New healing active ingredient and its use
A polypeptide derived from the C-terminal region of the GPRC5A protein enhances keratinocyte mobility to accelerate wound healing and reduce infection risk by promoting cellular adhesion loss and migration.
Patent Information
- Application Number
- FR2022004336
- Authority / Receiving Office
- FR · FR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-05-06
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2042-05-06
AI Technical Summary
Existing wound healing processes are vulnerable to invasions by pathogenic organisms and foreign substances, and there is a need to promote wound closure effectively to prevent infection.
A polypeptide derived from the C-terminal region of the GPRC5A protein, comprising a specific sequence of less than 60 amino acids, is used to enhance keratinocyte mobility and re-epithelialization by promoting cellular adhesion loss and migration.
The polypeptide accelerates wound healing by facilitating keratinocyte migration and re-epithelialization, reducing the risk of infection and enhancing wound closure.
Smart Images

Figure 00000029_0000 
Figure 00000029_0001 
Figure 00000029_0002
Abstract
Description
Title of the invention: New healing active ingredient and its use Field of invention
[0001] The present invention relates to a new peptide active ingredient and its use for promoting healing. State of the art
[0002] The epidermis, also known as the interfollicular epidermis (IFE), forms the outermost layer of the skin, which is made up of 90% keratinocytes. The remaining 10% is made up of melanocytes, cells responsible for skin pigmentation and photoprotection from ultraviolet rays, Langerhans cells, immune cells, and Merkel cells, sensory cells of the epidermis.
[0003] Keratinocytes express and synthesize different structural and lipid proteins during their maturation. Keratinocytes at the level of the basal layer give rise to cells that will begin a process of terminal differentiation during which they undergo a large number of morphological modifications and gene expressions. This outward-oriented differentiation leads to the stratification of the epidermis and thus gives rise to 4 distinct layers: the basal layer, the spinous layer, the granular layer and the horny layer.
[0004] The interfollicular epidermis is the site of a continuous renewal process, which process is ensured by epidermal stem cells at the level of the basal layer. Within this layer, keratinocytes proliferate and then end up exiting the cell cycle, leaving the basal layer and migrating into the suprabasal layers to differentiate. To ensure constant renewal and therefore homeostasis of the epidermis, a fine balance between the processes of proliferation and differentiation is essential.
[0005] In the case of a skin injury, the healing process will require a series of precisely controlled events within the epidermis and dermis. Healing is thus divided into four phases: hemostasis, inflammation, proliferation and remodeling.
[0006] In connection with hemostasis, a fibrin-platelet clot is formed immediately after injury, which clot constitutes a temporary matrix composed of fibrin, fibronectin, vitronectin and thrombospondin. This matrix serves as a reservoir of growth factors and as a scaffolding structure for the migration of immune cells, keratinocytes, fibroblasts and endothelial cells.
[0007] The presence of chemical mediators leads, during the inflammatory phase, to the recruitment of immune cells such as neutrophils and monocytes, at the level of the lesion area, ensuring the cleaning of the wound. These cells are responsible for the synthesis of numerous cytokines which help to amplify the immune response and stimulate the formation of granulation tissue.
[0008] A proliferation phase follows during which fibroblasts proliferate and migrate towards the center of the wound. Once in place, they will synthesize and remodel a new extracellular matrix (ECM). In parallel, neoangiogenesis takes place, which has been triggered by the migration and reorganization of surrounding endothelial cells. All these changes lead to the differentiation of fibroblasts into myofibroblasts and the formation of granulation tissue. This results in an increase in mechanical properties which, under the influence of surrounding growth factors, induces the active multiplication of keratinocytes and their migration from the edge of the banks towards the center of the wound. Once the area is covered with a monolayer of keratinocytes, the keratinocytes differentiate to give rise to a new stratified epithelium.
[0009] Finally, the ECM is progressively remodeled, due to a balance between its degradation by matrix metalloproteinases (MMPs) and the synthesis of its constituents. The vascular network changes as the granulation tissue disappears and gives way to more or less fibrous scarring. The aim of this phase is to obtain a tissue with a structure and function as close as possible to the original tissue.
[0010] The wound closure process, corresponding to contraction then re-epithelialization, excluding remodeling, can last for a period of a few days to a few weeks depending on the extent of the wound and the physiopathological state of the individual.
[0011] During this period, whether short or long, the wound can be subject to all types of invasions (pathogenic organisms or foreign substances) until the regeneration of a new epidermis which completely closes the breach.
[0012] To prevent infection, the wound is usually treated to remove any contaminants that could introduce pathogenic material into the injured area. Tissue debridement and sanitization are then performed in the area. In some cases, a number of stitches are also performed to facilitate wound closure. Once these steps have been completed, the wound is maintained in an environment conducive to healing. To achieve this, different types of dressings are used to prevent the intrusion of pathogens and / or their proliferation.
[0013] It is therefore important, when treating a wound, to promote the phenomenon of its closure in order to avoid, for example, the invasion of the wound by microorganisms or foreign substances and, consequently, the infection of this same wound. Summary of the invention:
[0014] In order to induce or accelerate wound healing, a certain number of active ingredients capable of acting at different levels and at different phases of healing can be administered.
[0015] Now, the inventors have discovered that a polypeptide derived from the C-terminal region of the GPRC5A protein (G protein-coupled receptor class C group 5 member A) has the capacity, like the entire GPRC5A protein, to induce the loss of adhesion of keratinocytes and, as a result, to facilitate their cellular mobility within the wound and, as a result, re-epithelialization.
[0016] Consequently, a first subject of the invention relates to a polypeptide whose size is less than or equal to 60 amino acids and which comprises the sequence chosen from the C-terminal sequence of the GPRC5A protein ranging from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1), its orthologs, their fragments or their derivatives.
[0017] A second subject of the invention relates to a polynucleotide (DNA or RNA) coding for a polypeptide as described previously.
[0018] A third subject of the invention relates to a vector comprising the polynucleotide as described above.
[0019] A fourth object of the invention relates to a cell transformed by a vector as described previously.
[0020] A sixth subject of the invention relates to a composition comprising such a polypeptide.
[0021] A seventh object of the invention relates to a dressing comprising such a composition.
[0022] An eighth object of the invention relates to a pharmaceutical composition comprising such a polypeptide and a pharmaceutically acceptable carrier.
[0023] A ninth subject of the invention relates to a composition comprising such a polypeptide for its use in promoting and / or accelerating the healing of a lesion of an epithelium in a subject, preferably in promoting and / or accelerating re-epithelialization. Brief description of the drawings
[0024] [Fig.l] represents an alignment of the sequence going from residue 321 to 357 of the GPRC5A sequence of Homo sapiens (SEQ ID NO: 2), with the corresponding sequences of GPRC5A of Mus musculus (SEQ ID NO: 5), of Camelus bactrianus (SEQ ID NO: 6), of Felis catus (SEQ ID NO: 7), of Canis lupus familiaris (SEQ ID NO: 8), Talpa occidentalis (SEQ ID NO: 9), Halichoerus grypus (SEQ ID NO: 10), Tursiops truncatus (SEQ ID NO: 11), Loxodonta africana (SEQ ID NO :12), of Gallus gallus (SEQ ID NO : 13), of Cygnus olor (SEQ ID NO :14), of Ap-tenodytes patagonicus (SEQ ID NO :15), of Haliaeetus leucocephalus (SEQ ID NO :16), of Chelonia mydas (SEQ ID NO :17), of Trache eleganys de script (SEQ ID NO :18), of ID NO :18), Pseudonaja textilis (SEQ ID NO :19), Python bivittatus (SEQ ID NO :20) and Ranitomeya imitator (SEQ ID NO :21).
[0025] [Fig.2] represents an alignment of the sequence ranging from residue 321 to 357 of the sequence of GPRC5A of Homo sapiens (SEQ ID NO :2), with the corresponding sequences of GPRC5A of Mus musculus (SEQ ID NO: 6), of Camrian: ba ID: Felis catus (SEQ ID NO :7), Canis lupus familiaris (SEQ ID NO :8), Palpa occidentalis (SEQ ID NO :9), Halichoerus grypus (SEQ ID NO :10), Tursiops truncatus (SEQ ID NO :11) and Loxodonta africana (SEQ ID NO :12).,
[0026] [Fig.3] shows the result of an adhesion test for primary keratinocytes and immortalized N / TERT-1 keratinocytes, whose GPRC5A gene has been partially invalidated or not.
[0027] [Fig.4] shows the result of a cell migration test for primary keratinocytes and immortalized N / TERT-1 keratinocytes, whose GPRC5A gene has been partially invalidated or not.
[0028] [Fig.5] shows the relocalization of the C-terminal region of GPRC5A to the nucleus in primary keratinocytes.
[0029] [Fig.6] shows the electrophoretic profiles of a recombinant polypeptide mimicking the C-terminal region of GPRC5A and its cleavage sites.
[0030] [Fig.7] shows the effects of the recombinant polypeptide on the migration and adhesion of N / TERT-1 cells partially invalidated for the GPRC5A gene. Description of the embodiments
[0031] Advantageously, the polypeptide according to the invention will have a length less than or equal to 50 amino acids, preferably less than or equal to 40 amino acids.
[0032] Advantageously, the polypeptide according to the invention will have a size of between 20 and 60 amino acids, preferably between 25 and 50 amino acids. According to a particular embodiment, the polypeptide according to the invention will have a size of 25 to 40 amino acids.
[0033] The protein GPRC5A (G protein-coupled receptor class C group 5 member A), also known as RAI3; TIG1; RAIG1; GPCR5A and PEIG-1, belongs to the family of G protein-coupled receptors type 3 and contains their characteristic transmembrane domain (with 7 segments). This protein is involved in the interaction between the retinoid acid signaling pathways and that of the G protein.
[0034] The sequence of the GPRC5A protein in different species of animals, in particular mammals, reptiles, amphibians or birds, is part of the general knowledge of those skilled in the art. Therefore, those skilled in the art will be able to identify simply and without difficulty the orthologs of the fragment ranging from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1).
[0035] Examples of mammalian sequences include the Homo sapiens GPRC5A sequence (NP_003970.1) and its orthologs in other mammalian species including Mus musculus (NP_852109.2), Camelus bactrianus (XP_010944750.1), Felis catus (XP_019690106.1), Canis lupus familiaris (XP_038294887.1), Talpa occidentalis (XP_037370212.1), Halichoerus grypus (XP_035967917.1), Tursiops truncatus (XP_033722915.1), and Loxodonta africana (XP_023410262.1).
[0036] Examples of bird sequences include the GPRC5A sequence of Gallus gallus (XP_040516431.1), Cygnus olor (XP_040411303), Aptenodytes patagonicus (KAF1666521.1), and Haliaeetus leucocephalus (XP_010564139.1).
[0037] As an example of reptile sequences, we can cite the GPRC5A sequence of Chelonia mydas (XP_043400668.1), of Trachemys scripta elegans (XP_034630427.1), of Pseudonaja textilis (XP_006024224.1), of Python bivittatus (XP_025019164.1).
[0038] As an example of amphibian sequences, we can cite the sequence of GPRC5A of Ranitomeya imitator (CAF4926718.1).
[0039] The conservation of sequences of the C-terminal fragment of the GPRC5A protein between species appears clearly in view of [Fig.l] which shows an alignment of all the sequences described previously.
[0040] This conservation made it possible to determine a consensus sequence.
[0041] Advantageously, the polypeptide according to the invention comprises the sequence XiX2HX3 qx4x5x6x7x8x9x10x11x12fsiprx13 x14x15x16x17spyx18x19y x20x21x22x23x24x25x26 (SEQ ID NO: 3), their fragments and their derivatives;
[0042] In which:
[0043] X! is S, A or Y;
[0044] X2 is T, A or P;
[0045] X3 is F or L;
[0046] X4 is M or L;
[0047] X5 is Q, K or E;
[0048] X6 is N, T or S;
[0049] X7 is Q, H, R, L or I;
[0050] X8 is P, N, T, A, S, D, K, E or no amino acid;
[0051] X9 is P, S, A, T or no amino acid;
[0052] X10 is Q, P, K or R;
[0053] XnestK, R, N, QouE;
[0054] X12 is E, D or N;
[0055] Xn is A or P;
[0056] X14 is H, Q or K;
[0057] X15 is S, A, T or no amino acid;
[0058] Xi6 is W, P, R, H, Q or no amino acid;
[0059] X17 is P, A, T, V or L;
[0060] X18 is K, N, S, H, Q or E;
[0061] X19 is D, N or E;
[0062] X20 is E, T, S or A;
[0063] X21 is V or G;
[0064] X22 is K, R or G;
[0065] X23 is K, N or Q;
[0066] X24 is E, G, D or V;
[0067] X25 is G, D, V, P, T or I; and
[0068] X26 is S, M or K.
[0069] As used herein, the term "amino acid" refers to the 20 naturally occurring standard amino acid residues (G, P, A, V, L, I, M, C, F, Y, W, H, K, R, Q, N, E, D, S, and T), rare naturally occurring amino acid residues (e.g., hydroxyproline, hydroxylysine, allohydroxylysine, 6 N-methylysine, N-ethylglycine, N-methylglycine, N-ethylasparagine, alloisoleucine, N-methylisoleucine, N-methylvaline, or aminobutyric acid), and unnatural amino acids (e.g., norleucine, norvaline, and cyclohexylalanine). Preferably, this term refers to the 20 naturally occurring standard amino acid residues (G, P, A, V, L, I, M, C, F, Y, W, H, K, R, Q, N, E, D, S and T).
[0070] L and D isomers of amino acids are contemplated. Indeed, D isomers are not sensitive to proteases and the polypeptide according to the present invention also comprises molecules comprising D amino acids, in particular polypeptides comprising only or essentially D amino acids. In a particular embodiment, L amino acids are preferred.
[0071] Typically, the polypeptide according to the invention will comprise a sequence chosen from the sequences SEQ ID NO: 2 and SEQ ID NO: 5 to SEQ ID NO: 21, their fragments and their derivatives.
[0072] Advantageously, the polypeptide comprises the sequence XiTHFQLQNX2X3 X4X5KX6FSIPRA XvXsXçXwSPYXnXnY EX13X14KX15X16S (SEQ ID NO: 4), their fragments and their derivatives;
[0073] In which:
[0074] X! is S or A;
[0075] X2 is Q, H or R;
[0076] X3 is P, N, T, A, S or no amino acid;
[0077] X4 is P, S, A or no amino acid;
[0078] X5 is Q or P;
[0079] X6 is E, D or N;
[0080] X7 is H or Q;
[0081] X8 is S, A, T or no amino acid;
[0082] X9 is W, P, R or no amino acid;
[0083] X10 is P, A, T or V;
[0084] XnestK, N or S;
[0085] X12 is D or N;
[0086] X13 is V or G;
[0087] X14 is K or R;
[0088] X15 is E, G or D; and
[0089] X16 is G, D or V.
[0090] Typically, the polypeptide according to the invention will comprise a sequence chosen from the sequences SEQ ID NO: 2 and SEQ ID NO: 5 to SEQ ID NO: 12, their fragments and their derivatives.
[0091] Preferably, the polypeptide according to the invention will comprise a sequence chosen from the sequence SEQ ID NO: 2, its fragments and its derivatives.
[0092] The sequence alignments (see [Fig.l]) also show less conservation at both ends of the sequence from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO:1). At the C-terminal end, it is thus observed that the residues corresponding to those present at positions 321 and 322 of the human GPRC5A protein (SEQ ID NO:1) are not necessarily conserved. Furthermore, it is possible that the conservation between residues 323 and 328 is necessary only for the efficient cleavage of the C-terminal end of GPRC5a. Therefore, maintaining this sequence in a fragment to obtain a functional polypeptide would not necessarily be necessary and it would only be essential to maintain the sequence from residue 335. Similarly, and at the C-terminal end, it is observed that the residues corresponding to those present at positions 351 to 357 of the human GPRC5A protein (SEQ ID NO: 1) are not necessarily conserved.
[0093] Consequently, fragments are understood to mean the sequences ranging from residue 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334 or 335 to residue 350, 351, 352, 353, 354, 355, 356 or 357 of the human GPRC5A protein (SEQ ID NO: 1) or their orthologs, with the natural exception of the sequence ranging from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1) and its orthologs.
[0094] By derivative is meant a sequence which has a percentage identity of at least 80% with the sequence from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1), with the orthologous sequences thereof, with the sequence SEQ ID NO: 3 with the sequence SEQ ID NO: 4 or with the sequences of their fragments, preferably an identity of at least 85% and, particularly preferably, an identity of at least 90% with these sequences.
[0095] By percentage identity between two polypeptide sequences is meant the percentage of identical amino acids, between two sequences to be compared, obtained with the best possible alignment of said sequences. This percentage is purely statistical and the differences between the two sequences are distributed randomly over the entire length of the amino acid sequences. By best possible alignment or optimal alignment is meant the alignment allowing the highest percentage identity to be obtained. Sequence comparisons between two amino acid sequences are usually carried out by comparing said sequences after they have been aligned according to the best possible alignment; the comparison is then carried out on comparison segments so as to identify and compare regions of similarity.The best possible alignment for comparison can be achieved using the global homology algorithm developed by Smith and Waterman (Ad. App. Math., vol.2, p:482, 1981), using the local homology algorithm developed by Neddleman and Wunsch (J. Mol. Biol., vol.48, p:443, 1970), using the similarity method developed by Pearson and Lipman (Proc. Natl. Acd. Sci. USA, vol.85, p:2444, 1988), using computer programs based on such algorithms (GAP, BESTFIT, BLAST P, BLAST N, FASTA, TFASTA, Genetics Computer Group, 575 Science Dr., Madison, WI USA), using the MUSCLE multiple alignment algorithms (Edgar, Robert C., Nucleic Acids Research, vol. 32, p:1792, 2004). To obtain the best possible alignment, the BLAST program should preferably be used with the BLOSUM 62 matrix or the PAM 30 matrix.The percentage of identity is determined by comparing the two optimally aligned sequences, said sequences may include additions or deletions with respect to the reference sequence in order to obtain the best possible alignment between these two sequences. The percentage of identity is calculated by determining the number of identical positions between the two sequences, dividing the number obtained by the total number of positions compared and multiplying the result obtained by 100 to obtain the percentage of identity between these two sequences.
[0096] The amino acids of these derivatives which do not correspond to those present within the reference sequences correspond to substitutions.
[0097] The term "substitution" as used herein refers to the replacement of one amino acid residue with another selected from the 20 naturally occurring standard amino acid residues, rare naturally occurring amino acid residues, and unnaturally occurring amino acids. Preferably, the term "substitution" refers to the replacement of one amino acid residue with another selected from the 20 naturally occurring standard amino acid residues (G, P, A, V, L, I, M, C, F, Y, W, H, K, R, Q, N, E, D, S, and T). The substitution(s) may be conservative or non-conservative substitutions. The term "conservative substitution" as used herein refers to a substitution of one amino acid residue with another that has similar chemical or physical properties (size, charge, or polarity). Examples of conservative substitutions are shown in the following tables.
[0098] Advantageously, the substitutions within these derivatives are located at only positions Xi to X26 within the consensus sequence SEQ ID NO: 3, preferably at only positions Xi to Xi6 within the consensus sequence SEQ ID NO: 4.
[0099] Optionally, the polypeptide according to the invention may further comprise other peptide sequences, whether on the N-terminal side and / or on the C-terminal side.
[0100] The polypeptide according to the invention may also comprise at the N-terminus a tag (or label) useful for the purification or immobilization of the polypeptide. Such tags are well known to those skilled in the art and include, for example, histidine (His6), FLAG, HA (epitope derived from the hemagglutinin of the influenza virus), MYC (epitope derived from the human proto-oncoprotein MYC) or GST (glutathione-S-transferase) tags. Optionally, the polypeptide may comprise a cleavage site by a protease or a chemical agent making it possible to remove this tag.
[0101] The polypeptide may also comprise an element facilitating the cellular penetration of the molecule, preferably at its C-terminal end. In particular, this element is a peptide facilitating the cellular penetration of the molecule (CPP element). These peptides are well known to those skilled in the art (for example, VIVES et al, Biochimica et Biophysica Acta, vol. 1786, p: 126-138, 2008). For example and without limitation, the peptide facilitating cellular penetration may be selected from the group consisting of a Tat peptide, an antennapedia or penetratin peptide, and a peptide rich in arginine and lysine.
[0102] Preferably, the polypeptide according to the invention comprises a sequence rich in arginine and lysine at its C-terminal end so as to promote nuclear localization. Advantageously, the polypeptide according to the invention does not comprise all or part of residues X22 to X26 of SEQ ID NO: 3 or all or part of the sequence EX^Xu KXi5Xi6S of SEQ ID NO: 4 (SEQ ID NO: 22), since it comprises a sequence rich in arginine and lysine at its C-terminal end.
[0103] Furthermore, the peptide bond(s) of the polypeptide according to the present invention may be modified to make them resistant to proteolysis. For example, at least one peptide bond (-CO-NH-) may be replaced by a divalent bond selected from (-CH2-NH-), (-NH-CO-), (-CH2-O-), (-CH2-S-), (-CH2-CH2-), (-CO-CH2-), (-CHOH-CH2-), (N=N-), and (-CH=CH-). Optionally, all of the peptide bonds may be replaced.
[0104] The polypeptide according to the invention may comprise either a carboxylic (-COO) or amidated (-CONH2) C-terminal end. The polypeptide according to the invention may also be modified at its N-terminal end, for example by the addition of an acetyl radical.
[0105] The invention also relates to salts of said polypeptide, preferably pharmaceutically or veterinarily acceptable salts. A pharmaceutically or veterinarily acceptable salt is a salt which does not exhibit significant toxicity at the dose at which it is used. The salts may be, for example, salts with acceptable mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid and phosphoric acid; salts with acceptable organic acids such as acetic acid, citric acid, maleic acid, malic acid, succinic acid, ascorbic acid and tartaric acid; salts with acceptable mineral bases such as sodium, potassium, calcium, magnesium or ammonium salts; or salts with organic bases which have salifiable nitrogen. These salts are commonly used and their methods of preparation are well known to those skilled in the art.
[0106] There are many causes of instability or degradation of polypeptides such as hydrolysis and denaturation, which can lead to a decrease in the induction of the humoral or cellular response.
[0107] Consequently, and in a composition, the polypeptide according to the invention will advantageously be associated with at least one stabilizer to reduce or prevent such stability problems.
[0108] Examples of stabilizers include monosaccharides, disaccharides, polysaccharides, ionic and non-ionic detergents, alkali metal salts, phospholipids, fatty acids, polyols and stabilizing peptides such as bovine serum albumin.
[0109] Advantageously, the composition according to the invention is a topical composition.
[0110] As used herein, the term "topical composition" refers to a composition that is applied externally to any part of the body except mucous membranes such as the eyes, mouth, etc. The topical composition may, thus, be applied to any part of the body except mucous membranes such as the eyes, mouth, etc.
[0111] As such, the composition according to the invention takes the form of an ointment, a cream, lotion or gel.
[0112] Generally, the composition according to the invention may comprise numerous types of adjuvants or active ingredients used in cosmetic formulations, whether fatty substances, organic solvents, thickeners, gelling agents, softeners, antioxidants, opacifiers, stabilizers, foaming and / or detergent surfactants, emollients, superfatting agents, perfumes, ionic or non-ionic emulsifiers, fillers, sequestering agents, chelators, preservatives, essential oils, coloring materials, pigments, hydrophilic or lipophilic active ingredients, humectants, such as for example glycerin or glycols, preservatives, colorants, cosmetic active ingredients, mineral and / or organic sunscreens, mineral fillers such as iron oxides, titanium oxides and talc, synthetic fillers such as nylons and crosslinked or non-crosslinked poly(methyl methacrylate), silicone elastomers,or plant extracts or lipid vesicles, or any other ingredient usually used in cosmetics.
[0113] Examples of oils include paraffins, isoparaffins, white mineral oils, vegetable oils (from flowers, fruits, vegetables, trees, cereals, oilseeds, etc.), animal oils, synthetic oils, silicone oils, and fluorinated oils;and more particularly: oils of vegetable origin, such as sweet almond oil, coconut oil, castor oil, jojoba oil, olive oil, rapeseed oil, peanut oil, sunflower oil, wheat germ oil, corn germ oil, soybean oil, cottonseed oil, alfalfa oil, poppy seed oil, pumpkin oil, evening primrose oil, millet oil, barley oil, rye oil, safflower oil, candlenut oil, passionflower oil, hazelnut oil, palm oil, shea butter, apricot kernel oil, calophyllum oil, sysymbrium oil, avocado oil, calendula, oils from flowers or vegetables; ethoxylated vegetable oils; oils of animal origin, such as squalene, squalane; mineral oils, such as paraffin oil, vaseline oil and isoparaffins;synthetic oils, including fatty acid esters such as butyl myristate, propyl myristate, cetyl myristate, isopropyl palmitate, butyl stearate, hexadecyl stearate, isopropyl stearate, octyl stearate, isocetyl stearate, dodecyl oleate, hexyl laurate, propylene glycol dicaprylate; esters derived from lanolic acid, such as isopropyl lanolate, isocetyl lanolate, monoglycerides, diglycerides and triglycerides of fatty acids such as glycerol triheptanoate, alkylbenzoates, polyalphaolefins, polyolefins such as polyisobutene, synthetic isoalkanes such as isohexadecane, isododecane, perfluorinated oils and silicone oils. Among the latter, mention may be made more particularly of dimethylpolysiloxanes, methylphenylpolysiloxanes, ; amine-modified silicones, fatty acid-modified silicones, alcohol-modified silicones, alcohol- and fatty acid-modified silicones, polyether-modified silicones, epoxy-modified silicones, fluorinated group-modified silicones, cyclic silicones and alkyl group-modified silicones.
[0114] As other fatty substances, mention may be made of linear or branched, saturated or unsaturated fatty alcohols, mixtures of linear and / or branched, saturated and / or unsaturated fatty alcohols, or linear or branched, saturated or unsaturated fatty acids, mixtures of linear or branched, saturated or unsaturated fatty acids.
[0115] Among the thickening and / or emulsifying polymers that can be used, there are, for example, homopolymers or copolymers of acrylic acid or acrylic acid derivatives, homopolymers or copolymers of methacrylic acid or methacrylic acid derivatives, homopolymers or copolymers of acrylamide, homopolymers or copolymers of acrylamide derivatives, homopolymers or copolymers of acrylamidomethyl propanesulfonic acid, homopolymers or copolymers of vinyl monomers, homopolymers or copolymers of trimethylaminoethylacrylate chloride, hydrocolloids of plant or biosynthetic origin such as, for example, xanthan gum, karaya gum, carrageenans, alginates; silicates; cellulose and its derivatives; starch and its hydrophilic derivatives; polyurethanes.
[0116] Among the polyelectrolyte type polymers that can be used in the production of a gelled aqueous phase suitable for use in the preparation of W / O, O / W, W / O / W or O / W / O emulsions, or of an aqueous gel comprising SEPIBIO™ POTENTILLA 217, there are, for example, copolymers of acrylic acid and 2-methyl-[(1-oxo-2-propenyl)amino] 1-propane sulfonic acid (AMPS), copolymers of acrylamide and 2-methyl-[(1-oxo-2-propenyl)amino] 1-propane sulfonic acid, copolymers of 2-methyl-[(1-oxo-2-propenyl)amino] 1-propane sulfonic acid and (2-hydroxyethyl)acrylate, 2-methyl-[(l-oxo-2-propenyl)amino]-1-propanesulfonic acid homopolymer, acrylic acid homopolymer, copolymers of acryloyl ethyl trimethyl ammonium chloride and acrylamide, copolymers of AMPS and vinylpyrrolidone, copolymers of AMPS and N5N Dimethyl acrylamide, terpolymers of AMPS,acrylic acid and N5N Dimethyl acrylamide, copolymers of acrylic acid and alkyl acrylates whose carbon chain comprises between ten and thirty carbon atoms, copolymers of AMPS and alkyl acrylates whose carbon chain comprises between ten and thirty carbon atoms.
[0117] Among the waxes that can be used in the compositions according to the invention, mention may be made, for example, of beeswax, carnauba wax, candelilla wax, ouricoury wax, Japanese wax, cork or sugarcane fiber wax, paraffin waxes, lignite waxes, microcrystalline waxes, lanolin wax, ozokerite, polyethylene wax, hydrogenated oils, silicone waxes, vegetable waxes, fatty alcohols and fatty acids solid at room temperature, glycerides solid at room temperature.
[0118] Among the emulsifiers that can be used in the compositions according to the invention, mention may be made of:
[0119] - fatty esters of alkylpolyglycosides, optionally alkoxylated;
[0120] - alkoxylated fatty esters;
[0121] - fatty chain polyalkylene glycol carbamates;
[0122] - fatty acids, ethoxylated fatty acids, fatty acid esters of sorbitol, ethoxylated fatty acid esters, polysorbates, polyglycerol esters, ethoxylated fatty alcohols, sucrose esters, alkylpolyglycosides, sulfated and phosphated fatty alcohols or mixtures of alkylpolyglycosides and fatty alcohols;
[0123] - combinations of emulsifying surfactants chosen from alkylpolyglycosides; And
[0124] - combinations of alkylpolyglycosides and fatty alcohols, polyglycerol esters or polyglycols or polyols.
[0125] Among the surfactants that can be used in the compositions according to the invention, mention may be made of: topically acceptable anionic, cationic, amphoteric or non-ionic surfactants usually used in this field of activity.
[0126] Among the anionic surfactants which can be used in the compositions according to the invention, mention will be made in particular of the alkali metal salts, the alkaline earth metal salts, the ammonium salts, the amine salts, the amino alcohol salts of the following compounds: alkyl ether sulfates, alkyl sulfates, alkylamidoether sulfates, alkylarylpolyether sulfates, monoglyceride sulfates, alpha-olefinsulfonates, paraffin sulfonates, alkylphosphates, alkyletherphosphates, alkylsulfonates, alkylamidesulfonates, alkylarylsulfonates, alkylcarboxylates, alkylsulfosuccinates, alkylethersulfosuccinates, alkylamidesulfosuccinates, alkylsulfoacetates, alkylsarcosinates, acylisethionates, N-acyltaurates, acyllactylates.
[0127] Among the amphoteric surfactants that can be used in the compositions according to the invention, mention may be made of alkylbetaines, alkylamidobetaines, sultaines, alkylamidoalkylsulfobetaines, imidazoline derivatives, phosphobetaines, amphopolyacetates and amphopropionates.
[0128] In order to further potentiate the activity obtained by the composition according to the invention, it may be combined with other ingredients / active ingredients, in particular those known for their antioxidant, anti-radical, preservative, stabilizing, anti-aging, and raf action. firming, restructuring, stimulating, energizing, oxygenating, anti-wrinkle, relaxing, hydrating, antimicrobial, purifying, soothing, relaxing, anti-stress, lightening, immunomodulatory, cell renewal stimulator, etc.
[0129] In connection with the dressing according to the invention, the composition comprising the polypeptide described above may be present in the mass constituting the dressing or on a separate layer of the dressing or even in a coating covering the surface of the dressing intended to come into contact with the wound in order to treat it.
[0130] By dressing is meant here all types of known dressings and preferably interface dressings. Such dressings are marketed for example under the trade names TULLE GRAS (by SOLVAY PHARMA), PHYSIOTULLE (by COLOPLAST) or URGOTUL (by URGO Laboratories) and described in patent EP 1 143 895.
[0131] These interface dressings are generally in the form of a mesh or a net coated with a mass, usually an elastomeric mass. They can also be made up of a mass without mesh or net, having the shape of a plate with or without through holes, depending on the type of wound on which the dressing is applied (a plate with through holes will preferably be used on an exudative wound when the mass has only low or no absorbent power, the holes thus allowing the evacuation of exudates from the wound).
[0132] The present invention also finds application for the production of dressings based on hydrogels or hydrocolloids in which the aforementioned polypeptide is incorporated. Known hydrocolloid-based dressings are, for example, marketed under the names ALGOPLAQUE (by URGO Laboratories), DUODERM (by CONVATEC), COMFEEL (by COLOPLAST). Such dressings are described in the following patent applications: FR 2 392 076, FR 2 495 473, WO 98 / 10801, EP 264 299.
[0133] The polypeptide used in the context of the present invention can be incorporated into an absorbent element such as a compress or a foam, for example by depositing it on the surface intended to come into contact with the wound, as described in patent application WO 2006 / 007844. The present invention also finds application for the production of interface dressings complexed with an absorbent layer such as a foam or a compress, or of a hydrocolloid mass complexed with an absorbent foam. Such dressings are known and marketed for example under the trade names URGOTULDUO and CELLOSORB (by URGO Laboratories).
[0134] As used herein, the term “subject” means a mammal, preferably said subject is a human.
[0135] Lesion of an epithelium means lesions likely to appear following trauma or following medical, surgical, invasive or non-invasive, curative or aesthetic procedures.
[0136] It can then be a cutaneous epithelium or even a gastric or intestinal epithelium.
[0137] Advantageously, the lesion of an epithelium is a skin lesion.
[0138] As invasive medical or surgical procedures, we can cite surgical procedures (excisions, shavings) with or without sutures, cryotherapy, ablative laser, medium or strong peels, sutures, mesotherapy or even curettage for example.
[0139] Examples of post-traumatic skin lesions include those resulting from slight external alteration of the skin, such as cuts, scratches, scrapes and superficial burns or sunburn, for example.
[0140] As a superficial non-invasive medical procedure requiring a healing product which accelerates skin recovery, we can cite for example light peels, laser hair removal, superficial vascular treatments (rosacea).
[0141] Such use will be by means of a therapeutically effective amount of the composition.
[0142] By "therapeutically effective amount" is meant an amount capable of inducing re-epithelization within the wound. A person skilled in the art will be able to determine said therapeutically effective amount in view of the description of the invention given in the present patent application and in light of his general knowledge and / or using simple routine experiments.
[0143] The following experiments are provided to illustrate the embodiments of the invention and should not be construed as limiting the scope of the invention. Examples
[0144] 1-Functional study of GPRC5A in primary keratinocytes
[0145] Following the identification of the expression of the GPRC5A protein in the edges of a wound, the function of this protein was sought in the healing mechanism by inactivating the expression of the corresponding gene.
[0146] To do this, three strains of primary human keratinocytes and one immortalized line of human keratinocytes (N / TERT-1) were used.
[0147] The cells were cultured in a complete KGM-2 medium (KERATINOCYTE GROWTH MEDIUM, PROMOCELL), under a humidity-saturated atmosphere, at 37°C and under 5% CO2 throughout the experiments.
[0148] GPRC5A gene expression was downregulated by RNA interference approaches. Primary strains were transiently transfected in the presence of LIPOFECTAMINE 2000 (THERMO FISHER SCIENTIFIC) with 20nM of commercial siRNA specific for GPRC5A mRNA (siGPRC5A) (SI04438021, QIAGEN) or a control siRNA (siNT) not targeting any known mammalian mRNA sequence (SI03650318, QIAGEN). The N / TERT-1 line was infected with a lentiviral vector whose transcriptional activity allows the release of small interfering RNA sequences, a shRNA ("short hairpin" RNA) specific for the GPRC5A mRNA sequence (shGPRC5A) (TRCN0000005, SIGMA ALDRICH) or a control shRNA (shCTR) composed of the same nucleotides but not targeting any known sequence (SHC002V, SIGMA ALDRICH).
[0149] The interference efficiency in the different strains was evaluated by quantitative PCR. For this, total RNAs were isolated at the indicated times after transfection by the RNEASY kit (QIAGEN). For each condition, 500 ng of RNA were reverse transcribed by the PRIMESCRIPTt™ RT Reagent Kit (TAKARA). Quantitative PCR was performed in an ARIAMX thermal cycler (AGILENT TECHNOLOGIES) in the presence of the SYBR® PREMIX EXx TAQ™ II kit (TAKARA) and using specific primers for GPRC5A (sense: TCTCAAGAGGAAATCACTCAAGGT, SEQ ID NO 23; antisense: GTGGGATGGAGAATTCCTTTT, SEQ ID NO 24) and the ribosomal housekeeping gene RPLP0 (sense: CCATTCTATCATCAACGGGTACAA, SEQ ID NO 25; antisense: TCAGCAAGTGGGAAGGTGTAATC, SEQ ID NO 26).
[0150] In parallel, the effect of RNA interference was evaluated on the amount of protein by western blotting. Proteins were extracted in RIPA buffer (50 mM Tris-HCl, pH 8, 150 mM NaCl, 1% Nonidet P-40, 0.1% sodium deoxycholate, 0.1% SDS) supplemented with 1 mM sodium orthovanadate and a protease inhibitor cocktail (SIGMA ALDRICH). Lysates were centrifuged for 10 min at 14,000 g at 4 °C to remove cellular debris. Proteins were separated by SDS-PAGE and then transferred to a polyvinylidene fluoride membrane (EMD-MILLIPORE). The membrane was blocked with 5% skim milk in Tris-buffered saline (TBS) containing 0.1% TWEEN-20, and incubated with anti-GPRC5A antibody (HPA007928, SIGMA ALDRICH) at 1:250 and anti-actin antibody (C4, MAB1501, SIGMA ALDRICH) at 1:5000 overnight at 4°C.The membrane was incubated with secondary antibodies for 1 h at room temperature: goat anti-rabbit-HRP antibody (170-6510, BIO-RAD) or goat anti-mouse-HRP antibody (170-6516, BIO-RAD) at 1:10000. Antibody binding was detected by the SUPER SIGNAL WEST PICO PLUS chemiluminescence system (THERMO FISHER SCIENTIFIC) using the Fusion Fx camera (VILBER LOURMAT).
[0151] The results showed that, following transfection with GPRC5A siRNA or transduction by GPRC5A shRNA, the expression of the GPRC5A gene is decreased by around 70% in the different cell strains [Fig 3a and 3e]. Under similar conditions, a clear decrease in the amount of GPRC5A protein is observable in primary keratinocytes and in the N / TERT-1 line [Fig 3b and 3f].
[0152] In order to determine the impact of this inactivation on keratinocytes, the proliferation of the latter was determined following inactivation of the GPRC5A gene. In detail, the cell proliferation rate of keratinocytes transfected with siNT or siGPRC5A or transduced with the shCTR or shGPRC5A lentivirus was measured using the QUANT-IT™ PICOGREEN™ dsDNA test kit (THERMO FISHER SCIENTIFIC). For this, 104 cells were seeded in 96-well microplates and the DNA concentration was evaluated at 1, 2 and 3 days after seeding according to the manufacturer's instructions.
[0153] The results showed that inactivation of the GPRC5A gene has no impact on keratinocyte proliferation [Fig 3c and 3g].
[0154] The determination of the adhesion capacity of primary keratinocytes was also determined following inactivation of the GPRC5A gene.
[0155] In detail, the adhesion test was performed according to the Percoll method (GOOWIN & PAULI, J Immunol Methods 1995). 96-well plates were coated with either 100 μg / ml type I collagen (THERMO FISHER SCIENTIFIC) or 1% bovine serum albumin (BSA) in phosphate-buffered saline (PBS) (negative control). Cells were detached with 10 mM EDTA for 10 min at 37°C and washed twice with serum-free medium. Then, 2.5x104 cells / well were resuspended in serum-free medium and plated in 5 replicates for each condition. Cells were fixed for 5, 10, 30, 60, 120, and 240 min at 37 °C, and then unfixed cells were removed with Percoll solution containing 0.57 mM NaCl. The remaining cells were fixed with Percoll solution containing 5% w / v glutaraldehyde for 15 min at room temperature.Cells were stained with 0.1% w / v crystal violet for 30 min at room temperature, then the plates were washed with tap water. The plates were air-dried and the crystal violet was then extracted using 2% SDS in distilled water for 30 min on a shaker. Absorbance at 570 nm was measured spectrophotometrically on a TECAN INFINITE M1000. Background absorbance (from blank wells) was subtracted from all test wells. The assay was performed in 5 technical replicates and 3 biological replicates.
[0156] The results show that inactivation of the GPRC5A gene induces significantly greater adhesion of primary keratinocytes [Fig 3d] and N / TERT-1 cells [Fig 3h] from 5 minutes.
[0157] In light of these results in terms of adhesion, the migration capacity of kera- tinocytes was determined following inactivation of the GPRC5A gene.
[0158] In detail, in a 6-well plate, cells (2x104 cells / well) were seeded in a 2-well silicone insert (IBIDI) for 30 hours. After confluence, the culture insert was slowly removed. After washing with PBS, cells were cultured with complete KGM2. Cells were then allowed to migrate in space (500 pm) and imaged in phase contraction under an inverted microscope (NIKON TLE) at times 12h, 14h, 16h, 18h, 20h and 22h for primary cells, and at times 3h, 6h, 8h, 10h and 12h for N / TERT-1 cells. Quantification of cell migration was performed by measuring uncovered areas using Image J software. Each experiment was repeated 3 technical replicates and 3 biological replicates.
[0159] The results are presented in [Fig.4] and show that primary keratinocytes whose GPRC5A gene has been repressed show a significant migration delay from 12h [Fig 4a], and from 6h for N / TERT-1 cells [Fig 4b].
[0160] In view of these results, the characterization of reconstructed epidermis, comprising immortalized N / TERT-1 keratinocytes whose GPRC5A gene has been stably repressed (shGPRC5A), was carried out.
[0161] Fibroblasts (2.5x104) were seeded under the polycarbonate membrane of a 0.4 μm porosity cell culture insert (NUNC, THERMO FISHER SCIENTIFIC). After 4 hours, the inserts were inverted and placed in 24-well plates, and the fibroblasts were cultured for 2 days in DMEM / F12 (1 / 1) supplemented with 10% fetal bovine serum (Fêtai Clone II; HYCLONE, THERMO FISHER SCIENTIFIC) and 1% penicillin / streptomycin (SIGMA ALDRICH).2.5x105 N / TERT-1 shRNA control (shCTR) or shRNA GPRC5A (shGPRC5A) cells were seeded on top of the membrane and cultured for 3 days in DMEM / F12 (1:1) supplemented with 5% fetal bovine serum (FETAL CLONE II; HYCLONE), 0.2 ng / ml EGF (THERMO FISHER SCIENTIFIC), 0.4 pg / ml hydrocortisone (SIGMA ALDRICH), 5 pg / ml insulin (SIGMA ALDRICH), 8 ng / ml cholera toxin (SIGMA ALDRICH), 2x10 11 M triiodothyronine (SIGMA ALDRICH), 24 pg / ml adenine (SIGMA ALDRICH), and 1% penicillin / streptomycin. To induce stratification and differentiation, keratinocytes were placed at the air / liquid interface and cultured for 2 days with the same medium, except that EGF and adenine were omitted and the final concentration of calcium chloride was adjusted to 2 mM and 50 pg / ml vitamin C. Cells were then cultured for an additional 14 days in the same medium, except that fetal bovine serum was reduced to 1%.During the emergence phase, the culture medium was changed every day.
[0162] For histology and immunofluorescence experiments, samples were fixed in 4% paraformaldehyde solution for 24h at 4°C. The samples were then dehydrated and embedded in paraffin and cut with a microtome into 5 μm thick sections. After deparaffinization and rehydration, the sections were stained with hematoxylin and eosin solutions for routine histology or permeabilized by 0.1% triton XI00 for 10 min, then boiled in 10 nM citrate buffer pH 6 for antigen retrieval. The sections were blocked by 5% bovine serum albumin and incubated with the following primary antibodies overnight at 4°C: rabbit anti-GPRC5A (HPA007928, SIGMA ALDRICH, 1:250); mouse anti-E-cadherin (abl416, ABCAM, 1:1000); rabbit anti-cytokeratin 10 (ab76318, ABCAM, 1:500); and rabbit anti-involucrin (ab53112, ABCAM, 1:500). Secondary antibodies were: goat anti-mouse or anti-rabbit alexa-488 and alexa-546 (THERMO FISHER SCIENTIFIC).Nuclear counterstaining with DAPI (4',6-diamino-2-phenylindole) (SIGMA ALDRICH) was performed. Sections were then mounted in PROLONG™ GOLD ANTIFADE MOUNTANT solution (THERMO FISHER SCIENTIFIC). Image acquisition was performed using a NIKON TLE fluorescence microscope.
[0163] Histological staining results showed two characteristics of epidermis reconstructed from N / TERT-1 shGPRC5A cells: areas of lesser thickness than control epidermis (shCTR), and areas showing detachment of the suprabasal layers [Fig 4c]. These histological defects are associated with a differentiation defect characterized by a decrease in the expression and localization of E-cadherin, cytokeratin 10 and involucrin. These results demonstrate the involvement of GPRC5A in epidermal morphogenesis.
[0164] 2- Translocation to the nucleus of the C-terminal part of GPRC5A
[0165] Primary keratinocytes in the proliferative phase were rinsed 3 times with PBS, then detached by the action of trypsin / EDTA (THERMO FISHER SCIENTIFIC) in order to obtain a cell suspension. A portion of the suspended cells was fixed by adding 4% paraformaldehyde for 20 minutes, and the unfixed cells were seeded in 12-well dishes at a density of 2x104 cells / well. At times 30 min, 60 min, 24 h, at confluence and 5 days post confluence, the cells were fixed in 4% paraformaldehyde for 20 minutes. After 3 washes in PBS, the cells were permeabilized by adding 0.1% triton X100 and then saturated with a solution of 5% BSA in PBS for 1 h. Immunostaining of the N-terminal and C-terminal regions was performed by incubation of anti-GPRC5A antibodies HPA007928 (SIGMA ALDRICH, 1:250) and PA5-28738 (THERMO FISHER SCIENTIFIC, 1:250) overnight at 4°C, respectively.The secondary antibody was a goat anti-rabbit antibody coupled to Alexa-546 (THERMO FISHER SCIENTIFIC). Localization in the nucleolus was demonstrated by direct immunofluorescence. of nucleolin by a murine antibody coupled to alexa-488 (abl54028, ABCAM, 1:1000). Nuclear counterstaining with DAPI was performed. Sections were then mounted in PROLONG™ GOLD ANTIFADE MOUNTANT solution (THERMO FISHER SCIENTIFIC). Image acquisition was performed using a Nikon Ti-E fluorescence microscope or a ZEISS LSM800 confocal microscope.
[0166] The results showed that only the C-terminal end of GPRC5A is translocated to the nucleus, from the early phases of adhesion until the entry into differentiation of primary keratinocytes [Fig 5a]. More precisely, the C-terminal region of GPRC5A is found in the nucleolus [Fig 5b]. This suggests that GPRC5A undergoes proteolysis in the perinuclear space upstream of translocation to the nucleus. 3- Production of the C-terminal region of GPRC5A
[0167] The C-terminal part of the GPRC5A protein (89 amino acids) was produced in bacteria.
[0168] BL21 bacteria (LIFE TECH 44-048) were transformed with the plasmid pET30a_GPRC5A-C-terminal_poly(R / K)_TEV-cleavage-site_2x-6Histidines, then cultured on LB-agar petri dishes supplemented with kanamycin. A pre-culture is then carried out in which an isolated bacterial colony is inoculated into 100ml of LB BROTH LENNOX medium (Formedium LBX0102) overnight at 37°C and 150rpm. From this pre-culture, the bacteria are inoculated at an OD of 0.15 in HYPER BROTH medium (ATHENAES AE-0107), then cultured at 37°C 150rpm. The evolution of OD of the culture is monitored every hour in order to plot a growth curve (ln(OD) over time). During the exponential doubling phase of the bacteria (OD=0.8-1, approximately 2 hours post-seeding), ImM of IPTG is added to the culture medium in order to stimulate the production of the polypeptide.The culture is then continued until the stationary phase (approximately 6 hours post-seeding), then the bacterial pellets are recovered by centrifugation (4000g, 10 minutes at 4°C), separated from the supernatant and frozen at -20°C. During protein extraction, the bacteria are lysed in a lysis buffer (PBS1X, 500mM NaCl, 10mM MgC12, 0.5% Triton X100 - v=1 / 10th of the bacterial culture volume) supplemented with protease inhibitor (COMPLETE™ PROTEASE INHIBITOR COKTAIL, ROCHE), DNAse (100pg / ml) and lysozyme (10mg / ml); and incubated for 30 minutes on a wheel at 4°C before undergoing sonication (2x5 minutes, 3-second pulse, amplitude 30). Cell debris and the insoluble fraction are separated from the soluble fraction by centrifugation (15000g, 15 minutes at 4°C).The soluble fraction is then stored at 4°C, while the insoluble fraction is resuspended in urea buffer (PBS1X, 8M urea, 500mM NaCl, v=1 / 4 of the lysis buffer volume) supplemented with DNAse (100pg / ml), then incubated for 1 hour on . wheel at 4°C. The proteins released into the buffer are recovered in the supernatant by centrifugation (15000g, 15 minutes at 4°C) and added to the soluble fraction previously set aside. Subsequently, the entire polypeptide is affinity purified from its ôHistidines tag with Ni-NTA beads (745400 Propino, MACHERY-NAGEL, v=1 / 1000th of the bacterial culture volume). The beads, previously washed with PBS1X, are added to the protein suspension and incubated for 1 hour on a wheel at 4°C. The beads are then placed on a column (cotton filter whose porosity does not exceed the size of the beads) and the unretained fraction is removed by aspiration using a peristaltic pump (1ml / minute). The beads are then washed by adding one volume of 1M NaCl beads, followed by 5 volumes of wash buffer beads (PBS1X, 500mM NaCl, 10mM MgCl2, 15mM imidazole).Finally, the polypeptide is eluted from the Ni-NTA beads by adding an elution buffer (PBS1X, 50mM EDTA, v= approximately 10 volumes of beads), and assayed (PIERCE™ BCA PROTEIN ASSAY Kit). Without waiting, the polypeptide in solution is supplemented with 1 / 10M DTT and then digested by adding TEV protease (SFR BIOSCIENCES - 0.5mg for 10mg of protein). The resulting mixture is placed in a dialysis tube rinsed with PBS1X (MWCO: 3500Da) and diffusion against a PBS1X 500mM NaCl solution takes place in a beaker with magnetic stirring overnight at 4°C. The cleaved peptide is finally purified by adding, as before, Ni-NTA beads which will fix the released ôHistidines tag (1ml of beads / 50mg of peptide) for 1h on a wheel at 4°C. After depositing the peptide-bead suspension on a column identical to the previous one, the cleaved peptide is recovered in the non-retained fraction, measured then aliquoted and frozen at -80°C.
[0169] Gel analysis of the polypeptide after purification reveals multiple bands at a molecular weight lower than expected [Fig 6a]. HPLC-UV analyses (216nm) however show the purity of the purified peptide with a single absorbance peak [Fig 6b]. Also, the results establish that the polypeptide produced in bacteria has been cleaved, a priori at different sites. EDMAN microsequencing analysis (N-terminal) identified the sequence sthfqlqnqp (SEQ ID NO: 27), which sequence allows us to conclude that the cleavage was carried out upstream of position 321 of human GPRC5A [Fig 6c].
[0170] 4- Activity of the GPRC5A polypeptide produced on the adhesion and migration of keratinocytes tinocytes
[0171] The activity of the previously purified polypeptide was tested on the adhesion and migration of keratinocytes.
[0172] The cell adhesion and migration protocols are those described previously. The effect of the purified recombinant polypeptide was analyzed by preincubation for 12 to 24 hours in the culture medium of N / TERT-1 cells. shGPRC5A at concentrations of 5 and 10 pg / ml.
[0173] The results show that the addition of polypeptide at 5 or 10 pg / ml makes it possible to induce a higher migration capacity from 5 hours of migration of GPRC5A-deficient N / TERT-1 cells [Fig 7a and 7b]. No notable difference was noted between the two concentrations used. The polypeptide, however, has a lesser effect on the adhesion capacity of these cells [Fig 7c].
[0174] The results showed that, even if the purified polypeptide is cleaved, the latter still exhibits significant activity on the adhesion and migration of keratinocytes. Consequently, these results allow us to conclude that the keratinocyte migration induction activity is associated with sequence elements within the fragment ranging from residues 321 to 357 of human GPRC5A.
[0175] It should be noted that, for different species, two isoforms of GPRC5A are distinguished, one of which is truncated and does not include this C-terminal segment (as for example in Gallus gallus). It is possible that the activity of this C-terminal fragment justifies the existence of these different isoforms.
[0176] Sequence alignments between C-terminal fragments of GPRC5A proteins from different origins reveal highly conserved residues including serine and tyrosine residues. In addition to these residues, the consensus shows a high conservation of the EFSIPR sequence, which is found specifically and almost identically (QFSIPR) in several CUB domain proteins. The CUB domain is a structural motif of approximately 110 residues found almost exclusively in extracellular and plasma membrane-associated proteins, many of which are developmentally regulated. Now, no activity has been associated with this sequence to date.
[0177] 5- Phosphorylation of the C-terminal part of GPRC5A
[0178] In order to determine the phosphorylation status of the C-terminus of GPRC5A translocated to the nucleus, the cytoplasmic and nuclear fractions of keratinocytes were isolated.
[0179] Immunoprecipitation was then carried out on these fractions using or not an antibody directed against phosphorylated serines or against phosphorylated tyrosines.
[0180] The results showed that the C-terminus of GPRC5A comprises phosphorylated serine residues.
[0181] In order to evaluate the importance of phosphorylation, the peptides listed in the following Table I were synthesized in which the serine and / or tyrosine residues were phosphorylated. Note that pegylation was carried out at the N-terminus.
[0182] [Tables 1] Sequence SEQ ID N: pegsthFQLQNQPPQKEFSIPRAHAWPSPYKDYEVKKEGSRKRKRKRKRK RK 28 pegSpTHFQLQNQPPQKEFSpIPRAHAWPSpPYKDYEVKKEGSpRKRKRKRK RKRK 29 pEGSTHFQLQNQPPQKEFSIPRAHAWPSPYpKDYpEVKKEGSRKRKRKRKR KRK 30 pEGSpTHFQLQNQPPQKEFSpIPRAHAWPSpPYpKDYpEVKKEGSpRKRKRKR KRKRK 31
[0183] The activity of the different polypeptides is then tested on the adhesion and migration of keratinocytes as described previously and at different concentrations.
Claims
Claims
1. A composition for use in promoting and / or accelerating the healing of a lesion of an epithelium in a subject, which composition comprises a polypeptide whose size is less than or equal to 60 amino acids and which comprises the sequence chosen from the C-terminal sequence of the GPRC5A protein (G protein-coupled receptor class C group 5 member A) ranging from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1), its orthologs, fragments thereof or derivatives thereof, a polynucleotide encoding such a polypeptide, a vector comprising such a polynucleotide or a cell transformed by such a vector; where: - the orthologs are selected from the group including the sequence of the GPRC5A of Mus musculus (NP_852109.2), Camelus bactrianus (XP_010944750.1), Felis catus (XP_019690106.1), Canis lupus familiaris (P_80838), Talpa occidentalis (XP_037370212.1), Halichoerus grypus (XP_035967917.1), Tursiops truncatus (XP_033722915.1), African Loxodonta (XP_023410262.1), Gallus de Gallus (XP_037370212.1), Gallus de (XP_035967917.1). Cygnus olor (XP_040411303), Aptenodytes patagonicus (KAF1666521.1), Haliaeetus leucocephalus (XP_010564139.1), Chelonia mydas (XP_043400668.1), Trachemys elegans scripta. (XP_034630427.1), Pseudonaja textilis (XP_006024224.1), Python bivittatus (XP_025019164.1), and Ranitomeya imitator (CAF4926718.1) ; - the fragments are selected from the group consisting of the sequences from residue 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334 or 335 to residue 350, 351, 352, 353, 354, 355, 356 or 357 of the human GPRC5A protein (SEQ ID NO: 1) or their orthologs, with the natural exception of the sequence from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1) and its orthologs; and - the derivatives are chosen from the group consisting of sequences having a sequence identity of at least 80% with the sequence from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1) and with the orthologous sequences thereof.
2. The composition according to claim 1, characterized in that the polypeptide comprises the sequence XiX2HX3QX4X5X6X7X8X9XioXiiXi2 FSIPRX13 x14x15x16x17spyx18x19y x20x21x22x23x24x25x26 (SEQ ID NO: 3), fragments thereof and derivatives thereof; wherein: - Xi is S, A or Y; - X2 is T, A or P; - X3 is F or L; - X4 is M or L; - X5 is Q, K or E; - X6 is N, T or S; - X7 is Q, H, R, L or I; - X8 is P, N, T, A, S, D, K, E or no amino acid; - X9 is P, S, A, T or no amino acid; - Xio is Q, P, K or R; - Xn is K, R, N, Q or E; - Xi2 is E, D or N; Xi3 is A or P; - X14 is H, Q or K; - X15 is S, A, T or no amino acid; - Xi6 is W, P, R, H, Q or no amino acid; - Xi7 is P, A, T, V or L; - X18 is K, N, S, H, Q or E; - Xi9 is D, N or E; - X20 is E, T, S or A; - X2i is V or G; - X22 is K, R or G; - X23 is K, N or Q; - X24 is E, G, D or V; - X25 is G, D, V, P, T or I; and - X26 is S, M or K.
3. The composition according to any one of claims 1 or 2, characterized in that the polypeptide comprises a sequence chosen from the sequences SEQ ID NO: 2 and SEQ ID NO: 5 to SEQ ID NO: 21, their fragments and their derivatives.
4. The composition according to any one of claims 1 to 3, characterized in that the polypeptide comprises a sequence chosen from the sequence sthfqlqnqp pqkefsipra hawpspykdy evkkegs (SEQ ID NO: 2), its fragments and its derivatives.
5. The composition according to any one of claims 1 to 3, characterized in that said fragments of the polypeptide are chosen from the group consisting of the sequences ranging from residue 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334 or 335 to residue 350, 351, 352, 353, 354, 355, 356 or 357 of the human GPRC5A protein (SEQ ID NO: 1) or their orthologs, with the exception of course of the sequence from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1) and its orthologs.
6. The composition according to any one of claims 1 to 3, characterized in that said derivatives of the polypeptide are chosen from the group consisting of the sequences having a percentage of identity of at least 80% with the sequence ranging from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1), with the orthologous sequences thereof, with the sequence SEQ ID NO: 3 with the sequence SEQ ID NO: 4 or with the sequences of their fragments.
7. A dressing comprising a composition comprising a polypeptide whose size is less than or equal to 60 amino acids and which comprises the sequence selected from the C-terminal sequence of the GPRC5A protein (G protein-coupled receptor class C group 5 member A) ranging from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1), its orthologs, fragments thereof or derivatives thereof where: - the orthologs are selected from the group comprising the sequence of the GPRC5A of Mus musculus (NP_852109.2), Camelus bactrianus (XP_010944750.1), Felis catus (XP_019690106.1), Canis lupus familiaris (XP_038294887.1), Talpa occidentalis (XP_037370212.1), Halichoerus grypus (XP_035967917.1), Tursiops truncatus (XP_033722915.1), Loxodonta africana (XP_023410262.1), Gallus gallus (XP_040516431.1), Cygnus olor (XP_040411303), Aptenodytes patagonicus (KAF1666521.1), Haliaeetus leucocephalus (XP_010564139.1), Chelonia mydas (XP_043400668.1), Trachemys scripta elegans (XP_034630427.1), Pseudonaja textilis (XP_006024224.1), Python bivittatus (XP_025019164.1), and Ranitomeya imitator (CAF4926718.1); - the fragments are selected from the group consisting of the sequences from residue 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334 or 335 to residue 350, 351, 352, 353, 354, 355, 356 or 357 of the human GPRC5A protein (SEQ ID NO: 1) or their orthologs, with the natural exception of the sequence from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1) and its orthologs; and. - the derivatives are chosen from the group consisting of sequences having a sequence identity of at least 80% with the sequence from residue 321 to residue 357 of the human GPRC5A protein (SEQ ID NO: 1) and with the orthologous sequences thereof.
8. A composition according to any one of claims 1 to 6, for use in promoting and / or accelerating re-epithelialization in a subject.