Composite nucleic acid-fiber material for data storage

Abstract

The present invention relates to a composition comprising a fiber and at least a non-encapsulated nucleic acid compound comprised within said fiber, whereby the sequence of said nucleic acid compound encodes digital data. The invention also relates to a method for the preparation of said composite material and to a method for the retrieval of digital data from said composite material.

Description

[0001] COMPOSITE NUCLEIC ACID-FIBER MATERIAL FOR DATA STORAGE FIELD OF THE INVENTION

[0001] The present invention relates to a composition comprising a polymer fiber and at least a non-encapsulated nucleic acid compound comprised within said fiber, whereby the sequence of said nucleic acid compound encodes digital data. The invention also relates to a method for the preparation of said composite material and to a method for the retrieval of digital data from said composite material. BACKGROUND

[0002] Several data storage technologies are currently available and include magnetic data storage, optical storage, cloud storage and holographic storage. The storage of encoded information in molecules of deoxyribonucleic acid (DNA) is however emerging as a promising data storage technology for the following reasons. In the first place, DNA exhibits a high data storage capacity. Indeed, DNA molecules are expected to store data at a density of up to a theoretical maximum of 215 petabytes (millions of gigabytes) per gram of material, far above conventional storage mediums. This is illustrated in Goldman et al. Towards practical, high-capacity, low-maintenance information storage in synthesized DNA Nature 2013494, 77–80. In addition, naturally occurring DNA is a very stable molecule when stored under appropriate conditions, as DNA can potentially remain stable for centuries.

[0003] Since the sequence of DNA can be customized by synthesis, it is possible to encode digital data to specific DNA sequences following different algorithms. Such algorithms are disclosed for instance in Wang et al. CCF Transactions on High Performance Computing 2022, 4, 23–33. The possibility to select and design an encoding / decoding algorithm allows for encrypting data and increasing the degree of security of the stored information. Also, once data is encoded into DNA, no further power supply is required to provide for data retention, unlike conventional data storage systems. In this regard, storage of digital data in DNA for long periods of time is regarded as a sustainable data storage technology.

[0004] While naturally occurring DNA is particularly stable, strands of synthetic DNA, which are generally smaller than naturally occurring DNA, typically suffer from longevity problems and prove more sensitive to moisture and oxygen. This represents a challenge that is currently the object of intensive research. Several strategies have thus been disclosed in the art to increase the longevity of synthetic DNA in the context of digital data storage. Buko, T.; Tuczko, N.; Ishikawa, T. DNA Data Storage. BioTech 2023, 12, 44 summarizes several approaches for preserving DNA. These approaches include (i) DNA encapsulation, for instance in silica particles, (ii) storage of DNA in the presence of calcium phosphate crystals (to mimic bone environment), (iii) preservation of DNA in solution, (iv) dehydration of DNA and compositions thereof with silica and (v) use of additives such as trehalose. The authors are however silent about the use of polymer fibers as matrix for DNA preservation.

[0005] Patent application US 2022 / 0333095 discloses a coated particle for stabilizing oligonucleotide molecules encoding digital data. The particle comprises a silica, mesoporous silica, or hydrolysed organosilicon disulphide core that is functionalized with quaternary ammonium groups so as to bear positive charges, which facilitates the adhesion of oligonucleotides on the surface of the core via electrostatic interactions, thus creating a first oligonucleotide layer on the surface of the functionalized core. The process may be repeated so as to produce a multi-layered particle comprising several layers of oligonucleotide separated by layers of a positively charged core material

[0006] Koch et al disclose in A DNA-of-things storage architecture to create materials with embedded memory Nature Biotechnology 2020, 38, 39-43 a material comprising oligonucleotides encoding digital information encapsulated by silica particles (Silica Particle Encapsulated DNA – SPED), whereby said particles are comprised within a polymer matrix. This document emphasizes that SPEDs are particularly useful for prolonging the half-life of the DNA and facilitate the mixing of DNA material with the polymer matrix. In particular, a filament prepared by extrusion of a mixture of SPEDs with polycaprolactone for 3D printing is disclosed. Extrusion does not allow preparing fibers of nanometric or micrometric dimension. The resulting filament comprises 2 mg DNA per kilogram of filament. The recovery of the information from the 3D printed pieces using said filament is achievable by (i) dissolving the polymer matrix so as to release the silica particles, (ii) releasing the DNA from the silica particles, which step requires the use of buffered oxide etch to disrupt the silica particle, (iii) amplifying the DNA sequence by PCR and (iv) sequencing the DNA sequence of the amplified.

[0007] US patent application US 201 / 0151545 discloses compositions suitable for storing nucleic acids encoding digital data. These compositions comprise a solid matrix acting as a support for the nucleic acid. Said solid support may be cellulose. In these compositions, the nucleic acid is supported on the surface of the support. In addition, the authors are silent about the use of electrohydrodynamic processes in the preparation of these compositions.

[0008] From what is disclosed in the art, it derives that there is still a need for providing improved materials for DNA-based data storage, allowing, among others, for releasing DNA in mild conditions. SUMMARY OF THE INVENTION

[0009] After exhaustive research, the inventors have developed a composite material for the storage of digital data in nucleic acid, whereby said nucleic acid is comprised within a fiber and is not encapsulated in particles, in particular in silica particles. The inventors have found that the formed material is surprisingly robust upon storage and advantageously allows for releasing the molecules of nucleic acid in mild conditions, e.g. upon dissolution of the fiber in an organic solvent.

[0010] Unlike with the polymer materials for DNA data storage disclosed in the art, the inventors have surprisingly found that the encapsulation of the nucleic acid in particles such as silica particles, is not necessary to afford the successful mixing of the polymer with the nucleotide when polymer fibers are made using an electrohydrodynamic process such as, for instance, electrospinning or melt electrowriting. As a consequence, the release of the nucleic acid from the polymer material advantageously does not require the use of expensive or hazardous reagents, such as phosphines or hydrofluoric acid. Also, it was found that the polymer fibers comprising non-encapsulated nucleic acid are stable upon storage and are therefore suitable for the storage of digital data. Advantageously, the mechanical properties of the polymer forming the fiber can be readily translated to said fiber, thus allowing for the provision of flexible materials storing digital information. In addition, careful choice of the polymer allows introducing functional groups to the material, thus providing materials with fine-tunable properties and suitable for a broad range of applications.

[0011] Thus, in a first aspect, the invention relates to a composition for digital data storage comprising: (a) a fiber comprising a material, preferably a polymer, suitable for forming fibers by an electrohydrodynamic process, and (b) at least a synthetic nucleic acid, preferably a synthetic deoxyribonucleic acid, comprised within said fiber, characterized in that the sequence of said nucleic acid encodes digital data D and that said nucleic acid is not encapsulated in silica particles. The first aspect of the invention also relates to a composition for digital data storage comprising: (a) a fiber comprising a material, preferably a polymer, suitable for forming fibers by an electrohydrodynamic process, and (b) at least a synthetic nucleic acid, preferably a synthetic deoxyribonucleic acid, comprised within said fiber, characterized in that the sequence of said nucleic acid encodes digital data D and that said nucleic acid is not encapsulated in silica particles, being the sequence of said nucleic acid not totally identical to that of a naturally occurring nucleic acid.

[0012] As defined above, the composition of the first aspect of the invention is useful for storing digital data. A second aspect of the invention thus relates to the use of a composition according to the first aspect of the invention in digital data storage and / or retrieval.

[0013] A third aspect of the invention relates to a method for the preparation of a composition for digital data storage according to the first aspect of the invention comprising: (i) providing a material, preferably a polymer, suitable for forming fibers by an electrohydrodynamic process, (ii) providing at least a nucleic acid compound wherein the sequence of said nucleic acid encodes digital data D, (iii) preparing a solid or liquid precursor composition for said electrohydrodynamic process comprising the material, preferably the polymer, provided in (i) and the at least nucleic acid compound provided in (ii); (iv) submitting the precursor composition of (iii) to a fiber-forming electrohydrodynamic process.

[0014] The third aspect of the invention also relates to a method for storing digital data into a nucleic acid; particularly, in a strand of a nucleic acid.

[0015] A fourth aspect of the invention relates to a method comprising the steps of: (i) submitting a composition for data storage as defined in the first aspect of the invention to conditions for releasing, at least partially, the nucleic acid compound comprised within the fiber, thus providing a medium comprising free strands of said nucleic acid compound, (ii) optionally, amplifying the sequence of the free strands of said nucleic acid compound comprised in the medium obtained in (i), and (iii) detecting or sequencing the released nucleic acid compound obtained in (i) or (ii).

[0016] Preferably, the fourth aspect of the invention relates to a method for retrieving digital data D stored in a composition as defined in the first aspect of the invention comprising the steps of: (i) submitting a composition for data storage as defined in the first aspect of the invention to conditions for releasing, at least partially, the nucleic acid compound comprised within the fiber, thus providing a medium comprising free strands of said nucleic acid compound, (ii) optionally, amplifying the sequence of the free strands of said nucleic acid compound comprised in the medium obtained in (i), (iii) sequencing the released nucleic acid compound obtained in (i) or (ii), and (iv) decoding the sequence obtained in (iii) to digital data.

[0017] A further aspect of the invention relates to the composition obtainable by the method of the third aspect of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Fig. 1 describes a process according to the invention for the preparation of a material according to the invention by solution electrospinning, said process comprising (i) providing a solution of DNA and polymer suitable for solution electrospinning; (ii) submitting the solution of (i) to solution electrospinning so as to produce a nanofiber that is collected on a support; thereby producing (iii) polymer fibers comprising non- encapsulated DNA.

[0019] Fig.2 describes a method for retrieval of digital data stored in a material according to the invention, said method comprising the step of (i) releasing DNA from the polymer fibers, (ii) submitting the released DNA to amplification by PCR, followed by gel electrophoresis, (iii) sequencing the amplified signal resulting from (ii) to retrieve encoded digital data (SEQ ID NO: 10)

[0020] Fig. 3 shows (left) a close-up view of an electrospun PEO fiber mesh being detached from the collector and (right) Collected DNA-loaded PEO fibers stored in Eppendorf® tubes, as prepared according to the Examples.

[0021] Fig.4 shows DNA containing PEO fibers as observed by (a) optical microscopy, (b) fluorescence microscopy, (c) scanning electron microscopy (SEM) and (d) atomic force microscopy (AFM).

[0022] Fig. 5 shows Polycaprolactone (PCL) mixed with message-loaded oligonucleotide (referred to as “Message”) as prepared by melt-electrowriting (MEW) (a) into a rhomboid shape collected on an aluminum foil; (b) its analysis by Dark-field Optical microscopy and the (c) corresponding picture showing controlled deposition of the fibers. After dissolution in acetone, (d) DNA is recovered using PCR amplification and gel electrophoresis.

[0023] Fig.6 shows the sequence (SEQ ID NO: 11) of the retrieved DNA as determined by Sanger sequencing after PCR amplification and gel electrophoresis of a Polycaprolactone (PCL) mixed with message-loaded oligonucleotide as disclosed in the examples after dissolution in acetone. The grey background on the traces represents the statistical reliability of the base call.

[0024] Fig. 7 shows optical microscopic pictures measured on an optical microscope (Leica DFC425) of (top) DNA-PEO fibers before (left) and after (right) accelerated ageing treatment as described in the Examples and (bottom) DNA-PCL fibers before (left) and after (right) accelerated ageing treatment as described in the Examples.

[0025] Fig. 8 shows the agarose gel electrophoresis after PCR amplification of (left) PEO-DNA fibers and showing (left column) original DNA sequence, (middle column) retrieved sequence of the DNA in the fiber prior to ageing, (right column) retrieved sequence of the DNA in the fiber after ageing; and (right) PCL-DNA fibers, showing (left column) original DNA sequence, (middle column) retrieved sequence of the DNA in the fiber prior to ageing, (right column) retrieved sequence of the DNA in the fiber after ageing.

[0026] Fig. 9 shows the sequence mapping of the retrieved DNA as determined by Sanger sequencing after PCR amplification and gel electrophoresis of PEO mixed with message-loaded oligonucleotide as disclosed in the examples before (top) and after (bottom) ageing as disclosed in the Example. The grey background on the traces represents the statistical reliability of the base call.

[0027] Fig. 10 shows the sequence mapping of the retrieved DNA as determined by Sanger sequencing after PCR amplification and gel electrophoresis of PCL mixed with message-loaded oligonucleotide as disclosed in the examples before (top) and after (bottom) ageing as disclosed in the Example. The grey background on the traces represents the statistical reliability of the base call.

[0028] Fig .11 shows the evolution of the fractional release of nucleic acid as a function of time (in hours), as measured by UV-Vis for (a) PEO fibers, (b) PVA fibers and (c) PCL fibers. DETAILED DESCRIPTION

[0029] All terms as used herein in this application, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions for certain terms as used in the present application are as set forth below and are intended to apply uniformly throughout the specification and claims unless an otherwise expressly set out definition provides a broader definition.

[0030] In the context of the present invention, the term “digital data” refers to any information which can be encoded in discrete symbols, such as binary code, and which can be stored, processed and transmitted. Examples of information that can be encoded in digital data include, but are not limited to, texts, figures, videos, photographs, drawings, sketches, computing files, documents, audio recordings, databases and software.

[0031] In the context of the present invention, and more particularly in the context of digital data storage the term “synthetic nucleic acid” refers to a nucleic acid that is not naturally occurring (i.e. not produced by a living organism), and in particular is man-made using laboratory processes such as chemical synthesis, e.g. by enzymatic synthesis or recombinant DNA or RNA technology or oligonucleotide synthesis using for instance the phopshoramidite synthesis. Therefore, the structure of a synthetic nucleic acid is not totally identical to that of a naturally occurring nucleic acid. Examples of synthetic nucleic acid are an optionally modified deoxyribonucleic acid (DNA) molecule, such as a modified naturally occurring DNA molecule, an optionally modified ribonucleic acid molecule (RNA); a peptide nucleic acid molecule; or a locked nucleic acid molecule. Thus, it is contemplated that the nucleic acid molecule is a DNA / RNA molecule, which has been optionally modified. Said DNA / RNA modifications may be at one or more of: (i) the bases of the nucleic acid molecule, for instance by the use of non-canonical DNA or RNA bases or by chemical modification of the base such as by methylation, (ii) the sugar backbone, (iii) the phosphodiester group. In addition, bioinformatics solutions allowing for determining whether a gene is natural or synthetic based are known in the art, as disclosed for instance in Kunjapur, A.M., Pfingstag, P. & Thompson, N.C. “Gene synthesis allows biologists to source genes from farther away in the tree of life”. Nat Commun 9, 4425 (2018), the content of which is incorporated herein by reference.

[0032] The nucleic acid may further be a nucleic acid that is single-stranded or double- stranded. The use of a mixture of single-stranded and double-stranded nucleic acids is also contemplated, for instance in a nucleic acid molecule comprising a single-stranded portion overhanging on a double stranded portion of said nucleic acid (i.e. toehold). The number of bases comprised in said nucleic acid depends on various factors, including the amount of digital data to be encoded and the encoding algorithm.

[0033] In preferred embodiments of the invention, the term “synthetic nucleic acid” refers to deoxyribonucleic acid molecules as described above.

[0034] In an embodiment, in the composition of the first aspect of the invention the at least a synthetic nucleic acid is a plurality of nucleic acids, such as a plurality of nucleic acids or oligonucleotides having different sequences, any one or all of which may be a single-stranded or double-stranded nucleic acid, as explained elsewhere herein.

[0035] In further preferred embodiments, the synthetic nucleic acid encoding digital data D is one wherein the nucleic acid or the product of translation of the sequence of said nucleic acid, such as a protein, does not produce a biological function, such as when translated in an organism, e.g. via the expression of the protein. In this embodiment, it is thus contemplated that the synthetic nucleic acid does not have a therapeutic or cosmetic effect.

[0036] In further preferred embodiments, the synthetic nucleic acid is a terminally protected nucleic acid, such as a nucleic acid wherein at least one of its terminal hydroxyl groups, such as at the 3’ or 5’ end of the nucleic acid chain, preferably at the 5’ end, is protected by a protecting group. In particular, the hydroxyl group at the 3’ or 5’ position, preferably at the 5’ position, of the hydrocarbon ring, preferably sugar ring, more preferably pentose ring, even more particularly ribose or deoxyribose ring, at respectively the 3’ or 5’ end of the nucleic acid chain is protected by a protecting group. Suitable protecting groups are well known in the art of nucleic acid synthesis and will become apparent to the skilled person upon reduction to practice of the invention. These groups include, for instance, groups of formula –CAr1Ar2Ar3wherein each of Ar1, Ar2and Ar3is independently a phenyl group optionally substituted with one or more (C1-C6)alkyl groups, such as DMT or Tr. In an embodiment, the protecting group does not comprise a phosphorous-containing group, such as a phosphate group.

[0037] In further preferred embodiments, the synthetic nucleic acid is a nucleic acid prepared according to the phospharamidite method. In said method, building blocks whereby the oxygen atoms born by the P atoms are substituted with 2-cyanoethyl groups are used. Thus, in said embodiment, the synthetic nucleic acid is a nucleic acid comprising at least one cyano group in its molecular formula. In further alternative embodiments, it is contemplated that the phosphate backbone of a synthetic nucleic acid is modified by incorporation of at least one or more of methyl group, fluorescent label, amine group, carboxyl group and thiol group.

[0038] In the context of the present invention, the term “storage of digital data” refers to the process of preserving and retaining digital information in a persistent and accessible form. In the context of DNA storage of digital data, digital data is stored in molecules of deoxyribonucleic acid, by converting the digital data, e.g. a binary code, in a sequence of deoxyribonucleic acid. Methods and algorithms for converting digital data into nucleic acid sequences are well-known in the art and have been disclosed for instance in Mainstream encoding–decoding methods of DNA data storage CCF Transactions on High Performance Computing 2022, 4, 23–33. The selection of said encoding method will have consequences on the sequence to be prepared by chemical synthesis and provides some restrictions in the method for retrieving encoded digital data. Other methods known in the art or determined by the skilled person using common general knowledge may however be used.

[0039] In the context of the present invention, the term “electrohydrodynamic process” refers to a process involving an electrically charged liquid, whereby said liquid is transformed by means of said process. Herein, the electrically charged liquid is the precursor composition (i.e. a solution or a melt solid), and transformation is into a fiber. Examples of electrohydrodynamic processes include, among others, electrospray, electrospinning, e.g. solution electrospinning or melt-electrospinning, and melt electrowriting. When a solid precursor is used in an “electrohydrodynamic process”, it is usually melted prior to processing via said “electrohydrodynamic process”, e.g. by extrusion.

[0040] In the context of the present invention, the term “thermoplastic polymer” refers to a solid polymer compound that softens or melts upon heating and solidifies upon cooling. Said polymer is for the purpose of the invention particularly suitable for forming fibers by electrospinning. Examples of such thermoplastic polymers include polyethylene (PE), polypropylene (PP), polyvinyl alcohol (PVA), polyethylene oxide (PEO), poly(lactide-co- glycolic acid) (PLGA), poly(ethylene glycol) (PEG), polyvinyl acetate (PVAc), polystyrene (PS), polycaprolactone (PCL), polyurethane (PU), polyacrylonitrile (PAN), polylactic acid (PLA), poly(ethylene terephthalate) (PET), polyamide (PA, Nylon), polyethylene terephthalate (PET), poly(methyl methacrylate) (PMMA), polycarbonate (PC), polyvinyl chloride (PVC), polyoxymethylene (POM), polyvinylidene fluoride (PVDF), polybutylene terephthalate (PBT), blends, co-polymers and mixtures thereof.

[0041] In the context of the invention, the “diameter” of the polymer fiber refers to the statistical average diameter of a population of polymer fibers comprised in a sample. Said diameter can be measured by microscopic techniques known in the art, such as optical microscopy, Transmission Electron Microscopy TEM, Scanning Electron Microscopy SEM, and Atomic Force Microscopy AFM, and by measuring the diameter of a statistically relevant number of fibers (i.e. at least 75%) within the sample followed by computing the average value of the measured diameters. A nanofiber is thus a fiber having a diameter within the nanometric range. A microfiber is thus a fiber having a diameter within the micrometric range.

[0042] In the context of the present invention, the term “fiber” refers to a material having an essentially cylindrical shape and wherein the ratio of the length of said fiber to the diameter of the fiber is of at least 100; preferably of at least 500; more preferably of at least 1000; such as from any of these values up to 10000, 5000 or 2000. In preferred embodiments of the invention, a fiber has a diameter comprised between 10 nm and 5 ^m; preferably of between 100 nm and 1.5 ^m – this is particularly the case when the fiber is prepared by solution electrospinning. In other preferred embodiments of the invention, a fiber has a diameter comprised between 1 ^m and 100 ^m– this is particularly the case when the fiber is prepared by melt electrowriting. In further embodiments, these ratios and diameters are combined. In any of these embodiments of the invention, said fiber is a polymer fiber.

[0043] In the context of the present invention, the term “electrospinning” refers to a process for producing fibers from a precursor for electrohydrodynamic process by ejecting via a syringe or a nozzle said precursor towards a collector in a manner that an electric potential is applied to the precursor between the tip of the syringe or nozzle and the collector, thereby forming a fiber. Suitable precursors for electrospinning include melt polymers or solutions of polymers, e.g. in water. When the precursor for electrospinning is a solution, said electrospinning is referred to as “solution electrospinning”. When the precursor for electrospinning is a melt polymer, said electrospinning is referred to as “melt electrospinning”. Electrospinning methods are described / reviewed in “Electrospun nanofibers – 1stedition” by Mehdi Afshari, Elsevier publishing, ISBN: 9780081009079.

[0044] In addition, when the precursor for the electrohydrodynamic process is a melt polymer and the movement of the nozzle with respect to the collector is controlled for creating a tridimensional or bidimensional shape or specific pattern via a printing process, said electrohydrodynamic process is referred to as “melt electrowriting”. Devices suitable for performing melt electrowriting have been disclosed in WO2021037894, incorporated herein by reference.

[0045] In the context of the present invention, the terms “deoxyribonucleic acid” and “DNA” are used interchangeably and all refer to a molecule of deoxyribonucleic acid. As known in the art, deoxyribonucleic acid is a polymer of phosphodiester comprising a sequence of different nucleotides, the arrangement of which constitutes the sequence of said DNA molecule. As mentioned above, it is contemplated that the DNA molecule of the invention comprises canonical and / or non-canonical bases. Preferably, the DNA molecule is single-stranded or double-stranded. The use of a mixture of single-stranded and double-stranded nucleic acids is also contemplated , for instance in a nucleic acid molecule comprising a single-stranded portion overhanging on a double stranded portion of said nucleic acid (i.e. toehold). In preferred embodiments, DNA molecules are single- stranded DNA molecules.

[0046] In the context of the present invention, a molecule of nucleic acid is said to be “encapsulated”, when it is comprised within a particle, preferably comprising one or more nanometric or micrometric dimensions, forming a protective shell or coating around said nucleic acid molecule, said particle comprising or consisting of a material other than the material forming the fiber which comprises said nucleic acid molecule. Examples of such material forming the protective shell or coating are known in the art and include particularly silica or silicon-comprising materials, liposomes, polymersomes, capsids.

[0047] In preferred embodiments, a molecule of nucleic acid is said to be “encapsulated”, when it is comprised within a particle, preferably comprising one or more nanometric or micrometric dimensions, forming a protective shell or coating around said nucleic acid molecule, wherein preferably said particle comprises or consists of a material which is not a material, preferably a polymer, suitable for forming fibers by an electrohydrodynamic process as described elsewhere herein; preferably said particle comprises or consists of silica or silicon materials.

[0048] As defined above, a first aspect of the invention relates to a composition for digital data storage comprising: (a) a fiber comprising a material suitable for forming fibers by an electrohydrodynamic process, and (b) at least a synthetic nucleic acid comprised within said polymer fiber, characterized in that the sequence of said nucleic acid encodes digital data D and that said nucleic acid is not encapsulated in silica particles, preferably being the sequence of said nucleic acid not totally identical to that of a naturally occurring nucleic acid.

[0049] In certain embodiments of the first aspect of the invention, at least one synthetic nucleic acid is encapsulated in a vesicle other than silica particles. Such vesicles may be of any type known in the art suitable for encapsulating a nucleic acid, such as lipid nanoparticles, liposomes and polymersomes.

[0050] In a preferred embodiment of the first aspect of the invention, the material suitable for forming fibers by an electrohydrodynamic process is selected from the group consisting of a polypeptide, a polysaccharide such as cellulose acetate, a ceramic material, a metal oxide, carbon nanotubes and a polymer. Such materials are well- known in the art and will become apparent to the skilled person upon reduction to practice of the invention on the basis of common general knowledge. For instance, suitable polypeptides have been disclosed in Ji Y, et al. Biomolecules.2022 Jun 7;12(6):794 or in Nuansing W, Faraday Discuss.2013;166:208-21, the content of which is incorporated herein by reference. Preferably, it is a polymer. Said polymer may be a synthetic polymer or a natural polymer. It may also be a thermoplastic polymer or a polymer suitable for extrusion. In further preferred embodiments of the first aspect of the invention, the material suitable for forming fibers by an electrohydrodynamic process is a thermoplastic polymer.

[0051] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber and at least a synthetic nucleic acid that is comprised within said polymer fiber.

[0052] The term “polymer fiber” refers to a fiber comprising, preferably consisting of, a polymer material as defined herein.

[0053] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber obtainable by means of an electrohydrodynamic process and at least a synthetic nucleic acid that is comprised within said polymer fiber.

[0054] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises an electrospun polymer fiber and at least a synthetic nucleic acid that is comprised within said electrospun polymer fiber. Said electrospinning may be solution electrospinning, or melt-electrospinning.

[0055] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber obtainable by means of melt- electrowriting and at least a synthetic nucleic acid that is comprised within said fiber.

[0056] In certain embodiments of the first aspect of the invention the composition for digital data storage of the first aspect comprises, in addition to said at least synthetic nucleic acid comprised within said fiber, synthetic nucleic acid on the surface of said fiber.

[0057] In further embodiments of the first aspect of the invention, the composition for digital data storage of the first aspect comprises two or more fibers as defined in any of the embodiments of the first aspect of the invention described above and below. In certain of these embodiments, each fiber may comprise nucleic acid having a different nucleotide sequence and / or a different material for forming a fiber by means of an electrohydrodynamic process. Such fibers are preferably arranged in a co-axial manner, thereby forming core-shell structures of alternating layers of encoded nucleic acid. Co- axial electrospinning is a method known in the art. Such method uses two or more fluids, each flowing through their respective concentric nozzles in an electrospinning device. The core fluid, which is encapsulated by the shell fluid, forms a compound Taylor cone at the co-axial needle tip or nozzle tip due to the applied electric field. As the electrospun jet travels towards the collector, solvent evaporation results in the formation of core-shell nanofibers. Such fiber arrangements allow for a stepwise and / or selective retrieval of the digital data stored in nucleic acid molecules.

[0058] In further embodiments of the first aspect of the invention, the composition for digital data storage of the first aspect comprises a synthetic nucleic acid that is deoxyribonucleic acid.

[0059] In further embodiments of the first aspect of the invention, the composition for digital data storage of the first aspect comprises a synthetic nucleic acid comprising from 10 to 5000 nucleotides. Preferably, the composition for digital data storage of the first aspect comprises at least one synthetic nucleic acid comprising from 10 to 2000 nucleotides; more preferably from 50 to 1000 nucleotides and even more preferably, from 100 to 300 nucleotides. As mentioned above, the composition of the first aspect of the invention may comprise a plurality of nucleic acids, such as a plurality of nucleic acids or oligonucleotides having different sequences. Such nucleic acids may be single- stranded or double-stranded.

[0060] In another preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber that is a nanofiber or a microfiber.

[0061] In another preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber that is nanofiber or a microfiber obtainable by means of an electrohydrodynamic process.

[0062] In another preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber comprising a polymer suitable for forming fibers by electrospinning.

[0063] In another preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber comprising a polymer suitable for forming fibers by melt-electrowriting.

[0064] In another preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber comprising a thermoplastic polymer suitable for forming fibers by solution electrospinning.

[0065] In another preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber comprising a polymer suitable for extrusion and for forming fibers by melt electrowriting or melt electrospinning.

[0066] In another preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber having a diameter comprised between 1 nm and 5 ^m.

[0067] In certain embodiments, the diameter of said fiber is lower than 4.5 ^m, 4 ^m, 3.5 ^m, 3.25 ^m, 3 ^m, 2.75 ^m, 2.5 ^m, 2.25 ^m, 2 ^m, 1.9 ^m, 1.8 ^m, 1.7 ^m, 1.6 ^m or 1.5 ^m; and / or the diameter of said fiber is higher than 1 nm, 10 nm, 20 nm, 25 nm, 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm or 100 nm.

[0068] In certain embodiments, the diameter of said fiber is comprised between 100 nm and 1.5 ^m.

[0069] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber obtainable by means of a electrohydrodynamic process and at least a synthetic nucleic acid that is comprised within said polymer fiber; wherein the diameter of said polymer fiber is lower than 4.5 ^m, 4 ^m, 3.5 ^m, 3.25 ^m, 3 ^m, 2.75 ^m, 2.5 ^m, 2.25 ^m, 2 ^m, 1.9 ^m, 1.8 ^m, 1.7 ^m, 1.6 ^m or 1.5 ^m; and / or the diameter of said polymer fiber is higher than 1 nm, 10 nm, 20 nm, 25 nm, 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm or 100 nm; preferably the diameter of said polymer fiber is comprised between 100 nm and 1.5 ^m.

[0070] In a preferred embodiment, the material suitable for forming fibers by an electrohydrodynamic process comprised in the fiber of the composition of the first aspect of the invention is not one of poly(ethylene oxide), a co-polymer of poly(lactide-co- glycolide) and a poly(D,L-lactide)–poly(ethylene glycol) (PLA–PEG) block copolymer.

[0071] In another preferred embodiment, the material suitable for forming fibers by an electrohydrodynamic process comprised in the fiber of the composition of the first aspect of the invention is selected from the group consisting of polyethylene (PE), polypropylene (PP), polyvinyl alcohol (PVA), polyethylene oxide (PEO), poly(lactide-co- glycolic acid) (PLGA), poly(ethylene glycol) (PEG), polyvinyl acetate (PVAc), polystyrene (PS), polycaprolactone (PCL), polyurethane (PU), polyacrylonitrile (PAN), polylactic acid (PLA), poly(ethylene terephthalate) (PET), polyamide (PA, Nylon), polyethylene terephthalate (PET), poly(methyl methacrylate) (PMMA), polycarbonate (PC), polyvinyl chloride (PVC), polyoxymethylene (POM), polyvinylidene fluoride (PVDF), polybutylene terephthalate (PBT), polypyrrole (PPy), blends, co-polymers and mixtures thereof; more preferably, the polymer is selected from the group consisting of polyvinyl alcohol (PVA), polycaprolactone (PCL), polylactic acid (PLA), polyoxymethylene (POM), blends, co- polymers and mixtures thereof; preferably it is selected from polyvinyl alcohol (PVA), polyethylene oxide (PEO) and polycaprolactone (PCL); more preferably it is selected from polyvinyl alcohol (PVA) and polycaprolactone (PCL); even more preferably, it is polycaprolactone (PCL). The inventors have surprisingly found that polycaprolactone fibers are particularly robust towards ageing.

[0072] In further preferred embodiments, the material suitable for forming fibers by solution electrospinning comprised in the fiber of the composition of the first aspect of the invention is selected from the group consisting of polyvinyl alcohol (PVA), polyethylene oxide (PEO), poly(lactide-co-glycolic acid) (PLGA), poly(ethylene glycol) (PEG), polyvinyl acetate (PVAc), polystyrene (PS), polycaprolactone (PCL), polyurethane (PU), polyacrylonitrile (PAN), polylactic acid (PLA), poly(ethylene terephthalate) (PET), polyamide (PA, Nylon), polyethylene terephthalate (PET), poly(methyl methacrylate) (PMMA), polycarbonate (PC), polyvinylidene fluoride (PVDF), polybutylene terephthalate (PBT), polypyrrole (PPy), blends, co-polymers and mixtures thereof.

[0073] In further preferred embodiments, the material suitable for forming fibers by melt- electrowriting comprised in the fiber of the composition of the first aspect of the invention is selected from the group consisting of polyethylene (PE), polypropylene (PP), poly(lactide-co-glycolic acid) (PLGA), polyvinyl acetate (PVAc), polycaprolactone (PCL), polyurethane (PU), polylactic acid (PLA), poly(ethylene terephthalate) (PET), polyamide (PA, Nylon), polyethylene terephthalate (PET), poly(methyl methacrylate) (PMMApolyvinylidene fluoride (PVDF), polypyrrole (PPy), blends, co-polymers and mixtures thereof.

[0074] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber obtainable by means of an electrohydrodynamic process and at least a synthetic nucleic acid that is comprised within said polymer fiber, said polymer being as defined herein.

[0075] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber obtainable by means of a electrohydrodynamic process and at least a synthetic deoxyribonucleic acid that is comprised within said polymer fiber, said polymer being selected from the group consisting of polyvinyl alcohol (PVA), polyethylene oxide (PEO) and polycaprolactone (PCL); more preferably it is selected from polyvinyl alcohol (PVA) and polycaprolactone (PCL); even more preferably, it is polycaprolactone (PCL); and wherein the diameter of said polymer fiber is as was defined elsewhere herein, and more preferably is comprised between 100 nm and 1.5 ^m.

[0076] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber obtainable by means of a electrohydrodynamic process and at least a synthetic nucleic acid that is comprised within said polymer fiber, said nucleic acid being as defined herein.

[0077] The amount of digital data which can be stored in a composition according to the first aspect of the invention is determined by the weight ratio of nucleic acid molecules to material for forming fibers by an electrohydrodynamic process. The molecular weight of a nucleic acid molecule encoding digital data is determined by its sequence of nucleotides, and the number of nucleotides is determined by (i) the amount of digital data D, (ii) the encoding algorithm (iii) the number of repetitions, if any, of the encoded digital data and (iv) any base sequence employed for the purpose of error-correction, indexing the data and / or acting as primers for amplification. Thus, the higher the weight ratio of nucleic acid molecules to said material in the composition according to the first aspect of the invention is, the more digital data can be stored in said composition.

[0078] Thus, in a preferred embodiment, the composition of the first aspect of the invention is one wherein the nucleic acid is present in an amount of at least 0.1 gram per kilogram of material for forming fibers by an electrohydrodynamic process; preferably of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 or 3.0 gram per kilogram of material for forming fibers by an electrohydrodynamic process.

[0079] In a more preferred embodiment, the composition of the first aspect of the invention is one wherein the nucleic acid is present in an amount of less than 10 grams per kilogram of material for forming fibers by an electrohydrodynamic process; preferably in an amount of less than 9, 8, 7, 6, 5, 4, 3, 2, or 1 gram per kilogram of material for forming fibers by an electrohydrodynamic process.

[0080] In more particular embodiments, the above lower and upper limits of nucleic acid amounts are combined, where compatible.

[0081] In more particular embodiments, the composition of the first aspect of the invention is one wherein the nucleic acid is present in an amount of between 2 and 10 grams per kilogram of material for forming fibers by an electrohydrodynamic process.

[0082] In further particular embodiments, the composition of the first aspect of the invention is one wherein the nucleic acid is present in an amount of between 0.2 and 1.0 gram per kilogram of material for forming fibers by an electrohydrodynamic process; more particularly in an amount of between 0.2 and 0.5 gram per kilogram of material for forming fibers by an electrohydrodynamic process.

[0083] Synthetic nucleic acids may be limited in size, such that, in some instances, for instance when the digital data to be stored is not to be fitted in one synthetic nucleic acid sequence, digital data may be broken into separate pieces of digital data of suitable size for being encoded in corresponding synthetic nucleic acids. In such embodiments, the composition of the first aspect may comprise nucleic acids of different sequences, encoding each a portion of the digital data. The sequence of the nucleic acid may thus comprise a sequence for identifying the encoded digital data and / or provide instructions on how to restore the digital data by decoding of the separate pieces of encoded digital data. Thus, in further particular embodiments of the first aspect of the invention, the nucleic acid is one wherein the sequence of the nucleic acid comprises a sequence for identifying the encoded digital data D. Said sequence may be preferably located after or before the sequence encoding the digital data D.

[0084] As mentioned above, the nucleic acid sequence may comprise a primer sequence for amplification. Thus, in further particular embodiments, the composition of the first aspect of the invention is one wherein the nucleic acid comprises a primer sequence for indicating that the sequence to be amplified comprises the sequence encoding digital data D.

[0085] Any method known in the art as being suitable for defining the sequence of a primer for amplification purposes may be used as to define a primer sequence in the sequence of the nucleic acid of the composition of the first aspect of the invention.

[0086] In further particular embodiments, the composition of the first aspect of the invention is one wherein the sequence of the nucleic acid comprises a forward primer sequence and a reverse primer sequence (for indicating that the sequence to be amplified comprises the sequence encoding digital data D), said forward primer sequence having preferably the sequence with SEQ ID 8 and the reverse primer sequence having preferably the sequence with SEQ ID 9.

[0087] In further particular embodiments, the composition of the first aspect of the invention is one wherein the sequence of the nucleic acid comprises a sequence for error correction. Said sequence is such that it comprises or encodes information allowing the detection and correction of any error occurring during the synthesis or the sequencing of the nucleic acid. Such errors may be one or more of random insertions, base substitution or deletion, synthesis, sequencing errors or errors arising from encapsulation or recovery processes.

[0088] In preferred embodiments, the sequence for error correction comprises redundant information of the encoded data. In a first alternative, such sequence for error correction may be introduced for instance by splitting the sequence encoding the digital data in overlapping sequences by generating multi-fold redundancy (e.g. fourfold), as disclosed in Goldman N, Bertone P, Chen S, Dessimoz C, LeProust EM, Sipos B, Birney E. Nature.2013 Feb 7; 494(7435):77-80, the content of which is incorporated herein by reference. A second alternative manner of introducing such sequence for error correction adds redundancy as the result of Reed-Solomon coding, as disclosed in Grass RN, Heckel R, Puddu M, Paunescu D, Stark WJ. Angew Chem Int Ed Engl. 2015 Feb 16;54(8):2552-5 and I.S. Reed, G. Solomon. J. Soc. Ind. Appl. Mat.1960, 8, 300, the content of which references is incorporated herein by reference. A third alternative embodiment of the sequence for error correction relates to the addition of redundancy by XOR encoding, as disclosed in section 5.2 of Bornholt, James and Lopez, Randolph and Carmean, Douglas M. and Ceze, Luis and Seelig, Georg and Strauss, Karin, ASPLOS '16: Proceedings of the Twenty-First International Conference on Architectural Support for Programming Languages and Operating Systems 2016, 637-649, the content of which is incorporated herein by reference. A fourth alternative embodiment of the sequence for error correction relates to the addition of redundancy by using DNA Fountain encoding as disclosed in Yaniv Erlich, Dina Zielinski, DNA Fountain enables a robust and efficient storage architecture.Science355,950-954(2017), the content of which is incorporated herein by reference. A fifth alternative manner of introducing such sequence for error correction is that the sequence of the nucleic acid comprises a plurality of iterations of the encoded data. A combination of the above disclosed alternatives may be employed if compatible.

[0089] As mentioned above, it is contemplated that the composition of the first aspect of the invention is one wherein the at least one nucleic acid comprises a plurality of iterations of the section of the sequence encoding digital data D. The presence of a plurality of iterations of the section of the sequence encoding digital data D advantageously allows decoding digital D in a more reliable manner, as a statistical approach of the decoding of digital data D can be adopted.

[0090] The sequence of the nucleic acid of the composition of the first aspect of the invention may include any number of iterations of the digital data D. The presence of iterations allows verifying the accuracy of the decoded digital data D, such that the skilled person will be able to choose the number of iterations suitable for allowing a statistically relevant decoding of digital data D.

[0091] It is however preferred in some embodiments that the nucleic acid comprises from at least 2 iterations, preferably from 2 to 100 iterations of the sequence encoding digital data D.

[0092] In further embodiments, the nucleic acid comprises from 1 to 10 iterations of the sequence encoding digital data D.

[0093] In particular embodiments of the first aspect of the invention, the sequence of the at least one nucleic acid comprises the sequence of formula (B)m-C-E wherein m is 0 or 1; B represents a sequence for identifying the encoded digital data and / or providing instructions on how to restore the digital data; C represents the sequence encoding the digital data D; and E represents a sequence for error correction. In said embodiments, each of B and E are preferably as defined above.

[0094] In more particular embodiments of the first aspect of the invention, the sequence of the nucleic acid comprises the sequence of formula A-(B)m-C-E-A’ wherein A and A’ respectively represent the nucleic acid sequence of a forward primer and reverse primer sequence; m is 0 or 1; B represents a sequence for identifying the encoded digital data and / or providing instructions on how to restore the digital data; C represents the sequence encoding the digital data D; and E represents a sequence for error correction. In said embodiments, each of B and E are preferably as defined above.

[0095] In further particular embodiments, the composition of the first aspect of the invention is one wherein the at least one nucleic acid comprises a spacing sequence separating each iteration of said encoded digital data D employed for the purpose of indexing the data. In said embodiments, the sequence of the nucleic acid preferably comprises the sequence of formula (B1-C)nwherein n is equal to or higher than 1, such as up to 100, more particularly up to 10; and B1 represents the nucleic acid sequence of a sequence acting as a separator between each iteration of the sequence C of encoded digital data D or, when n is 1, B1 represents the nucleic acid sequence of a sequence acting as an indication of the location of the encoded digital data D. In said sequence, sequence B1 advantageously allows indexing the encoded data.

[0096] In further particular embodiments, the composition of the first aspect of the invention is one wherein the sequence of the at least one nucleic acid comprises the sequence of formula A-(B1-C)n- wherein n is equal to or higher than 1; A represents the nucleic acid sequence of a primer (for indicating that the sequence to be amplified comprises the sequence encoding digital data D); B1 represents the nucleic acid sequence of a sequence acting as a separator between the primer sequence A and the sequence C of encoded digital data D and / or as an indication of the localization of sequence C of encoded digital data D.

[0097] In further particular embodiments, the composition of the first aspect of the invention is one wherein the structure of the nucleic acid is not totally identical to that of a naturally occurring nucleic acid.

[0098] As mentioned above, the composition of the first aspect of the invention may be one comprising a plurality of nucleic acids, such as a plurality of nucleic acids or oligonucleotides having different sequences, each of said sequences being independently as defined in any of the embodiments defining the sequence of the nucleic acid described above. The sequences may in particular differ in one or more of the portion of the sequences which are used for encoding digital data, as separator sequence, for identifying the encoded digital data, providing instructions on how to restore the digital data and / or for error correction. Since such nucleic acid may be double-stranded, it is contemplated that the composition of the first aspect of the invention further comprises the complementary sequence to the sequence as defined in any of the embodiments defining the sequence of the nucleic acid described above.

[0099] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer suitable for forming fibers by an electrohydrodynamic process and at least a synthetic deoxyribonucleic acid that is comprised within said fiber, - said polymer being selected from the group of polymers listed elsewhere herein, preferably from the group consisting of polyvinyl alcohol (PVA), polyethylene oxide (PEO) and polycaprolactone (PCL); more preferably it is selected from polyvinyl alcohol (PVA) and polycaprolactone (PCL); even more preferably, it is polycaprolactone (PCL); - wherein the diameter of said fiber is that described elsewhere herein, and preferably is comprised between 100 nm and 1.5 ^m; and wherein - the deoxyribonucleic acid is present in an amount as described elsewhere herein, preferably in an amount of between 0.2 and 1.0 gram per kilogram of polymer; preferably in an amount of between 0.2 and 0.5 gram per kilogram of polymer.

[0100] In a preferred embodiment of the invention, the composition for digital data storage of the first aspect comprises a polymer fiber obtainable by means of a electrohydrodynamic process and at least a synthetic deoxyribonucleic acid that is comprised within said polymer fiber, - said polymer being selected from the group of polymers listed elsewhere herein, preferably from the group consisting of polyvinyl alcohol (PVA), polyethylene oxide (PEO) and polycaprolactone (PCL); more preferably it is selected from polyvinyl alcohol (PVA) and polycaprolactone (PCL); even more preferably, it is polycaprolactone (PCL); - wherein the diameter of said polymer fiber is that described elsewhere herein, and preferably is comprised between 100 nm and 1.5 ^m; and wherein - the deoxyribonucleic acid is present in an amount as described elsewhere herein, preferably in an amount of between 0.2 and 1.0 gram per kilogram of polymer; preferably in an amount of between 0.2 and 0.5 gram per kilogram of polymer.

[0101] In further particular embodiments, the composition of the first aspect of the invention comprises a surfactant. The use of a surfactant advantageously minimizes surface tension so as to favour the formation of a fiber by means of the electrohydrodynamic process. In preferred embodiments, the surfactant is a non-ionic surfactant, such as PEG, Pluronic® (block copolymer of poly(ethylene oxide) (PEO) and poly(propylene oxide) (PPO)), polysorbate (e.g. Tween®), sorbitan fatty acid esters (e.g. Span®) and Triton®). Preferred surfactants include Triton X-100 (CAS number 9002-93- 1).

[0102] In further particular embodiments, the material of the fiber is a cross-linked material. When the material is a polymer, said cross-linking may be achieved by reaction between unsaturated double bonds or hydroxyl groups comprised in said polymer and a cross-linking agent. For instance, thiols are suitable cross-linking agents for polymers comprising unsaturated double bonds via thiol-ene reaction. In addition, aldehydes, such as glutaraldehyde, are suitable cross-linking agents for polymers comprising hydroxyl groups via the formation of ketals.

[0103] In even more particular embodiments, the composition of the first aspect of the invention consists of (a) a fiber comprising a polymer suitable for forming fibers by an electrohydrodynamic process, and (b) at least a synthetic nucleic acid comprised within said polymer fiber, wherein said fiber, said polymer and said nucleic acid are as defined in any of the embodiments of the first aspect of the invention defined above.

[0104] In even more particular embodiments, the composition of the first aspect of the invention consists of (a) a fiber obtainable by means of a electrohydrodynamic process, and (b) at least a synthetic nucleic acid comprised within said polymer fiber, wherein said polymer fiber and said nucleic acid are as defined in any of the embodiments of the first aspect of the invention defined above.

[0105] As defined above, the second aspect of the invention relates to the use of a composition according to the first aspect of the invention in digital data storage and / or retrieval.

[0106] Further uses of said composition are also contemplated. For instance, when the fiber comprises at least a nucleic acid molecule on the surface of said fiber, the composition of the first aspect of the invention may also be used in authentication of products, e.g. by detecting the presence of said nucleic acid molecule having a known sequence of nucleotides.

[0107] In preferred embodiments, the second aspect of the invention relates to the use of a composition as defined in any of the preferred or particular embodiment of the first aspect of the invention defined above in digital data storage and / or retrieval.

[0108] As defined above, the third aspect of the invention relates to a method for the preparation of a composition for digital data storage according to the first aspect of the invention comprising: (i) providing a material, preferably a polymer, suitable for forming fibers by an electrohydrodynamic process, (ii) providing at least a nucleic acid compound wherein the sequence of said nucleic acid encodes digital data D, (iii) preparing a solid or liquid precursor composition for said electrohydrodynamic process comprising the material provided in (i) and the at least nucleic acid compound provided in (ii); (iv) submitting the precursor of (iii) to a fiber-forming electrohydrodynamic process.

[0109] In preferred embodiments of the third aspect of the invention, the material provided in (i) is as defined in any of the preferred or particular embodiment of the first aspect of the invention.

[0110] In preferred embodiments of the third aspect of the invention, the nucleic acid provided in (ii) is as defined in any of the preferred or particular embodiment of the first aspect of the invention.

[0111] In certain embodiments of the third aspect of the invention, the polymer provided in (i) is provided as a solution in a solvent, which is preferably water or acetone. Solvents suitable for dissolving the polymer and for electrohydrodynamic processing are known in the art and will become apparent to the skilled person using common general knowledge upon reduction to practice of the invention.

[0112] In further embodiments of the third aspect of the invention, the nucleic acid provided in (ii) is provided as a solution in a solvent, which is preferably water or acetone; preferably it is water. Solvents suitable for dissolving the polymer and for electrospinning processing are known in the art and will become apparent to the skilled person using common general knowledge upon reduction to practice of the invention.

[0113] In further embodiments, the method of the third aspect of the invention further comprises the previous step of preparing synthetically the nucleic acid provided in (ii), using methods known in the art such as solid phase synthesis, enzymatic synthesis (e.g. enzymatic ligation), non-enzymatic ligation or nucleic acid edition.

[0114] In further embodiments of the third aspect of the invention, the precursor for electrohydrodynamic process provided in (iii) is a solution comprising the polymer provided in (i) and the at least nucleic acid compound provided in (ii). This is particularly the case when the fiber-forming electrohydrodynamic process of step (iv) is solution electrospinning.

[0115] In further embodiments of the third aspect of the invention, the precursor for electrohydrodynamic process provided in (iii) is a solid comprising the polymer provided in (i) and the at least nucleic acid compound provided in (ii). This particularly the case when the fiber-forming electrohydrodynamic of step (iv) is melt electrospinning or melt electrowriting. Said solid may be obtained or is obtainable by evaporation of the solvent from a solution comprising the polymer provided in (i) and the at least nucleic acid compound provided in (ii). The same precursor solution may be used in (iii) when (iv) is solution electrospinning or melt electrospinning or melt electrowriting, with the proviso that when electrospinning techniques using solid precursors are used in (iv), the solvent of said solution is previously removed, e.g. by evaporation, so as to provide a solid precursor in (iii).

[0116] In further embodiments, when the precursor provided in step (iii) of the method of the third aspect of the invention is a solution, the solvent of said solution comprises water; preferably, it is water.

[0117] In further embodiments of the third aspect of the invention, the amount of nucleic acid per kilogram of material in the precursor provided in (iii) is as defined in any of the preferred and particular embodiments of the first aspect of the invention.

[0118] When the precursor provided in (iii) is a solution, it is preferred that the material provided in (i) is in a concentration of between 5% w / w and 25% w / w; preferably of between 10% w / w and 15% w / w of the solution.

[0119] In further embodiments of the third aspect of the invention, the precursor of step (iii) further comprises a surfactant. The use of a surfactant advantageously minimizes surface tension so as to favour the formation of a fiber by means of the electrohydrodynamic process. In preferred embodiments, the surfactant is a non-ionic surfactant, such as PEG, Pluronic® (block copolymer of poly(ethylene oxide) (PEO) and poly(propylene oxide) (PPO)), polysorbate (e.g. Tween®), sorbitan fatty acid esters (e.g. Span®) and Triton® (). Preferred surfactants include Triton X-100 (CAS number 9002- 93-1).

[0120] In further embodiments of the third aspect of the invention, the precursor of step (iii) further comprises a cross-linking agent. This is particularly the case when the material provided in (i) is cross-linkable, for instance when it is a polymer comprising unsaturated double bonds or hydroxyl groups. For instance, thiols are suitable cross- linking agents for polymers comprising unsaturated double bonds via thiol-ene reaction. In addition, aldehydes, such as glutaraldehyde, are suitable cross-linking agents for polymers comprising hydroxyl groups via the formation of ketals.

[0121] In further embodiments of the third aspect of the invention, the process further comprises step (v) of submitting the product of step (iv) to a step of cross-linking with a cross-linking agent. This is particularly the case when the material provided in (i) is cross- linkable, for instance when it is a polymer comprising unsaturated double bonds or hydroxyl groups. For instance, thiols are suitable cross-linking agents for polymers comprising unsaturated double bonds via thiol-ene reaction. In addition, aldehydes, such as glutaraldehyde, are suitable cross-linking agents for polymers comprising hydroxyl groups via the formation of ketals.

[0122] In further embodiments of the third aspect of the invention, when the precursor of step (iii) is a liquid, the method of the invention further comprises a sonication step. This step favours the production of an homogeneous mixture.

[0123] In further embodiments of the third aspect of the invention, the fiber-forming electrohydrodynamic process of step (iv) is selected from solution electrospinning, melt electrospinning and melt electrowriting; preferably, it is selected from solution electrospinning and melt electrowriting; more preferably, it is melt electrowriting.

[0124] In further embodiments of the third aspect of the invention, the fiber-forming electrohydrodynamic process of step (iv) comprises submitting the precursor of (iii) to a potential bias of at least 1 kV; preferably of at least 2 kV, 3 kV, 4 kV, 5 kV, 6 kV, 7 kV, 8 kV, 9 kV or 10 kV. Said potential bias may be positive or negative, depending on the fiber forming material employed in the electrohydrodynamic process. Thus, the values disclosed above correspond to absolute values of potential bias.

[0125] In further embodiments of the third aspect of the invention, the fiber-forming electrohydrodynamic process of step (iv) comprises submitting the precursor of (iii) to a potential bias of no more than 30 kV; preferably no more than 29 kV, 28 kV, 27 kV, 26 kV, 25 kV, 24 kV, 23 kV, 22 kV, 21 kV, 20 kV, 19 kV, 18 kV, 17 kV, 16 kV or 15 kV.

[0126] In further preferred embodiments of the third aspect of the invention, these lower and upper potential biases are combined. In preferred particular embodiments of the third aspect of the invention, the fiber-forming electrohydrodynamic process of step (iv) comprises submitting the precursor of (iii) to a potential bias of between 5 and 20 kV.

[0127] In further preferred embodiments of the third aspect of the invention, the fiber- forming electrohydrodynamic process of step (iv) comprises ejecting the solution precursor provided in (iii) at a rate of between 0.1 to 0.5 mL per hour from the needle or from the nozzle comprised in the device for electrohydrodynamic process; preferably of about 0.35 mL per hour. When the precursor of step (iii) is a solid, that is further transformed in a melt polymer prior to the electrohydrodynamic process when the electrohydrodynamic process is melt electrospinning or melt electrowriting, said melting may be achieved by the means of an extruder, preferably operated at a pressure of about 0.2 bar and / or at a temperature of between 90 ºC and 105 ºC. As will be obvious to the skilled person, the temperature of said extruder needs to be sufficient to allow the polymer to melt.

[0128] As mentioned above, a further aspect of the invention relates to the product or composition obtainable by the method of the third aspect of the invention.

[0129] The method of the third aspect of the invention also corresponds to a method for storing digital data D into nucleic acid. A process for retrieving said data also forms part of the invention.

[0130] Thus, a fourth aspect of the invention relates to a method comprising the steps of: (i) submitting a composition for data storage as defined in the first aspect of the invention to conditions for releasing at least partially the nucleic acid compound comprised within the fiber, thus providing a medium comprising free strands of said nucleic acid compound, (ii) optionally, amplifying the sequence of the free strands of said nucleic acid compound comprised in the medium obtained in (i), and (iii) detecting or sequencing the released nucleic acid compound obtained in (i) or (ii).

[0131] In preferred embodiments, the fourth aspect of the invention relates to a method for retrieving digital data D stored in a composition as defined in the first aspect of the invention comprising the steps of: (i) submitting a composition for data storage as defined in the first aspect of the invention to conditions for releasing at least partially the nucleic acid compound comprised within the fiber, thus providing a medium comprising free strands of said nucleic acid compound, (ii) optionally, amplifying the sequence of the free strands of said nucleic acid compound comprised in the medium obtained in (i), (iii) sequencing the released nucleic acid compound obtained in (i) or (ii), and (iv) decoding the sequence obtained in (iii) to digital data.

[0132] In preferred embodiments, step (i) of the fourth aspect of the invention comprises contacting said composition for data storage with a solvent suitable for solubilizing the fiber comprised in said composition. In preferred embodiments, when said fiber is a polymer fiber that comprises polycaprolactone, step (i) of the fourth aspect of the invention comprises contacting the composition with acetone.

[0133] In preferred embodiments, step (i) of the fourth aspect of the invention does not comprise contacting said composition with fluoride anions. Fluoride anions are typically used in the art to disrupt Si-O bonds in silica particles. Fluoride anions are found for instance in hydrofluoric acid, ammonium fluoride and mixtures thereof. Such mixtures are also known in the art as buffered oxide etch. In preferred embodiments, step (i) of the fourth aspect of the invention does not comprise etching.

[0134] In preferred embodiments, when said fiber is a polymer fiber that comprises polyethylene oxide and / or polyvinyl alcohol, step (i) of the fourth aspect of the invention comprises contacting the composition with water.

[0135] Alternative conditions for releasing at least partially the nucleic acid compound comprised within the fiber include heating the composition, submitting the composition to sonication, or treating the composition with an acid or a base.

[0136] Advantageously, the release conditions of free strands of nucleic acid take place in mild conditions and with no need for expensive or hazardous reagents, such as phosphines or hydrofluoric acid. It is believed that the absence of particles encapsulating the nucleic acid compound advantageously allows releasing at least partially the nucleic acid compound in milder conditions than the systems disclosed in the art with no impact on the distribution of nucleic acid molecules within the fiber.

[0137] In more preferred embodiments of the fourth aspect of the invention, step (ii) is carried out. Step (ii) is preferably carried out by polymerase chain reaction, whereby strands of nucleic acid comprising specific primer sequences are amplified. In further embodiments, step (ii) is preferably followed by a step of visualization of nucleic acid fragments, which is more preferably carried out by gel electrophoresis. This step advantageously allows for identifying nucleic acid strands and confirming the presence of encoded digital data D.

[0138] In further embodiments of the fourth aspect of the invention, step (iii) of sequencing retrieved nucleic acid fragments is carried out by the Sanger method. This is particularly the case when step (ii) is carried out. Alternative sequencing methods, such as nanopore sequencing or Illumina sequencing by synthesis (SBS), are known in the art and will become apparent to the skilled person upon reduction to practice of the invention. When nanopore sequencing is employed, step (ii) is advantageously not necessary. As the composition of the first aspect is robust, the retrieved sequence of nucleic acid according to the method of the fourth aspect is substantially the same as the sequence of the nucleic acid that was synthesized in the step of encoding digital data D.

[0139] Step (iv) of the fourth aspect of the invention comprises converting the nucleic acid sequence retrieved in step (iii) in digital data. As will be obvious to the skilled person, the same algorithm as used upon encoding digital data D is preferably used. Thus, in preferred embodiments, step (iv) of the method of the fourth aspect of the invention comprises decoding the sequence obtained in (iii) in digital data using the same algorithm employed for encoding said digital data.

[0140] Throughout the description and claims the word “comprises" and variations of the word, are not intended to exclude other technical features, additives, components or steps. Furthermore, the word “comprise” encompasses the cases of “consist of” and “consists essentially of”. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples are provided by way of illustration, and they are not intended to be limiting of the present invention.

[0141] The following clauses are provided in order to further define the specific embodiments and aspects of the invention detailed above: 1. Composition for digital data storage comprising: (a) a fiber comprising a material suitable for forming fibers by an electrohydrodynamic process, and (b) at least a synthetic nucleic acid, preferably deoxyribonucleic acid, comprised within said polymer fiber, characterized in that the sequence of said nucleic acid encodes digital data D and that said nucleic acid is not encapsulated in silica particles. 2. Composition according to clause 1 wherein the sequence of said nucleic acid is not totally identical to that of a naturally occurring nucleic acid or, alternatively, the structure of said nucleic acid is not totally identical to that of a naturally occurring nucleic acid . 3. Composition according to any one of clauses 1 to 2 wherein the synthetic nucleic acid is not encapsulated in particles. 4. Composition according to any one of clauses 1 to 3 wherein the fiber is a polymer fiber comprising a polymer suitable for forming fibers by an electrohydrodynamic process. 5. Composition according to any one of clauses 1 to 4 wherein the fiber is a nanofiber or a microfiber. 6. Composition according to any one of clauses 1 to 5 wherein the electrohydrodynamic process is selected from the group consisting of solution electrospinning, melt- electrospinning and melt-electrowriting. 7. Composition according to any one of clauses 1 to 6 wherein the material suitable for forming fibers by electrohydrodynamic process is a polymer suitable for forming fibers by electrospinning. 8. Composition according to any one of clauses 1 to 6 wherein the material suitable for forming fibers by electrohydrodynamic process is a polymer suitable for forming fibers by melt-electrowriting. 9. Composition according to any one of clauses 1 to 8 wherein the material is not one of poly(ethylene oxide), a co-polymer of poly(lactide-co-glycolide) and a poly(D,L-lactide)– poly(ethylene glycol) (PLA–PEG) block copolymer. 10. Composition according to any one of clauses 1 to 8 wherein the material is selected from the group consisting of polyethylene (PE), polypropylene (PP), polyvinyl alcohol (PVA), polyethylene oxide (PEO), poly(lactide-co-glycolic acid) (PLGA), poly(ethylene glycol) (PEG), polyvinyl acetate (PVAc), polystyrene (PS), polycaprolactone (PCL), polyurethane (PU), polyacrylonitrile (PAN), polylactic acid (PLA), poly(ethylene terephthalate) (PET), polyamide (PA, Nylon), polyethylene terephthalate (PET), poly(methyl methacrylate) (PMMA), polycarbonate (PC), polyvinyl chloride (PVC), polyoxymethylene (POM), polyvinylidene fluoride (PVDF), polybutylene terephthalate (PBT), blends, co-polymers and mixtures thereof. 11. Composition according to any one of clauses 1 to 8 wherein the material is selected from the group consisting of polyvinyl alcohol (PVA), polycaprolactone (PCL), polylactic acid (PLA), polyoxymethylene (POM), blends, co-polymers and mixtures thereof. 12. Composition according to any one of clauses 1 to 8 wherein the material is selected from the group consisting of polyvinyl alcohol (PVA) and polycaprolactone (PCL). 13. Composition according to any one of clauses 1 to 8 wherein the material is polycaprolactone (PCL). 14. Composition according to any one of clauses 1 to 13 wherein the diameter of said fiber is comprised between 100 nm and 1.5 ^m 15. Composition according to any one of clauses 1 to 14 wherein the nucleic acid is present in an amount of at least 0.2 gram per kilogram of material suitable for forming fibers by an electrohydrodynamic process. 16. Composition according to any one of clauses 1 to 15 wherein the nucleic acid is present in an amount of between 0.2 and 0.5 gram per kilogram of material suitable for forming fibers by an electrohydrodynamic process. 17. Composition according to any one of clauses 1 to 16 wherein the nucleic acid is further present on the surface of said fiber. 18. Composition according to any one of clauses 1 to 17 wherein the sequence of the nucleic acid comprises a sequence for identifying the encoded digital data and / or provide instructions on how to restore the digital data. 19. Composition according to any one of clauses 1 to 18 wherein the sequence of the nucleic acid comprises a primer sequence; preferably, the sequence of the nucleic acid comprises a forward primer sequence and a reverse primer sequence. 20. Composition according to any one of clauses 1 to 19 wherein the sequence of the nucleic acid comprises a sequence for error correction. 21. Composition according to any one of clauses 1 to 20 wherein the sequence of the nucleic acid comprises the sequence of formula (B)m-C-E wherein m is 0 or 1; B represents a sequence for identifying the encoded digital data and / or providing instructions on how to restore the digital data; C represents the sequence encoding the digital data D; and E represents a sequence for error correction. 22. Composition according to any one of clauses 1 to 21 wherein the sequence of the nucleic acid comprises the sequence of formula A-(B)m-C-E-A’ wherein A and A’ respectively represent the nucleic acid sequence of a forward primer and reverse primer sequence; m is 0 or 1; B represents a sequence for identifying the encoded digital data and / or providing instructions on how to restore the digital data; C represents the sequence encoding the digital data D; and E represents a sequence for error correction. In said embodiments, each of B and E are preferably as defined above. 23. Composition according to any one of clauses 1 to 22 the sequence of the nucleic acid comprises a plurality of iterations of the section of the sequence encoding digital data D. 24. Composition according to any one of clauses 1 to 23 wherein the sequence of the nucleic acid comprises a spacing sequence separating each iteration of said encoded digital data D employed for the purpose of indexing the data, such that the sequence of the nucleic acid preferably comprises the sequence of formula (B1-C)nwherein n is an integer equal to or higher than 1; and B1 represents the nucleic acid sequence of a sequence acting as a separator between each iteration of the sequence C of encoded digital data D or, when n is 1 B1 represents the nucleic acid sequence of a sequence acting as an indication of the location of the encoded digital data D. 25. Composition according to any one of clauses 1 to 24 wherein the sequence of the nucleic acid comprises a primer sequence for indicating that the sequence to be amplified comprises the sequence encoding digital data D. 26. Composition according to any one of clauses 1 to 25 wherein the sequence of the nucleic acid comprises a forward primer sequence and a reverse primer sequence for indicating that the sequence to be amplified comprises the sequence encoding digital data D, said forward primer sequence having preferably the sequence with SEQ ID 8 and the reverse primer sequence having preferably the sequence with SEQ ID 9. 27. Composition according to any one of clauses 1 to 26 wherein the sequence of the nucleic acid comprises the sequence of formula A-(B1-C)n- wherein n represents an integer equal to or higher than 1; A represents the nucleic acid sequence of a primer for indicating that the sequence to be amplified comprises the sequence encoding digital data D; B1 represents the nucleic acid sequence of a sequence acting as a separator between the primer sequence A and the sequence C of encoded digital data D and / or as an indication of the localization of sequence C of encoded digital data D. 28. Composition according to any one of clauses 1 to 27 comprising a plurality of fibers as defined in any one of clauses 1 to 27 wherein the sequence of each nucleic acid is as defined in any one of clauses 18 to 27. 29. Composition according to any one of clauses 18 to 28 wherein the nucleic acid is double stranded and further comprises the complementary sequence to the sequence of the nucleic acid as defined in any one of clauses 18 to 28. 30. Composition that comprises two or more fibers as defined in any of the clauses 1 to 29 wherein: (i) the sequence of nucleic acid comprised within a fiber is distinct from the sequence of nucleic acid comprised within at least another fiber; and / or (ii) the material suitable for forming a fiber by an electrohydrodynamic process comprised in a fiber is different from the material suitable for forming a fiber by an electrohydrodynamic process comprised in at least another fiber. 31. Composition according to clause 30 wherein the two or more fibers are arranged in a co-axial manner. 32. Use of a composition according to any one of clauses 1 to 31 in digital data storage and / or retrieval. 33. Use of a composition according to any one of clauses 1 to 32 as means of authentication of a product comprising said composition. 34. Method for the preparation of a composition for digital data storage according to any one of clauses 1 to 31 comprising: (i) providing a material suitable for forming fibers by an electrohydrodynamic process, (ii) providing at least a nucleic acid compound, preferably a deoxyribonucleic acid compound, wherein the sequence of said nucleic acid encodes digital data D, (iii) preparing a solid or liquid precursor composition for said electrohydrodynamic process comprising the material provided in (i) and the at least nucleic acid compound provided in (ii); (iv) submitting the precursor of (iii) to a fiber-forming electrohydrodynamic process. 35. The method according to clause 34 wherein the material suitable for forming fibers by an electrohydrodynamic process provided in (i) is a material as defined in any one of the clauses 1 to 31. 36. The method according to any one of clauses 34 to 35 further comprising the previous step of preparing synthetically the nucleic acid. 37. The method according to clause 36 wherein the nucleic acid is prepared according to a method selected from the group consisting of solid phase synthesis, enzymatic synthesis, non-enzymatic ligation or nucleic acid edition. 38. The method according to any one of clauses 36 to 37 wherein the nucleic acid is prepared by solid phase synthesis. 39. The method according to any one of clauses 34 to 37 comprising: (i) providing a polymer suitable for forming fibers by an electrohydrodynamic process, (ii) providing at least a nucleic acid compound wherein the sequence of said nucleic acid encodes digital data D, (iii) preparing a solid or liquid precursor composition for said electrohydrodynamic process comprising the polymer provided in (i) and the at least nucleic acid compound provided in (ii); (iv) submitting the precursor of (iii) to a fiber-forming electrohydrodynamic process. 40. The method according to any one of claims 34 to 39 wherein the fiber-forming electrohydrodynamic process of step (iv) is selected from the group consisting of solution electrospinning, melt-electrospinning and melt electrowriting. 41. The method according to any of clauses 34 to 40 wherein the precursor composition of (iii) is a solution comprising the material provided in (i) and the at least nucleic acid compound provided in (ii) and wherein the fiber-forming electrohydrodynamic process of step (iv) is solution electrospinning. 42. Method according to clause 41 wherein the solvent of the solution prepared in (iii) comprises water, preferably is water. 43. The method according to any of clauses 34 to 40 wherein the precursor composition of (iii) is a solid comprising the material provided in (i) and the at least nucleic acid compound provided in (ii) and wherein the fiber-forming electrohydrodynamic process of step (iv) is melt electrospinning or melt electrowriting. 44. The method according to any of clauses 34 to 40 wherein the precursor composition of (iii) is a solid comprising the material provided in (i) and the at least nucleic acid compound provided in (ii) and wherein the fiber-forming electrohydrodynamic process of step (iv) is melt electrowriting. 45. The method according to any of clauses 34 to 44 wherein (iv) comprises submitting the precursor of (iii) to a potential bias of between 5 and 20 kV. 46. Method comprising the steps of: (i) submitting a composition for data storage as defined in any of the clauses 1 to 31 to conditions for releasing at least partially the nucleic acid compound comprised within the fiber, thus providing a medium comprising free strands of said nucleic acid compound, (ii) optionally, amplifying the sequence of the free strands of said nucleic acid compound comprised in the medium obtained in (i), and (iii) detecting or sequencing the released nucleic acid compound obtained in (i) or (ii). 47. Method for authenticating a product comprising a composition as defined in any of the clauses 1 to 31, comprising the steps of: (i) submitting said product to conditions for releasing at least partially the nucleic acid compound comprised within the fiber comprised in the composition, thus providing a medium comprising free strands of said nucleic acid compound, (ii) optionally, amplifying the sequence of the free strands of said nucleic acid compound comprised in the medium obtained in (i), and (iii) detecting the released nucleic acid compound obtained in (i) or (ii); whereby the detection of the sequence of said nucleic acid confirms the authentication of the product. 48. Method according to clause 47 wherein step (ii) is not optional and is carried out by polymerase chain reaction. 49. Method for retrieving digital data D stored in a composition as defined in any of clauses 1 to 31 comprising the steps of: (i) submitting a composition for data storage as defined in any of clauses 1 to 29 to conditions for releasing at least partially the nucleic acid compound comprised within the fiber, thus providing a medium comprising free strands of said nucleic acid compound; (ii) optionally, amplifying the sequence of the free strands of said nucleic acid compound comprised in the medium obtained in (i), (iii) sequencing the released nucleic acid compound obtained in (i) or (ii), and (iv) decoding the sequence obtained in (iii) to digital data. 50. Method according to any of clauses 46 to 49 wherein (i) comprises solubilizing the polymer fiber in solvent capable of dissolving said material. 51. Method according to clause 50, wherein, when said fiber is a polymer fiber that comprises polycaprolactone, step (i) comprises contacting the composition with acetone. 52. Method according to clause 50, wherein, when said fiber is a polymer fiber that comprises polyethylene oxide and / or polyvinyl alcohol, step (i) of the fourth aspect of the invention comprises contacting the composition with water. EXAMPLES Encoding and oligonucleotide design

[0142] A text file of 16 bytes is encoded into DNA bases by first converting it to binary and mapping bit pairs to bases using the following encoding algorithm: A:01, T:11, G:10, C:00. The oligonucleotide includes the encoded message ”Nanogune” (encoded as ACTGAGCAAGTGAGTTAGATATAAAGTGAGAA, SEQ ID NO: 7) with a forward primer and the complementary to the reverse primer at the 5’ and 3’ ends (underlined), respectively, allowing for PCR amplification.

[0143] Message duplication within the sequence is employed to aid decoding and minimize sequencing errors in short DNA strands. The two message iterations are separated by a 4-base sequence which encodes the binary code of a bar space (CGCC - in bold) and also serves as the starting point for the message. Forward primer: TCCTCTACAGAGAGCAGGTT (SEQ ID NO: 8) Reverse primer: ACGCAACTTCGAGACAGGTA (SEQ ID NO: 9) Message:TCCTCTACAGAGAGCAGGTTCGCCACTGAGCAAGTGAGTTAGATATAAA GTGAGAACGCCACTGAGCAAGTGAGTTAGATATAAAGTGAGAATACCTGTCTCGA ATTGCGT (SEQ ID NO: 1) Chemicals

[0144] PCR primers (forward and reverse) and oligonucleotides containing the encoded message were purchased from Integrated DNA Technologies (IDT), received in lyophylised form after standard desalting. All oligonucleotides were suspended in deionized water to obtain a 100 μM stock solution that was kept at 4°C. Deoxyribonucleic acid, low molecular weight from salmon sperm (CAS:100403- 24-5), Polyethylene oxide (PEO, Mw 400,000 Da, CAS:25322-68-3), Polyvinyl alcohol (PVA, Mw 146,000-186,000 Da, CAS: 9002-89-5) and Polycaprolactone (PCL, Mw 45,000 Da) were purchased from Sigma-Aldrich in dry form. The cross-linker Glutaraldehyde Grade I at 70% in water (CAS: 111-30-8) and the surfactant Triton X-100 were purchased from Sigma-Aldrich. Polymer / DNA mixture preparation as precursors for electrospinning The following precursor compositions for electrospinning were prepared:

[0145] PEO / DNA mixture: A homogeneous PEO / DNA mixture is prepared by combining 100 mg of PEO and 10 μL of message oligonucleotide at a concentration of 100 μM per mL of deionized water resulting in final concentrations of 10%w / w PEO and 0.0034 w / w% of DNA. The procedure is repeated without the addition of DNA to provide a control. For thorough mixing the solution is left on a magnetic stirrer overnight at room temperature.

[0146] PVA / DNA mixture: A PVA / DNA mixture is prepared with 80 mg of PVA and 10 μL of message oligonucleotide at 100 μM per mL of deionized water resulting in final concentrations of 8%w / w PVA and 0.0034% w / w of DNA. Furthermore, Triton X-100 surfactant is introduced at a final concentration of 0.25% w / w to minimize surface tension, thereby facilitating fiber formation. The prepared mixture is subsequently left on a magnetic stirrer overnight for optimal mixing.

[0147] PCL / DNA mixture: A PCL / DNA mixture is prepared with 1 g of PCL dissolved in 5.6 g of acetone for a final concentration of 15% w / w. This mixture is sonicated at a moderate temperature of 40°C for an hour to ensure a uniform blend. Post-sonication, DNA is added at the same concentration as employed for the other two mixtures. Preparation of DNA-comprising fibers by solution electrospinning

[0148] The solution electrospinning (SE) experimental setup comprises a high-voltage power supply (iseq, Compact High Voltage Module, +30kV, 0.3mA), a syringe pump, a Hamilton glass syringe with a metallic needle, and an aluminum sheet acting as a grounded collector. A 5 mL Hamilton glass syringe is filled with 2 mL of the polymer / deoxyribonucleic acid mixture for electrospinning prepared according to the procedure described above. The syringe with the needle is placed horizontally on the pump and the needle tip is arranged such that it is pointing towards the collector. The flow rate is set at 0.350 mL / hour. PEO / deoxyribonucleic acid and PVA / deoxyribonucleic acid fibers are electrospun at a positive voltage of +10 kV and PCL / deoxyribonucleic acid at +15 kV. The electrospinning process is carried out at room temperature and in ambient conditions. The fibers are collected on an aluminum foil placed 12 cm (for forming PEO or PVA fibers) and 20 cm (for forming PCL fibers) away from the tip of the needle respectively. In addition, a microscope glass slide serves as a secondary collection surface for subsequent optical characterization. Following collection, approximately 100 mg of the electrospun fibers are gathered with the aid of a pair of precision tweezers and subsequently transferred into an Eppendorf® microtube for storage. All samples are preserved under room temperature conditions. Preparation of DNA-comprising fibers by melt-electrowriting

[0149] Melt Electrowriting (MEW) is a high-resolution biofabrication method that integrates aspects of electrospinning and 3D printing. This process necessitates the melting of a polymer, which is then deposited using a high-voltage system to produce fibers with micro-scale diameters. By introducing a G-code into the MEW equipment software, we regulate the fiber deposition pattern, thereby enhancing our control over the final design. A PCL and DNA mixture is prepared following the same protocol as defined above.2 mL of the acetone solution where PCL and DNA are dissolved is then dried on a glass petri dish and the obtained pellet crushed into a powder. The sample is then melted at 100°C in a pneumatic extruder in the melt-electrowriting apparatus disclosed in WO2021037894, incorporated herein by reference (NovaSpider®). The temperature is then decreased to 95°C for the deposition of fibers. Fibers are produced at an applied voltage of -7 kV, 6 mm away from a grounded collector (aluminum foil) with the extruder set at a pressure of 0.2 bar. Fibers are printed on the aluminum foil collector forming a rhomboid shaped mesh (115 x 58 mm) as instructed by a custom G-code programmed into the system software. Retrieval of DNA and PCR amplification

[0150] The mesh of fibers produced by solution electrospinning is carefully collected into an Eppendorf® tube, and supplemented with 200 ^l of deionized water. In the case of melt-electrowritten PCL half of the rhomboid shaped fibers are placed into a tube and dissolved in acetone in a sonication bath at 40°C for an hour. The obtained respective solutions then undergo PCR amplification and are subsequently evaluated using agarose gel electrophoresis. The PCR reactions are carried out in the MiniAmpTMPlus thermal cycler (Applied Biosystems, ThermoFisher). Using the OneTaq HotStart, HiFidelity polymerase (New England Biolabs), the reactions are performed on 1 ng of DNA reference template and 10 μL of fibers-DNA mixture, with Forward and Reverse primers included at 0.5 μM final concentration in a reaction volume of 50 μL. The PCR reaction cycle starts with an initial denaturation at 94°C for 30 seconds, followed by 30 cycles of 10 seconds denaturation at 94°C, 30 seconds annealing at 65°C, 30 seconds of extension at 68°C and a final extension at 68°C for up to 3 min. PCR products are then analyzed by gel electrophoresis on 2% agarose 0.5X TBE (Tris-Borate-EDTA Buffer) gels, pre-stained with Sybr-Safe (10000X, Invitrogen). For each sample 5 μL are mixed with 1 μL of Orange Loading Dye (6X, Thermofisher) and injected in the well for migration at 80 V. A 50 bp molecular weight ladder (FastLoad, SERVA) is used as reference. Images are taken on a UV transilluminator (BioRad). Successfully amplified PCR products appear as distinct bands on the gel, whereas samples which contained no DNA do not show any bands. In the case of PCL / DNA fibers, DNA is successfully recovered using both water and acetone, although the DNA signal is stronger in acetone treatment as the fibers are then fully dissolved. DNA sequencing and decoding of message

[0151] Once obtained, PCR products are purified and sent for Sanger sequencing, alongside primers. Upon completion, chromatogram files containing raw sequence data are analyzed using the software 4Peaks. Extracted sequences are then decoded as described previously. As shown in Figure 6, the results demonstrate that the message- bearing oligonucleotide can be retrieved after fiber formation and PCR amplification steps, and the encoded message is recovered completely: (SEQ ID NO: 1) Quantitation of DNA release kinetics from fibers

[0152] After adding 200 μL of water to the electrospun fibers, a sample of 2 μL is taken every two hours for the first day, and then at 24h. For each time point the absorbance at 260 nm is measured with a Nanodrop spectrometer (Thermofisher®) three times. The maximal DNA quantity in each sample is estimated after full fiber dissolution: the fibers undergo heating at 80°C for an hour, followed by ten minutes of sonication before measuring the absorbance again. A complete UV-Vis spectrum was performed for each polymer fiber in aqueous solution, devoid of DNA, to determine the basal level of absorbance at 260 nm. Fig .11 shows the evolution of the fractional release of nucleic acid as a function of time, as measured by UV-Vis for (a) PEO fibers, (b) PVA fibers and (c) PCL fibers. Fibers characterization (Figure 4)

[0153] The fibers collected on a glass slide are characterized by dark-field microscopy (Leica DFC425) with a HC PLANS 10x / 25 objective and a magnification of either 50x or 100x. Further analysis is performed with environmental scanning electron microscopy (eSEM Fei Quanta 250) for optical characterization and estimation of the diameter of the fiber. In the latter, fibers spun on a silicon wafer are sputtered with gold with the Quorum Q150T ES sputter coater (set at 25 mA for 30 seconds) to obtain a 10 nm thick layer before observation in high vacuum. To observe the presence of DNA in the fibers, a high concentration of genomic DNA (from salmon testes) is used for visualization in fluorescence microscopy (Zeiss optical microscope). Finally, atomic force microscopy (AFM) is used to determine the mechanical properties of the fibers. The measurements are performed with the QI (quantitative imaging) mode of the JPK NanoWizard V (Bruker) using a Multi75-5Ai-G cantilever (75 kHz, 3N / m). Accelerated ageing test

[0154] Dry fibers prepared according to the procedure described above for solution electrospinning are subjected to high humidity and temperature in open Eppendorf® tubes and on microscope slides inside an enclosed chamber. High humidity is produced using a saturated aqueous sodium chloride solution in an open Petri dish. The samples are left undisturbed until the relative humidity reaches 80%, as measured by a hygrometer (Testo 174H) placed inside the chamber. After the humidity stabilizes, the samples are placed inside and left overnight. Subsequently, they are kept in an oven at 70ºC for an additional 24 hours. The integrity of the deposited fibers is analysed by microscopy and the retrieved DNA from Eppendorf® tubes is then characterized by PCR, analysed on gel electrophoresis and subsequent Sanger sequencing as described above.

[0155] The PCR samples run on the message oligonucleotide alone or in PEO and PCL fibers after dissolution or ageing were sequenced through Sanger sequencing. The resulting sequences and chromatograms are aligned to show message retrieval and integrity in the second iteration of the encoded message (underlined in the alignment below – see also Figures 9 and 10). Highlighted in grey are the non-identified bases at the beginning and end of the sequences. The grey background on the traces of Figures 9 and 10 shows the statistical reliability of the base call. The ageing tests shows that the composition for data storage of the invention is robust upon storage, despite the absence of silica particles for DNA protection, In addition, the Examples further show that the composition for data storage of the invention advantageously allows for releasing the molecules of oligonucleotides or polynucleotides in mild conditions, e.g. upon dissolution of the fiber in an organic solvent, such as water or acetone. (Message) GAACGCCACTGAGCAAGTGAGTTAGATATAAAGTGAGAATACCTGT CTCGAAGTTGCNNNN (SEQ ID NO: 2) (Dissolved PEO) GAACGCCACTGAGCAAGTGAGTTAGATATAAAGTGAGAATACCTGTCTCGAAGTT GCNN (SEQ ID NO: 3) (Aged PEO fiber) GAACGCCACTGAGCAAGTGAGTTAGATATAAAGTGAGAATACCTGTCTCGAAGTT GNNN (SEQ ID NO: 4) (Dissolved PCL)

Claims

CLAIMS 1. Composition for digital data storage comprising: (a) a fiber comprising a polymer suitable for forming fibers by an electrohydrodynamic process, and (b) at least a synthetic nucleic acid comprised within said polymer fiber, characterized in that the sequence of said nucleic acid encodes digital data D and that said nucleic acid is not encapsulated in silica particles, being the sequence of said nucleic acid not totally identical to that of a naturally occurring nucleic acid.

2. Composition according to claim 1 wherein the polymer fibre is obtained by a electrohydrodynamic process.

3. Composition according to any one of claims 1 to 2 wherein the polymer fibre is a nanofiber or a microfiber.

4. Composition according to any one of claims 1 to 3 wherein the polymer suitable for forming fibers by electrohydrodynamic process is a polymer suitable for forming fibers by electrospinning.

5. Composition according to any one of claims 1 to 3 wherein the polymer suitable for forming fibers by electrohydrodynamic process is a polymer suitable for forming fibers by melt-electrowriting.

6. Composition according to any one of claims 1 to 5 wherein the polymer is not one of poly(ethylene oxide), a co-polymer of poly(lactide-co-glycolide) and a poly(D,L-lactide)– poly(ethylene glycol) (PLA–PEG) block copolymer.

7. Composition according to any one of claims 1 to 5 wherein the polymer is selected from the group consisting of polyethylene (PE), polypropylene (PP), polyvinyl alcohol (PVA), polyethylene oxide (PEO), poly(lactide-co-glycolic acid) (PLGA), poly(ethylene glycol) (PEG), polyvinyl acetate (PVAc), polystyrene (PS), polycaprolactone (PCL), polyurethane (PU), polyacrylonitrile (PAN), polylactic acid (PLA), poly(ethylene terephthalate) (PET), polyamide (PA, Nylon), polyethylene terephthalate (PET), poly(methyl methacrylate) (PMMA), polycarbonate (PC), polyvinyl chloride (PVC), polyoxymethylene (POM), polyvinylidene fluoride (PVDF), polybutylene terephthalate (PBT), polypyrrol (Ppy), blends, co-polymers and mixtures thereof; more preferably, the polymer is selected from the group consisting of polyvinyl alcohol (PVA), polycaprolactone (PCL), polylactic acid (PLA), polyoxymethylene (POM), blends, co- polymers and mixtures thereof; preferably it is selected from polyvinyl alcohol (PVA) and polycaprolactone (PCL); more preferably, it is polycaprolactone (PCL).

8. Composition according to any one of claims 1 to 7 wherein the synthetic nucleic acid is synthetic deoxyribonucleic acid.

9. Composition according to any one of claims 1 to 8 wherein the nucleic acid is present in an amount of at least 0.2 gram per kilogram of polymer.

10. Composition according to any one of claims 1 to 9 wherein the sequence of the nucleic acid comprises a plurality of iterations of the section of the sequence encoding digital data D.

11. Composition according to any one of claims 1 to 10 wherein the sequence of the nucleic acid comprises a spacing sequence separating each iteration of said encoded digital data D employed for the purpose of indexing the data, such that the sequence of the nucleic acid preferably comprises the sequence of formula (B-C)nwherein n is an integer equal to or higher than 1; and B represents the nucleic acid sequence of a sequence acting as a separator between each iteration of the sequence C of encoded digital data D or, when n is 1, B represents the nucleic acid sequence of a sequence acting as an indication of the location of the encoded digital data D.

12. Composition according to any one of claims 1 to 11 wherein the sequence of the nucleic acid comprises a primer sequence for indicating that the sequence to be amplified comprises the sequence encoding digital data D.

13. Composition according to any one of claims 1 to 12 wherein the sequence of the nucleic acid comprises a forward primer sequence and a reverse primer sequence for indicating that the sequence to be amplified comprises the sequence encoding digital data D, said forward primer sequence having preferably the sequence with SEQ ID 8 and the reverse primer sequence having preferably the sequence with SEQ ID 9.

14. Composition according to any one of claims 1 to 13 wherein the sequence of the nucleic acid comprises the sequence of formula A-(B1-C)n- wherein n is equal to or higher than 1; A represents the nucleic acid sequence of a primer for indicating that the sequence to be amplified comprises the sequence encoding digital data D;B1 represents the nucleic acid sequence of a sequence acting as a separator between the primer sequence A and the sequence C of encoded digital data D and / or as an indication of the localization of sequence C of encoded digital data D.

15. Use of a composition according to any one of claims 1 to 14 in digital data storage and / or retrieval.

16. Method for the preparation of a composition for digital data storage according to any one of claims 1 to 14 comprising: (i) providing a polymer suitable for forming fibers by an electrohydrodynamic process, (ii) providing at least a nucleic acid compound, preferably a deoxyribonucleic acid, wherein the sequence of said nucleic acid encodes digital data D, (iii) preparing a solid or liquid precursor composition for said electrohydrodynamic process comprising the polymer provided in (i) and the at least nucleic acid compound provided in (ii); (iv) submitting the precursor of (iii) to a fiber-forming electrohydrodynamic process.

17. Method according to claim 16 further comprising the previous step of preparing synthetically the nucleic acid provided in (ii) by solid phase synthesis.

18. Method according to any of claims 16 to 17 wherein the precursor composition of (iii) is a solution comprising the polymer provided in (i) and the at least nucleic acid compound provided in (ii) and wherein the fiber-forming electrohydrodynamic process of step (iv) is solution electrospinning.

19. Method according to any of claims 16 to 18 wherein the precursor composition of (iii) is a solid comprising the polymer provided in (i) and the at least nucleic acid compound provided in (ii) and wherein the fiber-forming electrohydrodynamic process of step (iv) is melt electrospinning or melt electrowriting; preferably it is melt electrowriting.

20. Method according to any of claims 16 to 19 wherein (iv) comprises submitting the precursor of (iii) to a potential bias of between 5 and 20 kV.

21. Method for retrieving digital data D stored in a composition as defined in any of claims 1 to 14 comprising the steps of: (i) submitting a composition for data storage as defined in any of claims 1 to 14 to conditions for releasing at least partially the nucleic acid compound comprised within the polymer fiber, thus providing a medium comprising free strands of said nucleic acid compound; preferably, (i) comprises solubilizing the polymer fiber in solvent capable of dissolving said polymer;(ii) optionally, amplifying the sequence of the free strands of said nucleic acid compound comprised in the medium obtained in (i), (iii) sequencing the released nucleic acid compound obtained in (i) or (ii), and (iv) decoding the sequence obtained in (iii) to digital data.

Images