APTAMER COMPOSITE AND ITS USE IN DETECTING A MOLECULE OF INTEREST

Abstract

TITLE: COMPOSITE APTAMER AND ITS USE FOR DETECTING A MOLECULE OF INTEREST The present invention relates to the fabrication of an electroactive composite aptamer from an electroactive nucleotide sequence and a donor aptamer. The present invention also relates to the use of this electroactive composite aptamer for detecting at least one molecule of interest and / or for fabricating an electroactive apta-sensor, which can also be used to detect at least one molecule of interest. (no figure)

Description

Title of the invention: COMPOSITE APTAMER AND ITS USE FOR DETECTING A MOLECULE OF INTEREST FIELD OF THE INVENTION

[0001] The present invention relates to the manufacture of an electroactive composite aptamer from an electroactive nucleotide sequence and a donor aptamer. The present invention also relates to the use of this electroactive composite aptamer for detecting at least one molecule of interest and / or for manufacturing an electroactive aptamer, which can also be used for detecting at least one molecule of interest. PREVIOUS ART

[0002] Biosensors are analytical tools with multiple possibilities of use in many fields (medicine, agri-food, environment, etc.), they have been the subject of intense research efforts for around thirty years. These tools consist of the association of a sensitive biological element, also called a bioreceptor, and a physical element, called a transducer. The bioreceptor allows the specific detection of the analyte in a complex medium. This specific recognition step results in a physicochemical change in the medium or the sensor-solution interface. The transducer will transform this signal resulting from the reaction between the analyte and the bioreceptor into a measurable physical signal which will then be recorded. It is generally an electrode or an optical system.

[0003] From a reaction point of view, two types of biosensors can be distinguished depending on the nature of the recognition. Catalytic systems generally use an enzyme as a bioreceptor, while affinity devices are based on the use of antibodies. However, a new generation of affinity sensors has emerged in recent years in which the antibodies are substituted by oligonucleotides called aptamers. These are synthetic single-stranded fragments of DNA or RNA that have the property of specifically recognizing the target molecule(s) for which they were produced. Aptamers have several advantages over antibodies, including greater chemical stability as well as greater flexibility in chemical modification, making them particularly suitable for biosensor technology.Additionally, aptamers can be synthesized for a wide variety of targets, including small organic or inorganic compounds, peptides, proteins, and even whole cells. Aptamer selection is performed using methods. iterative in vitro methods such as the SELEX (Systematic Evolution of Ligands by EX-ponential enrichment) process, thus advantageously replacing in vivo antibody production methods. Aptamer production is relatively rapid, inexpensive, and exhibits virtually no batch-to-batch variability. In addition, the aptamer-target complex can generally be dissociated, allowing for possible reuse of both the aptamer and the target.

[0004] Although many aptamers have already been described in the literature, the main challenge in designing aptasensors remains the same as for other affinity sensors: it is about being able to measure small physicochemical changes resulting from the interaction between the bioreceptor and the target. For this, three strategies can be developed:

[0005] The first is based on the use of direct measurement methods such as electrochemical impedance spectroscopy, microgravimetry (quartz microbalances), or surface plasmon resonance. However, these sophisticated methods are limited in their use to the analysis of simple matrices and often have insufficient sensitivity.

[0006] The second strategy consists of carrying out so-called "competition" detection involving a derivative of the target molecule labeled by an easily detectable probe (generally an enzyme or a fluorescent marker). This strategy shows good sensitivity, but the measurement protocols require several incubation / washing cycles and involve expensive reagents.

[0007] A third strategy is based on the labeling of the aptamer by an easily measurable probe. During the interaction of the aptamer with the target molecule, the signal corresponding to this probe undergoes a modification proportional to the concentration of the target. This method, widely used for the development of aptasensors, allows direct detection of the analyte. However, it requires prior labeling of the aptamers and is not applicable to all analytes. BRIEF OVERVIEW

[0008] To overcome all of these problems, the inventors have developed a unique electrochemical measurement strategy based on the integration of a fragment of a donor aptamer into an electroactive nucleotide sequence, allowing the production of electrochemical aptasensors that are not only sensitive and reliable but also easy to use. This tool is also applicable to numerous targets, and shows strong exploitation potential.

[0009] In view of the above, a first aim of the invention is to use an electroactive nucleotide sequence for the manufacture of an electroactive composite aptamer capable of specifically targeting at least one molecule of interest. A second aim of the invention is to provide this electroactive composite aptamer either for its use for the detection of at least one molecule of interest, or for the manufacture of an electroactive aptasensor which can also be used to detect at least one molecule of interest. A third aim of the invention is to provide methods for manufacturing the electroactive composite aptamer and the electroactive aptasensor. Another aim of the invention is to provide a bank of electroactive nucleotide sequences which are used for the manufacture of the electroactive composite aptamer. DETAILED DESCRIPTION

[0010] As a preamble, the invention relates to the objects as defined below and unless otherwise indicated or if the context indicates otherwise, all terms have their ordinary meaning in the field(s) concerned.

[0011] Generally, a first subject of the invention relates to the use of an electroactive nucleotide sequence comprising an electroactive central ring (1) and five stem-loops (2) for the manufacture of an electroactive composite aptamer comprising a secondary electroactive central ring (1') and at least five stem-loops (2', 3') capable of specifically targeting at least one molecule of interest, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 582 and 606, and their respective mirror sequence SEQ ID NOs: 609 and 633,

[0012] and wherein said electroactive composite aptamer comprises said electroactive nucleotide sequence into which at least one fragment of at least one donor aptamer has been introduced by addition or substitution, said fragment being capable of specifically binding a molecule of interest,

[0013] the electroactivity of the central electroactive ring (1') of said electroactive composite aptamer being preserved with respect to that of the central electroactive ring (1) of said electroactive nucleotide sequence, and

[0014] the capacity to specifically fix said molecule of interest to said at least one fragment of said electroactive composite aptamer being preserved compared to that of said at least one fragment of at least one donor aptamer.

[0015] By "electroactive", "electroactive" and "electroactivity" is meant that the aptamer immobilized on an electrode spontaneously gives a measurable electric current when subjected to an oxidation potential, depending on the electrode material used.

[0016] By "nucleotide sequence" is meant a single-stranded DNA sequence consisting of the four nucleotides adenosine (A), thymidine (T), guanosine (G) and cytidine (C). It is described as "electroactive" because it has an intrinsic electrochemical activity that can be exploited for the purposes of the invention. In the invention, this is chosen from a bank of particular electroactive nucleotide sequences (see below) and it is distinguished by a secondary structure comprising five stem-loops organized around a central electroactive ring whose intrinsic electrochemical activity can be measured using electrochemical measurement methods such as cyclic voltammetry, differential pulse voltammetry or others (Alawad et al., A reagentless aptasensor based on intrinsic aptamer redox activity for the detection of tetracycline in water, Sensors and Actuators B: Chemical, Volume 288, 2019, Pages 141-146; Alawad et al., SECM for Studying the Immobilization and Distribution of a Redox Anti-tetracycline Aptamer on Screen-printed Carbon Electrodes, Electroanalysis 2021, 33, 292.).Among the electroactive nucleotide sequences of this library, the sequence SEQ ID NO: 1 can be considered as the reference one since it is from this that the inventors have demonstrated the intrinsic electrochemical activity of the central ring, that they have constructed the library of electroactive nucleotide sequences and that they have decided to exploit it cleverly to manufacture a multitude of novel electroactive composite aptamers. In particular, the inventors have demonstrated that this electroactive nucleotide sequence of sequence SEQ ID NO: 1, once immobilized on the surface of an electrode (carbon or gold) has an anodic peak between 0.1 V and 0.2 V in a cyclic voltammetry test where 2 cyclic voltammetry cycles are carried out between -0.4 V and +0.6 V vs. Ag / AgCl at a speed of 50 mV / sec using an electrochemical station such as Autolab PGSTAT100 potentiostat / galvanostat (EcoChimie, Netherlands).Also and under these same conditions, it should be noted that all of the electroactive nucleotide sequences of the bank of the invention have this electroactive signature.

[0017] By "anodic peak between 0.1 V and 0.2 V" is meant the signal obtained by oxidation of the aptamer immobilized on the surface of the electrode. The potential at which this peak is observed varies between 0.1 and 0.2 V vs Ag / AgCl depending on the aptamer and the type of electrode used ([Fig.4]).

[0018] By "central ring" is meant the circular shape of the part of the secondary structure which results from the organization of the five stem-balls (cf [Fig.l]). It is described as "electroactive" because it has an intrinsic electrochemical activity which can be exploited for the purposes of the invention. On this point it should be noted that the structure of this electroactive central ring comprises at least 14, preferably at least 15, free nucleotides, i.e. at least 14, preferably at least 15, nucleotides which are neither engaged in pairing nor do they belong to the five stem-loops. It should also be noted that the electroactive central ring (1') of the electroactive composite aptamer of the invention is constructed on the basis of (has as its origin) the electroactive central ring (1) of the electroactive nucleotide sequence of the invention which was used to manufacture said electroactive composite aptamer of the invention. In this regard, the electroactive central ring (1') of the electroactive composite aptamer of the invention similarly comprises at least 14, preferably at least 15, free nucleotides, i.e. at least 14, preferably at least 15, nucleotides which are neither engaged in pairing nor do they belong to the five stem-loops. By "at least 14 free nucleotides" is meant that this electroactive central ring (1, 1') may comprise more (eg 15, 16, 17, 18, etc.).This is particularly possible if, in order to preserve the secondary structure of the electroactive composite aptamer of the invention and its intrinsic electroactivity, the (modeled) secondary structure requires modifying (by addition or deletion) the number of free nucleotides to remove one or more unwanted AT, TA, CG and / or GC pairings, correctly introducing the fragment of a donor aptamer and having an electroactive central ring (1') with intrinsic electrochemical activity.

[0019] By "mirror sequence" is meant an electroactive nucleotide sequence constructed as a mirror image of a reference electroactive nucleotide sequence. That is to say, the 5' end of one becomes the 3' end of the other and the 3' end of one becomes the 5' end of the other, the sequence of nucleotides being preserved with mirror symmetry. For example, the sequence SEQ ID NO: 125 is represented by the sequence:

[0020] 5 ' -CGTTC AAATTTTTTTGTTTGAAATTTTTTTCTTGAAATTTTTTTCTTGAA ATTTTTTTCTTTTCAAATTTTTTTG-3 '

[0021] and the sequence in SEQ ID NO: 156 is represented by the sequence:

[0022] 5 ' -GTTTTTTTAAACTTTTCTTTTTTTTAAAGTTCTTTTTTTTAAAGTTCTTTTTT TAAAGTTTGTTTTTTTTAAACTTGC-3 '.

[0023] Note that if it is possible to modify the number of nucleotides at the time of introducing at least one fragment of at least one donor aptamer onto an electroactive nucleotide sequence (see above), it is also possible to replace / substitute one or more nucleotides to preserve the secondary structure of the electroactive nucleotide sequence and its intrinsic electroactivity, and / or of the electroactive composite aptamer of the invention and its intrinsic electroactivity. This is then referred to as a corrected mirror, a corrected mirror sequence or a corrected mirror motif. This modification is notably carried out to remove one or more unwanted AT, TA, CG and / or GC pairings. For example, the reference sequence SEQ ID NO: 1 is represented by the sequence:

[0024] 5'- CGTACAAATTTTTTTGCTAGAAATTTTTTTCAGGAAATTTTTTTCTT- GAAATTTTTTTCACTGCAAATTTTTTTG -3'

[0025] and its corrected mirror sequence SEQ ID NO: 32 is represented by the sequence:

[0026] 5 '- GTTTTTTTAAACGTCT CTTTTTTTAAAGTTCTTTTTTTAAAG- GACTTTTTTTAAAGATCGTTTTTTTAAACATGC -3',

[0027] where the ACTG motif before the last stem-loop of the reference sequence SEQ ID NO: 1 became the corrected mirror motif GTCT after the first stem-loop of its corrected mirror sequence SEQ ID NO: 32.

[0028] By "aptamer" is meant a synthetic single-stranded fragment of DNA or RNA which has the property of specifically recognizing the target molecule(s) for which it was produced; it is referred to as a "donor" in the invention, because the inventors were able to take advantage of the region responsible for the affinity of the aptamer for its target(s) to manufacture the electroactive composite aptamers of the invention. Just like the electroactive nucleotide sequences of the invention, this region, also referred to as "fragment of at least one donor aptamer", has a secondary structure. This comprises a stem-loop (or hairpin), which, as mentioned above, has the capacity to specifically bind (target) at least one molecule of interest, which can be measured using electrochemical measurement methods such as cyclic voltammetry, differential pulse voltammetry or others (egby surface plasmon resonance) (Dziqbowska, Karolina, et al. 'Application of Electrochemical Methods in Biosensing Technologies'. Biosensing Technologies for the Detection of Pathogens -A Prospective Way for Rapid Analysis, InTech, Mar. 2018). Among the donor aptamers, it is possible to exploit those described in the prior art but also to carry out an in vitro selection using for example the SELEX method (Systematic Evolution of Ligands by EXPonential enrichment) (Tuerk & Gold, Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase, Science, 3 Aug 1990, Vol 249, Issue 4968, pp. 505-510; Ellington, A., Szostak, J. In vitro selection ofRNA molecules that bind specifies ligands. Nature 346, 818-822 (1990)) and to exploit the results of this selection.It should be noted that for the purposes of the invention it is desirable that the donor Taptamer structure consists of one to three associated stem-loops separated by 2 to 4 nucleotides. Variations in the length of the stem or the size of the loop, as well as the presence of more elaborate structures (e.g. the presence of secondary stem-loops on the main stem-loops) do not, however, rule out the possibility of carrying out the invention. In the case of complex structures, it is then sometimes important to carry out truncation studies of the donor Taptamer in order to determine the part involved in the recognition of the molecule of interest, which will be the subject of the grafting.

[0029] By "electroactive composite aptamer" is meant a synthetic aptamer resulting from the integration (grafting), by addition or substitution, of at least one fragment of at least one donor aptamer in an electroactive nucleotide sequence of the invention. If it is described as "composite", it is therefore because it is constructed from from two distinct elements, namely: an electroactive nucleotide sequence of the invention and at least one fragment of at least one donor aptamer. And if it is described as "electroactive", it is because its secondary structure retains at least five stem-loops organized around a central electroactive ring whose intrinsic electrochemical activity can be measured by means of electrochemical measurement methods such as cyclic voltammetry, differential pulse voltammetry or others. Indeed, the inventors have demonstrated that the addition of a stem-loop (i.e. that of said at least one fragment of at least one donor aptamer) or the replacement of at least one of the stem-loops of an electroactive nucleotide sequence of the invention by that of said at least one fragment of at least one donor aptamer does not affect the intrinsic electrochemical activity of the oligonucleotide obtained (i.e.the electroactive composite aptamer of the invention), provided that the secondary structure of the latter gives the same shape of at least five stem-loops and a single-stranded electroactive central ring on which all the stem-loops associate. Similarly, the inventors have demonstrated that the isolation of the fragment of a donor aptamer responsible for the specific binding of a molecule of interest and its introduction into an electroactive nucleotide sequence of the invention does not affect its ability to specifically bind the molecule of interest for which it has an affinity.

[0030] By "the electroactivity of the electroactive central ring (1') of said electroactive composite aptamer being preserved with respect to that of the electroactive central ring (1) of said electroactive nucleotide sequence", it is therefore understood, for example, that once immobilized on the surface of an electrode (carbon or gold) the electroactive composite aptamer of the invention has an anodic peak between 0.1 V and 0.2 V in a cyclic voltammetry test where 2 cyclic voltammetry cycles are carried out between -0.4 V and +0.6 V vs. Ag / AgCl at a speed of 50 mV / sec using in particular an electrochemical station of the Autolab PGSTAT100 potentiostat / galvanostat type (EcoChimie, Netherlands) like the electroactive nucleotide sequences of the invention.

[0031] By "the ability to specifically bind said molecule of interest to said at least one fragment of said electroactive composite aptamer being preserved with respect to that of said at least one fragment of at least one donor aptamer", it is therefore understood that the electroactive composite aptamer of the invention is capable, via the fragment of the donor aptamer which has been grafted to it, of specifically binding the molecule which is capable of binding the donor aptamer from which said fragment is derived, which can be measured by means of electrochemical measurement methods such as cyclic voltammetry, differential pulse voltammetry or others (e.g. by surface plasmon resonance). On this point, it should be noted that when the electroactive composite aptamer has bound its target, its electroactivity signal decreases. Also, the more the electroactive aptamer of the invention incorporating at least one aptamer fixed electroactive composite of target molecules, the more the measured electroactivity signal decreases until saturation of the electroactive aptasensor of the invention. Using a calibration curve, it is therefore possible to use this measurement to quantify the concentration of a molecule of interest in a sample.

[0032] Interestingly, it should be noted that the implementation of the same electrochemical measurement method makes it possible both to demonstrate and to exploit the electroactivity of the electroactive composite aptamer of the invention, and to verify and exploit its capacity to fix at least one molecule of interest.

[0033] In view of the above, it is therefore understood how the invention takes advantage, on the one hand, of the electroactivity of the electroactive nucleotide sequences of the invention and, on the other hand, of the ability to bind a molecule of interest of a donor aptamer, to propose a universal and modular platform for the abundant manufacture of easy-to-use electroactive composite aptamers. Indeed, with the electroactive composite aptamer of the invention, it is possible to quickly and easily determine, using an electrochemical measurement (e.g. cyclic voltammetry, differential pulse voltammetry or others), the presence (or absence) of a molecule of interest in a sample, by exploiting the electroactivity originating from an electroactive nucleotide sequence of the invention and the ability of this molecule of interest to be bound by the fragment of a donor aptamer introduced into this electroactive nucleotide sequence.

[0034] Furthermore, if it is a question of introducing by addition or substitution "at least one fragment of at least one donor aptamer", it is because the inventors have developed electroactive composite aptamers comprising at least 2, at least 3, or even at least 4 fragments of at least one donor aptamer. The electroactive composite aptamer of the invention can therefore be monofunctional or multifunctional (bifunctional, trifunctional, tetrafunctional or pentafunctional).

[0035] In the case of a monofunctional electroactive composite aptamer, this comprises the integration once or several times of the same fragment derived from the same donor aptamer on an electroactive nucleotide sequence of the invention. This monofunctional electroactive composite aptamer is then capable of recognizing and specifically binding only one molecule of interest, which is the one for which the integrated fragment(s) have an affinity. For the purposes of illustration, it is for example possible to have an electroactive composite aptamer comprising 2 identical fragments derived from the same donor aptamer capable of binding troponin. This electroactive composite aptamer is therefore monofunctional since it only has an affinity for troponin.

[0036] In the case of a multifunctional electroactive composite aptamer, this comprises the integration of at least two different fragments from different donor aptamers. on an electroactive nucleotide sequence of the invention. This multifunctional electroactive composite aptamer is then capable of recognizing and specifically binding several molecules of interest, which are those specifically bound by each integrated fragment. For the purposes of illustration, it is for example possible to have an electroactive composite aptamer comprising 2 fragments from different donor aptamers, one capable of binding metronidazole and the other capable of binding tetracycline. This electroactive composite aptamer is therefore bi-functional since it has an affinity for both metronidazole and tetracycline.

[0037] According to another embodiment, the invention relates to the above use of an electroactive nucleotide sequence for the manufacture of an electroactive composite aptamer capable of specifically targeting at least one molecule of interest,

[0038] in which said electroactive nucleotide sequence: • has a secondary structure comprising a central electroactive ring (1) and five stem-loops (2), the electroactivity of the central electroactive ring (1) being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and • is chosen from the sequences SEQ ID NOs: 582 and 606, and their respective mirror sequence SEQ ID NOs: 609 and 633,

[0039] said sequence SEQ ID NO: 582 being represented by the sequence:

[0040] HDWWSaNw-iooSbHWWScNw-iooSdWDSeNw-woSfWWSgNwuooShWHWDSiNw-woSj

[0041] and its mirror sequence SEQ ID NO: 609 being represented by the sequence:

[0042] SjN^ooSiDWHWShN^ooSgWWSfN^ooSeDWSdN^ooScWWHSbN^^^^

[0043] in which: • H represents nucleotides A or C or T; • D represents the nucleotides A or G or T; • W represents nucleotides A or T; • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-iooSb, ScNio-iooSd, SeNio-iooSf, SgNio-iooSh, S;Nio-iooSj, SjNio-iooSi, S hNio-iooSg, SrNio mSL., SdNio-iooSc and SbNiO_iooSa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • S; = G then Sj = C, and

[0044] said sequence SEQ ID NO: 606 being represented by the sequence:

[0045] CGTAWaNlo_1ooWbCTAWcN1(,iooWdAGWeN1o_1ooWfTTWgN1(,iooWhACTGWiN1o.iooWj

[0046] and its mirror sequence SEQ ID NO: 633 being represented by the sequence:

[0047] WJN1O-iooWiGTCAWhN1o_1ooWgTTWfN1o_1ooWeGAWdN1o4ooWcATCWbNlo_1ooWaATGC

[0048] in which: • W represents nucleotides A or T; • N represents the nucleotides A or C or G or T; and the motifs WaNlo_1OoWb, WCNIO IOoWd, WeNl0100Wf, WgNlo_1OoWh, WiNio-iooWj, W jNio-iooWi, WhNio-iooWg, WNio iooWe, WdNio-iooWc and WbNio-iooWa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Wa = A then Wb = T; • Wa = T then Wb = A; • Wc = A then Wd = T; • Wc = T then Wd = A; • We = A then Wf = T; • We = T then Wf = A; • Wg = A then Wh = T; • Wg = T then Wh = A; • W; = A then Wj = T ; and • W; = T then Wj = A,

[0049] and in which said electroactive composite aptamer: • comprises said electroactive nucleotide sequence into which at least one fragment of at least one donor aptamer has been introduced by addition or substitution, the secondary structure of said at least one fragment comprising a stem-loop (3) capable of specifically binding a molecule of interest, the binding of said molecule of interest to said at least one fragment being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and • has a secondary structure comprising a central electroactive ring (1') and at least five stem-loops (2', 3'),

[0050] the electroactivity of the electroactive central ring (1') of said electroactive composite aptamer being preserved with respect to that of the electroactive central ring (1) of said electroactive nucleotide sequence, said electroactivity being able to be determined at using electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and

[0051] the capacity to specifically fix said molecule of interest to said at least one fragment of said electroactive composite aptamer being preserved compared to that of said at least one fragment of at least one donor aptamer, said fixing being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry.

[0052] For all useful purposes, it is specified that the sequence SEQ ID NO: 582 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 1, 63, 125, 149, 187, 249, 311, 435 and 497, knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 100 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0053] Likewise:

[0054] the mirror sequence (of the sequence SEQ ID NO: 582) SEQ ID NO: 609 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 32, 94, 156, 218,280, 342, 466 and 528; and

[0055] the sequence SEQ ID NO: 606 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 373, and its mirror sequence SEQ ID NO: 633 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 404,

[0056] knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 100 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0057] By "from 10 to 100 nucleotides" is also meant that said stem-loop motif above comprises from 10 to 90 nucleotides, from 10 to 80 nucleotides, from 10 to 70 nucleotides, from 10 to 60 nucleotides, from 10 to 50 nucleotides, from 10 to 40 nucleotides, from 10 to 30 nucleotides or from 10 to 20 nucleotides. By "from 10 to 100 nucleotides" is also meant that said stem-loop motif above comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides. In this respect, it It should be noted that these definitions apply to all embodiments of the invention.

[0058] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 583, 584 and 585, and their respective mirror sequence SEQ ID NOs: 610, 611 and 612,

[0059] said sequence SEQ ID NO: 583 being represented by the sequence:

[0060] YKTWSaNw-iooSbYTWScNw-woSdWKSeNw-woSfTTSgNw-iooShWYTKSiNwuooSj

[0061] and its mirror sequence SEQ ID NO: 610 being represented by the sequence:

[0062] SjNw-woSiKTYWShNw-iooSgTTSfNw-woSeKWSdNwuooSeWTYSbNw-iooSaWTKY,

[0063] in which: • Y represents the nucleotides C or T; • K represents the nucleotides G or T; • W represents nucleotides A or T; • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-iooSb, ScNio-iooSd, SeNio-iooSf, SgNio-iooSh, SiNio-iooSj, SjNio-iooSi, S hNio-iooSg, SrNio mSL., SdNio-iooSc and SbNiO_iooSa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • S; = G then Sj = C,

[0064] said sequence SEQ ID NO: 584 being represented by the sequence:

[0065] TTTTSaN1o.iooSbTTTScN1o.iooSdTTSeN1o.iooSfTTSgN1o.iooShTTTTSiNlo.iooSj

[0066] and its mirror sequence SEQ ID NO: 611 being represented by the sequence:

[0067] SjN1o.iooSiTTTTShN1o.iooSgTTSfN1o.iooSeTTSdN1o.iooScm

[0068] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-iooSb, ScNio-iooSd, SeNio-iooSf, SgNio-iooSh, SiNio-iooSj, SjNio-iooSi, S hNio-iooSg, SfNio-iooSe, SdNio-iooSc and SbNiO-iooSa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • If = G then Sj = C,

[0069] and said sequence SEQ ID NO: 585 being represented by the sequence:

[0070] AAAASaN1o.iooSbAAAScN1o.iooSdAASeN1o-iooSfAASgN1o.iooShAAAASiNlo.iooSj

[0071] and its mirror sequence SEQ ID NO: 612 being represented by the sequence:

[0072] SjNio-iooSiAAAAShNio.iooSgAASfNio-iooSeAASdNio-iooScAAASbNio.iooS.AAAA,

[0073] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-iooSb, ScNio-iooSd, SeNio-iooSf, SgNio-iooSh, SiNio-iooSj, SjNio-iooSi, S hNio-iooSg, SfNio-iooSe, SdNio-iooSc and SbNiO-iooSa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • If = G then Sj = C.

[0074] For all useful purposes, it is specified that the sequence SEQ ID NO: 583 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 1, 63, 149, 187 and 249, knowing that: • the base of the loop rods are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 100 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0075] Likewise:

[0076] the mirror sequence (of the sequence SEQ ID NO: 583) SEQ ID NO: 610 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 32, 94, 218 and 280;

[0077] the sequence SEQ ID NO: 584 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 311 and 497, and its mirror sequence SEQ ID NO: 611 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 342 and 528; and

[0078] the sequence SEQ ID NO: 585 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 435, and its mirror sequence SEQ ID NO: 612 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 466,

[0079] knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 100 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0080] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 586, 587, 588 and 589, and their respective mirror sequence SEQ ID NOs: 613, 614, 615 and 616,

[0081] said sequence SEQ ID NO: 586 being represented by the sequence:

[0082] CGTASaNw-iooSbCTAScNw-iooSdAGSgNw-woSfTTSgNw-iooSijACTGSiNw-woSj

[0083] and its corrected mirror sequence SEQ ID NO: 613 being represented by the sequence:

[0084] SjN^ooSiGTCTShN^ooSgTTSfN^œSeGASdN^œScATCSbN^ooS^

[0085] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-iooSb, ScNio-iooSd, SeNio-iooSf, SgNio-iooSh, SiNio-iooSj, SjNio-iooSi, S hNio-iooSg, SfNio-iooSe, SdNio-iooSc and SbNiO-iooSa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • S; = G then Sj = C,

[0086] said sequence SEQ ID NO: 587 being represented by the sequence:

[0087] CGTTSaN1(,iooSbTTTScN1(,iooSdAGSeN1o_1ooSfTTSgN1(,iooShACTGSiN1(,iooSj

[0088] and its corrected mirror sequence SEQ ID NO: 614 being represented by the sequence:

[0089] SjNio-iooSiGTCTShNio-iooSgTTSfNio-iooSeGASdNio-iooScTTTSbNio-iooSJTGC,

[0090] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-iooSb, ScNio-iooSd, SeNio-iooSf, SgNio-iooSh, SiNio-iooSj, SjNio-iooSi, S hNio-iooSg, SfNio-iooSe, SdNio-iooSc and SbNiO-iooSa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • S; = G then Sj = C,

[0091] said sequence SEQ ID NO: 588 being represented by the sequence:

[0092] CGTTSaN1(,iooSbTTTScN1(,iooSdTTSeN1o_1ooSfTTSgN1(,iooShTTTTSiN1(,iooSj

[0093] and its mirror sequence SEQ ID NO: 615 being represented by the sequence:

[0094] SjNio-iooSiTTTTShNio.iooSgTTSfNio-iooSeTTSdNio.iooScTTTSbNio.iooS.TTGC,

[0095] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-iooSb, ScNio-iooSd, SeNio-iooSf, SgNio-iooSh, SiNio-iooSj, SjNio-iooSi, S hNio-iooSg, SfNio-iooSe, SdNio-iooSc and SbNiO_iooSa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • S; = G then Sj = C,

[0096] and said sequence SEQ ID NO: 589 being represented by the sequence:

[0097] TTTASaN1o-iooSbCTAScN1o.iooSdAGSeN1o-iooSfTTSgN1o.iooShACTGSiNlo.iooSj

[0098] and its corrected mirror sequence SEQ ID NO: 616 being represented by the sequence:

[0099] SJN1O-iooSiGTCTShN1o-iooSgTTSfN1o-iooSeGASdN1O-iooScATCSbN1o4ooSaATTT,

[0100] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-iooSb, ScNio-iooSd, SeNio-iooSf, SgNio-iooSh, SjNio-iooSj, SjNio-iooSi, S hNio-iooSg, SNio looSe. SdNio-iooSc and SbNiO-iooSa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • S; = G then Sj = C.

[0101] For all useful purposes, it is specified that the sequence SEQ ID NO: 586 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 1 and 187, knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 100 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0102] Likewise:

[0103] the mirror sequence (of the sequence SEQ ID NO: 586) SEQ ID NO: 613 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 32 and 218;

[0104] the sequence SEQ ID NO: 587 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 63, and its mirror sequence SEQ ID NO: 614 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 94;

[0105] the sequence SEQ ID NO: 588 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 125 and 149, and its mirror sequence SEQ ID NO: 615 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 156; and

[0106] the sequence SEQ ID NO: 589 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 249, and its mirror sequence SEQ ID NO: 616 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 280,

[0107] knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 100 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0108] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 590 and 607, and their respective mirror sequence SEQ ID NOs: 617 and 634,

[0109] said sequence SEQ ID NO: 590 being represented by the sequence:

[0110] HDWWSaN1(,5oSbHWWScN1o.5oSdWDSeN1o.5oSfWWSgN1o.5oShWHWDSiN1o.5oSj

[0111] and its mirror sequence SEQ ID NO: 617 being represented by the sequence:

[0112] SjNio.5oSiDWHWShNio.5oSgWWSfNio.5oSeDWSdNio.5oScWWHSbNio.5oSaWWDH,

[0113] in which: • H represents nucleotides A or C or T; • D represents the nucleotides A or G or T; • W represents nucleotides A or T; • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-5oSb, ScNio-5oSd, SeNio-5oSf, SgNio-5oSh, SiNio-soSj, SjNio-soSi, SbN io-5oSg, SfNio-5oSe, SdNio-5()Sc and SbNiO_5oSa represent a stem-loop motif comprising from 10 to 50 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C, and

[0114] said sequence SEQ ID NO: 607 being represented by the sequence:

[0115] CGTAWaNio-5oWbCTAWcNio-5oWdAGWeNio-5oWfTTWgNio-5oWhACTGWiNio-5oWj

[0116] and its mirror sequence SEQ ID NO: 634 being represented by the sequence:

[0117] WjNio-5oWiGTCAWhNio-5oWgTTWfNio-5oWeGAWdNio-5oWcATCWbNio-5oWaATGC

[0118] in which: • W represents nucleotides A or T; • N represents the nucleotides A or C or G or T; and the motifs WaNl0 50Wb, WcN10_50Wd, WAmX WgNlo.5oWh, WiN^oWj, W,N io-5oWi, WhNio-5oWg, WfNio-5oWe, WdNio-5oWc and WbNiO_5oWa represent a stem-loop motif comprising from 10 to 50 nucleotides N where when: • Wa = A then Wb = T; • Wa = T then Wb = A; • Wc = A then Wd = T; • Wc = T then Wd = A; • We = A then Wf = T; • We = T then Wf = A; • Wg = A then Wh = T; • Wg = T then Wh = A; • W; = A then Wj = T ; and • Wi = T then Wj = A.

[0119] For all useful purposes, it is specified that the sequence SEQ ID NO: 590 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 1, 63, 125, 149, 187, 249, 311, 435 and 497, knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 50 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0120] Likewise:

[0121] the mirror sequence (of the sequence SEQ ID NO: 590) SEQ ID NO: 617 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 32, 94, 156, 218,280, 342, 466 and 528; and

[0122] the sequence SEQ ID NO: 607 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 373, and its mirror sequence SEQ ID NO: 634 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 404,

[0123] knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 50 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0124] By "from 10 to 50 nucleotides" is also meant that said stem-loop motif above comprises from 10 to 40 nucleotides, from 10 to 30 nucleotides or from 10 to 20 nucleotides. By "from 10 to 50 nucleotides" is also meant that said above stem-loop motif comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. In this regard, it should be noted that these definitions apply to all embodiments of the invention.

[0125] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 591, 592 and 593, and their respective mirror sequence SEQ ID NOs: 618, 619 and 620,

[0126] said sequence SEQ ID NO: 591 being represented by the sequence:

[0127] YKTWSaN1o.5oSbYTWScN1(,5oSdWKSeN1o.5oSfTTSgN1(,5oShWYTKSiN1(,5oSj

[0128] and its mirror sequence SEQ ID NO: 618 being represented by the sequence:

[0129] SjN1o.5oSiKTYWShN1o.5oSgTTSfN1o.5oSeKWSdN1o.5oScWTYSbNlo.5oSaWTKY,

[0130] in which: • Y represents the nucleotides C or T; • K represents the nucleotides G or T; • W represents nucleotides A or T; • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-5oSb, ScNio-5oSd, SeNio-5oSf, SgNio-5oSh, SiNio-soSj, SjNio-soSi, SbN io-5oSg, SfNio-5oSe, SdNio-5()Sc and SbNiO_5oSa represent a stem-loop motif comprising from 10 to 50 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C,

[0131] said sequence SEQ ID NO: 592 being represented by the sequence:

[0132] TTTTSaNlo.5oSbTTTScN1o-5oSdTTSeN1o-5oSfTTSgN1o-5oShTTTTSiN1O-5oSj

[0133] and its mirror sequence SEQ ID NO: 619 being represented by the sequence:

[0134] SjNio^oSiTTTTShNio^oSJTSfNio^oSeTTSdNio^oSeTTTShNio^oSJTTT,

[0135] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-soSb, ScNio-5oSd, SeNio-5oSf, SgNio-5t)Sh, SiNio-soSj, SjNio-soSi, SbN io-5oSg, SfNio-5oSe, SdNio-5()Sc and SbNiO_5oSa represent a stem-loop motif comprising from 10 to 50 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C,

[0136] and said sequence SEQ ID NO: 593 being represented by the sequence:

[0137] AAAASaNlo.5oSbAAAScN1(,5oSdAASeN1(,5oSfAASgN1(,5oShAAAASiN1o.5oSj

[0138] and its mirror sequence SEQ ID NO: 620 being represented by the sequence:

[0139] SjNlo.5oSiAAAAShN1(,5oSgAASfN1(,5oSeAASdN1(,5oScAAASbN1o.5oSaAAAA,

[0140] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-soSb, ScNio-5oSd, SeNio-5oSf, SgNio-5oSh, SiNio-soSj, SjNio-soSi, SbN io-5oSg, SfNio-5oSe, SdNio-5()Sc and SbNiO_5oSa represent a stem-loop motif comprising from 10 to 50 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C.

[0141] For all useful purposes, it is specified that the sequence SEQ ID NO: 591 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 1, 63, 149, 187 and 249, knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 50 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0142] Likewise:

[0143] the mirror sequence (of the sequence SEQ ID NO: 591) SEQ ID NO: 618 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 32, 94, 218 and 280;

[0144] the sequence SEQ ID NO: 592 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 311 and 497, and its mirror sequence SEQ ID NO: 619 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 342 and 528; and

[0145] the sequence SEQ ID NO: 593 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 435, and its mirror sequence SEQ ID NO: 620 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 466,

[0146] knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 50 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0147] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 594, 595, 596 and 597, and their respective mirror sequence SEQ ID NOs: 621, 622, 623 and 624,

[0148] said sequence SEQ ID NO: 594 being represented by the sequence:

[0149] CGTASaN1o.5oSbCTAScN1o.5oSdAGSeN1o.5oSfTTSgNlo.5oShA^^

[0150] and its corrected mirror sequence SEQ ID NO: 621 being represented by the sequence:

[0151] SjNlo.5oSiGTCTShN1(,5oSgTTSfN1(,5oSeGASdN1(,5oScATCSbN1(,5oSaATGC,

[0152] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-5oSb, ScNio-5oSd, SeNio-5oSf, SgNio-5oSh, SiNio-soSj, SjNio-soSi, SbNio-5oSg, SfNio-5oSe, SdNio-5()Sc and SbNiO-5oSa represent a stem-loop motif comprising from 10 to 50 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C,

[0153] said sequence SEQ ID NO: 595 being represented by the sequence:

[0154] CGTTSaN1(,5oSbTTTScN1o.5oSdAGSeN1o.5oSfTTSgN1o.5oShACTGSiN1o.5oSj

[0155] and its corrected mirror sequence SEQ ID NO: 622 being represented by the sequence:

[0156] SjNio-soSiGTCTShN^oSgTTSfN^oSeGASdN^oScTTO^

[0157] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-5oSb, ScNio-5oSd, SeNio-5oSf, SgNio-5oSh, SiNio-soSj, SjNio-soSi, ShNio-5oSg, SfNio-5oSe, SdNio-5oSc and SbNiO-5oSa represent a stem-loop motif comprising from 10 to 50 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C,

[0158] said sequence SEQ ID NO: 596 being represented by the sequence:

[0159] CGTTSaNi0.50SbTTTScNi0-50SdTTSeNi0-50SfTTSgNi0-50ShTTTTSiNi0.50Sj

[0160] and its mirror sequence SEQ ID NO: 623 being represented by the sequence:

[0161] SjNio-boSiTTTTShNio-boSJTSfNio-boSeTTSdNio-boSeTTTSbNio-boSJTGC,

[0162] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-5oSb, ScNio-5oSd, SeNio-5oSf, SgNio-5oSh, SiNio-soSj, SjNio-soSi, ShNio-5oSg, SfNio-5oSe, SdNio-5oSc and SbNiO-5oSa represent a stem-loop motif comprising from 10 to 50 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C,

[0163] and said sequence SEQ ID NO: 597 being represented by the sequence:

[0164] TTTASaN1O-5oSbCTAScN1o-5oSdAGSeN1o-5oSfTTSgN1o-5oShACTGSiN1O-5oSJ

[0165] and its corrected mirror sequence SEQ ID NO: 624 being represented by the sequence:

[0166] SjN^oSiGTCTShN^oSgTTSfN^oSeGASdN^oScATCSbN!^

[0167] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the motifs SaNio-5t)Sb, ScNio-5t)Sd, SeNio-5oSf, SgNio-5oSh, SiNio-soSj, SjNio-soSi, SbN io-5oSg, SfNio-5oSe, SdNio-5oSc and SbNiO_5oSa represent a stem-loop motif comprising from 10 to 50 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C.

[0168] For all useful purposes, it is specified that the sequence SEQ ID NO: 594 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 1 and 187, knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 50 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0169] Likewise:

[0170] the mirror sequence (of the sequence SEQ ID NO: 594) SEQ ID NO: 621 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 32 and 218;

[0171] the sequence SEQ ID NO: 595 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 63, and its mirror sequence SEQ ID NO: 622 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 94;

[0172] the sequence SEQ ID NO: 596 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 125 and 149, and its mirror sequence SEQ ID NO: 623 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 156; And

[0173] the sequence SEQ ID NO: 597 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 249, and its mirror sequence SEQ ID NO: 624 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 280,

[0174] knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) can comprise from 10 to 50 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeated sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0175] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 598 and 608, and their respective mirror sequence SEQ ID NOs: 625 and 635,

[0176] said sequence SEQ ID NO: 598 being represented by the sequence:

[0177] HDWWSaNioSbHWWScNioSdWDSeNioSfWWSgNioShWHWDSiNioSj

[0178] and its mirror sequence SEQ ID NO: 625 being represented by the sequence:

[0179] SjNioSiDWHWShNioSgWWSfNioSeDWSdNioScWWHSbNioSaWWDH,

[0180] in which: • H represents nucleotides A or C or T; • D represents the nucleotides A or G or T; • W represents nucleotides A or T; • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and the motifs SaN10Sb, ScN10Sd, SeN10Sf, SgN10Sh, SiN^Sj, SjN^Si, ShN10Sg, SfN10Se, SdNi0Sc and SbNioSa represent a stem-loop motif comprising 10 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C, and

[0181] said sequence SEQ ID NO: 608 being represented by the sequence:

[0182] CGTAWaNioWbCTAWcNioWdAGWeNioWfTTWgNioWhACTGWiNioWj

[0183] and its mirror sequence SEQ ID NO: 635 being represented by the sequence:

[0184] WjNioWiGTCAWhNioWgTTWfNioWeGAWdNioWcATCWbNioWaATGC

[0185] in which: • W represents nucleotides A or T; • N represents the nucleotides A or C or G or T; and • the motifs WaN10Wb, WcN10Wd, WeN10Wf, WgN10Wh, WiN10Wj, WjN10Wi, WhN i0Wg, WfNioWe, WdNioWc and WbNi0Wa represent a stem-loop motif comprising 10 nucleotides N where when: • Wa = A then Wb = T; • Wa = T then Wb = A; • Wc = A then Wd = T; • Wc = T then Wd = A; • We = A then Wf = T; • We = T then Wf = A; • Wg = A then Wh = T; • Wg = T then Wh = A; • Wi = A then Wj = T ; and • W; = T then Wj = A.

[0186] For all useful purposes, it is specified that the sequence SEQ ID NO: 598 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 1, 63, 125, 149, 187, 249, 311, 435 and 497, knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) comprise 10 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeat sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0187] Likewise:

[0188] the mirror sequence (of the sequence SEQ ID NO: 598) SEQ ID NO: 625 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 32, 94, 156, 218,280, 342, 466 and 528; and

[0189] the sequence SEQ ID NO: 608 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 373, and its mirror sequence SEQ ID NO: 635 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 404,

[0190] knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) comprise 10 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeat sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0191] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 599, 600 and 601, and their respective mirror sequence SEQ ID NOs: 626, 627 and 628,

[0192] said sequence SEQ ID NO: 599 being represented by the sequence:

[0193] YKTWSaNioSbYTWScNioSdWKSeNioSfTTSgNioShWYTKSiNioSj

[0194] and its mirror sequence SEQ ID NO: 626 being represented by the sequence:

[0195] SjNioSiKTYWShNioSgTTSfNioSeKWSdNioScWTYSbNioSaWTKY,

[0196] in which: • Y represents the nucleotides C or T; • K represents the nucleotides G or T; • W represents nucleotides A or T; • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and the motifs SaN10Sb, ScN10Sd, SeN10Sf, SgN10Sh, SiN^Sj, SjN^Si, ShN10Sg, SfN10Se, SdNi0Sc and SbNioSa represent a stem-loop motif comprising 10 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C,

[0197] said sequence SEQ ID NO: 600 being represented by the sequence:

[0198] TTTTSaNioSbTTTScNioSdTTSeNioSfTTSgNioShTTTTSiNioSj

[0199] and its mirror sequence SEQ ID NO: 627 being represented by the sequence:

[0200] SjNwSiTTTTShNwSgTTSfNwSeTTSaNwSeTTTSbNwSJTTT,

[0201] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and the motifs SaN10Sb, ScN10Sd, SeN10Sf, SgN10Sh, S^, SjN^Si, ShN10Sg, SfN10Se, SdNit)Sc and SbNioSa represent a stem-loop motif comprising 10 nu cleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C,

[0202] and said sequence SEQ ID NO: 601 being represented by the sequence:

[0203] AAAASaNioSbAAAScNioSdAASeNioSfAASgNioShAAAASiNioSj

[0204] and its mirror sequence SEQ ID NO: 628 being represented by the sequence:

[0205] SjN1oSiAAAAShN1oSgAASfN1oSeAASdN1oScAAASbNloSaAAAA,

[0206] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and the motifs SaN10Sb, ScN10Sd, SeN10Sf, SgN10Sh, SiN^, SjN^Si, ShN10Sg, SfN10Se, SdNioSc and SbNi0Sa represent a stem-loop motif comprising 10 nu cleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C.

[0207] For all useful purposes, it is specified that the sequence SEQ ID NO: 599 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 1, 63, 149, 187 and 249, knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) comprise 10 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeat sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0208] Likewise:

[0209] the mirror sequence (of the sequence SEQ ID NO: 599) SEQ ID NO: 626 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 32, 94, 218 and 280;

[0210] the sequence SEQ ID NO: 600 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 311 and 497, and its mirror sequence SEQ ID NO: 627 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 342 and 528; and

[0211] the sequence SEQ ID NO: 601 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 435, and its mirror sequence SEQ ID NO: 628 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 466,

[0212] knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) comprise 10 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeat sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0213] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 602, 603, 604 and 605, and their respective mirror sequence SEQ ID NOs: 629, 630, 631 and 632,

[0214] said sequence SEQ ID NO: 602 being represented by the sequence:

[0215] CGTASaNioSbCTAScNioSdAGSeNioSfTTSgNioShACTGSiNioSj

[0216] and its corrected mirror sequence SEQ ID NO: 629 being represented by the sequence:

[0217] SjNioSiGTCTShNioSgTTSfNioSeGASdNioScATCSbNioSaATGC,

[0218] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and the motifs SaN10Sb, ScN10Sd, SeN10Sf, SgN10Sh, S^, SjN^Si, ShN10Sg, SfN10Se, SdNit)Sc and SbNioSa represent a stem-loop motif comprising 10 nu cleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • If = G then Sj = C,

[0219] said sequence SEQ ID NO: 603 being represented by the sequence:

[0220] CGTTSaNioSbTTTScNioSdAGSeNioSfTTSgNioShACTGSiNioSj

[0221] and its corrected mirror sequence SEQ ID NO: 630 being represented by the sequence:

[0222] SjNioSiGTCTShNioSgTTSfNioSeGASdNioScTTTSbNiOSaTTGC,

[0223] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and the motifs SaN10Sb, ScN10Sd, SeN10Sf, SgN10Sh, SiN^, SjN^Si, ShN10Sg, SfN10Se, SdNi0Sc and SbNi0Sa represent a stem-loop motif comprising 10 nu cleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • S; = C then Sj = G; and • If = G then Sj = C,

[0224] said sequence SEQ ID NO: 604 being represented by the sequence:

[0225] CGTTSaNioSbTTTScNioSdTTSeNioSfTTSgNioShTTTTSiNioSj

[0226] and its mirror sequence SEQ ID NO: 631 being represented by the sequence:

[0227] SjNioSiTTTTShNioSgTTSfNioSeTTSdNioScTTTSbNioSaTTG

[0228] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and the motifs SaNi0Sb, ScN10Sd, SeN10Sf, SgN10Sh, S^, SjN^Si, ShN10Sg, SfN10Se, SdNit)Sc and SbNioSa represent a stem-loop motif comprising 10 nu cleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C,

[0229] and said sequence SEQ ID NO: 605 being represented by the sequence:

[0230] TTTASaNioSbCTAScNioSdAGSeNioSfTTSgNioShACTGSiNioSj

[0231] and its corrected mirror sequence SEQ ID NO: 632 being represented by the sequence:

[0232] SjNioSiGTCTShNioSgTTSfNioSeGASdNioScATCSbNioSaATTT,

[0233] in which: • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and the motifs SaN10Sb, ScN10Sd, SeN10Sf, SgN10Sh, SiN^, SjN^Si, ShN10Sg, SfN10Se, SdNi0Sc and SbNi0Sa represent a stem-loop motif comprising 10 nu cleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; • Se = G then Sf = C; • Sg = C then Sh = G; • Sg = G then Sh = C; • If = C then Sj = G; and • If = G then Sj = C.

[0234] For all useful purposes, it is specified that the sequence SEQ ID NO: 602 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 1 and 187, knowing that : • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) comprise 10 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeat sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0235] Likewise:

[0236] the mirror sequence (of the sequence SEQ ID NO: 602) SEQ ID NO: 629 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 32 and 218;

[0237] the sequence SEQ ID NO: 603 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 63, and its mirror sequence SEQ ID NO: 630 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 94;

[0238] the sequence SEQ ID NO: 604 corresponds to the consensus sequence obtained from the sequences SEQ ID NOs: 125 and 149, and its mirror sequence SEQ ID NO: 631 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 156; and

[0239] the sequence SEQ ID NO: 605 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 249, and its mirror sequence SEQ ID NO: 632 corresponds to the consensus sequence obtained from the sequence SEQ ID NO: 280,

[0240] knowing that: • the base of the stem-loops are interchangeable without affecting the electroactivity of the electroactive composite aptamer of the invention; and • stem-loop motifs (or hairpin structure) comprise 10 nucleotides with the condition that once folded a stem-loop is formed, i.e. from inverted repeat sequences of complementary bases, a pairing is formed so that a double helix structure appears locally.

[0241] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is different from the sequences SEQ ID NOs: 637 and 638.

[0242] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559; their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636; and sequences having at least 95 %, preferably at least 98%, of identity with the sequences SEQ ID NOs: 1 to 559 and 636,

[0243] in particular said electroactive nucleotide sequence being chosen from the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559, and their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636.

[0244] By "percent identity" is meant the percentage determined by direct comparison of two oligonucleotide sequences, determining the number of identical nucleotides between the two sequences, then dividing it by the number of nucleotides in the longer sequence of the two, and multiplying the result by 100. By "at least 95%" is also meant that the aforementioned percentage identity is at least 96%, at least 97%, at least 98%, at least 99% or 100%. In this regard, it should be noted that this definition applies to all embodiments of the invention.

[0245] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, wherein said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559, and their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636.

[0246] According to another embodiment, the invention relates to the use of an electroactive nucleotide sequence above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 1, 32, 63, 149, 187 and 249.

[0247] Generally speaking, a second subject of the Invention relates to an electroactive composite aptamer above capable of specifically binding at least one molecule of interest, said electroactive composite aptamer having a secondary structure comprising a central electroactive ring and at least five stem-loops, and comprising two elements: • an electroactive nucleotide sequence chosen from the sequences SEQ ID NOs: 582 and 606 as defined above, and their respective mirror sequence SEQ ID NOs: 609 and 633 as defined above; and • at least one fragment of at least one donor aptamer, the secondary structure of said at least one fragment comprising a stem-loop capable of specifically binding a molecule of interest, said at least one fragment having been introduced by addition or substitution into said electroactive nucleotide sequence,

[0248] and wherein the electroactivity of the electroactive central ring of said aptamer electroactive composite is preserved relative to that of the central electroactive ring of said electroactive nucleotide sequence, and

[0249] the capacity to specifically fix said molecule of interest to said at least one fragment of said electroactive composite aptamer being preserved compared to that of said at least one fragment of at least one donor aptamer.

[0250] According to another embodiment, the invention relates to the above electroactive composite aptamer capable of specifically binding at least one molecule of interest, said electroactive composite aptamer having a secondary structure comprising an electroactive central ring (1') and at least five stem-loops (2', 3'), and comprising two elements: • an electroactive nucleotide sequence chosen from the sequences SEQ ID NOs: 582 and 606 as defined above, and their respective mirror sequence SEQ ID NOs: 609 and 633 as defined above, said electroactive nucleotide sequence having a secondary structure comprising an electroactive central ring (1) and five stem-loops (2), the electroactivity of the electroactive central ring (1) being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and • at least one fragment of at least one donor aptamer, the secondary structure of said at least one fragment comprising a stem-loop (3) capable of specifically binding a molecule of interest, said at least one fragment having been introduced by addition or substitution into said electroactive nucleotide sequence,

[0251] and wherein the electroactivity of the electroactive central ring (1') of said electroactive composite aptamer is preserved relative to that of the electroactive central ring (1) of said electroactive nucleotide sequence, said electroactivity being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry, and

[0252] the capacity to specifically fix said molecule of interest to said at least one fragment of said electroactive composite aptamer being preserved compared to that of said at least one fragment of at least one donor aptamer, said fixing being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry.

[0253] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 583, 584 and 585, and their respective mirror sequence SEQ ID NOs: 610, 611 and 612 as defined above.

[0254] According to another embodiment, the invention relates to the composite aptamer elec electroactive sequence above, wherein said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 586, 587, 588 and 589, and their respective mirror sequence SEQ ID NOs: 613, 614, 615 and 616 as defined above.

[0255] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 590 and 607, and their respective mirror sequence SEQ ID NOs: 617 and 634 as defined above.

[0256] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 591, 592 and 593, and their respective mirror sequence SEQ ID NOs: 618, 619 and 620 as defined above.

[0257] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 594, 595, 596 and 597, and their respective mirror sequence SEQ ID NOs: 621, 622, 623 and 624 as defined above.

[0258] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 598 and 608 as defined above, and their respective mirror sequence SEQ ID NOs: 625 and 635 as defined above.

[0259] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 599, 600 and 601, as defined above and their respective mirror sequence SEQ ID NOs: 626, 627 and 628 as defined above.

[0260] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 602, 603, 604 and 605, as defined above and their respective mirror sequence SEQ ID NOs: 629, 630, 631 and 632 as defined above.

[0261] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said electroactive nucleotide sequence is different from the sequences SEQ ID NOs: 637 and 638.

[0262] According to another embodiment, the invention relates to the above electroactive composite aptamer, wherein said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559; their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636; and the sequences having at least 95%, preferably at least 98%, identity with the sequences SEQ ID NOs: 1 to 559 and 636,

[0263] in particular said electroactive nucleotide sequence being chosen from the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559, and their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636.

[0264] According to another embodiment, the invention relates to the above electroactive composite aptamer, wherein said electroactive nucleotide sequence is selected from the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559, and their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636

[0265] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 1, 32, 63, 149, 187 and 249.

[0266] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said at least one donor aptamer specifically targets a molecule of interest chosen from: an antibiotic (penicillins, quinolones, macrolides, etc.), a biomarker (cardiovascular diseases, cancer, neurodegenerative disease, autoimmune disease, etc.), a hormone, a drug, an anthropogenic pollutant (pesticides, insecticides, fungicides, herbicides, etc.), a protein and a toxin (fungal, microbial, algal, etc.).

[0267] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said at least one donor aptamer specifically targets a molecule of interest chosen from: metronidazole A, tetracycline, estradiol A, bisphenol A, saxitoxin and troponin.

[0268] According to another embodiment, the invention relates to the above electroactive composite aptamer, wherein said at least one fragment of at least one donor aptamer comprises from 10 to 100 nucleotides, in particular from 10 to 50 nucleotides. By "from 10 to 100 nucleotides", it is also meant that said at least one fragment of at least one donor aptamer comprises from 10 to 90 nucleotides, from 10 to 80 nucleotides, from 10 to 70 nucleotides, from 10 to 60 nucleotides, from 10 to 50 nucleotides, from 10 to 40 nucleotides, from 10 to 30 nucleotides or from 10 to 20 nucleotides. By "from 10 to 100 nucleotides" is also meant that said at least one fragment of at least one donor aptamer comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides. In this regard, it should be noted that these definitions apply to all embodiments of the invention.

[0269] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which said at least one fragment of at least one donor aptamer is chosen from the sequences SEQ ID NOs: 560 to 570 and 639.

[0270] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which: • said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 582 and 606 as defined above, and their respective mirror sequence SEQ ID NOs: 609 and 633 as defined above; and • said at least one fragment of at least one donor aptamer is chosen from the sequences SEQ ID NOs: 560 to 570 and 639.

[0271] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which the electroactive composite aptamer is chosen from the sequences SEQ ID NOs: 571 to 581 and 640 to 642, and the sequences having at least 95%, preferably at least 98%, identity with the sequences SEQ ID NOs: 571 to 581 and 640 to 642,

[0272] in particular said electroactive composite aptamer being chosen from the sequences SEQ ID NOs: 571 to 581 and 640 to 642.

[0273] According to another embodiment, the invention relates to the above electroactive composite aptamer, in which the electroactive composite aptamer is chosen from the sequences SEQ ID NOs: 571 to 581 and 640 to 642.

[0274] Generally speaking, a third subject of the invention relates to a method for manufacturing an electroactive composite aptamer capable of specifically binding at least one molecule of interest as defined above, said method comprising at least one step of chemical synthesis of said electroactive composite aptamer,

[0275] in particular said chemical synthesis further comprising a step of incorporating a modification by an amine (-NH2) or thiol (-SH) group on one of the 5' or 3' ends of said electroactive composite aptamer (in order to allow its oriented immobilization, for example, on an electrode - see below).

[0276] By "chemical synthesis" is meant oligonucleotide synthesis, i.e. the chemical synthesis of relatively short fragments of nucleic acid with a defined structure. Well known, this technique is widely used in laboratories or is outsourced to companies specializing in chemical synthesis (eg Microsynth).

[0277] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, said method comprising, upstream of the chemical synthesis of said electroactive composite aptamer, a step of designing and modeling its secondary structure by means in particular of the DNA application folding available on the Mfold server at the University of Albany (Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003 Jul 1;31(13):3406-15.) including at least the steps: a. selecting an electroactive nucleotide sequence from the sequences SEQ ID NOs: 582 and 606 as defined above, and their respective mirror sequence SEQ ID NOs: 609 and 633 as defined above, said electroactive nucleotide sequence having a secondary structure comprising an electroactive central ring (1) and five stem-loops (2), the electroactivity of the electroactive central ring (1) being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; b. selection of at least one fragment of at least one donor aptamer, the secondary structure of said at least one fragment comprising a stem-loop (3) capable of specifically binding a molecule of interest, the binding of said molecule of interest to said at least one fragment being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and c. introducing by addition or substitution of said at least one fragment into said electroactive nucleotide sequence to manufacture, model and validate that said electroactive composite aptamer has a secondary structure comprising an electroactive central ring (1') and at least five stem-loops (2', 3'), and wherein: d. the electroactivity of the electroactive central ring (1') of said electroactive composite aptamer is preserved relative to that of the electroactive central ring (1) of said electroactive nucleotide sequence, said electroactivity being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and e. the capacity to specifically fix said molecule of interest to said at least one fragment of said electroactive composite aptamer being preserved compared to that of said at least one fragment of at least one donor aptamer, said fixing being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry,

[0278] steps a) and b) being reversible.

[0279] By "modeling" is meant the prediction of the secondary structures of the electroactive composite aptamer of the invention. This, as mentioned above, is carried out in particular by means of the DNA folding application available on the Mfold server at the University ofAlbany (Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003 Jul 1;31(13):3406-15.) taking into account the following parameters: ionic concentrations Na+ 100 mM and Mg2+ 5 mM, temperature 25°C. It can also be performed using online platforms such as OligoAnalyzer™ Tool (Integrated DNA Technologies) or Nupack (Beckman Institute at Caltech) and the use of these two tools can be recommended to confirm the modeling results.

[0280] By "a step of introduction by addition or substitution of said at least one fragment in said electroactive nucleotide sequence" is meant a step which consists of grafting the stem-loop of the donor aptamer capable of fixing a molecule of interest onto the previously chosen electroactive nucleotide sequence. This involves in particular replacing the bases of the electroactive structure with the bases of the fragment of the donor aptamer and then predicting the secondary structure of the oligonucleotide obtained (see above). This is done as follows: The stem-loop structures are replaced by those of the fragment of the donor aptamer and it is possible to replace the stem-loops individually or jointly. Note that the incorporation of said fragment of the donor aptamer may require modification (by addition, deletion and / or substitution) of bases at a distance from the incorporation zone to preserve the secondary structure of the invention (egelectroactive composite aptamer capable of binding troponin), i.e. formed of five stem-loops attached to a single-stranded electroactive central ring. These modifications concern base modifications which in particular make it possible to avoid unwanted AT, TA, CG and / or GC pairings which computer modeling would reveal if these modifications were not carried out.

[0281] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 583, 584 and 585, and their respective mirror sequence SEQ ID NOs: 610, 611 and 612 as defined above.

[0282] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 586, 587, 588 and 589, and their respective mirror sequence SEQ ID NOs: 613, 614, 615 and 616 as defined above.

[0283] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 590 and 607, and their respective mirror sequence SEQ ID NOs: 617 and 634 as defined above.

[0284] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 591, 592 and 593, and their respective mirror sequence SEQ ID NOs: 618, 619 and 620 as defined above.

[0285] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 594, 595, 596 and 597, and their respective mirror sequence SEQ ID NOs: 621, 622, 623 and 624 as defined above.

[0286] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 598 and 608 as defined above, and their respective mirror sequence SEQ ID NOs: 625 and 635 as defined above.

[0287] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 599, 600 and 601, as defined above and their respective mirror sequence SEQ ID NOs: 626, 627 and 628 as defined above.

[0288] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 602, 603, 604 and 605, as defined above and their respective mirror sequence SEQ ID NOs: 629, 630, 631 and 632 as defined above.

[0289] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is different from the sequences SEQ ID NOs: 637 and 638.

[0290] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559; their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636; and the sequences having at least 95%, preferably at least 98%, identity with the sequences SEQ ID NOs: 1 to 559 and 636,

[0291] in particular said electroactive nucleotide sequence being chosen from the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559, and their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636.

[0292] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, wherein said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559, and their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636.

[0293] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 1, 32, 63, 149, 187 and 249.

[0294] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which the introduction step c) is carried out by one of the following methods: • substitution (or replacement) of at least one of the stem-loops (2) of said electroactive nucleotide sequence by the stem-loop (3) of said at least one fragment; and / or • addition of the stem-loop (3) of said at least one fragment to at least one of the stem-loops (2) of said electroactive nucleotide sequence,

[0295] said above steps can be combined. In particular, said introduction step c) is carried out by means of a substitution (or replacement) of at least one of the stem-loops (2) of said electroactive nucleotide sequence by the stem-loop (3) of said at least one fragment of at least one donor aptamer.

[0296] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, further comprising a test step making it possible to validate (verify) that: • the electroactivity of the central electroactive ring (1') of said electroactive composite aptamer is preserved relative to that of the central electroactive ring (1) of said electroactive nucleotide sequence, said electroactivity being determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and / or • the capacity to specifically fix said molecule of interest to said at least one fragment of said electroactive composite aptamer being preserved compared to that of said at least one fragment of at least one donor aptamer, said fixing being determined by means of electrochemical measurement methods such as cyclic voltammetry or pulse voltammetry differentials.

[0297] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, further comprising a test step for validating (verifying) that the electroactivity of the electroactive central ring (1') of said electroactive composite aptamer is preserved relative to that of the electroactive central ring (1) of said electroactive nucleotide sequence, said electroactivity being determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry. In particular, this test is carried out by means of a cyclic voltammetry test where 2 cyclic voltammetry cycles are carried out between -0.4 V and +0.6 V vs.Ag / AgCl at a speed of 50 mV / sec using in particular an electrochemical station of the Autolab PGSTAT100 potentiostat / galvanostat type (EcoChimie, Netherlands), and the observation of an anodic peak between 0.1 V and 0.2 V confirms the existence of an intrinsic electroactivity of the central ring of the electroactive composite aptamer of the invention.

[0298] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, further comprising a test step making it possible to validate (verify) that the capacity to specifically fix said molecule of interest of said at least one fragment of said electroactive composite aptamer is preserved compared to that of said at least one fragment of at least one donor aptamer, said fixation being determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry. In particular, this test is carried out by means of a cyclic voltammetry test where 2 cyclic voltammetry cycles are carried out between -0.4 V and +0.6 V vs.Ag / AgCl at a speed of 50 mV / sec using in particular an electrochemical station of the Autolab PGSTAT100 potentiostat / galvanostat type (EcoChimie, Netherlands), and the observation of a loss of signal between the electroactive composite aptamer of the invention in the absence of the molecule of interest for which it is supposed to have an affinity and that in the presence of this molecule of interest confirms that the grafting of the fragment of at least one donor aptamer capable of fixing this molecule of interest on an electroactive nucleotide sequence of the invention makes it possible to preserve its affinity for said molecule of interest.

[0299] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said at least one donor aptamer specifically targets a molecule of interest chosen from: an antibiotic (penicillins, quinolones, macrolides, etc.), a biomarker (cardiovascular diseases, cancer, neurodegenerative disease, autoimmune disease, etc.), a hormone, a drug, an anthropogenic pollutant (pesticides, insecticides, fungicides, herbicides, etc.), a protein and a toxin (fungal, microbial, algal, etc.).

[0300] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said at least one donor aptamer specifically targets a molecule of interest chosen from: metronidazole A, tetracycline, estradiol A, bisphenol A, saxitoxin and troponin.

[0301] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said at least one fragment of at least one donor aptamer comprises from 10 to 100 nucleotides, in particular from 10 to 50 nucleotides.

[0302] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which said at least one fragment of at least one donor aptamer is chosen from the sequences SEQ ID NOs: 560 to 570 and 639.

[0303] According to another embodiment, the invention relates to the method of manufacturing an electroactive composite aptamer above, in which: • said electroactive nucleotide sequence is chosen from the sequences SEQ ID NOs: 582 and 606 as defined above, and their respective mirror sequence SEQ ID NOs: 609 and 633 as defined above; and • said at least one fragment of at least one donor aptamer is chosen from the sequences SEQ ID NOs: 560 to 570 and 639.

[0304] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which the electroactive composite aptamer is chosen from the sequences SEQ ID NOs: 571 to 581 and 640 to 642, and the sequences having at least 95%, preferably at least 98%, identity with the sequences SEQ ID NOs: 571 to 581 and 640 to 642,

[0305] in particular said electroactive composite aptamer being chosen from the sequences SEQ ID NOs: 571 to 581 and 640 to 642.

[0306] According to another embodiment, the invention relates to the method for manufacturing an electroactive composite aptamer above, in which the electroactive composite aptamer is chosen from the sequences SEQ ID NOs: 571 to 581 and 640 to 642.

[0307] In general, another subject of the Invention relates to the use of an electroactive composite aptamer according to the invention for the detection of at least one molecule of interest {capable of being targeted by said electroactive composite aptamer according to the invention),

[0308] in particular at least one molecule of interest chosen from: an antibiotic (penicillins, quinolones, macrolides, etc.), a biomarker (cardiovascular diseases, cancer, neurodegenerative disease, autoimmune disease, etc.), a hormone, a drug, an anthropogenic pollutant (pesticides, insecticides, fungicides, herbicides, etc.), a protein and a toxin (fungal, microbial, algal, etc.).

[0309] As discussed previously, the inventors were able to develop monofunctional electroactive composite aptamers (i.e. affinity for a single molecule of interest) or multifunctional electroactive composite aptamers (i.e. affinity for at least two molecules of interest). This explains why the above use concerns the detection of at least one molecule of interest. Thus, in the case of a monofunctional electroactive composite aptamer, the detection of one molecule of interest will be concerned. And in the case of a bifunctional, trifunctional, tetrafunctional or even pentafunctional electroactive composite aptamer, the respective detection of two, three or even four molecules of interest will be concerned.

[0310] According to another embodiment, the invention relates to the above use of an electroactive composite aptamer according to the invention for the detection of at least one molecule of interest chosen from: an antibiotic (penicillins, quinolones, macrolides, etc.), a biomarker (cardiovascular diseases, cancer, neurodegenerative disease, autoimmune disease, etc.), a hormone, a drug, an anthropogenic pollutant (pesticides, insecticides, fungicides, herbicides, etc.), a protein and a toxin (fungal, microbial, algal, etc.).

[0311] According to another embodiment, the invention relates to the above use of an electroactive composite aptamer according to the invention for the detection of at least one molecule of interest chosen from: metronidazole A, tetracycline, estradiol A, bisphenol A, saxitoxin and troponin.

[0312] In general, another subject of the invention relates to the use of an electroactive composite aptamer according to the invention for the manufacture of an electroactive aptasensor capable of specifically detecting at least one molecule of interest,

[0313] said electroactive aptacensor comprising an electroactive composite aptamer according to the invention immobilized: • on a magnetic ball; or • on the surface of an electrode (screen printed), in particular a carbon electrode or a gold electrode,

[0314] (said at least one molecule of interest being capable of being targeted by said electroactive composite aptamer according to the invention).

[0315] By "electroactive composite aptasensor" is meant the support (magnetic bead, electrodes, etc.) on which the electroactive composite aptasensor of the invention is immobilized and which makes it possible to implement the uses and methods of the invention. Also, in general, another subject of the invention relates to an electroactive aptasensor capable of specifically detecting at least one molecule of interest, said electroactive aptasensor comprising an electroactive composite aptamer according to the invention immobilized: • on a magnetic ball; or • on the surface of an electrode (screen printed), in particular a carbon electrode or a gold electrode,

[0316] (said at least one molecule of interest being capable of being targeted by said electroactive composite aptamer according to the invention).

[0317] In general, another subject of the invention relates to a method for manufacturing an electroactive aptasensor as defined above capable of specifically detecting at least one molecule of interest, said method comprising at least one step of immobilizing an electroactive composite aptamer according to the invention on: • a magnetic bead; or • on the surface of an electrode (screen printed), in particular a carbon electrode or a gold electrode,

[0318] (said at least one molecule of interest being capable of being targeted by said electroactive composite aptamer according to the invention).

[0319] This is made possible in particular by the incorporation of a modification by an amine (-NH2) or thiol (-SH) group on one of the 5' or 3' ends of said electroactive composite aptamer when the latter is chemically synthesized.

[0320] By "incorporation of a modification by an amine group (-NH2) on one of the 5' or 3' ends of said electroactive composite aptamer", is meant the modification which allows in particular the ED / NHS coupling of amine aptamers (NH2) on screen-printed carbon electrodes. According to another embodiment, the invention therefore relates to the method for manufacturing an electroactive composite aptamer of the invention, in which said chemical synthesis further comprises a step of incorporation of a modification by an amine group (-NH2) on one of the 5' or 3' ends of said electroactive composite aptamer. And according to another embodiment, the invention relates to the method for manufacturing an electroactive aptasensor above, in which the electroactive composite aptamer of the invention comprises a modification by an amine group (-NH2) on one of its 5' or 3' ends.

[0321] By "incorporation of a modification by a thiol group (-SH) on one of the 5' or 3' ends of said electroactive composite aptamer", is meant the modification which allows in particular the self-assembly of thiolated aptamers (SH) on gold screen-printed electrodes. According to another embodiment, the invention therefore relates to the method for manufacturing an electroactive composite aptamer of the invention, in which said chemical synthesis further comprises a step of incorporating a modification by a thiol group (-SH) on one of the 5' or 3' ends of said electroactive composite aptamer. And according to another embodiment, the invention relates to the method for manufacturing an electroactive aptasensor above, in which the electroactive composite aptamer of the invention comprises a modification by a thiol group (-SH) on one of its 5' or 3' ends.

[0322] According to another embodiment, the invention relates to the method for manufacturing an electroactive aptasensor above, said method comprising at least one step of immobilizing an electroactive composite aptamer according to the invention on a magnetic bead.

[0323] According to another embodiment, the invention relates to the method for manufacturing an electroactive aptacensor above, said method comprising at least one step of immobilizing an electroactive composite aptamer according to the invention on a magnetic bead, said immobilization comprising at least the following steps:

[0324] a) suspending pre-activated magnetic beads in a buffer with a pH of between 4.5 and 6.5;

[0325] b) washing said pre-activated magnetic beads;

[0326] c) adding a mixture of l-Ethyl-3-[3-dimethylaminopropyl]-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS); and

[0327] d) adding a solution comprising the electroactive composite aptamer according to the invention modified at the 5' or 3' end with an amine group.

[0328] Here, the EDC reacts with the surface carboxylic acids of the magnetic beads to form an unstable O-acylisourea intermediate which immediately reacts with the NHS to form a more stable reactive ester. The addition of the aptamer solution of the electroactive composite aptamers of the invention bearing a terminal amine group then allows the establishment of stable amide bonds between the magnetic beads and the electroactive composite aptamers of the invention.

[0329] This immobilization can be carried out non-limitingly in the following manner:

[0330] Magnetic beads of 1 μm diameter activated with carboxylic groups of the Dynabeads MyOne™ type (Invitrogen) are used for the immobilization of the electroactive composite aptamer of the invention. These beads are provided in aqueous suspension, they have a hydrophilic surface which guarantees low non-specific binding and excellent dispersion capacities.

[0331] 200 pL of these beads are suspended in a microtube containing 800 pL of MES buffer (2-(N-morpholino) ethanesulfonic acid hydrate) 0.1 M pH 5.5. The microtube is then placed on a magnetic support, allowing the buffer to be removed by simple inversion. The beads retained in the tube are then treated with 1 mL of a mixture of 0.1 M EDC and 25 mM NHS in 0.1 M MES buffer and kept stirring for 2 hours, then the solution is removed by inversion on the magnetic support. The immobilization of the electroactive composite aptamers of the invention is carried out by adding to the beads 1 mL of 1 pM electroactive composite aptamer solution of the invention and stirring the resulting suspension for 4 hours. The quantity of immobilized electroactive composite aptamers of the invention could be estimated by measuring the absorbance at 260 nm of the composite aptamer solution electroactive agents of the invention before and after incubation with the activated beads. The modified beads are then incubated in the presence of a 20 mM Tris-HCl buffer pH 7.6 in order to block the potentially free active sites.

[0332] According to another embodiment, the invention relates to the method for manufacturing an electroactive aptasensor above, said method comprising at least one step of immobilizing an electroactive composite aptamer according to the invention on the surface of an electrode, in particular a screen-printed electrode.

[0333] In particular, the invention relates to the method for manufacturing an electroactive aptasensor above, said method comprising at least one step of immobilizing an electroactive composite aptamer according to the invention on the surface of a carbon electrode.

[0334] In particular, the invention also relates to the method for manufacturing an electroactive aptasensor above, said method comprising at least one step of immobilizing an electroactive composite aptamer according to the invention on the surface of a carbon electrode, said immobilization comprising at least the following steps:

[0335] a) the preliminary electrochemical treatment of a carbon electrode in an acid medium;

[0336] b) electrografting of benzoate or phenylcarboxylate groups onto said carbon electrode;

[0337] c) adding a mixture of l-Ethyl-3-[3-dimethylaminopropyl]-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS); and

[0338] d) adding a solution comprising the electroactive composite aptamer according to the invention modified at the 5' or 3' end with an amine group.

[0339] Here, the carboxylic acid groups of the benzoate or phenylcarboxylate groups are activated by the EDC / NHS mixture in order to generate reactive esters. The addition of the aptamer solution of electroactive composite aptamers of the invention bearing a terminal amine group then allows the establishment of stable amide bonds between the carbon electrode and the electroactive composite aptamers of the invention.

[0340] This immobilization can be carried out non-limitingly in the following way:

[0341] A type of screen-printed sensors consisting of 3-electrode systems is used. It consists of screen-printed sensors comprising a carbon working electrode (4 mm diameter, LOCTITE® ED AG 423SS carbon paste), a carbon counter-electrode (16 mm x 1.5 mm curved track, LOCTITE® ED AG 423SS) and an Ag / AgCl reference electrode (16 mm x 1.5 mm, Electrodag 6037SS). Before immobilization, the working electrode is pretreated in linear voltammetry by applying five cycles between 1.0 and -1.5 V vs Ag / AgCl in 0.5 M H2SO4 containing 0.1 M KC1, which makes it possible to obtain batches of electrodes having homogeneous and regular surface characteristics. The surface of the working electrodes is then activated in order to create surface groups on which the electroactive composite aptamer of the invention can be immobilized. This activation is carried out using a diazonium salt obtained by mixing, with stirring for 5 minutes, 2 mM sodium nitrite (NaNO2) and 2 mM 4-aminophenylacetic acid in a 0.5 M HCl solution. A volume of 100 pL of the product obtained is then deposited on the surface of the working electrode, and the electrochemical generation of surface phenylacetic groups is carried out in situ by linear voltammetry by scanning the potential from 0.4 to -1 V vs Ag / AgCl.The electrodes are then washed with distilled water and the carboxylic groups thus obtained are then activated by depositing on the working electrode 50 pL of a 0.1 M MES buffer solution pH 5.5 containing 100 mM of l-ethyl-3-[3-(dimethylamino)propyl]carbodiimide (EDC) and 25 mM of N-hydroxysuccinimide (NHS) for an incubation time of 120 min. After rinsing with distilled water, 20 pL of electroactive composite aptamer solution of the invention (5' or 3' amino) of 1 pM concentration are deposited on the working electrode and left to incubate for 4 h to allow immobilization. The electrode is then rinsed with PBS buffer, and then the residual activated sites are blocked by incubation for 60 min with 50 pL of 1 M ethanolamine solution pH 11. Finally, the electrode is rinsed with 0.1 M phosphate buffer, pH 7.4 and can be used.

[0342] In particular, the invention also relates to the method for manufacturing an electroactive aptamer above, said method comprising at least one step of immobilizing an electroactive composite aptamer according to the invention on the surface of a gold electrode.

[0343] In particular, the invention also relates to the method for manufacturing an electroactive aptamer above, said method comprising at least one step of immobilizing an electroactive composite aptamer according to the invention on the surface of a gold electrode, said immobilizing comprising at least the following steps:

[0344] a) adding a solution comprising the electroactive composite aptamer according to the invention modified at the 5' or 3' end with a thiol group to a gold electrode; and

[0345] b) the application of a sufficient potential for a sufficient duration allowing the reduction of possible disulfide bridges between the gold electrode and the electroactive composite aptamer according to the invention modified at the 5' or 3' end with a thiol group.

[0346] Here, the oriented immobilization of the electroactive composite aptamer of the invention on a gold electrode is therefore based on the establishment of spontaneous covalent bonds between the terminal thiol (SH) groups of the aptamers and the gold (Au) constituting the electrode material. No coupling reagent is necessary for this reaction.

[0347] This immobilization can be carried out non-limitingly in the following manner:

[0348] A type of screen-printed sensors consisting of 3-electrode systems is used. It consists in particular of screen-printed electrodes marketed by the company DropSens-Metrohm (Asturias, Spain) comprising a gold working electrode. They were produced with electroactive composite aptamers modified in 5' by a thiol group (SH). The immobilization, carried out in particular with electroactive composite aptamers of the invention modified in 5' by a thiol group (SH), is carried out by depositing 80 pL of aptamer solution on the gold working electrode. The application of a potential of -1.2 V for 300 seconds allows the reduction of any disulfide bridges and thus promotes the fixation of the electroactive composite aptamers of the invention on the gold surface. After which, the electrodes are rinsed with a buffer.

[0349] In general, another subject of the invention relates to the use of an electroactive aptamer as defined above for detecting at least one molecule of interest (capable of being targeted by said electroactive composite aptamer according to the invention),

[0350] in particular at least one molecule of interest chosen from: an antibiotic (penicillins, quinolones, macrolides, etc.), a biomarker (cardiovascular diseases, cancer, neurodegenerative disease, autoimmune disease, etc.), a hormone, a drug, an anthropogenic pollutant (pesticides, insecticides, fungicides, herbicides, etc.), a protein and a toxin (fungal, microbial, algal, etc.).

[0351] According to another embodiment, the invention relates to the above use of an electroactive aptasensor as defined above for detecting at least one molecule of interest chosen from: an antibiotic (penicillins, quinolones, macrolides, etc.), a biomarker (cardiovascular diseases, cancer, neurodegenerative disease, autoimmune disease, etc.), a hormone, a drug, an anthropogenic pollutant (pesticides, insecticides, fungicides, herbicides, etc.), a protein and a toxin (fungal, microbial, algal, etc.).

[0352] According to another embodiment, the invention relates to the above use of an electroactive aptasensor as defined above for detecting at least one molecule of interest chosen from: metronidazole A, tetracycline, estradiol A, bisphenol A, saxitoxin and troponin.

[0353] In general, another subject of the invention relates to a method for detecting at least one molecule of interest (capable of being targeted by said electroactive composite aptamer according to the invention), said method comprising at least the implementation of the electroactive composite aptamer according to the invention or of the electroactive aptasensor as defined above,

[0354] in particular said at least one molecule of interest being chosen from: an anti biotic (penicillins, quinolones, macrolides, etc.), a biomarker (cardiovascular diseases, cancer, neurodegenerative diseases, autoimmune diseases, etc.), a hormone, a drug, an anthropogenic pollutant (pesticides, insecticides, fungicides, herbicides, etc.), a protein and a toxin (fungal, microbial, algal, etc.).

[0355] According to another embodiment, the invention relates to the method for detecting at least one molecule of interest above, in which said at least one molecule of interest is chosen from: an antibiotic (penicillins, quinolones, macrolides, etc.), a biomarker (cardiovascular diseases, cancer, neurodegenerative disease, autoimmune disease, etc.), a hormone, a drug, an anthropogenic pollutant (pesticides, insecticides, fungicides, herbicides, etc.), a protein and a toxin (fungal, microbial, algal, etc.)

[0356] According to another embodiment, the invention relates to the method for detecting at least one molecule of interest above, in which said at least one molecule of interest is chosen from: metronidazole A, tetracycline, estradiol A, bisphenol A, saxitoxin and troponin.

[0357] According to another embodiment, the invention relates to the method for detecting at least one molecule of interest above comprising at least the following steps:

[0358] a) adding a “control” solution not comprising said at least one molecule of interest to the electroactive composite aptamer according to the invention or to the electroactive aptacensor as defined above and measuring the electrical signal of the electroactive composite aptamer according to the invention or of the electroactive aptacensor as defined above;

[0359] b) adding a test sample capable of containing said at least one molecule of interest to the electroactive composite aptamer according to the invention or to the electroactive aptacensor as defined above and measuring the electrical signal of the electroactive composite aptamer according to the invention or of the electroactive aptacensor as defined above;

[0360] c) comparing the signal measured in step a) with the signal measured in step b),

[0361] wherein a change (a decrease) in the signal measured in step b) by relative to the signal measured in step a) indicates the presence of said at least one molecule of interest in the sample to be tested.

[0362] Also, it is understood that the general principle of the detection of at least one molecule of interest is based on the measurement of the current generated by the composite aptamer of the invention in the absence and in the presence of said at least one molecule of interest. The fixation of the latter by (on) the composite aptamer of the invention results in a reduction in the intensity of the measured current. This reduction being proportional to the concentration of said at least one molecule of interest in the sample tested, it is possible to quantify it if a standard curve has been produced in parallel.

[0363] By "sample to be tested" is meant, in a non-limiting manner, biological samples (blood, urine, saliva, etc.), environmental samples (spring water, groundwater, surface water), liquid agro-industrial samples (milk, fruit juice, wines and other fermented beverages) or solid samples after extraction (cereals, cocoa, coffee, tea, and other plant or animal matrices) in which the detection of at least one molecule of interest is envisaged, for example, either to diagnose a pathology, or to highlight pollution, or to highlight food contamination or to attest to the conformity of a product.

[0364] This method can be carried out non-limitingly in the following manner:

[0365] After having prepared or obtained the electroactive aptasensor of the invention on which is immobilized the electroactive composite aptasensor of the invention, which is capable of recognizing and fixing said at least one molecule of interest, 100 pL of a control solution (i.e. not containing said at least one molecule of interest) are deposited on the surface of the electroactive aptasensor, and the signal is measured by carrying out 2 cyclic voltammetry cycles between -0.4 and +0.6 V vs. Ag / AgCl at a speed of 50 mV / sec. The presence of an anodic peak observed between 0.1 and 0.2 V confirms the presence of an intrinsic electroactivity of the electroactive composite aptasensor of the invention, and the peak intensity is considered as the signal of the aptasensor. Then, 100 pL of a test solution (i.e.which may contain said at least one molecule of interest) are deposited on the surface of the electroactive aptasensor, and the signal is measured by performing 2 cyclic voltammetry cycles between -0.4 and +0.6 V vs. Ag / AgCl at a speed of 50 mV / sec. The observation of a change in the signal of the electroactive aptasensor validates the recognition (fixation) and therefore the detection of said at least one molecule of interest in the test solution by the electroactive composite aptasensor of the invention. This change in signal is subsequently expressed as follows: .

[0366] [Math.l] %decrease = 100-( x 100 )

[0367] where Itest represents the intensity of the signal measured with a test solution and Icontrôie represents the intensity of the signal measured with a control solution.

[0368] Conversely, the absence of change in the signal from the aptachensor indicates that the test solution does not comprise said at least one molecule of interest.

[0369] In general, another subject of the Invention relates to a library of electroactive nucleotide sequences, said library comprising the sequences SEQ ID NOs: 582 and 606 as defined above, and their respective mirror sequence SEQ ID NOs: 609 and 633 as defined above, which sequences and mirror sequences have a secondary structure comprising an electroactive central ring (1) and five stem-loops (2), the electroactivity of the electroactive central ring (1) can be determined using electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry.

[0370] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 583, 584 and 585, and their respective mirror sequence SEQ ID NOs: 610, 611 and 612 as defined above.

[0371] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 586, 587, 588 and 589, and their respective mirror sequence SEQ ID NOs: 613, 614, 615 and 616 as defined above.

[0372] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 590 and 607, and their respective mirror sequence SEQ ID NOs: 617 and 634 as defined above.

[0373] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 591, 592 and 593, and their respective mirror sequence SEQ ID NOs: 618, 619 and 620 as defined above.

[0374] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 594, 595, 596 and 597, and their respective mirror sequence SEQ ID NOs: 621, 622, 623 and 624 as defined above.

[0375] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 598 and 608 as defined above, and their respective mirror sequence SEQ ID NOs: 625 and 635 as defined above.

[0376] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 599, 600 and 601, as defined above and their respective mirror sequence SEQ ID NOs: 626, 627 and 628 as defined above.

[0377] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 602, 603, 604 and 605, as defined above and their respective mirror sequence SEQ ID NOs: 629, 630, 631 and 632 as defined above.

[0378] According to another embodiment, the invention relates to the above library, said library comprising neither the sequence SEQ ID NO: 637 nor the sequence SEQ ID NO: 638.

[0379] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559; their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636; and the sequences having at least 95%, preferably at least 98%, identity with the sequences SEQ ID NOs: 1 to 559 and 636,

[0380] in particular said library comprising the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559, and their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636.

[0381] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559, and their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636.

[0382] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 1 to 31, 63 to 93, 125 to 155, 187 to 217, 249 to 279, 311 to 341, 373 to 403, 435 to 465, 497 to 527 and 559, and their respective mirror sequence SEQ ID NOs: 32 to 62, 94 to 124, 156 to 186, 218 to 248, 280 to 310, 342 to 372, 404 to 434, 466 to 496, 528 to 558 and 636.

[0383] According to another embodiment, the invention relates to the above library, said library comprising the sequences SEQ ID NOs: 1, 32, 63, 149, 187 and 249.

[0384] In any respect, it should be noted that the different aspects of the invention, as well as the different embodiments thereof, are interdependent. The latter can therefore be combined with each other to obtain preferred aspects and / or embodiments of the invention not explicitly described. This is also valid for all the definitions provided in the present description, which applies to all aspects of the invention and its embodiments.

[0385] Further, the present invention is illustrated, but not limited to, the following Figures and Examples. LIST OF FIGURES

[0386] [Fig.l]

[0387] [Fig.l] schematically represents the design of the electroactive composite aptamer capable of binding metronidazole of sequence SEQ ID NO: 571 obtained by substituting the fourth stem-loop of the electroactive nucleotide sequence of sequence SEQ ID NO: 1 with the stem-loop of sequence SEQ ID NO: 560 of the donor aptamer capable of binding metronidazole.

[0388] [Fig.2]

[0389] [Fig.2] represents the modeling of the secondary structure of the electroactive nucleotide sequences of sequences SEQ ID NOs: 32, 63, 149, 187 and 249. They all have a central electroactive ring and five stem-loops.

[0390] [Fig.3]

[0391] [Fig.3] represents the modeling of the secondary structure of the electroactive nucleotide sequences of sequences SEQ ID NOs: 311, 373, 497 and 559. They all have an electroactive central ring and five rod-loops.

[0392] [Fig.4]

[0393] [Fig.4] shows the cyclic voltammogram and the anodic peak intensity for the electroactive aptasensor on which the anti-TPN-5 electroactive composite aptamer (SEQ ID NO: 581) is immobilized. The peak intensity is considered as the signal of the electroactive aptasensor.

[0394] [Fig.5]

[0395] [Fig.5] shows a calibration curve performed using the electroactive anti-TPN-5 composite aptamer (SEQ ID NO: 581) and in the presence of troponin at concentrations ranging from 0.5 nM to 10 nM. EXAMPLES

[0396] EXAMPLE No. 1: Intrinsic electroactivity of the electroactive nucleotide sequence of the Invention

[0397] 1. MATERIALS & METHODS

[0398] 1.1. Design and Modeling

[0399] The prediction of the secondary structures of the designed sequence was carried out using the “DNA folding” application available on the Mfold server (University of Albany, State University of New York, USA) (Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003 Jul l;31(13):3406-15. doi: 10.1093 / nar / gkg595. PMID: 12824337; PMCID: PMC169194.). It was carried out taking into account the following parameters: ionic concentrations Na+ 100 mM and Mg2+ 5 mM, temperature 25°C.

[0400] 12. Chemical synthesis

[0401] After the computer design of the electroactive nucleotide sequence, the obtained sequence was produced (Microsynth AG, Switzerland) with a modification by an amine group on one of the ends of the sequence (5' or 3'), in order to allow its oriented immobilization.

[0402] 13. Immobilization of the electroactive nucleotide sequence on an electrode of carbon

[0403] Before immobilization, the working electrode was pretreated in linear voltammetry by applying five cycles between 1.0 and -1.5 V vs Ag / AgCl in 0.5 M H2SO4 containing 0.1 M KC1, which makes it possible to obtain batches of electrodes having homogeneous and regular surface characteristics. The surface of the working electrodes was then activated in order to create surface groups on which the electroactive nucleotide sequence of the invention can be immobilized. This activation was carried out using a diazonium salt obtained by mixing under stirring for 5 minutes 2 mM sodium nitrite (NaNO2) and 2 mM 4-aminophenylacetic acid. mM in a 0.5 M HCl solution. A volume of 100 pL of the obtained product was then deposited on the surface of the working electrode, and the electrochemical generation of surface phenylacetic groups was carried out in situ by linear voltammetry by scanning the potential from 0.4 to -1 V vs Ag / AgCl. The electrodes were then washed with distilled water and the carboxylic groups thus obtained were then activated by depositing on the working electrode 50 pL of a 0.1 M MES buffer solution pH 5.5 containing 100 mM of l-ethyl-3-[3-(dimethylamino)propyl]carbodiimide (EDC) and 25 mM of N-hydroxysuccinimide (NHS) for an incubation time of 120 min. After rinsing with distilled water, 20 pL of solution of the electroactive nucleotide sequence of the invention (amino in 5' or in 3') of concentration 1 pM were deposited on the working electrode and left to incubate for 4 h to allow immobilization.The electrode was then rinsed with PBS buffer, and then the residual activated sites were blocked by incubation for 60 min with 50 μL of 1 M ethanolamine solution pH 11. Finally, the electrode was rinsed with 0.1 M phosphate buffer, pH 7.4 and could be used.

[0404] 14. Cyclic voltammetry

[0405] Using an electrochemical station of the Autolab PGSTAT100 potentiostat / gal-vanostat type (EcoChimie, Netherlands), 2 cyclic voltammetry cycles were carried out between -0.4 V and +0.6 V vs. Ag / AgCl at a speed of 50 mV / sec.

[0406] 2. RESULTS

[0407] After having designed and modeled the sequence SEQ ID NO: 1, it was shown that it has 5 stem-loops organized around a central ring ([Fig.l]), which, in cyclic voltammetry, was shown to have a characteristic intrinsic electroactivity. Indeed, a singular anodic peak was observed between 0.1 V and 0.2 V.

[0408] From this electroactive nucleotide sequence of sequence SEQ ID NO: 1, the sequences SEQ ID NOs: 2 to 559 and 636 were designed and modeled, and the electroactivity of the sequences SEQ ID NOs: 32, 63, 149, 187 and 249 was measured in the same way. For each of them, the same secondary structure was modeled (1 central electroactive ring + 5 stem-loops) ([Fig. 2]) and the same anodic peak between 0.1 V and 0.2 V was also measured (Table 1). Surprisingly, the measured electrochemical signal of the mirror sequence SEQ ID NO: 32 was more significant than that of the sequence SEQ ID NO: 1 of which it is the mirror.

[0409] [Tables 1] Electroactive nucleotide sequences (SEQ ID NO) Initial signal (pA) 1 34 + 6.3 32 68 + 8.2 63 23 + 3.5 149 15+1.4 187 18+1.6 249 24 + 5.3

[0410] Table 1. Measurements of the electrochemical activity of electroactive nucleotide sequences

[0411] With the sequences SEQ ID NOs: 311, 373, 497 and 559 having the same secondary structure as that of the sequence SEQ ID NO: 1 ([Fig.3]), this anodic peak between 0.1 V and 0.2 V is also observed.

[0412] These data finally made it possible to affirm that the replacement of the bases which constitute the stem-loops and / or the modification of another base does not affect the intrinsic electrochemical activity of the oligonucleotide obtained, provided that the secondary structure of the latter gives the same form of five stem-loops and a central single-stranded ring on which all the stem-loops associate. Consensus sequences could therefore be generated.

[0413] EXAMPLE No. 2: Design of an electroactive composite aptamer

[0414] 1. MATERIALS & METHODS

[0415] 1.1. Design of an electroactive composite aptamer

[0416] Wishing to take advantage of the intrinsic electroactivity of the electroactive nucleotide sequences that they designed, the inventors then developed electroactive composite aptamers resulting from the replacement (= substitution) of stem-loops by structures derived from other donor aptamers exhibiting recognition properties for a molecule of interest. Concretely, this went through three main stages:

[0417] The first consisted of selecting an electroactive nucleotide sequence of the invention from those described in the library of the invention, namely the sequences SEQ ID NOs: 582 and 606 as defined above, and their respective mirror sequence SEQ ID NOs: 609 and 633 as defined above.

[0418] The second consisted of selecting a donor aptamer having an affinity specific for a molecule of interest (= its target). This step was facilitated when the aptamer had already been described in the scientific literature, but it was also possible to carry out an in vitro selection using, for example, the SELEX method (Systematic Evolution of Ligands by EXponential enrichment). The prediction of the secondary structures of the aptamer obtained is then necessary and it can give rise to simple or very complex structures.

[0419] Note that it is only possible to produce an electroactive composite aptamer if the structure of the donor aptamer consists of one to three associated stem-loops separated by 2 to 4 nucleotides. Variations in the length of the stem or the size of the loop, as well as the presence of more elaborate structures (e.g. the presence of secondary stem-loops on the main stem-loops) do not, however, rule out the possibility of producing a composite aptamer from the donor aptamer. In the case of complex structures, it is then sometimes important to carry out truncation studies of the donor aptamer in order to determine the part involved in the recognition of the molecule of interest, which will be the subject of the grafting.

[0420] The third consisted of grafting the donor aptamer (or a fragment of this donor aptamer) onto the previously chosen electroactive nucleotide sequence. This involves replacing the bases of the electroactive structure with the bases of the donor aptamer and then predicting the secondary structure of the oligonucleotide obtained (see above, Example No. 1, point LL). This is done as follows: The stem-loop structures are replaced by those of the donor aptamer (or a fragment of this donor aptamer) and it is possible to replace the stem-loops individually or jointly. Note that the incorporation of the donor aptamer (or a fragment of this donor aptamer) may require modifying bases at a distance from the incorporation zone.

[0421] The oligonucleotide obtained was only retained as a candidate to proceed to the validation stage if the secondary structure of the latter is of the same type as that of the electroactive nucleotide sequence, i.e. formed of five stem-loops attached to a single-stranded central ring.

[0422] 12. Validation of the modeled composite aptamer

[0423] After its computer design, the oligonucleotide obtained with the obtained sequence was produced (Microsynth AG, Switzerland) and a modification by an amine group on one of the 5' or 3' ends of its sequence was incorporated therein, in order to allow its oriented immobilization. The oligonucleotide thus obtained is only considered an electroactive composite aptamer if it meets two experimentally proven requirements: • the first is to exhibit measurable intrinsic electroactivity when immobilized on the surface of an electrode; and • the second is to maintain its affinity for its target (for which the aptamer donor has been selected), and that the recognition of the target by this oligonucleotide gives rise to a measurable change in electrochemical signal.

[0424] 12.1. Oligonucleotide processing and electrodes

[0425] An oligonucleotide solution was prepared in a 0.1 M phosphate buffer at pH 11. The solution was then heated for 5 min at 95°C then cooled for 5 min at 4°C, and left at room temperature (20°C to 24°C) for at least 5 min before being deposited on the electrode surface.

[0426] In this work, two types of screen-printed sensors consisting of 3-electrode systems were used: • sensors marketed by DropSens (Ref: 220 AT) comprising a gold working electrode; and • sensors screen-printed in the laboratory using a DEK248 semi-automatic screen-printing machine (DEK, Miribel, France), and consisting of a carbon working electrode (4 mm diameter, LOCTITE® EDAG 423SS carbon paste), a carbon counter-electrode (16 mm x 1.5 mm curved track, LOCTITE® EDAG 423SS), and an Ag / AgCl reference electrode (16 mm x 1.5 mm, Electrodag 6037SS). Before immobilization, the working electrode was pre-treated in linear voltammetry by applying five cycles between 1.0 and -1.5 V vs Ag / AgCl in 0.5 M H2SO4 containing 0.1 M KC1. This treatment makes it possible to obtain batches of electrodes with homogeneous and regular surface characteristics.

[0427] All electrochemical measurements were carried out using an Autolab PGSTAT100 potentiostat / galvanostat electrochemical station (EcoChimie, Netherlands).

[0428] 122. Immobilization of oligonucleotides on the electrode

[0429] 122.1. Surface activation by a coupling agent

[0430] The surface of the working electrodes was activated to create surface groups on which the oligonucleotide could be immobilized. This activation was carried out using a diazonium salt obtained by mixing 2 mM sodium nitrite (NaNO2) and 2 mM 4-aminophenylacetic acid in a 0.5 M HCl solution under stirring for 5 minutes. A volume of 100 μL of the product obtained was then deposited on the surface of the working electrode, and the electrochemical generation of surface phenylacetic groups was carried out in situ by linear voltammetry by scanning the potential from 0.4 to -1 V vs Ag / AgCl. The electrodes were then washed with distilled water.The carboxylic groups thus obtained were then activated by depositing on the working electrode 50 pL of a 0.1 M MES buffer solution pH 5.5 containing 100 mM of l-ethyl-3-[3-(dimethylamino)propyl]carbodiimide (EDC) and 25 mM of N-hydroxysuccinimide (NHS) for an incubation time of 120 min.

[0431] 1222. Immobilization of oligonucleotides

[0432] After rinsing with distilled water, 20 μL of oligonucleotide solution (5' or 3' amino) with a concentration of 1 μM was deposited on the working electrode and left to incubate for 4 h to allow immobilization.

[0433] 1223. Blocking of residual active sites (not fixed by the oligonucleotide).

[0434] The electrode was then rinsed with PBS buffer. The residual activated sites were then blocked by incubation for 60 min with 50 μL of 1 M ethanolamine solution pH 11. The electrode was then rinsed with 0.1 M phosphate buffer, pH 7.4.

[0435] 123. Measurement of the intrinsic electroactivity of the immobilized oligonucleotide

[0436] 100 pL of a buffer solution was deposited on the surface of the electrode on in which the oligonucleotide is immobilized, and the signal was measured by performing 2 cycles of cyclic voltammetry between -0.4 and +0.6 V vs. Ag / AgCl at a rate of 50 mV / sec. The presence of an anodic peak observed between 0.1 and 0.2 V confirms the presence of intrinsic electroactivity of the immobilized oligonucleotide and this means that requirement 1 has been met.

[0437] 12.4. Validation of the affinity of the immobilized oligonucleotide and detection of its target

[0438] 100 pL of the solution containing the target at 0M (control) and at different concentrations were deposited on the electrode surface for an incubation time of 20 min. Then the electrochemical signal was measured as described above and the observation of a change in the signal validates the recognition of the target by the immobilized oligonucleotide. The response was then expressed as follows:

[0439] [Math.2] %decrease= 100-( / ---- x lOO)

[0440] Finally, the observation of a change in the signal means that requirement 2 has been fulfilled and that the oligonucleotide designed above is an electroactive composite aptamer within the meaning of the invention which can be used to manufacture electroactive aptasensors allowing the detection of the molecule of interest.

[0441] 123. Tampons used

[0442] Different oligonucleotides were designed to bind a molecule of interest chosen from: metronidazole A, tetracycline, estradiol A, bisphenol A, saxitoxin and troponin. The electrochemical measurements were carried out with the following buffers, which depend on the nature of the target, which correspond to the optimal conditions that ensure the aptamer-target affinity: • Saxitoxin detection: 10 mM phosphate buffer pH 7.4 containing 140 mM NaCl, 2.7 mM KC1 and 0.05% Tween-20; • Detection of tetracycline: 20 mM Tris-HCl buffer pH 7.4 containing 100 mM NaCl, 5 mM KC1, 2 mM MgCl2, 1 mM CaCl2 and 0.02% Tween 20; • Detection of metronidazole A: 50 mM Tris-HCl buffer pH 7.4 containing 100 mM NaCl, 5 mM KC1 and 1 mM MgCl2; • Estradiol A detection: 2 mM Tris-HCl buffer pH 7.5 containing 10 mM NaCl, 5 mM KCl, 0.2 mM MgCl2, 0.1 mM CaCl2, and 5% ethanol; • Detection of bisphenol A: 0.02 mM Tris-HCl buffer pH 8 containing 100 mM NaCl, 40 mM KC1, 20 mM MgCl2 and 0.01% SDS; and • Troponin detection: 20 mM phosphate buffer pH 8 containing 100 mM NaCl, 5 mM KCl, 2 mM MgCl2, 1 mM CaCl2.

[0443] These so-called “selection” buffers were used for all the above steps and for the measurement of electrochemical signals.

[0444] 2. RESULTS

[0445] 2.1. Design of electroactive composite aptamers for the detection of: the tracycline, metronidazole, saxitoxin, estradiol, bisphenol A and troponin

[0446] 2.1.1. Design of an electroactive composite aptamer responsible for the recognition birth of tetracycline

[0447] The donor aptamer was chosen following the work of the Inventors, its sequence is as follows:

[0448] 5'-TTGGGTTGGTCCC-3' (SEQ ID NO: 639).

[0449] Its secondary structure consists of 13 bases, 11 of which form a stem-loop preceded by 2 thymines.

[0450] The electroactive composite aptamer was designed by replacing the stem-loop structure number 4 of the electroactive nucleotide sequence SEQ ID NO: 1 with the bases of the donor aptamer. The sequence of the obtained electroactive composite aptamer is the sequence SEQ ID NO: 640:

[0451] 5 '-CGTACAAATTTTTTTGCTAGAAATTTTTTTCAGGAAATTTTTTTCTTGGG TTGGTCCCACTGCAAATTTTTTTG -3'.

[0452] The secondary structures of the two aptamers “donor” and “electroactive composite” are presented in Table 2.

[0453] 2.12. Design of an electroactive composite aptamer responsible for the recognition birth of metronidazole

[0454] Two electroactive composite aptamers were designed from two sequences described in the prior art and having an affinity for metronidazole.

[0455] The first one is: 5'-CTGTTTGGTAGCAG-3' (SEQ ID NO: 560), its secondary structure consists of a stem-loop, and electroactive composite aptamer was designed by replacing the stem-loop structure number 4 of the electroactive nucleotide sequence SEQ ID NO: 1 with the bases of the donor aptamer. The sequence of the electroactive composite aptamer obtained is the sequence SEQ ID NO: 571:

[0456] 5'-CGTACAAATTTTTTTGCTAGAAATTTTTTTCAGGAAAATTTTTTCTTG TTTGGTAGGCAGACTGCAAATTTTTTTG-3'.

[0457] The second is: 5' - ATCCCTGCAGTTTGGTAGGGTGCGAGC AACATCAGGCACCTGC AGG-3' (SEQ ID NO: 561), its secondary structure consists of a primary stem-loop structure associated with a secondary stem-loop. The electroactive composite aptamer was designed by replacing the stem-loop structure number 2 of the electroactive nucleotide sequence SEQ ID NO: 1 with the bases of the donor aptamer. The sequence of the obtained electroactive composite aptamer is the sequence SEQ ID NO: 572:

[0458] 5 '-CGT ACAAATTTTTTTGATCCCTGCAGTTTGGTAGGGTGCG AGCAACATC AGGCACCTGCAGGAGGAAATTTTTTTCTTGAAATTTTTTTCACTGCAAATTT TTTTG-3'.

[0459] The secondary structures of the two donor aptamers and the two electroactive composite aptamers obtained are presented in Table 2.

[0460] 2.13. Design of an electroactive composite aptamer responsible for the recognition birth of saxitoxin

[0461] The donor aptamer was selected from a sequence described in the prior art and having an affinity for saxitoxin. The secondary structure of this donor aptamer consists of two stem-loop structures surrounded by short linear parts. The bases probably involved in the recognition of saxitoxin are indicated in bold:

[0462] 5'-TTGAGGGTCGCATCCCGTGGAAACAGGTTCATTG-3' (SEQ ID NO: 565).

[0463] The electroactive composite aptamer was designed by replacing the first 32 bases of the electroactive nucleotide sequence SEQ ID NO: 1 by the first 32 bases of the donor aptamer. The sequence of the electroactive composite aptamer obtained is the sequence SEQ ID NO: 576:

[0464] 5'-TTGAGGGTCGCATCCCGTGGAAACAGGTTCATGAAATTTTTTTCTTGA AATTTTTTTCACTGCAAATTTTTTTG-3'.

[0465] The secondary structures of the two aptamers “donor” and “electroactive composite” are presented in Table 2.

[0466] 2.1.4. Design of an electroactive composite aptamer responsible for the recognition birth of estradiol

[0467] The donor aptamer was selected from a sequence described in the prior art and having an affinity for estradiol: 5'-GCCGTTTGGGCCCAAGTTCGGC-3' (SEQ ID NO: 562). The secondary structure consists of a secondary stem-loop associated with a primary stem-loop.

[0468] The electroactive composite aptamer was designed by replacing the bases of stem-loop 4 of the electroactive nucleotide sequence SEQ ID NO: 1 with this sequence. The sequence of the obtained electroactive composite aptamer is the sequence SEQ ID NO: 573:

[0469] 5 ' -CGT ACAAATTTTTTTGCT AGAAATTTTTTTC AGGAAATTTTTTTCTTGÇÇ GTTTGGGCCCAAGTTCGGCACTGCAAATTTTTTG-3'

[0470] The secondary structures of the two aptamers “donor” and “electroactive composite” are presented in Table 2.

[0471] 2.15. Design of an electroactive composite aptamer responsible for the recognition birth of bisphenol A

[0472] The donor aptamer was selected from a sequence described in the prior art and having an affinity for bisphenol A: 5'-TTTTTTTTTTGGATAGCGGGTTCC-3' (SEQ ID NO: 563). The secondary structure of this donor aptamer consists of 24 bases, 14 of which form a stem-loop positioned at the end of a linear part composed of 10 thymine bases.

[0473] The electroactive composite aptamer was designed by replacing the stem-loop 4 bases of the electroactive nucleotide sequence SEQ ID NO: 1 with the stem-loop structure of the donor aptamer. The sequence of the resulting electroactive composite aptamer is the sequence SEQ ID NO: 574:

[0474] 5 '-CGTACAAATTTTTTTGCTAGAAATTTTTTTCAGGAAATTTTTTTCTTGGA TAGCGGGTTCCACTGCAAATTTTTTTG-3'

[0475] The secondary structures of the two aptamers “donor” and “electroactive composite” are presented in Table 2.

[0476] 2.1.6. Design of an electroactive composite aptamer responsible for the recognition birth of troponin

[0477] The donor aptamer was selected from a sequence described in the prior art and having an affinity for troponin. The secondary structure of this donor aptamer consists of 40 bases, 30 of which form a stem-loop positioned within a single-stranded segment. The bases probably involved in the recognition of the target are indicated in bold:

[0478] 5'-CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTA-3' (SEQ ID NO: 570)

[0479] Several electroactive composite aptamers have been designed by replacing certain stem-loop structures of the electroactive nucleotide sequence SEQ ID NO: 1 with all or part of this donor aptamer.

[0480] The 5 sequences used from this donor aptamer are as follows:

[0481] Fragment 1 (SEQ ID NO: 566): CAGTACGCCAACCTTTCTCATGCGCTGC (stem-loop only);

[0482] Fragment 2 (SEQ ID NO: 567): CAGTACGCCAACCTTTCT-CATGCGCTGCCCCT (stem-loop followed by the 4 CCCT bases);

[0483] Fragment 3 (SEQ ID NO: 568): CAGTACGCCAACCTTTCT-CATGCGCTGCCCCTC (stem-loop followed by the 5 bases CCCTC);

[0484] Fragment 4 (SEQ ID NO: 569): CGTGCAGTACGCCAACCTTTCT-CATGCGCTGCCCC (stem-loop preceded by the four CGTG bases and followed by the 3 CCC bases); and

[0485] Fragment 5 (SEQ ID NO: 570): CGTGCAGTACGCCAACCTTTCT-CATGCGCTGCCCCTCTTA (complete sequence).

[0486] The 5 electroactive composite aptamers obtained from this donor aptamer and its fragments are as follows:

[0487] The 1st electroactive composite aptamer was designed by replacing stem-loop number 4 of the electroactive nucleotide sequence SEQ ID NO: 1 with fragment 1:

[0488] 5'- CGTACAAATTTTTTTGCTAGAAATTTTTTTCAGGAAATTTTTTTCTTG CAGTACGCCAACCTTTCTCATGCGCTGCACTGCAAATTTTTTTG-3' (SEQ ID NO: 577).

[0489] The 2nd electroactive composite aptamer was designed by replacing stem-loop number 4 of the electroactive nucleotide sequence SEQ ID NO: 1 with fragment 2. This modification requires substituting the ACTG bases in positions 77-80 of the anti-troponin aptamer thus obtained with the CCCT bases in positions 33-36:

[0490] 5 '-CGT ACAAATTTTTTTGCT AGAAATTTTTTTC AGGAAATTTTTTTCTTGCA GTACGCCAACCTTTCCATGCGCTGCCCCTCAAATTTTTTTG-3' (SEQ ID NO: 578).

[0491] The 3rd electroactive composite aptamer was designed by replacing stem-loop number 4 of the electroactive nucleotide sequence SEQ ID NO: 1 with fragment 3. This modification requires substituting the ACTG bases in positions 77-80 of the anti-troponin aptamer thus obtained with the CCCT bases in positions 33-36 and integrating an extra C nucleotide in position 81:

[0492] 5 '-CGT ACAAATTTTTTTGCT AGAAATTTTTTTC AGGAAATTTTTTTCTTGCA GTACGCCAACCTTTCTCATGCGCTGCCCCTCCAAATTTTTTTG-3' (SEQ ID NO: 579).

[0493] The 4th electroactive composite aptamer was designed by replacing stem-loop number 1 of the electroactive nucleotide sequence SEQ ID NO: 1 with fragment 4. This modification requires deleting nucleotide A in position 4 of the electroactive nucleotide sequence, and replacing the CTA bases in positions 33, 34 and 35 of the anti-troponin aptamer thus obtained by CCC:

[0494] 5'-CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCG AA ATTTTTTTC AG GAAATTTTTTTCTTGAAATTTTTTTCACTGCAAATTTTTTTG-3' (SEQ ID NO: 580).

[0495] The 5th electroactive composite aptamer was designed by replacing stem-loop number 2 of the electroactive nucleotide sequence SEQ ID NO: 1 with fragment 5. This modification requires substituting the CTA bases in positions 17-19 with CGT and the AG bases (49-50) with CC. The stem-loop structure number 3 of sequence GAAATTTTTTTTC also had to be replaced with CTCTTAAAAGAG:

[0496] 5 '-CGTACTTTTTTTAAAGCGTGCAGTACGCCAACCTTTCTCATGCGCTGCC CCTCTTAAAGAGTTGAAATTTTTTTCACTGCAAATTTTTTTG-3' (SEQ ID NO: 581).

[0497] The secondary structures of the five donor aptamer fragments and the five electroactive composite aptamers are shown in Table 2.

[0498] 2.1.7. Design of an electroactive composite aptamer responsible for the recognition birth of several targets

[0499] 2.1.7.1. Design of an electroactive composite aptamer responsible for the recognition birth of two antibiotics: tetracycline and metronidazole

[0500] The electroactive composite aptamer is designed by replacing two stem-loop structures of the electroactive nucleotide sequence SEQ ID NO: 1: - stem-loop number 2 of the electroactive nucleotide sequence is replaced by Donor taptamer recognizing metronidazole: 5'-CTGTTTGGTAGCAG-3' (SEQ ID NO: 560); and - the stem-loop structure number 4 of the electroactive nucleotide sequence by Taptamer donor recognizing tetracycline: 5'-GGGTTGGTCCC-3' (SEQ ID NO: 564).

[0501] The sequence of the obtained bifunctional electroactive composite aptamer is the next:

[0502] 5'-CGTAGAAATTTTTTTCCTACTGTTTGGTAGCAGAGGAAATTTTTTTCTT GGGTTGGTCCCACTGCAAATTTTTTTG-3' (SEQ ID NO: 641).

[0503] The secondary structure of electroactive composite Taptamer is shown in Table 2.

[0504] 2.1.72. Design of an electroactive composite aptamer responsible for the recognition birth of two endocrine disruptors: bisphenol A and estradiol

[0505] The electroactive composite aptamer is designed by replacing two stem-loop structures of the electroactive nucleotide sequence SEQ ID NO: 1: - the stem-loop structure number 1 of the electroactive nucleotide sequence by the donor aptamer having an affinity for estradiol: 5'-GCCGTTTGGGCCCAAGTTCGGC-3' (SEQ ID NO: 562); and - the stem-loop structure number 4 of the electroactive nucleotide sequence by the donor aptamer having an affinity towards bisphenol A: 5'-GGATAGCGGGTTCC-3' (SEQ ID NO: 564).

[0506] The sequence of the obtained electroactive composite aptamer is as follows:

[0507] 5'-CGTAGCCGTTTGGGCCCAAGTTCGGCCTACAAATTTTTTTGAGGAAATT TTTTTCTTGGATAGCGGGTTCCACTGCAAATTTTTTTG-3' (SED ID NO: 642).

[0508] The secondary structure of the electroactive composite aptamer is shown in Table 2.

[0509] [Tables2] Target molecule Secondary structure of donor aptamer Secondary structure of electroactive composite aptamer Tetracycline [CHEM 1] Anti-TET (TET) TGT T-- x / '\ [CHEM 2] T —TYV -K-.-- AA H zX5\x^'\ ■XC À-t 7 f C f -c -;T- -¾ À CT / A. X / ÂC" Ce :..à .S”- / T ...... T ...... ...... C ---------- :< / "'YTY '“ç G ,C!VA v •* x / > .i a.» ; A \r' X'T .-T, / 3 / A l UA TT YG V •r'^ SEQID NO: 639 SEQ ID NO: 640 Métronidazo le (MET) [CHEM 3] G T T — A ........- C....... G -........ SEQID NO : 560 Anti-MET-1 [CHEM 4] V? .N ? . C / •" ••' Ç1 >v : ’> A ; : : • À- VG... A \ A' SEQIDNO : 571 [CHEM 5] 5 .....A J. 10 I X X 1 ! i i fe S 5 G G A — 0 ■“ G -^T cz W ‘ T \ * rs A 'c .A o s A. ..- & v "'A—-G SEQ ID NO : 561 Anti-MET-2 [CHEM 6] •; :A k> - > •'' v- A ? <>’ : V - .•• : A ■ <-> .■ ' s X A V' h- SEQ ID NO : 572 Estradiol (CHEM 7] ï G g '' a K / — g T' \ XJ Aî ty G "■■ A Anti-EST [CHEM 8] SEQID NO : 565 £ y : ..y / ' £CSA' '■ ty / t-à ? ay / / --A / $• T ' 3' 4 S''"> V v-*' SEQ ID NO :576 Bisphenol A (BPA) [CHEM 9] <;'• ..... y Y f •V î iyy ......î .T Ci-- :3- -AQ c ••• A ü NOM-3 ID- CHE '5Q ■ 10] T?xyx.. aî .x, J? XxA"" TXX:''T SEQ ID NO : 573 Saxitoxin (SAX) [CHEM 11] T 1 j >' L -XT"À > i î ' ! \ y \ ï“?_'î a / \ C — 7—7 / 2 \ J t / 's TT [ Anti-SAX [CHEM 12] SEQID NO : 563 \x / / A À~T Xj ' v " \ 1 1 A / -^--V V _ V f sX \ A । ... i J ■. û —vi* 1 t < i A \ 1 J X J SEQ ID NO : 574 Troponine (TPN) [CHEM 13] / c^ c \ C M C M C r » « \ / i « T i 1 ïî । 1 G-C | 1 « 4U f ’ A 1 ( 1 t 1 l \ VI / X A - 1 -- s / v 1 2 > \ 1 1 G — G -tA£- G^t — G — G — T — G — T — T — A: 1 y 2’ SEQ ID NO : 566 Anti-TPN-1 [CHEM 14] »> / ''C i‘ / .i ï! / - A / \ V? / ■-v । । / ^-C c Y,? C.X - X XJ / A / " ? i T 1 K A aX- / / W f - \ > 7 SEQ ID NO : 577 . Anti-TPN-2 [CHEM 16] SEQID NO : 567 7' / a Z y / k j ï\ . B 77k '7 "7^-y\ j. 7y -4 B 1 T-' > G / v^,,.,. A. / A ' A” G.G- Za 5 * y B SEQ ID NO : 578 [CHEM 17] ' T--? - T \ / C C k / / 'r V < T V >1 A l « X / 1 1 4 ; Q : 1 T 7 ! i ..-C -G , \ G / v G —C / \ l A — / \ A i "" v T ï. . . . G — G — T^G - G — G— G— G— T — G — T — A SEQ ID NO : 568 Anti-TPN-3 [CHEM 18] <y~ / - Ab 7 yÿ^ 77^ 7'f "‘K’ Gf> / SEQ ID NO : 579 [CHEM 19] A A \ 7 C T / ! \ v * C ' B 7 1 7 i । 1 G-C i 1 X 1 7 gJ / G 11 ' \ rr \ 1 1 7 \ Q—G - T - G— G - G- C-C -^T - G— T - î -A SEQ ID NO : 569 Anti-TPN-4 [CHEM 20] B, 7 f 1 i—— .-;• 7k A. 17" sjbâm 7 A, 7 X '•. Z v l> X clC / Z .. ' V 7>a y x 7 < '-> '.j ■ X < SEQ ID NO : 580 [CHEM 21] 20 T-^-yc / VCT yv AEAA : \ / ' C .TGT J. , î 1 1 Â-T — 1 1 GG C - G - T - G - G - G - C - C - T-Q — NO : - Ç nti : - 5 SE [CHEM 22] : yy X ; 1 / \ X'\ \ W * y U " x 1 TX;>v X--XT Xt / t" FX y / ' \J SEQIDNO : 581 Tetracycline and meter-nidazole (TET-MET) Anti-TET-MET [CHEM 23] «Vy SEQIDNO- : 6 .--■■'■■"""x * ,X El Z' \ x 2 H \ xaM^''0 aayx y TT rr [ 7 '4 4 XA 'v XX Bisphenol A and estradiol (PBA- EST) Anti-PBA-EST 1 / rT"y /

[0510] Table 2. Secondary Structures of the Two Aptamers “Donor” and “Composite” electroactive »

[0511] 22. Measurements of the electrochemical activity of electroactive composite aptamers designed

[0512] Among the designed and modeled composite sequences, 11 composite sequences were tested (SEQ ID NOs: 571-574, 576-581 and 640) and all showed an intrinsic electrochemical signal once immobilized on electrodes. These are therefore electroactive composite aptamers.

[0513] [Fig.4] shows the cyclic voltammogram and anodic peak intensity for the electroactive aptasensor based on the anti-TPN-5 electroactive composite aptamer (SEQ ID NO: 581). The peak intensity was considered as the signal of the electroactive aptasensor, and Table 3 below shows the signals of 11 electroactive aptasensors based on the 11 electroactive composite aptamers tested above in the absence or presence of their target molecule used at a fixed concentration of 10 nM.

[0514] [T ableaux3 ] Composite aptamer (SEQ ID NO) Initial signal (pA) Signal measured after incubation with the target at 10 nM (pA) % decrease Anti-TET (640) 45.2 + 1.1 40.1 + 1.0 11.28 Anti-MET-1 (571) 55.4 + 4.2 46.3 + 3.8 16.42 Anti-MET-2 (572) 10.2 + 0.1 9.8 + 0.1 03.92 Anti-SAX (576) 23.5 + 0.6 20.3 + 0.3 13.62 Anti-EST (573) 37.3 + 2.2 32.2 + 2.5 13.67 Anti-BPA (574) 32.3 + 1.5 29.3 + 4.5 09.29 Anti-TPN-1 (577) 36.4+1.7 33.9 + 1.5 06.86 Anti-TPN-2 (578) 35.5 + 2.3 32.1 + 1.9 09.57 Anti-TPN-3 (579) 31.0 + 2.1 21.6 + 1.6 30.32 Anti-TPN-4 (580) 34.5 + 1.9 31.6 + 1.8 08.41 Anti-TPN-5 (581) 57.3 + 4.8 34.4 + 4.1 39.96

[0515] Table 3. Electrochemical activity measurements of the designed electroactive composite aptamers

[0516] TET: Tetracycline; MET: Metronidazole; SAX: Saxitoxin; EST: Estradiol; BPA: Bisphenol A and TPN: Troponin.

[0517] In the presence of the target molecules of the electroactive composite aptamers, the 11 electroactive apta-sensors tested showed a decrease in the signal (Table 3), which indicates the binding of the target molecules by their respective electroactive composite aptamers. These electroactive composite aptamers are therefore functional and can be used to detect their target molecules in a test sample.

[0518] Furthermore, the tests carried out with the electroactive anti-TPN-5 composite aptamer (SEQ ID NO: 581) using and in the presence of troponin at concentrations ranging from 0.5 nM to 10 nM made it possible to establish a calibration curve ([Fig.5]). It is therefore possible to use the invention to quantify the concentration of at least one molecule of interest in a sample to be tested.

Claims

1. Claims Use of an electroactive nucleotide sequence for the manufacture of an electroactive composite aptamer capable of specifically targeting at least one molecule of interest, in which said electroactive nucleotide sequence: • has a secondary structure comprising a central electroactive ring (1) and five stem-loops (2), the electroactivity of the central electroactive ring (1) being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and • is chosen from the sequences SEQ ID NOs: 582 and 606, and their respective mirror sequence SEQ ID NOs: 609 and 633, said sequence SEQ ID NO: 582 being represented by the sequence: HDWWSaN1O-iooSbHWWScN1o-iooSdWDSeN1o-iooSfWWSgNlo_1ooShWHWD SiNio-iooSj and its mirror sequence SEQ ID NO: 609 being represented by the sequence: SjN.ouooSiDWHWShN.ouœSgWWSfN.ouooSeDWSdN^ooScWW^^ SaWWDH, in which: • H represents nucleotides A or C or T; • D represents the nucleotides A or G or T; • W represents nucleotides A or T; • S represents the nucleotides C or G; • N represents the nucleotides A or C or G or T; and • the patterns SaNio-iooSb, ScNio-iooSd, SeNio-iooSf, SgNio-iooSh, S;N lo iooSj, SjNio-iooSi, ShNio-iooSg, SfNio-iooSe, SdNio-iooSc and SbNio-iooS a represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Sa = C then Sb = G; • Sa = G then Sb = C; • Sc = C then Sd = G; • Sc = G then Sd = C; • Se = C then Sf = G; Se = G then Sf = C; Sg = C then Sh = G; Sg = G then Sh = C; If = C then Sj = G ; and If = G then Sj = C, and said sequence SEQ ID NO: 606 being represented by the sequence: CGTAWaNio-iooWbCTAWcNio-iooWdAGWeNio-iooWfTTWgNio-iooWhACT GWNioiooW, and its mirror sequence SEQ ID NO: 633 being represented by the sequence: WjNio-iooWiGTCAWhNio-iooWgTTWfNio-iooWeGAWdNio-iooWcATCWbNio. iooWaATGC in which: • W represents nucleotides A or T; • N represents the nucleotides A or C or G or T; and the motifs WaNm mWb, WCNIO iœWd, WeNm100Wf, WgNlo_1OoWh, W,Nm iooWP W,NIO iooWi, WhNlo_1OoWg, WrNio1OoWe, WdNl0100 Wc and WbNio iooWa represent a stem-loop motif comprising from 10 to 100 nucleotides N where when: • Wa = A then Wb = T; • Wa = T then Wb = A; • Wc = A then Wd = T; • Wc = T then Wd = A; • We = A then Wf = T; • We = T then Wf = A; • Wg = A then Wh = T; • Wg = T then Wh = A; • W; = A then Wj = T ; and • W; = T then Wj = A, and wherein said electroactive composite aptamer: • comprises said electroactive nucleotide sequence into which at least one fragment of at least one donor aptamer has been introduced by addition or substitution, the secondary structure of said at least one fragment comprising a stem-

2. loop (3) capable of specifically fixing a molecule of interest, the fixing of said molecule of interest on said at least one fragment being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and • has a secondary structure comprising a central electroactive ring (1') and at least five stem-loops (2', 3'), the electroactivity of the electroactive central ring (1') of said electroactive composite aptamer being preserved with respect to that of the electroactive central ring (1) of said electroactive nucleotide sequence, said electroactivity being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and the capacity to specifically fix said molecule of interest to said at least one fragment of said electroactive composite aptamer being preserved compared to that of said at least one fragment of at least one donor aptamer, said fixing being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry. Electroactive composite aptamer capable of specifically binding at least one molecule of interest, said electroactive composite aptamer having a secondary structure comprising an electroactive central ring (1') and at least five stem-loops (2', 3'), and comprising two elements: • an electroactive nucleotide sequence chosen from the sequences SEQ ID NOs: 582 and 606 as defined according to claim 1, and their respective mirror sequence SEQ ID NOs: 609 and 633 as defined according to claim 1, said electroactive nucleotide sequence having a secondary structure comprising an electroactive central ring (1) and five stem-loops (2), the electroactivity of the electroactive central ring (1) being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry; and • at least one fragment of at least one donor aptamer, the secondary structure of said at least one fragment comprising a stem-loop (3) capable of specifically binding a molecule of interest, said at least one fragment having been introduced by addition or substitution into said electroactive nucleotide sequence, and in which the electroactivity of the central electroactive ring (1') of said electroactive composite aptamer is preserved relative to that of the central electroactive ring (1) of said electroactive nucleotide sequence, said electroactivity being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry, and the capacity to specifically bind said molecule of interest of said at least one fragment of said electroactive composite aptamer being preserved relative to that of said at least one fragment of at least one donor aptamer,said fixation can be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry.,

3. Method for manufacturing an electroactive composite aptamer capable of specifically binding at least one molecule of interest according to claim 2, said method comprising at least one step of chemical synthesis of said electroactive composite aptamer, in particular said chemical synthesis further comprising a step of incorporation of a modification by an amine (-NH2) or thiol (-SH) group on one of the 5' or 3' ends of said electroactive composite aptamer.

4. Use of an electroactive composite aptamer according to claim 2 for the detection of at least one molecule of interest, in particular at least one molecule of interest chosen from: an antibiotic, a biomarker, a hormone, a drug, an anthropogenic pollutant, a protein and a toxin.

5. Use of an electroactive composite aptamer according to claim 2 for the manufacture of an electroactive aptasensor capable of specifically detecting at least one molecule of interest, said electroactive aptasensor comprising an electroactive composite aptamer according to claim 2 immobilized: • on a magnetic ball; or • on the surface of an electrode, in particular a carbon electrode or a gold electrode.

6. Electroactive aptasensor capable of specifically detecting at least one molecule of interest, said electroactive aptasensor comprising an electroactive composite aptamer according to claim 2 immobilized: • on a magnetic bead; or • on the surface of an electrode, in particular a carbon electrode or a gold electrode.

7. Method for manufacturing an electroactive aptasensor according to claim 6 capable of specifically detecting at least one molecule of interest, said method comprising at least one step of immobilizing an electroactive composite aptamer according to claim 2 on: • a magnetic bead; or • the surface of an electrode, in particular a carbon electrode or a gold electrode.

8. Use of an electroactive aptasensor according to claim 6 for detecting at least one molecule of interest, in particular at least one molecule of interest chosen from: an antibiotic, a biomarker, a hormone, a drug, an anthropogenic pollutant, a protein and a toxin.

9. Method for detecting at least one molecule of interest, said method comprising at least the implementation of the electroactive composite aptamer according to claim 2 or the electroactive aptasensor according to claim 6, in particular said at least one molecule of interest being chosen from: an antibiotic, a biomarker, a hormone, a drug, an anthropogenic pollutant, a protein and a toxin.

10. Library of electroactive nucleotide sequences, said library comprising the sequences SEQ ID NOs: 582 and 606 as defined according to claim 1, and their respective mirror sequence SEQ ID NOs: 609 and 633 as defined according to claim 1, which sequences and mirror sequences have a secondary structure comprising a central electroactive ring (1) and five stem-loops (2), the electroactivity of the central electroactive ring (1) being able to be determined by means of electrochemical measurement methods such as cyclic voltammetry or differential pulse voltammetry.

Images