Nanoparticle

Abstract

A lipid nanoparticle (liposome) comprising: (i) an outer shell comprising a lipid formulation; and (ii) one or more therapeutic agents which prevent apoptosis of a target cell is provided. The therape

Description

FIELD The present invention relates to a nanoparticle, and in particular to a nanoparticle for use in treating or preventing infection in a subject who has suffered a stroke. BACKGROUND Stroke is a leading cause of death and disability worldwide and carries a substantial socioeconomic burden. Stroke patients' recovery is often compromised by secondary complications such as stroke-associated infection (SAI) which affects one-third of stroke survivors and correlates with a worse outcome, including increased risk of recurrent stroke and death. Post-stroke pneumonia, which occurs in the first few days after a stroke, is one such infection which is of great clinical relevance and has significant impact on poor outcomes. There is growing evidence that SAI is in part a result of impairment in the immune response that is induced by the stroke. The spleen is an important immune organ that is significantly affected after a stroke, with general shrinkage and loss in cellularity being reported in experimental animal models and humans. Currently, there is no selective targeting intervention that can prevent the loss of B cells and ameliorate the risk of SAI. Moreover, the results of preclinical and clinical studies indicate that conventional non-selective treatments are inefficient. There is therefore a need for improved compositions and approaches to treat or prevent SAI. SUMMARY In a first aspect, the invention provides a lipid nanoparticle comprising: (i) An outer shell comprising or consisting of a lipid formulation; and (ii) one or more therapeutic agent which prevents apoptosis of a target cell. The one or more therapeutic may be incorporated into the outer shell or may be encapsulated therein. The one or more therapeutic agent may comprise or consist of one or more caspase inhibitor. The caspase inhibitor may be a pan-caspase inhibitor, such as Emricasan (CAS 254750-02-2). Emricasan The caspase inhibitor may inhibit one or more of caspase 1, caspase 2, caspase 3, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10 and caspase 12. The one or more therapeutic agent may comprise or consist of one or more oligonucleotide, such as a siRNA. The siRNA may prevent or reduce the expression of a protein which induces or enhances apoptosis of a cell. The protein which induces or enhances apoptosis of a cell may be NR3C1 or ADRB2. The lipid nanoparticle may comprise one or more siRNA which prevents or reduces the expression of NR3C1 and one or more siRNA which prevents or reduces the expression of ADRB2. The reduction or prevention of expression of NR3C1 and / or ADRB2 may be at least a 30% or more, 50% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more reduction in the observed mRNA or protein production compared to an equivalent cell or sample which has not received the siRNA. The skilled person will know of many techniques to measure the reduction or prevention of expression of protein or mRNA, such as western blotting and qRT-PCR. A siRNA which prevents or reduces the expression of NR3C1 may comprise or consist of the sequence of AAGGAAGGTCTGAAGAGCCAA (SEQ ID NO: 1), CAGTGGTGCGATAGCAACAAA (SEQ ID NO: 2), AAGCGTGATGGACTTGTATAA (SEQ ID NO: 3), CAGACTCAGCATGGAGAATTA (SEQ ID NO: 4), AAGTGCAAACCTGCTGTGTTT (SEQ ID NO: 5), AAGCTTTCCTGGAGCAAATAT (SEQ ID NO: 6), CGGTGGCAATGTGAAATTGTA (SEQ ID NO: 7), or AAGGACGGTCTGAAGAGCCAA (SEQ ID NO: 8), or a sequence with 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more identity thereto. A siRNA which prevents or reduces the expression of ADRB2 may comprise or consist of the sequence of CACAAAGCCCTCAAGACTTTA (SEQ ID NO: 9), AAGGAAGATTCCACGCCCAAA (SEQ ID NO: 10), AACTTGAGTGTAATAACTTTA (SEQ ID NO: 11), TACCTCACTGGTCAAGTATTA (SEQ ID NO: 12), CCAGGATAACCTCATCCGTAA (SEQ ID NO: 13), CACAAGGGAGGAATTGTAGTA (SEQ ID NO: 14), GAGGGTAATAAACTTAGAATA (SEQ ID NO: 15), or AGGGTAATAAACTTAGAATAA (SEQ ID NO: 16), or a sequence with 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more identity thereto. Advantageously, the lipid nanoparticles of the invention are nontoxic, biocompatible, and demonstrate selective in vivo targeting to the spleen of a subject post-stroke. Such spatial and temporal targeting leads to localised and efficient therapeutic agent release, resulting in reduced susceptibility to infection post-stroke and therefore improved mortality. In an embodiment, the lipid formulation of the outer shell of the nanoparticle may comprise hydrogenated soy phosphatidylcholine (HSPC), cholesterol (Choi) and 2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DSPE-PEG2Ooo). The lipid formulation may further comprise l,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaaceticacid (PE-DTPA). The lipid formulation may comprise 40-70 mol / mol% HSPC, or 50-60 mol / mol% HSPC, such as about 55 mol / mol% HSPC, such as about 56 mol / mol% HSPC, or about 56.3 mol / mol% HSPC. The lipid formulation may comprise about 20-60 mol / mol% Choi, or 30-40 mol / mol% Choi, such as about 35 mol / mol% Choi, such as about 38 mol / mol% Choi, or about 38.2 mol / mol% Choi. The lipid formulation may comprise about 1-7 mol / mol% DSPE-PEG2000, or 2-5.5 mol / mol% DSPE-PEG2000, or about 3 mol / mol% DSPE-PEG2ooo, or about 4 mol / mol% DSPE-PEG2ooo. The lipid formulation may comprise or consist of about 56.3 mol / mol% HSPC, about 38.2 mol / mol% Choi and about 5.5 mol / mol% DSPE-PEG2ooo. This particular nanoparticle may further comprise about 90 pg / ml of Emricasan. The lipid formulation may be labelled, for example with l,l'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate (Dil) or radioactive indium (H1In). The lipid nanoparticle may comprise about 1-1000 pg / ml of the therapeutic, about 5-500 pg / ml of the therapeutic, about 10-200 pg / ml of the therapeutic, about 50-5 100 pg / ml of the therapeutic, or about 90 pg / ml of the therapeutic. The nanoparticle may have a lipid formulation of Table 1. Table 1: Lipid Nanoparticle Formulations for caspase therapeutics Liposomal formulations Lipids Molar Ratio (mol / mol%) Size (nm) Zeta (mV) PDI Dye / Drug level Dil-labelled- Lp HSPC: Choi: DSPE- PEG2000- Dil 53.62:36.38:5.24:4.76 104.9 ± 3.4 -13.4 ± 0.95 0.24 ± 0.007 5 mol 0 / / 0 11lln- labelled-Lp HSPC: Choi: DSPEPEG- 2000:PE- DTPA 55.74:37.82:5.45:0.99 133± 1.63 -38.6 ± 1.1 0.05 ± 0.01 42.5 MBq / ml Lp-CI HSPC: Choi: DSPE- PEG2000 56.3:38.2:5.5 125.8 ± 2.1 -33.4 ± 10 0.06 ± 0.03 90 Pg / ml In another embodiment, the lipid formulation of the outer shell of the nanoparticle may 10 comprise 1,2-distearoyl sn-glycero-3-phosphocholine (DSPC) and Choi. The lipid formulation may further comprise CM-102 (heptadecan-9-yl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl] amino (octanoate). The lipid formulation may further comprise a l,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol) ammonium salt, such as 15 CI4PE-PEG2000 (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N- [methoxy(polyethylene glycol)-2000] ammonium salt). The lipid formulation may further comprise DLin-MC3-DMA (4-(dimethylamino)-butanoic acid, (10Z, 13Z)-1 -(9Z, 12Z)-9,12-octadecadien-1 -yl-10,13-nonadecadien-l-yl ester). The lipid formulation may further comprise a l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol, such as DMG-PEG2000 (l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000). The lipid formulation may further comprise 18:1PA (DOPA, or l,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphate sodium salt). The lipid formulation may comprise about 0.1-20 mol / mol% DSPC, such as about 2-15 mol / mol% DSPC, or about 3-12 mol / mol% DSPC, or about 5-10 mol / mol% DSPC. The lipid formulation may comprise about 20-60 mol / mol% DLin-MC3-DMA, such as about 30-40 mol / mol% DLin-MC3-DMA, or about 35 mol / mol% DLin-MC3-DMA. The lipid formulation may comprise about 10-50 mol / mol% DOPA, such as about 20-40 mol / mol% DOPA, about 25-35 mol / mol% DOPA, or about 30% mol / mol% DOPA. The lipid formulation may comprise about 0.1-5 mol / mol% DMG-PEG2000, or 0.2-3 mol / mol% DMG-PEG2000, or about 1 mol / mol% DMG-PEG2000. The lipid formulation may comprise about 30-70 mol / mol% CM-102, or 40-60 mol / mol% CM-102, or about 50 mol / mol% CM-102. The lipid formulation may comprise about 0.2-10 mol / mol% C14PE- PEG2000, or 0.5-5 mol / mol% C14PE- PEG2000, or about 2.5 mol / mol% C14PE- PEG2000. The lipid formulation may comprise about 50 mol / mol% CM-102, about 10 mol / mol% DSPC, about 38 mol / mol% Choi and about 2 mol / mol% C14PE- PEG2000. This particular lipid nanoparticle may further comprise about 24 pg / ml of one or more ADRB2 or NR3C1 siRNA, such as one or more ADRB2 or siRNA of any of SEQ ID Nos: 1-8 or one or more NR3C1 siRNA of any of SEQ ID Nos: 9-16. The lipid formulation may comprise about 49.5 mol / mol% CM-102, about 9.9 mol / mol% DSPC, about 38.12 mol / mol% Choi and about 2.47 mol / mol% C14PE-PEG2000. This particular lipid nanoparticle may further comprise about 23.5 pg / ml of one or more ADRB2 or NR3C1 siRNA, such as one or more ADRB2 or siRNA of any of SEQ ID Nos: 1-8 or one or more NR3C1 siRNA of any of SEQ ID Nos: 9-16. The lipid formulation may comprise about 35 mol / mol% DLin-MC3-DMA, about 7 mol / mol% DSPC, about 27 mol / mol% Choi, 30 mol / mol% DOPA and about 1 mol / mol% DMG- PEG2000. This particular lipid nanoparticle may further comprise about 20 pg / ml of one or more ADRB2 and NR3C1 siRNA, such as one or more ADRB2 or siRNA of any of SEQ ID Nos: 1-8 and a NR3C1 siRNA of any of SEQ ID Nos: 9-16. The lipid nanoparticle may comprise equal or non-equal amounts of each siRNA such that about 20 pg / ml of siRNA is present in the nanoparticle. The lipid formulation may comprise about 34.96 mol / mol% DLin, about -MC3-DMA, about 6.99 mol / mol% DSPC, about 26.97 mol / mol% Choi, 29.97 mol / mol% 5 DOPA and about 1.09 mol / mol% DMG- PEG2000. This particular lipid nanoparticle may further comprise about 20 pg / ml of one or more ADRB2 and NR3C1 siRNA, such as one or more ADRB2 or siRNA of any of SEQ ID Nos: 1-8 and a NR3C1 siRNA of any of SEQ ID Nos: 9-16. The lipid nanoparticle may comprise about 1-1000 pg / ml of the therapeutic, 10 about 2-500 pg / ml of the therapeutic, about 5-200 pg / ml of the therapeutic, about 10-100 pg / ml of the therapeutic, or about 20-25 pg / ml of the therapeutic. The nanoparticle may have a lipid formulation of Table 2. Table 2: Lipid Nanoparticle Formulations for siRNA therapeutics Liposomal formulatio ns Lipids Molar Ratio (mol / mol%) Size (nm) Zeta (mV) PDI Dye / Dru g level LNP-488 DLin-MC3-DMA: 34.96: 6.99: 0.08 29.3 siRNA DSPC: Choi: 26.97: 29.97: ± 8 DOPA: DMG- 1.09 81.78 -5.4 ± 0.02 Mg / PEG2000 ± 0.06 0.68 9 ml or CM-102: DSPC: 49.5: 9.9: 104.4 -6.09 ± 0.36 34.7 Choi: C14PE- 38.12: 2.47 ± 0.28 0.8 ± Mg / PEG2000 0.01 ml 3 LNP- CM-102: DSPC: 49.5: 9.9: 72.34 2.78 ± 0.40 23.5 Adrb2siRN Choi: C14PE- 38.12: 2.47 ± 1.95 .22 ± pg / A PEG2000 0.06 ml LNP- CM-102: DSPC: 79.48 5.21 ± 0.26 23.8 Nr3clsiRN Choi: C14PE- 49.5: 9.9: ± 0.38 0.41 ±0.0 Pg / A PEG2000 38.12: 2.47 3 ml LNP- Adrb2 & Nr3cl siRNA combinatio n DLin-MC3-DMA: DSPC: Choi: DOPA: DMG- PEG2000 34.96: 6.99: 26.97: 29.97: 1.09 97.59 ± 1.59 0.56 ± 0.04 0.25 ± 0.01 20.0 Pg / ml The nanoparticle may be less than about 500nm in diameter. The nanoparticle may be between about 50nm and 150nm in diameter. The nanoparticle may be between about 70nm and 135nm in diameter. Preferably, the diameter of the nanoparticle is above the glomerular filtration limit. The average diameter may be measured using dynamic light scattering (DLS). The diameter may be a Z-average of intensity of light scattering. The nanoparticle may have a neutral or slightly negative charge. The nanoparticle may have a surface charge of between about -40mV and 7mV. This facilitates splenic targeting in a subject, the skilled person will understand that the charge can be controlled by the choice of the lipids and their molar percentages. For example, lipid nanoparticles that have positively charged lipid components such as SM-102 or MC3 have a neutral charge. Other types of lipid nanoparticles without positively charged lipids are slightly negatively charged. HSPC, DSPC, Cholesterol and DOPA may provide a neutral or slightly negative charge. DSPE-PEG2000 and DMG-PEG2000 may be used to cover the surface of lipid nanoparticle and reduce the overall positive or negative charge. Having neutral or slightly negative charge alters the type of proteins adsorbed onto the surface of the lipid nanoparticles. This is also termed the “protein corona”, and permits splenic accumulation compared to liver or lung. See Cheng et al., Nat. Nanotech, 202, 15(4):313-320. The nanoparticle polydispersity index of between about 0.02 and 0.5. The nanoparticle may have an average diameter of -120 nm with a polydispersity index (PDI) of 0.1 and surface charge -19.7± 6.14 mV. The average diameter may be measured using dynamic light scattering (DLS). PDI as used herein may refer to Mw / Mn where Mw and Mn are the weight average and number average molecular weight, respectively. The nanoparticle may be covered with a hydrophilic surface. This minimises nonspecific protein interaction and reduces recognition by immune cells to maximise circulation half-life. Coating lipid nanoparticles with hydrophilic polymers such as DPSE-PEG2000 reduces the interactions with blood stream components and protein adsorption on the surface of the nanoparticles, minimising opsonization and phagocytosis by mononuclear phagocytic cells. The lipid nanoparticle may further comprise a moiety which enhances targeting of the nanoparticle to the spleen of a subject when administered. The lipid nanoparticles may further comprise a targeting moiety that specifically bind to antigens in the spleen. One such example is an anti-CDld targeting moiety, such as an anti Cd Id antibody or antigen binding fragment thereof. The lipid nanoparticle may be for use in modulating splenic immune responses in a subject. The lipid nanoparticle may be for use in modulating immune responses originating from the marginal zone of the spleen. The lipid nanoparticle may be for use in modulating B-cell activity in the marginal zone of the spleen. In another aspect, there is provided a composition comprising lipid nanoparticles of the invention, optionally together with one or more pharmaceutically acceptable excipients or diluents. The lipid nanoparticles of the invention beneficially prevent apoptosis of important immune cells in the spleen after a stroke, such as marginal zone B cells, the population of which rapidly decline after a stroke, leading to susceptibility of infection. Such activity therefore reduces the risk of stroke associated infection and provides a more positive clinical outcome, such as lower mortality. This effect is amplified by the unexpected localisation of the lipid nanoparticles to the spleen after a stroke, providing a cell-specific, organ-targeted therapy in as essential timeframe for the subejct after suffering a stroke. Therefore, in another aspect, there is provided a lipid nanoparticle or composition of the invention for use in medicine. The lipid nanoparticle or composition of the invention may be for use in treating or preventing a disease or disorder associated with spleen abnormality. Spleen abnormality may relate to changes in the immune activity of cells in the spleen compared to a healthy subject. In another aspect, the invention provides the manufacture of a medicament for treatment or prevention of a disease or disorder associated with spleen abnormality in a subject. In another aspect, there is provided a method of treating or preventing a disease or disorder associated with spleen abnormality in a subject, comprising administering a lipid nanoparticle or composition of the invention to the subject. The disease or disorder associated with spleen abnormality may be an infection. Therefore, the lipid nanoparticle or composition of the invention may be for use in treating or preventing an infection in a subject. The infection may be a post-brain injury infection, such as a stroke-associated infection. The stroke-associated infection may be caused by one or more of Streptococcus pneumoniae. Staphylococcus aureus, Group A Streptococcus, Klebsiella pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Mycoplasma, pneumoniae, and SARS-CoV-2. The disease or disorder associated spleen abnormality may be myocardial infarction, spinal cord injury, sepsis, or traumatic brain injury. In these conditions, the splenic activation is mediated by sympathetic stimulation and the release of noradrenaline that activate the P-ARs present on splenic lymphocytes and macrophages. This leads to the release of inflammatory cells such as monocytes and macrophages, and inflammatory cytokines such as TNF-a, IL-2, IL-6, and IFN-y, into the peripheral blood. These eventually reach the injury site and can further exacerbate the primary injury. Further, significant apoptosis of splenic lymphocytes (B-cells, CD4+T-cells) and follicular dendritic cells is seen in these conditions, which increases the subject’s susceptibility to infections. The subject may be a mammal, such as a human. The subject may be a non-human animal, such as a domestic animal or livestock. In one embodiment, the use of the invention may be veterinary. The lipid nanoparticle may administered to the subject between about 0.5 to 48 hours, about 1 to 24 hours, about 24 to 48 hours after the subject has suffered a stroke. The lipid nanoparticle may be administered to the subject at multiple intervals, for example every 0.5 hours, 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, 24 hours or 48 hours after subject has suffered a stroke. The skilled person will know that a medical professional such as a paramedic or physician can use a number of methods to determine whether and when a subject has suffered a stroke. The lipid nanoparticle may be administered to a subject at a dose of about 0.1-lO.Omg / kg, about 0.2-5.0mg / kg, about 0.3-2.0mg / kg, about 0.4-1,5mg / kg, about 0.5-1.2mg / kg, or about 0.9mg / kg. A pharmaceutical composition of the invention may be administered via any parenteral or non-parenteral (enteral) route that is therapeutically effective. Parenteral application methods include, for example, intracutaneous, subcutaneous, intramuscular, intratracheal, intranasal, intravitreal, intraperitoneal or intravenous injection and infusion techniques, e.g. in the form of injection solutions, infusion solutions or mixtures, as well as aerosol installation and inhalation, e.g. in the form of aerosol mixtures, sprays or powders. Preferably, the composition of the invention is administered intravenously or intraperitoneally. A pharmaceutical composition of the invention can be administered systemically or topically in formulations containing conventional non-toxic pharmaceutically acceptable excipients or carriers, additives and vehicles as desired. A combination of intravenous and subcutaneous infusion and / or injection might be most convenient in case of compounds with a relatively short or long serum half-life or needing rapid onset of action. Preferably, the pharmaceutical composition is administered subcutaneously or intravenously. The pharmaceutical composition may be an aqueous solution, an oil-in water emulsion or a water-in-oil emulsion. For intravenous injection, or other site of administration, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using for example, isotonic vehicles such as Sodium Chloride Injection, Ringer’s Injection, Lactated Ringer’s Injection. Preservatives, stabilisers, buffers, antioxidants and / or other additives may be included, as required. The compositions are preferably administered to an individual in a “therapeutically effective amount", this being sufficient to show benefit to the individual. The optimal dosage will depend on the biodistribution of the antibody or antigen binding fragment thereof, the mode of administration, the severity of the disease / disorder being treated as well as the medical condition of the patient. If desired, the antibody or antigen binding fragment thereof may be given in a sustained release formulation, for example liposomal dispersions or hydrogel-based polymer microspheres, like PolyActiveTM or OctoDEXTM (cf. Bos et al., Business Briefing: Pharmatech 2003: 1-6). Other sustained release formulations available are for example PLGA based polymers (PR pharmaceuticals), PLA-PEG based hydrogels (Medincell) and PEA based polymers (Medivas). Prescription of treatment, e.g., decisions on dosage etc, is within the responsibility of a medical practitioner, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. The pharmaceutical composition may also contain additives, such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect. The latter is that fusion proteins may be incorporated into slow or sustained release or targeted delivery systems, such as liposomes and microcapsules. The determination of percent identity between two sequences can be accomplished using a mathematical algorithm known to those of skill in the art. An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul, 1990, PNAS, 87(6):2264-8, modified as in Karlin and Altschul, 1993, PNAS, 90(12):5873-5877 The NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol., 215:403-10 have incorporated such an algorithm. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997). Alternatively, PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules (Id.). When utilizing BLAST, GappedBLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http: / / www.ncbi.nlm.nih.gov. Another example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller. The ALIGN program (version 2.0) which is part of the GCG sequence alignment software package has incorporated such an algorithm. Other algorithms for sequence analysis known in the art include ADVANCE and ADAM as described in Torellis and Robotti (1994); and FASTA described in Pearson and Lipman (1988). Within FASTA, ktup is a control option that sets the sensitivity and speed of the search. Features which are described in the context of separate aspects and embodiments of the invention may be used together and / or be interchangeable wherever possible. Similarly, where features are described in the context of a single embodiment for brevity, those features may also be provided separately or in any suitable sub-combination. Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows that lipid nanoparticles selectively target the spleen after stroke: A) "’in-DTPA-liposomes injected I.V at different time points after induction of MCAo model in C57 mice and the biodistribution profile was monitored in real-time over the first hour after I.V and again 1 day after injection using whole-body SPECT / CT live imaging. B) Quantification of In-DTPA-Lp specific uptake in the spleen and other tissues 24h after I.V administration using gamma scintigraphy and compared to healthy mice and MCAo mice injected with free H1In-DTPA. C) The window of selective LNP accumulation in the spleen that was used for therapy studies (4h and 24h) is outside the biphasic liposomal infiltration into the brain was reported before which showed significant entry into tire brain only when administered at 0.5h and 48h after stroke. D) Co-localisation of Dil-LNP with MZ B cells (CDId + ve cells indicated by white arrows) was confirmed by immunohistochemistry (IHC). E) 2h following I.V administration of Dil-Liposomes I. the spleen was harvested and FACS analysis was performed to quantify the uptake of Dil-LP with B cells (CD 19+), T cells (CD3+) and marginal zone metallophilic macrophages (MZMM) identified as CD 169+, MARC0+ marginal zone macrophages (MZM), monocytes-derived macrophages (MM) identified as F4 / 80+ CDllb+, red pulp macrophages (RM) identified as F4 / 80hi CD I lb-, CD1 lc+ dendritic cells (DC) and CD49b hi / + Natural killer cells (NK). A significant increase in liposomal uptake was observed in B cells, T cells and MZM, DC and NK cells as early as 2h after I.V injection. Data expressed as average % ± SEM. Data analysed with one-way ANOVA followed by Tukey's multiple comparison test or unpaired t-test, * P<0.05, ** PC0.01, *** P< 0.001 and **** P< 0.0001. Figure 2 shows that lipid nanoparticles selectively target the spleen after stroke: A&B) Evaluation of biodistribution profile of 18:PA (a.k.a. DOPA) LNP encapsulating AF488siRNA was performed by IVIS optical imaging 24h after I.V injection to healthy mice and mice with MCAo. IVIS optical imaging of LNP-AF488siRNA confirmed significant selective accumulation in the spleen with no infiltration in the other organs. C) Splenic accumulation of LNP-AF488siRNA into the spleen was further confirmed by histology. Data expressed as average % ± SEM. Data was analysed with one-way ANOVA followed by Tukey's multiple comparison test, * P<0.05. Figure 3 shows selective accumulation of LNP in the spleen is due to extracellular matrix remodelling: A) Visualization of structural changes in the spleen post-stroke compared to healthy mice. IHC staining of Collagen-I (Coll-I) and Collagen-Ill (Coll-Ill) was performed to observe the effect of ischemic stroke on ECM of the spleen compared to healthy mice. M0MA1, Blue marker was used to distinguish white pulp (WP) and red pulp (RP) zone of the spleen. Quantification of B) % of Collagen-I and C) Collagen-III +ve areas in the WP of naive, healthy and MCAo spleen was performed. All images were taken at 20x and quantification was done by using ImageJ. It was shown that the significant increase in LNP uptake by lymphocytes and MZ cells after MCAo is associated with extensive extracellular matrix and reticular fibre network remodelling in the spleen, particularly collagen I and collagen III. Statistical analysis was carried out by One-way ANOVA followed by Turkey’s multiple comparison’s test. Data was expressed in terms of an average % ±SEM. Scale bars of A) is 100pm. n=3-5. Figure 4 demonstrates showing CI and Lp-CI can reverse the loss of splenic immune cells ex-vivo after stimulation with NE (norepinephrine): A&B) The effect of pan-CI on preventing the apoptotic loss of splenocytes after stimulation with 500pM apoptotic inducer (NE) in the presence and absence of CI (50pM as a free drug) for 4h. The effect of treatment was monitored with flow cytometry analysis which showed % of splenic B-cells in untreated, NE and NE+CI treated groups. Overall it was observed that CI significantly reversed apoptotic cell death of splenic B cells after stimulation with NE ex-vivo. C) Evaluation of the therapeutic efficacy of Lp-CI in-vitro using terminally differentiated B-cells. Cells were cultured in 96 well-plate and treated with either 500nM bortezomib (to induce apoptosis) in combination with CI (50pM) as a free drug and in liposomes (Lp-CI). Control groups of untreated cells and cells treated with 10% DMSO were included. Cells with bortezomib plus empty liposomes were also added to confirm the effect of Lp-CI. Cell viabilities were then assessed 24h after treatment using AlamrBlue and the plate was read at 570nm and 600nm by using a Tecan spectrophotometer. LNP-CI significantly reversed the apoptotic loss of terminally differentiated B cells after inducing apoptosis with bortezomib (Bortz) in vitro. Statistical analysis was carried out by One-way ANOVA followed by Turkey’s multiple comparison test. Data was expressed in terms of an average % ±SEM. The samples were run in triplicates. Figure 5 shows that LNP-Adrb2siRNA and LNP-Nr3clsiRNA combined in two separate LNPs or in the same formulation can reverse the apoptotic loss of splenic immune cells after stimulation with Dex and NE ex-vivo: Evaluating the effect of LNP-Adrb2siRNA and LNP-Nr3cl siRNA on preventing the apoptotic loss of splenocytes after stimulation with Dex and NE ex-vivo for 24h. Control groups of untreated cells and cells treated with 10% DMSO were included. The effect of treatment was monitored using AlamrBlue and the plate was read at 570nm and 600nm by using a Tecan spectrophotometer. Treatment with LNP-Adrb2siRNA and LNP-Nr3clsiRNA combined as separate formulations or in the same LNP significantly restores splenocyte cell viability after stimulation with Dex and NE ex-vivo. Statistical analysis was carried out by One-way ANOVA followed by Turkey’s multiple comparison test. Data was expressed in terms of an average % ±SEM. The samples were run in triplicates. Figure 6 shows that in vivo treatment with Lp-CI reversed splenic shrinkage, splenic lymphocytes loss, IgM level and as a result reduced associated lung infection. A) Schematic representation of intervention study in mice to assess the therapeutic effect of LNP-CI using middle cerebral artery occlusion model (MCAo) of stroke showing study design and assessment criteria. LNP-CI treatment was initiated 4h and 24h after MCAo and compared to vehicle and free CI treatment groups (n=9-12). The therapeutic effect was assessed by measuring B) spleen size, C) splenocytes count and D-H) various lymphocyte loss including total B cells, follicular B cell, NK cell and T cell and MZ B cell using FACS. Overall, a reversal in lymphocyte loss was observed following LNP-CI treatment compared to the free drug. I&J) Measurement of plasma IgM level with ELISA showed an increase in IgM plasma level in LNP-CI treated group compared to vehicle and free CI (p-value = 0.053). This was further confirmed with immunohistochemistry staining of IgM in the spleen. K) recovery of hematopoietic cells in the spleen was also confirmed with H&E staining of the spleen. L) No significant difference in infarct volume was observed between the groups which was expected due to the limited infiltration of LNP-CI into the brain at the time points administered (4h and 24h post MCAo). M) A reduction in lung infection was observed with LNP-CI. MATERIALS AND METHODS Materials. Hydrogenated soy phosphatidylcholine (HSPC) and 2-distearoyl-5M-glycero-3-phosphoethanolamine-A-[methoxy(polyethylene glycol)-2000] (DSPE-PEG2000) were kind gifts from Lipoid GmbH (Ludwigshafen, Germany).18:0 PE-DTPA 1,2-distearoyl-5«-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (ammonium salt) was purchased from Avanti Polar Lipids (USA). Chloroform and methanol were purchased from Fisher Scientific. Phosphate buffer saline, cholesterol, paraformaldehydes were purchased from Sigma. l,T-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate (Dil) was purchased from Invitrogen Detection Technologies. Polycarbonate extrusion filters (Whatman) 800nm, 200nm, and lOOnm were form VWR, UK. PD-10 desalting columns were bought from GE-Healthcare Life Sciences. Mice and diets C57BL / 6 male mice (11-12-week-old, weighing 25-30 g; Envigo, UK) were housed in groups of 4-5. All mice were given free access to diet and water and were housed at a constant ambient temperature of 21 ± 2°C and humidity of 40-50%, on a 12-h light, 12-h dark cycle. All experimental procedures using animals were carried out according to the United Kingdom Animals (Scientific Procedures) Act, 1986 and approved by the Home Office and the local Animal Ethical Review Group, University of Manchester and reported in compliance with the ARRIVE guidelines. Induction of focal cerebral ischaemia Focal ischaemic stroke was induced by transient middle cerebral artery occlusion (MCAo) as previously described '. Briefly, under 2% isoflurane anaesthesia (in a mixture of 30 % oxygen and 70 % nitrous oxide), the carotid arteries were exposed and a 6-0 silicon rubber-coated monofilament (Doccol, USA) with a 2-mm tip (210pm diameter, coating length 405 mm) was inserted into the left common carotid artery and advanced along the left internal carotid artery 10mm after the left carotid bifurcation. Cerebral blood flow was monitored in all mice by laser-Doppler (Moor Instruments, UK) and MCAo was confirmed by a drop in cerebral blood flow of at least 40-50% of baseline. After 20min occlusion, reperfusion was achieved by withdrawing the filament and the wound was sutured. During surgery, core body temperature was monitored using a rectal probe and maintained at 37 ±0.5°C, using a homoeothermic blanket. Before recovery, all mice were given saline (0.5 ml, S.C) and buprenorphine (0.05mg / kg S.C). After surgery, mice were weighed every day and assessed for their general well-being. Bodyweight data were presented as a % weight change compared with bodyweight on the day of surgery. Assessment of cerebral ischemia was performed using the 28-point neurological scoring system ’. Assessment of ischaemic damage Brain sections were stained with cresyl violet and the infarct volume was calculated by measuring the areas of neuronal loss at eight defined coronal levels as previously described. On each section, the area of damage was measured using ImageJ (NIH, Bethesda, MD, USA), adjusted for oedema and the volume of damage calculated by integration of areas of damage with the distance between coronal levels using GraphPad Prism 7, Software. The volume of damage was expressed as the total amount of ischaemic damage. For the assessment of haemorrhagic transformation, haematoxylin and eosin (H&E) staining was performed. The area of red blood cells was measured in the same way as the infarct volume was calculated and compared between the groups. Preparation of Dil-labelled liposomes (Dil-Lp) Dil-labelled liposomes composed of HSPC:Chol:DSPE-PEG:<. 56.3:38.2:5.5 mol / mol % were prepared by thin-film hydration method followed by extrusion '. Briefly, lipids dissolved in chloroform: methanol mixture (4:1) were mixed in a round bottom flask and 5mol% of Dil in ethanol (Img / ml) was added to the lipid mixture. Organic solvents were then evaporated to produce the lipid film. Lipid films were kept protected from light and hydration was performed with HBS (20mM HEPES, 150mM NaCl, pH 7.4) to a final lipid concentration of 12.5mM. To produce small unilamellar liposomes, the size was reduced by extrusion through 800nm and 200nm polycarbonate filters 5 times each then 20-40 times through lOOnm membranes using a mini-Extruder (Avanti Polar Lipids, Alabaster, AL). Preparation and characterisation of niIn-labelled liposomes (inIn-Lp) To investigate the biodistribution profile of liposomes in stroke mice, real-time SPECT / CT imaging and gamma counting was used. Liposomes were radiolabelled with radioactive indium (inIn) using a procedure that was described previously Briefly, 25mM (total lipid concentration) of HSPC:Chol:DSPE-PEG2ooo: PE-DTPA 56.3:38.2:5.5:1 mol / mol % liposomes were prepared as described above using thin-film hydration method. Hydration of the lipid film was done with freshly prepared ammonium acetate buffer (0.095M, pH 5.5) at 60°C followed by extrusion to reduce the size of the liposomes. Subsequently, liposomes were radiolabelled by Ih incubation with radioactive "'inCL (1 lMBq / 2.5pmol lipids) in 2.0 M ammonium acetate pH 5.5. Incubation carried out at room temperature with continuous vortexing every 5 minutes. At the end of incubation 0.1M, EDTA (1 / 20 of the total volume) was added to chelate any free "in. To determine the radiolabelling efficiency, any unbound 1HIn and '"ln-EDTA were removed with PD-10 column pre-equilibrated with HBS pH 7.4. Aliquots of each final product were diluted five folds in PBS and then 1 pl was spotted on silica gel impregnated glass fibre sheets (PALL Life Sciences, UK). The strips were developed with a mobile phase of 50mM EDTA in 0.1M ammonium acetate and allowed to dry before analysis. This was then developed and the autoradioactivity quantitatively counted using a cyclone phosphor detector (Packard Biosciences, UK). The immobile spot on the TLC strips indicated the percentage of radiolabelled inIn-Lp, while free inIn was detected as the mobile spots near the solvent front. Very minimum free 1HIn was detected to yield radiolabelling efficiency of >85%. The radiolabelling stabilities of the final product of "’In-Lp were studied after five times dilution in both 50% serum or PBS and then incubated at 37°C up to 48h. At different time-points (0, 1 and 24h), Ipl of the aliquots was spotted on silica gel impregnated glass fibre sheets and then developed and quantified as described above. No significant release of InCL, was detected after incubation with PBS and minimum free "’inCh was detected after incubation in 50% for 2 days. Liposomes characterization Liposome size and surface charge were measured using Zetasizer Nano ZS (Malvern, Instruments, UK). Samples were diluted 100 times with purified distilled water before measurements. Triplicates measurements were recorded, and the data expressed as average ± S.D. Fluorescence intensity of Dil-Lp was recorded using Carry Eclipse fluorescence spectrophotometer, (Agilent technology). Samples were first diluted 200 times in HBS and recorded at 518nm / 565nm excitation / emission wavelengths (slit 5 / 10). Single-photon emission computed tomography (SPECT / CT) Mice were subjected to anaesthesia via the inhalation of 2.5% isoflurane in a mixture of 30 % oxygen and 70 % nitrous oxide. Each animal was then intravenously injected with 200ul of the radioactive In-Lp (8-9 MBq). At different time points after injection (t= 0-lh, &24h) SPECT / CT imaging was carried out using a Nano-Scan® SPECT / CT scanner (Mediso, Hungary). SPECT images were obtained in 20 projections over 40-60 min using a 4-head scanner with 1.4 mm pinhole collimators. CT scans were taken at the end of each SPECT acquisition using a semi-circular method with full scan, 480 projections, maximum FOV, 35 kV energy, 300 ms exposure time and 1-4 binning. Acquisitions were done using the Nucline v2.01 (Build 020.0000) software (Mediso, Hungary), while reconstruction of all images and fusion of SPECT with CT images was performed using the Interview™ FUSION bulletin software (Mediso, Hungary). The images were further analysed using VivoQuant 3.0 software (Boston, US) where the SPECT images with scale bars in MBq were corrected for decay and the slight differences in radioactivity in the injected doses between animals. For a quantitative assessment of mln-Lp in the spleen, a cut and count method was used. Mice were anaesthetized by isofluorane inhalation and each mouse was injected via the tail vein with 200pl containing luIn-Lp labelled with approximately 8-9 MBq. 24h after injection, mice were perfused with iced cold saline (0.9%) followed by PFA (4%) to remove any niIn-Lp from the blood before brain tissues were collected. Each sample was weighed and counted on a gamma counter (Perkin Elmer, USA), together with a dilution of the injected dose.The results were represented as the percentage of the injected dose (% ID / gm tissue ± SEM), n=4-5 mice per group. Haematoxylin and Eosin staining of spleen Haematoxylin and Eosin staining was used to examine the histopathology of the spleens from all experimental groups. Slides were scanned using a slide scanner (3D Histec Pannoramic250) and imaged were captured using Pannoramic Viewer. Flow cytometry Mouse spleens tissues were first mechanically dissociated and incubated with red blood cells lysis buffer to produce single-cell suspensions that were used for flow cytometric analysis. Briefly, cell surface staining to allow the detection of distinct splenocytes population was carried out using antibodies against CD45R-BV 510 (clone 30-FI1; Biolegend), F4 / 80-APC (clone BM8; Biolegend), CDllb-BV-785 (clone Ml / 70; Biolegend), Cdllc-AF 700 (clone HL3, BD biosciences), MOMA-1-BV421 (CD169; Siglec-1, clone 7-239, BD Biosciences), MARCO-FITC (clone ED31; ThermoFisher), Cd49-APC (pan NK cells, clone DX5, Biolegend) and CD19-BV786 (clone 1D3, BD Biosciences). Cells were incubated in anti-mouse CD 16 / 32 (clone 93; Affymetrix eBioscience) for 20 min on ice to block Fc receptors then fluorescently conjugated primary antibody cocktails were added and incubated in the dark on ice for 30 min at room temperature. Cells were washed in PBS with 1% FBS and fixed with 2% PFA. Flow cytometry was performed on a Becton Dickinson LSR II and analysed by Flowjo. Live cells were gated based on FSC and SSC and 100,000 cells in this gate collected for each sample. Unlabelled cells and cells labelled with full minus one (FMOs) were used to set the Baseline voltages. Immunohistochemistry Serial frozen sections of the spleen (6 or 20 pm in thickness) were cut on a cryostat, fixed in ice-cold acetone for 10 min, left to dry for 15 minutes then washed in 0.05% BSA for three minutes then blocked using a species-specific serum for 20 minutes (Jackson Immunoresearch Laboratories Inc., USA) appropriate to secondary antibody host species at 1:20. The slides were incubated in the primary antibody for 1 hour in a dark and humidified box. MZMM were detected with mAb CD 169 (Siglecl; clone 3D6.112, 1:200; Biolegend, UK). M3 / 84 (1:200; Biolegend, UK), was used to detect LAMP-2 on lysosomes. For detection of spleen vasculature, Rat Anti-Mouse CD31 (MEC 13.3 (RUO) was to detect CD31 and Rat Anti-Mouse CD34 (RAM34) to detect CD34. After incubation with the primary antibody, spleen sections were washed with 0.05% BSA in PBS and incubated with either Streptavidin Alexa Fluor 488 conjugate or Alexa flour 647 conjugate for 1 hour at room temperature. Following that y washing in 0.05% BSA then mounted in fluorescent mounting media. Images were captured wither using SP5 Leica confocal microscope or Digital slide scanner (3D Histec Pannoramic250) and were captured using Pannoramic viewer then analysed using ImageJ. All spleens from each experimental group were analysed. More than three discrete areas from the WP of each spleen were collected at a magnification of 20x. Each area was analysed in ImageJ by applying fluorescence intensity threshold and the number of pixels from each colour (black, red, green, yellow, blue, magenta) were then automatically measured as previously described (Inman, C. F.; Rees, L. E. N.; Barker, E. N.; Haverson, K.; Stokes, C. R.; Bailey, M. Validation of Computer-Assisted, Pixel-Based Analysis of Multiple-Colour Immunofluorescence Histology. J. Immunol. Methods 2005). These values enabled us to ascertain the area of immunolabeling from each cell type and their co-localisation with the liposomes. All data recorded were normalised to the average naive mice values to determine the foldchange difference compared to naive mice. Data and statistical analyses Statistical analysis of the data was performed using Graph Pad Prism 8 software. Two-tailed unpaired student t-test and one-way analysis of variance followed by the Tukey multiple comparison tests were used and p values <0.05 were considered significant. For all analyses, data are represented as mean ± standard error of the mean (SEM), unless otherwise indicated. The invention will now be described by way of the following examples. EXAMPLES Splenic sympathetic stimulation after brain injury leads to the excessive release of pro-inflammatory cytokines and preferential loss of innate and adaptive immune cells, which can further exacerbate brain tissue damage and predispose stroke patients to infectious complications. Experimental Therapeutic approaches currently in use to manipulate post-stroke splenic responses are not selective, and their clinical translation potential is still controversial, which stresses the need for more selective technologies. The inventors observed that LNP could efficiently and selectively target the spleen poststroke with more than 90% of the injected dose reaching this organ (Figure 1 and 2). This selective LNP accumulation is mediated by splenic structural alterations, extracellular matrix degradation (Figure 3), enhanced blood vessel permeability and higher phagocytic capacity (Figure 6). The inventors show the LNPs can be used as a selective treatment strategy to reverse the apoptotic loss of splenic innate and adaptive immune cells and control post-stroke infections. To evaluate the therapeutic benefit of this, the inventors tested two approaches; 1) inhibit immune cell apoptosis using LNP formulation of a broad-spectrum caspase inhibitor and 2) transiently shut down the expression of beta 2 adrenergic (b2AR) and glucocorticoid receptors that mediate the apoptotic loss of immune cells in response to adrenergic and glucocorticoid signalling using LNP RNA interference therapy. The inventors evaluated their effect using various in vitro, ex-vivo and in vivo approaches. It was shown that Lp-CI can reverse the loss of terminally differentiated B-Cells after stimulation with NE in vitro (Figure 4). It was also shown that LNP-Adrb2siRNA and LNP-Nr3clsiRNA combined in two separate LNPs or in the same formulation can reverse the apoptotic loss of splenic immune cells after stimulation with Dex and NE ex-vivo (Figure 5). To test this approach in vivo, focal cerebral ischemia was induced in C57BL / 6 male mice (10-12 weeks old) using the middle cerebral artery occlusion (MCAo) model and treated the mice at 4h and 24h post-MCAo and reperfusion (n=12 / group) with intravenous administration of lipid nanoparticles delivering treatment of pan-CI (Lp-CI). Stroke mice were then challenged with intranasal bacterial infections 24 h after MCAo and Lp-CI treatment effects were monitored by assessing various primary (spleen size, lymphocytes loss) and secondary (Infarct volume and functional recovery) stroke outcomes in comparison free drug or vehicle-treated groups (Figure 6). The data showed that Lp-CI treatment significantly reduced splenic atrophy, and reversed stroke-induced apoptotic loss of B-cells, T-cells and NK-cells populations. Notably, Lp-CI reduced the bacterial burden in the lungs of stroke mice, increased the survival rate of animals, and significantly lowered neurological and motor function impairment compared to controls. Overall, our data demonstrate the potential of Lp-CI as a novel promising approach to target post-stroke splenic dysfunction and infectious complications. In summary, this approach can provide novel therapeutics to prevent acute post-stroke infection, amongst other diseases and disorders associated with abnormal splenic function. In summary, the inventors show: (1) At the organ level, there is an increased specific accumulation of lipid nanoparticles in the spleen as early as Ih after I.V administration, whereas accumulation in other organs remains unchanged. (2) Liposomal uptake is significantly enhanced in WP populations after stroke which may be associated with structural alterations in this region due to significant loss in cellularity and alterations in blood vessels. (3) There is a co-localization of liposomes within areas of enhanced phagocytic activity (MZ and RP) suggesting that there is a link between increased phagocytic capacity and specific uptake in the spleen. There is a strong link between acute brain injury and modulations of resident immune cells in the spleen, a process termed brain-spleen inflammatory coupling. This brainspleen link causes complex immune changes in the spleen that collectively impact the brain pathology, neurological function and predispose patients to infectious complications. Therefore, the ability to manipulate those peripheral changes in the spleen without inducing off-target effects represents an attractive treatment strategy for many neurological disorders such as stroke, traumatic brain injury and sepsis. In this study, the inventors demonstrated in a mouse model of ischemic stroke that it is possible to efficiently and selectively target the spleen post-stroke with more than 90% of injected dose using lipid nanoparticles of the invention, a process mediated by splenic structural alterations and enhanced phagocytic activity. This observation highlights the use of the lipid nanoparticles of the invention as a selective treatment strategy to modulate splenic immune responses in conditions where these changes play a critical role in the disease process, such as stroke. References: [1] Patel, A. et al. Current, future and avoidable costs of stroke in the UK Part 2: Societal costs of stroke in the next 20 years and potential returns from increased spending on research. Stroke Assoc,. (2017). [2] Vermeij, J. D., et al. J. Post-stroke infections and preventive antibiotics in stroke: Update of clinical evidence, (2018). [3] Westendorp, W. F. et al. Pre-stroke use of beta-blockers does not lower post-stroke infection rate: An exploratory analysis of the preventive antibiotics in stroke study. Cerebrovasc. Dis., (2016). [4] Mcculloch, L., et al. Adrenergic-mediated loss of splenic marginal zone B cells contribute to infection susceptibility after stroke. Nat. Commun., (2017). [5] Shim, R. et al. The role of P2 adrenergic receptor on infection development after ischaemic stroke. Brain, Behav. Immun. - Heal, (2021). 5 [6] Liu, Q. et al. Brain ischemia suppresses immunity in the periphery and brain via different neurogenic innervations. Immunity, (2017). [7] Mcculloch, L. et al. Treatment with IgM-enriched intravenous immunoglobulins enhances clearance of stroke-associated bacterial lung infection, (2022). [8] Cheng, Q. et al. Selective organ targeting (SORT) nanoparticles fortissue-specific 10 mRNA delivery and CRISPR Cas gene editing. Nat. Nanotechnol, (2020). [9] Kimura, S , et al. Novel lipid combination for delivery of plasmid DNA to immune cells in the spleen. J. Control. Release, (2021).

[10] Al-Ahmady, Z. S. et al. Selective liposomal transport through blood-brain barrier disruption in ischemic stroke reveals two distinct therapeutic opportunities. ACS Nano, 15 (2019).

Claims

1. A liposome comprising:(i) An outer shell comprising a lipid formulation; and5 (ii) one or more therapeutic agent which prevents apoptosis of a target cell,wherein the lipid formulation of the outer shell of the liposome comprises hydrogenated soy phosphatidylcholine (HSPC), cholesterol (Choi) and 2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DSPE-PEG2000), and10 wherein the one or more therapeutic agent comprises or consists of one or morecaspase inhibitor.

2. The liposome of claim 1, wherein the one or more caspase inhibitor comprises or consists of Emricasan.

153. The liposome of any of claim 1 or claim 2, wherein the lipid formulation of the outer shell of the liposome further comprises l,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaaceticacid (PE-DTPA).20 4. The liposome of any of claims 1-3, wherein the lipid formulation of the outershell of the liposome comprises or consists of 40-70 mol / mol% HSPC, 20-60 mol / mol% Choi, and 1-7 mol / mol% DSPE-PEG20005. The liposome of claim 4, wherein the lipid formulation of the outer shell of the 25 liposome comprises or consists of 50-60 mol / mol% HSPC, 30-40 mol / mol% Choi, and2-5.5 mol / mol% DSPE-PEG2000.

6. The liposome of claim 4, wherein the lipid formulation of the outer shell of the liposome comprises or consists of 56.3 mol / mol% HSPC, 38.2 mol / mol% Choi and 5.5 30 mol / mol% DSPE-PEG2000.

7. The liposome of any of claims 1-6, wherein the liposome comprises 1-1000 pg / ml of the caspase inhibitor.

8. The liposome of claim 7, wherein the liposome comprises 90 pg / ml of the caspase inhibitor.

9. The liposome of any of claims 1-8, wherein the liposome is less than 500nm in 5 diameter,10. The liposome of claim 9, wherein the liposome is between 70nm and 135nm in diameter.10 11. The liposome of any of claims 1-10, further comprising a spleen-targetingmoiety.

12. The liposome of claim 11, wherein the spleen-targeting moiety is a Cdla-targeting moiety.1513. The liposome of any of claims 1-12, for use in modulating splenic immune C\j responses in a subject.। 14. The liposome of any of claim 13, wherein the splenic immune response20 comprises B-cell activity in the marginal zone of the spleen.CM15. A pharmaceutical composition comprising a liposome of any of claims 1-14.

16. The liposome of any of claims 1-14, or the pharmaceutical composition of claim 25 15, for use in medicine.

17. The liposome of any of claims 1-14, or the pharmaceutical composition of claim 15, for use in treating or preventing a disease or disorder associated with spleen abnormality in a subject.3018. The liposome or pharmaceutical for use according to claim 17, wherein the disease or disorder is an infection, myocardial infarction, spinal cord injury, sepsis, or traumatic brain injury.

19. The liposome for use according to claim 18, wherein the infection is a post postbrain injury infection, such as a stroke-associated infection.

20. The liposome for use according to claim 19, wherein the post stroke infection is 5 caused by one or more of Streptococcus pneumoniae, Staphylococcus aureus. Group A Streptococcus, Klebsiella pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Mycoplasma, pneumoniae, and SARS-CoV-2.

21. The liposome for use according to claim 19, wherein the liposome is to be 10 administered to the subject between 0.5 to 48 hours after the subject has suffered a stroke.24 10 24

Images