Use of cholinergic-directed RNA interference to control insect pests

Abstract

------ USE OF INTERFERING RNA DIRECTED AGAINST THE CHOLINERGIC SYSTEM FOR CONTROLLING PEST INSECTS The present invention relates to a method for controlling pest insects by inhibiting the translation of an mRNA of a target gene belonging to the cholinergic system of the insect induced by RNA interference. The invention also relates to an insecticidal composition comprising a double-stranded RNA or an antisense oligonucleotide and a transfection agent or a solvent.The invention further relates to an interfering RNA in which the dsRNA or antisense oligonucleotide inhibits the translation of mRNAs corresponding to the coding sequence of any of the genes of the neuronal α subunit group of the nicotinic receptor, the genes of the neuronal β subunit group of the nicotinic receptor, and their isoforms, to any of the nucleotide sequences of the genes coding for the proteins and auxiliary molecules of the nicotinic receptor, and their isoforms, or to the DNA sequence coding for a protein of the interactome of the nicotinic receptor. Uses of the interfering RNA or antisense oligonucleotide as a bioinsecticide, as an agent for synergizing the insecticidal effect of an insecticide or a molecule with an insecticidal effect against a harmful insect and as an agent for restoring the sensitivity of a harmful insect to an insecticide are described. Figure to be published with the abstract: Figure 2.

Description

Title of the invention: Use of interfering RNA directed against the cholinergic system to combat harmful insects

[0001] Background of the invention

[0002] The present invention relates to the field of combating harmful insects. Taking into consideration in particular the implementation of the Ecophyto 11+ plan which aims to reduce the use of phytosanitary products by 50%, the need for means of combating harmful insects is particularly pressing. These insects represent a nuisance both from the point of view of public health and the smooth running of human activities, whether domestic or professional. The presence of cockroaches, bedbugs within a home, as well as the infestation of crops by aphids, leafhoppers, weevils or others, has a deleterious effect on human activity.

[0003] In fact, modern agriculture is moving towards agroecological control of harmful insects. But this requires the development of new, suitable alternative techniques.

[0004] Since the beginning of the 19th century, the world population has been constantly increasing, going from 7.5 billion individuals in 2017 to a forecast of approximately 11 billion at the end of the 21st century. Given the problems of undernutrition and malnutrition encountered in the world, agriculture must face a significant challenge which is to produce food resources in sufficient quantity and quality. Indeed, many pests causing considerable damage to plants can lead to quantitative losses and / or a qualitative change in the harvest. Among these pests, insect pests cause between 20 and 40% of agricultural production losses each year.

[0005] The reduction in the number of authorized active substances makes the fight against harmful insects increasingly difficult. In addition, the unreasonable use of insecticides has led to the emergence of harmful insects resistant to insecticides.

[0006] The inventors were particularly interested in developing a strategy for combating harmful insects such as, for example, the pea aphid Acyrthosiphon pisum and the cockroach Periplaneta americana.

[0007] The pea aphid colonizes many cultivated legumes such as peas, beans, broad beans, lentils and alfalfa. Legume cultivation ranks second in world production after cereals, representing approximately 13% of cultivated areas (Gepts et al., 2005). It causes direct damage due to sap extraction but is also capable of transmitting many viruses. To date, 30 viruses transmitted by the pea aphid have been identified: bean mosaic, cucumber mosaic, etc.

[0008] Neonicotinoids are the insecticides that have been most widely used in agriculture over the past ten years. Although a temporary authorization for use was granted by the law of December 14, 2020 to protect sugar beet crops threatened by massive aphid infestations against which current insecticide treatments are not effective, the use of these neonicotinoids has been prohibited since 2018.

[0009] Consequently, few chemical substances currently remain usable for combating harmful insects, including crop pests, and more particularly aphids, which makes it problematic to control these insects adapted or even resistant to these chemical insecticide treatments.

[0010] Brief description of the invention

[0011] The inventors propose a new strategy for controlling harmful insects based on the use of interfering RNA (RNAi) targeting the cholinergic system as bioinsecticides or as agents that synergize the effect of the insecticide used at low doses. Indeed, the cholinergic system in insects plays a major role in their physiology.

[0012] Given this important physiological role of acetylcholine (ACh) in insects, the cholinergic system constitutes a privileged target for numerous families of insecticides such as, for example, carbamates and organophosphates which inhibit the activity of the ACh degradation enzyme, acetylcholinesterase; spinosyns, neonicotinoids, butenolides, sulfoximines and mesoionics targeting nicotinic cholinergic receptors (nAChR).

[0013] Until 2018, the use of neonicotinoids was the most effective way to control insect pests in crops. These insecticides were widely used in agriculture for plant protection, as phytosanitary products, and by individuals or companies to control insects harmful to human and animal health, as biocidal products.

[0014] Article 125 of the law of 8 August 2016, known as the "law for the recovery of biodiversity, nature and landscapes", prohibits "the use of plant protection products containing one or more active substances from the neonicotinoid family and seeds treated with these products [...] from 1 September 2018", with possible exceptions.

[0015] Since the ban on the use of neonicotinoids, neurotoxic chemical control has been mainly based on the use of pyrethroids. However, the lower effectiveness of this class of insecticide on harmful insects has led to a temporary authorization for the use of neonicotinoids by the law of December 14 2020 for sugar beets, while other solutions are found to protect these crops, which are massively threatened by aphids. Other known methods of controlling aphids include the use of beneficial insects such as Coccinella septempunctata and parasitoids such as Aphidius avenae, mechanical control with the installation of insect nets, or trapping with the use of sticky panels.

[0016] The present invention is based on the use of the RNA interference technique which is a species-specific method (Whyard et al., 2009), which has made it possible to develop a new specific strategy for controlling harmful insect species, for example the pea aphid Acyrthosiphon pisum, without affecting beneficial insects such as the honeybee Apis mellifera.

[0017] The RNA interference technique allows the specific regulation of protein expression. Once in the cell, double-stranded interfering RNAs (dsRNA or dsRNA) are cleaved into small interfering RNAs of 21 to 25 nucleotides (siRNA or siRNA) by an RNAse III called DICER. This ribonuclease then transfers the siRNAs to the multi-enzyme complex RISC (RNA-induced silencing complex). While the sense strand of the siRNA, called the "passenger," is eliminated, the antisense "guide" strand, complementary to the mRNA of the gene of interest, directs the RISC complex to the target mRNAs in order to degrade them, thus preventing their translation.

[0018] The present invention targets the cholinergic system of the harmful insect and more precisely the neuronal nicotinic subunits forming the nicotinic receptors (nAChRs) and their auxiliary proteins.

[0019] nAChRs, which are the targets of many insecticides, are part of transmembrane complexes that are located at synapses and allow the rapid transmission of nerve information when activated by the binding of ACh. They are pentameric glycoprotein complexes belonging to the "Cys-loop" family which includes different ionotropic receptors called "Ligand-Gated Ion Channel" (LGIC) and are permeable to different cations (Na+, Ca2+ and K+). These nAChRs composed of 5 subunits can be homomeric (5 identical α subunits) or heteromeric (5 different α or |3 subunits). To date, genome analysis of different insects has identified several nicotinic subunits: 10 α subunits ranging from al to alO and 10 [3 subunits ranging from [31 to [310, plus their isoforms (Jones et al., 2021; Dale et al., 2010).The α subunits are distinguished from the [3] subunits by the presence of two adjacent cysteines in the amino-terminal part.

[0020] The nicotinic subunit composition of nAChRs makes it possible to define their electrophysiological and pharmacological properties, as well as their sensitivity to insecticides.

[0021] For example, sequencing of the A. pisum genome (International Aphid Genomics Consortium, 2010) has enabled the identification of 11 genes coding for nicotinic subunits (Dale et al., 2010). Among these, the α9, α10 and [32 subunits are so-called "divergent" subunits, i.e. they have little sequence homology with known nicotinic subunits in other insect species. The inventors used the RNA interference technique to target one of these subunits, the Apisum [32 subunit, also called [32. Further development was necessary to determine the mode of application of the interfering RNAs (dsRNA). Thus, a topical application of 400 ng of dsRNA per aphid was used in the experiments.After having demonstrated that this interfering RNA did indeed cause a reduction in the number of transcripts coding for [32, the inventors demonstrated that the aphids having received these dsRNAs topically presented an increase in the mortality rate of approximately 6%, 31% and 51% at 24h, 48h and 72h respectively after the application.

[0022] Considering that the nicotinic subunit composition of nAChRs determines their sensitivity to insecticides, the decrease in the expression of

[32] subunit mRNAs by specific dsRNAs observed in the pea aphid suggests a modification of the composition of nAChRs leading to a modulation of the efficacy of an insecticide treatment.

[0023] The experimental results show that adult aphids having absorbed the dsRNA against the

[32] subunit, then intoxicated with imidacloprid at a concentration close to the LC50, namely 5.103 pg / mL, have a slightly increased mortality (1.4 times) 72 hours after acute poisoning, compared to control aphids. Thus, the use of specific dsRNA inducing a modification of the composition of the nAChRs would make it possible to make the insects more sensitive to the insecticide. This synergistic effect is detailed below in the examples. Detailed description of the invention

[0024] The present invention relates to a method for controlling harmful insects by inhibiting the translation of mRNA of a target gene belonging to the cholinergic system of the insect induced by RNA interference.

[0025] The term "harmful insect" means any insect exhibiting an activity having effects considered to be harmful to public health and / or to the smooth running of certain human activities such as agriculture or livestock farming. Harmful insects include phytophagous, saprophagous and detritiphagous insects, predatory, parasitic, commensal and hematophagous insects.

[0026] Among the phytophagous insects, we can in particular cite Helicoverpa armigera, Bemisia tabaci, Plutella xylostella, Tribolium castaneum, Myzus persicae, Spodoptera frugiperda, Aphis gossypii, Nilaparvata lugens, Spodoptera exigua, Ceratitis capitata, Cydia pomonella, Acyrthosiphon pisum, Diaphorina citri or Thrips tabaci.

[0027] The term "cholinergic system" includes cholinergic receptors capable of binding acetylcholine, as well as their ligands. Only nicotinic receptors are of interest here, not muscarinic receptors.

[0028] "RNA interference" means the technique which makes it possible to specifically regulate the expression of a protein by inhibiting the translation of the mRNA. The mechanism already discussed above will be detailed below.

[0029] In a particular embodiment, the method may comprise the steps of: - prepare a double-stranded RNA specific to a target mRNA; - administering the double-stranded RNA to at least one harmful insect in a amount effective to induce mortality or sensitivity to an insecticide of the target insect.

[0030] In a particular alternative embodiment, the method may comprise the steps of: - prepare a single-stranded antisense oligonucleotide (ASO) specific to a target mRNA; - administering the single-stranded antisense oligonucleotide to at least one harmful insect in an amount effective to induce mortality or sensitivity to an insecticide of the target insect.

[0031] Antisense oligonucleotides are small, single-stranded nucleic acids (RNA or DNA) that have the ability to associate to form heteroduplexes with the target mRNA, inhibiting its function by impairing the translation of the mRNA into protein or by causing the destruction of the mRNA by recruiting RNAse H, which hydrolyzes the RNA in the RNA / DNA duplex. Their function differs depending on the type of oligonucleotide used for gene silencing.

[0032] In a particular embodiment, the target mRNA may be selected from the group comprising mRNAs of the neuronal subunit group α of the nicotinic receptor, mRNAs of the neuronal subunit group β of the nicotinic receptor, mRNAs encoding auxiliary proteins and molecules, and their isoforms, and a protein of the nicotinic receptor interactome.

[0033] Known nicotinic receptor proteins and auxiliary molecules are, for example, NACHO, Lynx, TMX3, RIC-3, UNC50 and their isoforms.

[0034] Here, the term "interactome" means all the molecular interactions that occur with the nicotinic receptor within a cell, tissue or organism, during various physiological processes.

[0035] Furthermore, herein the term “effective amount” is understood to mean to induce mortality or sen sensitivity to an insecticide of the target insect, an amount allowing an increase in mortality of at least 10% compared to no treatment or an improvement in sensitivity of at least 10% compared to treatment with the insecticide alone. This effective amount depends on both the effectiveness of each double-stranded RNA or antisense oligonucleotide, its functionality time, the type of administration and the target insect.

[0036] In a particular embodiment, the target mRNA may be at least one selected from the mRNAs of the neuronal subunits α1 to α10 of the nicotinic receptor and the mRNAs of the neuronal subunits [31 to [310 of the nicotinic receptor.

[0037] In an exemplary embodiment, the target mRNA may be selected from the group consisting of Acyrthosiphon pisum neuronal nicotinic receptor α subunit group mRNAs, namely mRNAs encoding the neuronal nicotinic receptor α subunit (SEQ ID NO: 1, Accession No: XM_008182407.3), mRNAs encoding the neuronal a2 subunit of the nicotinic receptor (SEQ ID NO: 2, accession no.: XM_008182417.3), mRNAs encoding the neuronal a3 subunit of the nicotinic receptor (SEQ ID NO: 3, accession no.: XM_008187942.3), mRNAs encoding the isoforms of the neuronal a4 subunit of the nicotinic receptor (SEQ ID NO: 4, accession no.: XM_029490651.1; SEQ ID NO: 5, accession no.: XM_029490650.1), mRNAs encoding the isoforms of the neuronal a6 subunit of the nicotinic receptor (SEQ ID NO: 6, accession no.: XM_016809607.2; SEQ ID NO: 7, accession no.: XM_016809606.2), mRNAs encoding isoforms of the neuronal α7 subunit of the nicotinic receptor (SEQ ID NO: 8, accession no.: XM_001945189.5; SEQ ID NO: 9, accession no.: XM_029490468.1; SEQ ID NO: 10, accession no.: XM_008187756.3; SEQ ID NO: 11, accession no.: XM_016806826.2; SEQ ID NO: 12, accession no.: XM_029490467.1; SEQ ID NO: 13, accession no.: XM_016806827.2), mRNAs encoding the neuronal a8 subunit of the nicotinic receptor (SEQ ID NO: 14, accession no.: XM_001949983.5), mRNAs encoding the neuronal a9 subunit of the nicotinic receptor (SEQ ID NO: 15, accession no.: XM_016807628.1), mRNAs encoding the neuronal a10 subunit of the nicotinic receptor (SEQ ID NO: 16, accession no.: XM_016807463.2), and their isoforms.

[0038] In another exemplary embodiment, the target mRNA may be selected from the group consisting of Acyrthosiphon pisum neuronal nicotinic receptor subunit group [3] mRNAs, namely mRNAs encoding the neuronal nicotinic receptor subunit

[31] (SEQ ID NO: 17, Accession No: XM_029487953.1) and mRNAs encoding the neuronal nicotinic receptor subunit

[32] (SEQ ID NO: 18, Accession No: XM_001945029.5), and isoforms thereof.

[0039] In an exemplary embodiment, the target mRNA may be selected from the group consisting of the mRNAs of the neuronal nicotinic receptor α subunit group of Periplaneta americana, namely the mRNAs encoding the neuronal nicotinic receptor α subunit (SEQ ID NO: 19, Accession No: KP725463.1), the mRNAs encoding the neuronal nicotinic receptor α2 subunit (SEQ ID NO: 20, Accession No: KP725464.1), the mRNAs encoding the neuronal nicotinic receptor α3 subunit (SEQ ID NO: 21, Accession No: KR021292.1), the mRNAs encoding the isoforms of the neuronal nicotinic receptor α4 subunit (SEQ ID NO: 22, Accession No: JN390946.1; SEQ ID NO: 23, Accession No: JN390945.1), mRNAs encoding the neuronal α5 subunit of the nicotinic receptor (SEQ ID NO: 24, accession no.: GFCQ01005211.1), mRNAs encoding isoforms of the neuronal α6 subunit of the nicotinic receptor (SEQ ID NO: 25, accession no.: JF731243.1; SEQ ID NO: 26, accession no.: JX466887.1; SEQ ID NO: 27, accession no.: JX466888.1; SEQ ID NO: 28, accession no: JX466889.1; SEQ ID NO: 29, Accession No: JX466890.1), mRNAs encoding isoforms of the neuronal α7 subunit of the nicotinic receptor (SEQ ID NO: 30, Accession No: MW201211.1; SEQ ID NO: 31, Accession No: JF731242.1; SEQ ID NO: 32, Accession No: MK790056.1; SEQ ID NO: 33, Accession No: JX466891.1), mRNAs encoding the neuronal α8 subunit of the nicotinic receptor (SEQ ID NO: 34, Accession No: MW201212.1), mRNAs encoding the neuronal α9 subunit of the nicotinic receptor (SEQ ID NO: 35, Accession No: MW201214.1), and their isoforms.

[0040] In another exemplary embodiment, the target mRNA may be selected from the group consisting of mRNAs of the neuronal subunit group [3 of the nicotinic receptor of Periplaneta americana, namely mRNAs encoding the neuronal subunit [31 of the nicotinic receptor (SEQ ID NO: 36, Accession No.: MW201213.1), mRNAs encoding the neuronal subunit [32 of the nicotinic receptor (SEQ ID NO: 37, Accession No.: GFCQ01032711.1), mRNAs encoding the neuronal subunit [33 of the nicotinic receptor (SEQ ID NO: 38, Accession No.: GFCQ01027461.1), mRNAs encoding the neuronal subunit [34 of the nicotinic receptor (SEQ ID NO: 39, accession no.: GAWS02039241.1), mRNAs encoding the neuronal subunit [35 of the nicotinic receptor (SEQ ID NO: 40, accession no.: GFCQ01009686.1), mRNAs encoding the neuronal subunit [36 of the nicotinic receptor (SEQ ID NO: 41, accession no.: GFCQ01010089.1), mRNAs encoding the neuronal subunit [37 of the nicotinic receptor (SEQ ID NO: 42, Accession No: GFCQ01012153.1), mRNAs encoding the neuronal subunit [38 of the nicotinic receptor (SEQ ID NO: 43, Accession No: GFCQ01034959.1), mRNAs encoding the neuronal subunit [39 of the nicotinic receptor (SEQ ID NO: 44, Accession No: GBJC01015771.1), mRNAs encoding the neuronal subunit [310 of the nicotinic receptor (SEQ ID NO: 45, Accession No: GFCQ01027794.1), and their . isoforms.

[0041] For this purpose, the double-stranded RNA or single-stranded antisense oligonucleotide can be administered by a topical administration method, by spraying, by vaporization, by means of nanoparticles such as lipid nanoparticles, chitosan, liposomes, niosomes, cationic dendrimers, lipoplexes, by food, by trapping in a bait box, by irrigation of the crops.

[0042] The administration is not limited to the methods provided above, but those skilled in the art will be able to include any other possible method of administration from an agricultural, agri-food, health and / or environmental point of view.

[0043] In one embodiment, the harmful insect may be at least one selected from phytophagous insects, saprophagous and detritiphagous insects, predatory insects, parasitic insects and commensal insects, hematophagous insects, in particular from phytophagous insects, more particularly He-licoverpa armigera, Bemisia tabaci, Plutella xylostella, Tribolium castaneum, Myzus persicae, Spodoptera frugiperda, Aphis gossypii, Nilaparvata lugens, Spodoptera exigua, Ceratitis capitata, Cydia pomonella, Acyrthosiphon pisum, Diaphorina citri or Thrips tabaci.

[0044] In particular, the harmful insect is Acyrthosiphon pisum.

[0045] The aphid is one of the most destructive insect pest species of crops to date. There are approximately 5,000 species of aphids in the world, 100 of which are pests with a significant economic impact through the destruction of crops. The damage caused by these insects is due, on the one hand, to a large number of offspring per aphid that can reproduce by parthenogenesis and, on the other hand, to the fact that these insects are piercing-sucking insects that feed on the sap of plants causing possible growth delays, discoloration or even deformation of plants, and that can transmit viruses. More specifically, the pea aphid A. pisum colonizes many cultivated legumes, which represent approximately 13% of cultivated areas in the world. This aphid is responsible for hundreds of millions of dollars in losses every year.

[0046] In another particular embodiment, the harmful insect is Periplaneta americana.

[0047] In a particular embodiment of the invention, the double-stranded RNA or antisense oligonucleotide may be administered by feeding at least one insect with a transgenic organism expressing the double-stranded RNA or antisense oligonucleotide.

[0048] For this purpose, the transgenic organism may be a transgenic plant.

[0049] Examples of transgenic plants include legumes, such as peas, beans, chickpeas, lentils, broad beans, fava beans, soybeans, alfalfa, lupins, sainfoin, trefoil, clovers or vetch, cereals, such as wheat, corn, sorghum, rye, barley, oats or rice, but also fruit and vegetable plants.

[0050] The invention also relates to an insecticidal composition for harmful insects, the composition comprising a double-stranded RNA or an antisense oligonucleotide and at least one of a transfection agent and a solvent, wherein said double-stranded RNA or antisense oligonucleotide comprises a nucleotide sequence which is at least 90% identical with at least a part of the sequence of a target mRNA, the target mRNA being selected from the group comprising the coding sequences of the genes of the neuronal subunit group α of the nicotinic receptor, the genes of the neuronal subunit group β of the nicotinic receptor, and their isoforms, the nucleotide sequences of the genes coding for the proteins and auxiliary molecules of the nicotinic receptor, and their isoforms, or for a protein of the interactome of the nicotinic receptor.

[0051] The composition of the invention is intended to be administered by a topical administration method, by spraying, by vaporization, by means of nanoparticles of the lipid nanoparticle type, chitosan, liposomes, niosomes, cationic den-drimers, lipoplexes, by food, by trapping in a bait box, by irrigation of crops.

[0052] The administration is not limited to the methods provided above, but those skilled in the art will be able to include any other possible method of administration from an agricultural, agri-food, health and / or environmental point of view.

[0053] In an exemplary embodiment, the invention provides an insecticidal composition comprising a double-stranded RNA or antisense oligonucleotide and a transfection agent or solvent, wherein said double-stranded RNA or antisense oligonucleotide comprises a nucleotide sequence that is at least 90% identical with at least a portion of the sequence of the target mRNA, wherein the target mRNA is selected from the group consisting of the coding sequences of the genes of the neuronal nicotinic receptor α subunit group of genes of Acyrthosiphon pisum, namely the mRNAs encoding the neuronal nicotinic receptor α subunit (SEQ ID NO: 1), the mRNAs encoding the neuronal nicotinic receptor α2 subunit (SEQ ID NO: 2), the mRNAs encoding the neuronal nicotinic receptor α3 subunit (SEQ ID NO: 3), the mRNAs encoding the neuronal nicotinic receptor α4 subunit (SEQ ID NO: 4), the mRNAs encoding the neuronal nicotinic receptor α5 subunit (SEQ ID NO: 5), the mRNAs encoding the neuronal nicotinic receptor α6 subunit (SEQ ID NO: 6), the mRNAs encoding the neuronal nicotinic receptor α7 subunit (SEQ ID NO: 7), the mRNAs encoding the neuronal nicotinic receptor α8 subunit (SEQ ID NO: 8), the mRNAs encoding the neuronal nicotinic receptor α9 subunit (SEQ ID NO: 9), the mRNAs encoding the neuronal nicotinic receptor α1 subunit (SEQ ID NO: 10), the mRNAs encoding the neuronal nicotinic receptor α1 subunit (SEQ ID NO: 11), the mRNAs encoding the neuronal nicotinic receptor α1 subunit (SEQ ID NO: 12), the mRNAs encoding the neuronal nicotinic receptor α2 subunit (SEQ ID NO: 1 isoforms of the neuronal α4 subunit of the nicotinic receptor (SEQ ID NO: 4;SEQ ID NO: 5), mRNAs encoding isoforms of the neuronal α6 subunit of the nicotinic receptor (SEQ ID NO: 6; SEQ ID NO: 7), mRNAs encoding isoforms of the neuronal α7 subunit of the nicotinic receptor (SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 12; SEQ ID NO: 13), mRNAs encoding the neuronal α8 subunit of the nicotinic receptor (SEQ ID NO: 14), mRNAs encoding the neuronal α9 subunit of the nicotinic receptor (SEQ ID NO: 15), mRNAs encoding; for the neuronal subunit alO of the nicotinic receptor (SEQ ID NO: 16), and their isoforms, and in the group consisting of the coding sequences of the genes of the neuronal subunit group [3 of the nicotinic receptor of Acyrthosiphon pisum, namely the mRNAs encoding the neuronal subunit [31 of the nicotinic receptor (SEQ ID NO: 17) and the mRNAs encoding the neuronal subunit [32 of the nicotinic receptor (SEQ ID NO: 18), and their isoforms.

[0054] In a particular embodiment, the transfection promoting agent may comprise, but is not limited to, a lipid compound, a liposome, a niosome, a lipid nanoparticle, a dendrimer, an insect virus.

[0055] It is understood that a person skilled in the art will be able to adapt the transfection method depending on the context and the need. RNA transfection techniques are widely described in the scientific literature.

[0056] In a particular embodiment, the composition may further comprise one or more agents selected from a synergistic agent, a repellent agent and an attractive agent.

[0057] The synergistic agent (or synergizing agent) may, for example, be piperonyl butoxide (PBO) which is a detoxification enzyme inhibitor. Its action is to slow down the degradation of toxic chemicals in insects and this mechanism allows the pesticide to be maintained in its toxic form for longer periods of time.

[0058] The term "repellent agent" means a natural or synthetic chemical substance used to repel the harmful insect of interest, in particular to protect agricultural crops or harvests.

[0059] The term "attractive agent" means a natural or synthetic chemical substance used to attract the harmful insect of interest, in particular to bait it or attract it towards a trap.

[0060] In a particular embodiment, the composition may further comprise a support that is acceptable from an agricultural, agri-food, health and / or environmental point of view.

[0061] Such a carrier refers to a non-toxic material that does not interfere with the effectiveness of the biological activity of the composition and that is compatible with a biological system such as a cell, cell culture, tissue or organism.

[0062] In a particular embodiment, the composition is formulated in the form of a bait for the harmful insect(s).

[0063] For this purpose, the composition may comprise an attractive agent intended to attract the insect towards a bait box to trap it inside it.

[0064] The invention also relates to a plant cell, a plant tissue or a transgenic plant comprising at least one nucleic acid which is transcribed in order to produce A double-stranded RNA, in which the double-stranded RNA comprises a nucleotide sequence having at least 90% identity with at least a part of the sequence of a target mRNA, the target mRNA being selected from the group consisting of the coding sequences of the genes of the neuronal subunit a group of the nicotinic receptor, the coding sequences of the genes of the neuronal subunit [3 group of the nicotinic receptor, and their isoforms, the nucleotide sequences of the genes coding for the proteins and auxiliary molecules of the nicotinic receptor, and their isoforms, or for a protein of the interactome of the nicotinic receptor.

[0065] In an exemplary embodiment, the invention provides a plant cell, plant tissue, or transgenic plant comprising one or more nucleic acids that is or are transcribed to produce a double-stranded RNA, wherein said double-stranded RNA comprises a nucleotide sequence that is at least 90% identical to at least a portion of the sequence of the target mRNA, wherein the target mRNA is selected from the group consisting of the coding sequences of the genes of the neuronal nicotinic receptor α subunit group of genes of Acyr-thosiphonpisum, namely the mRNAs encoding the neuronal nicotinic receptor α subunit (SEQ ID NO: 1), the mRNAs encoding the neuronal nicotinic receptor α2 subunit (SEQ ID NO: 2), the mRNAs encoding the neuronal nicotinic receptor α3 subunit (SEQ ID NO: 3), the mRNAs encoding isoforms of the neuronal α4 subunit of the nicotinic receptor (SEQ ID NO: 4;SEQ ID NO: 5), mRNAs encoding isoforms of the neuronal α6 subunit of the nicotinic receptor (SEQ ID NO: 6; SEQ ID NO: 7), mRNAs encoding isoforms of the neuronal α7 subunit of the nicotinic receptor (SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 12; SEQ ID NO: 13), mRNAs encoding the neuronal α8 subunit of the nicotinic receptor (SEQ ID NO: 14), mRNAs encoding the neuronal α9 subunit of the nicotinic receptor (SEQ ID NO: 15), mRNAs encoding the neuronal α10 subunit of the nicotinic receptor (SEQ ID NO: 16), and isoforms thereof, and in the group consisting of the coding sequences of the genes of the group of neuronal subunits [3 of the nicotinic receptor of Acyrthosiphon pisum, namely the mRNAs encoding the neuronal subunit [> I of the nicotinic receptor (SEQ ID NO: 17) and the mRNAs encoding the neuronal subunit [32 of the nicotinic receptor (SEQ ID NO: 18), and their isoforms. ;

[0066] For this purpose, the double-stranded RNA is at least 20 base pairs in length, in particular 20-2000 base pairs in length, preferably 20-900 base pairs in length.

[0067] Interfering RNA can inhibit the translation of mRNAs corresponding to the coding sequence of any of the genes of the neuronal subunit group a of the nicotinic receptor, genes of the neuronal subunit group [3 of the nicotinic receptor, and their isoforms, to any of the nucleotide sequences of the genes coding for the proteins and auxiliary molecules of the nicotinic receptor, and their isoforms, or to the DNA sequence coding for a protein of the nicotinic receptor interactome.

[0068] The antisense oligonucleotide can inhibit the translation of mRNAs corresponding to the coding sequence of any of the genes of the neuronal subunit group α of the nicotinic receptor, the genes of the neuronal subunit group [3 of the nicotinic receptor, and their isoforms, to any of the nucleotide sequences of the genes coding for the proteins and auxiliary molecules of the nicotinic receptor, and their isoforms, or to the DNA sequence coding for a protein of the interactome of the nicotinic receptor.

[0069] In an exemplary embodiment, the antisense RNA or oligonucleotide can inhibit the translation of the mRNA corresponding to the coding sequence of any one of the genes of the neuronal a subunit group of the Acyrthosiphon pisum nicotinic receptor, namely the mRNAs coding for the neuronal a1 subunit of the nicotinic receptor (SEQ ID NO: 1), the mRNAs coding for the neuronal a2 subunit of the nicotinic receptor (SEQ ID NO: 2), the mRNAs coding for the neuronal a3 subunit of the nicotinic receptor (SEQ ID NO: 3), the mRNAs coding for the isoforms of the neuronal a4 subunit of the nicotinic receptor (SEQ ID NO: 4; SEQ ID NO:5), the mRNAs coding for the isoforms of the neuronal a6 subunit of the nicotinic receptor (SEQ ID NO: 6; SEQ ID NO: 7), the mRNAs coding for the isoforms of the neuronal a7 subunit of the nicotinic receptor (SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 12;SEQ ID NO: 13), the mRNAs encoding the neuronal α8 subunit of the nicotinic receptor (SEQ ID NO: 14), the mRNAs encoding the neuronal α9 subunit of the nicotinic receptor (SEQ ID NO: 15), the mRNAs encoding the neuronal α10 subunit of the nicotinic receptor (SEQ ID NO: 16), and isoforms thereof, and any of the genes in the neuronal subunit cluster [3 of the nicotinic receptor of Acyrthosiphon pisum, namely the mRNAs encoding the neuronal subunit [31 of the nicotinic receptor (SEQ ID NO: 17) and the mRNAs encoding the neuronal subunit [32 of the nicotinic receptor (SEQ ID NO: 18), and isoforms thereof. ;

[0070] The invention also relates to the use of interfering RNA or antisense oligonucleotide as a bioinsecticide.

[0071] The term "bioinsecticide" or "biological insecticide" means a form of insecticide based on microorganisms or natural products. These bioinsecticides are biological or biologically derived agents that allow the management of harmful insects in a more environmentally friendly manner.

[0072] In another embodiment, the invention relates to the use of interfering RNA or antisense oligonucleotide as an agent for synergizing the insecticidal effect of an insecticide or a molecule with an insecticidal effect against a harmful insect.

[0073] The term “insecticidal effect synergizing agents” means molecules that make it possible to increase the effect of the insecticide by, for example, increasing sensitivity to it while reducing the concentration necessary for its action.

[0074] Examples of synergistic agents in this context include, but are not limited to, chemical molecules or microorganisms, such as insect viruses.

[0075] The expression “molecule with an insecticidal effect against a harmful insect” aims to describe complex natural substances such as essential oils or pheromones.

[0076] Examples of such substances include, in particular, lavender essential oil, geranium essential oil, citronella essential oil, eucalyptus essential oil, peppermint essential oil, cryptomeria essential oil, thyme essential oil.

[0077] Furthermore, the insecticide may include, but is not limited to, neonicotinoids, in particular imidacloprid, clothianidin, acetamiprid, dinotefuran, ni-tenpyram, thiacloprid and thiamethoxam, spinosyns, butenolides, mesoionics, sulfoximines, carbamates, pyrethroids, oxadiazines and organophosphorus compounds or the molecule with an insecticidal effect may include, but is not limited to, a natural substance, an essential oil, a pheromone.

[0078] In another embodiment, the invention relates to the use of interfering RNA or antisense oligonucleotide as an agent for restoring the sensitivity of a harmful insect to an insecticide.

[0079] For this purpose, the interfering RNA or antisense oligonucleotide of interest makes it possible to restore sensitivity to an insecticide which may have been lost due to excessive and / or incorrect exposure to the insecticide. Many biochemical, physiological or even behavioral mechanisms are developed by insects to try to escape the toxicity of insecticides.

[0080] This aspect is interesting and the experimental results obtained by the inventors suggest a particularly innovative use of interfering RNA or antisense oligonucleotides to overcome resistance to insecticides.

[0081] To better illustrate the object of the present invention, the following examples will now be described below, by way of illustration and not limitation, in conjunction with the appended drawings.

[0082] In these drawings:

[0083] [Fig. 1] is a histogram representing the quantification by qPCR of the expression of the transcripts of the nicotinic subunit [32 in the aphid A. pisum at 2h, 24h and 72h post-absorption of dsRNA ([32 or LacZ). The relative expression is normalized with the RPL7 gene (reference gene) according to the 2 AACt method (*p<0.05 [32 vs LacZ for each time, Mann-Whitney test, n=5 to 7).

[0084] [Fig.2] is a histogram representing the percentage of mortality corrected for aphids 24h, 48h and 72h after absorption of dsRNA LacZ or [32 (**p<0.01 vs LacZ, Mann-Whitney test, n=5 including 15 to 30 aphids per condition).

[0085] [Fig.3] is a graphical representation of the effect-concentration curve of the percentage of corrected mortality observed in aphid larvae as a function of imidacloprid concentration at 48h (A) and 72h (B) (n=5 including 20 aphid larvae per concentration).

[0086] [Fig.4] is a histogram representing the percentage of mortality corrected for aphids having absorbed dsRNA (LacZ or [32) 72h post-intoxication by imidacloprid (5.10 3pg / mL). DMSO is the solvent of imidacloprid serving as a control (**p<0.01 vs LacZ, Mann-Whitney test n=3 to 5 including 15 to 30 aphids per n and per condition).

[0087] [Fig.5A] is a histogram representing the quantification by qPCR of the expression of the mRNAs of the nicotinic subunits in the aphid A. pisum at 2h post-absorption of dsRNA [32 or LacZ. The relative expression is normalized by the RPL7 gene (reference gene) according to the 2 AACt method and the results are expressed in ratio with the control condition (dsRNA LacZ, corresponding with the value bar 1) (*p<0.05 [32 vs LacZ, **p<0.01, Mann-Whitney test).

[0088] [Fig.5B] is a histogram representing the quantification by qPCR of the expression of the mRNAs of the nicotinic subunits in the aphid A. pisum at 24h post-absorption of dsRNA [32 or LacZ.

[0089] [Fig.5C] is a histogram representing the quantification by qPCR of the expression of the mRNAs of the nicotinic subunits in the aphid A. pisum at 72h post-absorption of dsRNA [32 or LacZ.

[0090] [Fig.6] is a graphical representation of the qPCR quantification of the expression of nicotinic subunit transcripts [31 in the DGA (last abdominal ganglion) from P. americana cockroaches that ingested dsRNA (LacZ, [31-start, [31-end and [31-start+end mix). The relative expression is normalized with the actin gene (reference gene) according to the 2 AAct method (*p<0.05 vs LacZ, Mann-Whitney test, n=4 to 8).

[0091] [Fig.7A] is a histogram representing the percentage of corrected mortality 96h after acute imidacloprid poisoning of cockroaches exposed (IMI J30) and not exposed (NE) to the sublethal dose of imidacloprid for 30 days.

[0092] [Fig.7B] is a histogram representing the percentage of corrected mortality 96h after acute imidacloprid poisoning of cockroaches exposed to the sublethal dose of imidacloprid for 30 days having ingested the dsRNA (LacZ, [31-fin or [31 -start+end) or not (IMI J30). (n=1 including 8 to 9 cockroaches per condition).

[0093] Referring to [Fig. 1], it can be seen that the expression levels of mRNAs coding for the nicotinic [32 subunit in A. pisum aphids significantly decreased by 51%, 43% and 41% in aphids that absorbed the dsRNA [32 compared to control aphids that absorbed the LacZ dsRNA at 2h, 24h and 72h, respectively. This allows us to verify the effectiveness of dsRNAs on the expression of transcripts of the nicotinic [32 subunit of the pea aphid.

[0094] Referring to [Fig.2], it can be seen that the corrected mortality of aphids at 24h, 48h and 72h after topical application of dsRNA is increased in aphids having absorbed dsRNA targeting the [32 subunit compared to control aphids (dsRNA LacZ) by approximately 6%, 31% and 51%, respectively.

[0095] If we refer to [Fig.3], we can see that the imidacloprid concentration / effect on aphid mortality curves allow us to estimate the LC50 at 8.10 3pg / mL at 48h and 4.103pg / mL at 72h. For the rest of the experiments combining the dsRNAs directed against the nicotinic subunit [32 and imidacloprid, the imidacloprid concentration of 5.10 3pg / mL is retained.

[0096] In [Fig.4], it can be seen that at 72h post-intoxication with imidacloprid at 5.103 pg / mL, the percentage of mortality increases by approximately 1.4 times in aphids having absorbed dsRNA targeting the subunit [32 (82%) compared to control aphids (LacZ, 60%). DMSO, the solvent for imidacloprid, serves as a positive control.

[0097] Referring to [Fig.5A], the expression levels of the mRNAs corresponding to the different nicotinic subunits identified in the genome of the aphid A. pisum were quantified by qPCR from the cDNAs from aphids having absorbed dsRNAs at different times post-administration. [Fig.5A] shows that 2 hours after administration of the dsRNAs, a significant increase in the expression of the mRNAs coding for the subunits a1 to a8 is highlighted in the aphids having absorbed the dsRNAs of interest compared to the control aphids while the expression of the subunits a9, a10 and [31 is not modified. [Fig.5B] shows that 24 hours post-administration of the dsRNAs, only the expression of the subunit a9 is affected by the decrease in the expression of the subunit [32. [Fig.5C] shows that at 72h post-administration, the decrease in the expression of the

[32] subunit does not appear to impact the expression of the other nicotinic subunits.

[0098] In [Fig.6], we can note at 96h post-ingestion of dsRNA a decrease in the expression of transcripts of the nicotinic subunit

[31] of 20% in the DGA from cockroaches exposed to dsRNA [31-end and to the mixture of dsRNA [31-start+end. On the other hand, the expression of mRNA of the subunit

[31] does not seem to be affected by dsRNA [31-start targeting the beginning of the nucleotide sequence of

[31] .

[0099] Referring to [Fig.7A], it can be seen that sublethal imidacloprid poisoning for 30 days induces a loss of sensitivity of cockroaches to this insecticide following re-exposure of the cockroaches to an acute poisoning of 96 hours. [Fig.7B] shows that, unlike cockroaches that ingested LacZ dsRNA, corrected mortality rates of 55% and 60% were observed 96 hours after acute imidacloprid poisoning in cockroaches that ingested [31-end+start and [31-end] dsRNAs, respectively. These rates are similar to those obtained in cockroaches not exposed to the sublethal dose of imidacloprid for 30 days, which suggests that dsRNA, by modifying the expression of nAChRs, could circumvent the resistance mechanisms put in place by the insect by restoring their sensitivity to the insecticide. EXAMPLES

[0100] The following examples illustrate the invention.

[0101] Example 1: Development of the RNA interference technique targeting the nicotinic subunit [32 in the pea aphid A. pisum as a means of controlling harmful insects

[0102] For this species of harmful insect, the inventors focused on a divergent nicotinic subunit, the neuronal subunit [32, in order to preserve non-target organisms.

[0103] Materials and methods Study model: the aphid Acyrthosiphon pisum

[0104] Pea aphids Acyrthosiphon pisum are reared in the SiFCIR laboratory on fava bean plants covered with a perforated cellophane bag and closed with an elastic band in an enclosure at a temperature of 20°C with a photoperiod of 16 hours of light and 8 hours of darkness. To ensure this rearing, 7 larvae reproducing by parthenogenesis are placed on each fava bean plant every 10 days. On the 21st day, adult aphids are used for experiments. Extraction of total RNA

[0105] The extraction of total RNA is carried out using the NucleoSpin® RNA kit (Macherey-Nagel) from adult aphids. To do this, each aphid is ground using an ultra-turrax® in 350qL of lysis buffer (RAI) supplemented with 3.5pL of [3-mercaptoethanol] and then the ground material is filtered. The nucleic acids contained in the lysate are then precipitated with 70% ethanol (350qL) and then fixed on a silica membrane. After DNase treatment and various membrane washes, the RNAs are eluted in 50qL of H20. The quality and quantity of the RNAs obtained are evaluated by a spectrophotometric assay (SimpliNano). Reverse transcription

[0106] cDNA synthesis from mRNAs is performed with the RevertAid H Minus First strand cDNA Synthesis® kit (Thermoscientific). Thus, 500ng of total RNA (H2O qsp 11qL) are incubated at 65°C for 5 minutes with 1qL of oligo(dT)18 primers (0.5p.g / pL) to allow hybridization of the primer to the poly(A) tail of the mRNAs. Then, an 8qL reaction mixture composed of 4qL of 5X reaction buffer, 1qL of RiboLock RNase Inhibitor (20U / qL), 2qL of dNTP (10mM) and 1 pL of RevertAid H Minus M-MuLV Reverse Transcriptase enzyme (200U / pL) is added. Reverse transcription is performed for 1 hour at 42°C and a final 5-minute step at 70°C to inactivate the reverse transcriptase is performed. Finally, the cDNA samples obtained are stored at -20°C. Amplification of sequences of interest by PCR

[0107] In order to obtain the coding sequence of the

[32] subunit (NCBI accession no.: XM_001945029.5 - SEQ ID NO: 18) and the 140bp nucleotide fragment necessary for the synthesis of dsRNA targeting this subunit, PCR amplification is carried out from the cDNA of the aphid A. pisum with the high-fidelity polymerase KOD Hot Start™ (Novagen) using respectively [32-ORF primers specific for the open reading frame and [32-dsRNA primers comprising the T7 promoter sequence (5'- TAATACGACTCACTATAGGG-3') (Table 1).Thus, from a reaction mixture composed of 0.4pL of high-fidelity KOD DNA polymerase (1U / pL, Novagen), 2pL of KOD buffer (10X), 2pL of dNTP (2mM), 1.2pL of MgSO4 (10mM), 1.2pL of sense and antisense primers (10pM), 2pL of cDNA diluted to 1 / 20th and 1.2pL of H2O, the amplicons of interest are obtained after an initial denaturation at 95°C for 2 minutes followed by 30 cycles composed of 3 steps (denaturation for 20 seconds at 95°C, hybridization for 20 seconds at 60°C and elongation for 10 seconds at 70°C) then a final elongation of 5 minutes at 72°C.

[0108] In parallel, the amplification of a part of the bacterial nucleotide sequence coding for [3-galactosidase (140bp), present in the plasmid pCR-Blunt, is carried out using the specific primers LacZ-dsRNA (Table 1) associated with the sequence of the T7 promoter. This amplicon will be used for the production of control dsRNA.

[0109] [Tables] Primers (5'-3') Amplicon size (bp) SEQ ID NO: [32-ORF Sense: AGCATTCTGACTACAGCGAG Antisense: AACTAGTAGATAGATACA- CAAACATTGAT 1519 46 47 [32-dsRNA Sense: TAATACGACTCACTATAGGGTA- GATGCTGCAATAACAGAC Antisense: TAATACGACTCACTATAGG- GAGTGTCTATCGTAGAACCTC 140 48 49 LacZ-dsR NA Sens: TAATACGACTCACTATAGGGATGAC- CATGATTACGCCAAG Antisense: TAATACGACTCACTA- TAGGGTGGCGGCCGTTACTAGTGGA 140 50 51 [32-qPCR Sense: CGCAAAGACGAAGAGTCGAG Antisense: ACGGATAGCGTCAGGAACAC 151 52 53 RPL7-qPC R Sense: ACGTAAAGAGCGCGTGAAGA Antisense: GGTTCACACCACGAATACGCA 182 54 55

[0110] Table 1: Sequences of primers used for cloning of the

[32] subunit, dsRNA synthesis and qPCR. The T7 promoter sequence is boxed. Purification of PCR products

[0111] After electrophoretic migration on a 2% agarose gel, the PCR products are purified using the NucleoSpin® Gel and PCR clean-up kit (Macherey-Nagel). Briefly, the piece of agarose gel containing the amplicons of interest is dissolved in a water bath at 50°C in NT1 buffer (200qL for 100mg of gel) containing chaotropic salts allowing the fixation of the DNA on a silica membrane. After complete dissolution of the gel, the amplicons are retained by a silica membrane and two washes with 700qL of NT3 buffer (30-second centrifugations at 11000g) are carried out. The PCR products are eluted in 30pL of H2O by centrifugation for 1 minute at 11000g. The quality and quantity of DNA are finally assessed by spectrophotometry (SimpliNano).

[0112] Molecular cloning of the nicotinic subunit [32

[0113] Cloning of the

[32] subunit is carried out using the Zero Blunt© PCR Cloning kit (Invitrogen). To do this, the purified amplicons corresponding to the coding sequence of the

[32] subunit are inserted into the PCR-Blunt cloning vector according to a ratio “insert:vector” of 10:1. Thus, 1pL of plasmid pCR-Blunt (25ng / pL), 6pL of purified insert, 2pL of ExpressLink T4 DNA ligase reaction buffer (5X) and 1pL of ExpressLink T4 DNA ligase enzyme (5U / pL) are incubated for 30 minutes at room temperature. Then, 4pL of the ligation product is introduced into chemo-competent E. Coli One Shot© Top 10 bacteria following bacterial transformation by heat shock (30 minutes in ice then 45 seconds at 42°C and finally 2 minutes in ice). The transformed bacteria are incubated for 1h at 37°C in 250pL of SOC medium then spread on Petri dishes containing a selective LB-agar medium supplemented with kanamycin (50pg / mL). After an overnight incubation at 37°C, the recombinant clones are selected using PCR using M13 primers specific to the flanking plasmid sequences of the insert and then cultured overnight in 5mL of LB-kanamycin medium at 37°C with shaking (225 rpm).The recombinant plasmids are finally purified using the NucleoSpin Plasmid® kit (Macherey-Nagel) and sequenced (Eurofins). In vitro transcription and synthesis of dsRNA

[0114] The purified PCR products (140bp) specific for a part of the coding sequence of the

[32] subunit or [3-galactosidase containing upstream and downstream the T7 promoter sequence are transcribed in vitro using the MEGAscript® T7 High Yield Transcription kit (Ambion). The transcription reaction is carried out at 37°C overnight from a 20pL reaction mixture composed of 100ng of PCR products, 2pL of each nucleotide (ATP, GTP, CTP, UTP; 75mM), 2pL of reaction buffer (10X), 2pL of T7 RNA polymerase enzyme. A TURBO DNase treatment (2U) is then carried out for 15 minutes at 37°C in order to eliminate the template DNA and then the transcription products are purified using the NucleoSpin® miRNA kit (Macherey-Nagel).First, 150 pL of ML buffer and 200 pL of absolute ethanol are added to the transcription products (qsp 150 pL H2O) then the mixture is deposited on a silica membrane to fix the DNA and large RNA fragments (>200 bp). After centrifugation at 11000g for 30 seconds, 100pL of MP buffer and 800pL of MX buffer are added to the eluate containing RNA fragments smaller than 200 bp such as dsRNA to allow their precipitation and fixation on the silica membrane. In parallel, a 15-minute DNAse treatment at room temperature is carried out on the silica membrane previously desalted using 350 pL of MDB buffer (one-minute centrifugation at 11000g). After the fixation of the small RNA fragments on the silica membrane (centrifugation for 30 sec at 11000 g), the membrane is washed twice with MW2 buffer, the dsRNAs are eluted in 30 pL of H2O.Finally, the dsRNAs are denatured for 5 minutes at 95°C and then rehybridized for 1h30 at room temperature. The quality and quantity of the dsRNAs are evaluated using a spectrophotometer (ShnpliNano). The dsRNAs . obtained are stored at -20°C.

[0115] Preparation of lipoplexes containing dsRNA and topical administration

[0116] In order to facilitate the absorption of dsRNA in the aphid and limit the degradation of dsRNA, liposomes containing the different dsRNAs (lipoplexes) are produced. To do this, 400ng of dsRNA ([32 or LacZ) are brought into contact with 0.1 pL of Escort IV® transfection agent (Sigma-Aldrich) in the presence of 1x PBS (qsp 1 uL) for 30 minutes at room temperature. The dsRNAs are absorbed following topical administration in the adult aphid according to Niu et al (2019). Briefly, the aphids are immobilized using a piece of parafilm® which will have been previously pierced in order to have access to the abdomen of the aphid. Thus, 1 pL of lipoplexes containing the dsRNAs is deposited on the abdomen of the aphid. A waiting time of 30 minutes is necessary for the drop to completely penetrate the aphid.

[0117] Quantitative PCR analysis of

[32] subunit expression in aphids that have absorbed dsRNA

[0118] From the cDNAs from the different batches of aphids having absorbed dsRNA ([32 or LacZ), the quantification of the transcripts of the [32 subunit is carried out by quantitative PCR (qPCR) in order to evaluate the effect of the dsRNAs targeting the [32 subunit on the expression of this subunit at different times post-administration (2h, 24h and 72h), as well as on the expression of the different nicotinic subunits and then highlight potential compensation phenomena. Each qPCR reaction requires 5pL of Takyon No Rox SYBR® Master Mix Blue dTTP reaction buffer (Eurogentec), 1pL of sense and antisense primers (10pM) (Table 1), 0.5pL of H2O and 2.5pL of cDNA diluted to 1 / 10. The quantification program consists of a first step of 3 minutes at 95°C followed by 40 cycles of denaturation of 10 seconds at 95°C and annealing and elongation of 1 minute at the primer annealing temperature (60°C).Finally, an additional dissociation curve (“melting curve”) step is performed, which allows the temperature to gradually increase from 50°C to 95°C to verify the primer specificity. The efficiency of the different qPCR amplifications ranges from 97% to 102%. All reactions are performed in duplicate and the threshold cycle (Ct) values are normalized with the reference gene encoding the RPL7 protein. The fluorescence intensity emitted by the SYBR® Green I probe is detected by the CFX Connect™ Real-Time PCR Detection System thermocycler (Biorad), and the data are then analyzed using the CFX Maestro™ Software. The relative expression of the nicotinic subunits is evaluated according to the 2−ΔΔCt method.. Mortality tests

[0119] The mortality tests are performed using an artificial feeding system consisting of a PVC tube closed with parafilm® at each end, in which are deposited 5 adult aphids or 20 larvae. At one end of the artificial nutrition "cell", 200 μL of nutrient solution including the solution to be tested (insecticide, dsRNA) are deposited on the parafilm and then covered with a second parafilm allowing the aphids to suck up the solution to feed by piercing the parafilm with their rostrum. The cells are placed at 20°C in an enclosure with a 16-hour photoperiod. In order to determine the concentration of imidacloprid leading to 50% mortality (LC50) in aphid larvae, an effect-concentration curve is established at 48 and 72 hours from a concentration range of 106 to 10 μg / mL of imidacloprid.

[0120] In order to evaluate the effectiveness of the strategy using interfering RNA as a bioinsecticide, the mortality of adult aphids is observed at 24h, 48h and 72h after the absorption of dsRNA. The modulating effect of dsRNA on the sensitivity of aphids to imidacloprid will be studied by combining the topical administration of dsRNA and toxicological tests with imidacloprid.

[0121] Acute intoxication with imidacloprid (5.103qg / mL) is carried out 2h after absorption of dsRNA and aphid mortality is evaluated at 24h, 48h and 72h.

[0122] The death of the insect is validated in the absence of movement observed under a binocular microscope. The results are expressed as a percentage of mortality corrected according to the Henderson-Tilton formula allowing for taking into account the mortality of aphids under control conditions:

[0123] [Math.l] Corrected mortality = h - \ *100 Corrected MOHOlUe (1 mLacZ^nvfil+nmpi) / 1

[0124] where nvLacZ is the number of live aphids in the control condition; nMLacZ is the number of dead aphids in the control condition; nvp2 is the number of live aphids that absorbed dsRNA [32 and nMp2 is the number of dead aphids that absorbed dsRNA [32. Statistical analyses

[0125] Statistical analyses of qPCR results are performed using a Mann-Withney test, using GraphPad Prism software (version 8.0.1, GraphPad Software) where p values ​​less than 0.05 are considered significant (*p<0.05, **p<0.01 and ***p<0.001).

[0126] The mortality curves are obtained with the GraphPad Prism software in the form of a non-linear regression and adjusted according to the Hill equation,

[0127] [Math.2] I — WZ+ A ,,r nH / -HAS

[0128] where Y is the percentage of mortality observed at the concentration value X, m and M are the minimum and maximum values ​​of the curve, respectively, nH is the Hill coefficient and CLSo is the imidacloprid concentration resulting in 50% mortality. The results are expressed as mean ± SEM. Nature of the effect of dsRNA

[0129] In order to determine the nature of the effect of dsRNA targeting the

[32] subunit on the sensitivity of aphids to imidacloprid, the results are analyzed by the Model Deviation Ratio (MDR) formula:

[0130] MDR = observed toxicity / expected toxicity

[0131] where the observed toxicity corresponds to the percentage of corrected mortality of aphids having absorbed the dsRNA [32 and exposed to imidacloprid and the expected toxicity corresponds to the sum of the percentages of corrected mortality obtained in aphids of each condition taken individually (dsRNA [32 and imidacloprid). The MDR results are interpreted as follows: if the MDR is greater than or equal to 1.3, the effect is considered synergistic; if the MDR is less than or equal to 0.7, then the effect is antagonistic; and if the MDR is between 0.7 and 1.3, the effect is additive. Results

[0132] Obtaining the plasmid pCR-Blunt containing the nucleotide sequence coding for the nicotinic subunit [32

[0133] In order to confirm the nucleotide sequences (accession No. XM_001945029.5, SEQ ID NO: 18) and protein sequences (accession No. XP_001945064.2 SEQ ID NO: 56) coding for the

[32] subunit deposited in the NCBI database in the aphids of the SiFCIR laboratory, the plasmid construction with the pCR-Blunt vector was carried out. The sequence inserted into the recombinant plasmid obtained at the end of this cloning has 100% homology with the deposited protein sequence.

[0134] Efficacy of dsRNAs on the expression of nicotinic subunit transcripts [32

[0135] In order to determine the efficacy of dsRNAs targeting the [32 subunit, the expression levels of mRNAs coding for this protein were quantified by qPCR in adult aphids having absorbed dsRNAs ([32 or LacZ). This quantification was carried out at different post-absorption times (2h, 24h and 72h). Thus, significant decreases in the expression of the [32 subunit of 51%, 43% and 41% were observed in aphids having absorbed dsRNAs [32 compared to control aphids having absorbed LacZ dsRNAs at 2h, 24h and 72h respectively (*p<0.05; [Fig.l]). For toxicological tests in the presence of imidacloprid associated with the absorption of dsRNA, the 2h dsRNA incubation time will be kept.

[0136] Effect of dsRNA on aphid mortality

[0137] In order to verify whether dsRNAs targeting the

[32] subunit can be used in As a bioinsecticide, the inventors evaluated aphid mortality 24h, 48h and 72h after topical application of dsRNA. Preliminary results suggest an increase in mortality of aphids that absorbed dsRNA targeting the [32 (|32) subunit compared to control aphids (LacZ) of approximately 6%, 31% and 51% at 24h, 48h and 72h respectively ([Fig.2]; n=5 including 15 to 30 aphids per condition). Thus, the use of dsRNA as a bioinsecticide is feasible under these experimental conditions, namely a single topical administration of 400ng per aphid.

[0138] Evaluation of the sensitivity of aphids to imidacloprid and determination of CL 50

[0139] Before studying the involvement of the

[32] subunit in the modulation of aphid sensitivity to imidacloprid, the concentration of imidacloprid resulting in 50% insect mortality was determined. For this, different concentrations of imidacloprid ranging from 106 to 10qg / mL were tested. From the concentration-effect curve, the LC50 was estimated at 8.10 3qg / mL and 4.10 3qg / mL at 48h and 72h respectively ([Fig.3]). The concentration of 5.10 3qg / mL is retained for the experiments combining dsRNA targeting the

[32] subunit and imidacloprid.

[0140] Effect of dsRNA on aphid sensitivity to imidacloprid

[0141] Given that the nicotinic subunit composition of nAChRs determines their sensitivity to insecticides, the decrease in the expression of mRNA of the [32 subunit by specific dsRNAs observed in aphids suggests a modification of the composition of nAChRs inducing a modulation of the efficacy of an insecticide treatment. To evaluate the effect of dsRNAs as a modulator of the efficacy of an insecticide treatment, toxicological tests in the presence of imidacloprid are carried out. For this purpose, adult aphids having absorbed the dsRNAs are intoxicated with imidacloprid at a concentration close to the LC50, namely 5.10 3qg / mL. 72 hours after acute intoxication, a slight increase in mortality (x1.4 times) is observed in aphids having absorbed dsRNA directed against the subunit [32 compared to control aphids (LacZ) ([Fig.4]).Thus, the use of specific dsRNAs inducing a modification of the composition of nAChRs would make insects more sensitive to the insecticide.

[0142] In order to determine the nature of the effect of the association "dsRNA [32 and imida-cloprid", the results were analyzed according to the Model Deviation Ratio (MDR) and the value of the MDR was evaluated at 0.74. Thus, the MDR being between 0.7 and 1.3, the effect of the association dsRNA against the subunit [32 and imidacloprid is considered additive.

[0143] Effect of the decrease of the

[32] subunit on the expression of other nicotinic subunits in the aphid A. pisum

[0144] To correlate the modification of the sensitivity of aphids having absorbed the dsRNAs targeting [32 to possible changes in the composition of nAChRs, the expression levels of the mRNAs corresponding to the different nicotinic subunits identified in the genome were quantified by qPCR from the cDNAs from aphids having absorbed dsRNAs at different post-administration times (2h, 24h and 72h). Two hours after the administration of the dsRNAs, a significant increase in the expression of the mRNAs coding for the subunits a1 to a8 is highlighted in aphids having absorbed the dsRNAs of interest compared to control aphids ([Fig.5A]) while the expression of the subunits a9, a10 and [31 is not modified.

[0145] At 24h post-administration of dsRNA, only the decrease in the expression of the a9 subunit is associated with the decrease in the expression of the [32 subunit in aphids having absorbed the dsRNA [32 ([Fig.5B]). Finally, the decrease in the expression of the [32 subunit induced by the dsRNA [32 observed at 72h does not seem to impact the expression of the other nicotinic subunits ([Fig.5C]).

[0146] These results make it possible to consider interfering RNAs as a potentiating agent for an insecticide such as imidacloprid, with a view to reducing the quantity of insecticide used in the fight against harmful insects, in accordance with government directives.

[0147] The inventors were therefore able to demonstrate an increase in the mortality of aphids having absorbed the dsRNA targeting the

[32] subunit of approximately 40% from 48h to 72h post-absorption, compared to control aphids. These results suggest the opportunity to use dsRNA directed against the

[32] subunit as a bioinsecticide and suggest that this subunit is essential in the aphid.

[0148] Finally, aphids having absorbed dsRNAs targeting the

[32] subunit show better sensitivity to imidacloprid compared to control aphids having absorbed LacZ dsRNAs. The results of toxicological tests suggest that the decrease in the expression of the

[32] subunit induced by the interfering RNAs of interest could lead to a modification of the composition of nicotinic receptors in aphids making them more sensitive to the insecticide.

[0149] Example 2: Use of the RNA interference technique targeting a nicotinic subunit in the cockroach as a means of restoring the sensitivity of the harmful insect that has become resistant to the insecticide

[0150] In this study, the cockroach P. americana was used as a model. Indeed, this insect, whose genome has recently been sequenced but not annotated, is capable of adapting to insecticide treatment by modifying its composition in nicotinic subunits (Benzidane Y et al., 2017) and has well-identified and characterized neuronal targets of insecticides (Thany SH et al., 2007; Sinakevitch IG et al., 1996; Grolleau F et al., 2000).

[0151] To date, 19 nicotinic subunits have been identified in P. americana and deposited in the NCBI database: 9 α subunits (α1 to α9) and 10 β subunits (β31 to β310) (Jones et al., 2021). The β subunit belonging to the majority of heteropentameric nAChRs, it represents a target of choice for dsRNAs in order to develop the RNA interference technique in the context of the invention.

[0152] Materials and methods Production of dsRNA

[0153] Identification of specific fragments of interest of the nicotinic subunit [31

[0154] In order to determine the nucleotide fragments (100 bp) specific to the coding sequence of the subunit [31 (NCBI accession number: MW201213.1 - SEQ ID NO: 36) necessary for the synthesis of dsRNA, the alignment of the different nicotinic subunits identified in the cockroach P. americana was carried out using the Clustal Omega software.

[0155] Amplification of specific fragments by PCR

[0156] The plasmid pCR-Blunt into which the nucleotide sequence of the nicotinic subunit

[31] was inserted (pCR-Blunt / [31) served as a template for obtaining the fragments of interest. PCR amplification was performed using KOD Hot Start™ High Fidelity DNA Polymerase (Novagen) using the specific primers dsRNA-[31 (Table 2) supplemented with the T7 promoter sequence (5'-TAATACGACTCACTATAGGG-3') according to the following reaction mixture: 0.4 pL KOD DNA polymerase (1 U / pL), 2 pL KOD buffer (10X), 2 pL dNTPs (2 mM), 1.2 pL MgSO4 (10 mM), 1.2 pL forward and reverse primers (10 pM), 2 pL pCR-Blunt / [31 plasmid (10 ng / pL) and H2O qs 20 pL.

[0157] The amplicons are obtained after an initial denaturation at 95°C for 2 minutes followed by 30 cycles composed of 3 steps (denaturation for 20 seconds at 95°C, hybridization for 20 seconds at 60°C and elongation for 10 seconds at 70°C) then a final elongation of 7 minutes at 70°C.

[0158] In parallel, the amplification of a part of the bacterial nucleotide sequence coding for [3-galactosidase (100 bp), present in the plasmid pCR-Blunt, was carried out using the specific primers LacZ (Table 2) associated with the sequence of the T7 promoter. This amplicon will be used for the production of control dsRNA.

[0159] [Tables2] Primers (5'-3') Size of the amplicon (bp) Position on the sequence (base number) SEQ ID NO: [31-start Sense: TAATACGACTCACTATAGGGAT- GAACACGGGGGCGCGAGC Antisense: TAATACGACTCACTATAGGGCAT CCTCCGAGCACCAACCA 140 1-100 57 58 [31-end Sense: TAATACGACTCACTA- TAGGGCCGCCGCACCCCTCGTACGG Antisense: TAATACGACTCACTA- TAGGGGGTCCGACAGCTCCATCACC 140 1123-12 22 59 60 LacZ Sense: TAATACGACTCACTATAGGGAT- GACCATGATTACGCCAAG Antisense: TAATACGACTCACTA- TAGGGTGGCGGCCGTTACTAGTGGA 140 1-100 61 62

[0160] Table 2: Sequences of primers used for dsRNA synthesis. The T7 promoter sequence is boxed.

[0161] Purification of PCR products and in vitro transcription and synthesis of dsRNA

[0162] The protocol detailed above for the pea aphid was used.

[0163] Study model: Periplaneta americana cockroaches

[0164] P. americana cockroaches are raised in the SiFCIR laboratory in vivariums at a temperature of 29°C and with a cyclic photoperiod of 12 hours of light and 12 hours of darkness. They are fed and hydrated ad libitum.

[0165] In order to circumvent the resistance mechanisms put in place by the insect, the dsRNAs will be tested on male cockroaches having been exposed for 30 days to a sublethal dose of imidacloprid (0.025 qg / cockroach / day) according to Benzidane et al. (2017). Preparation of lipoplexes containing dsRNAs

[0166] In order to orally administer dsRNAs to cockroaches and for better stability of these dsRNAs, lipoplexes, liposomes containing the different dsRNAs ([31-start, [31-end or LacZ), were formed. To do this, 0.25 qg of dsRNA ([31-start, [31-end, [31-start + [31-end, LacZ) at 0.1 qg / qL are brought into contact with 1 qL of Escort IV® transfection agent (Sigma-Aldrich) in the presence of 6.5 qL of 5% glucose solution for 30 minutes at room temperature. Ingestion of dsRNA in cockroaches

[0167] The dsRNAs are administered to the cockroaches orally. Briefly, using a P10 pipette, 10 μL of lipoplex solution containing the dsRNAs ([31-start, [31-end, [31-start+fm, LacZ) are ingested by the cockroach which is held by the wings. The effect of the dsRNAs as a bioinsecticide is evaluated by observing mortality at 24h, 48h, 72h and 96h post-ingestion.

[0168] Dissection of the last abdominal ganglion and extraction of total RNA

[0169] 96 hours after ingestion of the dsRNA, the cockroaches are dissected to extract the last abdominal ganglion (DGA) which contains the DUM neurons. Extraction of total RNA from the DGA is performed using the Nucleospin® RNA kit (Macherey-Nagel). The quantity of extracted RNA is then assessed by a UV spectrophotometer assay (SimpliNano).

[0170] Reverse transcription

[0171] Reverse transcription allowing the synthesis of cDNA from mRNA is carried out using the Revertaid H Minus First Strand cDNA Synthesis® kit (ThermoScientific) as described above.

[0172] Quantitative PCR analysis of the expression of the

[31] subunit in cockroaches having ingested the dsRNA

[0173] From the cDNAs from the different batches of cockroaches having ingested the dsRNAs ([31-start, [31-end, [31-start+end, LacZ), the quantification of the transcripts of the [31 subunit was carried out by quantitative PCR (qPCR) in order to evaluate the effect of the dsRNAs on the expression of the [31 subunit. The protocol is adapted from that used in the pea aphid, with the sense and antisense primers indicated in Table 3 (2.5 pM for the [31 subunit and 10 pM for actin used as a reference gene, and the hybridization temperature of the primers also indicated in Table 3).

[0174] [Tables3] Gene Sense primers (5'-3') Antisense primers (5'-3') Hybridization accession number (°C) SEQ ID NO: [31 GGTGACCAAG TGTCCTTAG ATGATTGCCCT CGTAGATG MW201213.1 65 63; 64 Actin e GACTACTGGT ATTGTGCTGG AAAGCTGTAA CCACGCTCAG AY 116670.1 60 65; 66

[0175] Table 3: Sequences of primers used for qPCR Results

[0176] Identification of specific fragments of interest of the nicotinic subunit [37

[0177] Following the bioinformatic analysis using the alignment of the different nucleotide sequences of the nicotinic subunits of the cockroach P. americana deposited in the NCBI database, 2 fragments of 100 bp specific to the nicotinic subunit [31 were identified. The 1st is located at the beginning of the nucleotide sequence (nucleotide no. 1 to 100 - SEQ ID NO: 67) while the 2nd is found towards the end (nucleotide no. 1123-1222 - SEQ ID NO: 68).

[0178] Effect of dsRNA on the expression of nicotinic subunit transcripts [31

[0179] The inventors were able to demonstrate, 96 hours post-ingestion, a decrease in the expression of transcripts of the [31 subunit of 20% in the DGA from cockroaches exposed to dsRNA-[31 end and to the mixture of dsRNA-[31 start and end (*p<0.05). On the other hand, the expression of mRNA of the [31 subunit does not seem to be affected by the dsRNA [31-start targeting the beginning of the nucleotide sequence of [31 ( [Fig.6]).

[0180] For the rest of the experiments, only the dsRNA [31-end and the mixture of dsRNA [31-start and [31-end will be ingested by the cockroaches for the toxicological tests.

[0181] Use of dsRNA to circumvent resistance mechanisms in the cockroach P. americana

[0182] In order to study the effectiveness of dsRNA in restoring the loss of sensitivity observed in resistant insects, toxicological tests using cockroaches made less sensitive to imidacloprid following exposure to a sublethal dose of imidacloprid were undertaken. In a first step, the inventors verified that sublethal imidacloprid intoxication for 30 days induced a loss of sensitivity of cockroaches to imidacloprid ([Fig.7A]).

[0183] Unlike cockroaches that ingested LacZ dsRNA, 55% and 60% mortality were observed 96 hours after acute imidacloprid poisoning in cockroaches that ingested [31-end+start and [31-end] dsRNAs respectively ([Fig.7B]). These rates are similar to that obtained in cockroaches not exposed to the sublethal dose of imidacloprid for 30 days ([Fig.7A] and 7B). Thus, dsRNAs, by modifying the expression of nAChRs, would make it possible to circumvent the resistance mechanisms put in place by the insect by restoring their sensitivity to the insecticide.

[0184] These results also show the interest of the technique in circumventing the resistance mechanisms put in place by the insect against the insecticide, by targeting the nicotinic subunit(s) over-expressed by the resistant cockroaches, in order to restore the “sensitive” phenotype of the cockroaches.

[0185] The examples mentioned above are only preferred embodiments of the invention, and are not intended to limit the scope of the present invention. Modifications, substitutions by equivalents and improvements made by a person skilled in the art without departing from the spirit of the present invention must fall within the scope of the present invention defined by the appended claims.

[0186] Bibliographic references: • Gepts et al., 2005. Legumes as a Model Plant Family. Genomics for Food and Feed Report of the Cross-Vegetable Advances through Genomics Conference. Plant Physiol. 2005;137(4):1228-1235 • Whyard et al., 2009. Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochem Mol Biol. 2009 Nov;39(l1):824-32. • Dale et al., 2010. Identification of ion channel genes in the Acyrthosiphon pisum genome. Insect Mol Biol. 2010; 19(s2): 141-153. • Niu et al (2019). Topical dsRNA delivery induces gene silencing and mortality in the pea aphid. Pest Manag Sci. 2019;75(l 1):2873-2881. • Benzidane Y et al., 2017. Subchronic exposure to sublethal dose of imi-dacloprid changes electrophysiological properties and expression pattern of nicotinic acétylcholine receptor subtypes in insect neurosecretory cells. Neu-rotoxicology. 62:239-47. • Thany SH et al., 2007. Exploring the pharmacologie al properties of insect nicotinic acétylcholine receptors. Trends Pharmacol Sci. 28:14-22. • Sinakevitch IG et al., 1996. Anatomy and targets of Dorsal Unpaired Médian neurones in the Terminal Abdominal Ganglion of the male cockroach Per-iplaneta americana L. J Comp Neurol. 367:147-63. • Grolleau F et al., 2000. Dorsal unpaired médian neurones in the insect central nervous System: towards a better understanding of the ionic mechanisms un-derlying spontaneous electrical activity. J Exp Biol. 203:1633-48. • Jones et al., 2021. The cys-loop ligand-gated ion channel gene superfamilies of the cockroaches Blattella germanica and Periplaneta americana. Pest Manag Sci. 77(8):3787-3799

Claims

Claims

1. - Method for controlling harmful insects by inhibiting the translation of mRNA of a target gene belonging to the insect cholinergic system induced by RNA interference, characterized in that it comprises the steps of: - prepare a single-stranded antisense oligonucleotide specific to a target mRNA; - administering the single-stranded antisense oligonucleotide to at least one harmful insect in an amount effective to induce mortality or sensitivity to an insecticide of the target insect; and characterized in that the target mRNA is selected from the group consisting of mRNAs of the neuronal subunit group α of the nicotinic receptor of Acyrthosiphon pisum, namely mRNAs encoding the neuronal subunit α1 of the nicotinic receptor, mRNAs encoding the neuronal subunit α2 of the nicotinic receptor, mRNAs encoding the neuronal subunit α3 of the nicotinic receptor, mRNAs encoding the isoforms of the neuronal subunit α4 of the nicotinic receptor, mRNAs encoding the isoforms of the neuronal subunit α6 of the nicotinic receptor, mRNAs encoding the isoforms of the neuronal subunit α7 of the nicotinic receptor, mRNAs encoding the neuronal subunit α8 of the nicotinic receptor, mRNAs encoding the neuronal subunit α9 of the nicotinic receptor, mRNA encoding the neuronal alO subunit of the nicotinic receptor, and their isoforms;or the target mRNA is selected from the group consisting of mRNAs of the neuronal subunit group [3 of the nicotinic receptor of Acyrthosiphon pisum, namely mRNAs encoding the neuronal subunit [31 of the nicotinic receptor and mRNAs encoding the neuronal subunit [32 of the nicotinic receptor, and isoforms thereof, mRNAs encoding proteins and auxiliary molecules of the nicotinic receptor of Acyrthosiphon pisum, and isoforms thereof, and a protein of the interactome of the nicotinic receptor of Acyrthosiphon pisum; or from the group consisting of mRNAs of the neuronal subunit group a of the nicotinic receptor of Periplaneta americana, namely mRNAs encoding the neuronal subunit al of the nicotinic receptor, the;

2. mRNAs encoding the neuronal α2 subunit of the nicotinic receptor, mRNAs encoding the neuronal α3 subunit of the nicotinic receptor, mRNAs encoding isoforms of the neuronal α4 subunit of the nicotinic receptor, mRNAs encoding the neuronal α5 subunit of the nicotinic receptor, mRNAs encoding isoforms of the neuronal α6 subunit of the nicotinic receptor, mRNAs encoding isoforms of the neuronal α7 subunit of the nicotinic receptor, mRNAs encoding the neuronal α8 subunit of the nicotinic receptor, mRNAs encoding the neuronal α9 subunit of the nicotinic receptor, and isoforms thereof; or the target mRNA is selected from the group consisting of mRNAs of the neuronal subunit group [3 of the nicotinic receptor of Periplaneta americana, namely mRNAs encoding the neuronal subunit [31 of the nicotinic receptor, mRNAs encoding the neuronal subunit [32 of the nicotinic receptor,mRNAs encoding the neuronal subunit [33 of the nicotinic receptor, mRNAs encoding the neuronal subunit [34 of the nicotinic receptor, mRNAs encoding the neuronal subunit [35 of the nicotinic receptor, mRNAs encoding the neuronal subunit [36 of the nicotinic receptor, mRNAs encoding the neuronal subunit [37 of the nicotinic receptor, mRNAs encoding the neuronal subunit [38 of the nicotinic receptor, mRNAs encoding the neuronal subunit [39 of the nicotinic receptor, mRNAs encoding the neuronal subunit [310 of the nicotinic receptor, and their isoforms, mRNAs encoding the proteins and auxiliary molecules of the nicotinic receptor of Periplaneta americana, and their isoforms, and a protein of the interactome of the nicotinic receptor of American Periplanet., - Method for combating harmful insects by inhibiting the translation of mRNA of a target gene belonging to the cholinergic system of the insect induced by RNA interference, characterized in that it comprises the steps consisting of: - prepare a double-stranded RNA specific to a target mRNA; - administer double-stranded RNA to at least one harmful insect in an amount effective to induce mortality or susceptibility to an insecticide of the target insect, and characterized by the fact that the target mRNA is chosen from the group consisting of the mRNAs of the neuronal a subunit group of the nicotinic receptor of Acyrthosiphon pisum, namely the mRNAs encoding the neuronal a1 subunit of the nicotinic receptor, the mRNAs encoding the neuronal a2 subunit of the nicotinic receptor, the mRNAs encoding the neuronal a3 subunit of the nicotinic receptor, the mRNAs encoding the isoforms of the neuronal a4 subunit of the nicotinic receptor, the mRNAs encoding the isoforms of the neuronal a6 subunit of the nicotinic receptor, the mRNAs encoding the isoforms of the neuronal a7 subunit of the nicotinic receptor, the mRNAs encoding the neuronal a8 subunit of the nicotinic receptor, the mRNAs encoding the neuronal a9 subunit of the nicotinic receptor, the mRNAs encoding the neuronal a10 subunit of the receptor nicotinic, and their isoforms;or the target mRNA is selected from the group consisting of mRNAs of the neuronal subunit group [3 of the nicotinic receptor of Acyrthosiphon pisum, namely mRNAs encoding the neuronal subunit [31 of the nicotinic receptor and mRNAs encoding the neuronal subunit [32 of the nicotinic receptor, and their isoforms, mRNAs encoding proteins and auxiliary molecules of the nicotinic receptor of Acyrthosiphon pisum, and their isoforms, and a protein of the interactome of the nicotinic receptor of Acyrthosiphon pisum;or in the group consisting of the mRNAs of the neuronal subunit group α of the nicotinic receptor of Periplaneta americana, namely the mRNAs encoding the neuronal subunit α1 of the nicotinic receptor, the mRNAs encoding the neuronal subunit α2 of the nicotinic receptor, the mRNAs encoding the neuronal subunit α3 of the nicotinic receptor, the mRNAs encoding the isoforms of the neuronal subunit α4 of the nicotinic receptor, the mRNAs encoding the neuronal subunit α5 of the nicotinic receptor, the mRNAs encoding the isoforms of the neuronal subunit α6 of the nicotinic receptor, the mRNAs encoding the isoforms of the neuronal subunit α7 of the nicotinic receptor, the mRNAs encoding the neuronal subunit α8 of the nicotinic receptor, the mRNAs encoding the neuronal subunit α9 of the nicotinic receptor nicotinic, and their isoforms;or the target mRNA is selected from the group consisting of mRNAs of the neuronal subunit group [3 of the nicotinic receptor of Periplaneta americana, namely mRNAs encoding the neuronal subunit [31 of the nicotinic receptor, mRNAs encoding the neuronal subunit [32 of the; nicotinic receptor, mRNAs encoding the neuronal subunit [33 of the nicotinic receptor, mRNAs encoding the neuronal subunit [34 of the nicotinic receptor, mRNAs encoding the neuronal subunit [35 of the nicotinic receptor, mRNAs encoding the neuronal subunit [36 of the nicotinic receptor, mRNAs encoding the neuronal subunit [37 of the nicotinic receptor, mRNAs encoding the neuronal subunit [38 of the nicotinic receptor, mRNAs encoding the neuronal subunit [39 of the nicotinic receptor, mRNAs encoding the neuronal subunit [310 of the nicotinic receptor, and their isoforms, mRNAs encoding the proteins and auxiliary molecules of the nicotinic receptor of Periplaneta americana, and their isoforms, and a protein of the receptor interactome nicotine from Periplaneta americana.

3. - Method according to any one of claims 1 or 2, characterized in that the double-stranded RNA or single-stranded antisense oligonucleotide is administered by a topical administration method, by spraying, by vaporization, by means of nanoparticles of the lipid nanoparticle type, chitosan, liposomes, niosomes, cationic dendrimers, lipoplexes, by food, by trapping in a bait box, by irrigation of the crops.

4. - Method according to claim 3, characterized in that the double-stranded RNA or antisense oligonucleotide is administered by feeding at least one insect with a transgenic organism expressing the double-stranded RNA or the antisense oligonucleotide.

5. - Method according to claim 4, characterized in that the transgenic organism is a transgenic plant.

6. - An insecticidal composition for pest insects, the composition comprising a double-stranded RNA or an antisense oligonucleotide and at least one of a transfection agent and a solvent, wherein said double-stranded RNA or antisense oligonucleotide comprises a nucleotide sequence which is at least 90% identical with the sequence of a target mRNA, the target mRNA being selected from the group consisting of the coding sequences of the genes of the neuronal subunit group a of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana, the genes of the neuronal subunit group [3 of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana, and isoforms thereof, the nucleotide sequences of the genes encoding the proteins and auxiliary molecules of the nicotinic receptor

7.

8.

9.

10. cotinic acid from Acyrthosiphon pisum or Periplaneta americana, and their isoforms, or for a protein of the ni-cotinic acid receptor interactome from Acyrthosiphon pisum or Periplaneta americana, wherein the transfection promoting agent comprises a lipid compound, a liposome, a niosome, a lipid nanoparticle, a dendrimer, an insect virus. - Insecticidal composition according to claim 6, further comprising one or more agents selected from a synergistic agent, a repellent agent and an attractive agent. - Insecticidal composition according to any one of claims 6 or 7, further comprising a support which is acceptable from an agricultural, agri-food, health and / or environmental point of view. - Insecticidal composition according to any one of claims 6 to 8, characterized in that the composition is formulated in the form of a bait for the harmful insect(s). - A transgenic plant cell, transgenic plant tissue or transgenic plant comprising at least one nucleic acid which is or is transcribed to produce a double-stranded RNA, wherein the double-stranded RNA comprises a nucleotide sequence having at least 90% identity with the sequence of a target mRNA, the target mRNA being selected from the group consisting of mRNAs of the neuronal nicotinic receptor subunit group α of Acyrthosiphon pisum, namely mRNAs encoding the neuronal nicotinic receptor subunit α1, mRNAs encoding the neuronal nicotinic receptor subunit α2, mRNAs encoding the neuronal nicotinic receptor subunit α3, mRNAs encoding isoforms of the neuronal nicotinic receptor subunit α4, mRNAs encoding isoforms of the neuronal nicotinic receptor subunit α6, mRNAs encoding isoforms of the neuronal a7 subunit of the nicotinic receptor,mRNAs encoding the neuronal α8 subunit of the nicotinic receptor, mRNAs encoding the neuronal α9 subunit of the nicotinic receptor, mRNAs encoding the neuronal α10 subunit of the nicotinic receptor, and isoforms thereof; or the target mRNA is selected from the group consisting of mRNAs of the neuronal subunit group [3 of the nicotinic receptor of Acyrthosiphon pisum, namely mRNAs encoding the neuronal subunit [31 of the nicotinic receptor and mRNAs encoding the neuronal subunit [32 of the nicotinic receptor, and isoforms thereof, mRNA encoding Acyrthosiphon pisum nicotinic receptor proteins and auxiliary molecules, and their isoforms, and a protein of the Acyrthosiphon pisum nicotinic receptor interactome; or in the group consisting of the mRNAs of the neuronal nicotinic receptor α subunit group of Periplaneta americana, namely the mRNAs encoding the neuronal nicotinic receptor α1 subunit, the mRNAs encoding the neuronal nicotinic receptor α2 subunit, the mRNAs encoding the neuronal nicotinic receptor α3 subunit, the mRNAs encoding the isoforms of the neuronal nicotinic receptor α4 subunit, the mRNAs encoding the neuronal nicotinic receptor α5 subunit, the mRNAs encoding the isoforms of the neuronal nicotinic receptor α6 subunit, the mRNAs encoding the isoforms of the neuronal nicotinic receptor α7 subunit, the mRNAs encoding the neuronal nicotinic receptor α8 subunit,mRNAs encoding the neuronal a9 subunit of the nicotinic receptor, and their isoforms; or the target mRNA is selected from the group consisting of mRNAs of the neuronal subunit group [3 of the Periplaneta americana nicotinic receptor, namely mRNAs encoding the neuronal subunit [31 of the nicotinic receptor, mRNAs encoding the neuronal subunit [32 of the nicotinic receptor, mRNAs encoding the neuronal subunit [33 of the nicotinic receptor, mRNAs encoding the neuronal subunit [34 of the nicotinic receptor, mRNAs encoding the neuronal subunit [35 of the nicotinic receptor, mRNAs encoding the neuronal subunit [36 of the nicotinic receptor, mRNAs encoding the neuronal subunit [37 of the nicotinic receptor, mRNAs encoding the neuronal subunit [38 of the nicotinic receptor, mRNAs encoding the neuronal subunit [39 of the nicotinic receptor,mRNAs encoding the neuronal [310] subunit of the nicotinic receptor, and their isoforms, mRNAs encoding Periplaneta americana nicotinic receptor proteins and auxiliary molecules, and their isoforms, and a Periplaneta americana nicotinic receptor interactome protein.,

11. - Transgenic plant cell, transgenic plant tissue or plant transgenic according to claim 10, wherein the double-stranded RNA is at least 20 base pairs in length, in particular 20-2000 base pairs in length, preferably 20-900 base pairs in length.

12. - Interfering RNA in which the double-stranded RNA inhibits the translation of mRNAs corresponding to the coding sequence of any of the genes of the neuronal subunit group α of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana, the genes of the neuronal subunit group [3 of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana, and their isoforms, to any of the nucleotide sequences of the genes coding for the proteins and auxiliary molecules of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana, and their isoforms, or to the DNA sequence coding for a protein of the interactome of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana.

13. - An antisense oligonucleotide wherein the antisense oligonucleotide inhibits the translation of mRNAs corresponding to the coding sequence of any of the genes of the neuronal subunit group α of the nicotinic receptor, the genes of the neuronal subunit group [3 of the nicotinic receptor, and their isoforms, to any of the nucleotide sequences of the genes coding for the proteins and auxiliary molecules of the nicotinic receptor, and their isoforms, or to the DNA sequence coding for a protein of the interactome of the nicotinic receptor.

14. - The antisense oligonucleotide of claim 13, wherein the antisense oligonucleotide inhibits the translation of mRNAs corresponding to the coding sequence of any of the genes of the neuronal subunit group α of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana, the genes of the neuronal subunit group β of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana, and their isoforms, to any of the nucleotide sequences of the genes coding for the proteins and auxiliary molecules of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana, and their isoforms, or to the DNA sequence coding for a protein of the interactome of the nicotinic receptor of Acyrthosiphon pisum or Periplaneta americana.

15. - Use of interfering RNA according to claim 12 or of antisense oligonucleotide according to any one of claims 13 or 14 as a bioinsecticide.

16. - Use of interfering RNA according to claim 12 or of antisense oligonucleotide according to any one of claims 13 or 14 as a synergizing agent of the insecticidal effect of an insecticide or a molecule with an insecticidal effect against a harmful insect.

17. - Use of interfering RNA or antisense oligonucleotide according to claim 16, wherein the insecticide is a neurotoxic insecticide targeting the insect's nicotinic receptor which comprises neonicotinoids, in particular imidacloprid, clothianidin, acetamiprid, dinotefuran, nitenpyram, thiacloprid and thia-methoxam, spinosyns, butenolides, mesoionics, sulfoximines, or the molecule with neurotoxic insecticidal effect targeting the insect's nicotinic receptor comprising a natural substance, an essential oil.

18. - Use of interfering RNA according to claim 12 or of antisense oligonucleotide according to any one of claims 13 or 14 as an agent for restoring the sensitivity of a harmful insect to an insecticide.

Images