Gram-positive bacteria of the species Lactococcus lactis or Streptococcus thermophilus having very low surface proteolysis, their methods of obtaining and their uses

Abstract

The present invention relates to a bacterium in which the expression and / or activity of surface proteases is inhibited, its preparation method and the uses of this bacterium.

Description

Title of the invention: GRAM-POSITIVE BACTERIA OF THE SPECIES ACTOCOCCUSLACTIS OR STREPTOCOCCUS THERMOPHILUS HAVING VERY LOW SURFACE PROTEOLYSIS, METHODS OF OBTAINING THEM AND THEIR USES

[0001] The present invention relates to Gram-positive bacteria of the species Lactococcus lactis or Streptococcus thermophilus exhibiting very low surface proteolysis; it also relates to the use of these bacteria, in particular for the production of proteins of interest.

[0002] An analysis of the peptides produced by the bacterium Lactococcus lactis and accumulated in its culture medium revealed a high accumulation of peptides of bacterial origin (Guillot et al., 2016). This set of peptides defines the exocellular peptidome or exopeptidome of the bacterium. Analysis of these peptides shows that approximately half of them come from the degradation of surface proteins that are neither cytoplasmic nor transmembrane.

[0003] This degradation would be due to the presence of several proteases located on the surface of the bacteria. Two proteases located in this way have already been characterized in lactic acid bacteria. One, a serine protease of the subtilisin family, called PrtS in Streptococcus thermophilus (S. thermophilus) and PrtP in Lactococcus lactis (L. lactis), covalently anchored to the wall is capable of hydrolyzing milk caseins (Fernandez-Espla et al., 2000 and Siezen et al., 1999). The second, also a serine protease, called HtrA, has been characterized in L. lactis (Poquet et al., 2000); a homologue in S. thermophilus is also present. This protease hydrolyzes abnormal and / or misfolded proteins and intervenes in the maturation of exported proteins (Poquet et al., 2000).

[0004] One of the main drawbacks of this surface proteolysis is encountered during the production of proteins of interest by bacteria, in particular Gram-positive bacteria. Indeed, surface proteolysis leads to a degradation of these proteins during and / or after their export, leading to a reduction in yield and / or an alteration in the structure and activity of the protein of interest.

[0005] It therefore appears desirable to obtain strains of bacteria exhibiting very low surface proteolysis compared to wild strains.

[0006] In this context, the Inventors have constructed single and double mutants for PrtS and HtrA in the LMD9 strain of S. thermophilus (see example 1) and are concluded that the deletion of the two proteases PrtS and HtrA does not abolish surface proteolysis in S. thermophilus LMD9 since residual proteolysis is observed (see example 2). The same results were obtained for L. lacti s strains MG1363 and IL1403 (Guillot et al., 2016) and therefore confirm that the surface proteases HtrA and PrtS / PrtP are not responsible alone for all the surface proteolytic activity of these strains.

[0007] The hypothesis formulated by the Inventors is then that one or more proteases responsible for this residual activity are present in each of the three strains. This is how they identified the protease Ster-1612 (or STER_RS07910 in the new NCBI annotation) in the wild-type strain LMD9 of S. thermophilus; this protease is called YwdF (or EFV54_RS11495 in the new NCBI annotation) for the strain IL1403 of L. lactis subsp. lactis and llmg-2442 (or LLMG_RS 12255 in the new NCBI annotation) for the strain MG1363 of L. lactis subsp. cremoris (see example 3). This protease belongs to the S16 family of LonA proteases (Gottesman et al., 1978 and Charrette et al., 1981) which are serine proteases, characterized by the presence of a conserved Serine-Lysine catalytic dyad in the C-terminal region of the protein (Botos et al., 2004).

[0008] The inventors then constructed strains derived from S. thermophilus LMD9 in which all or part of the three proteases PrtS, HtrA and Ster-1612 were inactivated (see example 1); the inactivation of the three proteases leads to almost abolished surface proteolysis in this bacterium (see example 4). In addition, they constructed the strain of S. thermophilus LMD9 in which the three proteases PrtS, HtrA and Ster-1612 were inactivated and producing the heterologous proteins IL-10 or elafin (see example 6) and confirmed that the inhibition of these three proteases no longer led to degradation of heterologous proteins, thus allowing the improvement of the production yield of heterologous proteins, compared to the wild-type parent bacterium (see example 7).

[0009] The subject of the present invention is therefore a Gram-positive bacterium of the species Lactococcus lactis or Streptococcus thermophilus, such that the endogenous surface protease comprising an amino acid motif having at least 80% identity with the sequence SEQ ID No. 1, has a reduced or abolished expression and / or activity,

[0010] where SEQ ID No. 1 is defined as follows:

[0011] I- AGTGTIE-X1-DG-X2-X3-G-X4-LG-G-X5-X6-X7-K

[0012] with

[0013] XI is histidine (H) or lysine (K);

[0014] X2 is serine (S), alanine (A) or threonine (T);

[0015] X3 is isoleucine (I), leucine (L) or valine (V);

[0016] X4 is aspartic acid (D) or glutamine (Q);

[0017] X5 is alanine (A) or valine (V);

[0018] X6 is aspartic acid (D) or tyrosine (Y);

[0019] and X7 is lysine (K) or leucine (L).

[0020] The endogenous surface protease is a serine protease whose enzymatic activity can be characterized by evaluating the degradation of a chromogenic substrate by colorimetric assay, or of a protein substrate by SDS-PAGE electrophoresis or by HPLC liquid chromatography analysis.

[0021] Preferably, the amino acid motif comprised in said protease has at least 80% identity, and in ascending order of preference at least 82%, 86%, 91%, 95% or 100% identity with the amino acid sequence SEQ ID No. 1 when the sequences are aligned over their entire length.

[0022] According to a particular embodiment, the Gram-positive bacterium is of the species Streptococcus thermophilus and the endogenous surface protease has at least 70% identity, and in ascending order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, and particularly preferably at least 90% identity with the sequence SEQ ID No. 2 when the sequences are aligned over their entire length. In particular, the endogenous surface protease is Ster-1612 of sequence SEQ ID No. 2.

[0023] According to yet another embodiment, the Gram-positive bacterium is of the species Lactococcus lactis and the endogenous surface protease has at least 70% identity, and in ascending order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, and particularly preferably at least 80% identity with the sequence SEQ ID No. 3 or with the sequence SEQ ID No. 4 when the sequences are aligned over their entire length. In particular, the Gram-positive bacterium may be Lactococcus lactis subsp. lactis and the endogenous surface protease is YwdF of sequence SEQ ID No. 3 or the Gram-positive bacterium may also be Lactococcus lactis subsp. cremoris and the endogenous surface protease is llmg 2442 of sequence SEQ ID No. 4.

[0024] Unless otherwise indicated, the identity percentages are calculated from a global alignment of the amino acid sequences carried out using the "needle" algorithm (Needleman and Wunsch, 1970) using the default parameters: "Matrix": EBLOSUM62, "Gap penalty": 10.0 and "Extend penalty": 0.5.

[0025] The nucleotide sequence of the gene encoding Ster-1612 is represented by the sequence SEQ ID No. 5. The nucleotide sequence of the gene encoding YwdF is represented by the sequence SEQ ID No. 6. The nucleotide sequence of the gene encoding llmg_2442 is represented by the sequence SEQ ID No. 7.

[0026] The analysis of 102 genomes of the subspecies L. lactis subsp. lactis, made it possible to define a degree of conservation of YwdF greater than 80% for 100 strains, the 2 the latter apparently lacking the gene encoding YwdF. Sequence conservation is also high within the subspecies L. lactis subsp. cremoris, since among the 56 genomes analyzed, 51 have a gene encoding a protein that is more than 80% identical to the llmg_2442 protein of L. lactis subsp. cremoris MG1363, 5 do not appear to possess the gene encoding this protein.

[0027] By way of illustration and without limitation, the Gram-positive bacterium according to the invention can be obtained from a strain of S. thermophilus LMD9, S. thermophilus CNRZ1066, Lactococcus lactis subsp. lactis IL1403, Lactococcus lactis subsp. cremoris MG1363.

[0028] The bacterium according to the invention exhibits very low surface proteolysis compared to the parent bacterium from which it is derived; this proteolysis is estimated at less than 10% and preferably less than 5% of the proteolysis of the parent bacterium from which it is derived (see the protocol for quantifying proteolysis in example 2).

[0029] By "the expression of an endogenous surface protease in a bacterium is reduced" is meant the reduction in the quantity of the protease produced by the bacterium of the invention in comparison with the parent bacterium from which it is derived and in which the expression of said protease is not reduced, whatever the cause (reduction in the level of expression of the gene encoding the protease, reduction in the number of messenger RNAs, degradation of the protease).

[0030] Methods used to measure the decrease in the expression of a protease in a bacterium include, for example, quantitative RT PCR to assess the level of expression of the gene encoding the protease or protein assay by Elisa to quantify the synthesized protein.

[0031] By "the activity of an endogenous surface protease in a bacterium is decreased" is meant the decrease in the activity of the protease produced by the bacterium according to the invention in comparison with a parent bacterium from which it is derived and in which the activity of said protease is not decreased.

[0032] The methods used to measure the decrease in the activity of a protease in a bacterium include, for example, the counting of surface peptides identified by mass spectrometry following a double chromatographic separation (Guillot et al., 2016), the evaluation of the degradation of a chromogenic substrate allowing easy quantification of the activity by colorimetric assay, or of a protein substrate by SDS-PAGE electrophoresis or HPLC liquid chromatography analysis....

[0033] By "the expression and / or activity of an endogenous surface protease in a bacterium is abolished" is meant the absence of expression and / or activity of the protease; this is the case when the proteolysis of the bacterium considered represents less than 5% of the proteolysis of the parent bacterium from which it derives, according to the proteolysis quantification protocol of example 2. Such abolition of the expression and / or of the activity of the endogenous surface protease can be obtained by total reduction of the expression and / or activity of the protease (as defined below) or can occur when the structural gene of the protease is not naturally present in the genome of the bacteria, or present in a truncated (pseudogeneic) form.

[0034] Preferably, the bacterium of the species S. thermophilus according to the invention is further such that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8 or the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 9 has a reduced or abolished expression and / or activity.

[0035] Preferably, the bacterium of the species L. lactis according to the invention is further such that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 10 or the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 11 has a reduced or abolished expression and / or activity.

[0036] The surface protease, called HtrA in Streptococcus thermophilus, has at least 70% identity, and in ascending order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence SEQ ID No. 8, when the sequences are aligned over their entire length. The surface protease, designated HtrA in Lactococcus lactis, has at least 70% identity, and in ascending order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence SEQ ID No. 10, when the sequences are aligned over their entire length.

[0037] The nucleotide sequence of the gene coding HtrA is represented by the sequence SEQ ID No. 12 in the case of a strain of S. thermophilus, and by the sequence SEQ ID No. 13 in the case of a strain of Lactococcus lactis.

[0038] The surface protease, called PrtS in Streptococcus thermophilus, has at least 70% identity, and in ascending order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence SEQ ID No. 9, when the sequences are aligned over their entire length. The surface protease, called PrtP in Lactococcus lactis, has at least 70% identity, and in ascending order of preference at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the amino acid sequence SEQ ID No. 11, when the sequences are aligned over their entire length.

[0039] The nucleotide sequence of the gene coding PrtS is represented by the sequence SEQ ID No. 14 in the case of a strain of S. thermophilus, by the sequence SEQ ID No. 15 in the case of a strain of Lactococcus lactis.

[0040] According to another embodiment of the invention, the bacterium of the species S. thermophilus according to the invention is such that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8 and the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 9 have a reduced or abolished expression and / or activity.

[0041] According to another embodiment of the invention, the bacterium of the species L. lactis according to the invention is such that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 10 and the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 11 have a reduced or abolished expression and / or activity.

[0042] In the present case, the decrease in the expression of each of the three endogenous surface proteases in a bacterium according to the invention is measured for example by quantitative RT PCR to evaluate the level of expression of each of the genes encoding the proteases, or by ELISA assay to quantify each of the synthesized proteins, and is compared to the expression of the surface proteases of a parent bacterium from which it is derived.

[0043] The decrease in the overall activity of the three endogenous surface proteases in a bacterium according to the invention can be measured by counting the surface peptides identified by mass spectrometry following a double separation in liquid chromatography (HPLC) and is compared to the overall activity of the surface proteases of a parent bacterium from which it is derived.

[0044] The decrease in the expression and / or activity of the proteases may be total or partial. The decrease in expression and / or activity is considered total within the meaning of the invention when it represents less than 5% of the proteolysis of the parent bacterium from which it is derived, according to the proteolysis quantification protocol of Example 2. It is considered partial when it is significantly lower than that of the parent bacterium from which it is derived. The significance of the difference is estimated by a statistical test adapted to small sample sizes (non-parametric Kruskal-Wallis test) with a probability P less than 0.05.

[0045] The reduction of the expression and / or activity of endogenous surface proteases as defined above in a bacterium can be obtained in different ways detailed below.

[0046] This reduction in the expression and / or activity of endogenous surface proteases can be obtained by mutagenesis of the genes encoding these proteases. This mutagenesis can then occur at the level of the coding sequence or the sequences regulating the expression of these genes, in particular at the level of the promoter, leading to an inhibition of the transcription or translation of the proteases. For example, the introduction of one or more point mutations within the sequence coding sequence of a gene or its expression regulation sequences can induce, depending on the nature of the mutation, a shift in the reading frame and / or the introduction of a stop codon in the sequence and / or the inhibition of transcription or translation of the genes coding for these 3 proteases and / or a substitution of one of the amino acids in the active site of the enzyme and lead to the expression of an inactive protease, or a protease with reduced activity. Finally, when the gene coding for one of the surface proteases is organized in an operon (case of ster-1612 in S. thermophilus, and probably of YwdF and llmg2442 in L.lactis), the introduction of one or more point mutations within the coding sequence of a gene in the operon other than that coding for the protease can induce, depending on the nature of the mutation, a shift in the reading frame and / or the introduction of a stop codon in the sequence and thus abolish the expression of the protease (polar mutation). The same applies to the sequence regulating the expression of the entire operon.

[0047] The bacterium according to the invention can be obtained by deletion, insertion and / or substitution of one or more nucleotides, for example by deletion of all or part of the coding sequence of the gene coding the protease or its promoter, by the insertion of an exogenous sequence within the coding sequence of the gene coding the protease or its promoter, by the substitution of one or more nucleotides of the coding sequence of the gene coding one of the amino acids of the active site of the protease or its promoter, or by introduction of a polar mutation in the case of a gene organized in an operon. Methods for deleting, inserting and / or substituting a given genetic sequence in the bacterium, in particular in S. thermophilus and Lactococcus lactis, are well known to those skilled in the art (Gardan et al., 2009 and Biswas et al., 1993).For example, the insertion of an exogenous sequence within the coding sequence of the gene encoding the protease can be achieved using transposons of natural or artificial origin.

[0048] Mutagenesis can be implemented by the induction of random mutations, for example using physical agents, such as radiation or chemical agents such as EMS (Ethyl Methane Sulfonate) or in a targeted manner by transfection, transduction, natural transformation or by electroporation (Bron et al., 2019). Alternatively, mutagenesis can be implemented by methods using nucleases (TALEN, CRISPR / Cas9, Wei et al., 2013).

[0049] The reduction of protease activity can be obtained by the use of specific serine protease inhibitors (PMSF [PhenylMethaneSulfonyl Fluoride], DFP [DiisopropylFluoroPhosphate], triterpenoid, coumarin, serpins, peptidomimetics..., Shamsi et al., 2016; Soualmia and El Amri, 2018). Finally, the reduction of protease expression can be obtained by modification of the promoter sequence of the gene according to, for example, one of the methods used to substitute a nucleotide sequence cited above, or by an RNA interference technique (RNAi), by expression of an antisense RNA or by aptamers.

[0050] The mutated genes encoding the proteases as defined above can be identified for example by PCR using primers specific to said genes, PCR possibly followed by sequencing of the PCR fragment in the case of mutations not affecting the size of said gene (substitutions, for example).

[0051] The inventors investigated the presence of the genes encoding these three surface proteases, STER_1612, HtrA and PrtS, in 61 genomes of S. thermophilus, and the conservation of the corresponding protein sequences was analyzed. The variability of the presence of the PrtS protease within the species S. thermophilus was already known (Delorme et al., 2010). Conversely, the two proteases HtrA and STER_1612 are present in all strains, and their protein sequences are very well conserved (except for one strain, N4L, whose gene encoding HtrA would be a pseudogene).

[0052] Thus, two groups of S. thermophilus strains can be distinguished on the basis of their surface protease equipment: a group A of 24 strains which possess the three proteases PrtS, HtrA and STER_1612, to which the LMD9 strain belongs and a group B of 37 strains which possess the two proteases HtrA and STER_1612 and do not possess the PrtS protease, to which the CNRZ1066 strain belongs.

[0053] The inventors evaluated the role of the two surface proteases HtrA and STER_1612 on the surface proteolysis of S. thermophilus group B strains and showed that the residual surface proteolysis of the double mutant is comparable to that obtained with the triple mutant of the LMD9 strain (see example 5).

[0054] Whether the S. thermophilus strain has two or three surface proteases, inactivation of the genes coding for these two or three surface proteases respectively is sufficient to reduce the surface proteolysis of the bacteria by more than 90%.

[0055] An advantageous bacterium within the meaning of the present invention is a bacterium, preferably Streptococcus thermophilus, in which the expression or activity of the 3 endogenous surface proteases, Ster-1612 of sequence SEQ ID No. 2, HtrA of sequence SEQ ID No. 8, and PrtS of sequence SEQ ID No. 9, of said bacterium is inhibited.

[0056] Another bacterium advantageous within the meaning of the present invention is a bacterium, preferably Streptococcus thermophilus, in particular a strain of Streptococcus thermophilus which does not possess PrtS, in which the expression or the activity of the 2 endogenous surface proteases, Ster-1612 of sequence SEQ ID No. 2 and HtrA of sequence SEQ ID No. 8 of said bacterium is inhibited.

[0057] The present invention also relates to a bacterium as defined above, modified to express a protein of interest, for example a heterologous or recombinant protein of interest, said bacterium being transformed by a expression vector containing a DNA fragment coding for the protein of interest, or by integration of the DNA fragment of interest into the chromosome of said bacterium.

[0058] By heterologous protein is meant a protein which is neither naturally produced by the bacterial strain, nor necessary for its growth.

[0059] The present invention therefore has the advantage of the expression by the bacterium according to the present invention of proteins of industrial interest, which will be secreted into the culture medium of said bacterium and in which the proteins of interest can be easily recovered, or associated with the bacterial surface and exerting their enzymatic activity on the external face of the bacterium.A protein associated with the bacterial surface is understood to mean a protein covalently anchored to the bacterial wall via a sortase-specific anchoring motif, a protein inserted into the plasma membrane via a membrane anchor located at the N- or C-terminal end of its amino sequence, a protein covalently bound to the membrane via a lipid anchoring motif located at the N-terminal end of its amino sequence, or a protein possessing non-covalent association motifs to the wall, such as LysM (Cossart and Joncquières, 2000; Desvaux et al., 2018).

[0060] The present invention also relates to a method for preparing a Gram-positive bacterium of the species Lactococcus lactis or Streptococcus thermophilus which is weakly proteolytic, comprising the reduction or abolition in said bacterium of the expression and / or the activity of an endogenous surface protease of said bacterium, said protease comprising an amino acid motif having at least 80%, and in increasing order preferably at least 82%, 86%, 91%, 95% or 100% identity with the sequence SEQ ID No. 1,

[0061] where SEQ ID No. 1 is defined as follows:

[0062] I- AGTGTIE-X1-DG-X2-X3-G-X4-LG-G-X5-X6-X7-K

[0063] with

[0064] XI is histidine (H) or lysine (K);

[0065] X2 is serine (S), alanine (A) or threonine (T);

[0066] X3 is isoleucine (I), leucine (L) or valine (V);

[0067] X4 is aspartic acid (D) or glutamine (Q);

[0068] X5 is alanine (A) or valine (V);

[0069] X6 is aspartic acid (D) or tyrosine (Y);

[0070] and X7 is lysine (K) or leucine (L).

[0071] Preferably, the endogenous surface protease in Streptococcus thermophilus has at least 70% and more preferably 90% identity with the sequence SEQ ID No. 2 and the endogenous surface protease in Lactococcus lactis has at least 70% and more preferably 80% identity with the sequence SEQ ID No. 3 or with the sequence SEQ ID No. 4.

[0072] Preferably, the method for preparing a weakly proteolytic Streptococcus thermophilus bacterium according to the invention further comprises the reduction or abolition in said bacterium of the expression and / or the activity of the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8 and / or of the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 9.

[0073] Preferably, the method for preparing a weakly proteolytic Lactococcus lactis bacterium according to the invention further comprises the reduction or abolition in said bacterium of the expression and / or the activity of the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 10 and / or of the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 11.

[0074] By "weakly proteolytic bacterium" is meant a bacterium exhibiting very low surface proteolysis compared to the parent bacterium from which it derives, i.e. estimated at less than 10% and preferably less than 5% of the proteolysis of the parent bacterium from which it derives.

[0075] The reduction of the expression and / or activity of these proteases can be carried out as described above.

[0076] The present invention also relates to a method for reducing or abolishing the proteolytic activity of proteases in a Gram-positive bacterium of the species Lactococcus lactis or Streptococcus thermophilus, comprising reducing or abolishing in said bacterium, the expression and / or the activity of an endogenous surface protease of said bacterium, said protease comprising an amino acid motif having at least 80%, and in ascending order preferably at least 82%, 86%, 91%, 95% or 100% identity with the sequence SEQ ID No. 1,

[0077] where SEQ ID No. 1 is defined as follows:

[0078] LA-GTGT-LE-X1-DG-X2-X3-G-X4-LG-G-X5-X6-X7-K

[0079] with

[0080] XI is histidine (H) or lysine (K);

[0081] X2 is serine (S), alanine (A) or threonine (T);

[0082] X3 is isoleucine (I), leucine (L) or valine (V);

[0083] X4 is aspartic acid (D) or glutamine (Q);

[0084] X5 is alanine (A) or valine (V);

[0085] X6 is aspartic acid (D) or tyrosine (Y);

[0086] and X7 is lysine (K) or leucine (L).

[0087] Preferably, the endogenous surface protease in Streptococcus thermophilus has at least 70% and more preferably 90% identity with the sequence SEQ ID No. 2 and the endogenous surface protease in Lactococcus lactis ... preferentially 80% identity with the sequence SEQ ID No. 3 or with the sequence SEQ ID No. 4.

[0088] Preferably, the method for decreasing or abolishing the proteolytic activity of proteases in a Streptococcus thermophilus bacterium further comprises decreasing or abolishing in said bacterium the expression and / or activity of the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8 and / or the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 9.

[0089] Preferably, the method for decreasing or abolishing the proteolytic activity of proteases in a Lactococcus lactis bacterium further comprises decreasing or abolishing in said bacterium the expression and / or activity of the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 10 and / or the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 11.

[0090] The present invention also relates to the use of a bacterium according to the present invention for the production of heterologous protein of interest, said bacterium being transformed by an expression vector containing a DNA fragment coding for the heterologous protein of interest or by integration of the DNA fragment of interest into the chromosome of said bacterium.

[0091] Among the heterologous proteins of interest, we can cite elafin which is an inhibitor of proteolytic activity. This activity is particularly sought after, notably for the treatment of chronic inflammatory bowel diseases, in which the activity of human proteases must be inhibited (Bermudez-Humaran et al., 2015). More generally, we can cite anti-inflammatory proteins targeting the mucosal immune system (cytokines, human trefoil factor TFF-1, etc.), vaccine proteins (fragment C of tetanus toxin, E7 antigen of the human papillomavirus, etc.), antibacterial peptides targeting imbalances in the intestinal flora (defensins, cathelidicins, PAP protein associated with pancreatitis), enzymes compensating for deficiencies or deficiencies (superoxide dismutase, phenylalanine hydroxylase, glutamate decarboxylase), etc. (Neirynck and Steidler, 2006; Bermudez-Humaran et al., 2013, Bermudez-Humaran and Langella, 2018).Proteins of interest in animal health (antiviral vaccine proteins, for example) or proteins of technological interest (esterase, aminotransferase, etc.) can also be considered.

[0092] Among the strains of bacteria used for the production of heterologous proteins of interest, mention may be made of the strains L. lactis and S. thermophilus.

[0093] Lactococcus lactis is considered the reference bacterium for the production of molecules of therapeutic interest. Its use has several advantages: This is a food bacterium whose safety is recognized (GRAS and QPS labeled bacterium), it is genetically manipulable and a deletion mutant of the gene coding for the HtrA protease is available. It was then demonstrated that the production of elafin by this mutant was higher than that of the wild strain, and that the treatment of mice with colitis by oral administration of the mutated strain was more effective than with the wild strain (Bermudez-Humaran et al., 2015).

[0094] Furthermore, Streptococcus thermophilus according to the invention also has numerous advantages: it is thermophilic, its optimum temperature corresponds to the human body temperature of 37°C, it is easily transformable and totally devoid of surface proteolytic activity, which avoids the degradation of the heterologous protein of interest as it is produced.

[0095] A particularly advantageous bacterium for the production of heterologous proteins of interest is a S. thermophilus bacterium as defined in the present invention.

[0096] The present invention also relates to a method for producing a heterologous protein, using a bacterium of the invention, as defined above.

[0097] The present invention also relates to the use of a bacterium according to the present invention as a milk pre-maturation ferment.

[0098] One of the problems that arises in dairy technology is the variation in the composition of milk in non-protein nitrogen (free amino acids and peptides). This is particularly marked during changes in the animals' diet, resulting in summer and winter milks with very different compositions. These variations in non-protein nitrogen composition are the cause of variations in the growth of lactic acid bacteria in the milk, this growth being closely dependent on the use of these non-protein nitrogen sources. These variations in growth result in a lack of reproducibility of fermentation times, which constitutes a difficulty for the dairy industries.

[0099] The use of a bacterium according to the present invention as a milk pre-maturation ferment makes it possible to abolish these variations. Indeed, in a first stage which corresponds to the pre-maturation stage, the usable non-protein nitrogen sources would be consumed, without surface proteases being able to hydrolyze the milk proteins and generate new non-protein nitrogen sources. In a second stage, the growth of the starter used to ferment the milk would only rely on its ability to hydrolyze caseins, carried by the proteases PrtP and PrtS, depending on the bacterium considered. Such an operation therefore has the effect of standardizing the growth of the starter, by abolishing the growth variations due to variations in the composition of the milk in non-protein nitrogen.

[0100] A particularly advantageous bacterium as a milk pre-ripening ferment is a strain of S. thermophilus as defined in the present invention.

[0101] The present invention will be better understood with the aid of the additional description which follows, which refers to the non-limiting examples illustrating the very low surface proteolytic activity of a bacterium according to the invention in which the 2 (strain CNRZ1066A / ztrAA5ter_ 1612) or 3 proteases (strain LMD9A / ztrAAprt5'A5ter_ 1612) as defined in the invention are inhibited, compared to the parent bacterial strain from which it is derived (strain CNRZ1066 or strain LMD9), as well as the appended figures:

[0102] [Fig-1] Effect of the inactivation of the two surface proteases PrtS and HtrA on the presence in the culture medium of peptides resulting from the degradation of surface proteins of S. thermophilus LMD9, present in the culture medium. Average of 3 experiments (in black), with standard deviation of the average (in gray).

[0103] [Fig.2] Alignment of the sequences of the three proteins STER_1612, YwdF and llmg_2442. The multiple alignment was performed with MUSCLE (v3.8) available on the EMBL-EBI server (http: / / www.ebi.ac.uk / Tools / msa / muscle / ). White characters on a black background indicate amino acids located inside the cell, italic characters correspond to the transmembrane fragment and black characters are located outside the cell (HMMTOP predictions). Amino acids potentially constituting the catalytic diad are highlighted in gray.

[0104] [Fig.3] Growth of S. thermophilus LMD9 wild-type strain and strain mutated for the three surface proteases PrtS, HtrA and STER_1612 (triple mutant) in a chemically defined medium (CDM) containing only free amino acids as a source of amino nitrogen.

[0105] [Fig.4] Effect of inactivation of the 3 surface proteases PrtS, HtrA and STER_1612 on the number of peptides resulting from the degradation of surface proteins of S. thermophilus LMD9. Average of 3 experiments (in black), with standard deviation of the average (in gray).

[0106] [Fig.5] Coverage of IL-10 and elafin proteins by the degradation fragments (peptides) identified in the corresponding culture media of S. thermophilus LMD9 (wild strain producing 1TL-10 or elafin respectively). In gray background, the regions of IL-10 and elafin proteins corresponding to the peptides identified in the culture media of S. thermophilus LMD9 are shown. These regions group together all the identified peptides. Cysteines (C) are indicated in bold.

[0107] [Fig.6] Immunodetection of elafin in the culture supernatant of S. thermophilus CNRZ1066 (wild strain and double mutant AhtrAASTER_1612).

[0108] [Fig.7] Effect of inactivation of surface proteolysis on elafin activity produced by S. thermophilus CNRZ1066 (wild-type strain in black and double mutant A htrAASTER_1612 in gray).

[0109] [Fig.8] Immunodetection of elafin produced by S. thermophilus CNRZ1066 (wild strain and double mutant AhtrAASTER_1612) and L. lactis IL1403 (wild strain and AhlrA mutant).

[0110] [Fig.9] Comparison of elafin activities produced by E. lactis IL1403A / ztM (denoted IL1403D) and S. thermophilus CNRZlQ66AhtrAASTER_1612 (denoted CNRZ1066DD). [YES] EXAMPLE 1: CONSTRUCTIONS OF MUTANTS OF THE STREPTOCOCCUS THERMOPHILUS BACTERIA STRAIN LMD9 AND OF THE STREPTOCOCCUS THERMOPHILUS BACTERIA STRAIN CNRZ1066

[0112] 1) Construction of the simple mutants AA trA, AprtS and ASTER_1612 beyond strain S. thermophilus LMD9

[0113] General principle

[0114] The single mutants AhlrA, AprtS and ASTER_1612 are constructed from the wild-type strain S. thermophilus LMD9 by gene replacement. The technique used consists of producing a PCR fragment associating three amplicons:

[0115] an upstream amplicon corresponding to a region located at the beginning of the gene to be replaced,

[0116] an antibiotic resistance cassette and

[0117] a downstream amplicon corresponding to a region located at the end of the gene to be replaced.

[0118] The three amplicons are produced separately and then combined via a final additional PCR. This combination is made possible by adding extensions to the oligonucleotides used to amplify the upstream and downstream regions that allow binding to the antibiotic resistance cassette (PCR overlap). This final PCR fragment is then introduced into the strain by natural competence (WO2010 / 125091). The homology between the upstream and downstream fragments of the gene and the PCR fragment allows recombination at the site of the gene to be replaced. Colonies whose targeted gene has been replaced by the resistance gene can easily be isolated on a medium containing the corresponding antibiotic.

[0119] Mutant AhtrA

[0120] A kanamycin resistance cassette is used. Upstream and downstream regions of the htrA gene were amplified separately by PCR from S. thermophilus LMD9 chromosomal DNA; kanamycin resistance cassette is amplified from the pKa plasmid (Trieu-Cuot et al., 1983) using oligonucleotide pairs htrA-upstream-F / htrA-upstream-R, htrA-downstream-F / htr-R-A and aphA3-F / aphA3-R, whose nucleotide sequences are shown in Table 1 .

[0121] [Tables 1] Oligonucleotide s Sequence SEQ ID N° htrA-amont-F GTA ATC ACG GTC ACC AAC C 16 htrA-amont-R GAC ATC TAA TCT TTT CTG AAG TAC ATC CGC A AC AGT AAA CCA CCT AGT AAG CC 17 htrA CTAF ATC ATC ATC ATC ATC AAG AAT GGT TCG CT G GGT AGT GTT CAG AAA GGT ATG CC 18 htrA-aval-R GGA TTG AGA TTT GAT CGT TG 19 aphA3-R GTT GCG GAT GTA CTT CAG 20 aphA3-F CCA GCG AAC CAT TTG AG 21

[0122] Table 1

[0123] The three fragments are amplified, purified on column with the PCR Clean- kit Up (Promega) and the expected sizes (480 bp, 580 bp and 1350 bp) are verified by agarose gel electrophoresis. An additional PCR associating the 3 fragments is carried out from the three fragments obtained and the oligonucleotides htrA-upstream-F and htrA-downstream-R to obtain a 2410 bp fragment which is purified on column and used to transform the LMD-9 strain according to the following natural transformation protocol. A first pre-culture is carried out during the day in M17 medium with 1% lactose (M171ac) (Terzagui et al., 1975) from a frozen stock of the strain; from which a second pre-culture in chemically defined medium (CDM) (Letort et al., 2001) is carried out overnight. This second pre-culture is used to inoculate a culture in MCD at an optical density at 600 nm (OD600) of 0.05. After 1 h of incubation at 42°C, the PCR product associating the three fragments is added to an aliquot of the culture.After incubation at 42°C, the culture aliquot is spread on M171ac agar plates containing 1 mg / ml of kanamycin. The plates are incubated for 48 hours at 42°C in an anaerobic jar. Several resistant clones are verified by colony PCR and one clone is then verified by sequencing.

[0124] Mutant AprtS

[0125] An erythromycin resistance cassette is used. The upstream and downstream regions of the ptrS gene were amplified separately by PCR from the chromosomal DNA of S. thermophilus LMD9; the erythromycin resistance cassette is amplified from the plasmid pG+host9 (Biswas et al., 1993) using the oligonucleotide pairs prtS-upstream-F / prtS-upstream-R, prtS-downstream-F / prtS-downstream-R and erm-F / erm-R, the nucleotide sequences of which are shown in Table 2.

[0126] [Tables2] Oligonucleotide s Sequence SEQ ID No. prtS-amont-F TGG TAA GCA CGT AGA CC 22 prtS-amont-R CTA CTG ACA GCT TCC AAG GAG CTA AAG T CC CAG GCT TGT CAA TTC ATC TG 23 prtS-aval-F GCA AGT CAG CAG CAC GAA CGA T CAC T GAA ATG G 24 prtS-aval-R CGT ATG CTT ACC AAC G 25 erm-F GGG ACC TCT TTA GCT CCT TGG 26 erm-R GGA GAT AAG ACG GTT CGT GTT CG 27

[0127] Table 2

[0128] The three fragments are amplified, purified on column and the expected sizes (660 bp, 650 bp and 1060 bp) verified. An additional PCR associating the 3 fragments is carried out from the three fragments obtained and the oligonucleotides prtS-upstream-F and prtS-downstream-R to obtain a fragment of 2370 bp which is purified on column and used to transform the LMD-9 strain according to the protocol described above. This culture is then spread on M171ac agar plates containing erythromycin (5 pg / ml) which are incubated for 48 hours at 42°C in an anaerobic jar. Several resistant clones are verified by colony PCR and one clone is then verified by sequencing.

[0129] Mutant &STER_1612.

[0130] A spectinomycin resistance cassette is used. The upstream and downstream regions of the STER_1612 gene are amplified separately by PCR from the chromosomal DNA of S. thermophilus LMD9; the spectinomycin resistance cassette is amplified from the plasmid pAT28 (Trieu-Cuot et al., 1990) using the oligonucleotide pairs STER_1612-upstream-F / STER_1612-upstream-R, STER_1612-downstream-F / STER_1612-downstream-R and spec-F / spec-R, the nucleotide sequences of which are shown in Table 3.

[0131] [Tables3] Oligonucleotide s Sequence SEQ ID No. STER_1612-amont-F CCC AAC AAC ACC AGG CTC ATT 28 STER_1612-amont-R GAA AAA TTC TAT AGA AAC TTC TCT CAA TT A GGC TAA GGC TGA TCC GGA TGC CAA 29 STER_1612-aval-F TAC AGA TTA ATA ATT ATT CTT TAT TAT ACA GAT CCA GAG TAA TTT CCA GTT GCC 30 STER_1612-aval-R TTC GAG GCC TAC GCA ATG CG 31 spec-F GAT CTG TAT AAT AAA GAA TA 32 spec-R AGC CTA ATT GAG AGA AGT TTC 33

[0132] Table 3

[0133] The three fragments are amplified, purified on column and the expected sizes (596 bp, 957 bp and 566 bp) verified. An additional PCR associating the 3 fragments is carried out from the three fragments obtained and the oligonucleotides STER_1612-upstream-F and STER_1612-downstream-R to obtain a fragment of 2050 bp which is purified on column and used to transform the LMD-9 strain according to the protocol described above. This culture is then spread on M171ac agar plates containing spectinomycin (150 pg / ml) which are incubated for 48 hours at 42°C in an anaerobic jar. Several resistant clones are verified by colony PCR and one clone is then verified by sequencing.

[0134] 2) Construction of the double mutant AhtrA AprtS of the strain S. thermophilus LMD9

[0135] The double mutant AhtrAAprtS is constructed from the single mutant AprtS by natural transformation using chromosomal DNA of the AhtrA mutant. After breaking the cells with glass beads, the chromosomal DNA of the AhtrA mutant is extracted with phenol-chloroform, then precipitated with ethanol. The mutant AprtS is transformed with the purified chromosomal DNA of the AhtrA mutant, following the same natural transformation protocol as described previously. Transformants are selected by plating on agar medium containing kanamycin (1 mg / ml). Some resistant clones are verified by colony PCR.

[0136] 3) Construction of the double mutants AhtrA ASTER _1612, AprtSASTER _1612 and the triple mutant AhtrA AprtSASTER 1612 of the strain S. thermophilus LMD9

[0137] The double mutants AhtrAASTER_1612, AprtSASTER_1612 and the triple mutant AhtrA AprtSASTER_1612 are obtained by natural transformation of the strains LMD9A / ztM, LMD9AprtS and LMD9 AhtrA AprtS with the PCR fragment containing the upstream and downstream regions of the STER_1612 gene fused to the spectinomycin resistance cassette used to construct the single mutant ASTER_1612 following the protocol described above. The protocol for selecting and controlling the mutants is that described for obtaining the single mutant LMD9ASTERI6I2.

[0138] 4) Construction of mutants of the strain S. thermophilus CNRZ1066

[0139] The general principle of the construction of the different mutants is identical to that described above, as well as the protocol used. Only the differences are indicated below.

[0140] In the case of single mutants, chromosomal DNA from strain CNRZ1066 is used as a template to amplify the upstream and downstream regions of the gene to be mutated. During natural transformation of strain CNRZ1066, strain competence is stimulated by adding ComS competence peptide (LPYFAGCL) at a concentration of 1pM for 10 minutes before adding the PCR fragment to the culture.

[0141] The double mutant CNRZ1066 AhlrA ASTER! 612 is obtained by transformation natural DNA from strain CNRZ1066ASTE7?_7672 with chromosomal DNA from strain CNRZ1066 AhtrA. Some mutants were checked by colony PCR.

[0142] EXAMPLE 2: DELETION OF THE TWO PROTEASES P RT S AND H TR A DOES NOT ABOLISH SURFACE PROTEOLYSIS IN THE BACTERIUM STRAIN STREPTOCOCCUS THERMOPHILUS LMD9

[0143] The LMD9 strain naturally produces the two surface proteases PrtS and HtrA. To evaluate their respective roles in the formation of the exopeptidome of the LMD9 strain, two single mutants AprtS and AhtrA and one double mutant AhtrAAprtS were constructed by natural transformation (WO2010 / 125091), following the protocol described in Example 1.

[0144] 1) Materials and methods: Determination of the exopeptidome of the strains

[0145] The exopeptidome of the strains thus obtained is determined under the same experimental conditions as that of the wild-type strain LMD9, as described below.

[0146] Cultivation of the strain

[0147] 50 ml of MCD whose concentration of aromatic amino acids (Phenylalanine, Tryptophan and Tyrosine) was reduced by a factor of 10 are seeded with 500 μl of overnight preculture in standard MCD and incubated at 42°C until OD60o = 1.0. The cells are then removed by centrifugation (5,000 rpm, 4°C; 10 minutes), the supernatant is filtered through a PVDF membrane with a porosity of 0.22 μm.

[0148] Isolation and concentration of peptides

[0149] The filtered culture supernatant is acidified with trifluoroacetic acid (TFA) to a final concentration of 0.1% (470 μl of a 10% TFA solution in 47 ml of culture supernatant), and stored overnight at 4°C.

[0150] The peptides present in the acidified supernatant are extracted by solid phase extraction (SPE) on a StrataX cartridge (Phenomenex) containing 200 mg of phase, at a flow rate of approximately 0.3 ml / min, according to the manufacturer's recommendations. The cartridge is first activated with 3 ml of methanol, then equilibrated with 6 ml of an aqueous solution containing 5% acetonitrile and 0.1% TFA. 1.75 ml of acetonitrile is added to 35 ml of acidified supernatant, so as to have a final acetonitrile concentration of 5% in the supernatant. 35 ml of the supernatant thus prepared is loaded onto the activated and equilibrated cartridge, at a flow rate of 0.3 ml / min. The cartridge is then washed with 5 ml of the aqueous solution containing 5% acetonitrile and 0.1% TFA, then the peptides are eluted with 1.5 ml of an aqueous solution containing 50% acetonitrile and 0.1% TFA. The eluate is dried for 16 to 18 hours by vacuum evaporation (speed vac system) then stored at -20°C.

[0151] The dried eluate containing the peptides is taken up with 350 μl of an aqueous solution containing 0.1% TFA (final concentration), which corresponds to a concentration factor of 100. The solubilization of the peptides is obtained by vortexing and passing for 5 minutes in an ultrasonic tank. The concentrated peptide solution is ultrafiltered through a membrane with a porosity of 3 kDa, by centrifugation for 1 h at 13000 rpm.

[0152] The peptides are then separated by HPLC on a reverse phase column (Kinetex C18 column (Phenomenex), porosity 100 Å, particle size 2.6 pm, dimension 150 x 4.6 mm) with a linear gradient (slope 1.6%) of acetonitrile in ammonium formate (20 mM, pH 6.2) at a flow rate of 0.7 ml / min and at a temperature of 40°C. The equivalent of 20 ml of culture (i.e. 200 μl of concentrated suspension) is injected onto the column. The fractions eluted between 3.2% and 53.3% acetonitrile are collected and dried using a speed vac.

[0153] Identification of peptides

[0154] Peptide identification is performed by mass spectrometry. The dried fractions are taken up in 30 μl of an aqueous solution containing 0.1% TFA and 2% acetonitrile, and a 4 μl fraction is loaded onto a Pepmap Cl8 column (150 x 0.075 mm, particle size 2 μm, porosity 100 Å). The peptides are eluted with a gradient of acetonitrile in formic acid (0.1%), and analyzed online by mass spectrometry (LTQ-Orbitrap Discovery, Thermo Fisher). Peptide ionization is performed by electrospray (1.3kV), and the analysis parameters of the ionized peptides are as follows: measurement of mass / charge ratios (m / z) from 300 to 1600 with a resolution of 15000 on the Orbitrap mass analyzer, and fragmentation of the 6 most abundant parent ions on the LTQ linear trap. Doubly charged peptides are subjected to fragmentation, with a 40-second exclusion window and conventional fragmentation parameters (collision energy: 35%).

[0155] The identification of peptides and the proteins from which they are derived is done with the XÎTandem search engine (version 2017.2.1.4) and the XÎTandem pipeline software suite (version 3.4.3, www.pappso.fr) using the protein sequence of the S. thermophilus LMD9 strain associated with a protein base of contaminants adapted to the analysis activity of the analysis platform (tryptic peptides from a sample of eukaryotic proteins containing in particular human keratins, bovine and murine proteins). The XÎTandem pipeline search parameters include the absence of tryptic cleavage for the identification of peptides, a minimum peptide per protein, identified with an E-value less than or equal to 0.01 and a mass tolerance of 10 ppm.

[0156] For each bacterial context (wild strain, single and double mutants), all peptides identified as surface peptides (i.e., peptide resulting from the degradation of a surface protein) are counted. When a peptide is identified several times (identification redundancy), each identification is considered (spectrum counting). Thus, a peptide identified once will have a count of 1, a peptide identified three times a count of three. The total number of surface peptides is totaled. Since these peptides are derived from surface proteins, they result from the surface proteolytic activity of the strain. The number of peptides counted is therefore an indicator of the intensity of surface proteolysis: the higher the count, the greater the degradation activity, and therefore the surface proteolysis. 2) Results

[0157] The results show that both proteases HtrA and PrtS are involved in the formation of the exopeptidome of S. thermophilus LMD9. In the double mutant, a reduction of more than half in the number of peptides resulting from the hydrolysis of surface proteins is observed ([Fig.l]). A statistical test adapted to small sample sizes (non-parametric Kruskal-Wallis test) indicates that this reduction is statistically significant ( P = 0.049). 3) Conclusion

[0158] The surface proteases HtrA and PrtS are not alone responsible for all the surface proteolytic activity of these strains.

[0159] EXAMPLE 3: IDENTIFICATION OF A NOVEL SURFACE PROTEASE IN STREPTOCOCCUS THERMOPHILUS LMD9

[0160] According to the MEROPS protease and peptidase specific database, the genome of S. thermophilus LMD9 is reported to contain 45 proteolytic enzymes (http: / / merops.sanger.ac.uk / cgi-bin / speccards?sp=sp000991;type=peptidase;strain=498). Analysis of the genome annotation of this strain (https: / / www.ncbi.nlm.nih.gov / genome / genomes / 420?) suggests the presence of additional proteases, resulting in a total of 52 proteins that may contain a proteolytic domain.

[0161] Of these, 11 are predicted to be localized on the cell surface according to the LocateP (http: / / www.cmbi.ru.nl / locatep-db / cgi-bin / locatepdb.py) or SecretomeP (http: / / www.cbs.dtu.dk / services / Secr etomeP / ) database. These include PrtS (STER_0846) (STER_RS04165) and HtrA (STER_2002) (STER_RS09790). The hypothesis pursued is that at least one of the remaining 9 proteases is involved in the surface proteolysis of S. thermophilus.

[0162] Among these nine proteases, six are present in L. lactis subsp. lactis IL1403 and L. lactis subsp. cremoris MG 1363 (Table 4).

[0163] [Tables4] LMD9 IL1403 MG1363 Protein Size (AAs) Protein Size % Identity Protein Size % Identity STER_01 13 415 DacA 435 181 / 432 ( 42%) DacA 434 159 / 402 ( 39%) STER_01 59 265 DacB 248 132 / 246 ( 54%) DacB 248 122 / 232 ( 52%) STER_02 60 775 Pbp2A 743 359 / 628 ( 57%) Pbp2A 743 260 / 472 ( 55%) STER_12 55 762 SrtA 287 134 / 255 ( 53%) SrtA 250 114 / 214 (53%) STER_16 12,345 YwdF 342 169 / 338 (50%) Llmg_244 2,343 147 / 318 (46%) STER_17 41,207 SipL 208 109 / 206 (53%) SipL 208 99 / 206 (4 8%)

[0164] Table 4

[0165] Peptides resulting from the degradation of three of these 6 proteases (STER_0260, STER_1612 and STER_1741) were identified in the exopeptidome of S. thermophilus LMD9, indicating that these putative proteases were synthesized under these growth conditions. Among these three proteins, STER_0260 is annotated as a D-Ala-D-Ala carboxypeptidase and STER_1741, as a signal peptide peptidase.

[0166] The protease STER_1612 (STER_RS07910) (annotated respectively YwdF in IL1403 and llmg_2442 in MG1363) therefore appears as the candidate protein to participate in the surface proteolysis of L. lactis and S. thermophilus. The presence of a transmembrane fragment in the N-terminal region (www.enzim.hu / hmmtop / ) is predicted for the protein of the 3 strains ([Fig.2]).

[0167] The synthesis of these predictions leads to the hypothesis that the STER_1612 protein would be a protease anchored to the cytoplasmic membrane whose active site would be oriented towards the external face of the membrane.

[0168] EXAMPLE 4: DELETION OF THE THREE PROTEASES PRTS, HTRA AND STER_1612 ABOLISHES THE DEGRADATION OF ENDOGENOUS SURFACE PROTEINS

[0169] The inventors hypothesized that the protease STER_1612 in the S. thermophilus strain LMD9 and its homologues in the L. lactis strains, IL1403 and MG1363, were involved in the formation of the exopeptidome of S. thermophilus and L. lactis. 1) Materials and Methods

[0170] Validation of this hypothesis was undertaken in the LMD9 strain, by constructing all single, double and triple mutants by natural transformation, following the protocol described in Example 1.

[0171] In the already constructed LMD9 wild-type, LMD9AHtrA, LMD9APrtS and LMD9AHtrAAPrtS strains, the ster _1612 gene was replaced by a spectinomycin resistance cassette. 2) Results

[0172] The growth of the strain mutated for the synthesis genes of the three surface proteases is not significantly affected in the culture medium used, a chemically defined medium containing only amino acids as a source of amino nitrogen (see [Fig.3]), so that any differences observed between the wild-type strain and the mutants cannot be attributed to a difference in growth between the strains.

[0173] Inactivation of just one of the three surface proteases reduces the number of peptides resulting from the proteolysis of surface proteins accumulated in the culture medium (exopeptidome surface peptides) by about a factor of 2. When all three proteases are inactivated, this reduction reaches a factor of 25, with only 24 peptides accumulated (average of three independent experiments; see [Fig. 4]). If we compare the number of peptides accumulated by the double mutant htrA_prtS and by the triple mutant prtS_htrA_ster_1216, the additional inactivation of the protease STER_1612 reduces it by a factor of 9. 3) Conclusion

[0174] Surface proteolysis is almost abolished in the triple mutant of S. thermophilus, representing only 5% of that of the wild-type strain, based on the number of peptides present in the exopeptidome.

[0175] EXAMPLE 5: EXTENSION TO OTHER STRAINS OF STREPTOCOCCUS THERMOPHILUS NOT POSSESSING THE PRTS PROTEASE 1) Materials and Methods

[0176] The role of the two surface proteases HtrA and STER_1612 on the surface proteolysis of S. thermophilus strains lacking the PrtS protease was evaluated using strain CNRZ1066 as a representative.

[0177] The double mutant CNRZlOôôA / ztrAAprtS is constructed by natural transformation following the experimental protocol described in Example 1. The exopeptidome of the wild strain CNRZ1066 and the mutant thus obtained are determined under the same experimental conditions as those described for strain LMD9 and its mutants (example 2). 2) Results

[0178] The exopeptidome of the wild-type strain CNRZ1066 contains 240 spectra (peptide counts) from surface proteins. That of the double mutant contains only 15 spectra from surface proteins. Based on the number of spectra identified, the residual surface proteolysis of the CNRZ1066 double mutant can be estimated at 6% of that of the wild-type strain, a reduction comparable to that obtained with the LMD9 strain. 3) Conclusion

[0179] Even though the strain only has the two surface proteases HtrA and STER_1612, inactivation of the genes encoding these two proteases is sufficient to reduce the surface proteolysis of the bacteria by more than 90%.

[0180] EXAMPLE 6: OBTAINING STREPTOCOCCUS STRAINS THERMOPHILUS PRODUCING A HETEROLOGOUS PROTEIN

[0181] 1) Obtaining strains of S. thermophilus producing IL-10 and elafin

[0182] The L. lactis LL-pLB350 and LBH832 strains contain the plasmids pLB350 (Hossain et al., 2012) and pLB386, respectively, which carry the genes encoding IL-10 and elafin, respectively, placed under the control of a bile salt-inducible promoter (pGroEL). The plasmids are extracted from these strains and purified using a commercial kit (Midikit, Quiagen).

[0183] The two plasmids pLB350 and pLB386 are then introduced into the wild strain S. thermophilus LMD9 and its triple mutant by natural competence, following the experimental protocol described in example 1.

[0184] Plasmid pLB386 is introduced into the wild-type strain CNRZ1066 and its surface protease mutant by natural competence.

[0185] Transformants are selected by plating on M17 agar medium containing 5 μg / ml of chloramphenicol.

[0186] The presence of the plasmid pLB350 is then verified by PCR on colonies using the two pairs of oligonucleotides pGroEL-F (ATAATGCCGACTGTACTTT of sequence SEQ ID No. 34) / IL-10-R (GGCCTTGTAGACACCTTGGTCTT of sequence SEQ ID No. 35) generating a band of 690 base pairs. That of the plasmid pLB386 is with the two pairs of oligonucleotides pGroEL-F and Elafin-R (TCACTGGGGAACGAAACAGGC of sequence SEQ ID No. 36) giving a band of 572 bp and that of the empty plasmid using the two oligonucleotides Cm-F (GTTCAACAAACGAAAATTGG of sequence SEQ ID No. 37) and Cm-R (TTATAAAAGCCAGTCATTAG of sequence SEQ ID No. 38) giving a band of 807 bp.

[0187] EXAMPLE 7: A NON-PROTEOLYTIC BACTERIA STRAIN IMPROVES THE PRODUCTION YIELD OF HETEROLOGOUS PROTEINS

[0188] 1) Inactivation of surface proteases reduces protein degradation heterologous * LMD9 strain

[0189] Materials and Methods

[0190] Two heterologous protein models were chosen, interleukin 10 (IL-10) and elafin. These two proteins are candidate proteins in the treatment of chronic inflammatory bowel diseases (Benbouziane et al., 2013 and Bermudez-Humaran et al., 2015). The plasmid carrying the gene encoding IL-10 was extracted from the lactococcus strain that contained it and introduced into the S. thermophilus LMD9 strain and its triple mutant lacking surface proteolytic activity by natural transformation, following the protocol described in Example 6. The same operation was carried out for the plasmid encoding elafin. 4 strains were thus obtained, two wild-type strains producing one IL-10, the other elafin and two protease mutants producing the same two heterologous proteins.

[0191] To evaluate the stability of IL-10 and elafin, the two pairs of wild-type and mutant strains carrying respectively the plasmid pLB350 and the plasmid pLB386 are cultured for 4 hours in MCD at 42°C. An equal-weight mixture of cholic acid and deoxycholic acid is then added to the culture medium, at a final concentration of 150 pg / ml. This addition aims to induce the expression of the genes controlled by the pGroESL promoter. After 15 minutes of induction at 42°C, the cells are eliminated by centrifugation and the peptides present in the culture supernatant are identified as indicated in Example 2. The only difference consists in the modification of the interrogation library, to which the sequence of IL-10 or elafin has been added, depending on the pair of strains considered.

[0192] Results

[0193] Several degradation fragments of heterologous proteins are detected in the culture medium of the wild-type strains, covering in total more than 30% of their respective sequence (see Table 5 and [Fig.5]). Under the same experimental conditions, no fragment is detected in the triple mutants. Therefore, the inactivation of the three surface proteases abolishes the degradation of the two heterologous proteins in S. thermophilus LMD9.

[0194] [Tables5] Wild strain Triple mutant protease Number of peptides from IL-10 9 0 Number of peptides from elafin 43 0

[0195] Table 5: Number of peptides resulting from the degradation of IL-10 or elafin, present in the culture medium of S. thermophilus LMD9 and its mutant of the three surface proteases PrtS, HtrA and STER_1612.

[0196] The results obtained with the two protein models being of the same nature, the rest of the work only focused on one model, elafin. * Strain CNRZ1066

[0197] The same experiments were conducted on the CNRZ1066 strain.

[0198] Materials and Methods

[0199] The plasmid encoding elafin is extracted from the lactococcus strain containing it, and introduced into the wild-type and mutant strains of CNRZ1066 by natural competence. To evaluate the stability of elafin, their degradation fragments are sought in the culture medium after 4 h of growth, following the same approach as that developed for the LMD9 strain.

[0200] Results

[0201] Thirty-six spectra from elafin are identified in the supernatant of the wild-type strain. The region of elafin covered by the degradation products is the same as in the case of the LMD9 strain, and represents 40% of the total sequence (see [Fig. 5]). Under the same experimental conditions, no elafin degradation fragment is detected in the double mutant.

[0202] Conclusion

[0203] No heterologous protein degradation fragment is found in the supernatant of a strain of S. thermophilus mutated for its surface proteases, whether or not this strain possesses the PrtS protease.

[0204] 2) The reduction in degradation of heterologous proteins is correlated with a increased production of intact protein

[0205] Since the results are comparable to the S. thermophilus strain having two or three surface proteases, the further work only concerns a single strain, CNRZ1066. Since no more elafin degradation fragments are detected in the supernatant of the double mutant, it is appropriate to ensure that the protein is indeed produced in this strain, and at a higher level than in the wild-type strain.

[0206] Materials and Methods

[0207] This verification was carried out by immunodetection of the whole elafin in the supernatant (since the protein is secreted into the external environment by the streptococcus strain), following the following experimental protocol.

[0208] The culture and induction of elafin production by the strains carrying the plasmid pLB386 are carried out as described in Example 6. After 15 min of induction, the cells are removed by centrifugation, and the supernatant containing the elafin is filtered through a 0.22 μm porosity filter (PVDF membrane with low protein adsorption). Ten ml of supernatant are concentrated by a factor of 20 by ultrafiltration through a 3 kDa cutoff membrane (Amicon ultracell 3k, MerckMillipore). Five μl of retentate are deposited on a polyacrylamide gel (pre-cast gel NuPAGE 4-12% Bis-Tris Gel, Invitrogen). After migration for 1 h at 110 mA and 200 V, the proteins are transferred onto a PVDF transfer membrane (Trans-Bot Turbo Mini transfer pack, Bio-Rad). Elafin, after being labeled with a mouse monoclonal anti-elafin antibody (SantaCruz Biotechnology), is detected by chemiluminescence (ECL Plus Western kit, Pierce).

[0209] Results

[0210] Several strains are used in these experiments, carried out several times and systematically giving the same results; illustrated for one of them in [Fig.6]:

[0211] The wild and mutated strains of S. thermophilus CNRZ1066 do not produce elafin (wells 3 and 4, marked pis vide). No bands are observed, indicating that none of the strains produce elafin (nor any protein that cross-reacts with the antibody directed against elafin).

[0212] The wild-type CNRZ166 strain producing elafin (well 5, noted WT pis elafin). Two bands are observed, the upper one of which migrates at a size very slightly smaller than that of the mature form of commercial elafin. The second migrates at a size significantly smaller, and would be a truncated form of elafin in the process of degradation,

[0213] Strain CNRZ1066 mutated for its surface proteases producing elafin (well 6, noted mutant pis elafin). The lower band corresponding to the truncated form of elafin is no longer detected, only the band corresponding to mature elafin is revealed.

[0214] Conclusion

[0215] Inactivation of surface proteolysis abolishes elafin degradation in S. thermophilus.

[0216] 3) Inactivation of surface proteases induces an increase in activity enzymatic carried by elafin

[0217] Materials and Methods

[0218] The activity of elafin accumulated in the supernatants of the wild-type and mutant CNRZ1666 strains is evaluated by determining the power of inhibition of the activity of a control human protease (elastase), following the protocol described below.

[0219] S. thermophilus strains carrying plasmid pLB386 are grown in MCD at 37°C to an OD60o of LO.

[0220] L. lactis strains carrying this same plasmid are cultured at 30°C in a lactococcus-specific MCD (Otto et al., 1983) to an OD600 of 1.0.

[0221] At this stage of growth, the cultures are centrifuged, and the cells resuspended in fresh MCD at a DO of 2.0.

[0222] Elafin production is obtained by induction with bile salts (15 ng / ml) and incubation overnight at 37°C. The cells are then centrifuged, and the elafin contained in the supernatant is concentrated by ultrafiltration by a factor of approximately 300.

[0223] Elafin is a protease inhibitor. It is therefore assayed according to the following principle. The activity of a human protease (elastase) is measured by fluorescence using a labeled substrate (EnzCheck® Elastae assay kit, Molecular Probes), in the presence and absence of supernatant containing elafin. The intensity of inhibition (reflecting the concentration of elastase) is measured by the difference in fluorescence between the measurement without and with elafin over time following the protocol supplied with the assay kit (Molecular Probes).

[0224] Results

[0225] The elafin activity produced by the strain lacking proteolytic activity increases approximately twice as fast as that produced by the wild-type strain ([Fig.7]).

[0226] Conclusion

[0227] Inactivation of surface proteolysis induces a doubling of the elafin activity produced by the strain.

[0228] EXAMPLE 8: THE PRODUCTION OF ELAFINE BY NON-PROTEOLYTIC BACTERIAL STRAINS OF THE INVENTION

[0229] Elafin production is evaluated for the L. lactis IL1403AHtrA strain and the S. thermophilus CNRZ1066AHtrAAster_1612 strain.

[0230] Materials and Methods

[0231] The two strains are cultivated to an identical population level, and the induction of elafin production is carried out under optimal conditions for each of the strains (see example 7 point 3)).

[0232] Results

[0233] The results obtained by immunodetection of the elafin produced by each of these strains show for the strain CNRZ1066, the presence of a band corresponding to the intact protein detected in the protease mutant and the wild-type strain, and a truncated form detected in the wild-type strain only. For strain IL 1403, truncated forms of elafin are still observed in the single mutant AHtrA ([Fig.8]).

[0234] Therefore, the absence of elafin degradation is only observed in S. thermophilus AHtrAASter_1612.

[0235] Furthermore, the results relating to the elafin activity produced by each of these strains show that this elafin activity is 5 to 10 times greater in S. thermophilus CNRZ1066AHtrAAster_1612 than in L. lactis IL1403AHtrA ([Fig.9]). REFERENCES

[0236] Benbouziane B. et al., J. Biotechnol., 2013, 168: 120-129

[0237] Bermudez-Humaran LG et al., Curr. Opinion. Microbiol., 2013, 16:278-283

[0238] Bermudez-Humaran LG et al., Microb. Cell Fact., 2015, 14:26

[0239] Bermudez-Humaran LG and Langella P., Nat. Biotechnol., 2018, 36:816-818

[0240] Biswas I. et al., J. Bacteriol., 1993, 175:3628-3635

[0241] Botos I. et al., J. Biol. Chem., 2004, 279:8140-8148

[0242] Bron PA et al., Cur. Opinion. Biotechnol., 2019, 56:61-68

[0243] Charrette MF et al., Proc. Natl. Acad. Sci., 1981, 87:4728-4732

[0244] Cossart P. and Joncquières R., Proc.Natl. Acad. Sci. USA, 2000, 97:5013-5015.

[0245] Delorme C. et al., Appl. Approximately. Microbiol., 2010, 76:451-460

[0246] Desvaux M. et al., Front. Microbiol., 2018, 9:100

[0247] Femandez-Espla MD et al., Appl. Environ. Microbiol., 2000, 66:4772-4778

[0248] Gardan R. et al., J. Bacteriol., 2009, 191:4647-4655

[0249] Gottesman S. et al., J. Bacteriol., 1978, 133:844-851

[0250] Guillot A. et al., J. Proteome Res., 2016, 15:3214-3224

[0251] Hossain MS et al., J. Bacteriol., 2012, 194:5886-5896

[0252] Letort J. et al., J. Appl. Microbiol., 2001, 91:1023-1029

[0253] Motta JP et al., Sci. Trans. Med., 2012, 4:158ral44

[0254] Neirynck S. et Steidler L., Biotechnol. Genet. Eng. Rev., 2006, 22:253-266.

[0255] Otto R. et al., FEMS Microbiol. Lett., 1983, 16: 69-74.

[0256] Poquet I. et al., Mol. Microbiol., 2000, 35:1042-1051

[0257] Shamsi TN et al., Int. J. Biol. Macromol., 2016, 91:1120-1133.

[0258] Siezen R. et al., Ant. Leeuwenhoek., 1999, 76:139-155

[0259] Soualmia et El Amri, 2018. Expert Opin. Ther. Pat. 28:93–110

[0260] Terzagui BE et al., Appl. Microbiol., 1975, 29:807-813

[0261] Trieu-CuotP. et al., Gene, 1983, 23:331-341

[0262] Trieu-Cuot P. et al., Nucleic Acids Res., 1990, 18: 4296

[0263] Wei J. et al., J. Genet. Genomics, 2013, 40:281-289

Claims

Claims

1. A Gram-positive bacterium of the species Streptococcus thermophilus or Lactococcus lactis such that the endogenous surface protease comprising an amino acid motif and having at least 80% identity with the sequence SEQ ID No. 1, has an expression and / or activity that is reduced or abolished by mutagenesis or by the use of specific inhibitors of serine proteases or by the use of a strain such that the gene encoding said protease is absent or present in a truncated form, wherein SEQ ID No. 1 is defined as follows: IAGTGTIE-X1-DG-X2-X3-G-X4-IGG-X5-X6-X7-K with XI being histidine (H) or lysine (K); X2 being serine (S), alanine (A) or threonine (T); X3 is isoleucine (I), leucine (L), or valine (V); X4 is aspartic acid (D) or glutamine (Q); X5 is alanine (A) or valine (V); X6 is aspartic acid (D) or tyrosine (Y); and X7 is lysine (K) or leucine (L).

2. Bacteria according to claim 1, characterized in that the Gram-positive bacterium is a Streptococcus thermophilus and the endogenous surface protease whose expression and / or activity is reduced or abolished has at least 70% identity with the sequence SEQ ID No. 2 of Ster_1612 when the sequences are aligned over their entire length.

3. A bacterium according to claim 2, further characterized in that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8 of HtrA or in that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 9 of PrtS has an expression and / or activity reduced or abolished by mutagenesis or by use of specific inhibitors of serine proteases or by use of a strain such that the gene encoding said protease is present in a truncated form.

4. A bacterium according to claim 2, further characterized in that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 8 of HtrA and in that the endogenous surface protease having at least 70% identity with the sequence SEQ ID PrtS No. 9 has decreased or abolished expression and / or activity by mutagenesis or by use of specific serine protease inhibitors or by use of a strain such that the gene encoding said protease is present in a truncated form.

5. A bacterium according to claim 1, further characterized in that the Gram-positive bacterium is a Lactococcus lactis and the endogenous surface protease whose expression and / or activity is reduced or abolished has at least 70% identity with the sequence SEQ ID No. 3 of Ywdf or with the sequence SEQ ID No. 4 of llmq 2442 when the sequences are aligned over their entire length.

6. A bacterium according to claim 5, further characterized in that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 10 of HtrA or in that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 11 of PrtP has an expression and / or activity reduced or abolished by mutagenesis or by use of specific inhibitors of serine proteases or by use of a strain such that the gene encoding said protease is present in a truncated form.

7. A bacterium according to claim 5, further characterized in that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 10 of HtrA and in that the endogenous surface protease having at least 70% identity with the sequence SEQ ID No. 11 of PrtP has an expression and / or activity reduced or abolished by mutagenesis or by use of specific inhibitors of serine proteases or by use of a strain such that the gene encoding said protease is present in a truncated form.

8. A bacterium according to any one of claims 1 to 7, modified to express a heterologous protein of interest, said bacterium containing an expression vector containing a DNA fragment encoding the heterologous protein of interest or by a DNA fragment encoding the heterologous protein of interest inserted into its chromosome.

9. A method for preparing a weakly proteolytic bacterium, comprising a step of mutagenesis or use of specific inhibitors of serine proteases or use of a strain such that the gene encoding said protease is present in a truncated form for the abolition or reduction in said bacterium of the expression and / or activity of the endogenous surface protease of said bacterium comprising an amino acid motif having at least 80% identity with the sequence SEQ ID No. 1; where SEQ ID No. 1 is defined as follows: IAGTGTIE-X1-DG-X2-X3-G-X4-IGG-X5-X6-X7-K with XI is histidine (H) or lysine (K); X2 is serine (S), alanine (A) or threonine (T); X3 is isoleucine (I), leucine (L) or valine (V); X4 is aspartic acid (D) or glutamine (Q); X5 is alanine (A) or valine (V); X6 is aspartic acid (D) or tyrosine (Y); and X7 is lysine (K) or leucine (L).

10. Use of a bacterium as defined in claim 8, for the production of heterologous protein of interest, said bacterium being transformed by an expression vector containing a DNA fragment encoding the heterologous protein of interest or by a DNA fragment encoding the heterologous protein of interest inserted into its chromosome.

11. Use of a bacterium as defined in any one of claims 1 to 7, as a milk pre-maturation ferment.

Images