Modified Clostridium bacteria to assimilate several sugars simultaneously, their preparation and uses
Genetic modification of Clostridium bacteria to inhibit XylR and/or AraR repressors enables simultaneous assimilation of diverse carbon sources, addressing the challenge of catabolic repression and improving fermentation efficiency on complex substrates.
Patent Information
- Application Number
- FR2022006411
- Authority / Receiving Office
- FR · FR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-06-27
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2042-06-27
AI Technical Summary
Clostridium bacteria struggle to simultaneously utilize multiple carbon sources, particularly hexoses and pentoses, due to catabolic repression, limiting their efficiency in fermenting complex substrates like lignocellulose.
Genetically modify Clostridium bacteria to inactivate or prevent expression of the transcriptional repressors XylR and/or AraR, allowing them to simultaneously assimilate carbon sources such as glucose and arabinose.
The modified bacteria can efficiently co-ferment multiple carbon sources, enhancing their metabolic capabilities and facilitating the use of second-generation substrates like lignocellulose, reducing tensions between energy and food sectors.
Smart Images

Figure 00000038_0000 
Figure 00000039_0000 
Figure 00000040_0000
Abstract
Description
Title of the invention: Modified Clostridium bacteria to assimilate several sugars simultaneously, preparation and uses thereof
[0001] The present invention relates to the genetic modification of bacteria of the genus Clostridium, typically solvent-producing bacteria of the genus Clostridium. It further relates to methods, tools and kits for the removal or modification of coding sequence(s), or for controlling the transcription of coding sequence(s), the transcriptional repressors XylR and / or AraR, the genetically modified bacteria obtained and their uses, in particular for simultaneously fermenting at least one hexose and one pentose or the carbon elements of a substrate comprising at least two carbon elements selected from glucose, arabinose, xylose, mannose and galactose. TECHNOLOGICAL BACKGROUND
[0002] The genus Clostridium contains Gram-positive, strictly anaerobic, spore-forming bacteria belonging to the phylum Bacillota. Clostridia are an important group for the scientific community for several reasons. The first is that a number of serious diseases (e.g., tetanus, botulism) are caused by infections from pathogenic members of this family (John & Wood, 1986). The second is the potential for using so-called acidogenic or solventogenic strains in biotechnology. These non-pathogenic Clostridia have the natural ability to transform a wide variety of sugars to produce chemical species of interest, particularly acetone, butanol, and ethanol (John & Wood, 1986) during a fermentation known as ABE. The bacterium Clostridium acetobutylicum is now considered a model representative of solventogenic Clostridium.
[0003] Solvent-forming Clostridium are capable of assimilating a wide variety of carbon sources, which is an advantage for ABE fermentation processes (Keis, Shaheen, and Jones 2001). This versatility theoretically allows them to proliferate efficiently on a wide range of substrates, including agri-food by-products (Qureshi et al. 2008; Ezeji, Qureshi, and Blaschek 2007; Ezeji and Blaschek 2008; Qureshi et al. 2006). Thanks to the rise of industrial fermentation processes, and more recently green chemistry, the incorporation of plant biomass into industrial processes is becoming increasingly widespread. However, a categorization of plant substrates has quickly become widespread across the industry, contrasting two "generations" of industrial substrates based on environmental considerations. mental and human.
[0004] First-generation substrates (GFs) encompass all carbon sources derived from plant storage organs. GF substrates can be derived from maize, wheat, sugarcane, or sugar beets, among other sources. Primarily composed of sucrose and starch, their fermentation on an industrial scale is now highly efficient. However, the use of these substrates is controversial, as it requires the use of arable land and crops processed by the food industry.
[0005] In contrast to this paradigm, second-generation substrates (“2G”) encompass all substrates derived from plant structural organs or agri-food by-products. This approach helps to reduce tensions between the energy and food sectors. However, their use is much more complex than that of GI substrates. This is due to the main carbon source of these substrates: lignocellulose, a complex and recalcitrant polymeric matrix. Its degradation into fermentable sugars requires pretreatments that can be costly and may generate inhibitors of microbial growth.
[0006] Due to the complex nature of the different fractions from which they are derived, hemicellulose hydrolysates contain various carbon sources. These are predominantly xylose and glucose, accompanied by a mixture of minor sugars such as galactose, mannose, and arabinose. All these sugars are fermentable by the solvent-producing species of Clostridium. In practice, however, a biological process known as Catabolic Repression (CR) prevents the optimal and simultaneous utilization of all these carbon sources. In particular, catabolic repression prevents the efficient metabolism of the xylose contained in lignocellulose hydrolysates. The bacterium C. acetobutylicum, in particular, is sensitive to this repression (Qureshi et al. 2006; Grimmler et al. 2010). Summary of the invention
[0007] The inventors describe, in the context of the present invention, bacteria of the genus Clostridium, typically solvent-producing bacteria, capable of simultaneously consuming different carbon sources, in particular different sugars. In particular, they describe, for the first time, a bacterium C. acetobutylicum capable of simultaneously consuming glucose and a pentose, preferably glucose and arabinose.
[0008] The inventors describe in particular a genetically modified bacterium, belonging to the genus Clostridium, in particular a solventogenic bacterium, not expressing the transcriptional repressors XylR and / or AraR or expressing non-functional versions thereof. This genetically modified bacterium is a bacterium not expressing the products of the xylR and / or araR genes, in particular the products of the CA_C2613, CA_C3673 and / or CA_C1340 genes, or expressing non-functional versions of said products.
[0009] A particular bacterium described by the inventors in this text does not express the transcriptional repressor XylR or expresses a non-functional version thereof. This genetically modified bacterium is a bacterium that does not express the products of the xylR genes, in particular the products of the CA_C2613 and / or CA_C3673 genes, or expresses non-functional versions of said products.
[0010] Another specific bacterium described by the inventors in this text does not express the transcriptional repressor AraR or expresses a non-functional version thereof. This genetically modified bacterium is a bacterium that does not express the product of the araR gene, in particular the product of the CA_C1340 gene, or expresses a non-functional version of said product.
[0011] Another preferred genetically modified bacterium according to the invention is a bacterium that does not express the transcriptional repressors XylR and AraR or that expresses non-functional versions thereof. This genetically modified bacterium is a bacterium that does not express the products of the xylR and araR genes, in particular the products of the CA_C2613, CA_C3673, and CA_C1340 genes, or that expresses non-functional versions of said products.
[0012] Particularly preferred genetically modified bacteria according to the invention correspond to the strain identified in this description as IFP 968 as registered on June 13, 2022 under application number LMG P-32703 in the BCCM-LMG collection (also identified in this text as ACA_C1340 ACA_C2613 ACA_C3673 or AaraR AxylRl AxylR2), and to the strain identified in this description as IFP 967 as registered on June 13, 2022 under application number LMG P-32702 in the BCCM-LMG collection (also identified in this text as ACA_C1340 or AaraR), which can be used to prepare a strain equivalent to the IFP 968 strain. The invention also relates to any derived, cloned, mutant or genetically modified version of these bacteria.
[0013] The inventors further describe a method for producing a recombinant bacterium as described herein, in particular a method comprising the deletion or inactivation of the xylR and / or araR genes so as to prevent or reduce the expression of functional XylR and / or AraR proteins, as well as the genetically modified bacteria that can be obtained by this method, of which IFP 967 and IFP 968 bacteria are examples.
[0014] They also describe the use of a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the product of the xylR gene or araR, or expresses a non-functional version of the xylR or araR gene, such as strain IFP 967, to prepare a genetically modified bacterium according to the invention not expressing the products of the xylR and araR genes, or expressing non-functional versions thereof.
[0015] The inventors further describe the use of a bacterium according to the invention to produce a solvent, a sugar or a bio-based molecule for example from i) lignocellulosic biomass, ii) the product of a particular dedicated crop such as an energy crop, a perennial forage crop, a herbaceous crop or a shrub crop, or iii) GI substrate(s) from one or more sugar, cereal, or oilseed plants, or iv) a mixture of such carbon sources.
[0016] They also describe the use of the bacteria according to the invention to simultaneously ferment (or in other words, to "co-ferment") at least one hexose and one pentose, or the carbon compounds of a substrate comprising at least two carbon compounds selected from glucose, arabinose, xylose, mannose, and galactose. Such bacteria can advantageously be used to produce a solvent or a mixture of solvents, particularly on an industrial scale.
[0017] The invention also relates to a fermentation process involving the use of a genetically modified bacterium as described in this text.
[0018] The inventors further describe kits, in particular a kit for transforming and preferably genetically modifying a bacterium belonging to the genus Clostridium, and a kit for producing a solvent, a sugar, or a bio-based molecule using a bacterium belonging to the genus Clostridium, said kit comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention and ii) a medium, in particular a rich culture medium, preferably an RCM-type culture medium, more preferably a GAPES-type culture medium, even more preferably a CGM-type culture medium, containing at least glucose and a pentose, preferably glucose and arabinose and / or xylose. DETAILED DESCRIPTION OF THE INVENTION
[0019] Although used in industry for over a century, knowledge of bacteria belonging to the genus Clostridium, particularly solvantogenic bacteria, remains very limited. A major constraint encountered by manufacturers concerns their inability to simultaneously use several distinct carbon sources and therefore to efficiently metabolize different types of substrates, especially different types of sugars.
[0020] Despite the difficulties, well known to those skilled in the art, encountered in genetically modifying bacteria belonging to the genus Clostridium, the inventors are succeeded, for the first time in the context of the present invention, in obtaining a C. acetobutylicum bacterium capable of simultaneously using, i.e., co-assimilating, co-metabolizing or co-fermenting (these terms being used interchangeably in this text) several distinct carbon sources, in particular from biomass, especially from plant biomass, for example from lignocellulosic biomass.
[0021] A preferred "raw biomass," also called "native biomass" within the scope of the invention, is plant biomass, in particular lignocellulosic biomass. The latter essentially comprises three natural constituents (polymers) present in varying quantities depending on its origin: cellulose (approximately 35 to 50% by dry mass of the biomass), which is a polysaccharide primarily composed of hexoses; hemicellulose (approximately 20 to 30% by dry mass of the biomass), which is a polysaccharide primarily composed of pentoses; and lignin (approximately 15 to 25% by dry mass of the biomass), which is a complex, high molecular weight polymer composed of aromatic alcohols linked by ether bonds. These different molecules are responsible for the intrinsic properties of the plant cell wall and are organized into a complex network.Of these three basic polymers that incorporate lignocellulosic biomass, cellulose and hemicellulose are those that allow the production of 2G sugar juices and 2G alcohol.
[0022] Non-limiting examples of lignocellulosic biomass include, for example, agricultural residues (in particular straw waste, corn cobs, sugarcane bagasse, etc.), but also forestry residues, sawmill residues (typically wood chips), or any other type of woody residue of forestry, industrial, urban, or household origin. Cellulosic biomass can also be the product of a specific dedicated crop, such as an energy crop, dedicated, for example, to the cultivation of annual plants (whole-plant use, for example, of wheat or corn).Alternatively, it can be, for example, a crop of perennial forage plants (e.g., fescue, orchardgrass or ryegrass), a crop of herbaceous plants (e.g., miscanthus or "elephant grass" or switchgrass or "erect panic grass"), or a shrub crop (short or very short rotation coppices, for example, of willow, poplar, chestnut or eucalyptus).
[0023] Another biomass that could be used in the context of the invention may be a 1G substrate or a mixture of several 1G substrates derived from sugar crops (such as, for example, sugar cane or sugar beet), cereal crops (such as, for example, maize or wheat), and / or oilseed crops (such as, for example, soybeans, rapeseed, palm). In the context of the invention, the biomass may be used alone or as a mixture, for example, of several different types of biomass. The amount of water contained in the raw biomass is between 1% and 70% of the total mass of raw biomass.
[0024] The inventors have thus advantageously succeeded in genetically modifying, in this respect, a solventogenic bacterium, the reference strain C. acetobutylicum. In particular, they have made it capable of fermenting two carbon elements of different natures, for example at least one hexose and one pentose, or the carbon elements of a substrate comprising at least two distinct carbon elements chosen from glucose, arabinose, xylose, mannose and galactose, preferably chosen from glucose, arabinose and xylose, even more preferably from glucose and arabinose.
[0025] In C. acetobutylicum, genes related to xylose catabolism are organized as a regulon (Gu et al. 2010). The main operon involved in xylose assimilation is the CA_C2610-CA_C2612 locus, which contains the genes encoding the xylose isomerase XylA (CA_C2610) and the xylulokinase XylB (CA_C2612) (Gu et al. 2010). The genes encoding the permeases predicted to be involved in xylose import, AraEl (CA_C1339) and XylT (CA_C1345), are located on a second locus (CA_C1339-CA_C1349) which also contains genes related to arabinose assimilation. A third operon (CA_C3451-CA_C3452) contains the genes encoding the XynT and XynB proteins, corresponding respectively to a hypothetical permease and an 1,4-[3-D-xylosidase.
[0026] With the exception of xylT, all these genes possess XylR-binding-site (XBS) operator sequences in their promoter or coding sequence (Gu et al. 2010). The presence of XBS has the effect of placing these genes under the control of a xylose repressor, named XylR, capable of preventing transcription in the absence of xylose in the medium.
[0027] The CA_C2613 gene is located upstream of the xylB gene within the main xylose assimilation operon. This organization is very similar to that observed in species possessing a xylose repressor (Gu et al. 2010).
[0028] The CA_C3673 gene has an XBS at its promoter, suggesting autoregulation of its transcription. The product of this gene is also the repressor exhibiting the most identity with XylR homologs belonging to closely related solventogenic Clostridium species, such as C. beijerinckii NCIMB 8052.
[0029] The genes involved in the assimilation of arabinose are mostly located within the CA_C1339-CA_C1349 locus. This locus includes the genes encoding the presumed arabinose transporters AraEl and XylT, the L-arabinose isomerases AraAl (CA_C1342) and AraA2 (CA_C1346), the ribulokinase AraK (CA_C1344) and the L-ribulose-5-phosphate 4-epimerase AraD (CA_C1341).
[0030] A second operon contains the CA_C1529 and CA_C1530 genes which encode the arabinofuranosidase Arb43 and the arabinoside transporter AraT.
[0031] All these genes, as well as the gene encoding phosphoketolase Xfp, are placed under the control of the transcriptional repressor AraR (CA_C1340), which is active in the absence of arabinose (Zhang et al. 2012).
[0032] A recently highlighted peculiarity in C. acetobutylicum is the phenotypic difference between growth on xylose and growth on arabinose, even though the metabolic pathways allowing the assimilation of these sugars share many common intermediates (Servinsky et al. 2010). Indeed, while the generation time on arabinose is 78 min, it reaches 287 min on xylose (Servinsky et al. 2012). While xylose-permease and xylulokinase activities have been implicated, this difference is also explained by the action of transcriptional regulatory factors.
[0033] Transcriptomic analysis of C. acetobutylicum ATCC 824 cultures in the presence of glucose, xylose, or arabinose reveals that the pentose phosphate pathway is induced similarly by xylose and arabinose (Servinsky et al. 2010). In contrast, the expression of the phosphoketolase Xfp exhibits a different expression profile. Indeed, xfp is weakly induced by xylose (by a factor of 3 compared to glucose) but strongly induced by arabinose (by a factor of 185 compared to glucose) (Servinsky et al. 2012). The marked contrast in the induction of xfp gene expression in the absence of arabinose can be explained by the presence of an AraR-binding site upstream of this gene. Thus, one of the most remarkable consequences when transcribing a mutant whose araR gene has been inactivated is the improvement of xfp gene transcription by a factor of more than 1000 (Zhang et al. 2012).This transcriptional regulation of phosphoketolase contributes to partially hindering xylose assimilation in the absence of arabinose.
[0034] Recent work further shows that, in addition to undergoing partial repression in the absence of arabinose, xylose assimilation is reduced in the presence of arabinose. Indeed, cultures grown in the presence of both xylose and arabinose show minimal xylose consumption, while the arabinose assimilation rate does not differ from the rate observed with arabinose alone (Aristilde et al. 2014). Metabolic flux analysis confirms the preferential assimilation of arabinose over cultured xylose with respect to these two sugars (Aristilde et al. 2014). Servinsky et al. also showed that the preference of arabinose over xylose cannot be entirely explained by the growth rates inherent to these two carbohydrates. They have thus highlighted the fact that arabinose would be able to specifically inhibit the expression of genes for the assimilation of other sugars, including those of xylose.
[0035] The inventors show for the first time that the joint inactivation of the genes encoding the AraR and XylR repressors makes it possible to obtain a strain exhibiting astonishing co-assimilation capabilities, since it is able to simultaneously assimilate and / or metabolize two distinct carbon sources such as arabinose and glucose, without lifting the catabolic repression on the assimilation of xylose.
[0036] An object described by the inventors thus refers to a genetically modified bacterium belonging to the genus Clostridium, in particular a species of Clostridium of industrial interest, in particular C. acetobutylicum, characterized in that it does not express the products of the xylR and / or araR genes, or expresses non-functional versions thereof.
[0037] In the context of the present invention, the term "xylR gene" refers in particular to the sequence SEQ ID NO: 1 (CA_C2613) or the sequence SEQ ID NO: 2 (CA_C3673). The term "xylR gene" also refers to variants of said sequences SEQ ID NO: 1 and SEQ ID NO: 2, in particular variants exhibiting sequence homology with one of said sequences SEQ ID NO: 1 or SEQ ID NO: 2.
[0038] In the context of the present invention, the term "araR gene" refers in particular to the sequence SEQ ID NO: 3 (CA_C1340) or a variant of said sequence, in particular a variant exhibiting sequence homology with said sequence SEQ ID NO: 3.
[0039] A typical example of a variant according to the invention exhibits sequence homology with sequence SEQ ID NO: 1, with SEQ ID NO: 2, or with sequence SEQ ID NO: 3, between 95% and 100%, and preferably between 96% and 100%. Sequence SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 and its variant are, for example, homologous at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. According to a preferred embodiment, sequence SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 and its variant exhibit sequence homology at least 96%, at least 97%, or at least 98%.
[0040] The term “xylR gene” also refers to a sequence encoding a fragment or functional variant of the XylR protein, in particular a protein capable of repressing, decreasing, or preventing (or involved in the repression of), for example in the absence of xylose, the expression of an enzyme of the xylose assimilation pathway, for example capable of repressing, decreasing, or preventing the transcription of at least one gene selected from the gene encoding the xylose isomerase “XylA” (encoded by the gene CA_C2610, SEQ ID NO: 4), the gene encoding the xylulokinase “XylB” (encoded by the gene CA_C2612, SEQ ID NO: 5), a gene encoding a permease involved in xylose import such as, for example, the protein “AraEl” (encoded by the gene CA_C1339, SEQ ID NO: 6), the "XylT" protein (encoded by the CA_C1345 gene, SEQ ID NO: 7), or the "XynT" protein (encoded by the CA_C3451 gene, SEQ ID NO: 8), and the gene encoding the λ,4-[3-D-xylosidase "XynB" (encoded by the CA_C3452 gene, SEQ ID NO: 9).
[0041] The term "xylR gene" also refers to a variant nucleotide sequence encoding a protein capable of binding in particular the promoter (SEQ ID NO: 10) of the "xylA" gene (CA_C2610, SEQ ID NO: 4), the promoter (SEQ ID NO: 11) of the "xylB" gene (CA_C2612, SEQ ID NO: 5) or an "XBS" (XylR-binding site) operator sequence chosen for example from SEQ ID NO: 12 and SEQ ID NO: 13. The protein encoded by the variant nucleotide sequence is preferably capable of recognizing an XBS (XylR-Binding site) sequence such as for example SEQ ID NO: 12 or SEQ ID NO: 13, and / or of repressing, decreasing or preventing the expression of said genes.
[0042] In a particular embodiment, the term "xylR gene" also refers to a sequence encoding a fragment or functional variant of the XylR protein, in particular a protein capable of / able to repress, decrease or prevent (or involved in the repression of), for example in the presence of xylose, the expression of an enzyme of the xylose assimilation pathway as described above.
[0043] The term "araR gene" also refers to a sequence encoding a fragment or functional variant of the AraR protein, in particular a protein capable of / able to repress, decrease or prevent (or involved in the repression of), for example in the absence of arabinose, the expression of an enzyme of the xylose assimilation pathway or the arabinose assimilation pathway, in particular capable of partially preventing the assimilation of xylose or arabinose.
[0044] The term "araR gene" also refers to a sequence capable of / able to repress, decrease or prevent, for example in the absence of arabinose, the transcription of at least one gene selected from a gene encoding a transporter, or presumed transporter, of the arabinose "XylA", such as "AraEl" (encoded by the gene CA_C1339, SEQ ID NO: 6) or "XylT" (encoded by the gene CA_C1345, SEQ ID NO: 7); a gene encoding an L-arabinose isomerase such as "AraAl" (encoded by the gene CA_C1342, SEQ ID NO: 14) or "AraA2" (encoded by the gene CA_C1346, SEQ ID NO: 15); the gene encoding ribulokinase “AraK” (encoded by gene CA_C1344, SEQ ID NO: 16); the gene encoding L-ribulose-5-phosphate 4-epimerase “AraD” (encoded by gene CA_C1341, SEQ ID NO: 17); the gene encoding arabinofuranosidase “Arb43” (encoded by gene CA_C1529, SEQ ID NO: 18); the gene encoding the arabinoside transporter “AraT” (encoded by gene CA_C1530, SEQ ID NO: 19);and the xfp gene (CA_C1343, SEQ ID NO: 20) encoding a phosphoketolase.
[0045] The term “araR gene” also refers to a variant nucleotide sequence encoding a protein capable of binding, in particular, the promoter of an “ara” gene such as “araEl”, “araAl”, “araA2”, “araK” or “araD”, for example a sequence chosen from SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, or an “ABS” (AraR-binding site) operator sequence chosen, for example, from SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27. The protein encoded by the variant nucleotide sequence is preferably capable of recognizing an ABS (AraR-binding site) sequence such as, for example, SEQ ID NO: 25 or SEQ ID NO: 26, and / or of repressing, decreasing, or preventing the expression of one or more of said genes encoding an enzyme involved in the arabinose assimilation pathway.
[0046] In a particular embodiment, the term "araR gene" also refers to a sequence encoding a fragment or functional variant of the AraR protein, in particular a protein capable of / able to repress, decrease or prevent (or involved in the repression of), for example in the presence of arabinose, the expression of an enzyme such as described above of the xylose assimilation pathway or the arabinose assimilation pathway.
[0047] When this text refers to a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the products of the xylR and / or araR genes, or expresses non-functional versions thereof, the expression "non-functional version of the gene product" xylR, or araR, designates a protein, typically a protein identified in this text as "XylR" or "AraR", which is non-functional, i.e., unable to perform the function of the protein encoded by the wild-type version of the gene in question.In the case of the xylR gene product, the non-functional version of said product designates a protein incapable of repressing, decreasing or preventing the expression of an enzyme of the xylose and / or arabinose assimilation pathway, for example incapable of repressing, decreasing or preventing the transcription of at least one gene chosen from among the gene encoding xylose isomerase "XylA", the gene encoding xylulokinase "XylB", a gene encoding a permease involved in xylose import such as for example the protein "AraEl", the protein "XylT", or the protein "XynT", and the gene encoding l,4-[3-D-xylosidase "XynB". .
[0048] In the case of the araR gene product, the non-functional version of said product designates a protein incapable of repressing, decreasing, or preventing the expression of an enzyme of the xylose assimilation pathway and / or the arabinose assimilation pathway, in particular capable of partially preventing xylose assimilation. This protein is, for example, incapable of repressing, decreasing, or preventing the transcription of at least one gene selected from among a gene encoding an arabinose transporter, or presumed transporter, "XylA", such as "AraEl" or "XylT"; a gene encoding an L-arabinose isomerase such as "AraAl" or "AraA2"; the gene encoding ribulokinase "AraK"; the gene encoding L-ribulose-5-phosphate 4-epimerase "AraD"; the gene encoding the arabinofuranosidase "Arb43"; the gene encoding the arabinoside transporter "AraT"; and the xfp gene encoding a phosphoketolase.
[0049] The term "Clostridium bacteria" refers in particular to Clostridium species of industrial interest, typically solvent-producing or acetogenic bacteria of the genus Clostridium. The expression "Clostridium bacteria" encompasses wild-type bacteria as well as strains derived from them that have been genetically modified to improve their performance.
[0050] By "species of Clostridium of industrial interest" or "Clostridium of industrial interest" bacteria, we mean species capable of producing, by fermentation, solvents such as ethanol, butanol, acetone or isopropanol and / or acids such as butyric acid or acetic acid, from sugars or monosaccharides, typically from sugars comprising 5 carbon atoms such as xylose, arabinose or fructose, from sugars comprising 6 carbon atoms such as glucose or mannose, from polysaccharides or polyosides such as cellulose or hemicellulose, and / or from any other source of carbon assimilable and usable by bacteria of the genus Clostridium (CO, CO2, and methanol for example).Examples of solvent-producing bacteria of interest are bacteria of the genus Clostridium that produce acetone, butanol, ethanol and / or isopropanol, such as the strains identified in the literature as "ABE strain" [strains carrying out fermentations enabling the production of acetone, butanol and ethanol], "IBE strain" [strains carrying out fermentations enabling the production of isopropanol (by reduction of acetone), butanol and ethanol] and "AIBE strain" [strains carrying out fermentations enabling the production of acetone, isopropanol, butanol and ethanol]. Solvent-producing bacteria of the genus Clostridium can be selected, for example, from, but not limited to, C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum and C. tyrobutyricum, preferably from C. acetobutylicum, C. beijerinckii, C.butyricum, C. tyrobutyricum and C. cellulolyticum, and even more preferably among C. acetobutylicum and C. beijerinckii.
[0051] The acetogenic bacteria of interest are bacteria that produce acids and / or solvents from CO2 and H2. Acetogenic bacteria of the genus Clostridium can be selected, for example, from C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatalogenes and C. carboxidivorans.
[0052] In a particular embodiment, the bacterium of the genus Clostridium concerned is an "ABE strain", preferably the bacterium C. acetobutylicum, for example strain DSM 792 (also designated strain ATCC 824 or LMG 5710) of C. acetobutylicum.
[0053] In another particular embodiment, the bacterium of the genus Clostridium concerned is an "ABE strain", preferably the bacterium C. beijerinckii, for example the NCIMB 8052 strain of C. beijerinckii.
[0054] In another particular embodiment, the bacterium of the genus Clostridium concerned is an "IBE strain", preferably a subclade of C. beijerinckii selected from DSM 6423, LMG 7814, LMG 7815, NRRL B-593 and NCCB 27006.
[0055] Thus, according to a preferred embodiment, the bacterium according to the invention belonging to the genus Clostridium is a Clostridium bacterium of industrial interest, in particular a solvent-producing bacterium, capable, in the wild, of producing solvents and / or acids by fermentation from a carbon source, said carbon source being chosen, for example, from a sugar, CO, CO2, an alcohol, and an organic acid. In a particular preferred embodiment, the carbon source is a sugar, in particular a sugar comprising 5 carbon atoms such as xylose or arabinose, a sugar comprising 6 carbon atoms such as glucose, fructose, or mannose, or a polysaccharide or polyoside such as cellulose or hemicellulose.
[0056] A particularly preferred bacterium according to the invention is a Clostridium bacterium capable of simultaneously fermenting at least one hexose and one pentose. A particularly preferred bacterium according to the invention is a Clostridium bacterium capable of simultaneously fermenting the carbon compounds of a substrate comprising at least two carbon compounds selected from glucose, arabinose, xylose, mannose, and galactose, preferably selected from glucose, arabinose, and xylose.
[0057] A person skilled in the art can thus easily verify whether the Clostridium bacterium is a bacterium according to the invention by culturing the bacterium on a substrate comprising several carbon sources (for example, according to the method taught by Grimmler et al., 2010): if the bacterium ferments / assimilates at least two different carbon sources simultaneously (as opposed to consecutively, i.e., one after the other), it is a bacterium according to the invention. Thus, a wild-type Clostridium bacterium placed in the presence of a substrate comprising glucose, arabinose, and xylose will first ferment the glucose, then the arabinose, and then the xylose. Conversely, a bacterium according to the invention is capable of simultaneously fermenting / assimilating at least two of the three sugars present in the substrate, namely, in the example given, glucose and arabinose (the xylose being assimilated subsequently).
[0058] Another simple way to easily verify whether the Clostridium bacterium is a bacterium according to the invention is to measure the growth rate of the bacterium. The observation in this bacterium of growth faster than that observed in a bacterium expressing a functional AraR protein, or a mixture of functional XylR and AraR proteins, on a medium comprising xylose as the sole carbon source, will be considered an indication of obtaining the bacterium using a process according to the invention (comprising the deletion or inactivation of the xylR and araR genes so as to prevent or decrease (the expression of functional XylR and AraR proteins). Specifically, a person skilled in the art considers that a wild-type Clostridium bacterium exhibits a maximum growth rate of between approximately 0.10 and approximately 0.25; preferably approximately 0.15; on a medium containing xylose as the sole carbon source (Servinsky et al., 2010). The inventors observed that a bacterium modified according to the invention exhibits a maximum growth rate of between approximately 0.45 and approximately 0.60; preferably greater than approximately 0.50, on such a medium. Another method for verifying whether the Clostridium bacterium is or is not a bacterium according to the invention consists of sequencing the CA_C1340, CA_C2613 and CA_C3673 loci and verifying whether they have, or have not, been modified compared to their wild version, in order to prevent or reduce the expression of functional XylR and AraR proteins.
[0059] A particularly preferred bacterium belongs to the species C. acetobutylicum and, as explained above, does not express the products of the genes of sequence SEQ ID NO: 1 (CA_C2613) or a sequence homologous to at least 95%, for example at least 96%, at least 97% or at least 98% of it, of SEQ ID NO: 2 (CA_C3673) or a sequence homologous to at least 95%, for example at least 96%, at least 97% or at least 98% of it, and of SEQ ID NO: 3 (CA_C1340) or a sequence homologous to at least 95%, for example at least 96%, at least 97% or at least 98% of it, or expresses non-functional versions of said expression products.
[0060] This particularly preferred bacterium exhibits the technical capabilities described above, i.e., it is capable of fermenting / assimilating at least two different carbon sources simultaneously, and it grows faster than a bacterium expressing a functional AraR protein, or a mixture of functional XylR and AraR proteins, on a medium comprising xylose as the sole carbon source.
[0061] Such a strain is characterized for the first time in the context of the present application.
[0062] This strain was registered on June 13, 2022, under LMG deposit number P-32703 in the BCCM-LMG collection. In this strain, the xylR and araR genes have been (jointly) inactivated. The description also applies to any derived, cloned, mutant, or genetically modified version of this strain, typically lacking the xylR and araR genes, or in which said genes have also been inactivated.
[0063] Another object of the invention relates to the use of a bacterium according to the invention to simultaneously ferment two distinct sources of carbon, for example at least one hexose and one pentose, or the carbon elements of a substrate comprising at least two carbon elements selected from glucose, arabinose, xylose, mannose, and galactose. In a particular embodiment, the bacterium according to the invention is, for example, capable of simultaneously fermenting glucose and arabinose, glucose and xylose, glucose and mannose, glucose and galactose, arabinose and xylose, arabinose and mannose, arabinose and galactose, xylose and mannose, xylose and galactose, or mannose and galactose.
[0064] In a particular preferred embodiment, the bacterium according to the invention is capable of fermenting a substrate comprising at least two sugars selected from glucose, arabinose and xylose, for example glucose and arabinose, glucose and xylose, or arabinose and xylose.
[0065] The genetically modified bacterium according to the invention can be advantageously used to produce a solvent, for example a biofuel, or a mixture of solvents, for example a mixture of biofuels, particularly on an industrial scale.
[0066] The invention also relates to a fermentation process, typically an industrial process, involving the use of a bacterium according to the invention.
[0067] Thanks to the present invention, the use of second-generation (“2G”) substrates, particularly lignocellulose, is now greatly facilitated. The present invention offers a welcome solution that will help reduce tensions between the energy and food sectors.
[0068] A genetically modified bacterium according to the invention can also be advantageously used to produce a sugar or a bio-based molecule from biomass, in particular lignocellulosic biomass, or from a dedicated energy culture.
[0069] In the context of the present invention, "bio-based molecule" means a molecule whose specific characteristic is that the raw material used for its production is necessarily derived from plant biomass, preferably from lignocellulosic biomass, and not from resources of fossil origin such as oil, coal or natural gas.
[0070] Non-limiting examples of lignocellulosic biomass include, for example, agricultural residues (in particular straw waste, corn cobs, sugar cane bagasse, etc.), but also forestry residues, sawmill residues (typically wood chips) or any other type of woody residue.
[0071] Cellulosic biomass can also be the product of a specific dedicated crop, such as an energy crop, dedicated, for example, to the cultivation of annual plants (whole-plant use, e.g., wheat or maize). Alternatively, it can be, for example, a perennial forage crop (e.g., fescue, orchardgrass, ryegrass), a herbaceous crop (e.g., miscanthus or "elephant grass", switchgrass or "erect switchgrass"), or a shrub crop (short- or very short-rotation coppices, e.g., willow, poplar, chestnut, or of eucalyptus).
[0072] Another biomass that could be used in the context of the invention may be a GI substrate derived from sugar plants (such as, for example, sugar cane or sugar beet), cereal plants (such as, for example, maize or wheat) and / or oilseed plants (such as, for example, soybeans, rapeseed, or palm).
[0073] The invention also relates to a method for producing a recombinant bacterium according to the invention, comprising the deletion or inactivation of the xylR and araR genes so as to prevent or reduce the expression of functional XylR and AraR proteins.
[0074] The most efficient known modification processes for obtaining genetically modified strains are based on homologous recombination events, which allow the genome to be modified in a precise and stable manner.
[0075] A particular production process according to the invention includes a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest.
[0076] For the purposes of this invention, "nucleic acid" means any natural, synthetic, semi-synthetic, or recombinant DNA or RNA molecule, possibly chemically modified (i.e., comprising non-natural bases, modified nucleotides including, for example, a modified bond, modified bases, and / or modified sugars), or optimized so that the codons of the transcripts synthesized from the coding sequences are the most frequently found codons in a bacterium of the genus Clostridium for use in that bacterium. In the case of the genus Clostridium, the optimized codons are typically codons rich in adenine ("A") and thymine ("T") bases.
[0077] In the peptide sequences described in this document, amino acids are represented by their one-letter code according to the following nomenclature: C: cysteine; D: aspartic acid; E: glutamic acid; F: phenylalanine; G: glycine; H: histidine; I: isoleucine; K: lysine; L: leucine; M: methionine; N: asparagine; P: proline; Q: glutamine; R: arginine; S: serine; T: threonine; V: valine; W: tryptophan and Y: tyrosine.
[0078] In a particular embodiment described, the nucleic acid of interest comprises at least two regions, each complementary to a target sequence, that are 100% or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to said targeted DNA region / portion / sequence within the bacterial genome. These regions are capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence, typically to a sequence as described above comprising at least one nucleotide, preferably at least 100 nucleotides, typically between 100 and 1000 nucleotides. The complementary regions of the target sequence present within the nucleic acid of interest can recognize, preferably target, the 5' and 3' flanking regions of the target sequence in a gene editing tool known to the person skilled in the art, typically any tool based on homologous recombination.
[0079] In a particular preferred embodiment, a portion of the nucleic acid of interest further recognizes (binds at least partially), and preferably targets, i.e., recognizes and allows the cleavage, in the genome of a Clostridium bacterium of interest, of at least one strand of i) a target sequence, ii) a sequence controlling the transcription of a target sequence, or iii) a sequence flanking a target sequence. The recognized sequence is also referred to herein as the "target sequence."
[0080] In this same preferred particular embodiment, the nucleic acid of interest comprises at least one complementary region of the target sequence that is 100% or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the targeted DNA region / portion / sequence within the bacterial genome and is capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence, typically to a sequence comprising at least 5 nucleotides, preferably at least 5, 10, 14, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 15 and 30 nucleotides, preferably to a sequence comprising 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.
[0081] The nucleic acid(s) of interest as described in the present invention are capable of deleting said target sequence(s) from the genome of the bacterium or of modifying their expression, for example by modulating / regulating them, in particular by inhibiting them, preferably by modifying them so as to render said bacterium incapable of expressing one or more proteins, in particular one or more functional proteins, from said sequence(s).
[0082] The "nucleic acids of interest," typically the expression cassettes or vectors, can be constructed using conventional techniques well known to those skilled in the art and may include one or more promoters, bacterial origins of replication (ORI sequences), termination sequences, selection genes, for example, antibiotic resistance genes, and sequences ("flanked regions") allowing targeted insertion of the cassette or vector. ORI sequences of interest may, for example, be chosen from pIP404, pAM
[31] , repH (origin of replication in C. acetobutylicum), ColEl or rep (origin of replication in E. coli), or any other origin of replication allowing the maintenance of the vector, typically the plasmid, within a bacterial cell belonging to the genus Clostridium.Termination sequences of interest can be chosen, for example, from those of the adc, thl genes, the bcs operon, or any other terminator, well known to humans. The art, allowing the cessation of transcription within a bacterial cell belonging to the genus Clostridium. Selection genes (resistance genes) of interest can be chosen from ermB, catP, bla, tetA, tetM, and / or any other gene of resistance to ampicillin, erythromycin, chloramphenicol, thiamphenicol, specti-nomycin, tetracycline, or any other antibiotic, well known to those skilled in the art, that can be used to select bacteria of the genus Clostridium.
[0083] The nucleic acid of interest may be a natural, synthetic, or recombinant RNA. This nucleic acid of interest may be prepared by any method known to those skilled in the art, such as, for example, chemical synthesis, in vivo transcription, or amplification techniques. When the nucleic acid(s) of interest are introduced directly into the cell in the form of RNA molecules (mature or precursor), for example, guide RNA (gRNA), these molecules may contain modified nucleotides or chemical modifications that allow them, for example, to increase their resistance to nucleases and thus increase their lifespan in the cell.They may include at least one modified or non-natural nucleotide such as, for example, a nucleotide containing a modified base, such as inosine, methyl-5-deoxycytidine, dimethylamino-5-deoxyuridine, deoxyuridine, diamino-2,6-purine, bromo-5-deoxyuridine or any other modified base allowing hybridization.
[0084] The nucleic acids of interest used according to the invention can also be modified at the level of the internucleotide bond as are for example phosphorothioates, H-phosphonates or alkyl-phosphonates, or at the level of the skeleton as are for example alpha-oligonucleotides, 2'-O-alkyl riboses or PNAs (Peptide Nucleic Acids) (Egholm et al., 1992).
[0085] In the context of this description, a particular example of a nucleic acid of interest, used to transform and / or genetically modify a bacterium of interest, is a DNA fragment i) recognizing a coding sequence, ii) controlling the transcription of a coding sequence, or iii) flanking a coding sequence, the XylR repressor or the AraR repressor.
[0086] In a preferred embodiment, the nucleic acid of interest is selected from the plasmid pGRNA-ACA_C1340 of sequence SEQ ID NO: 28, the plasmid pGRNA-ACA_C2613 of sequence SEQ ID NO: 29 or the plasmid pGRNA-ACA_C3673 of sequence SEQ ID NO: 30.
[0087] A nucleic acid of particular interest described by the inventors is, for example, a vector, preferably a plasmid, for example the plasmid pGRNA-ACA_C1340 of sequence SEQ ID NO: 28, the plasmid pGRNA-ACA_C2613 of sequence SEQ ID NO: 29 or the plasmid pGRNA-ACA_C3673 of sequence SEQ ID NO: 30, described in the experimental part of this description.
[0088] The recognized sequence(s) (target sequence(s)) is preferably one of the sequences SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 corresponding to the xylR and araR genes encoding, respectively, a XylR protein and the AraR protein, or an amino acid sequence identical to at least 70%, 75%, 80%, 85%, 90% or 95% of said protein, or a sequence comprising all or at least 95%, 96%, 97%, 98% or 99% of the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. In other words, the recognized sequence may be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides from the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
[0089] According to another specific example, the target sequence may also be a sequence controlling the transcription of a coding sequence as described above, typically a promoter sequence, for example the promoter sequence (SEQ ID NO: 10) of the "XylA" gene (CA_C2610, SEQ ID NO: 4), or that (SEQ ID NO: 11) of the "XylB" gene (CA_C2612, SEQ ID NO: 5). The nucleic acid of interest then recognizes, and is therefore typically able to bind to, a sequence controlling the transcription of a coding sequence as described above.
[0090] According to another particular example, the target sequence may be a sequence flanking a coding sequence as described above, for example a sequence flanking the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a sequence that is at least 70% identical to it. Such a flanking sequence typically comprises 1, 10 or 20 and 1000 nucleotides, e.g. between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides, between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, e.g. between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 15 and 40 nucleotides, between 15 and 30 nucleotides or between 15 and 20 nucleotides.
[0091] According to a particular aspect, the target sequence corresponds to the pair of sequences flanking such a coding sequence, each flanking sequence typically comprising at least 20 nucleotides, typically between 100 and 1000 nucleotides, preferably between 200 and 800 nucleotides.
[0092] Preferably, the method according to the invention for producing a recombinant bacterium comprises transforming the bacterial cell using at least one nucleic acid of interest, for example two or three nucleic acids of interest as described above, said nucleic acid(s) of interest being capable of i) recognizing (and capable of binding at least partially) a coding sequence, controlling the transcription of a coding sequence, or flanking a coding sequence, the repressor XylR, and ii) to recognize (and capable of binding at least in part) a coding sequence, controlling the transcription of a coding sequence, or flanking a coding sequence, the AraR repressor.
[0093] As explained above, the coding sequence, controlling the transcription of a coding sequence, or flanking a coding sequence, the XylR repressor or the AraR repressor is also identified in this text as the "target sequence" or "targeted sequence".
[0094] The nucleic acid of interest as described in the present invention is preferably capable of deleting said target sequence from the bacterial genome or modifying its expression, for example, modulating / regulating it, in particular inhibiting it, preferably modifying it so as to render said bacterium incapable of expressing a protein (typically an AraR or XylR protein), in particular a functional protein, from said sequence. In a particularly preferred embodiment, the nucleic acid of interest is capable of modifying the bacterium so as to render it incapable of expressing one or both of the AraR and XylR proteins.
[0095] The introduction into the bacterium of any nucleic acid of interest can be carried out by any method, direct or indirect, known to those skilled in the art, for example by transformation, conjugation, microinjection, transfection, electroporation, etc., preferably by electroporation (Mermelstein et al, 1993).
[0096] Moreover, these nucleic acids of interest (for example DNA fragments, RNA fragments, expression cassettes or expression vectors) can be integrated into the bacterial genome by techniques that are also well known to those skilled in the art.
[0097] In a particular embodiment, the process for transforming, and preferably genetically modifying, a bacterium as described in this text, comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest according to the invention as described above and involves a genetic modification tool, for example a genetic modification tool selected from a CRISPR tool, an insertional mutagenesis tool, for example based on the use of type II introns (for example the Targetron® tool or the ClosTron® tool) and an allelic exchange tool (for example the ACE® tool).
[0098] The process for transforming, and preferably further genetically modifying, a Clostridium bacterium may further include a step of obtaining, recovering, selecting or isolating the transformed bacterium, i.e. the bacterium exhibiting the desired recombinations / modifications / optimizations.
[0099] In a particular embodiment, the method according to the invention is based on the use of (implements) the CRISPR (Clustered) genetic technology / tool Regularly Interspaced Short Palindromic Repeats), in particular the CRISPR / Cas (CRISPR-associated protein) genetic tool. The present invention can be implemented using a conventional CRISPR / Cas genetic tool employing a single plasmid comprising a nuclease, an RNA gene, and a repair template as described by Wang et al. (2015). Those skilled in the art can readily define the sequence and structure of the RNA genes according to the chromosomal region or mobile genetic element to be targeted using well-known techniques (see, for example, the article by DiCarlo et al., 2013). Alternatively, the inventors have developed and described a bacterial modification genetic tool, adapted for bacteria of the genus Clostridium, usable in the context of the present invention, based on the use of two plasmids (see WO2017 / 064439, Wasels et al., 2017).
[0100] In another embodiment, the method according to the invention is based on the use of insertional mutagenesis tools, for example the use of type II introns, and implements for example the ClosTron® genetic technology / tool or the Targetron® genetic tool.
[0101] Targetron® technology is based on the use of a reprogrammable group II intron (based on the Ll.ltrB intron of Lactococcus lactis) capable of rapidly integrating the bacterial genome at a desired locus (Chen et al., 2005; Wang et al., 2013), typically to inactivate a targeted gene. The mechanisms for recognizing the edited region and for inserting it into the genome by backsplicing are based on homology between the intron and the region, and on the activity of a protein (ItrA).
[0102] ClosTron® technology is based on a similar approach, complemented by the addition of a selection marker in the intron sequence (Heap et al., 2007). This marker allows for the selection of the intron's integration into the genome, thus facilitating the generation of desired mutants. This genetic system also exploits type I introns. Indeed, the selection marker (called RAM for retrotrans-position-activated marker) is interrupted by such a genetic element, which prevents its expression from the plasmid (a more detailed description of the system: Zhong et al.). Splicing of this genetic element occurs before integration into the genome, resulting in a chromosome with an active form of the resistance gene. An optimized version of the system includes FLP / FRT sites upstream and downstream of this gene, allowing the use of the FRT recombinase to eliminate the resistance gene (Heap et al., 2010).
[0103] In another embodiment, the process according to the invention is based on the use of an allelic exchange tool, and implements for example the ACE® genetic technology / tool.
[0104] The ACE® technology is based on the use of an auxotrophic mutant (for uracil In C. acetobutylicum ATCC 824, resistance is induced by deletion of the pyrE gene, which also causes resistance to 5-fluoroorotic acid (A-5-F0); Heap et al., 2012. The system uses the allelic exchange mechanism, well known to those skilled in the art. Following transformation with a pseudo-suicide vector (with very few copies), its integration into the bacterial chromosome via an initial allelic exchange event can be verified using the resistance gene initially present on the plasmid. The integration step can be carried out in two different ways: either within the pyrE locus or within another locus. In the case of integration at the pyrE locus, the pyrE gene is also placed on the plasmid, but without being expressed (no functional promoter). The second recombination restores a functional pyrE gene and can then be selected by auxotrophy (minimal medium, not containing uracil).Since the non-functional pyrE gene also exhibits a selectable trait (sensitivity to A-5-FO), further integrations can then be considered using the same model, by successively alternating the pyrE state between functional and non-functional. In the case of integration at another locus, a genomic region allowing expression of the counter-selection marker after recombination is targeted (typically, as an operon following another gene, preferably a highly expressed gene). This second recombination is then selected by auxotrophy (minimal medium not containing uracil).
[0105] In the described embodiments based on the use of type II introns, and implementing for example the ClosTron® genetic technology / tool or the Targetron® genetic tool, or based on the use of an allelic exchange tool, and implementing for example the ACE® genetic technology / tool, the targeted sequence is typically one of the sequences described in this text.
[0106] The invention also relates to a kit for transforming and / or genetically modifying a bacterium of the genus Clostridium comprising at least one nucleic acid of interest as described in this text (for example two nucleic acids of interest, typically a fragment of DNA, each recognizing a target sequence) for transforming and preferably genetically modifying a bacterium of the genus Clostridium, and optionally one or more selection molecules.A particular kit includes the essential elements for the operation of a CRISPR tool (typically at least one nucleic acid usable as gRNA, one nucleic acid usable as a repair template, at least one primer pair, and an inducer allowing the expression of a Cas9 or MAD7 type nuclease), the essential elements for the operation of a tool based on the use of type II introns (typically at least one type II intron, at least one primer pair and an inducer allowing the expression of a reverse transcriptase, for example type LtrA RT or Tel4c RT), or the essential elements for the operation of an exchange tool. allelic (typically at least two nucleic acids usable as a homologous recombination template, and at least one primer pair).
[0107] The kits according to the invention may further include one or more consumables such as a culture medium, at least one competent bacterium of the genus Clostridium (i.e. conditioned for processing), or an explanatory leaflet.
[0108] The invention typically relates to a kit for implementing a genetic transformation and / or modification process described herein using a bacterium of the genus Clostridium.
[0109] The invention relates in particular to the genetically modified bacterium belonging to the genus Clostridium having the essential characteristic of not expressing the products of the xylR and araR genes, or of expressing non-functional versions thereof, as well as any derived, clone, mutant or genetically modified version of it, and their uses.
[0110] The application also describes strain IFP 967, registered on June 13, 2022 under application number LMG P-32702 in the BCCM-LMG collection, in which the araR gene has been inactivated, as well as any derived, cloned, mutant or genetically modified version of it, typically lacking the xylR and araR genes, or in which said genes have also been inactivated.
[0111] It relates in particular to the use of a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the product of the xylR or araR gene, or expresses a non-functional version of the xylR or araR gene, for example strain IFP 967, registered on June 13, 2022 under the application number LMG P-32702 in the BCCM-LMG collection, to prepare a genetically modified bacterium according to the invention not expressing the products of the xylR and araR genes, or expressing non-functional versions thereof.
[0112] The invention also relates to a kit for producing a solvent, a sugar, or a bio-based molecule using a bacterium belonging to the genus Clostridium, comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention, for example IPF968, and ii) a medium, typically a preservation medium or a culture medium for said bacterium. The kit may further include an instruction leaflet.
[0113] The preservation or culture medium for the genetically modified bacterium (belonging to the genus Clostridium) according to the invention, present within the kit, is preferably supplemented with a carbon source composed of glucose and at least one pentose, preferably i) glucose and ii) arabinose and / or xylose. This medium preferably comprises between 0.1 and 250 g / L, more preferably between 1 and 100 g / L, of said carbon source (composed of glucose and at least one pentose).
[0114] The medium for preserving or culturing the genetically modified bacterium is preferably an RCM type culture medium, more preferably a GAPES type culture medium, even more preferably a CGM type culture medium.
[0115] The invention also relates to a particular kit for producing a solvent or a biofuel, or a mixture of solvents or biofuels, using a bacterium belonging to the genus Clostridium, said kit comprising i) a bacterium (belonging to the genus Clostridium) genetically modified according to the invention, characterized in that it does not express the products of the xylR and araR genes, or expresses non-functional versions thereof, and ii) a rich culture medium, preferably an RCM type culture medium, more preferably a GAPES type culture medium, even more preferably a CGM type culture medium, containing at least glucose and a pentose, preferably arabinose and / or xylose.
[0116] The invention also relates to the possible uses of the process or kit according to the invention for transforming and / or genetically modifying a bacterium of the genus Clostridium, typically a solventogenic bacterium of the genus Clostridium, for example to generate improved variants of said bacterium.
[0117] It also relates to the possible uses of the process, the kit or a transformed and preferably genetically modified Clostridium bacterium according to the invention, in particular to enable the production of solvents or biofuels, or mixtures thereof, typically on an industrial scale.
[0118] The examples and figures below are intended to illustrate the invention more fully without limiting its scope. In particular, these examples show the production and characterization of bacteria according to the invention, wherein the inactivation of araR and / or xylR genes is carried out according to a particular preferred embodiment using a CRISPR-Cas9 tool. These genes can be inactivated according to other particular embodiments, well known to those skilled in the art, based, for example, on gene inactivation by homologous recombination or by insertional mutagenesis, as explained above. FIGURES
[0119] [Fig. 1] [Fig. 1] represents the pBANak plasmid map
[0120] [Fig.2] Fig.2 represents the map of the pGRNA_ACA_C1340 plasmid
[0121] [Fig.3] Fig.3 represents the pGRNA_ACA_C2613 plasmid map
[0122] [Fig.4] Fig.4 represents the pGRNA_ACA_C3673 plasmid map
[0123] [Fig. 5] [Fig. 5] shows the growth kinetics on 30 mM xylose CGM medium.
[0124] [Fig. 6A] [Fig. 6A] represents the consumption kinetics of a mixture of glucose, arabinose, and xylose in the wild-type strain C. acetobutylicum DSM 792, on a CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose
[0125] [Fig. 6B] Figure 6B shows the consumption kinetics of a mixture of glucose, arabinose and xylose in the strain C. acetobutylicum DSM 792 ACA_C2613 ACA_C3673, on a CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose
[0126] [Fig. 6C] [Fig. 6C] shows the consumption kinetics of a mixture of glucose, arabinose, and xylose in the strain C. acetobutylicum DSM 792 ACA_C1340, on a CGM medium containing 25 mM glucose, 25 mM arabinose, and 70 mM xylose.
[0127] [Fig. 6D] [Fig. 6D] shows the consumption kinetics of a mixture of glucose, arabinose, and xylose in the strain C. acetobutylicum DSM 792 ACA_C1340 ACA_C2613 ACA_C3673, on a CGM medium containing 25 mM glucose, 25 mM arabinose, and 70 mM xylose. EXAMPLES
[0128] EXAMPLE No. 1: Strain C. acetobutylicum ACA C2613 ACA C3673 Materials and methods Growing conditions
[0129] C. acetobutylicum DSM 792 was cultured in 2YTG medium (Tryptone 16 g L*, yeast extract 10 g L*, glucose 5 g L*, NaCl 4 g L1) and CGM (KH2PO4, 0.75 g; K2 HPO4, 0.75 g; MgSO4-7H2O, 0.40 g; MnSO4 H2O, 0.01 g; FeSO4-7 H2O, 0.01 g; NaCl, 1.0 g; asparagine, 2.0 g; yeast extract, 5.0 g; (NH4)2SO4, 2.0 g; carbon source as specified). Escherichia coli NEB 10-beta was cultured in LB medium (Tryptone 10 g L1, yeast extract 5 g L*, NaCl 10 g L1). Solid media were prepared by adding 15 g L1 of agarose to the liquid media. Erythromycin (at concentrations of 40 mg L1 in 2YTG medium), chloramphenicol (25 or 12.5 mg L1 in solid or liquid LB medium, respectively), and thiamphenicol (15 mg L1 in 2YTG medium) were used as needed. Nucleic acids and plasmid vectors
[0130] The list of primers used for all constructs (DNA name / sequence) is detailed below:
[0131] CA_C2613_LHA_Fwd : AAAAAAGAATTCATTTGTCCACTTATAC- CAATTCCT (SEQ ID NO : 31)
[0132] CA_C2613_LHA_Rev : TCCTACTAGATACGGCGGAGTAAAATTAGT (SEQ ID NO : 32)
[0133] CA_C2613_RHA_Fwd : CTCCGCCGTATCTAGTAGGAATCTCCCACT (SEQ ID NO : 33)
[0134] CA_C2613_RHA_Rev : AAAAAAGTCGACAAAGAAAATAAGAGGAA-TACAAAAG (SEQ ID NO : 34)
[0135] gRNA_CA_C2613_Fwd : TCATGTTACACTTGGAACAGGCGT (SEQ ID NO : 35)
[0136] gRNA_CA_C2613_Rev : AAACACGCCTGTTCCAAGTGTAAC (SEQ ID NO : 36)
[0137] CA_C3673_LHA_Fwd : AAAAAAGGATCCAGAAAGACTTGTTA-CATCTCTAAGT (SEQ ID NO : 37)
[0138] CA_C3673_LHA_Rev : TGATATAGACTTAATTGAACAAGATGTAATTT-GAAATTAGT (SEQ ID NO : 38)
[0139] CA_C3673_RHA_Fwd : GTTCAATTAAGTCTATATCAAACATATCG-CACCAACC (SEQ ID NO : 39)
[0140] CA_C3673_RHA_Rev : AAAAAAGTCGACATGAATGGGAAATATA-TAGGACTTT (SEQ ID NO : 40)
[0141] gRNA_CA_C3673_Fwd : TCATGGAGTAGCAAGCTCTACAGG (SEQ ID NO : 41) .
[0142] gRNA_CA_C3673_Rev : AAACCCTGTAGAGCTTGCTACTCC (SEQ ID NO : 42) .
[0143] CA_C2613_verif_Fwd : TCGGCAGCAAAAACTCCAGT (SEQ ID NO : 43);
[0144] CA_C2613_verif_Rev : GCAATTGCTGGCGGAATGA (SEQ ID NO : 44) .
[0145] CA_C3673_verif Fwd : TACTTCATACATATCTAACGCACTCT (SEQ ID NO : 45) .
[0146] CA_C3673_verif Rev : AAATAACTTCTACTATGAGACAAGCA (SEQ ID NO : 46)
[0147] The following plasmid vectors were constructed:
[0148] - Plasmid No. 1: pBANak (SEQ ID NO: 47)
[0149] It contains the pl5A origin of replication, as well as the ampR and kanR genes, which confer resistance to ampicillin and kanamycin, respectively. It also contains an expression cassette of the phi 3T I methyltransferase from Bacillus subtilis, which is necessary for the methylation of gene-editing vectors prior to transformation into C. acetobutylicum.
[0150] - Plasmid No. 2: pGRNA_ACA_C2613 (SEQ ID NO: 29)
[0151] It contains all the elements of the pGRNAind with a guide RNA substitution allowing targeting of CA_C2613 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C2613_Fwd (SEQ ID NO: 35) and gRNA_CA_C2613_Rev (SEQ ID NO: 36)) and integrated into the plasmid by the "golden gate assembly" technique, after digestion with Bsal. It also contains an editing template allowing the inactivation of CA_C2613. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C2613_LHA_Fwd (SEQ ID NO: 31) / CA_C2613_LHA_Rev (SEQ ID NO: 36) NO: 32) and CA_C2613_RHA_Fwd (SEQ ID NO: 33) / CA_C2613_RHA_Rev (SEQ ID NO: 34) from C. acetobutylicum DSM 792 γDNA. The editing template was cloned between the BamHI and Sali restriction sites.
[0152] - Plasmid No. 3: pGRNA_ACA_C3673 (SEQ ID NO: 30)
[0153] It contains all the elements of the pGRNAind with a guide RNA substitution allowing targeting of CA_C3673 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C3673_Fwd (SEQ ID NO: 41) and gRNA_CA_C3673_Rev (SEQ ID NO: 42) and integrated into the plasmid by golden gate assembly, after digestion with Bsal. It also contains an editing template allowing inactivation of CA_C3673. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C3673_LHA_Fwd (SEQ ID NO: 37) / CA_C3673_LHA_Rev (SEQ ID NO: 38) and CA_C3673_RHA_Fwd (SEQ ID NO: 39) / CA_C3673_RHA_Rev (SEQ ID NO: 40) from C. acetobutylicum DSM 792 γDNA. The editing template was cloned between the BamHI and Sali restriction sites. Transformation of C. acetobutylicum strains
[0154] Plasmids prepared in the NEB 10-beta strain were methylated by transformation in a NEB 10-beta strain also containing the pBANak plasmid. The methylated plasmids thus extracted will then be used to transform the C. acetobutylicum strain. The transformation is carried out according to the protocol described by Wasels et al. 2020.
[0155] Genetic editing of the CA_C2613 (SEQ ID NO: 1) and CA_C3673 (SEQ ID NO: 2) genes
[0156] The inactivations of the CA_C2613 and CA_C3673 genes in the ACA_C2613-ACA_C3673 strains were carried out by gene editing according to the protocol described by Wasels et al. 2020, using respectively the primer pairs CA_C2613_verif_Fwd (SEQ ID NO: 43) / CA_C2613_verif_Rev (SEQ ID NO: 44); CA_C3673_verif_Fwd (SEQ ID NO: 45) / CA_C3673_verif_Rev (SEQ ID NO: 46) during validation of the edit. The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, can make it possible to obtain mutants with equivalent genotypes, i.e. no longer expressing the products of the CA_C2613 and CA_C3673 genes, or expressing a non-functional version of them. Results
[0157] Growth kinetics and determination of generation time
[0158] Growth monitoring of wild-type C. acetobutylicum DSM 792 and ACA_C2613 ACA_C3673 strains was performed in quintuplicate on CGM medium containing 30 mM xylose ([Fig.5]).
[0159] The results reveal an improvement in generation time when growing on xylose as a carbon source. Furthermore, the joint inactivation of the CA_C2613 and CA_C3673 genes results in a 33% improvement in generation time compared to the wild-type strain. Monitoring of sugar mixture consumption
[0160] Follow-up studies of sugar mixture consumption were carried out in technical triplicates with the wild-type C. acetobutylicum DSM 792 and ACA_C2613 ACA_C3673 strains, on a CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose (Figure 6).
[0161] The results indicate that the joint inactivation of CA_C2613 and CA_C3673 does not present a significant phenotypic change compared to the wild strain.
[0162] Example No. 2: IFP 967 strain (LMG P-32702), C. acetobutylicum ACA C1340 Materials and methods Growing conditions
[0163] C. acetobutylicum DSM 792 was cultured in 2YTG medium (Tryptone 16 g L*, yeast extract 10 g L*, glucose 5 g L*, NaCl 4 g L1) and CGM (KH2PO4, 0.75 g; K2 HPO4, 0.75 g; MgSO4-7H2O, 0.40 g; MnSO4 H2O, 0.01 g; FeSO4-7 H2O, 0.01 g; NaCl, 1.0 g; asparagine, 2.0 g; yeast extract, 5.0 g; (NH4)2SO4, 2.0 g; carbon source as specified). Escherichia coli NEB 10-beta was cultured in LB medium (Tryptone 10 g L⁻¹, yeast extract 5 g L⁻¹*, NaCl 10 g L⁻¹). Solid media were prepared by adding 15 g L⁻¹ of agarose to the liquid media. Erythromycin (at concentrations of 40 mg L⁻¹ in 2YTG medium), chloramphenicol (25 or 12.5 mg L⁻¹ in solid or liquid LB medium, respectively), and thiamphenicol (15 mg L⁻¹ in 2YTG medium) were used as needed. Nucleic acids and plasmid vectors
[0164] The list of primers used for all constructs (DNA name / sequence) is detailed below:
[0165] CA_C1340_LHA_Fwd : AAAAAAGGATCCACCAGAAAAAC-CAACGCCTAGTA (SEQ ID NO : 48)
[0166] CA_C1340_LHA_Rev : AGAAGTAGAAATTAATTGAAATAATTA-TATTTAGTCCCTTGCC (SEQ ID NO : 49)
[0167] CA_C1340_RHA_Fwd : TTTCAATTTTAATCTTCTACTTCTTCA-TATTTGTGCT (SEQ ID NO : 50)
[0168] CA_C1340_RHA_Rev : AAAAAAGTCGACTAATTACTCATTACATACGT-TATTTTTCAGT (SEQ ID NO : 51)
[0169] gRNA_CA_C 1340_Fwd : TCATTTTAAGGTCGATGATTCAC A (SEQ ID NO : 52)
[0170] gRNA_CA_C1340_Rev : AAACTGTGAATCATCGACCTTAAA (SEQ ID NO : 53)
[0171] CA_C1340_verif_Fwd : CCTACCAATAGCATCGCCCAAGA (SEQ ID NO : 54)
[0172] CA_C1340_verif_Rev : TTCTAGCATAAAATACTCCTCCCTA (SEQ ID NO : 55)
[0173] Lestéivors plasm vec
[0174] - Plasmid N°1 : pBANak (SEQ ID NO : 47)
[0175] It contains the pl5A origin of replication, as well as the ampR and kanR genes, which confer resistance to ampicillin and kanamycin, respectively. It also contains an expression cassette of the phi 3T I methyltransferase from Bacillus subtilis, necessary for the methylation of gene-editing vectors prior to transformation into C. acetobutylicum.
[0176] - Plasmid No. 4: pGRNA_ACA_C1340 (SEQ ID NO: 28)
[0177] It contains all the elements of the pGRNAind (Wasels et al. 2020) with a guide RNA substitution allowing targeting of CA_C1340 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C1340_Fwd (SEQ ID NO: 52) and gRNA_CA_C1340_Rev (SEQ ID NO: 53) and integrated into the plasmid by the "golden gate assembly" technique, after digestion with Bsal. It also contains an editing template allowing the inactivation of CA_C1340. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C1340_LHA_Fwd (SEQ ID NO: 48) / CA_C1340_LHA_Rev (SEQ ID NO: 49) and CA_C1340_RHA_Fwd (SEQ ID NO: 50) / CA_C1340_RHA_Rev (SEQ ID NO: 51) from C. acetobutylicum DSM 792 γDNA. The editing template was cloned between the BamHI and Sali restriction sites. Transformation of C. acetobutylicum strains
[0178] Plasmids prepared in the NEB 10-beta strain were methylated by transformation in a NEB 10-beta strain also containing the pBANak plasmid. The methylated plasmids thus extracted will then be used to transform the C. acetobutylicum strain. The transformation is carried out according to the protocol described by Wasels et al. 2020.
[0179] Genetic editing of the CA_C1340 gene (SEQ ID NO: 3):
[0180] CA_C1340 gene inactivation in ACA_C1340 strains was achieved by gene editing according to the protocol described by Wasels et al. 2020, using the primer pairs CA_C1340_verif_Fwd (SEQ ID NO: 54) / CA_C1340_verif_Rev (SEQ ID NO: 55) respectively during edit validation. The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, can yield mutants. possessing equivalent genotypes, i.e. no longer expressing the product of the CA_C1340 gene or expressing a non-functional version thereof. Results
[0181] Growth kinetics and determination of generation time
[0182] Growth monitoring of wild-type C. acetobutylicum DSM 792 and ACA_C1340 strains was carried out in quintuplicate on CGM medium containing 30 mM xylose ([Fig.5]).
[0183] The results reveal an improvement in generation time when growing on xylose as a carbon source. Furthermore, inactivation of the gene encoding the AraR repressor results in a 152% improvement in generation time compared to the wild-type strain. Monitoring of sugar mixture consumption
[0184] Follow-up studies of sugar mixture consumption were carried out in technical triplicates with the wild-type C. acetobutylicum DSM 792 and ACA_C1340 strains on a CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose (Figure 6).
[0185] The results indicate that the inactivation of CA_C1340 allows for a faster arabinose consumption kinetics in the presence of glucose than that observed in the wild strain.
[0186] Example 3: IFP 968 strain (LMG P-32703), C. acetobutylicum ACA C1340-ACA C2613-ACA C3673 Materials and methods Growing conditions
[0187] C. acetobutylicum DSM 792 was cultured in 2YTG medium (Tryptone 16 g L*, yeast extract 10 g L*, glucose 5 g L*, NaCl 4 g L1) and CGM (KH2PO4, 0.75 g; K2 HPO4, 0.75 g; MgSO4-7H2O, 0.40 g; MnSO4 H2O, 0.01 g; FeSO4-7 H2O, 0.01 g; NaCl, 1.0 g; asparagine, 2.0 g; yeast extract, 5.0 g; (NH4)2SO4, 2.0 g; carbon source as specified). Escherichia coli NEB 10-beta was cultured in LB medium (Tryptone 10 g L1, yeast extract 5 g L*, NaCl 10 g L1). Solid media were prepared by adding 15 g L1 of agarose to the liquid media. Erythromycin (at concentrations of 40 mg L1 in 2YTG medium), chloramphenicol (25 or 12.5 mg L1 in solid or liquid LB medium, respectively), and thiamphenicol (15 mg L1 in 2YTG medium) were used as needed. Nucleic acids and plasmid vectors
[0188] The list of primers used for all constructs (DNA name / sequence) is detailed below:
[0189] CA_C1340_LHA_Fwd : AAAAAAGGATCCACCAGAAAAAC- CAACGCCTAGTA (SEQ ID NO : 48)
[0190] CA_C1340_LHA_Rev : AGAAGTAGAAGAATTGAAATTTTA- TATTTAGTCCCTTGCC (SEQ ID NO : 49)
[0191] CA_C1340_RHA_Fwd : TTTCAATTTTAATTCTTCTACTTCTTCA-TATTTGTGCT (SEQ ID NO : 50);
[0192] CA_C1340_RHA_Rev : AAAAAAGTCGACTAATTACTCATTACATACGT-TATTTTTCAGT (SEQ ID NO : 51) .
[0193] gRNA_CA_C1340_Fwd: TCATTTTAAGGTCGATGATTCACA. 52)
[0194] gRNA_CA_C1340_Rev : AAACTGTGAATCATCGACCTTAAA 53)
[0195] CA_C1340_verif_Fwd : CCTACCAATAGCATCGCCCAAGA (SEQ ID NO : 54) .
[0196] CA_C1340_verif_Rev : TTCTAGCATAAAATACTCCTCCCTA (SEQ ID NO : 55);
[0197] CA_C2613_LHA_Fwd : AAAAAAGAATTCATTTGTCCACTTATAC- . CAATTCCT (SEQ ID NO : 31)
[0198] CA_C2613_LHA_Rev : TCCTACTAGATACGGCGGAGTAAAATTAGT (SEQ ID NO : 32) .
[0199] CA_C2613_RHA_Fwd : CTCCGCCGTATCTAGTAGGAATCTCCCACT (SEQ ID NO : 33)
[0200] CA_C2613_RHA_Rev : AAAAAAGTCGACAAAGAAAATAAGAGGAA-TACAAAAG (SEQ ID NO : 34) [0201 ] gRNA_CA_C2613_Fwd : TCATGTTACACTTGGAACAGGCGT (SEQ ID NO : 35)
[0202] gRNA_CA_C2613_Rev : AAACACGCCTGTTCCAAGTGTAAC (SEQ ID NO : 36)
[0203] CA_C2613_verif_Fwd : TCGGCAGCAAAAACTCCAGT (SEQ ID NO : 42)
[0204] CA_C2613_verif_Rev : GCAATGCTGGCGGAATGAA (SEQ ID NO : 43)
[0205] CA_C3673_LHA_Fwd : AAAAAAGGATCCAGAAAGACTTGTTA- CATCTCTAAGT (SEQ ID NO : 37)
[0206] CA_C3673_LHA_Rev : TGATATAGACTTAATTGAACAAGATGTAATTT-GAAATTAGT (SEQ ID NO : 38)
[0207] CA_C3673_RHA_Fwd : GTTCAATTAAGTCTATATCAAACATATCG-CACCAACC (SEQ ID NO : 39)
[0208] CA_C3673_RHA_Rev : AAAAAAGTCGACATGAATGGGAAATATA-TAGGACTTT (SEQ ID NO : 40)
[0209] gRNA_CA_C3673_Fwd : TCATGGAGTAGCAAGCTCTACAGG (SEQ ID NO : 41)
[0210] gRNA_CA_C3673_Rev: AAACCCTGTAGAGCTTGCTACTCC (SEQ ID NO: 42)
[0211] CA_C3673_verif Fwd: TACTTCATACATATCTAACGCACTCT (SEQ ID NO: 44)
[0212] CA_C3673_verif Rev: AAATAACTTCTACTATGAGACAAGCA (SEQ ID NO: 45)
[0213] The following plasmid vectors were constructed:
[0214] - Plasmid No. 1: pBANak (SEQ ID NO: 52)
[0215] It contains the pl5A origin of replication, as well as the ampR and kanR genes, which confer resistance to ampicillin and kanamycin, respectively. It also contains an expression cassette of the phi 3T I methyltransferase from Bacillus subtilis, which is necessary for the methylation of gene-editing vectors prior to transformation into C. acetobutylicum.
[0216] - Plasmid No. 4: pGRNA_ACA_C1340 (SEQ ID NO: 28)
[0217] It contains all the elements of the pGRNAind (Wasels et al. 2020) with a guide RNA substitution allowing targeting of CA_C1340 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C1340_Fwd (SEQ ID NO: 52) and gRNA_CA_C1340_Rev (SEQ ID NO: 53) and integrated into the plasmid by the "golden gate assembly" technique, after digestion with Bsal. It also contains an editing template allowing the inactivation of CA_C1340. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C1340_LHA_Fwd (SEQ ID NO: 48) / CA_C1340_LHA_Rev (SEQ ID NO: 49) and CA_C1340_RHA_Fwd (SEQ ID NO: 50) / CA_C1340_RHA_Rev (SEQ ID NO: 51) from C. acetobutylicum DSM 792 γDNA. The editing template was cloned between the BamHI and Sali restriction sites.
[0218] - Plasmid No. 2: pGRNA_ACA_C2613 (SEQ ID NO: 29)
[0219] It contains all the elements of the pGRNAind with a guide RNA substitution allowing targeting of CA_C2613 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C2613_Fwd (SEQ ID NO: 35) and gRNA_CA_C2613_Rev (SEQ ID NO: 36) and integrated into the plasmid by the "golden gate assembly" technique, after digestion with Bsal. It also contains an editing template allowing the inactivation of CA_C2613. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C2613_LHA_Fwd (SEQ ID NO: 31) / CA_C2613_LHA_Rev (SEQ ID NO: 32) and CA_C2613_RHA_Fwd (SEQ ID NO: 33). / CA_C2613_RHA_Rev (SEQ ID NO: 34) from C. acetobutylicum DSM 792 γDNA. The editing template was cloned between the BamHI and Sali restriction sites.
[0220] - Plasmid No. 3: pGRNA_ACA_C3673 (SEQ ID NO: 30)
[0221] It contains all the elements of pGRNAind with a guide RNA substitution allowing the targeting of CA_C3673 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C3673_Fwd (SEQ ID NO: 41) and gRNA_CA_C3673_Rev (SEQ ID NO: 42) and integrated into the plasmid by golden gate assembly, after digestion with Bsal. It also contains an editing template allowing the inactivation of CA_C3673. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C3673_LHA_Fwd (SEQ ID NO: 37) / CA_C3673_LHA_Rev (SEQ ID NO: 38) and CA_C3673_RHA_Fwd (SEQ ID NO: 39) / CA_C3673_RHA_Rev (SEQ ID NO: 40) at starting from C. acetobutylicum DSM 792 DNA. The editing template was cloned between the BamHI and Sali restriction sites. Transformation of C. acetobutylicum strains
[0222] Plasmids prepared in the NEB 10-beta strain were methylated by transformation in a NEB 10-beta strain also containing the pBANak plasmid. The methylated plasmids thus extracted will then be used to transform the C. acetobutylicum strain. The transformation is carried out according to the protocol described by Wasels et al. 2020.
[0223] Genetic editing of the genes CA_C2613 (SEQ ID NO: 1), CA_C3673 (SEQ ID NO: 2) and / or CA_C1340 (SEQ ID NO: 3):
[0224] Inactivation of the CA_C1340, CA_C2613 and CA_C3673 genes in the ACA_C1340-ACA_C2613-ACA_C3673 strain was performed by gene editing according to the protocol described by Wasels et al. 2020, using the primer pairs respectively CA_C1340_verif_Fwd (SEQ ID NO: 54) / CA_C1340_verif_Rev (SEQ ID NO: 55); CA_C2613_verif_Fwd (SEQ ID NO: 43) / CA_C2613_verif_Rev (SEQ ID NO: 44); CA_C3673_verif_Fwd (SEQ ID NO: 45) / CA_C3673_verif_Rev (SEQ ID NO: 46) during the validation of the edit. The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, can make it possible to obtain mutants possessing equivalent genotypes, i.e. no longer expressing the products of the CA_C1340, CA_C2613 and / or CA_C3673 genes, or expressing a non-functional version of them. Results
[0225] Growth kinetics and determination of generation time
[0226] Growth monitoring of wild-type C. acetobutylicum DSM 792 strains, and ACA_C1340 ACA_C2613 ACA_C3673 was carried out in quintuplicate on CGM medium containing 30 mM xylose ([Fig.5]).
[0227] The results reveal an improvement in generation time when growing on xylose as a carbon source. Furthermore, the joint inactivation of the genes encoding the AraR and XylR repressors allows for a +171% improvement in generation time. generation in relation to the wild strain. Monitoring of sugar mixture consumption
[0228] Follow-up studies of sugar mixture consumption were carried out in technical triplicates with the wild-type C. acetobutylicum DSM 792 and ACA_C1340 ACA_C2613 ACA_C3673 strains, on a CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose (Figure 6).
[0229] The results indicate that the simultaneous co-assimilation of arabinose and glucose is made possible during the joint inactivation of CA_C1340 and the CA_C2613 and CA_C3673 genes.
[0230] The catabolic repression preventing the co-assimilation of xylose in the presence of the other two sugars is nevertheless maintained. This unexpected result indicates that the synergy between the joint inactivation of the genes encoding the AraR and XylR repressors allows the lifting of the catabolic repression affecting arabinose, while maintaining it for xylose. Conclusions
[0231] In the course of this work, the inventors were able to demonstrate the benefit of jointly inactivating the genes encoding the AraR and XylR repressors in the C. acetobutylicum DSM 792 strain, thus describing how the combination of these genetic modifications allows for the production of a C. acetobutylicum strain that performs glucose / arabinose co-assimilation and exhibits accelerated growth on xylose alone. Inactivation of the araR gene alone does not allow for the co-assimilation of arabinose and glucose, which is only achieved when the copies of the genes encoding the XylR repressor are also inactivated. Furthermore, inactivation of both copies of the XylR gene is not sufficient to significantly reduce the generation time of the microorganism when it grows on a medium containing xylose as the sole carbon source. Inactivation of the AraR gene is necessary.
[0232] This result is important because this strain naturally suffers from an inability to simultaneously assimilate pentoses and hexoses such as glucose, arabinose and xylose, drastically impacting performance during fermentation on substrates composed of a mixture of these sugars, such as industrial substrates in sugar production processes from biomass. REFERENCES
[0233] - Aristilde, Ludmilla; Lewis, lan A.; Park, Junyoung O.; Rabinowitz, Joshua D. (2014) Hierarchy in Pentose Sugar Metabolism in Clostridium acetobutylicum. In: Applied and environmental microbiology, vol. 81, n°4, p. 1452-1462. DOI: 10.1128 / aem.03199-14.
[0234] - Ezeji, Thaddeus; Blaschek, Hans P. (2008) Fermentation of dried distillers' grains and solubles (DDGS) hydrolysates to solvents and value-added products by sol-ventogenic clostridia. In : Bioresource Technology, vol. 99, n° 12, p. 5232-5242. DOI: 10.1016 / j.biortech.2007.09.032.
[0235] - Ezeji, Thaddeus; Qureshi, Nasib; Blaschek, Hans P. (2007) Butanol production from agricultural residues. Impact of dégradation products on Clostridium beijerinckii growth and butanol fermentation. In : Biotechnology and bioengineering, vol. 97, n° 6, p. 1460-1469. DOI: 10.1002 / bit.21373.
[0236] - Grimmler, Christina; Held, Claudia; Liebl, Wolfgang; Ehrenreich, Armin (2010) Transcriptional analysis of catabolite repression in Clostridium acetobutylicum growing on mixtures of D-glucose and D-xylose. In : Journal of biotechnology, vol. 150, n° 3, p. 315-323. DOI: 10.1016 / j.jbiotec.2010.09.938.
[0237] - Gu, Yang; Ding, Yi; Ren, Cong; Sun, Zhe; Rodionov, Dmitry A.; Zhang, Weiwen et al. (2010) Reconstruction of xylose utilization pathway and régulons in Firmicutes. In : BMC genomics, vol. 11, p. 255. DOI: 10.1186 / 1471-2164-11-255.
[0238] - Hu, Shiyuan; Zheng, Huajun; Gu, Yang; Zhao, Jingbo; Zhang, Weiwen; Yang, Yunliu et al. (2011) Comparative genomic and transcriptomic analysis revealed genetic characteristics related to solvent formation and xylose utilization in Clostridium acetobutylicum EA 2018. In : BMC genomics, vol. 12, n° 1. DOI: 10.1186 / 1471-2164-12-93.
[0239] - Keis, S.; Shaheen, R.; Jones, D. T. (2001) Emended descriptions of Clostridium acetobutylicum and Clostridium beijerinckii, and descriptions of Clostridium saccharo-perbutylacetonicum sp. nov. and Clostridium saccharobutylicum sp. nov. In : INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY ML CROBIOLOGY, vol. 51, n° 6, p. 2095-2103. DOI: 10.1099 / 00207713-51-6-2095.
[0240] - Qureshi, N.; Li, X.-L.; Hughes, S.; Saha, B. C.; Cotta, M. A. (2006) Butanol Production from Corn Fiber Xylan Using Clostridium acetobutylicum. In : Biotechnology Progress, vol. 22, n° 3, p. 673-680. DOI: 10.1021 / bp050360w.
[0241] - Qureshi, Nasib; Ezeji, Thaddeus C.; Ebener, Jennifer; Dien, Bruce S.; Cotta, Michael A.; Blaschek, Hans P. (2008) Butanol production by Clostridium beijerinckii. Part I. Use of acid and enzyme hydrolyzed corn fiber. In : Bioresource Technology, vol. 99, n° 13, p. 5915-5922. DOI: 10.1016 / j.biortech.2007.09.087.
[0242] - Servinsky, M. D. Arabinose-Induced Catabolite Repression as a Mechanism for Pentose Hierarchy Control in Clostridium acetobutylicum ATCC 824.
[0243] - Servinsky, M. D.; Germane, K. L.; Liu, S.; Kiel, J. T.; Clark, A. M.; Shankar, J.; Sund, C. J. (2012) Arabinose is metabolized via a phosphoketolase pathway in Clostridium acetobutylicum ATCC 824. In : Journal of industrial microbiology & biotechnology, vol. 39, n° 12, p. 1859-1867. DOI: 10.1007 / sl0295-012-1186-x.
[0244] - Servinsky, Matthew D.; Kiel, James T.; Dupuy, Nicole F.; Sund, Christian J. (2010) Transcriptional analysis of differential carbohydrate utilization by Clostridium aceto-butylicum. In : Microbiology (Reading, England), vol. 156, n° Pt 11, p. 3478-3491. DOI: 10.1099 / mic.0.037085-0.
[0245] - Wasels, François; Chartier, Gwladys; Hocq, Rémi; Lopes Ferreira, Nicolas; Julia Pettinari, M. (2020) A CRISPR / Anti-CRISPR Genome Editing Approach Underlines the Synergy of Butanol Dehydrogenases in Clostridium acetobutylicum DSM 792. In : Applied and environmental microbiology, vol. 86, n° 13, p. 4823. DOI: 10.1128 / AEM.00408-20.
[0246] - Xiao, Han; Li, Zhilin; Jiang, Yu; Yang, Yunliu; Jiang, Weihong; Gu, Yang; Yang, Sheng (2012) Metabolic engineering of D-xylose pathway in Clostridium beijerinckii to optimize solvent production from xylose mother liquid. In : Metabolic engineering, vol. 14, n° 5, p. 569-578. DOI: 10.1016 / j.ymben.2012.05.003.
[0247] - Zhang, Lei; Leyn, Semen A.; Gu, Yang; Jiang, Weihong; Rodionov, Dmitry A.; Yang, Chen (2012) Ribulokinase and transcriptional régulation of arabinose me-tabolism in Clostridium acetobutylicum. In : Journal of bacteriology, vol. 194, n° 5, p. 1055-1064. DOI: 10.1128 / JB.06241-11.
Claims
Demands
1. A genetically modified bacterium belonging to the species Clostridium acetobutylicum, characterized in that the bacterium does not express the products of the genes of sequence SEQ ID NO: 1 (CA_C2613) or a sequence homologous to at least 95% of it and of SEQ ID NO: 2 (CA_C3673) or a sequence homologous to at least 95% of it ("xylR gene"), and of SEQ ID NO: 3 (CA_C1340) or a sequence homologous to at least 95% of it ("araR gene"), or ii) expresses non-functional versions of these.
2. Bacterium according to claim 1, characterized in that it is capable of simultaneously fermenting at least one hexose and one pentose.
3. Bacterium according to claim 1, characterized in that it is capable of simultaneously fermenting the carbon elements of a substrate comprising at least two carbon elements selected from glucose, arabinose, xylose, mannose and galactose, preferably selected from glucose, arabinose and xylose.
4. Bacterium according to claim 1, characterized in that it grows faster than a bacterium expressing a functional AraR protein, or a mixture of functional XylR and AraR proteins, on a medium comprising xylose as the sole carbon source.
5. Bacteria according to any one of claims 1 to 4, characterized in that the bacterium is strain IFP 968 registered on June 13, 2022 under LMG filing number P-32703 with the BCCM-LMG collection.
6. Use of a genetically modified bacterium belonging to the genus Clostridium according to any one of claims 1 to 5, to simultaneously ferment at least one hexose and one pentose or the carbon elements of a substrate comprising at least two carbon elements selected from glucose, arabinose, xylose, mannose and galactose.
7. Use according to claim 6, characterized in that the substrate comprises at least two sugars selected from glucose, arabinose and xylose.
8. Use according to claim 6 or 7, to produce a solvent, for example a biofuel, or a mixture of solvents, for example a mixture of biofuels.
9. Use of a genetically modified bacterium belonging to the genus Clostridium according to any one of claims 1 to 5, to produce a sugar or a bio-based molecule from i) a biomass lignocellulosic, ii) the product of a particular dedicated crop such as an energy crop, a perennial forage crop, a herbaceous crop, a shrub crop, or iii) GI substrate(s) derived from one or more sugar, cereal, or oilseed plants, or iv) a mixture of such carbon sources.
10. A fermentation process involving the use of a genetically modified bacterium belonging to the genus Clostridium according to any one of claims 1 to 5.
11. A process for producing a recombinant bacterium belonging to the species Clostridium acetobutylicum, characterized in that the process comprises the deletion or inactivation of the genes of sequence SEQ ID NO: 1 (CA_C2613) or a sequence homologous to at least 95% of it and of SEQ ID NO: 2 (CA_C3673) or a sequence homologous to at least 95% of it ("xylR gene"), and of SEQ ID NO: 3 (CA_C1340) or a sequence homologous to at least 95% of it ("araR gene"), so as to prevent or decrease the expression of functional XylR and AraR proteins.
12. Genetically modified bacterium belonging to the genus Clostridium capable of being obtained by the process according to claim 11, characterized in that said bacterium is a bacterium as described in any one of claims 1 to 5.
13. Kit for producing a solvent, a sugar or a bio-based molecule using a bacterium belonging to the genus Clostridium, comprising a genetically modified bacterium belonging to the genus Clostridium according to any one of claims 1 to 5, and a medium for preserving said bacterium.