure.
[0066] In embodiments compositions comprise an effective amount of the lipid formulations described herein (e.g., LNP), as well as any other components, as needed.Leydig 770158 / US DHR P2023-3706-WO01 21
[0067] In aspects, the disclosure provides a pharmaceutical composition, comprising the lipid nanoparticle as described herein and a pharmaceutically acceptable excipient.
[0068] In embodiments, the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and / or one or more other accessory ingredients.
[0069] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient may generally be equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage including, but not limited to, one-half or one-third of such a dosage.
[0070] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and / or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1 percent and 99 percent (w / w) of the active ingredient.
[0071] In accordance with the present disclosure pharmaceutical compositions may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes, but is not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams and Wilkins, Baltimore, MD, 2006). The use of a conventional excipient medium is contemplated herein, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.
[0072] In aspects, the disclosure provides a method of treating or preventing a disease in a subject, the method comprising administering to the subject an effective amount of the lipid nanoparticle described herein or the pharmaceutical composition described herein toLeydig 770158 / US DHR P2023-3706-WO01 22 transfect cells of hematopoietic lineage. In some embodiments, the cells of hematopoietic lineage are T cells, Jurkat cells, hematopoietic stem cells, natural killer cells, or antigen presenting cells. In some embodiments, the transfected cells are in the liver of a subject.
[0073] As described herein, the terms “treat,” “treating,” “treatment,” “therapeutically effective,” etc. used herein do not necessarily imply 100% or complete treatment / etc. Rather, there are varying degrees, which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, a lipid nanoparticle or pharmaceutical composition described herein can provide any amount of any level of treatment. Furthermore, the treatment provided by the disclosed method can include the treatment of one or more conditions or symptoms of the disease or condition being treated.
[0074] The disclosed methods comprise using an effective amount of a lipid nanoparticle or pharmaceutical composition as described herein. As describe herein, the term an “effective amount” means an amount sufficient to show a meaningful benefit. A meaningful benefit includes, for example, detectably treating, relieving, or lessening one or more symptoms of a disease; inhibiting, arresting development, preventing, or halting further development of a diseases; reducing the severity of a disease; preventing a disease from occurring in a subject at risk thereof but yet to be diagnosed. The meaningful benefit observed can be to any suitable degree. For example, in some embodiments, the meaningful benefit can be observed at least 10%, such as from 10% to 95%, e.g., from 10% to 90%; from 15% to 90 from 10% to 90%; from 15% to 90%; from 20% to 90%; from 25% to 90%; from 30% to 90%; from 35% to 90%; from 40% to 90%; from 45% to 90%; from 50% to 90%; from 55% to 90%; from 60% to 90%; from 65% to 90%; from 70% to 90%; from 75% to 90%; from 80% to 90%; from 85% to 90%; from 10% to 85%; from 10% to 80%; from 10% to 75%; from 10% to 70%; from 10% to 65%; from 10% to 60%; from 10% to 55%; from 10% to 50%; from 10% to 45%; from 10% to 40%; from 10% to 35%; from 10% to 30%; from 10% to 25%; from 10% to 20%; from 10% to 15%; from 15% to 85%; from 20% to 80%; from 25% to 75%; from 30% to 65%; from 45% to 60%; from 50% to 75%; from 50% to 90%; etc.
[0075] In aspects, one or more symptoms are prevented, reduced, halted, or eliminated subsequent to administration of a lipid nanoparticles or pharmaceutical composition as described herein, thereby effectively treating the disease to at least some degree. In some embodiments, an effective amount of a lipid nanoparticle is from about 0.1 to about 2.5 µg per million cells of hematopoietic lineage, e.g., such as from about 0.1 to about 2.5 µg, from about 0.2 to about 2.5 µg, from about 0.3 to about 2.5 µg, from about 0.4 to about 2.5 µg,Leydig 770158 / US DHR P2023-3706-WO01 23 from about 0.5 to about 2.5 µg, from about 0.6 to about 2.5 µg, from about 0.7 to about 2.5 µg, from about 0.8 to about 2.5 µg, from about 0.9 to about 2.5 µg, from about 1 to about 2.5 µg, from about 1.2 to about 2.5 µg, from about 1.4 to about 2.5 µg, from about 1.5 to about 2.5 µg, from about 1.6 to about 2.5 µg, from about 1.8 to about 2.5 µg, from about 2 to about 2.5 µg, from about 2.2 to about 2.5 µg, from about 0.1 to about 2.2 µg, from about 0.1 to about 2 µg, from about 0.1 to about 1.8 µg, from about 0.1 to about 1.6 µg, from about 0.1 to about 1.5 µg, from about 0.1 to about 1.4 µg, from about 0.1 to about 1.2 µg, from about 0.1 to about 1 µg, from about 0.1 to about 0.8 µg, from about 0.1 to about 0.6 µg, from about 0.1 to about 0.4 µg, from about 0.5 to about 2.2 µg, from about 1 to about 2 µg, from about 1.5 to about 2 µg, etc.
[0076] In other embodiments, an effective amount of a lipid nanoparticle is from about 0.1 to about 2.5 mg / kg of a subject, e.g., such as from about 0.1 to about 2.5 mg / kg, from about 0.2 to about 2.5 mg / kg, from about 0.3 to about 2.5 mg / kg, from about 0.4 to about 2.5 mg / kg, from about 0.5 to about 2.5 mg / kg, from about 0.6 to about 2.5 mg / kg, from about 0.7 to about 2.5 mg / kg, from about 0.8 to about 2.5 mg / kg, from about 0.9 to about 2.5 mg / kg, from about 1 to about 2.5 mg / kg, from about 1.2 to about 2.5 mg / kg, from about 1.4 to about 2.5 mg / kg, from about 1.5 to about 2.5 mg / kg, from about 1.6 to about 2.5 mg / kg, from about 1.8 to about 2.5 mg / kg, from about 2 to about 2.5 mg / kg, from about 2.2 to about 2.5 mg / kg, from about 0.1 to about 2.2 mg / kg, from about 0.1 to about 2 mg / kg, from about 0.1 to about 1.8 mg / kg, from about 0.1 to about 1.6 mg / kg, from about 0.1 to about 1.5 mg / kg, from about 0.1 to about 1.4 mg / kg, from about 0.1 to about 1.2 mg / kg, from about 0.1 to about 1 mg / kg, from about 0.1 to about 0.8 mg / kg, from about 0.1 to about 0.6 mg / kg, from about 0.1 to about 0.4 mg / kg, from about 0.5 to about 2.2 mg / kg, from about 1 to about 2 mg / kg, from about 1.5 to about 2 mg / kg, etc.
[0077] One skilled in the art will recognize that dosage will depend upon a variety of factors, including the age, condition or disease state, predisposition to disease, genetic defect or defects, and body weight of the subject. The size of the dose will also be determined by the route, timing, and frequency of administration as well as the existence, nature, and extent of any adverse side-effects that might accompany the administration of a particular active agent and the desired effect. It will be appreciated by one of skill in the art that various conditions or disease states may require prolonged treatment involving multiple administrations.
[0078] In embodiments of the subject is a mammal. The mammal may be any suitable mammal. Mammals include, but are not limited to, the order Rodentia, such as mice, and theLeydig 770158 / US DHR P2023-3706-WO01 24 order Lagomorpha, such as rabbits. The mammal can be from the order Carnivora, including Felines (cats) and Canines (dogs). The mammal can be from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perissodactyla, including Equines (horses). The mammal can be of the order Primates, Cebids, or Simioids (monkeys) or of the order Anthropoids (humans and apes). In some embodiments, the mammal is human.
[0079] In some embodiments, the administration is in vivo. For in vivo administration, the pharmaceutical compositions are preferably administered parenterally (e.g., intraarticularly, intravenously, intraperitoneally, subcutaneously, intrathecally, intradermally, intratracheally, intraosseous, intramuscularly or intratumorally). In some embodiments, the pharmaceutical compositions are administered intravenously, intramuscularly, intrathecally, or intraperitoneally by a bolus injection. In other embodiments the administration routes include topical (skin, eyes, mucus membranes), oral, pulmonary, intranasal, sublingual, rectal, and vaginal. In some embodiments, wherein the administration is in vivo, the administration is intravenous, intramuscular, intrathecal, or intraperitoneal by bolus injection. In some embodiments, the administration is intramuscular. In other embodiments, the administration is intravenous.
[0080] In some embodiments, the administration is ex vivo. In some embodiments where the administration is ex vivo the cells of hematopoietic lineage are (i) removed from the subject, (ii) transfected, (iii) washed, and (iv) returned to the subject. In embodiments, this method is used for cell reprogramming, genetic restoration, or immunotherapy, for example. Examples of current cell products available commercially for immuno-oncology applications are KymriahTMfor B cell precursor acute lymphoblastic leukemia and YescartaTMfor use in B cell lymphoma. In some embodiments, this ex vivo therapy is CAR- T therapy, wherein modified T cells with CD19-targeted chimeric antigen receptor attacks the CD19 presenting cancer cells of the patient. In one embodiment, blood cells are drawn from the patient, isolated as to type (T cells, for example), activated, and expanded in sterile culture, and then mixed with LNP according to the present disclosure up to about four days later. The LNP may have been prepared with gene editing nucleic acid products such as CRISPR (Cas9 mRNA and sgRNA), whereafter the treated cells are assessed and expanded over days four to eleven. On day thirteen, cells are treated with chimeric antigen receptor (CAR) LNP, and the newly-created CAR-expressing cells are returned to the patient.
[0081] In embodiments, the disease is a genetic disease. In accordance with some embodiments of the present disclosure, the disease is a cancer.Leydig 770158 / US DHR P2023-3706-WO01 25
[0082] The present disclosure provides, in some embodiments, a composition for modifying human T cells with chimeric antigen receptor (CAR) encoded mRNA to produce CAR-T cell product to be infused back into the patient, without any viral means of delivery of nucleic acid. In embodiments, the present disclosure provides a composition for delivery of gene editing nuclease and guide RNA to perform permanent gene knockout and / or insertion (when a donor DNA is also included). Further, in some embodiments, the present disclosure provides a composition for transfecting cells involved in the hematopoietic systems including hematopoietic stem cells, natural killer cells, and antigen presenting cells.
[0083] The present disclosure provides a method of modulating the T cell receptors to recognize and destroy neoantigens present on the surface of the tumor cells of the patient, in accordance with some embodiments.
[0084] In addition, the present disclosure provides, in some embodiments, a method of modulating the expression of a target polynucleotide or polypeptide. These methods generally comprise contacting a cell with a lipid particle of the present disclosure that is associated with a nucleic acid capable of modulating the expression of a target polynucleotide or polypeptide. As described herein, the term “modulating” refers to altering the expression of a target polynucleotide or polypeptide. Modulating can mean increasing or enhancing, or it can mean decreasing or reducing.
[0085] A hematopoietic stem cell is capable of differentiating into different types of cells, and is capable of dividing, unlike most circulating cells in the peripheral blood stream. As referred to herein, the term “cells of a hematopoietic lineage’” encompass hematopoietic stem and progenitor cells and any cells differentiated from hematopoietic stem and progenitor cells. Bone marrow (BM) is the major site of hematopoiesis in humans and usually there are small numbers of hematopoietic stem and progenitor cells (HSPCs) in the peripheral blood (PB). Treatment with cytokines (in particular, granulocyte colony- stimulating factor; G-CSF), some myelosuppressive drugs used in cancer treatment, and compounds that disrupt the interaction between hematopoietic and BM stromal cells can rapidly mobilize large numbers of HSPCs into the blood stream and these methods can be used to increase the number of circulating cells.
[0086] Transplantation of bone marrow cells from related or HLA-matched unrelated donors (so-called allogeneic transplantation) constitutes an approach for treating leukemia and other diseases of the blood and immune system. Autologous transplantation uses the patient’s own HSPCs and can effectively treat lymphomas, myelomas, and other diseases.Leydig 770158 / US DHR P2023-3706-WO01 26 Umbilical cord blood (CB) can be collected at birth and cryopreserved, and has become increasingly important as another source of HSPCs for transplantation.
[0087] Jurkat cells (Jurkat, Clone E6-1) are an immortalized acute T cell lymphoma cell line available from the ATCC via Cedarlane, Burlington, Ontario in Canada. Jurkat cells are a useful model for cancers and T cells.
[0088] A T cell, or T lymphocyte, is the principal cell type involve in cell-mediated immunity. T cells have a T cell receptor on the cell surface. The main categories of T cells include Helper (CD4+), Cytotoxic (CD8+), Memory, and Regulatory T cells. The log phase of growth with reference to T cell cultures means the time that the cells undergo a rapid expansion, around day 5 or day 6 post activation. Log phase can be observed through a sudden increase in cell count, this rapid expansion can be used as a time point to begin preparing LNPs for T cell treatment. In embodiments of the present disclosure, T cells may be activated in different ways. In some embodiments, the triple activation method using anti-CD3 / CD28 / CD2 antibodies is used. In some embodiments, dual activation using anti CD3 / CD28 antibodies is used. Current clinically used protocols employ the dual activation protocol.
[0089] In embodiments, T cells may be derived or differentiated from induced pluripotent stem cells (IPSC) or Embryonic Stem Cells (ESC). Preparation of T cells for transformation by methods of the disclosure includes, in some embodiments, one or more culture and / or preparation steps. The T cells are usually isolated from biological tissue (such as peripheral blood or arterial blood) derived from a mammalian subject. In some embodiments, the subject from which the cell is isolated has a disease or condition or in need of a cell therapy or to which cell therapy will be administered.
[0090] The cells in some embodiments are primary cells, such as primary human cells. The tissue sources include but are not limited to blood, tissue, lymph, and other tissue sources taken directly from the subject, and samples resulting from one or more processing steps, such as separation, centrifugation, washing, and / or incubation.
[0091] In embodiments, the tissue source from which the T cells are derived may be a blood or a blood-derived tissue source, or an apheresis or leukapheresis product. Exemplary tissue sources include but are not limited to whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, lymph node, spleen, or other lymphoid tissues. The cells in some embodiments are obtained from a different species than the eventual subject needing therapy.Leydig 770158 / US DHR P2023-3706-WO01 27
[0092] Isolation of the cells may include more preparation or non-affinity based cell separation. In some embodiments, cells are washed, centrifuged, and / or incubated in the presence of one or more reagents, for example, to remove or enrich for certain components.
[0093] Cells from the circulating blood of a subject are obtained by apheresis or leukapheresis, in some embodiments. The blood cells may be washed to remove the plasma fraction and an appropriate buffer or media is used for subsequent processing steps. In some embodiments, the cells are washed with phosphate buffered saline (PBS). A washing step is performed by tangential flow filtration (TFF) according to the manufacturer's instructions (Spectrum Krosflo, GE Äkta Flux, for example) in accordance with embodiments of the present disclosure. Further, in embodiments, the cells are resuspended in a variety of biocompatible buffers after washing, such as, for example, Ca++ / Mg++free PBS.
[0094] Separating the T cells from tissue sources can involve density-based cell separation methods, including the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll™ or Ficoll™ gradient. In some embodiments, methods include the separation of different cell types based on the expression or presence in the cell of one or more specific surface markers.
[0095] Specific subpopulations of T cells, such as cells positive or expressing high levels of one or more surface markers, e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and / or CD45RO+T cells, can be isolated by positive or negative selection techniques in some embodiments. As one example, CD3+, CD28+T cells can be positively selected using CD3 / CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3 / CD28 T Cell Expander). A CD4+or CD8+selection step can be used to separate CD4+helper and CD8+cytotoxic T cells. Memory T cells are present in both CD62L+and CD62L- subsets of CD8+peripheral blood lymphocytes. Alternatively, a selection for CD4+helper cells may be undertaken. In some cases, naive CD4+T lymphocytes are CD45RO-, CD45RA+, CD62L+, or CD4+T cells. In others, central memory CD4+cells are CD62L+and CD45RO+. In still other cases, effector CD4+cells are CD62L- and CD45RO.
[0096] Cell populations can also be isolated using affinity magnetic separation techniques. In some embodiments, the cells to be separated are incubated with magnetically responsive particles or microparticles, such as paramagnetic beads (e.g., Dynabeads™ (Clontech) or MACS™ (Miltenyi) beads). The magnetically responsive material is attached to a binding partner that specifically binds to a surface marker, present on the cell, cells, or population of cells that it is desired to separate.Leydig 770158 / US DHR P2023-3706-WO01 28
[0097] In embodiments, T cells may be isolated by positive or negative selection processes from tissue sources depending on preference. Kits for both are available, for example, from StemCell Technologies in Vancouver, Canada.
[0098] For therapeutic purposes, isolation or separation is carried out using an apparatus that carries out one or more of the isolation, cell preparation, separation, processing, an incubation, required to transform the T cells in accordance with embodiments of the present disclosure. In embodiments, the system is used to carry out each of these steps in a closed or sterile environment. In one embodiment, the system is a system as described in United States Patent Pub. No.20110003380 A1. Separation and / or other steps may be accomplished using the CliniMACS system (Miltenyi Biotec). See, e.g., Klebanoff et al. (2012) J Immunother.35(9): 651-660, Terakura et al. (2012) Blood.1:72-82, and Wang et al. (2012) J Immunother.35(9):689-701. A desired cell population can be collected and enriched via flow cytometry, in which cells stained for multiple cell surface markers are carried in a fluid stream. Other methods include FACS or microelectromechanical systems (MEMS) chips in combination with a FACS-based detection system (see, e.g., WO 2010 / 033140).
[0099] T cell incubation and treatment, in embodiments, may be carried out in a culture vessel, such as a chamber, well, column, tube, tubing set, valve, vial, culture dish, bag, tank or other container for culture or cultivating cells. Stimulating conditions or agents include one or more agent, such as a ligand, capable of activating an intracellular signaling domain of a TCR complex. In some embodiments, incubation may be carried out as described in U.S. Pat. No.6,040,177 to Riddell et al. T cell cultures can be expanded by adding non- dividing peripheral blood mononuclear cells (PBMC) and incubating the culture. For example, in some embodiments, the resulting population of cells contains at least about 5 PBMC feeder cells for each T lymphocyte in the initial population to be expanded, such as from 5 to 50 PBMC feeder cells, e.g., from 5 to 45 PBMC feeder cells, from 5 to 40 PBMC feeder cells, from 5 to 35 PBMC feeder cells, from 5 to 30 PBMC feeder cells, from 5 to 25 PBMC feeder cells, from 5 to 20 PBMC feeder cells, from 5 to 15 PBMC feeder cells, from 5 to 10 PBMC feeder cells, from 10 to 45 PBMC feeder cells, from 15 to 45 PBMC feeder cells, from 20 to 45 PBMC feeder cells, from 25 to 45 PBMC feeder cells, from 30 to 45 PBMC feeder cells, from 35 to 45 PBMC feeder cells, from 40 to 45 PBMC feeder cells, etc. T cell stimulating conditions include temperatures suitable for the growth of human T lymphocytes, for example, from 25 to 37 degrees Celsius. Optionally, the incubation mayLeydig 770158 / US DHR P2023-3706-WO01 29 further include a supportive population of non-dividing EBV-transformed lymphoblastoid cells (LCL) as feeder cells, at a ratio to initial T cells of 10 to 1. In embodiments, the present disclosure provides a method of treating a disease or disorder characterized by overexpression of a polypeptide in a subject, comprising providing to the subject a pharmaceutical composition of the present disclosure, wherein the therapeutic agent is selected from an siRNA, a microRNA, an antisense oligonucleotide, and a plasmid capable of expressing an siRNA, a microRNA, or an antisense oligonucleotide, and wherein the siRNA, microRNA, or antisense RNA includes a polynucleotide that specifically binds to a polynucleotide that encodes the polypeptide, or a complement thereof. The present disclosure provides, in embodiments, a method of treating a disease or disorder characterized by under-expression of a polypeptide in a subject, comprising providing to the subject a pharmaceutical composition of the present disclosure, wherein the therapeutic agent is selected from an mRNA, a self-amplifying RNA (saRNA), or a plasmid, includes a nucleic acid therapeutic that specifically encodes or expresses the under-expressed polypeptide, or a complement thereof. Examples include RNA vaccines, and more particularly self-amplifying mRNA vaccines. For delivery of a biologically active agent (e.g., RNA encoding an immunogen) to cells of the immune system (e.g., antigen-presenting cells, including professional antigen presenting cells), in one embodiment formulation of the present disclosure is delivered intramuscularly, after which immune cells can infiltrate the delivery site and process delivered RNA and / or process encoded antigen produced by non-immune cells, such as muscle cells. In embodiments, such immune cells can include macrophages (e.g., bone marrow derived macrophages), dendritic cells (e.g., bone marrow derived plasmacytoid dendritic cells and / or bone marrow derived myeloid dendritic cells), T cells, and monocytes (e.g., human peripheral blood monocytes), etc. (for example, see WO2012 / 006372). The RNA is delivered with a lipid formulation of an embodiment of the present disclosure (e.g., formulated as a liposome or LNP) in accordance with embodiments of the present disclosure. In embodiments, the present disclosure utilizes LNPs within which immunogen-encoding RNA is encapsulated by LNPs that have an aqueous core or cores, and complexed with the LNPs that have a lipid core by noncovalent interactions (e.g., ionic interactions between negatively charged RNA and cationic lipid). Encapsulation and complexation within LNPs can protect RNA from RNase digestion. The encapsulation efficiency does not have to be 100%. Presence of external RNA molecules (e.g., on the exterior surface of a liposome or LNP) or “naked” RNA molecules (RNA molecules notLeydig 770158 / US DHR P2023-3706-WO01 30 associated with a liposome or LNP) is acceptable. In some embodiments, for a formulation comprising lipids and RNA molecules, at least half of the RNA molecules (e.g., at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the RNA molecules) are encapsulated in LNPs or complexed with LNPs. Some lipid nanoparticles have multilamellar components such as phospholipid bilayers and aqueous pockets. In embodiments, immunogen RNA molecules are used for immunization purposes. In some embodiments, immunogen RNA molecules encode a polypeptide immunogen. In these embodiments, after administration, the RNA is translated in vivo and the immunogen can elicit an immune response in the recipient. The immunogen may elicit an immune response against a pathogen (e.g., a bacterium, a virus, a fungus or a parasite) but, in some embodiments, it elicits an immune response against an allergen or a tumor antigen. The immune response may comprise an antibody response (usually including IgG) and / or a cell mediated immune response. The polypeptide immunogen will typically elicit an immune response which recognizes the corresponding pathogen (or allergen or tumor) polypeptide, but in some embodiments the polypeptide may act as a mimotope to elicit an immune response which recognizes a saccharide. The immunogen will typically be a surface polypeptide, e.g., an adhesin, a hemagglutinin, an envelope glycoprotein, a spike glycoprotein, etc. The RNA molecule can encode a single polypeptide immunogen or multiple polypeptides. Multiple immunogens can be presented as a single polypeptide immunogen (fusion polypeptide) or as separate polypeptides. If immunogens are expressed as separate polypeptides from a replicon, then one or more of these may be provided with an upstream IRES or an additional viral promoter element. Alternatively, multiple immunogens may be expressed from a polyprotein that encodes individual immunogens fused to a short autocatalytic protease (e.g., foot-and-mouth disease virus 2A protein), or as inteins. In certain embodiments, polypeptide immunogens (e.g., I, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more immunogens) may be used, either alone or together with a RNA molecule, such as a self- replicating RNA, encoding one or more immunogens (either the same or different as the polypeptide immunogens). In some embodiments, the immunogen elicits an immune response against Coronavirus spp., whose immunogens include, but are not limited to, those derived from a SARS CoV-1, SARS-CoV-2(12); human influenza virus, and Neisseria meningitidis forLeydig 770158 / US DHR P2023-3706-WO01 31 which useful immunogens include, but are not limited to, membrane proteins such as adhesins, autotransporters, toxins, iron acquisition proteins, and factor H binding protein. A combination of three useful polypeptides is disclosed in Giuliani et al. (Proc Natl Acad Sci U S A. 2006;103(29):10834-9. Epub 2006 / 07 / 06. doi: 10.1073 / pnas.0603940103. PubMed PMID: 16825336; PubMed Central PMCID: PMC2047628); Streptococcus pneumoniae, for which useful polypeptide immunogens are disclosed in WO2009 / 016515 including the RrgB pilus subunit, the beta-N-acetyl-hexosaminidase precursor (spr0057), spr0096, general stress protein GSP-781 (spr2021, SP2216), serine / threonine kinase StkP (SP1732), and pneumococcal surface adhesin PsaA; Hepatitis viruses, whose immunogens can include hepatitis B virus surface antigen (HBsAg), hepatitis C virus, delta hepatitis virus, hepatitis E virus, or hepatitis G virus antigens; Rhabdovirus: immunogens include, but are not limited to, those derived from a Rhabdovirus, such as a Lyssavirus (e.g., a Rabies virus) and Vesiculovirus (VSV); Caliciviridae, whose immunogens include, but are not limited to, those derived from Calciviridae, such as Norwalk virus (Norovirus), and Norwalk-like Viruses, such as Hawaii Virus and Snow Mountain Virus; avian infectious bronchitis (IBV), Mouse hepatitis virus (MHV), and Porcine transmissible gastroenteritis virus (TGEV); Retrovirus, whose immunogens include those derived from an Oncovirus, a Lentivirus (e.g., HIV-I or HIV-2) or a Spumavirus; Reovirus: immunogens include, but are not limited to, those derived from an Orthoreovirus, a Rotavirus, an Orbivirus, or a Coltivirus; Parvovirus, whose immunogens include those derived from Parvovirus B19; Herpesvirus, whose immunogens include those derived from a human herpesvirus, such as Herpes Simplex Viruses (HSV) (e.g., HSV types I and 2), Varicella-zoster virus (VZV), Epstein Barr virus (EBV), Cytomegalovirus (CMV), Human Herpesvirus 6 (HHV6), Human Herpesvirus 7 (HHV7), and Human Herpesvirus 8 (HHV8); Papovaviruses, whose immunogens include those derived from Papillomaviruses and Adenovirus. In some embodiments, the immunogen elicits an immune response to Chikungunya virus; in other embodiments, the immunogen elicits an immune response to Zika virus. In some embodiments, the immunogen elicits an immune response against a virus which infects fish. Fungal immunogens may be derived from Dermatophytres and other opportunistic organisms.Leydig 770158 / US DHR P2023-3706-WO01 32 In some embodiments, the immunogen elicits an immune response against a parasite from the Plasmodium genus, such as P. falciparum, P. vivax, P. malariae, or P. ovale. Thus, the invention may be used for immunizing against malaria. In some embodiments, the immunogen elicits an immune response against a parasite from the Caligidae family, particularly those from the Lepeophtheirus and Caligus genera e.g., sea lice such as Lepeophtheirus salmonis or Caligus rogercresseyi. In some embodiments, the immunogen is an mRNA specific to neoantigens in cancer cells or solid tumors. In some embodiments, the immunogen is a tumor antigen selected from: (a) cancer-testis antigens such as NY-ESO-I, SSX2, SCPI as well as RAGE, BAGE, GAGE and MAGE family polypeptides, for example, GAGE-1, GAGE-2, MAGE-1, MAGE-2, MAGE- 3, MAGE-4, MAGE-5, MAGE-6, and MAGE-12 (which can be used, for example, to address melanoma, lung, head and neck, NSCLC, breast, gastrointestinal, and bladder tumors; (b) mutated antigens, for example, p53 (associated with various solid tumors, e.g., colorectal, lung, head and neck cancer), p21 / Ras (associated with, e.g., melanoma, pancreatic cancer and colorectal cancer), CDK4 (associated with, e.g., melanoma), MUMI (associated with, e.g., melanoma), caspase-8 (associated with, e.g., head and neck cancer), CIA 0205 (associated with, e.g., bladder cancer), HLA-A2-R1701, beta catenin (associated with, e.g., melanoma), TCR (associated with, e.g., T-cell non-Hodgkins lymphoma), BCR-abl (associated with, e.g., chronic myelogenous leukemia), triosephosphate isomerase, KIA 0205, CDC-27, and LDLRFUT; (c) over-expressed antigens, for example, Galectin 4 (associated with, e.g., colorectal cancer), Galectin 9 (associated with, e.g., Hodgkin's disease), proteinase 3 (associated with, e.g., chronic myelogenous leukemia), WT I (associated with, e.g., various leukemias), carbonic anhydrase (associated with, e.g., renal cancer), aldolase A (associated with, e.g., lung cancer), PRAME (associated with, e.g., melanoma), HER-2 / neu (associated with, e.g., breast, colon, lung and ovarian cancer), mammaglobin, alpha-fetoprotein (associated with, e.g., hepatoma), KSA (associated with, e.g., colorectal cancer), gastrin (associated with, e.g., pancreatic and gastric cancer), telomerase catalytic protein, MUC-I (associated with, e.g., breast and ovarian cancer), G-250 (associated with, e.g., renal cell carcinoma), p53 (associated with, e.g., breast, colon cancer), and carcinoembryonic antigen (associated with, e.g., breast cancer, lung cancer, and cancers of the gastrointestinal tract such as colorectal cancer); (d) shared antigens, for example, melanoma-melanocyte antigens such as MART-1 / Melan A, gp100, MCIR, melanocyte- stimulating hormone receptor, tyrosinase, tyrosinase related protein-I / TRPI and tyrosinaseLeydig 770158 / US DHR P2023-3706-WO01 33 related protein-2 / TRP2 (associated with, e.g., melanoma); (e) prostate associated antigens such as PAP, PSA, PSMA, PSH-PI, PSM-PI, PSM-P2, associated with e.g., prostate cancer; (f) immunoglobulin idiotypes (associated with myeloma and B cell lymphomas, for example). In certain embodiments, tumor immunogens include, but are not limited to, p15, Hom / Mel-40, H-Ras, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens, including E6 and E7, hepatitis B and C virus antigens, human T-cell lymphotropic virus antigens, TSP-180, p185erbB2, p180erbB-3, c-met, mn-23HI, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, p16, TAGE, PSCA, CT7, 43-9F, 5T4, 791 Tgp72, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29&BCAA), CA 195, CA 242, CA-50, CAM43, CD68&KPI, CO-029, FGF-5, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-I, RCASI, SDCCAG16, TA-90 (Mac-2 binding protein / cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, and the like. For delivery of immunogen-coding RNA, in some embodiments the range of LNP diameters is 60-180 nm. In other embodiments, the range of LNP diameters is 80-160 nm. An LNP can be part of a composition comprising a population of LNPs, and the LNPs within the population can have a range of diameters. In some embodiments for a composition comprising a population of LNPs with different diameters, (i) at least 80% by number of the LNP have diameters in the range of 60-180 nm, e.g., in the range of 80-160 nm, (ii) the average diameter (by intensity, e.g., Z-average) of the population is ideally in the range of 60-180 nm, e.g., in the range of 80-160 nm; and / or the diameters within the plurality have a polydispersity index <0.2. To obtain LNPs with the desired diameter(s), mixing can be performed using a process in which two feed streams of aqueous RNA solution are combined in a single mixing zone with one stream of an ethanolic lipid solution, all at the same flow rate e.g., in a microfluidic channel. See other description relating to NanoAssemblr® microfluidic mixers sold by Precision NanoSystems ULC, Vancouver, Canada. After in vivo administration of an immunization composition (“vaccine vector LNP”), in some embodiments, the delivered RNA is released and is translated inside a cell to provide the immunogen in situ. In embodiments, the RNA is plus (“+”) stranded, so it can be translated by cells without needing any intervening replication steps such as reverse transcription. In some embodiments, the RNA is a self-replicating RNA. A self-replicating RNA molecule (replicon) can, when delivered to a vertebrate cell even without any proteins, lead to the production of multiple daughter RNAs by transcription from itself (via anLeydig 770158 / US DHR P2023-3706-WO01 34 antisense copy which it generates from itself). A self-replicating RNA molecule is thus in some embodiments: a (+) strand molecule that can be directly translated after delivery to a cell, and this translation provides an RNA-dependent RNA polymerase which then produces both antisense and sense transcripts from the delivered RNA. Thus, the delivered RNA leads to the production of multiple daughter RNAs. These daughter RNAs, as well as collinear subgenomic transcripts, may be translated themselves to provide in situ expression of an encoded immunogen, or may be transcribed to provide further transcripts with the same sense as the delivered RNA which are translated to provide in situ expression of the immunogen. The overall result of this sequence of transcriptions is an amplification in the number of the introduced replicon RNAs and so the encoded immunogen becomes a major polypeptide product of the host cells. One suitable system for achieving self-replication, in accordance with embodiments of the present disclosure, is to use an alphavirus-based RNA replicon. These (+) stranded replicons are translated after delivery to a cell to yield a replicase (or replicase- transcriptase). The replicase is translated as a polyprotein which auto cleaves to provide a replication complex which creates genomic (—) strand copies of the (+) strand delivered RNA. These (—) strand transcripts can themselves be transcribed to give further copies of the (+) stranded parent RNA, and also to give a subgenomic transcript which encodes the immunogen. Translation of the subgenomic transcript thus leads to in situ expression of the immunogen by the infected cell. Suitable alphavirus replicons can use a replicase from a Sindbis virus, a Semliki Forest virus, an eastern equine encephalitis virus, or more preferably, a Venezuelan equine encephalitis virus, etc. The system may be a hybrid or chimeric replicase in some embodiments. In one embodiment, the system uses a PNI-V101 replicon capable of self-amplifying in mammalian cells and expressing, through mRNA assembled, immunogenic proteins such as Sars-COV-2 spike proteins and as described in WO23057979 A1 by Abraham, Suraj; Chemmannur, Sijo; Geall, Andy; et al. An RNA molecule, in some embodiments, may have a 5' cap (e.g., a 7- methylguanosine). This cap can enhance in vivo translation of the RNA. The 5' nucleotide of an RNA molecule useful with the invention may have a 5' triphosphate group. In a capped RNA, this may be linked to a 7-methylguanosine via a 5'-to-5' bridge. A 5' triphosphate can enhance RIG-I binding and thus promote adjuvant effects. An RNA molecule may have a 3' polyA tail. It may also include a polyA polymerase recognition sequence (e.g., AAUAAA) near its 3' end. An RNA molecule useful with the invention forLeydig 770158 / US DHR P2023-3706-WO01 35 immunization purposes will typically be single-stranded. Single-stranded RNAs can generally initiate an adjuvant effect by binding to TLR7, TLR8, RNA helicases and / or PKR. RNA molecules, in accordance with embodiments of the present disclosure, can conveniently be prepared by in vitro transcription (IVT). IVT can use a (cDNA) template created and propagated in plasmid form in bacteria, or created synthetically (for example by gene synthesis and / or polymerase chain-reaction (PCR) engineering methods). In embodiments, as discussed in WO2011 / 005799, the self-replicating RNA can include (in addition to any 5' cap structure) one or more nucleotides having a modified nucleobase. Further, in some embodiments, a self-replicating RNA can include one or more modified pyrimidine nucleobases, such as pseudouridine and / or 5 methylcytosine residues. In some embodiments, however, the RNA includes no modified nucleobases, and may include no modified nucleotides, i.e., all of the nucleotides in the RNA are standard A, C, G and U ribonucleotides (except for any 5' cap structure, which may include a 7' methylguanosine). In other embodiments, the RNA may include a 5' cap comprising a 7' methylguanosine, and the first I, 2 or 35' ribonucleotides may be methylated at the 2' position of the ribose. In embodiments, an RNA used with the invention for immunization purposes ideally includes only phosphodiester linkages between nucleosides. In other embodiments, it contains phosphoramidate, phosphorothioate, and / or methylphosphonate linkages. In embodiments, multiple species of RNAs are formulated with a lipid formulation, such as two, three, four or more species of RNA, including different classes of RNA (such as mRNA, siRNA, self- replicating RNAs, and combinations thereof). In some embodiments, the RNA is an mRNA specific to neoantigens in cancer cells or solid tumors. In some embodiments, the RNA is an mRNA to a tumor antigen selected from: (a) cancer-testis antigens such as NY-ESO-I, SSX2, SCPI as well as RAGE, BAGE, GAGE and MAGE family polypeptides, for example, GAGE-1, GAGE-2, MAGE-1, MAGE-2, MAGE-3, MAGE-4, MAGE-5, MAGE-6, and MAGE-12 (which can be used, for example, to address melanoma, lung, head and neck, NSCLC, breast, gastrointestinal, and bladder tumors; (b) mutated antigens, for example, p53 (associated with various solid tumors, e.g., colorectal, lung, head and neck cancer), p21 / Ras (associated with, e.g., melanoma, pancreatic cancer and colorectal cancer), CDK4 (associated with, e.g., melanoma), MUMI (associated with, e.g., melanoma), caspase-8 (associated with, e.g., head and neck cancer), CIA 0205 (associated with, e.g., bladder cancer), HLA-A2-R1701, beta catenin (associated with, e.g., melanoma), TCR (associated with, e.g., T-cell non-Hodgkins lymphoma), BCR-abl (associated with, e.g., chronic myelogenous leukemia),Leydig 770158 / US DHR P2023-3706-WO01 36 triosephosphate isomerase, KIA 0205, CDC-27, and LDLRFUT; (c) over-expressed antigens, for example, Galectin 4 (associated with, e.g., colorectal cancer), Galectin 9 (associated with, e.g., Hodgkin's disease), proteinase 3 (associated with, e.g., chronic myelogenous leukemia), WT I (associated with, e.g., various leukemias), carbonic anhydrase (associated with, e.g., renal cancer), aldolase A (associated with, e.g., lung cancer), PRAME (associated with, e.g., melanoma), HER-2 / neu (associated with, e.g., breast, colon, lung and ovarian cancer), mammaglobin, alpha-fetoprotein (associated with, e.g., hepatoma), KSA (associated with, e.g., colorectal cancer), gastrin (associated with, e.g., pancreatic and gastric cancer), telomerase catalytic protein, MUC-I (associated with, e.g., breast and ovarian cancer), G-250 (associated with, e.g., renal cell carcinoma), p53 (associated with, e.g., breast, colon cancer), and carcinoembryonic antigen (associated with, e.g., breast cancer, lung cancer, and cancers of the gastrointestinal tract such as colorectal cancer); (d) shared antigens, for example, melanoma-melanocyte antigens such as MART-1 / Melan A, gp100, MCIR, melanocyte-stimulating hormone receptor, tyrosinase, tyrosinase related protein- I / TRPI and tyrosinase related protein-2 / TRP2 (associated with, e.g., melanoma); (e) prostate associated antigens such as PAP, PSA, PSMA, PSH-PI, PSM-PI, PSM-P2, associated with e.g., prostate cancer; (f) immunoglobulin idiotypes (associated with myeloma and B cell lymphomas, for example). In certain embodiments, tumor immunogens include, but are not limited to, p15, Hom / Mel-40, H-Ras, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens, including E6 and E7, hepatitis B and C virus antigens, human T-cell lymphotropic virus antigens, TSP-180, p185erbB2, p180erbB-3, c-met, mn-23HI, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, p16, TAGE, PSCA, CT7, 43-9F, 5T4, 791 Tgp72, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29&BCAA), CA 195, CA 242, CA-50, CAM43, CD68&KPI, CO-029, FGF-5, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-I, RCASI, SDCCAG16, TA-90 (Mac-2 binding protein / cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, and the like. In embodiments, the disclosure provides a method for screening lipid composition of lipid nanoparticles for preferential delivery of RNA to T cells, comprising: (a) preparing a plurality of lipid nanoparticles with different lipid compositions and a reporter RNA, (b) administering the lipid nanoparticles to Jurkat cells, (c) measuring the relative abundance of reporter RNA, (d) comparing the relative abundance of reporter RNA to a threshold, and (e) identifying lipid compositions above threshold as candidates for preferential delivery of RNA to T cells. In embodiments, the different lipid compositions ofLeydig 770158 / US DHR P2023-3706-WO01 37 step (a) comprise an ionizable lipid and a phospholipid. In some embodiments, the different lipid compositions of step (a) comprise an ionizable lipid and a phospholipid and further comprise at least one of a sterol or a stabilizing agent. In embodiments, the different lipid compositions of step (a) vary in at least one of (i) types of components, (ii) ratios of components, or (iii) the ratio of the total lipid components. As described herein, the term “reporter RNA” refers to any RNA that when delivered to a cell can have its relative abundance measured. In embodiments, the reporter RNA is an mRNA encoding a bioluminescent or biofluorescent protein. In other embodiments, the reporter RNA is an mRNA encoding a gene editing nuclease and a guide RNA targeting a reporter gene. In some embodiments, the reporter RNA is an siRNA targeting a reporter gene. In embodiments, the reporter RNA is labelled with a contrast agent. In some embodiments, the contrast agent is a radionuclide, an iodine agent, a luminescent dye, or a fluorescent dye. The relative abundance of a reporter RNA can be measured by any appropriate method known in the art. In embodiments, the relative abundance of reporter RNA in step (c) is measured by optical imaging. The threshold can be determined using any appropriate control. A threshold control be determined by measuring relative abundance of reporter RNA in a control group administered with LNPs without a reporter RNA, or any other appropriate control group. Any lipid composition that demonstrates a relative abundance of reporter RNA above the threshold is identified as a candidate for preferential delivery or RNA to T cells. Candidates can be further sorted based on a measurement of the relative abundance of reporter RNA above the threshold. In this disclosure, the word “comprising” is used in a non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. It will be understood that in embodiments which comprise or may comprise a specified feature or variable or parameter, alternative embodiments may consist, or consist essentially of such features, or variables or parameters. A reference to an element by the indefinite article “a” does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there be one and only one of the elements. The recitation of numerical ranges by endpoints includes all numbers subsumed within that range including all whole numbers, all integers and all fractional intermediates (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, and 5 etc.). In this disclosure the singular forms an “an”, and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to a composition containing “a compound” includesLeydig 770158 / US DHR P2023-3706-WO01 38 a mixture of two or more compounds. In this disclosure term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise. The disclosure is further illustrated by the following exemplary aspects. However, the disclosure is not limited by the following aspects. (1) A lipid formulation for forming a lipid-based nanoparticle suitable for transfecting nucleic acid cargo into cells of hematopoietic lineage comprising an ionizable lipid, a phospholipid, a sterol, and optionally a stabilizer. (2) A lipid formulation comprising an ionizable lipid, a phospholipid, a sterol, and optionally a stabilizer, for forming a lipid-based nanoparticle suitable for transfecting a nucleic acid cargo into T cells, Jurkat cells, hematopoietic stem cells, natural killer cells, or antigen presenting cells. (3) The lipid formulation of aspect 1, further comprising a nucleic acid cargo. (4) The lipid formulation of aspect 2, further comprising a nucleic acid cargo. (5) The lipid formulation of aspect 4, wherein the nucleic acid cargo comprises chimeric antigen receptor (CAR) encoded mRNA. (6) The lipid formulation of aspect 5, wherein the transfected cells are T cells. (7) The lipid formulation of aspect 5, wherein the transfected cells are hematopoietic stem cells. (8) The lipid formulation of aspect 4, wherein the nucleic acid cargo comprises a gene editing nuclease and a guide RNA to perform permanent gene knockout and / or insertion. (9) The lipid formulation of aspect 8, wherein the transfected cells are T cells. (10) The lipid formulation of aspect 8, wherein the transfected cells are hematopoietic stem cells. (11) The lipid formulation of aspect 3, wherein the nucleic acid cargo comprises an mRNA encoding a protein to correct a genetic deficiency. (12) The lipid formulation of aspect 3, wherein the nucleic acid cargo comprises an mRNA encoding a protein to treat disease. (13) The lipid formulation of any of aspects 1-12, wherein the stabilizer comprises from about 0.1 to about 10.0 %Mol. (14) The lipid formulation of aspect 13, wherein the stabilizer is a PEGylated lipid. (15) The lipid formulation of aspect 13, wherein the stabilizer is a polysarcosine.Leydig 770158 / US DHR P2023-3706-WO01 39 (16) The lipid formulation of aspect 13, wherein the stabilizer is vitamin E polyethylene glycol succinate (TPGS). (17) The lipid formulation of any of aspects 1-12, wherein the stabilizer is absent. (18) The lipid formulation of any one of aspects 1-17, wherein the ionizable lipid comprises from about 0.1 to about 85 %Mol. (19) The lipid formulation of any one of aspects 1-18 wherein the ionizable lipid has a jasmonic acid headgroup. (20) The lipid formulation of any one of aspects 1-18 wherein the ionizable lipid has a tetrahydrofuran head group. (21) The lipid formulation of any of aspects 1-18, wherein the ionizable lipid is selected from the group consisting of (Z)-3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9- yl)oxy)-2-oxoethyl)-2-(pent-2-en-1-yl)cyclopentyl 4-(dimethylamino)butanoate (PNI 516), 3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2-oxoethyl)cyclopentyl 4- (dimethylamino)butanoate (PNI 550), Z)-3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9- yl)oxy)-2-oxoethyl)-2-(pent-2-en-1-yl)cyclopentyl 1,4-dimethylpiperidine-4-carboxylate (PNI 560), (2R,3S,4S)-2-(((1,4-dimethylpiperidine-4-carbonyl)oxy)methyl)tetrahydrofuran- 3,4-diyl (9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12-dienoate) (PNI 127), (2R,3S,4S)-2-(((4- (dimethylamino)butanoyl)oxy)methyl)tetrahydrofuran-3,4-diyl bis(2-hexyldecanoate) (PNI 580), ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4- (dimethylamino)butanoate (PNI 659), (2R,3S,4S)-2-((((2- (dimethylamino)ethyl)carbamoyl)oxy)methyl)tetrahydrofuran-3,4-diyl bis(2- hexyldecanoate) (PNI 721), 2-(((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2- yl)methoxy)-N,N-dimethylethan-1-amine (PNI 722), ((2R,3R,4S)-3,4-bis((2- hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4-(diethylamino)butanoate (PNI 723), (2R,3S,4S)-2-((3-(dimethylamino)propoxy)methyl)tetrahydrofuran-3,4-diyl bis(2- hexyldecanoate) (PNI 726), ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2- yl)methyl (2-(dimethylamino)ethyl)carbamate (PNI 728), and (2R,3S,4S)-2-((2- (dimethylamino)ethoxy)methyl)tetrahydrofuran-3,4-diyl bis(2-hexyldecanoate) (PNI 730). (22) The lipid formulation of any of aspects 1-21, wherein the ionizable lipid comprises a mixture of ionizable lipids (23) The lipid formulation of any of aspects 1-22, wherein the phospholipid comprises from about 0.1 to about 85 %Mol. (24) The lipid formulation of any of aspects 1-23, wherein the phospholipid is distearoylphosphatidylcholine (DSPC).Leydig 770158 / US DHR P2023-3706-WO01 40 (25) The lipid formulation of any of aspects 1-24, wherein the phospholipid is dioleoyl-phosphatidylethanolamine (DOPE). (26) The lipid formulation of any of aspects 1-25, wherein the sterol comprises from about 0.1 to about 85 % Mol. (27) The lipid formulation of any of aspects 1-26, wherein the sterol is cholesteryl hemisuccinate. (28) The lipid formulations of any of aspects 1-27, wherein the formulation is substantially free of cholesterol. (29) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 40 to about 60 %Mol (e.g. 48 %Mol), the phospholipid is DSPC at from about 5 to about 20 %Mol (e.g. 13 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 30 to about 50 %Mol (e.g. 39 %Mol). (30) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721at from about 45 to about 55 %Mol (e.g. 48 %Mol), the phospholipid is DSPC at from about 10 to about 15 %Mol (e.g. 13 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 35 to about 45 %Mol (e.g. 39 %Mol). (31) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721at from about 50 to about 70 %Mol (e.g. 61.1 %Mol), the phospholipid is DSPC at from about 0.1 to about 10 %Mol (e.g. 0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 30 to about 50 %Mol (e.g. 38.4 %Mol). (32) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 55 to about 65 %Mol (e.g. 61.1 %Mol), the phospholipid is DSPC at from about 0.1 to about 1.0 %Mol (e.g. 0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 35 to about 45 %Mol (e.g. 38.4 %Mol). (33) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 1 to about 20 %Mol (e.g. 10.5 %Mol), the phospholipid is DSPC at from about 65 to about 85 %Mol (e.g. 75.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 5 to about 25 %Mol (e.g. 14 %Mol). (34) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 5 to about 15 %Mol (e.g. 10.5 %Mol), the phospholipid is DSPC at from about 70 to about 80 %Mol (e.g. 75.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 10 to about 20 %Mol (e.g. 14 %Mol). (35) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 30 to about 50 %Mol (e.g. 37.9 %Mol), theLeydig 770158 / US DHR P2023-3706-WO01 41 phospholipid is DSPC at from about 1 to about 20 %Mol (e.g. 10.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 40 to about 60 %Mol (e.g. 51.6 %Mol). (36) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 35 to about 45 %Mol (e.g. 37.9 %Mol), the phospholipid is DSPC at from about 5 to about 15 %Mol (e.g. 10.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 45 to about 55 %Mol (e.g. 51.6 %Mol). (37) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 15 to about 35 %Mol (e.g. 24 %Mol), the phospholipid is DSPC at from about 0.1 to about 10 %Mol (e.g. 0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 65 to about 85 %Mol (e.g. 75.5 %Mol). (38) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 20 to about 30 %Mol (e.g. 24 %Mol), the phospholipid is DSPC at from about 0.1 to about 1.0 %Mol (e.g. 0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 70 to about 80 %Mol (e.g. 75.5 %Mol). (39) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 30 to about 50 %Mol (e.g. 39.1 %Mol), the phospholipid is DSPC at from about 20 to about 40 %Mol (e.g. 30.4 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 20 to about 40 %Mol (e.g. 30.5 %Mol). (40) The lipid formulation of aspect 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 35 to about 45 %Mol (e.g. 39.1 %Mol), the phospholipid is DSPC at from about 25 to about 35 %Mol (e.g. 30.4 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 25 to about 35 %Mol (e.g. 30.5 %Mol). (41) A lipid nanoparticle comprising the lipid formulation of any of aspects 3-40. (42) A lipid nanoparticle comprising the lipid formulation of aspect 1 or 2. (43) The lipid nanoparticle of aspect 41 or 42, further comprising a peptide or polypeptide. (44) A method of preferentially transfecting cells of hematopoietic lineage using the lipid nanoparticles of any one of aspects 41-43, the method comprising contacting the cells with lipid nanoparticles, wherein the cells maintain at least 50 percent immune cell viability post contact. (45) The method of aspect 44, wherein the nucleic acid cargo comprises two or more nucleic acids. (46) The method of aspect 45, wherein the two or more nucleic acids are packaged in separate nanoparticles.Leydig 770158 / US DHR P2023-3706-WO01 42 (47) The method of any of aspects 44-46, wherein the transfection is performed in vitro. (48) The method of any of aspects 44-46, wherein the transfection is performed in vivo. (49) The method of any of aspects 44-46, wherein the transfection is performed ex vivo. (50) A pharmaceutical composition, comprising the lipid nanoparticle of any one of aspects 41-43 and a pharmaceutically acceptable excipient. (51) A vaccine comprising the lipid formulation of any of aspects 3-40 or the lipid nanoparticle of any of aspects 41-43, wherein the nucleic acid cargo is a nucleic acid vaccine element. (52) The vaccine of aspect 51, wherein the nucleic acid vaccine element encodes an antigen selected from coronavirus spike protein or influenza hemagglutinin protein. (53) The vaccine of aspect 51, wherein the nucleic acid vaccine element is derived from influenza virus. (54) The vaccine of aspect 51, wherein the nucleic acid vaccine element is derived from coronavirus. (55) The vaccine of aspect 51, wherein the nucleic acid vaccine element encodes an antigen to cancer cells or solid tumors. (56) A method of treating or preventing a disease in a subject, the method comprising administering to the subject an effective amount of the lipid nanoparticle of any of aspects 41-43 or the pharmaceutical composition of aspect 50 or the vaccine of any of aspects 51-55 to transfect cells of hematopoietic lineage. (57) The method of aspect 56, wherein the cells of hematopoietic lineage are T cells, Jurkat cells, hematopoietic stem cells, natural killer cells, or antigen presenting cells. (58) The method of aspect 56 or 57, wherein the administration is in vivo. (59) The method of aspect 58, wherein the administration is intravenous, intramuscular, intrathecal, or intraperitoneal by bolus injection. (60) The method of aspect 58, wherein the method comprises administering to the subject an effective amount of the vaccine of any of aspects 50-54 and the administration is intramuscular. (61) The method of aspect 58, wherein the administration is intravenous and wherein the cells of hematopoietic lineage are in the liver of a subject.Leydig 770158 / US DHR P2023-3706-WO01 43 (62) The method of any of aspects 56-61, wherein an effective amount of a lipid nanoparticle is from about 0.1 to about 2.5 mg / kg of a subject. (63) The method of aspect 56 or 57, wherein the administration is ex vivo. (64) The method of aspect 63, wherein cells of hematopoietic lineage are (i) removed from the subject, (ii) transfected, (iii) washed, and (iv) returned to the subject. (65) The method of aspect 63 or 64, wherein the nucleic acid cargo is a RNA encoding a chimeric antigen receptor. (66) The method of any of aspects 63-65, wherein an effective amount of a lipid nanoparticle is from about 0.1 to about 2.5 µg per million cells of hematopoietic lineage. (67) The method of any of aspects 56-66, wherein the disease is a genetic disease. (68) The method of any of aspects 56-66, wherein the disease is a cancer. (69) The method of any of aspects 56-68, wherein the subject is a mammal. (70) The method of any of aspects 56-69, wherein the subject is human. (71) A method for screening lipid composition of lipid nanoparticles for preferential delivery of RNA to T cells, comprising: (a) preparing a plurality of lipid nanoparticles with different lipid compositions and a reporter RNA, (b) administering the lipid nanoparticles to Jurkat cells, (c) measuring the relative abundance of reporter RNA, (d) comparing the relative abundance of reporter RNA to a threshold, and (e) identifying lipid compositions above threshold as candidates for preferential delivery of RNA to T cells. (72) The method of aspect 71, wherein the different lipid compositions of step (a) comprise an ionizable lipid and a phospholipid. (73) The method of aspect 72, wherein the different lipid compositions of step (a) further comprise at least one of a sterol or a stabilizing agent. (74) The method of any of aspects 71-73, wherein the different lipid compositions of step (a) vary in at least one of (i) types of components, (ii) ratios of components, or (iii) the ratio of the total lipid components. (75) The method of any of aspects 71-74, wherein the reporter RNA is an mRNA encoding a bioluminescent or biofluorescent protein. (76) The method of any of aspects 71-74, wherein the reporter RNA is an mRNA encoding a gene editing nuclease and a guide RNA targeting a reporter gene. (77) The method of any of aspects 71-74, wherein the reporter RNA is an siRNA targeting a reporter gene. (78) The method of any of aspects 71-74, wherein the reporter RNA is labelled with a contrast agent.Leydig 770158 / US DHR P2023-3706-WO01 44 (79) The method of aspect 78, wherein the contrast agent is a radionuclide, an iodine agent, a luminescent dye, or a fluorescent dye. (80) The method of any of aspects 71-79, wherein the relative abundance of reporter RNA in step (c) is measured by optical imaging. The following is a description of representative lipid particles prepared with nucleic acid (LNP), how they are made, evidence of their advantages, and methods for using them to deliver therapeutic benefits. The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope. EXAMPLES General considerations: All solvents and reagents were commercial products and used as such unless noted otherwise. Temperatures are given in degrees Celsius. ABBREVIATIONS GFP = green fluorescent protein ug = µg = microgram ng = nanogram pg = picogram g = gram h = hour(s) HPLC = High performance liquid chromatography MFI = Median Fluorescence Intensity min = minute(s) mmol = millimole(s) N / P ratio = the ratio of positively chargeable polymer amine (N = nitrogen) groups to negatively-charged nucleic acid phosphate (P) groups PBS = phosphate buffered saline wt = weight Deg. C = Degree Celsius CHEMS = cholesteryl hemisuccinate “Gene of interest” (GOI) signifies a genetic element or elements intended for expression to achieve a therapeutic goal, including immunization. A5 SARS Cov-2 antigenic coding elements and epidermal growth factor (EPO) are examples of a GOI toLeydig 770158 / US DHR P2023-3706-WO01 45 illustrate the present invention, but GOI is not limited to these demonstrated examples. For gene editing, GOI might be a group of nucleic acid tools including Cas-9, sgRNA, and a replacement gene like PCSK9 and ANGPTL3 for familial hypercholesterolemia, TTR for transthyretin amyloidosis, DMD for Duchenne muscular dystrophy, KLKB1 for hereditary angioedema, for example. Lipid Mixes include the ionizable lipid, phospholipid, and stabilizing agent. Low pH buffers (3-6) may be used. For ionizable aminolipids, the pH of the buffer is typically below the pKa of the lipid. iL = ionizable lipid, a lipid that is cationic at higher pH, and converts to uncharged at lower pH. Non-limiting examples include: Ionizable lipids disclosed in PCT Publication WO20252589 by Jain et al. are: PNI 516 is ionizable lipid (Z)-3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9- yl)oxy)-2-oxoethyl)-2-(pent-2-en-1-yl)cyclopentyl 4-(dimethylamino)butanoate; PNI 560 is ionizable lipid (Z)-3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9- yl)oxy)-2-oxoethyl)-2-(pent-2-en-1-yl)cyclopentyl 1,4-dimethylpiperidine-4-carboxylate; and PNI 550 is 3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2- oxoethyl)cyclopentyl 4-(dimethylamino)butanoate. Ionizable lipids disclosed in PCT Publication WO2100041 by Thomas et al. are: PNI 127 is (2R,3S,4S)-2-(((1,4-dimethylpiperidine-4- carbonyl)oxy)methyl)tetrahydrofuran-3,4-diyl (9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12- dienoate); PNI 580 is (2R,3S,4S)-2-(((4- (dimethylamino)butanoyl)oxy)methyl)tetrahydrofuran-3,4-diyl bis(2-hexyldecanoate); PNI 659: ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4- (dimethylamino)butanoate; PNI 660 is ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 1,4-dimethylpiperidine-4-carboxylate; PNI 659 is ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4-(dimethylamino)butanoate; PNI 721 is (2R,3S,4S)-2-((((2- (dimethylamino)ethyl)carbamoyl)oxy)methyl)tetrahydrofuran-3,4-diyl bis(2- hexyldecanoate);Leydig 770158 / US DHR P2023-3706-WO01 46 PNI 722 is 2-(((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2- yl)methoxy)-N,N-dimethylethan-1-amine; PNI 723 is ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4-(diethylamino)butanoate; PNI 726: (2R,3S,4S)-2-((3-(dimethylamino)propoxy)methyl)tetrahydrofuran-3,4- diyl bis(2-hexyldecanoate); PNI 728 is ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl (2-(dimethylamino)ethyl)carbamate; and PNI 730 is (2R,3S,4S)-2-((2-(dimethylamino)ethoxy)methyl)tetrahydrofuran-3,4- diyl bis(2-hexyldecanoate). Nucleic Acid demonstration materials: TagRFP Simplicon RNA Kit: Cat. SCR712 (contains both TagRFP RNA & B18R RNA) (Millipore Sigma Canada, Oakville Ontario). eGFP mRNA made in house: 5`Cap: m7GpppGm (vaccinia capping method), 5`UTR: Synthetic UTR, CDS: eGFP, 3’UTR: human alpha globin subunit 1 (HBA1), polyA tail: 45 nucleotides long sequence GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGA AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCG AGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGA GGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCA AGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAG UGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGC CAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCA ACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGC AUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACA AGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCA GAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGC AGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCC CGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAG ACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCC GGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUAACCGCGGUGAUAAUAGG CUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUC CUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAUCAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALeydig 770158 / US DHR P2023-3706-WO01 47 The method for generating self-amplifying mRNA synthesis was carried out as described in PCT Pub. No. WO23057979. Cas9 mRNA was obtained from TriLink Biotechnologies, SKU: L-7606-100, and TCR 1+3 sgRNA was obtained from Integrated DNA Technologies, Coralville, Iowa. Messenger RNA or self-amplifying mRNA (SAmRNA) as described above was diluted using sodium acetate buffer to the required concentration. Lipid nucleic acid particle (LNAP) samples were then prepared by running both fluids using the NanoAssemblr® Spark instrument. Briefly, 10-20μg of nucleic acids in 100 mM sodium acetate buffer in a total volume of 32μL was mixed with 16μL of 37.5 mM lipid mix solution as required by the N / P ratios (4, 6, 8, 10 or 12 as described in illustrated examples). The microfluidically mixed lipid nucleic acid particles (LNAP) made in the instrument were immediately diluted down with 48 μL Ca++ and Mg++ free 1X PBS at pH 7.4 in the aqueous output well. These LNAP were immediately collected into microcentrifuge tubes containing 96μL of the same buffer at pH 7.4. Encapsulation efficiency (EE) was measured by a modified Ribogreen™ assay (Quanti-iT RiboGreen™ RNA assay kit, Fisher). This information was used to establish the desired dosage. Microfluidic mixing of Nucleic Acid into Lipid Nanoparticles (LNP) Lipid mix formulation of lipid particles were generated by rapidly mixing lipid- ethanol solution with an aqueous buffer inside a microfluidic mixer designed to induce chaotic advection and provide a controlled mixing environment. The microfluidic channels have herringbone features or were configured in a manner as shown in PCT Pub. No. WO2017117647 or U.S. Patent No. 10,835,878. Briefly, 350 μL of 1 mg / mL mRNA or pDNA was diluted using 100 mM sodium acetate buffer (pH 4) to the required concentration of 0.05 to 0.3 mg / mL depending on N / P ratio of 12, 10, 8, 6 or 4. N / P ratio of 8 was chosen. Lipid nanoparticle samples were then prepared by running both fluids, namely, nucleic acids in aqueous solvent and Lipid Mix in ethanol at a flow ratio of 3:1 and at a total flow rate of 12 ml / minute. Following mixing in the microfluidic device, the post cartridge lipid nucleic acid particle sample was diluted by into RNAse free tubes containing three to 40 volumes of phosphate buffered saline (PBS) buffer, pH 7.4. Ethanol was finally removed using Amicon™ centrifugal filters (Millipore, USA) at 3000 RPM, or using TFF systems. Once the required concentration was achieved, the lipid nucleic acid particles were filter sterilizedLeydig 770158 / US DHR P2023-3706-WO01 48 using 200μm filters in aseptic conditions. Final encapsulation efficiency was measured by a modified Ribogreen™ assay. After the lipid particles were made as described in above, particle size (hydrodynamic diameter of the particles) was determined by Dynamic Light Scattering (DLS) using a ZetaSizer Nano ZS™, Malvern Instruments, UK). He / Ne laser of 633 nm wavelength was used as the light source. Data were measured from the scattered intensity data conducted in backscattering detection mode (measurement angle = 173). Measurements were an average of 10 runs of two cycles each per sample. Particle size measurements were done using the Zetasizer Ultra particle sizer (Malvern Instruments, UK) using multi angle dynamic particle sizes, and “polydispersity index” (PDI) of the lipid particle was measured by dynamic light scattering (DLS). PDI indicates the width of the particle distribution. This is a parameter calculated from a cumulative analysis of the (DLS)-measured intensity autocorrelation function assuming a single particle size mode and a single exponential fit to the autocorrelation function. From a biophysical point of view, a PDI below 0.1 indicates that the sample is monodisperse. A lower PDI indicates a more homogenous population of lipid particles. Following mixing in the microfluidic device, the post cartridge lipid nucleic acid particle sample was diluted into RNAse free tubes containing three volumes of PBS, pH 7.4. Ethanol was finally removed through either dialysis in PBS, pH 7, or using Amicon™ centrifugal filters (Millipore, USA) at 3000 RPM, or using TFF systems. Once the required concentration was achieved, the lipid nucleic acid particles were filter sterilized using 0.2μm filters in aseptic conditions. Final encapsulation efficiency was measured by the Ribogreen® assay. Quant-iT™ RiboGreen® RNA Reagent and Kit (Invitrogen) following manufacturer directions. Self-amplifying mRNA plasmid NAT preparation is described below. Observed particle attributes were generally sized from 50 – 200nm for mRNA, depending on lipid composition. Table 1: Lipid Mixes for Lipid Nanoparticles (LNP)Leydig 770158 / US DHR P2023-3706-WO01 49EXAMPLE 1 This example demonstrates exemplary benefits of the criticality of formulation in various cell types according to principles of embodiments of the disclosure. Specifically, this example demonstrates the suitability of Jurkat cells as a model for assessing T cell transfection of lipid nanoparticles with different lipid formulations. T cells are described above. Jurkat cells are an immortalized T cell model governed by ATCC rules. The inventors discovered that, surprisingly and unexpectedly, transfection in Jurkat cells correlates well with transfection in T cells and with Jurkat cells being much easier to culture, the Jurkat cells have been useful in prescreening. Hematopoietic stem cells (HSC) give rise to mature blood cells including B cells and T cells, and transfection of HSC is a model for a global genetic intervention in the lineage. Baby hamster kidney fibroblasts (BHK cells) are an adherent cell line used in molecular biology. LNP with payload as well as control were added to HSC four days after stimulation or, for the T cells or Jurkat typically three days after expansion. Staining was performed as follows. On day of detection, the 96-well U bottom plate containing cells were centrifuged at 300xg for 5 minutes at room temperature. Cells were the resuspended in 200ul of 1:1000 FVS660v in PBS, except Unstained and GFP only wells. The cells were incubated at RT in the dark for 10minutes. Centrifugation at 300xg for 5 minutes was then performed, supernatant removed, and 200µL of stain buffer was added. The cells were then centrifuged again, then washed with stain buffer again, and supernatant was removed and the cells were resuspended by placing the pellet in 60µL of stain buffer and performing flow cytometry.Leydig 770158 / US DHR P2023-3706-WO01 50 For LNPs, comprising PNI-127, PNI-516, PNI-580, PNI-560, PNI-726, PNI659, PNI-72, PNI-723, PNI-728, or PNI-730 ionizable lipids, with mRNA (GFP) concentrations of 84 µg / mL and N / P ratio of 8, the size, polydispersity index (PDI) and encapsulation efficiency (%EE) were studied. The half maximal effective concentration (EC50) is shown in BHK cells and the percent of Jurkat cells expressing the nucleic acid cargo are also shown in Tables 2A-2J. PNI-516 and PNI-721 were identified as the most promising candidates for further experiments. Tables 2A-2J depict the effect of different ionizable lipids on the size, PDI, encapsulation efficiency, the EC50 in BHK cells, and %positive nucleic acid cargo expressing Jurkat cells. Not potent results are labeled as “NP,” while “N / A” is used for any value where a technical issue was experienced. Table 2A: Effect of IL PNI-127 on Size, PDI, %EE, EC50 in BHK cells, and %positive Jurkat CellsLeydig 770158 / US DHR P2023-3706-WO01 51 Table 2B: Effect of IL PNI-516 on Size, PDI, %EE, and EC50 in BHK cells, and %positive Jurkat CellsTable 2C: Effect of IL PNI-580 on Size, PDI, %EE, and EC50 in BHK cells, and %positive Jurkat CellsLeydig 770158 / US DHR P2023-3706-WO01 52Table 2D: Effect of IL PNI-560 on Size, PDI, %EE, and EC50in cells, and %positive Jurkat CellsLeydig 770158 / US DHR P2023-3706-WO01 53 Table 2E: Effect of IL PNI-726 on Size, PDI, %EE, and EC50 in cells, and %positive Jurkat CellsTable 2F: Effect of IL PNI-659 on Size, PDI, %EE, and EC50 in cells, and %positive Jurkat CellsLeydig 770158 / US DHR P2023-3706-WO01 54Table 2G: Effect of IL PNI-721 on Size, PDI, %EE, and EC50in cells, and %positive Jurkat CellsLeydig 770158 / US DHR P2023-3706-WO01 55 Table 2H: Effect of IL PNI-723 on Size, PDI, %EE, and EC50 in cells, and %positive Jurkat CellsTable 2I: Effect of IL PNI-728 on Size, PDI, %EE, and EC50 in cells, and %positive Jurkat CellsLeydig 770158 / US DHR P2023-3706-WO01 56Table 2J: Effect of IL PNI-730 on Size, PDI, %EE, and EC50in cells, and %positive Jurkat CellsLeydig 770158 / US DHR P2023-3706-WO01 57 The effect of different ionizable lipids on the pKA in V118 LNPs was also studied. Table 3 shows this pKa data, as well as the effect on size, PDI, encapsulation efficiency, and the EC50in BHK cells for V118 LNPs. Table 3: Effect of Different ILs on pKA, Size, PDI, %EE of V118 LNPs and EC50in BHK cellsAs seen in Table 3 the ionizable lipids PNI-516, PNI-659, and PNI-728 had the best performing EC50. This suggests that these three ionizable lipids will be the most effective for transfection in V118 LNPs with cholesteryl hemisuccinate. The size, PDI and encapsulation efficiency of V90-PNI-729 is shown in Jurkat cells in Table 4. Also shown in Table 4, when the amount of PEG:DMG 2000 (“PEG”) was varied, encapsulation efficiency increased as PEG was decreased from 1.5 to 0 mole%. Table 4A. V90 Size, PDI and EE, and as PEG Ratio VariedLeydig 770158 / US DHR P2023-3706-WO01 58 As seen in Table 4A, for V90, the optimal PEG DMG concentration appeared to be best kept under 0.5 Mol%, and most preferably 0 Mol%. The results demonstrate, inter alia, that V90 PNI 721 without PEG encapsulates over 95% of the nucleic acid cargo. This increased %EE is a surprising and advantageous property of LNPs with minimal PEG or free of PEG. The size, PDI, %EE, and concentration of the nucleic acid cargo were further studied for the V90 PNI-721 LNPs with different PEG DMG concentrations at a 3X dilution. This data is shown in Table 4B. Table 4B. V90 PNI-721 Size, PDI and EE, and Nucleic Acid Cargo Concentration as PEG Ratio Varied at 3X DilutionAs Table 4B shows, the dilution improved the %EE for all the LNPs, especially the PEG free formulation. These results suggest that LNP formulations without PEG, such as V90 PNI-721, could be successfully used for transfection. EXAMPLE 2 This example demonstrates the effect of ionizable lipid selection on transfection of baby hamster kidney cell line, Jurkat cell line, and primary T cells according to principles of embodiments of the disclosure. Specifically, this example demonstrates V90 and V119 LNPs with at least PNI 516 and 721 can successfully transfect BHK, Jurkat, and Primary T cells. On Day 4 after re-activation of human primary CD3+ T cells (treatment media: Serum Free Media containing 100 ng / mL cytokine IL-2 and 1 µg / mL ApoE4), T cells were contacted with serial dilution of LNP starting at 0.5 µg per one million T cells. Batches were made on a NanoAssemblr®Ignite microfluidic mixer. All formulations were made with GFP mRNA at 84 µg / mL (N / P 8) in triplicate, and comprised the V90 and V119 ratio and varyingLeydig 770158 / US DHR P2023-3706-WO01 59 ionizable lipids. Ribogreen™data confirmed that the final concentration of nucleic acid was from 22 to 29.9 µg / ml. Detection was performed 24h post LNP treatment by flow cytometer. Potency was assessed by titration starting at 0.5 micrograms per million cells and ending at 2.5 micrograms per million cells (5 points). Table 5 depicts the effects of various lipid composition formulations, on size, PDI, encapsulation efficiency, zeta potential, the EC50in BHK, Jurkat, and T Cells, as well as the percent of Jurkat cells expressing the nucleic acid cargo. Not potent results are labeled as “NP,” while “N / A” is used for any value where a technical issue was experienced.Leydig 770158 / US DHR P2023-3706-WO01 60slleCTyramirPdnatakruJ,KHBninoitisopmocdipiLfotceffE.5elbaTLeydig 770158 / US DHR P2023-3706-WO01 61 As seen in Table 5, both V90 and V119 LNPs were surprisingly, able to transfect primary T cells without containing cholesterol as part of the lipid formulation. This suggests that cholesteryl hemisuccinate is a viable cholesterol substitute for LNP formulations for cell therapy targeting cells of hematopoietic lineage. EXAMPLE 3 This example demonstrates the transfection of BHK cells using commercially available LNP kits according to principles of embodiments of the disclosure. Specifically, this example demonstrates LNPs described herein can successfully transfect BHK cells. LNPs can be difficult to assemble. The use of commercial kits such as NanoAssemblr®SparkTMand the NanoAssemblr®IgniteTMallow for streamlined assembly. In this Example the LNPs described herein were assembled either using the NanoAssemblr®SparkTMor the NanoAssemblr®IgniteTMaccording to the manufacturer’s instructions. The size of LNPs were measured using the Wyatt Technology Nanostar™ and the Malvern™ Zetasizer™ according to the manufacturer’s instructions. For various LNP formulations comprising the ionizable lipids PNI-516 and PNI- 721 the size, PDI, %EE, and EC50in BHK cells was measured. Table 6 shows the size, PDI, %EE, and EC50 in BHK cells of various LNPs with ILs PNI-516 or PNI-721 made using NanoAssemblr® SparkTMor the NanoAssemblr® IgniteTM.Leydig 770158 / US DHR P2023-3706-WO01 62 et)inK05 Lemrnoi / of ta 123 872 9016803 0gIHBcEgn ert 6 1 9 1 6 6 1 1 4( Bli)fkraK05 L8 m.6 4.7 9.5 3 672 pSHBCE / gn 01( 23361 721617412 951tinEe)eErnoofitIa A / 8979898 3 1 A / 3g%eb( rtlN8 6 9N9ifkraEpE9S %9996699987579A / 4N9etnirI 261 7 63 64 2 nevl D 66935566753503032g1I a P. . . . . . . .0.M0 0 0 0 0 0 0 0 0slln y (t ege fatar-1 2 6 5 8 1 8 8cIWzi( t 1 1 1 1 2 1 1 1slifK))HettitBnam gyne(rnoofi 5 22013 47 8 eta 4nIWe 3619214 1 93467 8izi sb(rtli9 1 5 1f0) 5kCrttm Eaa npy (935688948 1 5 54SWez4 1 1257696975711d i nsaC,P0 Soi5 9 9 9 1 4 0.00. 9EEDt / a5.2 2 6 6 1Lr 0.1.1.3.3.0222086.43%I 1,IS 5 5.5 64DMPE.H070.30.: 3914.5: 3 5:1: 853 .;59 73,e C :94.4:5. : :z :iC 1SP: 0.3033.10 57 5.0 5. 31.S5D. ::0 1:.1:1.8: :49.5. :1 0: :8193937 0.11642 46eLI 3lbaelb6161616112121 1 1Tadi 5 5 52 2 2zipniL IININI5I7I7I7I7I7IoP PNPNPNPNPNPNPNPnoital9 u18180 3 2 1 4 0m1 111 9 9 9 9 9 9rV V V V V V V V V oFLeydig 770158 / US DHR P2023-3706-WO01 63 As seen in Table 6 all of the LNPs made using the NanoAssemblr® SparkTMor the NanoAssemblr® IgniteTMwere able to transfect the BHK cells. The V90 LNPs performed best overall particularly with respect to the EE% and EC50. This suggests that V90 formulation with PNI-516 or PNI-721 ionizable lipids can form LNPs effective for cell therapy applications. EXAMPLE 4 This example demonstrates the efficacy of LNP formulations comprising cholesteryl hemisuccinate as a cholesterol substitute for transfection according to principles of embodiments of the disclosure. Specifically, this example demonstrates LNPs comprising cholesteryl hemisuccinate described herein can successfully transfect BHK cells comparably to LNPs comprising cholesterol. LNPs were prepared as previously described using the NanoAssemblr® SparkTM. LNP formulations comprising cholesterol were compared to LNPs comprising cholesteryl hemisuccinate in BHK cells. Table 7 shows the EC50in BHK cells as well as the R2 for these LNPs. Table 7. A comparison of LNPs comprising cholesteryl hemisuccinate or cholesterol in BHK cellsLeydig 770158 / US DHR P2023-3706-WO01 64As Table 7 and the figure show, the cholesteryl hemisuccinate containing LNPs were able to transfect BHK cells with comparable efficacy to the cholesterol containing LNPs. In fact V94-PNI-728, which contains cholesteryl hemisuccinate, had a lower EC50 than several LNPs containing cholesterol. This suggests that LNPs containing cholesteryl hemisuccinate can transfect cells as effectively as cholesterol containing LNPs. EXAMPLE 5 This example demonstrates the preparation of LNPs containing saRNA as a nucleic acid cargo at batch scale according to principles of embodiments of the disclosure. Specifically, this example demonstrates that certain LNP formulations described herein can be successfully used to prepare batch scale LNPs with saRNA nucleic acid cargo. A lipid formulation with PNI-516 as the ionizable lipid was prepared as previously described, with a nucleic acid cargo of saRNA. At various steps of preparation the LNPs containing saRNA were analyzed. Table 8 depicts the size, PDI, measured pH, %EE, saRNA concentration (µg / mL), and % saRNA recovery of the LNPs at these various steps.Leydig 770158 / US DHR P2023-3706-WO01 65sPNLfoyrevoceRANRas%dna,)Lm / gµ(noitartnecnoCANRas,EE%,Hp,IDP,eziS.8elbaTLeydig 770158 / US DHR P2023-3706-WO01 66 As shown in Table 8, the V90 PNI-516 LNPs containing saRNA all had over 95% EE and maintained over 50% saRNA recovery. These results demonstrate that the LNP formulations described herein, containing cholesteryl hemisuccinate as a cholesterol substitute, can surprisingly and unexpectedly be used to produce saRNA containing LNPs at batch scale. This suggests that these LNPs overcome the manufacturability challenge for cell therapy, and would therefore be well suited for cell therapy applications. All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein. The use of the terms “a” and “an” and “the” and “at least one” and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The use of the term “at least one” followed by a list of one or more items (for example, “at least one of A and B”) is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. Stucco and water are fundamental ingredients in a slurry and are thus not considered additives. When amounts are compared between the core and dense layer slurries, it will be understood that it is in relation to a relative comparison, i.e., concentration. To the extent that some portions of the description may refer to the primary and secondary discharge conduits as integral to the board mixer and other portions may refer to them as separate pieces, it will be understood that any such difference in description does not suggest or imply different arrangements unless otherwise indicated. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the inventionLeydig 770158 / US DHR P2023-3706-WO01 67 unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention. Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. All amounts are by weight and not by volume, unless otherwise indicated. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Claims
Leydig 770158 / US DHR P2023-3706-WO01 68 CLAIM(S):
1. A lipid formulation for forming a lipid-based nanoparticle suitable for transfecting nucleic acid cargo into cells of hematopoietic lineage comprising an ionizable lipid, a phospholipid, a sterol, and optionally a stabilizer.
2. A lipid formulation comprising an ionizable lipid, a phospholipid, a sterol, and optionally a stabilizer, for forming a lipid-based nanoparticle suitable for transfecting a nucleic acid cargo into T cells, Jurkat cells, hematopoietic stem cells, natural killer cells, or antigen presenting cells.
3. The lipid formulation of claim 1, further comprising a nucleic acid cargo.
4. The lipid formulation of claim 2, further comprising a nucleic acid cargo.
5. The lipid formulation of claim 4, wherein the nucleic acid cargo comprises chimeric antigen receptor (CAR) encoded mRNA.
6. The lipid formulation of claim 5, wherein the transfected cells are T cells.
7. The lipid formulation of claim 5, wherein the transfected cells are hematopoietic stem cells.
8. The lipid formulation of claim 4, wherein the nucleic acid cargo comprises a gene editing nuclease and a guide RNA to perform permanent gene knockout and / or insertion.
9. The lipid formulation of claim 8, wherein the transfected cells are T cells.
10. The lipid formulation of claim 8, wherein the transfected cells are hematopoietic stem cells.
11. The lipid formulation of claim 3, wherein the nucleic acid cargo comprises an mRNA encoding a protein to correct a genetic deficiency.
12. The lipid formulation of claim 3, wherein the nucleic acid cargo comprises an mRNA encoding a protein to treat disease.Leydig 770158 / US DHR P2023-3706-WO01 69 13. The lipid formulation of any of claims 1-12, wherein the stabilizer comprises from about 0.1 to about 10.0 %Mol.
14. The lipid formulation of claim 13, wherein the stabilizer is a PEGylated lipid.
15. The lipid formulation of claim 13, wherein the stabilizer is a polysarcosine.
16. The lipid formulation of claim 13, wherein the stabilizer is vitamin E polyethylene glycol succinate (TPGS).
17. The lipid formulation of any of claims 1-12, wherein the stabilizer is absent.
18. The lipid formulation of any one of claims 1-17, wherein the ionizable lipid comprises from about 0.1 to about 85 %Mol.
19. The lipid formulation of any one of claims 1-18 wherein the ionizable lipid has a jasmonic acid headgroup.
20. The lipid formulation of any one of claims 1-18 wherein the ionizable lipid has a tetrahydrofuran head group.
21. The lipid formulation of any of claims 1-18, wherein the ionizable lipid is selected from the group consisting of (Z)-3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9- yl)oxy)-2-oxoethyl)-2-(pent-2-en-1-yl)cyclopentyl 4-(dimethylamino)butanoate (PNI 516), 3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2-oxoethyl)cyclopentyl 4- (dimethylamino)butanoate (PNI 550), Z)-3-(2-((1,17-bis(2-octylcyclopropyl)heptadecan-9- yl)oxy)-2-oxoethyl)-2-(pent-2-en-1-yl)cyclopentyl 1,4-dimethylpiperidine-4-carboxylate (PNI 560), (2R,3S,4S)-2-(((1,4-dimethylpiperidine-4-carbonyl)oxy)methyl)tetrahydrofuran- 3,4-diyl (9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12-dienoate) (PNI 127), (2R,3S,4S)-2-(((4- (dimethylamino)butanoyl)oxy)methyl)tetrahydrofuran-3,4-diyl bis(2-hexyldecanoate) (PNI 580), ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4- (dimethylamino)butanoate (PNI 659), (2R,3S,4S)-2-((((2- (dimethylamino)ethyl)carbamoyl)oxy)methyl)tetrahydrofuran-3,4-diyl bis(2- hexyldecanoate) (PNI 721), 2-(((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2- yl)methoxy)-N,N-dimethylethan-1-amine (PNI 722), ((2R,3R,4S)-3,4-bis((2- hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4-(diethylamino)butanoate (PNI 723), (2R,3S,4S)-2-((3-(dimethylamino)propoxy)methyl)tetrahydrofuran-3,4-diyl bis(2-Leydig 770158 / US DHR P2023-3706-WO01 70 hexyldecanoate) (PNI 726), ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2- yl)methyl (2-(dimethylamino)ethyl)carbamate (PNI 728), and (2R,3S,4S)-2-((2- (dimethylamino)ethoxy)methyl)tetrahydrofuran-3,4-diyl bis(2-hexyldecanoate) (PNI 730).
22. The lipid formulation of any of claims 1-21, wherein the ionizable lipid comprises a mixture of ionizable lipids 23. The lipid formulation of any of claims 1-22, wherein the phospholipid comprises from about 0.1 to about 85 %Mol.
24. The lipid formulation of any of claims 1-23, wherein the phospholipid is distearoylphosphatidylcholine (DSPC).
25. The lipid formulation of any of claims 1-24, wherein the phospholipid is dioleoyl-phosphatidylethanolamine (DOPE).
26. The lipid formulation of any of claims 1-25, wherein the sterol comprises from about 0.1 to about 85 % Mol.
27. The lipid formulation of any of claims 1-26, wherein the sterol is cholesteryl hemisuccinate.
28. The lipid formulations of any of claims 1-27, wherein the formulation is substantially free of cholesterol.
29. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 40 to about 60 %Mol (e.g.48 %Mol), the phospholipid is DSPC at from about 5 to about 20 %Mol (e.g.13 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 30 to about 50 %Mol (e.g.39 %Mol).
30. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721at from about 45 to about 55 %Mol (e.g.48 %Mol), the phospholipid is DSPC at from about 10 to about 15 %Mol (e.g.13 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 35 to about 45 %Mol (e.g.39 %Mol).
31. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721at from about 50 to about 70 %Mol (e.g.61.1 %Mol), the phospholipidLeydig 770158 / US DHR P2023-3706-WO01 71 is DSPC at from about 0.1 to about 10 %Mol (e.g.0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 30 to about 50 %Mol (e.g.38.4 %Mol).
32. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 55 to about 65 %Mol (e.g.61.1 %Mol), the phospholipid is DSPC at from about 0.1 to about 1.0 %Mol (e.g.0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 35 to about 45 %Mol (e.g.38.4 %Mol).
33. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 1 to about 20 %Mol (e.g.10.5 %Mol), the phospholipid is DSPC at from about 65 to about 85 %Mol (e.g.75.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 5 to about 25 %Mol (e.g.14 %Mol).
34. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 5 to about 15 %Mol (e.g.10.5 %Mol), the phospholipid is DSPC at from about 70 to about 80 %Mol (e.g.75.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 10 to about 20 %Mol (e.g.14 %Mol).
35. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 30 to about 50 %Mol (e.g.37.9 %Mol), the phospholipid is DSPC at from about 1 to about 20 %Mol (e.g.10.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 40 to about 60 %Mol (e.g.51.6 %Mol).
36. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 35 to about 45 %Mol (e.g.37.9 %Mol), the phospholipid is DSPC at from about 5 to about 15 %Mol (e.g.10.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 45 to about 55 %Mol (e.g.51.6 %Mol).
37. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 15 to about 35 %Mol (e.g.24 %Mol), the phospholipid is DSPC at from about 0.1 to about 10 %Mol (e.g.0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 65 to about 85 %Mol (e.g.75.5 %Mol).
38. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 20 to about 30 %Mol (e.g.24 %Mol), the phospholipid isLeydig 770158 / US DHR P2023-3706-WO01 72 DSPC at from about 0.1 to about 1.0 %Mol (e.g.0.5 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 70 to about 80 %Mol (e.g.75.5 %Mol).
39. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 30 to about 50 %Mol (e.g.39.1 %Mol), the phospholipid is DSPC at from about 20 to about 40 %Mol (e.g.30.4 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 20 to about 40 %Mol (e.g.30.5 %Mol).
40. The lipid formulation of claim 1 or 2, wherein the ionizable lipid is PNI 516, PNI 659, or PNI 721 at from about 35 to about 45 %Mol (e.g.39.1 %Mol), the phospholipid is DSPC at from about 25 to about 35 %Mol (e.g.30.4 %Mol), and wherein the sterol is cholesteryl hemisuccinate at from about 25 to about 35 %Mol (e.g.30.5 %Mol).
41. A lipid nanoparticle comprising the lipid formulation of any of claims 3-40.
42. A lipid nanoparticle comprising the lipid formulation of claim 1 or 2.
43. The lipid nanoparticle of claim 41 or 42, further comprising a peptide or polypeptide.
44. A method of preferentially transfecting cells of hematopoietic lineage using the lipid nanoparticles of any one of claims 41-43, the method comprising contacting the cells with lipid nanoparticles, wherein the cells maintain at least 50 percent immune cell viability post contact.
45. The method of claim 44, wherein the nucleic acid cargo comprises two or more nucleic acids.
46. The method of claim 45, wherein the two or more nucleic acids are packaged in separate nanoparticles.
47. The method of any of claims 44-46, wherein the transfection is performed in vitro.
48. The method of any of claims 44-46, wherein the transfection is performed in vivo.Leydig 770158 / US DHR P2023-3706-WO01 73 49. The method of any of claims 44-46, wherein the transfection is performed ex vivo.
50. A pharmaceutical composition, comprising the lipid nanoparticle of any one of claims 41-43 and a pharmaceutically acceptable excipient.
51. A vaccine comprising the lipid formulation of any of claims 3-40 or the lipid nanoparticle of any of claims 41-43, wherein the nucleic acid cargo is a nucleic acid vaccine element.
52. The vaccine of claim 51, wherein the nucleic acid vaccine element encodes an antigen selected from coronavirus spike protein or influenza hemagglutinin protein.
53. The vaccine of claim 51, wherein the nucleic acid vaccine element is derived from influenza virus.
54. The vaccine of claim 51, wherein the nucleic acid vaccine element is derived from coronavirus.
55. The vaccine of claim 51, wherein the nucleic acid vaccine element encodes an antigen to cancer cells or solid tumors.
56. A method of treating or preventing a disease in a subject, the method comprising administering to the subject an effective amount of the lipid nanoparticle of any of claims 41-43 or the pharmaceutical composition of claim 50 or the vaccine of any of claims 51-55 to transfect cells of hematopoietic lineage.
57. The method of claim 56, wherein the cells of hematopoietic lineage are T cells, Jurkat cells, hematopoietic stem cells, natural killer cells, or antigen presenting cells.
58. The method of claim 56 or 57, wherein the administration is in vivo.
59. The method of claim 58, wherein the administration is intravenous, intramuscular, intrathecal, or intraperitoneal by bolus injection.
60. The method of claim 58, wherein the method comprises administering to the subject an effective amount of the vaccine of any of claims 50-54 and the administration is intramuscular.Leydig 770158 / US DHR P2023-3706-WO01 74 61. The method of claim 58, wherein the administration is intravenous and wherein the cells of hematopoietic lineage are in the liver of a subject.
62. The method of any of claims 56-61, wherein an effective amount of a lipid nanoparticle is from about 0.1 to about 2.5 mg / kg of a subject.
63. The method of claim 56 or 57, wherein the administration is ex vivo.
64. The method of claim 63, wherein cells of hematopoietic lineage are (i) removed from the subject, (ii) transfected, (iii) washed, and (iv) returned to the subject.
65. The method of claim 63 or 64, wherein the nucleic acid cargo is a RNA encoding a chimeric antigen receptor.
66. The method of any of claims 63-65, wherein an effective amount of a lipid nanoparticle is from about 0.1 to about 2.5 µg per million cells of hematopoietic lineage.
67. The method of any of claims 56-66, wherein the disease is a genetic disease.
68. The method of any of claims 56-66, wherein the disease is a cancer.
69. The method of any of claims 56-68, wherein the subject is a mammal.
70. The method of any of claims 56-69, wherein the subject is human.
71. A method for screening lipid composition of lipid nanoparticles for preferential delivery of RNA to T cells, comprising: (a) preparing a plurality of lipid nanoparticles with different lipid compositions and a reporter RNA, (b) administering the lipid nanoparticles to Jurkat cells, (c) measuring the relative abundance of reporter RNA, (d) comparing the relative abundance of reporter RNA to a threshold, and (e) identifying lipid compositions above threshold as candidates for preferential delivery of RNA to T cells.Leydig 770158 / US DHR P2023-3706-WO01 75 72. The method of claim 71, wherein the different lipid compositions of step (a) comprise an ionizable lipid and a phospholipid.
73. The method of claim 72, wherein the different lipid compositions of step (a) further comprise at least one of a sterol or a stabilizing agent.
74. The method of any of claims 71-73, wherein the different lipid compositions of step (a) vary in at least one of (i) types of components, (ii) ratios of components, or (iii) the ratio of the total lipid components.
75. The method of any of claims 71-74, wherein the reporter RNA is an mRNA encoding a bioluminescent or biofluorescent protein.
76. The method of any of claims 71-74, wherein the reporter RNA is an mRNA encoding a gene editing nuclease and a guide RNA targeting a reporter gene.
77. The method of any of claims 71-74, wherein the reporter RNA is an siRNA targeting a reporter gene.
78. The method of any of claims 71-74, wherein the reporter RNA is labelled with a contrast agent.
79. The method of claim 78, wherein the contrast agent is a radionuclide, an iodine agent, a luminescent dye, or a fluorescent dye.
80. The method of any of claims 71-79, wherein the relative abundance of reporter RNA in step (c) is measured by optical imaging.