Compounds

Indazole and azaindazole compounds with enhanced GPR17 modulatory activity and reduced CYP2C19 inhibition address the limitations of existing treatments, providing effective oral therapies for myelination and neurodegenerative diseases, and metabolic disorders.

GB2701173APending Publication Date: 2026-04-22PHENO THERAPEUTICS LTD
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
GB · GB
Patent Type
Applications
Current Assignee / Owner
PHENO THERAPEUTICS LTD
Filing Date
2025-05-22
Publication Date
2026-04-22

AI Technical Summary

Technical Problem

Current treatments for myelination diseases such as multiple sclerosis lack effective oral medications that can reverse demyelination and promote remyelination, and existing GPR17 modulators face issues with low affinity, stability, and the ability to cross the blood-brain barrier, leading to limited therapeutic potential.

Method used

Development of indazole and azaindazole compounds with specific structural modifications that exhibit potent GPR17 modulatory activity, reduced CYP2C19 inhibitory potency, and improved brain penetration, suitable for oral administration.

Benefits of technology

These compounds effectively decrease GPR17 activity, offering potential therapeutic benefits for myelination disorders, neurodegenerative diseases, and metabolic disorders like obesity, while minimizing drug-drug interactions and side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001_0000
    Figure 00000001_0000
  • Figure 00000001_0001
    Figure 00000001_0001
  • Figure 00000002_0000
    Figure 00000002_0000
Patent Text Reader

Abstract

A compound of formula (I) or a pharmaceutically acceptable salt thereof: wherein R1 is independently selected from: halo, -CN, C1-C6 alkyl, C1-C6 haloalkyl, C3-C6 cycloalkyl, -O-C1-C6 alkyl and -S
Need to check novelty before this filing date? Find Prior Art

Description

[0001] The present invention relates to compounds that are GPR17 modulators, in particular GPR17 antagonists, and the use of the compounds in the treatment and prevention of diseases and conditions associated with GPR17, for example neurodegenerative diseases (e.g. amyotrophic lateral sclerosis (ALS), Alzheimer’s disease (AD), Parkinson’s disease (PD)), inflammatory diseases, ischemia, and myelination disorders such as multiple sclerosis. BACKGROUND

[0002] G-protein coupled receptors (GPCRs) constitute the largest family of membrane receptors in the cell. They transduce extracellular signals to intracellular effector systems and are involved in a large variety of physiological phenomena, therefore representing the most common targets of pharmaceutical drugs although only a small percentage of GPCRs are targeted by current therapies.

[0003] GPCRs respond to a wide range of ligands. Due to the progress in human genome sequencing, for about 25% out of the more than 400 GPCRs (not including the olfactory GPCRs) that have been identified, a defined physiologically relevant ligand is still lacking. These receptors are known as "orphan GPCRs". "Deorphanization" and identification of their in vivo roles is expected to clarify novel regulatory mechanisms and, therefore, to disclose novel drug targets. Whether GPR17 is such an orphan receptor is still a matter of debate. Phylogenetically, GPR17 is closely related to the nucleotide P2Y receptors and the cysteinylleukotriene (Cysl T1, Cysl T2) receptors, with an amino acid sequence identity of between about 30 and about 35%, respectively.

[0004] Multiple-tissue Northern blot and RT-PCR analyses indicate a predominant expression of GPR17 in the central nervous system (CNS) (Giana et al., 2006, EMBO J 25(19): 4615; Blasius et al., 1998, J Neurochem 70(4 ): 1357) and additionally in heart and kidney, i.e. organs typically undergoing ischemic damage. Two human GPR17 isoforms have been identified differing only by the length of their N-terminus. The short GPR 17 isoform encodes a 339 amino acid-residue protein with typical rhodopsin type-seven transmembrane motifs. The long isoform encodes a receptor with a 28 amino acid longer N-terminus (Blasius et al., 1998). GPR17 is highly conserved among vertebrate species (-90% identity of amino acid sequence to both mouse and rat orthologs), which may constitute an advantageous feature for development of small molecule ligands and animal models in a drug discovery context.

[0005] In the original deorphaning report, GPR17 was identified as a dual receptor for uracil nucleotides and cysteinyl-leukotrienes (cysl Ts) LTC4 and LTD4, respectively based on 3SGTPyS binding and cAMP inhibition assays as well as single cell calcium imaging (Giana et al., 2006, ibid). Evidence for GPR17 functionality was provided in different cellular backgrounds such as 1321 N1, COS7, CHO, and HEK293 cells (Giana et al., 2006, ibid). Subsequently, an independent study confirmed activation of GPR 17 by uracil nucleotides but failed to recapitulate activation by Cysl Ts (Benned-Jensen and Rosenkilde, 2010, Br J Pharmacol , 159(5): 1092). Yet recent independent reports (Maekawa et al., 2009, PNAS 106(28), 11685; Qi et al., 2013, J Pharmacol Ther 347,1, 38; Hennen et al.,2013, Sci Signal 6, 298) suggested lack of GPR17 responsiveness to both uracil nucleotides and Cysl Ts across different cellular backgrounds stably expressing GPR17 (1321 N1, CHO, HEK293 cells). A novel regulatory role for GPR17 has also been proposed: GPR17 - upon coexpression with the Cysl T1 receptor- rendered the Cysl T1 receptor unresponsive to its endogenous lipid mediators L TC4 and L TD4. Clearly, additional in vitro investigations are required to probe GPR17 pharmacology and function in more depth.

[0006] Drugs modulating the GPR17 activity may have neuroprotective, anti-inflammatory and anti-ischemic effects and may thus be useful for the treatment of cerebral, cardiac and renal ischemia, and stroke (WO 2006 / 045476), and / or for improving the recovery from these events (Bonfanti et al, Cell Death and Disease, 2017, 8, e2871).

[0007] GPR17 modulators are also thought to be involved in food uptake, insulin and leptin responses and are thus claimed to have a role in obesity treatment (WO 2013 / 113032). Administration of an agent that reduces GPR17 expression or reduces GPR17 activity such as a GPR17 antagonist is expected to increase glucose tolerance / insulin sensitivity via inhibition of intestinal GPR17 activity (Yan, S. et al., Cell Reports 38(1), 110179, 2022). Administration of a GPR17 antagonist is expected to block hypothalamic GPR17 receptors and modulate the oligodendrocytic GPR17-cAMP-lactate axis which regulates neuronal activity and contributes to whole body metabolic regulation promoting decreased body weight by reducing food intake (Ou, S. et al., Cell Reports 26(11), 2984-2997, 2019). Administration of a GPR17 antagonist is expected to block FoxO1 activation of Agrp neurons, thus resulting in reduced food intake and hepatic glucose production (Ren, H. et al., Cell 149(6), 1314-1326, 2012; Ren, H. etal., Cell 153(5), 1166, 2013). Administration of a GPR17 antagonist is expected to increase POMC neuronal activity and promote better energy homeostasis which could curtail weight gain (Reilly, A. M. et al., Nutrition and Diabetes 9:29, 2019).

[0008] Moreover, there is strong evidence that GPR17 is involved in myelination processes and that negative GPR17 modulators (antagonists or inverse agonists) can be valuable drugs for the treatment or alleviation of myelination disorders such as multiple sclerosis or spinal cord injury (Chen et al, Nature neuroscience 2009, 12(11 ): 1398-406; Ceruti et al; Brain: a journal of neurology 2009 132(Pt 8):2206-18; Hennen et al, Sci Signal, 6, 2013, 298; Simon et al J Biol Chern 291, 2016, 705; Fumagalli et al, Neuropharmacology 104, 2016, 82). Activation of GPR17 has been shown to inhibit oligodendrocyte precursor cells (OPCs) maturation thus preventing effective myelination (Simon et al, supra). The identification of potent and selective GPR17 antagonists or inverse agonists would thus be of significant relevance in the treatment of myelination disorders.

[0009] Several serious myelination diseases are known to be caused by disturbances in myelination, either by a loss of myelin (usually called demyelination), and / or by a failure of the body to properly form myelin (sometimes called dysmyelination). The myelination diseases may be idiopathic or secondary to certain trigger events like e.g. traumatic brain injury or viral infection. Myelination diseases may primarily affect the central nervous system (CNS) but may also concern the peripheral nervous system. Myelination diseases include, inter alia, multiple sclerosis, neuromyelitis optica (also known as Devic's disease), leucodystrophies, Guillain-Barr~ syndrome, and many other diseases as described in more detail further below (see also e.g. Love, J Clin Pathol, 59, 2006,1151, Fumagalli et al, supra). Neurodegenerative diseases such as Alzheimer's Disease, Huntington's Disease, Parkinson's Disease, amyotropic lateral sclerosis (ALS) and multiple system atrophy (MSA) have been also strongly associated with decreased myelination recently (see e.g. Ettie et al, Mol Neurobiol 53, 2016, 3046; Jellingerand Welling, Movement Disorders, 31, 2016; 1767; Kang etal, Nature Neurosci 6, 2013, 571; Bartzokis, Neurochem Res (2007) 32:1655).

[0010] Multiple Sclerosis (MS) is a chronic progressive disorder. It is an inflammatory autoimmune disease causing oligodendrocyte damage, demyelination and ultimately axonal loss, thus leading to a broad spectrum of signs and symptoms of a severe neurological disease, like e.g. fatigue, dizziness, mobility and walking issues, speech and swallowing difficulties, pain and others. MS takes several forms, with new symptoms either occurring in isolated attacks (relapsing forms) or building up overtime (progressive forms). While certain symptoms may disappear completely between isolated attacks, severe neurological problems often remain, especially as the disease advances to a more progressive form. According to the Multiple Sclerosis Association of America, approximately 400,000 individuals have been diagnosed with MS in the United States and as many as 2.5 million worldwide, with an estimated 10,000 new cases diagnosed in the United States annually. Multiple sclerosis is two to three times more common in women than in men.

[0011] There is no known causal treatment or cure for multiple sclerosis, or many other myelination diseases. Treatments are usually symptomatic and try to improve function after an attack and prevent new attacks, by addressing the inflammatory component of the disease. Such immunomodulatory drugs are usually only modestly effective, in particular if the disease is progressed, but can have side effects and be poorly tolerated. Moreover, most of the available drugs, like -interferons, glatiramer acetate, or therapeutic antibodies are only available in injectable form and / or only address the inflammatory component of the disease but not demyelination directly Others drugs, like corticosteroids, show rather unspecific antiinflammatory and immunosupressive effects thus potentially leading to chronic side effects, such as manifested in Cushing's syndrome, for example.

[0012] A strong need therefore exists for a safe and effective drug for the treatment of myelination diseases, like MS, preferably for a drug that is suitable for oral administration. Ideally such a drug would reverse the demyelination process by decreasing demyelination and / or by promoting remyelination of the impacted neurons. A chemical compound which effectively decreases the GPR 17 receptor activity could fulfil these requirements.

[0013] However, only few chemical compounds are known that effectively modulate GPR17 activity.

[0014] WO 2005 / 103291 suggests the endogenous molecules 5 amino levulinic acid (5-AI_A) and porphobilinogen (PBG) as activating ligands for GPR17, discloses analgesic effects of a GPR17 agonist and proposes the use of GPR17 agonists for treating neuropathic pain and as tools in GPR17 screening assays. However, the reported affinity of 5-AI_A and PBG is quite low and the amounts needed in the assays are significant, namely in the three digit micromolar range for 5-AI_A or even in the mM range for PBG, which make both compounds not well suited for use in routine screening assays or even for therapy. Moreover, PBG is a chemically unstable, reactive compound which rapidly decomposes after exposure to air and light, making it impractical to handle on a routine basis. Hence, these compounds do not offer a promising starting point to develop therapeutically effective negative GPR17 modulators.

[0015] Montelukast and pranlukast were originally developed as leukotriene receptor antagonists and were recently found to act on the GPR17 receptor as well (Giana et al, EMBO J. 2006, 25, 4615-4627). However, subsequent results in a functional assay were contradictory for montekulast (Hennen et al, 2013, ibid), while pharmacological inhibition of GPR17 with pranlukast promotes differentiation of primary mouse (Hennen et al., 2013, ibid) and rat (Ou et al., J. Neurosci. 36, 2016, 10560-10573) oligodendrocytes. Pranlukast even phenocopies the effect of GPR17 depression in a lysolecithin model of focal demyelination because both GPR17 knock-out and pranlukast-treated wild-type mice show an earlier onset of remyelination (Ou, ibid). These results strongly support the hypothesis that GPR17 inhibitors offer potential for the treatment of human demyelinating diseases.

[0016] However, the affinity of montekulast and prankulast to GPR17 is only in the high micromolar range (Kase et al, ACS Med. Chern. Lett. 2014, 5, 326-330). Given the high protein binding of both compounds and their poor brain penetration, it is unlikely that they could reach high enough free concentrations to bind to GPR17 receptors in amounts suitable for human therapy. In addition, results obtained in vivo with these compounds are difficult to interpret due to their confounding high affinity for CYSL T1 receptors.

[0017] US 8,623,593 discloses certain indole-2-carboxylic acids as GPR 17 agonists and their use in screening assays. However, these derivatives are all potent agonists and are not suited to down-regulate GPR 17 activity as needed in the treatment of myelination disorders such as MS. Moreover, this class of GPR17 activators does not sufficiently pass the blood-brain barrier due to their easily ionizable carboxyl groups and were thus no suitable lead compounds to develop negative GPR17 modulators. See also Baqi et al, Med. Chern. Commun., 2014, 5, 86 and K~se et al, 2014, ibid.

[0018] WO 2013 / 167177 suggests certain phenyltriazole and benzodiazepine compounds as GPR17 antagonists. However, the disclosed compounds were selected solely based on in- silica screening results and no biological data at all was provided. The inventors of the present application were unable to confirm the GPR17 antagonist modulating activity of any of purported ligands proposed by the authors of this former patent application so far.

[0019] A need therefore exists to identify potent modulators, preferably negative modulators, of GPR17 which are capable of effectively decreasing the GPR17 activity, preferably upon oral administration.

[0020] Mehra et al (Eur J Med Chern, 92, 2015, 78-90) disclose a variety of compounds with EColi acetyltransferase inhibiting activity, including four phenyl-substituted pyrrolo[2,3-b]pyridine-3-sulfonamides (compounds 20 [N-(3,4-difluorophenyl 1 H-pyrrolo[2,3-b]pyridine-3-sulfonamide], 32 [N-(3,5-dimethoxyphenyl 1 H-pyrrolo[2,3-b]pyridine-3-sulfonamide],37 [N-(2,5-difluorophenyl 1H-pyrrolo[2,3-b]pyridine-3-sulfonamide] and 43 [N-(3,5- difluorophenyl 1H-pyrrolo[2,3-b]pyridine-3-sulfonamide] of Table S7). These four azaindole compounds distinguish structurally from the presently disclosed compounds in that the azaindole core in Mehra is not further substituted. Moreover, Mehra et al do not suggest any GPR17 inhibiting property of these compounds and / or any utility of their compounds for treating a myelination disorder. Instead, Mehra et al disclose compounds as potential antibiotics.

[0021] WO 2018 / 122232, WO 2019 / 243303, WO 2019 / 243398, WO 2020 / 254289, WO 2020 / 180136, WO 2022 / 254027, WO 2024 / 017855, WO 2024 / 017856, WO 2024 / 017857, WO 2024 / 017858, WO 2024 / 017863, WO 2024 / 023128, WO 2024 / 023129, WO 2024 / 042147, WO 2024 / 104462 and WO 2024 / 115733 disclose compounds exhibiting GPR17 modulatory activity.

[0022] Cytochrome P450’s are critical enzymes primarily found in the liver and are one of the body’s key detoxification mechanisms involved in drug metabolism of xenobiotics. The activity of these enzymes can significantly impact the effectiveness and safety of various medications and new drug candidates that inhibit one or more of the P450’s needs to be carefully assessed for potential drug-drug interactions (DDI). A clinically relevant DDI occurs when the new drug candidate inhibits a particular P450 that changes the pharmacokinetics of a co-administered medication. For example, CYP2C19 constitutes approximately 20% of all CYPs found in the human liver and it metabolizes a significant portion of drugs used in clinical practice, such as the proton pump inhibitor omeprazole, the anti-anxiety drug diazepam, the antiplatelet drug clopidogrel and many others. Therefore, new drug candidates that inhibit CYP2C19 could significantly impact the safety and effectiveness of known drugs by changing the level of systemic exposure to ineffective or unsafe values. The FDA issued new and clear guidance in 2020 on the need for more extensive clinical trials for new drug candidates that are predicted to have the potential for a significant DDI interaction.

[0023] Therefore, it is advantageous for any new drug candidate to have low inhibitory activity of CYP450’s. The present inventors have surprisingly found that the indazole and azaindazole compounds of the present invention are less potent at CYP2C19 than corresponding prior art indoles, particularly those disclosed in WO 2018 / 122232, WO 2019 / 243303, WO 2019 / 243398, WO 2020 / 254289, WO 2020 / 180136, WO 2022 / 254027 and WO 2024 / 042147. Therefore, compounds according to the present invention have a lower propensity for DDI when co-administered with common drugs such as omeprazole, diazepam and any of the numerous others that are substrates of CYP2C19.

[0024] Accordingly, it is an aim of the present invention to provide compounds that exhibit GPR17 modulatory activity, whilst reducing off-target potency, in particular those exhibiting reduced potency at CYP2C19. BRIEF SUMMARY OF THE DISCLOSURE

[0025] In accordance with a first aspect, the present invention provides a compound of the formula (I), or a pharmaceutically acceptable salt thereof: (I) wherein: R1 is independently selected from: halo, -CN, Ci-Ce alkyl, Ci-Ce haloalkyl, C3-C6 cycloalkyl, -O-Ci-Ce alkyl and -SO2-C1-C6 alkyl; R2 is independently selected from: H, halo, and -CN; R3 is selected from: halo, and -O-Ci-Ce alkyl; R4 is independently selected from: halo, -CN, Ci-Ce alkyl, -O-Ci-Ce alkyl, C3-C6 cycloalkyl, -O-C3-C6 cycloalkyl, and -O-Ci-Ce alkyl-Cs-Ce cycloalkyl; wherein said Ci-Ce alkyl, -O-Ci-Ce alkyl, C3-C6 cycloalkyl, -O-C3-C6 cycloalkyl, and -O-Ci-Ce alkyl-Cs-Ce cycloalkyl, are each independently optionally substituted with from 1 to 6 groups selected from: deuterium, -CN, halo, -O-C1-C3 alkyl, and -O-C1-C3 haloalkyl; R5 is selected from: H, halo, and -O-Ci-Ce alkyl; X1 is CR6; and R6 is independently selected from: H, halo, Ci-Ce alkyl, Ci-Ce haloalkyl, -O-Ci-Ce alkyl, and -O-Ci-Ce haloalkyl.

[0026] In accordance with a second aspect, the present invention provides a pharmaceutical composition comprising a compound or pharmaceutically acceptable salt thereof according to the first aspect, and a pharmaceutically acceptable excipient.

[0027] In accordance with a third aspect, the present invention provides a compound or a pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use as a medicament.

[0028] In accordance with a fourth aspect, the present invention provides a compound or pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a GPR17-associated disease.

[0029] In accordance with a fifth aspect, the present invention provides a compound or pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a disease of the central nervous system (CNS).

[0030] In accordance with a sixth aspect, the present invention provides a compound or pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a diseases associated with a myelination disorder, in particular a demyelination disorder, such as of the central nervous system.

[0031] In accordance with an seventh aspect, the present invention provides a compound or pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a disease selected from: multiple sclerosis (MS), neuromyelitis optica (Devic’s disease), neuromyelitis optica spectrum disorder (NMOSD), chronic relapsing inflammatory optic neuritis, acute disseminated encephalomyelitis, acute haemorrhagic leucoencephalitis (AHL), periventricular leukomalacia, e.g. periventricular leukomalacia demyelination due to viral infections, such as by HIV or progressive multifocal leucoencephalopathy, central pontine and extrapontine myelinolysis, demyelination due to traumatic brain injury and / or traumatic brain tissue damage, including compression-induced demyelination, e.g. by tumours, demyelination in response to hypoxia, e.g. polycythemia vera, demyelination in response to stroke or ischaemia or other cardiovascular diseases, demyelination due to exposure to carbon dioxide, cyanide, or other CNS toxins, Schilder’s disease, Balo concentric sclerosis, Perinatal encephalopathy; Neurodegenerative Diseases including: Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease (AD), Multiple system atrophy, Parkinson’s Disease, Spinocerebellar ataxia (SCA), Huntington’s Disease; psychiatric disorders such as schizophrenia and bipolar disorder; and peripheral myelination diseases such as leukodystrophies (e.g. Pelizaeus-Merzbacher disease), peripheral demyelinating neuropathies, Dejerine-Sottas syndrome and Charcot-Marie-Tooth disease.

[0032] In accordance with a eighth aspect, the present invention provides a compound or a pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a disorder associated with food uptake, insulin response and leptin response, for example obesity.

[0033] In accordance with a ninth aspect, the present invention provides a compound or a pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a disorder associated with intestinal GPR17 activity, for example obesity.

[0034] In accordance with a tenth aspect, the present invention provides a compound or a pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a disorder associated with glucose tolerance and / or insulin sensitivity, for example obesity.

[0035] In accordance with a eleventh aspect, the present invention provides a compound or a pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a disorder associated with hypothalamic GPR17 receptors, for example obesity.

[0036] In accordance with a twelfth aspect, the present invention provides a compound or a pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a disorder associated with the oligodendrocytic GPR17-cAMP-lactate axis, for example obesity.

[0037] In accordance with an thirteenth aspect, the present invention provides a compound or a pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a disorder associated with FoxO1 activation of Agrp neurons, for example obesity.

[0038] In accordance with a fourteenth aspect, the present invention provides a compound or a pharmaceutically acceptable salt thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use in the treatment or prophylaxis of a disorder associated with POMC neuronal activity, for example obesity. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which: Figure 1 shows the results of the ataxia assay described in assay 1 of Example 9. Figure 2 shows the results of the auditory response assay described in assay 2 of Example 9. Figure 3 shows the results of the seizure assay described in assay 3 of Example 9. Figure 4 shows the results of the Percentage Dysphagia Phenotype with constricted Gl Tract assay described in assay 4 of Example 9. Figure 5 shows the results of the brain pathology assay described in assay 5 of Example 9. Figure 6 shows the results of the Gene Expression - RT-PCR gpr17 Expression Levels in Brain; RT-PCR assay described in assay 6 of Example 9. Figure 7 shows the results of the convulsions assay described in assay 1 of Example 10. Figure 8 shows the results of the visual acuity response assay described in assay 2 of Example 10. Figure 9 shows the results of the ataxia assay described in assay 3 of Example 10. Figure 10 shows the results of the predator avoidance test described in assay 4 of Example 10. Figure 11 shows the results of the wall hitting behaviour assay described in assay 5 of Example 10. Figure 12 shows the results of the Percentage Dysphagia Phenotype with constricted Gl Tract assay described in assay 6 of Example 10. Figure 13 shows the results of the brain pathology assay described in assay 7 of Example 10. Figure 14 shows the results of the Gene Expression - RT-PCR gpr17 Expression Levels in Brain; RT-PCR assay described in assay 8 of Example 10. Figure 15 shows the results of the temperature sensitivity assay described in assay 1 of Example 11. Figure 16 shows the results of the auditory response assay described in assay 2 of Example 11. Figure 17 shows the results of the ataxia assay described in assay 3 of Example 11. Figure 18 shows the results of the predator avoidance test described in assay 4 of Example 11. Figure 19 shows the results of the seizure assay described in assay 5 of Example 11. Figure 20 shows the results of the brain pathology assay described in assay 6 of Example 11. Figure 21 shows the results of the Gene Expression - RT-PCR gpr17 Expression Levels in Brain; RT-PCR assay described in assay 7 of Example 11. Figure 22 shows the habituation and test phase protocol for the conditioned response score assay described in assay 1 of Example 12. Figure 23 shows the results of the conditioned response assay described in assay 1 of Example 12. Figure 24 shows the results of the swim velocity assay described in assay 2 of Example 12. Figure 25 shows the results of the swim distance assay described in assay 2 of Example 12. Figure 26 shows the results of the Percentage Dysphagia Phenotype with constricted Gl Tract assay described in assay 3 of Example 12. Figure 27 shows the results of the Percentage Respiratory Insufficiency Phenotype with Reduced Operculum Activity assay described in assay 4 of Example 12. Figure 28 shows the results of the brain pathology assay described in assay 5 of Example 12. Figure 29 shows the results of the IHC-Microglia assay described in assay 6 of Example 12. Figure 30 shows the results of the Gene Expression - RT-PCR gpr17 Expression Levels in Brain; RT-PCR assay described in assay 7 of Example 12. DETAILED DESCRIPTION Definitions

[0040] Unless otherwise stated, the following terms used in the specification and claims have the following meanings set out below.

[0041] Reference herein to a “compound of the invention” is a reference to any of the compounds disclosed herein including compounds of the formulae (I) to (IV), or a compound described in any of the Examples, or a pharmaceutically acceptable salt, solvate, or salt of a solvate of any thereof.

[0042] The terms “treating”, or “treatment” refer to any beneficial effect in the treatment or amelioration of an injury, disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; modifying the progression of a disease or condition, making the final point of degeneration less debilitating; improving a patient’s physical or mental wellbeing. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination, neuropsychiatric examinations, and / or a psychiatric evaluation. The term "treating" and conjugations thereof, includes prevention of an injury, pathology, condition, or disease (i.e., prophylaxis or prevention). For example, the term "treating" and conjugations thereof, include prevention of a pathology, condition, or disease associated with GPR17 (e.g., reducing or preventing symptoms or effects of the disease or condition or preventing or inhibiting progression of the disease or condition.

[0043] The term “associated” or “associated with”, “involving” or “mediated by” in the context of GPR17 associated with a disease means that the disease is caused (in whole or in part), or a symptom of the disease is caused (in whole or in part) through GPR17 receptors.

[0044] An “effective amount” is an amount sufficient to accomplish a stated purpose. For example an amount sufficient to achieve the effect for which it is administered, treat a disease, reduce enzyme activity, increase enzyme activity, reduce receptor signalling, increase receptor signalling, reduce one or more symptoms of a disease or condition, or to provide a disease modifying effect (i.e. alter the underlying pathophysiology of the disease). An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, or modify the progression of a disease, which could also be referred to as a “therapeutically effective amount.” A “reduction” of a symptom or symptoms means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology, or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The full prophylactic effect does not necessarily occur by administration of one dose and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. The exact amounts will depend on the purpose of the treatment and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams &Wilkins).

[0045] The therapeutically effective amount of a compound of the invention can be initially estimated from cell culture assays. Target concentrations will be those concentrations of active compound(s) that are capable of achieving the therapeutic effect described herein, as measured using the methods described herein or known in the art.

[0046] Therapeutically effective amounts for use in humans can also be determined from animal models using known methods. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring compound effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan.

[0047] Dosages may be varied depending upon the requirements of the patient and the compound being employed. The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached.

[0048] Dosage amounts and intervals can be adjusted individually to provide levels of the administered compound effective for the particular clinical indication being treated, or in response to a biomarker or other correlate or surrogate end-point of the disease. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.

[0049] A prophylactic or therapeutic treatment regimen is suitably one that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient. This determination of a dosage regimen is generally based upon an assessment of the active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent.

[0050] The term “halo” or “halogen” refers to one of the halogens, group 17 of the periodic table. In particular the term refers to fluorine, chlorine, bromine and iodine. Preferably, the term refers to fluorine or chlorine.

[0051] The term Cm-n refers to a group with m to n carbon atoms.

[0052] The term “C1-6 alkyl” refers to a linear or branched hydrocarbon chain containing 1, 2, 3, 4, 5 or 6 carbon atoms, for example methyl, ethyl, n-propyl, / so-propyl, n-butyl, / so-butyl, sec-butyl, tert-butyl, n-pentyl and n-hexyl. “C1-4 alkyl” similarly refers to such groups containing up to 4 carbon atoms. Alkylene groups are divalent alkyl groups and may likewise be linear or branched and have two points of attachment to the remainder of the molecule. Furthermore, an alkylene group may, for example, correspond to one of those alkyl groups listed in this paragraph. For example, C1-6 alkylene may be -CH2-, -CH2CH2-, -CH2CH(CH3)-, -CH2CH2CH2- or-CH2CH(CH3)CH2-. The alkyl and alkylene groups may be unsubstituted or substituted by one or more substituents. Possible substituents are described herein. For example, substituents for an alkyl or alkylene group may be halogen, e.g. fluorine, chlorine, bromine and iodine, OH, C1-C4alkoxy, -NR’R” amino, wherein R’ and R” are independently H or alkyl. Other substituents for the alkyl group may alternatively be used.

[0053] The term “C1-6 haloalkyl”, e.g., “Cm haloalkyl”, refers to a hydrocarbon chain substituted with at least one halogen atom independently chosen at each occurrence, for example fluorine, chlorine, bromine, and iodine. The halogen atom may be present at any position on the hydrocarbon chain. For example, C1-6 haloalkyl may refer to chloromethyl, fluoromethyl, trifluoromethyl, chloroethyl e.g., 1-chloromethyl and 2-chloroethyl, trichloroethyl e.g., 1,2,2-trichloroethyl, 2,2,2-trichloroethyl, fluoroethyl e.g., 1-fluoromethyl and 2-fluoroethyl, trifluoroethyl e.g., 1,2,2-trifluoroethyl and 2,2,2-trifluoroethyl, chloropropyl, trichloropropyl, fluoropropyl, trifluoropropyl. A haloalkyl group may be, for example, -CX3, -CHX2, -CH2CX3,-CH2CHX2 or-CX(CH3)CH3 wherein Xis a halo (e.g., F, Cl, Br, or I). A fluoroalkyl group, i.e., a hydrocarbon chain substituted with at least one fluorine atom (e.g., -CF3, -CHF2, -CH2CF3or -CH2CHF2).

[0054] The term “heteroalkyl,” refers to a stable linear or branched chain alkyl, including at least one carbon atom and at least one heteroatom (e.g., O, N, P, Si, and S), and wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized. The heteroatom(s) (e.g., N, S, Si, or P) may be placed at any interior position of the heteroalkyl group. The heteroalkyl is a non-cyclic group. “2 to 8 membered heteroalkyl” refers to a heteroalkyl in which there are a total of 1, 2, 3, 4, 5, 6, 7 or 8 carbon atoms and heteroatoms (e.g., O, N, P, Si, and S) in the heteroalkyl group. Examples include, but are not limited to: -CH2-O-CH3,-CH2-CH2-O-CH3, -CH2-NH-CH3,-CH2-CH2-NH-CH3, -CH2-N(CH3)-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -CH2-S(O)-CH3, -CH2-S(O)2-CH3, -CH2-CH2-S-CH3, -CH2-CH2-S(O)-CH3, -CH2-CH2-S(O)2-CH3, -ch2-ch=n-OCH3, Up to two or three heteroatoms may be consecutive, such as, for example, -CH2-NH-OCH3 and -CH2-O-Si(CH3)3. A heteroalkyl moiety may include one heteroatom (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include two optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include three optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include four optionally different heteroatoms (e.g., O, N, S, Si, or P).

[0055] The term “C2-6 alkenyl” includes a branched or linear hydrocarbon chain containing at least one double bond and having 2, 3, 4, 5 or 6 carbon atoms. The double bond(s) may be present as the E or Z isomer. The double bond may be at any possible position of the hydrocarbon chain. For example, the “C2-6 alkenyl” may be ethenyl, propenyl, butenyl, butadienyl, pentenyl, pentadienyl, hexenyl and hexadienyl. Alkenylene groups are divalent alkenyl groups and may likewise be linear or branched and have two points of attachment to the remainder of the molecule. Furthermore, an alkenylene group may, for example, correspond to one of those alkenyl groups listed in this paragraph. For example, alkenylene may be -CH=CH-, -CH2CH=CH-, -CH(CH3)CH=CH- or -CH2CH=CH-. Alkenyl and alkenylene groups may unsubstituted or substituted by one or more substituents. Possible substituents are described herein. For example, substituents may be those described above as substituents for alkyl groups.

[0056] The term “C2-6 alkynyl” includes a branched or linear hydrocarbon chain containing at least one triple bond and having 2, 3, 4, 5 or 6 carbon atoms. The triple bond may be at any possible position of the hydrocarbon chain. For example, the “C2-6 alkynyl” may be ethynyl, propynyl, butynyl, pentynyl and hexynyl. Alkynylene groups are divalent alkynyl groups and may likewise be linear or branched and have two points of attachment to the remainder of the molecule. Furthermore, an alkynylene group may, for example, correspond to one of those alkynyl groups listed in this paragraph. For example alkynylene may be -C=C-, -CH2C=C-, -CH2CeCCH2-, -CH(CH3)CHeC- or-CH2C=CCH3. Alkynyl and alkynylene groups may unsubstituted or substituted by one or more substituents. Possible substituents are described herein. For example, substituents may be those described above as substituents for alkyl groups.

[0057] The term “C3-6 cycloalkyl” includes a saturated hydrocarbon ring system containing 3, 4, 5 or 6 carbon atoms. For example, the “C3-Ce cycloalkyl” may be cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, bicyclo[2.1.1]hexane or bicyclo[1.1.1]pentane. Suitably the “C3-Ce cycloalkyl” may be cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl.

[0058] The term “heterocyclyl”, “heterocyclic” or “heterocycle” includes a non-aromatic saturated or partially saturated monocyclic or fused, bridged, or spiro bicyclic heterocyclic ring system. Monocyclic heterocyclic rings may contain from about 3 to 12 (suitably from 3 to 7) ring atoms, with from 1 to 5 (suitably 1, 2 or 3) heteroatoms selected from nitrogen, oxygen or sulfur in the ring. Bicyclic heterocycles may contain from 7 to 12-member atoms in the ring. Bicyclic heterocyclic(s) rings may be fused, spiro, or bridged ring systems. The heterocyclyl group may be a 3-12, for example, a 3- to 9- (e.g. a 3- to 7-) membered non-aromatic monocyclic or bicyclic saturated or partially saturated group comprising 1, 2 or 3 heteroatoms independently selected from O, S and N in the ring system (in other words 1, 2 or 3 of the atoms forming the ring system are selected from O, S and N). By partially saturated it is meant that the ring may comprise one or two double bonds. This applies particularly to monocyclic rings with from 5 to 7 members. The double bond will typically be between two carbon atoms but may be between a carbon atom and a nitrogen atom. Bicyclic systems may be spiro-fused, i.e. where the rings are linked to each other through a single carbon atom; vicinally fused, i.e. where the rings are linked to each other through two adjacent carbon and / or nitrogen atoms; or they may be share a bridgehead, i.e. the rings are linked to each other through two non-adjacent carbon or nitrogen atoms (a bridged ring system). Examples of heterocyclic groups include cyclic ethers such as oxiranyl, oxetanyl, tetrahydrofuranyl, dioxanyl, and substituted cyclic ethers. Heterocycles comprising at least one nitrogen in a ring position include, for example, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydrotriazinyl, tetrahydropyrazolyl, tetrahydropyridinyl, homopiperidinyl, homopiperazinyl, 2,5-diaza-bicyclo[2.2.1]heptanyl and the like. Typical sulfur containing heterocycles include tetrahydrothienyl, dihydro-1,3-dithiol, tetrahydro-2H-thiopyran, and hexahydrothiepine. Other heterocycles include dihydro oxathiolyl, tetrahydro oxazolyl, tetrahydro-oxadiazolyl, tetrahydrodioxazolyl, tetrahydrooxathiazolyl, hexahydrotriazinyl, tetrahydro oxazinyl, tetrahydropyrimidinyl, dioxolinyl, octahydrobenzofuranyl, octahydrobenzimidazolyl, and octahydrobenzothiazolyl. For heterocycles containing sulfur, the oxidized sulfur heterocycles containing SO or SO2 groups are also included. Examples include the sulfoxide and sulfone forms of tetrahydrothienyl and thiomorpholinyl such as tetrahydrothiene 1,1-dioxide and thiomorpholinyl 1,1-dioxide. A suitable value for a heterocyclyl group which bears 1 or 2 oxo (=0), for example, 2 oxopyrrolidinyl, 2-oxoimidazolidinyl, 2-oxopiperidinyl, 2,5-dioxopyrrolidinyl, 2,5-dioxoimidazolidinyl or 2,6-dioxopiperidinyl. Particular heterocyclyl groups are saturated monocyclic 3 to 7 membered heterocyclyls containing 1, 2 or 3 heteroatoms selected from nitrogen, oxygen or sulfur, for example azetidinyl, tetrahydrofuranyl, tetrahydropyranyl, pyrrolidinyl, morpholinyl, tetrahydrothienyl, tetrahydrothienyl 1,1-dioxide, thiomorpholinyl, thiomorpholinyl 1,1-dioxide, piperidinyl, homopiperidinyl, piperazinyl or homopiperazinyl. As the skilled person will appreciate, any heterocycle may be linked to another group via any suitable atom, such as via a carbon or nitrogen atom. For example, the term “piperidino” or “morpholino” refers to a piperidin-1-yl or morpholin-4-yl ring that is linked via the ring nitrogen.

[0059] The term “bridged ring systems” includes ring systems in which two rings share more than two atoms, see for example Advanced Organic Chemistry, by Jerry March, 4th Edition, Wiley Interscience, pages 131-133, 1992. Suitably the bridge is formed between two non-adjacent carbon or nitrogen atoms in the ring system. The bridge connecting the bridgehead atoms may be a bond or comprise one or more atoms. Examples of bridged heterocyclyl ring systems include, aza-bicyclo[2.2.1]heptane, 2-oxa-5-azabicyclo[2.2.1]heptane, aza-bicyclo[2.2.2]octane, aza-bicyclo[3.2.1]octane, and quinuclidine.

[0060] The term “spiro bi-cyclic ring systems” includes ring systems in which two ring systems share one common spiro carbon atom, i.e., the heterocyclic ring is linked to a further carbocyclic or heterocyclic ring through a single common spiro carbon atom. Examples of spiro ring systems include 3,8-diaza-bicyclo[3.2.1]octane, 2,5-diaza-bicyclo[2.2.1]heptane, 6-azaspiro[3.4]octane, 2-oxa-6-azaspiro[3.4]octane, 2-azaspiro[3.3]heptane, 2-oxa-6-azaspiro[3.3]heptane, 6-oxa-2-azaspiro[3.4]octane, 2,7-diaza-spiro[4.4]nonane, 2-azaspiro[3.5]nonane, 2-oxa-7-azaspiro[3.5]nonane and 2-oxa-6-azaspiro[3.5]nonane.

[0061] “Heterocyclyl-Cm-n alkyl” includes a heterocyclyl group covalently attached to a Cm-n alkylene group, both of which are defined herein; and wherein the Heterocyclyl-Cm-n alkyl group is linked to the remainder of the molecule via a carbon atom in the alkylene group. The groups “aryl-Cm-n alkyl”, “heteroaryl-Cm-n alkyl” and “cycloalkyl-Cm-n alkyl” are defined in the same way.

[0062] “-Cm-n alkyl substituted by -NRR” and “Cm-n alkyl substituted by -OR” similarly refer to an -NRR” or -OR” group covalently attached to a Cm-n alkylene group and wherein the group is linked to the remainder of the molecule via a carbon atom in the alkylene group.

[0063] The term “aromatic” when applied to a substituent as a whole includes a single ring or polycyclic ring system with 4n + 2 electrons in a conjugated tt system within the ring or ring system where all atoms contributing to the conjugated tt system are in the same plane.

[0064] The term “aryl” includes an aromatic hydrocarbon ring system. The ring system has 4n +2 electrons in a conjugated tt system within a ring where all atoms contributing to the conjugated tt system are in the same plane. An aryl may be a single ring or multiple rings (preferably from 1 to 3 rings) that are fused together (i.e., a fused ring aryl) or linked covalently. A fused ring aryl refers to multiple rings fused together wherein at least one of the fused rings is an aryl ring. For example, the “aryl” may be a C6-12 aryl, suitably phenyl or naphthyl. The aryl system itself may be substituted with other groups. The term “aryl” also covers partially aromatic bi- or polycyclic ring systems wherein at least one ring is an aromatic ring and one or more of the other ring(s) is a non-aromatic, saturated or partially saturated ring.

[0065] The term “heteroaryl” includes an aromatic mono- or bicyclic ring incorporating one or more (for example 1-4, particularly 1, 2 or 3) heteroatoms selected from nitrogen, oxygen or sulfur. The ring or ring system has 4n + 2 electrons in a conjugated tt system where all atoms contributing to the conjugated tt system are in the same plane.

[0066] Examples of heteroaryl groups are monocyclic and bicyclic groups containing from five to twelve ring members, and more usually from five to ten ring members. The heteroaryl group can be, for example, a 5- or 6-membered monocyclic ring or a 9- or 10-membered bicyclic ring, for example a bicyclic structure formed from fused five and six membered rings or two fused six membered rings, also referred to as a “fused bicyclic heteroaryl”. Bicyclic heteroaryl groups can be vicinally fused, i.e., where the rings are linked to each other through two adjacent carbon and / or nitrogen atoms. Each ring may contain up to about four heteroatoms typically selected from nitrogen, sulfur and oxygen. Typically, the heteroaryl ring will contain up to 4, for example up to 3 heteroatoms, more usually up to 2, for example a single heteroatom. In one embodiment, the heteroaryl ring contains at least one ring nitrogen atom. The nitrogen atoms in the heteroaryl rings can be basic, as in the case of an imidazole or pyridine, or essentially non-basic as in the case of an indole or pyrrole nitrogen. In general, the number of basic nitrogen atoms present in the heteroaryl group, including any amino group substituents of the ring, will be less than five.

[0067] Examples of heteroaryl include furyl, pyrrolyl, thienyl, oxazolyl, isoxazolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazenyl, benzofuranyl, indolyl, isoindolyl, benzothienyl, benzoxazolyl, benzimidazolyl, benzothiazolyl, benzothiazolyl, indazolyl, purinyl, benzofurazanyl, quinolyl, isoquinolyl, quinazolinyl, quinoxalinyl, cinnolinyl, pteridinyl, naphthyridinyl, carbazolyl, phenazinyl, benzisoquinolinyl, pyridopyrazinyl, thieno[2,3-b]furanyl, 2H-furo[3,2-b]-pyranyl, 1 H-pyrazolo[4,3-d]-oxazolyl, 4H-imidazo[4,5-d]thiazolyl, pyrazino[2,3-d]pyridazinyl, imidazo[2,1-b]thiazolyl, imidazo[1,2-b][1,2,4]triazinyl, imidazo[1,2-a]pyridine, imidazo[1,2-a]pyrazine, imidazo[1,2-a]pyrimidine, imidazo[1,2-b]pyridazine, triazolo[1,5-a]pyridine, [1,2,3]triazolo[1,5-a]pyridine,. Examples of heteroaryl groups comprising at least one nitrogen in a ring position include pyrrolyl, oxazolyl, isoxazolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazenyl, indolyl, isoindolyl, benzoxazolyl, benzimidazolyl, benzothiazolyl, benzothiazolyl, indazolyl, purinyl, benzofurazanyl, quinolyl, isoquinolyl, quinazolinyl, quinoxalinyl, cinnolinyl and pteridinyl.

[0068] “Heteroaryl” also covers partially aromatic bi- or polycyclic ring systems wherein at least one ring is an aromatic ring and one or more of the other ring(s) is a non-aromatic, saturated or partially saturated ring, provided at least one ring contains one or more heteroatoms selected from nitrogen, oxygen or sulfur. Partially aromatic heteroaryl bicyclic ring systems can be vicinally fused, i.e., where the rings are linked to each other through two adjacent carbon and / or nitrogen atoms. Examples of partially aromatic heteroaryl groups include for example, tetrahydroisoquinolinyl, tetrahydroquinolinyl, 2-oxo-1,2,3,4-tetrahydroquinolinyl, dihydrobenzthienyl, dihydrobenzfuranyl, 1,3-dihydroisobenzofuran, 2,3-dihydro-benzo[1,4]dioxinyl, benzo[1,3]dioxolyl, 2,2-dioxo-1,3-dihydro-2-benzothienyl, 4,5,6,7-tetrahydrobenzofuranyl, indolinyl, 1,2,3,4-tetrahydro-1,8-naphthyridinyl, 1,2,3,4-tetrahydropyrido[2,3-b]pyrazinyl and 3,4-dihydro-2 / 7-pyrido[3,2-b][1,4]oxazinyl.

[0069] Examples of five-membered heteroaryl groups include but are not limited to pyrrolyl, furanyl, thienyl, imidazolyl, furazanyl, oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, triazolyl and tetrazolyl groups.

[0070] Examples of six-membered heteroaryl groups include but are not limited to pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl and triazinyl.

[0071] Particular examples of bicyclic heteroaryl groups containing a six-membered ring fused to a five-membered ring include but are not limited to benzofuranyl, benzothiophenyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzothiazolyl, benzisothiazolyl, isobenzofuranyl, indolyl, isoindolyl, indolizinyl, indolinyl, isoindolinyl, purinyl (e.g., adeninyl, guaninyl), indazolyl, benzodioxolyl, pyrrolopyridine, and pyrazolopyridinyl groups.

[0072] Particular examples of bicyclic heteroaryl groups containing two fused six membered rings include but are not limited to quinolinyl, isoquinolinyl, chromanyl, thiochromanyl, chromenyl, isochromenyl, chromanyl, isochromanyl, benzodioxanyl, quinolizinyl, benzoxazinyl, benzodiazinyl, pyridopyridinyl, quinoxalinyl, quinazolinyl, cinnolinyl, phthalazinyl, naphthyridinyl and pteridinyl groups.

[0073] The term “oxo,” or “=O” as used herein, means an oxygen that is double bonded to a carbon atom.

[0074] The term "optionally substituted" includes either groups, structures, or molecules that are substituted and those that are not substituted.

[0075] Where optional substituents are chosen from “one or more” groups it is to be understood that this definition includes all substituents being chosen from one of the specified groups or the substituents being chosen from two or more of the specified groups, which may be the same or different. For example, “one or more optional substituents” may refer to 1 or 2 or 3 substituents (e.g. 1 substituent or 2 substituents).

[0076] Where a moiety is substituted, it may be substituted at any point on the moiety where chemically possible and consistent with atomic valency requirements. The moiety may be substituted by one or more substituents, e.g., 1, 2, 3 or 4 substituents; optionally there are 1 or 2 substituents on a group. Where there are two or more substituents, the substituents may be the same or different.

[0077] Substituents are only present at positions where they are chemically possible, the person skilled in the art being able to decide (either experimentally or theoretically) without undue effort which substitutions are chemically possible and which are not.

[0078] Ortho, meta and para substitution are well understood terms in the art. For the absence of doubt, “ortho” substitution is a substitution pattern where adjacent carbons possess a substituent, whether a simple group, for example the fluoro group in the example below, or other portions of the molecule, as indicated by the bond ending in “

[0079] “Meta” substitution is a substitution pattern where two substituents are on carbons one carbon removed from each other, i.e., with a single carbon atom between the substituted carbons. In other words, there is a substituent on the second atom away from the atom with another substituent. For example, the groups below are meta substituted:

[0080] “Para” substitution is a substitution pattern where two substituents are on carbons two carbons removed from each other, i.e., with two carbon atoms between the substituted carbons. In other words, there is a substituent on the third atom away from the atom with another substituent. For example, the groups below are para substituted:

[0081] A bond terminating in a “ ”, i.e. represents that the bond is connected to another atom that is not shown in the structure.

[0082] Suitable or preferred features of any compounds of the present invention may also be suitable features of any other aspect.

[0083] The invention contemplates pharmaceutically acceptable salts of the compounds of the invention. These may include the acid addition and base salts of the compounds. These may be acid addition and base salts of the compounds.

[0084] Suitable acid addition salts are formed from acids which form non-toxic salts. Examples include the acetate, aspartate, benzoate, besylate, bicarbonate / carbonate, bisulfate / sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hibenzate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malate, maleate, malonate, mesylate, methylsulfate, naphthylate, 1,5- naphthalenedisulfonate, 2-napsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, saccharate, stearate, succinate, tartrate, tosylate and trifluoroacetate salts.

[0085] Suitable base salts are formed from bases which form non-toxic salts. Examples include the aluminium, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine and zinc salts. Hemisalts of acids and bases may also be formed, for example, hemisulfate and hemicalcium salts. For a review on suitable salts, see "Handbook of Pharmaceutical Salts: Properties, Selection, and Use" by Stahl and Wermuth (Wiley-VCH, Weinheim, Germany, 2002).

[0086] Pharmaceutically acceptable salts of compounds of the invention may be prepared by for example, one or more of the following methods: (i) by reacting the compound of the invention with the desired acid or base; (ii) by removing an acid- or base-labile protecting group from a suitable precursor of the compound of the invention or by ring-opening a suitable cyclic precursor, for example, a lactone or lactam, using the desired acid or base; or (iii) by converting one salt of the compound of the invention to another by reaction with an appropriate acid or base or by means of a suitable ion exchange column.

[0087] These methods are typically carried out in solution. The resulting salt may precipitate out and be collected by filtration or may be recovered by evaporation of the solvent. The degree of ionisation in the resulting salt may vary from completely ionised to almost nonionised.

[0088] Compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are termed “isomers”. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers”. Stereoisomers that are not mirror images of one another are termed “diastereomers” and those that are non-superimposable mirror images of each other are termed “enantiomers”. When a compound has an asymmetric centre, for example, it is bonded to four different groups, a pair of enantiomers is possible. An enantiomer can be characterised by the absolute configuration of its asymmetric centre and is described by the R- and S-sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light and designated as dextrorotatory or levorotatory (i.e., as (+) or (-)-isomers respectively). A chiral compound can exist as either individual enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is called a “racemic mixture”. Where a compound of the invention has two or more stereo centres any combination of (R) and (S) stereoisomers is contemplated. The combination of (R) and (S) stereoisomers may result in a diastereomeric mixture or a single diastereoisomer. The compounds of the invention may be present as a single stereoisomer or may be mixtures of stereoisomers, for example racemic mixtures and other enantiomeric mixtures, and diasteroemeric mixtures. Where the mixture is a mixture of enantiomers the enantiomeric excess may be any of those disclosed above. Where the compound is a single stereoisomer, the compounds may still contain other diasteroisomers or enantiomers as impurities. Hence a single stereoisomer does not necessarily have an enantiomeric excess (e.e.) or diastereomeric excess (d.e.) of 100% but could have an e.e. or d.e. of about at least 85%, for example at least 90%, at least 95%, at least 99%, or at least 99.9%.

[0089] The compounds of this invention may possess one or more asymmetric centres; such compounds can therefore be produced as individual (R) or (S)stereoisomers or as mixtures thereof. Unless indicated otherwise, the description or naming of a particular compound in the specification and claims is intended to include both individual enantiomers and mixtures, racemic or otherwise, thereof. The methods for the determination of stereochemistry and the separation of stereoisomers are well known in the art (see discussion in Chapter 4 of “Advanced Organic Chemistry”, 4th edition J. March, John Wiley and Sons, New York, 2001), for example by synthesis from optically active starting materials or by resolution of a racemic form. Some of the compounds of the invention may have geometric isomeric centres (E and Z isomers). It is to be understood that the present invention encompasses all optical, diastereoisomers and geometric isomers and mixtures thereof

[0090] Z / E (e.g., cis / trans) isomers may be separated by conventional techniques well known to those skilled in the art, for example, chromatography and fractional crystallisation.

[0091] Conventional techniques for the preparation / isolation of individual enantiomers when necessary include chiral synthesis from a suitable optically pure precursor or resolution of the racemate (or the racemate of a salt or derivative) using, for example, chiral high-pressure liquid chromatography (HPLC). Thus, chiral compounds of the invention (and chiral precursors thereof) may be obtained in enantiomerically-enriched form using chromatography, typically HPLC, on an asymmetric resin with a mobile phase consisting of a hydrocarbon, typically heptane or hexane, containing from 0 to 50% by volume of isopropanol, typically from 2% to 20%, and for specific examples, 0 to 5% by volume of an alkylamine e.g., 0.1% diethylamine. Concentration of the eluate affords the enriched mixture.

[0092] Alternatively, the racemate (or a racemic precursor) may be reacted with a suitable optically active compound, for example, an alcohol, or, in the case where the compound of the invention contains an acidic or basic moiety, a base or acid such as 1-phenylethylamine or tartaric acid. The resulting diastereomeric mixture may be separated by chromatography and / or fractional crystallization and one or both of the diastereoisomers converted to the corresponding pure enantiomer(s) by means well known to a skilled person.

[0093] When any racemate crystallises, crystals of two different types are possible. The first type is the racemic compound (true racemate) referred to above wherein one homogeneous form of crystal is produced containing both enantiomers in equimolar amounts. The second type is the racemic mixture or conglomerate wherein two forms of crystal are produced in equimolar amounts each comprising a single enantiomer.

[0094] While both of the crystal forms present in a racemic mixture have identical physical properties, they may have different physical properties compared to the true racemate. Racemic mixtures may be separated by conventional techniques known to those skilled in the art - see, for example, “Stereochemistry of Organic Compounds” by E. L. Eliel and S. H. Wilen (Wiley, 1994).

[0095] Compounds and salts described in this specification may be isotopically-labelled (or “radio-labelled”). Accordingly, one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number typically found in nature. Examples of radionuclides that may be incorporated include 2H (also written as “D” for deuterium), 3H (also written as “T” for tritium), 11C, 13C, 14C, 15O, 17O, 18O, 13N, 15N, 18F, 36CI, 123l, 25l, 32P, 35S and the like. The radionuclide that is used will depend on the specific application of that radio-labelled derivative. For example, for in vitro competition assays, 3H or 14C are often useful. For radio-imaging applications, 11C or 18F are often useful. In some embodiments, the radionuclide is 3H. In some embodiments, the radionuclide is 14C. In some embodiments, the radionuclide is 11C. And in some embodiments, the radionuclide is 18p

[0096] Isotopically-labelled compounds can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described using an appropriate isotopically-labelled reagent in place of the non-labelled reagent previously employed.

[0097] The selective replacement of hydrogen with deuterium in a compound may modulate the metabolism of the compound, the PK / PD properties of the compound and / or the toxicity of the compound. For example, deuteration may increase the half-life or reduce the clearance of the compound in vivo. Deuteration may also inhibit the formation of toxic metabolites, thereby improving safety and tolerability. It is to be understood that the invention encompasses deuterated derivatives of compounds of formula (I). As used herein, the term deuterated derivative refers to compounds of the invention where in a particular position at least one hydrogen atom is replaced by deuterium. Accordingly, in a compound of the invention one or more hydrogen atom is optionally replaced by deuterium. For example, one or more hydrogen atoms in a Ci-4-alkyl group may be replaced by deuterium to form a deuterated Ci-4-alkyl group.

[0098] Certain compounds of the invention may exist in solvated as well as unsolvated forms such as, for example, hydrated forms. It is to be understood that the invention encompasses all such solvated forms.

[0099] It is also to be understood that certain compounds of the invention may exhibit polymorphism, and that the invention encompasses all such forms.

[00100] Compounds of the invention may exist in a number of different tautomeric forms and references to compounds of the invention include all such forms. For the avoidance of doubt, where a compound can exist in one of several tautomeric forms, and only one is specifically described or shown, all others are nevertheless embraced by compounds of the invention. Examples of tautomeric forms include keto-, enol-, and enolate-forms, as in, for example, the following tautomeric pairs: keto / enol (illustrated below), imine / enamine, amide / imino alcohol, amidine / amidine, nitroso / oxime, thioketone / enethiol, and nitro / aci-nitro. ZO \ OH H+ x O’ —c-c' === c=cz === c=cz | \ / H+ / \ keto enol enolate

[00101] The in vivo effects of a compound of the invention may be exerted in part by one or more metabolites that are formed within the human or animal body after administration of a compound of the invention.

[00102] It is further to be understood that a suitable pharmaceutically-acceptable prodrug of a compound of the formula (I) also forms an aspect of the present invention. Accordingly, the compounds of the invention encompass pro-drug forms of the compounds and the compounds of the invention may be administered in the form of a pro-drug (i.e., a compound that is broken down in the human or animal body to release a compound of the invention). A pro-drug may be used to alter the physical properties and / or the pharmacokinetic properties of a compound of the invention. A pro-drug can be formed when the compound of the invention contains a suitable group or substituent to which a propertymodifying group can be attached. Examples of pro-drugs include in v / vo-cleavable ester derivatives that may be formed at a carboxy group or a hydroxy group in a compound of the invention and in v / vo-cleavable amide derivatives that may be formed at a carboxy group or an amino group in a compound of the invention.

[00103] Accordingly, the present invention includes those compounds of the invention as defined herein when made available by organic synthesis and when made available within the human or animal body by way of cleavage of a pro-drug thereof. Accordingly, the present invention includes those compounds of the formula (I) that are produced by organic synthetic means and also such compounds that are produced in the human or animal body by way of metabolism of a precursor compound, that is a compound of the formula (I) may be a synthetically-produced compound or a metabolically-produced compound.

[00104] A suitable pharmaceutically-acceptable pro-drug of a compound of the invention is one that is based on reasonable medical judgement as being suitable for administration to the human or animal body without undesirable pharmacological activities and without undue toxicity.

[00105] Various forms of pro-drug have been described, for example in the following documents:- a) Methods in Enzymology, Vol. 42, p. 309-396, edited by K. Widder, et al. (Academic Press, 1985); b) Design of Pro-drugs, edited by H. Bundgaard, (Elsevier, 1985); c) A Textbook of Drug Design and Development, edited by Krogsgaard-Larsen and H. Bundgaard, Chapter 5 “Design and Application of Pro-drugs”, by H. Bundgaard p. 113-191 (1991); d) H. Bundgaard, Advanced Drug Delivery Reviews, 8, 1-38 (1992); e) H. Bundgaard, et al., Journal of Pharmaceutical Sciences, 77, 285 (1988); f) N. Kakeya, et al., Chern. Pharm. Bull., 32, 692 (1984); g) T. Higuchi and V. Stella, “Pro-Drugs as Novel Delivery Systems”, A.C.S. Symposium Series, Volume 14; and h) E. Roche (editor), “Bioreversible Carriers in Drug Design”, Pergamon Press, 1987.

[00106] A suitable pharmaceutically-acceptable pro-drug of a compound of the formula (I) that possesses a carboxy group is, for example, an in v / Vo-cleavable ester thereof. An in v / Vo-cleavable ester of a compound of the invention containing a carboxy group is, for example, a pharmaceutically-acceptable ester which is cleaved in the human or animal body to produce the parent acid. Suitable pharmaceutically-acceptable esters for carboxy include C1-6 alkyl esters such as methyl, ethyl and tert-butyl, C1-6 alkoxymethyl esters such as methoxymethyl esters, C1-6 alkanoyloxymethyl esters such as pivaloyloxymethyl esters, 3-phthalidyl esters, C3-8 cycloalkylcarbonyloxy- C1-6 alkyl esters such as cyclopentylcarbonyloxymethyl and 1-cyclohexylcarbonyloxyethyl esters, 2-oxo-1,3-dioxolenylmethyl esters such as 5-methyl-2-oxo-1,3-dioxolen-4-ylmethyl esters and C1-6 alkoxycarbonyloxy- C1-6 alkyl esters such as methoxycarbonyloxymethyl and 1 -methoxycarbonyloxyethyl esters.

[00107] A suitable pharmaceutically-acceptable pro-drug of a compound of the invention that possesses a hydroxy group is, for example, an in v / vo-cleavable ester or ether thereof. An in v / vo-cleavable ester or ether of a compound of the invention containing a hydroxy group is, for example, a pharmaceutically-acceptable ester or ether which is cleaved in the human or animal body to produce the parent hydroxy compound. Suitable pharmaceutically-acceptable ester forming groups for a hydroxy group include inorganic esters such as phosphate esters (including phosphoramidic cyclic esters). Further suitable pharmaceutically-acceptable ester forming groups fora hydroxy group include Ci-walkanoyl groups such as acetyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl groups, C1-10alkoxycarbonyl groups such as ethoxycarbonyl, / V, / V-(Ci-6alkyl)2carbamoyl, 2-dialkylaminoacetyl and 2-carboxyacetyl groups. Examples of ring substituents on the phenylacetyl and benzoyl groups include aminomethyl, / V-alkylaminomethyl, N,N-dialkylaminomethyl, morpholinomethyl, piperazin-1-ylmethyl and 4-(Ci-4 alkyl)piperazin-1-ylmethyl. Suitable pharmaceutically-acceptable ether forming groups for a hydroxy group include a-acyloxyalkyl groups such as acetoxymethyl and pivaloyloxymethyl groups.

[00108] A suitable pharmaceutically-acceptable pro-drug of a compound of the invention that possesses a carboxy group is, for example, an in v / vo-cleavable amide thereof, for example an amide formed with an amine such as ammonia, a C1-4 alkylamine such as methylamine, a (C1-4 alkyl)2amine such as dimethylamine, / V-ethyl- / V-methylamine or diethylamine, a C1-4 alkoxy- C2-4 alkylamine such as 2-methoxyethylamine, a phenyl-Ci-4 alkylamine such as benzylamine and amino acids such as glycine or an ester thereof.

[00109] A suitable pharmaceutically-acceptable pro-drug of a compound of the invention that possesses an amino group is, for example, an in v / vo-cleavable amide or carbamate derivative thereof. Suitable pharmaceutically-acceptable amides from an amino group include, for example an amide formed with Ci-ioalkanoyl groups such as an acetyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl groups. Examples of ring substituents on the phenylacetyl and benzoyl groups include aminomethyl, N-alkylaminomethyl, / V, / V-dialkylaminomethyl, morpholinomethyl, piperazin-1-ylmethyl and 4-(Ci-4 alkyl)piperazin-1-ylmethyl. Suitable pharmaceutically-acceptable carbamates from an amino group include, for example acyloxyalkoxycarbonyl and benzyloxycarbonyl groups.

[00110] Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers, or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[00111] Features, integers, characteristics, compounds, chemical moieties, or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

[00112] The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference. COMPOUNDS

[00113] In certain embodiments the compound of the formula (I) is a compound of the formula (IV), or a pharmaceutically acceptable salt thereof: R3 (IV) wherein R3, R4, and R5are as defined for formula (I).

[00114] The following paragraphs are applicable to the compounds of the invention, including compounds of the formulae (I) to (IV), where possible.

[00115] In an embodiment, R1 is independently selected from: halo, -CN, Ci-Ce alkyl, Ci-Ce haloalkyl, and C3-C6 cycloalkyl.

[00116] In an embodiment, R1 is independently selected from: halo, -CN, C1-C3 alkyl, C1-C3 haloalkyl, and C3 cycloalkyl.

[00117] In an embodiment, R1 is independently selected from: halo, -CN, and C1-C3 alkyl.

[00118] In an embodiment, R1 is independently selected from: halo, -CN, and methyl.

[00119] In an embodiment, R1 is halo. In an embodiment, R1 is chloro.

[00120] In an embodiment, R2 is H. In an embodiment, R2 is halo. In an embodiment, R2 is -CN.

[00121] In an embodiment, R1 is independently selected from: halo, -CN, and methyl, and R2 is H. In an embodiment, R1 is halo and R2 is H. In an embodiment, R1 is chloro and R2 is H.

[00122] In an embodiment, R3 is halo. In an embodiment, R3 is fluoro. In an embodiment, R3 is chloro. In an embodiment, R3 is bromo.

[00123] In an embodiment, R3 is -O-Ci-Ce alkyl. In an embodiment, R3 is -O-C1-C3 alkyl. In an embodiment, R3 is -OMe.

[00124] In an embodiment R4 is independently selected from: halo, -CN, C1-C3 alkyl, -O-C1-C3 alkyl, C3-C6 cycloalkyl, -O-C3-C6 cycloalkyl, and -O-C1-C3 alkyl-Cs-Ce cycloalkyl.

[00125] In an embodiment R4 is independently selected from: halo, -CN, C1-C3 alkyl, -O-C1-C3 alkyl, C3 cycloalkyl, -O-C3 cycloalkyl, and -O-C1-C3 alkyl-Cs cycloalkyl.

[00126] In an embodiment R4 is independently selected from: halo, -CN, Ci-Ce alkyl, and -O-Ci-Ce alkyl.

[00127] In an embodiment R4 is independently selected from: halo, -CN, C1-C3 alkyl, and -O-C1-C3 alkyl.

[00128] In an embodiment R4 is independently selected from: Ci-Ce alkyl, and -O-Ci-Ce alkyl.

[00129] In an embodiment R4 is Ci-Ce alkyl. In an embodiment R4 is C1-C3 alkyl. In an embodiment R4 is methyl. In an embodiment R4 is ethyl.

[00130] In an embodiment, R4 is halo. In an embodiment, R4 is fluoro. In an embodiment, R4 is chloro. In an embodiment, R4 is bromo.

[00131] In an embodiment, R4 is -CN.

[00132] In an embodiment R4 is -O-Ci-Ce alkyl. In an embodiment R4 is -O-C1-C3 alkyl. In an embodiment R4 is -OMe. In an embodiment R4 is -OEt.

[00133] In an embodiment, R4 is substituted with from 1 to 6 groups selected from: deuterium, -CN, halo, -O-C1-C3 alkyl, and -O-C1-C3 haloalkyl, e.g. R4 is methyl or ethyl substituted with from 1 to 5 groups selected from: deuterium, -CN, and halo.

[00134] In an embodiment, R4 is substituted with from 1 to 3 groups selected from: deuterium, -CN, halo, -O-C1-C3 alkyl, and -O-C1-C3 haloalkyl, e.g. R4 is methyl or ethyl substituted with from 1 to 3 groups selected from: deuterium, -CN, and halo.

[00135] In an embodiment, R4 is substituted with from 1 to 6 groups selected from: deuterium, -CN, and halo, e.g. R4 is methyl or ethyl substituted with from 1 to 3 groups selected from: deuterium, -CN, and halo.

[00136] In an embodiment, R4 is substituted with from 1 to 3 groups selected from: deuterium, -CN, and halo, e.g. R4 is methyl or ethyl substituted with from 1 to 3 groups selected from: deuterium, -CN, and halo.

[00137] In an embodiment, R4 is substituted with from 1 to 3 groups selected from: -CN and halo, e.g. R4 is methyl or ethyl substituted with from 1 to 3 groups selected from: -CN, and halo.

[00138] In an embodiment, R4 is substituted with from 1 to 3 halo groups. In an embodiment, R4 is substituted with from 1 to 3 fluoro groups. In an embodiment, R4 is methyl or ethyl substituted with from 1 to 3 fluoro groups.

[00139] In an embodiment, R4 is substituted with 2 fluoro groups. In an embodiment, R4 is methyl or ethyl substituted with 2 fluoro groups.

[00140] In an embodiment, R4 is substituted with from 1 to 3 halo groups and from 1 to 3 deuterium groups. In an embodiment, R4 is methyl or ethyl substituted with from 1 to 3 fluoro groups and from 1 to 3 deuterium groups.

[00141] In an embodiment, R4 is substituted with from 1 to 3 halo groups and 2 deuterium groups. In an embodiment, R4 is methyl or ethyl substituted with from 1 to 3 fluoro groups and 2 deuterium groups.

[00142] In an embodiment, R4 is substituted with a -CN group and from 1 to 3 deuterium groups. In an embodiment, R4 is methyl or ethyl substituted with a -CN group and from 1 to 3 deuterium groups.

[00143] In an embodiment, R4 is substituted with a -CN group and 2 deuterium groups. In an embodiment, R4 is methyl or ethyl substituted with a -CN group and 2 deuterium groups.

[00144] In an embodiment, R4 is -O-CH2CH2F. In an embodiment, R4 is -CF3. In an embodiment, R4 is -CH2CH2CH2F. In an embodiment, R4 is -CH2CHF2. In an embodiment, R4 is -CH2CH2CN. In an embodiment, R4 is -CH2CN. In an embodiment, R4 is -O-CH2CHF2.

[00145] In an embodiment, R4 is -O-CH2CH2F. In an embodiment, R4 is -CH2CH2CH2F. In an embodiment, R4 is -CH2CHF2. In an embodiment, R4 is -CH2CH2CN. In an embodiment, R4 is -O-CH2CHF2.

[00146] In an embodiment, R5 is H. In an embodiment, R5 is halo. In an embodiment, R5 is fluoro. In an embodiment, R5 is chloro. In an embodiment, R5 is bromo.

[00147] In an embodiment, R5 is -O-Ci-Ce alkyl. In an embodiment, R5 is -O-C1-C3 alkyl. In an embodiment, R5 is -OMe.

[00148] In an embodiment, R3 is halo or -O-C1-C3 alkyl and R5 is H.

[00149] In an embodiment, R3 is fluoro and R5 is H.

[00150] In an embodiment, R3 is -OMe and R5 is H.

[00151] In an embodiment, R6 is independently selected from: H, halo, C1-C3 alkyl, C1-C3 haloalkyl, -O-C1-C3 alkyl, and -O-C1-C3 haloalkyl.

[00152] In an embodiment, R6 is independently selected from: H, halo, C1-C3 alkyl, and C1-C3 haloalkyl.

[00153] In an embodiment, R6 is independently selected from: H, and halo.

[00154] In an embodiment, R6 is H. In an embodiment, R6 is halo. In an embodiment, R6 is fluoro. In an embodiment, R6 is chloro. In an embodiment, R6 is bromo.

[00155] In an embodiment, X1 is CH.

[00156] In another embodiment there is provided a compound selected from Compound List 1, or a pharmaceutically acceptable salt thereof: Compound List 1 Example Structure IUPAC Name 1 / °A1 o. .o AA"01 F An n n MeO H N—nh 6-chloro-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide 2 0..0 AVCI f"^ A A ;s;vAA MeO^N H ANh 6-chloro-N-(5-(3-fluoropropyl)-4-methoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide 3 Vo-* F- / ~V AnhYyj \ / -N F o( H 6-chloro-N-(5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide 4 o CA \ / o. / ;w o' zi z 6-chloro-N-(5-(2-cyanoethyl)-4-methoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide 5 MeO 0. -0 AA'01 f7^ \ A # SA H N-nh 6-chloro-N-(5-(2,2-difluoroethoxy)-4-methoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide 6 MeO \ 0..0 / Ar01 F An N \\ MeO N H Anh 6-chloro-N-(5-(2,2- difluoroethoxy)-4,6-dimethoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide 7 MeO °' -0 AA"CI F2HC a A Me0^N H Lnh 6-chloro-N-(5-(difluoromethoxy)- 4,6-dimethoxypyrimidin-2-yl)- 1 H-indazole-3-sulfonamide 8 MeO °'-0 AA'01 A A ;saAA MeO^ H Anh 6-chloro-N-(5-(2-cyanoethyl)- 4,6-dimethoxypyrimidin-2-yl)- 1 H-indazole-3-sulfonamide PHARMACEUTICAL COMPOSITIONS

[00157] In accordance with another aspect, the present invention provides a pharmaceutical 5 composition comprising a compound of the invention, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

[00158] Conventional procedures for the selection and preparation of suitable pharmaceutical compositions are described in, for example, "Pharmaceuticals - The Science of Dosage Form Designs", M. E. Aulton, Churchill Livingstone, 1988.

[00159] The compositions of the invention may be in a form suitable for oral use (for example as tablets, lozenges, hard or soft capsules, aqueous or oily suspensions, emulsions, dispersible powders or granules, syrups or elixirs), for sublingual use, for topical use (for example as creams, ointments, gels, or aqueous or oily solutions or suspensions), for administration by inhalation (for example as a finely divided powder or a liquid aerosol), for administration by insufflation (for example as a finely divided powder) or for parenteral administration (for example as a sterile aqueous or oily solution for intravenous, subcutaneous, intramuscular or intraperitoneal dosing or as a suppository for rectal dosing).

[00160] The compositions of the invention may be obtained by conventional procedures using conventional pharmaceutical excipients, well known in the art. Thus, compositions intended for oral use may contain, for example, one or more colouring, sweetening, flavouring and / or preservative agents.

[00161] An effective amount of a compound of the present invention for use in therapy of a condition is an amount sufficient to symptomatically relieve in a warm-blooded animal, particularly a human the symptoms of the condition or to slow the progression of the condition.

[00162] The amount of active ingredient that is combined with one or more excipients to produce a single dosage form will necessarily vary depending upon the host treated and the particular route of administration. For example, a formulation intended for oral administration to humans will generally contain, for example, from 0.1 mg to 0.5 g of active agent (more suitably from 0.5 to 100 mg, for example from 1 to 30 mg) compounded with an appropriate and convenient amount of excipients which may vary from about 5 to about 98 percent by weight of the total composition.

[00163] The size of the dose for therapeutic or prophylactic purposes of a compound of the invention will naturally vary according to the nature and severity of the conditions, the age and sex of the animal or patient and the route of administration, according to well- known principles of medicine.

[00164] In using a compound of the invention for therapeutic or prophylactic purposes it will generally be administered so that a daily dose in the range, for example, a daily dose selected from 0.1 mg / kg to 100 mg / kg, 1 mg / kg to 75mg / kg, 1 mg / kg to 50 mg / kg, 1 mg / kg to 20 mg / kg or 5 mg / kg to 10 mg / kg body weight is received, given if required in divided doses. In general, lower doses will be administered when a parenteral route is employed. Thus, for example, for intravenous, subcutaneous, intramuscular or intraperitoneal administration, a dose in the range, for example, 0.1 mg / kg to 30 mg / kg body weight may be suitable. Similarly, for administration by inhalation, a dose in the range, for example, 0.05 mg / kg to 25 mg / kg body weight may be suitable. When administered orally a total daily dose of a compound of the invention may be, for example, selected from: 1 mg to 1000 mg, 5 mg to 1000 mg, 10 mg to 750 mg or 25 mg to 500 mg. Typically, unit dosage forms will contain about 0.5 mg to 0.5 g of a compound of the invention. In a particular embodiment the compound of the invention is administered parenterally, for example by intravenous administration. In another particular embodiment the compound of the invention is administered orally. THERAPEUTIC USES AND APPLICATIONS

[00165] In this section describing therapeutic uses, applications and methods of treatment reference to “a compound of the invention” includes compounds according to any to any of formulae (I) to (IV), or a pharmaceutically acceptable salt thereof.

[00166] Also provided is the use of a compound of the invention, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament.

[00167] Also provided is the use of a compound of the invention, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prophylaxis of a GPR17-associated disease.

[00168] In the following sections of the application, reference is made to a compound of the invention, or a pharmaceutically acceptable salt thereof for use in the treatment of certain diseases or medical disorders. It is to be understood that any reference herein to a compound for a particular use is also intended to be a reference to (i) the use of the compound of the invention, or pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment of that disease or disorder; and (ii) a method for the treatment of the disease or disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of the compound of the invention, or pharmaceutically acceptable salt thereof.

[00169] In certain embodiments the GPR17-associated disease is selected from: a disease of the central nervous system (CNS), diseases associated with a myelination disorder, multiple sclerosis (MS), neuromyelitis optica (Devic’s disease), neuromyelitis optica spectrum disorder (NMOSD), chronic relapsing inflammatory optic neuritis, acute disseminated encephalomyelitis, acute haemorrhagic leucoencephalitis (AHL), periventricular leukomalacia, e.g. periventricular leukomalacia demyelination due to viral infections, such as by HIV or progressive multifocal leucoencephalopathy, central pontine and extrapontine myelinolysis, demyelination due to traumatic brain injury and / or traumatic brain tissue damage, including compression-induced demyelination, e.g. by tumours, demyelination in response to hypoxia, e.g. polycythemia vera, demyelination in response to stroke or ischaemia or other cardiovascular diseases, demyelination due to exposure to carbon dioxide, cyanide, or other CNS toxins, Schilder’s disease, Balo concentric sclerosis, Perinatal encephalopathy; Neurodegenerative Diseases (such as Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease (AD), Multiple system atrophy, Parkinson’s Disease, Spinocerebellar ataxia (SCA), and Huntington’s Disease); psychiatric disorders (such as schizophrenia and bipolar disorder), and peripheral myelination diseases (such as leukodystrophies (e.g. Pelizaeus-Merzbacher disease), peripheral demyelinating neuropathies, Dejerine-Sottas syndrome and Charcot-Marie-Tooth disease).

[00170] In certain embodiments the GPR17-associated disease is selected from: multiple sclerosis (MS), neuromyelitis optica (Devic’s disease), neuromyelitis optica spectrum disorder (NMOSD), Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease (AD), Parkinson’s Disease, stroke, traumatic brain injury, Pelizaeus-Merzbacher disease, Polycythemia vera, and schizophrenia.

[00171] In certain embodiments the GPR17-associated disease is selected from: multiple sclerosis (MS), neuromyelitis optica (Devic’s disease), neuromyelitis optica spectrum disorder (NMOSD), Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease (AD), and Parkinson’s Disease (PD).

[00172] In certain embodiments the GPR17-associated disease is multiple sclerosis (MS).

[00173] In certain embodiments the GPR17-associated disease is obesity. EXAMPLES Abbreviations aq BAST aqueous; Bis(2-methoxyethyl)aminosulfur Trifluoride (Deoxo-Fluor®); B(OMe)3 CDCI3 trimethyl borate; chloroform-d (deuterated chloroform); CS2CO3 cesium carbonate; DCM dichloromethane; DIEA N,N-diisopropylethylamine; dioxane 1,4-dioxane; DMF N,N-dimethylformamide; DMSO-cfe CD3S(O)CD3 (deuterated dimethylsulfoxide); ESI electrospray atmospheric pressure ionization; EtOAc ethyl acetate; EtOH ethanol; Fe iron; g h gram; hour; HATU O-(7-azabenzotriazol-1-yl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate; HOAc acetic acid; HOBT 1 -hydroxybenzotriazole; HPLC high performance liquid chromatography; Hz hertz; 1H NMR proton nuclear magnetic resonance; H2O water; H2O2 hydrogen peroxide; iPrOH isopropanol; K degree Kelvin; K2CO3 potassium carbonate; KOAc potassium acetate; KOH potassium hydroxide; LAH Lithium aluminium hydride; LC-MS liquid chromatography-mass spectrometry; LiOH lithium hydroxide; M molar; MeCN acetonitrile; MeOH methanol; mg MgSO4 milligrams; magnesium sulphate; MHz megahertz; min minutes; mL millilitres; mmol millimoles; MS mass spectrometry; MW microwave; m / z mass charge ratio; NaH sodium hydride; NaNO2 sodium nitrite; Na2SOs sodium sulfite; n-BuLi n-butyllithium; NBS N-bromosuccinimide; nh3 ammonia; NH4CI ammonium chloride; nm nanometer; PCI5 phosphorous pentachloride; POCI3 phosphoryl chloride; Pd / C palladium on carbon; Pd(dppf)CI2 PE [1,1’-bis(diphenylphosphino)ferrocene]dichloropalladium; petroleum ether; PMB para-methoxybenzyl; PMB-CI para-methoxybenzylchloride; PPh3 triphenylphosphine; PPm Rt parts per million; retention time; RT room temperature; TBAB tetrabutylammonium bromide; TEA triethylamine; TFA trifluoroacetic acid; THF tetrahydrofuran; TLC thin layer chromatography; NaSO4 sodium sulphate; UPLC ultra performance liquid chromatography; UV ultraviolet; v / v volume / volume.

[00174] All starting materials and solvents were either purchased from commercial sources or obtained according to the literature citations. All reaction mixtures were stirred using a magnetic stir bar apparatus and conducted at room temperature (ca. 20 °C) unless otherwise indicated.

[00175] Column chromatography was performed on an automated flash chromatography system, such as a Biotage Isolera Rf system, using pre-packed silica (40 pm) cartridges, unless otherwise indicated.

[00176] 1H NMR spectra were recorded using a Bruker AVANCE 400 MHz spectrometer. Data for 1H are reported as chemical shift (ppm) along with multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet). Chemical shifts are expressed in parts per million using either the central peaks of the residual protic solvent or an internal standard of tetramethylsilane as references. The spectra were recorded at 298 K unless otherwise indicated.

[00177] Analytical UPLC-MS experiments to determine retention times and associated mass ions were performed using a Waters ACQUITY LIPLC® H-Class system, equipped with ACQUITY PDA Detector and ACQUITY QDa Mass Detector, running one of the analytical methods described below.

[00178] Analytical LC-MS experiments to determine retention times and associated mass ions were performed using an Agilent 1200 series HPLC system coupled to an Agilent 1956, 6100 or 6120 series single quadrupole mass spectrometer running one of the analytical methods described below. Compound Names

[00179] Nomenclature of structures was generated using ‘Structure to Name’ conversion from ChemDraw® Professional 17 (PerkinElmer). Preparative HPLC Generic Methods: HPLC Instruments: Shimadzu 20AP UV detector: SPD-20A. UV wavelength: 214 nm and 254 nm. Conditions 1: Mobile phase A: water; Mobile phase B: acetonitrile. Conditions 2: Mobile phase A: water with 0.1% trifluoroacetic acid; Mobile phase B: acetonitrile. Conditions 3: Mobile phase A: water with 0.1% formic acid; Mobile phase B: acetonitrile. Conditions 4: Mobile phase A: water with 0.1% ammonium hydroxide; Mobile phase B: acetonitrile. Column: Agilent 10 Prep-C18 250 x 21.2 mm. Column temperature: Ambient LC gradient: 20% to 85% in 20 min; then 85% to 100% in 0.01 min; then hold 100% for 5 min; then 100 % to 20% in 0.01 min; hold at 20% for 5 min. LC Flow rate: 20 mL / min binary pump. Preparative TLC Generic Method

[00180] The crude mixture or mixture of diastereoisomers was dissolved in DCM at a concentration of approximately 20 mg / 1 mL and applied to a preparative TLC silica gel plate. The plate was allowed to dry then was eluted in the appropriate solvent. The plate was visualised under UV light and the silica containing the product of interest collected, suspended in a mixture of DCM / MeCN (v / v=10 / 1) and sonicated. The suspension was filtered and the filter cake washed, the filtrate was concentrated under vaccum to give the desired product. Analytical Methods Method 1 - Acidic method (Shimadzu 3 min) Column: Shimadzu LC-20AD series, Binary Pump, Diode Array Detector. Agilent Poroshell 120 EC-C18, 2.7 pm, 4.6x50 mm column Detection: 2020, Quadrupole LC / MS, Ion Source: API-ESI, TIC: 100-900 m / z, Drying gas flow: 15 L / min, Nebulizer pressure: 1.5 L / min, Drying gas temperature: 250 °C, Vcap: 4500V. Samples were dissolved in methanol at 1-10 pg / mL, then filtered through a 0.22 pm filter membrane. Injection volume: 1-10 pL. Detector: 214 nm, 254 nm. Detection wavelength: 214 nm, 254 nm. Solvents: A: 0.05% v / v Formic acid in water, B: 0.05% v / v Formic acid in MeCN Gradient: T (min) A(%) B(%) Flow rate (mL / min) 0.00 80 15 1.5 0.28 80 15 1.5 2.38 10 90 1.5 2.39 0 100 1.5 2.69 0 100 1.5 2.70 85 15 1.5 3.00 85 15 1.5 Method 2 - Acidic 5 min method (Shimadzu 5 min) Column: Shimadzu LC-20AD series, Binary Pump, Diode Array Detector. Agilent Poroshell 120 EC-C18, 2.7 pm, 4.6x50 mm column. Detection: 2020, Quadrupole LC / MS, Ion Source: API-ESI, TIC: 100-900 m / z, Drying gas flow: 15 L / min, Nebulizer pressure: 1.5 L / min, Drying gas temperature: 250 °C, Vcap: 4500V. Samples were dissolved in methanol at 1—10 pg / mL, then filtered through a 0.22 pm filter membrane. Injection volume: 1—10 pL. Detection wavelength: 214 nm, 254 nm. Solvents: A: 0.05% formic acid in water (v / v), B: 0.05% formic acid in MeCN (v / v). Gradient: T (min) A(%) B(%) Flow rate (mL / min) 0.00 80 15 1.0 0.50 80 15 1.0 4.00 15 85 1.0 4.01 0 100 1.0 4.50 0 100 1.0 4.51 85 15 1.0 5.00 85 15 1.0 Method 3 -Acidic method (Waters QDa 3 min) Column: Waters QDa, Binary Pump, Diode Array Detector. Waters CORTECS LIPLC, C18, 1.6 pm, 2.1x50 mm column. Detection: QDa, Quadrupole LC / MS, Ion Source: API-ES, TIC: 70-900 m / z, Fragmentor: 10 70, Drying gas flow: 12 L / min, Nebulizer pressure: 36 psi, Drying gas temperature: 350 °C, Vcap: 3000V. Samples were dissolved in methanol at 1-10 pg / mL, then filtered through a 0.22 pm filter membrane. Injection volume: 1-10 pL. Detector: 214 nm, 254 nm. Solvents: A: 0.05% Formate in water (v / v), B: 0.05% Formate in MeCN (v / v). Gradient: T (min) A(%) B(%) Flow rate(m L / min) 0.00 80 20 0.6 1.80 20 80 0.6 2.65 20 80 0.6 2.80 80 20 0.6 3.00 80 20 0.6 15 General Synthetic Routes

[00181] The compounds of the invention may be prepared by methods well known to those skilled in the art and as described in the synthetic experimental procedures shown below.

[00182] Compounds of the invention may be prepared according to General Scheme 1: General Scheme 1

[00183] An appropriately substituted indazole or 7-azaindazole (1-1), for example the commercially available 6-chloro-1 / - / -indazole (CAS 698-25-9) or 6-chloro-1 / - / -pyrazolo[3,4-b]pyridine (CAS 63725-51-9), can be converted to the corresponding 3-iodo intermediate (I-2), for example 6-chloro-3-iodo-1H-indazole (CAS 503045-59-8) or 6-chloro-3-iodo-1 / - / - 10 pyrazolo[3,4-b]pyridine (CAS 1259223-95-4), by reaction with iodine and potassium hydroxide in a solvent such as DMF. Palladium catalysed cross-coupling with a thiol such as benzylthiol gives the intermediate thioether (I-3). Oxidation of thioether (I-3), with for example N-chlorosuccinimide in dilute acid gives intermediate arylsulphonyl chloride (I-4). Coupling of I-4 with an appropriate arylamine, for instance intermediate amines 1-8 detailed 15 below, typically catalysed by DMAP in pyridine provides compounds of the invention.

[00184] Compounds of the invention may be prepared according to General Scheme 2: General Scheme 2

[00185] In an alternative approach (General Scheme 2), the indazole ring is formed as the penultimate or last step by diazotization and ring closure. This approach starts with an 5 appropriate benzylalcohol (I-5) such as 4-chloro-2-nitrobenzylalcohol (CAS 22996-18-5) that can be converted to the corresponding aryl bromide (I-6), such as 1-(bromomethyl)-4-chloro-2-nitrobenzene (CAS 52311-59-8) by reaction with PBra in toluene. Bromo intermediate (I-6) is converted to the methanesulfinate (I-7) by reaction with sodium sulfite and tetrabutylammonium bromide. Methanesulfinate (I-7) can be converted to the corresponding 10 sulphonylchloride (I-8) by reaction with phosphorus pentachloride. Coupling of I-8 with an appropriate arylamine, for instance intermediate amines 1-8 detailed below, typically catalysed by a base such as diethylamine provides intermediate sulphonamide (I-9). Reduction of the nitroaryl to the corresponding aniline (1-10), for example with iron in methanolic ammonium chloride provides an intermediate ready for cyclisation and formation 15 of the indazole. Treatment of aniline 1-10 with for instance sodium nitrite in acetic acid gives indazole compounds of the invention. intermediate 1: 5-(2-fluoroethoxy)-4-methoxypyrimidin-2-amine KOAc, pd(dppf)CI2 dioxane PMB 30% H2O2 THF K2CO3, MeCN Step 1: 5-bromo-4-methoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine H PMB PMB DIEA, MeCN .PMB N PMB

[00186] To a solution of 5-bromo-2-chloro-4-methoxypyrimidine (10.0 g, 44.7 mmol) in MeCN (200 mL) were added bis(4-methoxybenzyl)amine (12.7 g, 49.2 mmol) and DIEA (6.36 g, 49.2 mmol). The reaction mixture was stirred at 70 °C for 48 h. The mixture was diluted with NaHCOs (200 mL), extracted with EtOAc (2 x 300 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue obtained was purified by column chromatography on silica gel (eluent: petroleum ether : EtOAc = 50 : 1) to afford title amine (9.6 g, 48%) as a white solid. LCMS m / z = 444.05 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 8.26 (s, 1H), 7.19 (d, J = 8.2 Hz, 4H), 6.87 (d, J = 8.6 Hz, 4H), 4.68 (s, 4H), 3.87 (s, 3H), 3.72 (s, 6H). Step 2: 4-methoxy-N,N-bis(4-methoxybenzyl)-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrimidin-2-amine

[00187] To a solution of Step 1 amine (3.5 g, 7.877 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (2.4 g, 9.45 mmol) and KOAc (2.3 g, 23.63 mmol) in dioxane (70 mL) was added Pd(dppf)Ch (570 mg, 0.7877mmol). The reaction mixture was purged with N2, and then stirred at 90 °C under a N2 atmosphere overnight. The mixture was diluted with water (60 mL) and extracted with EtOAc (2 x 100 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The crude product was purified by prep-TLC (eluent: petroleum ether: EtOAc = 3 : 1) to afford title amine (1 g, 25%) as a yellow oil. LCMS m / z = 492.25 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 8.32 (s, 1H), 7.19 (d, J = 8.2 Hz, 4H), 6.89-6.85 (m, 4H), 4.74 (s, 2H), 4.68 (s, 2H), 3.79 (s, 3H), 3.72 (s, 6H), 1.24 (s, 12H). Step 3: 2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-ol 30% H2O2 THF

[00188] To a solution of Step 2 amine (1.0 g, 2 mmol) in THF (10 mL) was added 30% H2O2 (2.3 g, 20 mmol). The reaction was stirred at 0 °C for 15 min and additional 3 h at room temperature. The reaction mixture was diluted with cold Na2SO3 solution (50 mL) and extracted with EtOAc (3 x 30 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated to afford title alcohol (740 mg, 95%) as a yellow oil. LCMS m / z = 382.25 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 8.56 (s, 1H), 7.71 (s, 1H), 7.16 (d, J= 8.6 Hz, 4H), 6.86 (d, J= 8.6 Hz, 4H), 4.62 (s, 4H), 3.81 (s, 3H), 3.72 (s, 6H). Step 4: 5-(2-fluoroethoxy)-4-methoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine XPMB N PMB F K2CO3, MeCN

[00189] To a solution of Step 3 alcohol (600 mg, 1.573 mmol) in MeCN (6 mL) were added 1-fluoro-2-iodoethane (548 mg, 3.146 mmol) and K2CO3 (652 mg, 4.719 mmol). The reaction mixture was stirred at room temperature for 15 min and 80 °C for 6 h then diluted with water (10 mL), extracted with EtOAc (2 x 20 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The mixture was purified by prep-TLC (eluent: petroleum ether: EtOAc = 3:1) to afford title amine (340 mg, 50%) as a light yellow oil. LCMS m / z = 428.3 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 7.93 (s, 1H), 7.18 (d, J = 8.6 Hz, 4H), 6.88 - 6.85 (m, 4H), 4.74 - 4.71 (m, 1H), 4.65 (s, 4H), 4.62 - 4.59 (m, 1H), 4.19 -4.08 (m, 2H), 3.84 (s, 3H), 3.72 (s, 6H). Step 5: 5-(2-fluoroethoxy)-4-methoxypyrimidin-2-amine

[00190] To a solution of Step 4 amine (340 mg, 0.795 mmol) in DCM (4 mL) was added TFA (5.44 g, 47.7 mmol). The reaction mixture was stirred at room temperature overnight and 55 °C for 6 h. The mixture was concentrated and then diluted with NaHCOs solution (40 mL), extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue was purified by prep-TLC (eluent: DCM : MeOH = 15:1) to afford title amine (135 mg, 91%) as a white solid. LCMS m / z = 188.15 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 7.76 (s, 1H), 6.19 (s, 2H), 4.72-4.56 (m, 2H), 4.14 - 4.03 (m, 2H), 3.84 (s, 3H). Intermediate 2: 5-(3-fluoropropyl)-4-methoxypyrimidin-2-amine LAH,THF Step 1: ethyl (E)-3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)acrylate Cs2CO3, pd(dppf)CI2 dioxane / H2O

[00191] To a solution of 5-bromo-4-methoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine 10 (Intermediate 1 Step 1; 500 mg, 1.125 mmol), ethyl (£)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)acrylate (330 mg, 1.46 mmol) and CS2CO3 (1.1 g, 3.375 mmol) in dioxane / H2O (8 mL / 2 mL) was added Pd(dppf)Ch (82 mg, 0.1125 mmol). The reaction mixture was purged with N2, and stirred at 110 °C for 3 h under a N2 atmosphere. The mixture was diluted with water (60 mL) and extracted with EtOAc (3 x 30 mL). The combined organic 15 layers were washed with brine, dried over Na2SO4, filtered and concentrated. The crude product was purified by prep-TLC (eluent: petroleum ether: EtOAc = 4 : 1) to afford ethyl (E)-3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)acrylate (400 mg, 76%) as a yellow oil. LCMS m / z = 464.35 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 8.55 (s, 1H), 7.52 (d, J = 16.0 Hz, 1H), 7.21 (d, J = 10.0 Hz, 4H), 6.92 - 6.84 (m, 4H), 6.47 (d, J = 16.0 Hz, 1H), 4.78 (s, 2H), 4.71 (s, 2H), 4.15 (q, J= 7.2 Hz, 2H), 3.94 (s, 3H), 3.72 (s, 6H), 1.24 (t, J = 7.2 Hz, 3H). Step 2: ethyl 3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)propanoate

[00192] To a solution of Step 1 acrylate (400 mg, 0.863 mmol) in MeOH (4 mL) was added 10% Pd / C (160 mg). The reaction mixture was stirred under a H2 atmosphere for 24 h. The mixture was filtered and concentrated to afford ethyl 3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)propanoate (340 mg, 85%) which was used directly in the next step without further purification. LCMS m / z = 466.35 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 5 7.95 (s, 1H), 7.17 (d, J= 8.6 Hz, 4H), 6.86 (d, J= 8.6 Hz, 4H), 4.67 (s, 4H), 4.04 (q, J= 7.2 Hz, 2H), 3.82 (s, 3H), 3.72 (s, 6H), 2.65-2.51 (m, 4H), 1.15 (t, J= 7.2 Hz, 3H). Step 3: 3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)propan-1-ol

[00193] To a solution of ethyl 3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)propanoate (570 mg, 1.224 mmol) in THF (10 mL) at 0 °C was added LAH (2.5 M in THF, 0.98 mL, 2.448 mmol). The reaction mixture was stirred at 0 °C for 1 h under N2 atmosphere. The mixture was diluted with NH4CI aq. solution (200 mL), extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue obtained was purified by column chromatography on silica gel (eluent: Petroleum ether: EtOAc = 2 : 1) to afford title alcohol (450 mg, 86%) as a colorless oil. LCMS m / z = 424.25 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 7.93 (s, 1H), 7.18 (d, J = 8.6 Hz, 4H), 6.87 (d, J= 8.6 Hz, 4H), 4.67 (s, 4H), 4.43 (t, J = 5.1 Hz, 1H), 3.82 (s, 3H), 3.72 (s, 6H), 3.39 (q, J= 6.1 Hz, 2H), 2.37 (t, J =7.7 Hz, 2H), 1.65-1.58 (m, 2H). Step 4: 5-(3-fluoropropyl)-4-methoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine

[00194] To a solution of Step 3 alcohol (450 mg, 1.06 mmol) in DCM (8 mL) at 0 °C was added Bis(2-methoxyethyl)aminosulfur Trifluoride (Deoxo-Fluor®, BAST; 940 mg, 4.24 mmol) in toluene (2 mL). The reaction mixture was stirred at room temperature for 3 days. The mixture was diluted with NaHCOs aq. solution (100 mL), extracted with EtOAc (3 x 30 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue obtained was purified by prep-TLC (eluent: petroleum ether : EtOAc = 2 : 1) to afford title amine (240 mg, 53%) as a light yellow oil. LCMS m / z = 426.35 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 7.96 (s, 1H), 7.18 (d, J = 8.2 Hz, 4H), 6.87 (d, J = 8.6 Hz, 4H), 4.67 (s, 4H), 4.52 - 4.36 (m, 2H), 3.83 (s, 3H), 3.72 (s, 6H), 2.44 (d, J = 7.8 Hz, 2H), 1.92-1.78 (m, 2H). Step 5: 5-(3-fluoropropyl)-4-methoxypyrimidin-2-amine

[00195] To a solution of Step 4 amine (280 mg, 0.658 mmol) in DCM (3 mL) was added TFA (4.5 g, 39.48 mmol). The reaction mixture was stirred at room temperature overnight and then heated to 55 °C for 6 h. The reaction mixture was concentrated and diluted with NaHCOs solution (50 mL), extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue was purified by prep-TLC (eluent: DCM : MeOH = 15:1) to afford title amine (95 mg, 78%) as a white solid. LCMS m / z = 186.20 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 7.79 (s, 1H), 6.31 (s, 2H), 4.49 - 4.33 (m, 2H), 3.82 (s, 3H), 2.42 - 2.37 (m, 2H), 1.88 - 1.74 (m, 2H). Intermediate 3: 5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-amine Step 1: (E)-5-(2-ethoxyvinyl)-4-methoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine „PMB N PMB Cs2CO3, Pd(dppf)CI2 dioxane / H2O

[00196] To a solution of 5-bromo-4-methoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine (Intermediate 1 Step 1; 900 mg, 2.03 mmol) in dioxane (12 mL) IH2O (2 mL) was added (E)-2-(2-ethoxyvinyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (523 mg, 2.64 mmol), CS2CO3 (2 g, 6.09 mmol) and Pd(dppf)Cl2.DCM (166 mg, 0.20 mol). The reaction was purged with N2, and then stirred at 110 °C under a N2 atmosphere for 3 h. The mixture was diluted with water (80 mL) and extracted with EtOAc (3 x 30 mL). The combined organic layers was dried over Na2SO4, filtered and concentrated. The residue was purified by column chromatography on silica gel (eluent: petroleum ether / EtOAc = 20 : 1) to afford title amine (600 mg, 55.5% yield) as a yellow oil. LCMS m / z = 436.20 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 8.09 (s, 1H), 7.18 (d, J= 8.7 Hz, 4H), 7.04 (d, J = 13.0 Hz, 1H), 6.86 (d, J= 8.7 Hz, 4H), 5.61 (d, J = 12.9 Hz, 1H), 4.68 (s, 4H), 3.84 (s, 3H), 3.84 - 3.77 (m, 2H), 3.72 (s, 6H), 1.23 (t, J = 7.0 Hz, 3H). Step 2: 2-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)acetaldehyde

[00197] Step 1 amine (240 mg, 0.55 mmol) was treated with formic acid (1.4 mL) in a round bottom flask. The reaction was stirred at 60 °C for 30 min. The reaction solution was quenched with NaHCOs (aq.) solution (50 mL) and extracted with EtOAc (3 x 20 mL). The combined organic layers were dried over MgSO4, filtered, and concentrated in vacuo to afford title aldehyde as a brown oil (220 mg, 98% yield). LCMS m / z = 408.20 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 9.60 (s, 1H), 7.99 (s, 1H), 7.20 (d, J = 8.0 Hz, 4H), 6.87 (d, J = 8.4 Hz, 4H), 4.69 (s, 4H), 3.79 (s, 3H), 3.72 (s, 6H), 3.51 (s, 2H). Step 3: 5-(2,2-difluoroethyl)-4-methoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine BAST DCM 5

[00198] To a solution of Step 2 aldehyde (124 mg, 0.30 mmol) in DCM (2 mL) at 0°C was added BAST (135 mg, 0.61 mmol). The reaction was stirred at room temperature for 1 h. The reaction solution was diluted with water (30 mL) and extracted with DCM (3 x 20 mL). The combined organic layers were dried over MgSO4, filtered, and concentrated in vacuo to afford title amine (120 mg, 92.3% yield) as a brown oil. LCMS m / z = 430.15 [M+H]+. 10 Step 4: 5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-amine

[00199] To a solution of Step 3 amine (1.1 g, 2.56 mmol) in DCM (8 mL) was added TFA (8 mL). The reaction heated at 50°C for 2 days. The reaction solution was concentrated, diluted with NaHCO3(aq.) solution (100 mL) and extracted with DCM (3 x 50 mL). The combined 15 organic layers were dried over MgSO4, filtered, and concentrated in vacuo to afford title amine (230 mg, 53.6% yield) as a light yellow solid. LCMS m / z = 190.10 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 7.87 (s, 1H), 6.53 (s, 2H), 6.26 - 5.94 (m, 1H), 3.83 (s, 3H), 2.94 -2.83 (m, 2H). Intermediate 4: 3-(2-amino-4-methoxy)pyrimidin-5-yl)propanenitrile nh3h2o HATU, DIEA, DMF TFA / DCM Step 1: 3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)propanoic acid

[00200] To a solution of ethyl 3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-5 yl)propanoate (Intermediate 2 Step 2; 340 mg, 0.73 mmol) in THF (4 mL) / EtOH (1 mL) / H2O (1 mL) was added NaOH (88 mg, 2.19 mmol). The reaction was stirred at 40 °C overnight then diluted with water (30 mL) and extracted with EtOAc (30 mL). The aqueous layer was collected and acidified with 1N HCI to pH ~ 4 then extracted with EtOAc (3 x 30 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and 10 concentrated to afford title acid (300 mg, 94%) as a yellow oil. LCMS m / z = 438.35 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 12.11 (s, 1H), 7.95 (s, 1H), 7.18 (d, J = 8.4 Hz, 4H), 6.87 (d, J = 8.6 Hz, 4H), 4.67 (s, 4H), 3.83 (s, 3H), 3.72 (s, 6H), 2.58 (t, J = 7.6 Hz, 2H), 2.46 -2.41 (m, 2H). 3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)propanamide

[00201] To a solution of Step 1 acid (300 mg, 0.69 mmol) in DMF (3 mL) was added HATLI (260 mg, 0.6857 mmol) and DIEA (266 mg, 2.057 mmol). The mixture was stirred at room temperature for 30 min. NH3.H2O (0.5 mL) was added and the reaction was stirred at room temperature for another 2 h. The mixture was diluted with water (20 mL), extracted with EtOAc (3x15 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue was purified by prep-TLC (eluent: DCM:MeOH = 15:1) to afford title carboxamide (260 mg, 86 %) as a yellow solid. LCMS m / z = 437.35 [M+H]+; 1H N MR (400 MHz, DMSO-d6) 6 7.92 (s, 1H), 7.18 (d, J=8.2 Hz, 4H), 6.88 - 6.85 (m, 4H), 4.67 (s, 4H), 3.82 (s, 3H), 3.72 (s, 6H), 2.56 (t, J = 7.6 Hz, 2H), 2.26 (t, J = 7.6 Hz, 2H). Step 3: 3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-yl)propanenitrile N

[00202] To a solution of Step 2 carboxamide (200 mg, 0.458 mmol) in DMF (2 mL) was added POCI3 (210 mg, 1.374 mmol). The mixture was stirred at room temperature for 1 h. The mixture was quenched with ice / water (20 mL), extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated to afford title nitrile (165 mg, 85 %) as a yellow oil. LCMS m / z = 419.35 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 8.03 (s, 1H), 7.19 (d, J = 8.2 Hz, 4H), 6.87 (d, J = 8.6 Hz, 4H), 4.69 (s, 4H), 3.84 (s, 3H), 3.72 (s, 6H), 2.72 - 2.65 (m, 4H). Step 4: 3-(2-amino-4-methoxypyrimidin-5-yl)propanenitrile TFA / DCM

[00203] To a solution of Step 3 nitrile (165 mg, 0.394 mmol) in DCM (1 mL) was added TFA (2 mL). The reaction mixture was stirred at 50 °C overnight, and then concentrated under vacuum. The residue was diluted with NaHCOs solution (40 mL), extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue was purified by prep-TLC (eluent: DCM : MeOH = 15:1) to afford title amine (60 mg, 85%) as a white solid. LCMS m / z = 179.25 [M+H]+; 1H NMR (400 MHz, DMSO-de) 6 7.87 (s, 1H), 6.47 (s, 2H), 3.83 (s, 3H), 2.69 - 2.65 (m, 2H), 2.63 - 2.58 (m, 2H). Intermediate 5: 5-(2,2-difluoroethoxy)-4-methoxypyrimidin-2-amine XPMB N PMB Step 1: 5-(2,2-difluoroethoxy)-4-methoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine HO ., PMB N PMB CS2CO3, DMF

[00204] To a solution of 2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5-ol (Intermediate 1; Step 3; 300 mg, 0.79 mmol) in DMF (4 mL) were added 2,2-difluoroethyl trifluoromethanesulfonate (337 mg, 1.57 mmol) and CS2CO3 (770 mg, 2.37 mmol). The reaction mixture was stirred at room temperature for 1 h, then diluted with water (10 mL), extracted with EtOAc (2 x 20 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated to afford title amine (317 mg, 90%) as a yellow solid. LCMS m / z = 446.15 [M+H]+; 1H NMR (400 MHz, Chloroform-d) 5 7.92 (s, 1H), 7.17 (d, J = 8.2 Hz, 4H), 6.89 - 6.81 (m, 4H), 6.21 - 5.90 (m, 1H), 4.72 (s, 4H), 4.16 - 4.07 (m, 2H), 3.91 (s, 3H), 3.80 (s, 6H). TFA, DCM

[00205] To a solution of Step 1 amine (317 mg, 0.71 mmol) in DCM (2 mL) was added TFA (2 mL). The reaction mixture was stirred at 50 °C overnight. The mixture was concentrated and diluted with NaHCOs solution (10 mL), extracted with EtOAc (3 x 20 mL). The combined 5 organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue was purified by prep-TLC (eluent: DCM : MeOH = 20:1) to afford title amine (144 mg, 98%) as a yellow solid. LCMS m / z = 206.05 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 7.81 (s, 1H), 6.45 - 6.12 (m, 3H), 4.18 - 4.08 (m, 2H), 3.85 (s, 3H). Intermediate 6: 5-(2,2-difluoroethoxy)-4,6-dimethoxypyrimidin-2-amine 10 k2co3, dmf TFA, DCM Step 1: 5-bromo-4,6-dimethoxypyrimidin-2-amine NBS ACN

[00206] To a solution of 4,6-dimethoxypyrimidin-2-amine (10 g, 64.45 mmol) in MeCN (100 mL) was added NBS (14.8 g, 83.79 mmol) portion wise. The reaction mixture was stirred at 15 room temperature for 1 h. The mixture was diluted with EtOAc (200 mL) and washed with brine (2 x 100 mL). The organic layer was dried over Na2SO4, filtered and concentrated. The residue obtained was purified by trituration to afford title amine (12 g, 80%) as a pale green solid. 1H NMR (400 MHz, DMSO-d6) 6 6.78 (s, 2H), 3.84 (s, 6H). Step 2: 5-bromo-4,6-dimethoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine PMB-CI NaH, DMF PMB PMB

[00207] To a solution of Step 1 amine (7.9 g, 33.9 mmol) in dry DMF (70 mL) at 0 °C was added NaH (60% in oil, 4.07 g, 101.7 mmol) portion wise. The mixture was stirred at 0 °C for 30 min, para-methoxybenzylchloride (10.6 g, 67.8 mmol) was added dropwise. The reaction mixture was stirred at 0 °C for 1 h, and then allowed to warm up to room temperature. The mixture was diluted with EtOAc (200 mL), and washed with brine (2 x 100 mL). The organic layer was dried over Na2SO4, filtered and concentrated. The residue obtained was purified by trituration to afford title amine (12.6 g, 78.7%) as a white solid. LCMS m / z = 474.10 [M+H]+ ; 1H NMR (400 MHz, DMSO-d6) 6 7.23 (d, J= 8.6 Hz, 4H), 6.88 (d, J= 8.6 Hz, 4H), 4.68 (s, 4H), 3.84 (s, 6H), 3.73 (s, 6H). Step 3: 2-(bis(4-methoxybenzyl)amino)-4,6-dimethoxypyrimidin-5-ol 2) H2O2 1) n-BuLi, B(OMe)3, AcOH, THF

[00208] To a solution of Step 2 amine (10 g, 21.14 mmol) in dry THF (70 mL) under N2 atmosphere at-78 °C was added n-BuLi (2.5 M in hexane, 11 mL, 27.48 mmol). The resulting yellow solution was stirred at-78 °C for 30 min. Trimethyl borate (3.34 mL, 31.71 mmol) was added dropwise and the stirring was continued at -78 °C for 1.5 h. The reaction mixture was allowed to warm up to 0 °C, and AcOH (2.28 mL, 42.3 mmol) was added dropwise, followed by 30% H2O2 (3.06 mL, 31.71 mmol). The stirring was continued at 0 °C for 1.5 h. The mixture was poured into Na2S20s (aq.) and extracted with EtOAc (2 x 200 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue obtained was purified by column chromatography on silica gel (eluent: petroleum ether: EtOAc = 5 : 1) to afford title alcohol (7.5 g, 86.3%) as a yellow solid. LCMS m / z = 412.20 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 7.62 (s, 1H), 7.20 (d, J = 8.4 Hz, 4H), 6.86 (d, J= 8.4 Hz, 4H), 4.62 (s, 4H), 3.78 (s, 6H), 3.72 (s, 6H). Step 4: 5-(2,2-difluoroethoxy)-4,6-dimethoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine

[00209] To a solution of Step 3 alcohol (2.0 g, 4.86 mmol) in DMF (20 mL) was added K2CO3 (2.01 g, 14.59 mmol) and 1,1-difluoro-2-iodoethane (2.8 g, 14.59 mmol). The reaction mixture was stirred at 80 °C for 5 h. The mixture was diluted with EtOAc (200 mL), washed with brine (2 x 100 mL). The organic layer was dried over Na2SO4, filtered and concentrated to afford title amine (1.5 g, 65%) as a yellow oil. LCMS m / z = 476.35 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 7.22 (d, J = 8.6 Hz, 4H), 6.88 (d, J = 8.6 Hz, 4H), 6.21 (tt, J = 54.8, 4.0 Hz, 1H), 4.65 (s, 4H), 3.97 (td, J = 14.8, 4.0 Hz, 2H), 3.82 (s, 6H), 3.72 (s, 6H). Step 5: 5-(2,2-difluoroethoxy)-4,6-dimethoxypyrimidin-2-amine TFA, DCM

[00210] To a solution of Step 5 amine (1.5 g, 3.16 mmol) in DCM (5 mL) was added TFA (10 mL). The reaction mixture was stirred at 50 °C overnight. The mixture was concentrated and diluted with NaHCOs solution (50 mL), extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue was purified by column chromatography on silica gel (eluent: petroleum ether : EtOAc = 5 : 1) to afford title amine (650 mg, 87.6%) as a white solid. LCMS m / z = 236.05 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 6.39 (s, 2H), 6.19 (tt, J = 54.8, 4.0 Hz, 1H), 3.93 (td, J = 14.7, 4.0 Hz, 2H), 3.81 (s, 6H). Intermediate 7.- 5-(difluoromethoxy)-4,6-dimethoxypyrimidin-2-amine Step 1: 5-(difluoromethoxy)-4,6-dimethoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine KOH, MeCN

[00211] To a solution of 2-(bis(4-methoxybenzyl)amino)-4,6-dimethoxypyrimidin-5-ol (Intermediate 6 Step 3; 2.26 g, 5.49 mmol) in MeCN (10 mL) at 0°C was added KOH (5 M in H2O, 20 mL) dropwise, followed by addition of diethyl (bromodifluoromethyl)phosphonate (2.93 g, 10.99 mmol) in MeCN (10 mL) dropwise at 0 °C. The reaction mixture was stirred at 0 °C for 10 min. The mixture was diluted with water (100 mL), extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue was purified by column chromatography on silica gel (eluent: petroleum ether / EtOAc = 50 / 1 to 5 / 1, v / v) to give the title amine (1.5 g, 59.2% yield) as a white solid. LCMS: m / z = 462.10 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 7.23 (d, J = 8.6 Hz, 4H), 6.95 - 6.52 (m, 5H), 4.67 (s, 4H), 3.83 (s, 6H), 3.73 (s, 6H). Step 2: 5-(difluoromethoxy)-4,6-dimethoxypyrimidin-2-amine TFA, DCM

[00212] To a solution of Step 1 amine (1.5 g, 3.25 mmol) in DCM (10 mL) at 0 °C was added TFA (22.24 g, 195.03 mmol). The reaction mixture was allowed towarm to room temperature and stirring was continued for 2 days. The mixture was concentrated in vacuum and purified by column chromatography on silica gel (eluent: petroleum ether / EtOAc=10 / 1 to 1 / 1, v / v) to give title amine (560 mg, 77.9% yield) as a yellow solid. LCMS: m / z = 222.05 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 6.86 - 6.49 (m, 3H), 3.82 (s, 6H). Intermediate 8: 3-(2-amino-4,6-dimethoxypyrimidin-5-yl)propanenitrile Cs2CO3, Pd(dppf)CI2 dioxane / H2O H2, Pd / C MeOH NH3H2O HATU, DIEA, DMF POCI3, DMF TFA, DCM Step 1: ethyl (E)-3-(2-(bis(4-methoxybenzyl)amino)-4,6-dimethoxypyrimidin-5-yl)acrylate

[00213] To a mixture of 5-bromo-4,6-dimethoxy-N,N-bis(4-methoxybenzyl)pyrimidin-2-amine (Intermediate 6 Step 2; 200 mg, 0.42 mmol) in dioxane (3 mL) / H2O (1 mL) was added ethyl (E)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)acrylate (124 mg, 0.55 mmol), CS2CO3 (412 mg, 1.26 mmol) and Pd(dppf)Ch (31 mg, 0.04 mol). The reaction was 10 stirred at 110 °C under a N2 atmosphere for 3 h. The mixture was diluted with water (50 mL) and extracted with EtOAc (3 x 20 mL). The combined organic layers were dried over Na2SO4, filtered and concentrated. The residue was purified by prep-TLC (eluent: petroleum ether / EtOAc = 10 : 1) to afford title acrylate (70 mg, 33.6% yield) as a colorless oil. LCMS m / z = 494.35 [M+H]+;1H NMR (400 MHz, DMSO-cfe) 6 7.69 (d, J = 16.0 Hz, 1H), 7.24 (d, J= 8.7 15 Hz, 4H), 6.89 (d, J = 8.7 Hz, 4H), 6.38 (d, J = 16.1 Hz, 1H), 4.73 (s, 4H), 4.12 (q, J= 7.1 Hz, 2H), 3.92 (s, 6H), 3.73 (s, 6H), 1.23-1.19 (m, 3H). Step 2: Ethyl 3-(2-(bis(4-methoxybenzyl)amino)-4,6-dimethoxypyrimidin-5-yl)propanoate H2, Pd / C MeOH

[00214] To a solution of Step 1 acrylate (1.3 g, 2.63 mmol) in MeOH (10 mL) was added 10% Pd / C (150 mg). The reaction mixture was stirred under a H2 atmosphere for 2 h. The mixture was filtered and concentrated to afford title ester (1.2 g, 92.3% yield) as a dark solid. 5 LCMS m / z = 496.40 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 7.21 (d, J = 8.6 Hz, 4H), 6.87 (d, J = 8.6 Hz, 4H), 4.66 (s, 4H), 4.05 - 3.99 (m, 2H), 3.79 (s, 6H), 3.72 (s, 6H), 2.62 - 2.56 (m, 2H), 2.37-2.30 (m, 2H), 1.15 (t, J= 7.1 Hz, 3H). Step 3: 3-(2-(bis(4-methoxybenzyl)amino)-4,6-dimethoxypyrimidin-5-yl)propanoic acid xN. PMB PMB NaOH THF / EtOH / H2O PMB PMB 10

[00215] To a solution of Step 2 ester (1.2 g, 2.42 mmol) in THFI H2OI MeOH (12 mL, v / v / v = 4:1:1) was added NaOH (200 mg, 4.84 mmol). The reaction mixture was stirred at 40 °C overnight. The mixture was diluted with water (50 mL) and extracted with EtOAc (20 mL). The aqueous layer was acidified with 1N HCI to pH ~ 4 and extracted with EtOAc (3 x 40 mL). The combined organic layers was washed with brine, dried over Na2SO4, filtered and 15 concentrated to afford title acid (1.0 g, 88.4%) as a white solid. LCMS m / z = 468.35 [M+H]+ ;1H NMR (400 MHz, DMSO-d6) 6 12.06 (s, 1H), 7.22 (d, J = 8.6 Hz, 4H), 6.88 (d, J= 8.6 Hz, 4H), 4.66 (s, 4H), 3.80 (s, 6H), 3.72 (s, 6H), 2.58 - 2.53 (m, 2H), 2.29 - 2.23 (m, 2H). Step 4: 3-(2-(bis(4-methoxybenzyl)amino)-4,6-dimethoxypyrimidin-5-yl)propanamide NH3H2O HATU, DIEA, DMF

[00216] To a solution of Step 3 acid (200 mg, 0.43 mmol) in DMF (3 mL) was added HATLI (162 mg, 0.43 mmol) and DIEA (110 mg, 0.86 mmol). The reaction mixture was stirred at room temperature for 30 min then NH3.H2O (1 mL) was added. The mixture was stirred at room temperature for another 2 h. The mixture was diluted with water (40 mL) and extracted with DCM (2 x 30 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue was purified by prep-TLC (eluent: DCM : MeOH = 20 : 1) to afford title carboxamide (180 mg, 90%) as a white solid. LCMS m / z = 467.35 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 6 7.23 - 7.20 (m, 4H), 6.87 (d, J = 8.6 Hz, 4H), 6.69 (s, 2H), 4.66 (s, 4H), 3.79 (s, 6H), 3.72 (s, 6H), 2.56 - 2.51 (m, 2H), 2.14 - 2.09 (m, 2H). Step 5: 3-(2-(bis(4-methoxybenzyl)amino)-4,6-dimethoxypyrimidin-5-yl)propanenitrile POCI3, DMF N

[00217] To a solution of Step 4 carboxamide (228 mg, 0.44 mmol) in DMF (2 mL) at 0 °C was added POCI3 (3 mL). The mixture was stirred at room temperature for 1 h. The mixture was poured into ice water (40 mL), and extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with NaHCOs solution and brine, dried over Na2SO4 and concentrated under vacuum to afford title nitrile (205 mg, 100%) as a yellow oil. LCMS m / z = 449.35 [M+H]+ Step 6: 3-(2-amino-4,6-dimethoxypyrimidin-5-yl)propanenitrile PMB PMB TFA, DCM N

[00218] To a solution of Step 5 nitrile (192 mg, 0.42 mmol) in DCM (2 mL) was added TFA (3 mL). The reaction was stirred at 50 °C overnight. The reaction mixture was concentrated and purified by prep-TLC (eluent: DCM : MeOH = 15:1) to afford title nitrile (89 mg, 100%), which was used directly in the next step. LCMS m / z = 209.20 [M+H]+ ■ 1H NMR (400 MHz, DMSO-cfe) 6 3.80 (s, 6H), 2.61 - 2.52 (m, 4H). Example 1: 6-chloro-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2-yl)-1 H-indazole-3- 5 sulfonamide F Step 1: 1-(bromomethyl)-4-chloro-2-nitrobenzene PBr3 toluene

[00219] To a solution of (4-chloro-2-nitrophenyl)methanol (5.0 g, 26.66 mmol) in toluene (50 10 mL) was added PBr3(3.61 g, 13.33 mmol). The reaction mixture was stirred at 100 °C for 0.5 h. The mixture was quenched with ice water, and extracted with Et20 (2 x 100 mL). The combined organic layers were washed with water and brine, dried over Na2SO4, concentrated to give 1-(bromomethyl)-4-chloro-2-nitrobenzene (6.9 g, crude) as a yellow oil. 1H NMR (400 MHz, DMSO-cfe) 5 8.17 (d, J=2.2 Hz, 1H), 7.86 (dd, J=8.3, 2.2 Hz, 1H), 7.79 15 (d, J= 8.4 Hz, 1H), 4.90 (s, 2H). Step 2: sodium (4-chloro-2-nitrophenyl)methanesulfinate

[00220] To a solution of 1-(bromomethyl)-4-chloro-2-nitrobenzene (6.9 g, 27.55 mmol) in H2O (50 mL) was added Na2SO3 (4.51 g, 35.81 mmol) and tetrabutylammonium bromide (TBAB; 1.42 g, 4.41 mmol). The reaction mixture was stirred at 100 °C overnight. The mixture was concentrated and the residue was recrystallized from iPrOH to afford sodium (4-chloro-2-nitrophenyl)methanesulfinate (4.7 g, 66.22% yield) as a white solid. 1H NMR (400 MHz, DMSO-cfe) 6 7.92 (d, J= 2.3 Hz, 1H), 7.69 (dd, J= 8.3, 2.2 Hz, 1H), 7.52 (d, J = 8.4 Hz, 1H), 4.14 (s, 2H). Step 3: (4-chloro-2-nitrophenyl)methanesulfonyl chloride

[00221] To a solution of sodium (4-chloro-2-nitrophenyl)methanesulfinate (4.7 g, 18.24 mmol) in DCM (20 mL) was added PCI5 (4.56 g, 2.89 mmol). The reaction mixture was stirred at room temperature overnight. The mixture was filtered and the filtrate was concentrated in vacuum to give title sulfonyl chloride (3 g, 60.90% yield) as a brown oil. 1H NMR (400 MHz, DMSO-cfe) 6 7.92 (d, J= 2.3 Hz, 1H), 7.70 (dd, J = 8.3, 2.3 Hz, 1H), 7.52 (d, J= 8.3 Hz, 1H), 4.16 (s, 2H). Step 4: N-((4-chloro-2-nitrobenzyl)sulfonyl)-1-(4-chloro-2-nitrophenyl)-N-(5-(2- fluoroethoxy)-4-methoxypyrimidin-2-yl)methanesulfonamide

[00222] A mixture of Step 3 sulfonyl chloride (1.4 g, 5.18 mmol), 5-(2-fluoroethoxy)-4-methoxypyrimidin-2-amine (Intermediate 1; 970 mg, 5.18 mmol) and DIEA (3.35 g, 25.92 mmol) in DCM (20 mL) was stirred at room temperature overnight. The mixture was concentrated in vacuum and purified by column chromatography on silica gel (eluent: DCM / MeOH = 100 / 1 to 10 / 1, v / v) to give N-((4-chloro-2-nitrobenzyl)sulfonyl)-1-(4-chloro-2-nitrophenyl)-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2-yl)methanesulfonamide (1.43 g, 42% yield) as a brown solid. LCMS: m / z = 653.90 [M+H]+. Step 5: 1-(4-chloro-2-nitrophenyl)-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2- yl)methanesulfonamide NaOH (aq.), THF

[00223] To a solution of N-((4-chloro-2-nitrobenzyl)sulfonyl)-1-(4-chloro-2-nitrophenyl)-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin- 2-yl)methanesulfonamide (1.4 g, 2.14 mmol) and N-benzyl-N,N-diethylethanaminium chloride (48.7 mg, 0.214 mmol) in THF (5 mL) was added 40% NaOH (aq.) (5 mL). The reaction mixture was stirred at room temperature for 2 h. The mixture was neutralized to pH 7~8 with 2 N HCI and extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with brine, dried over Na2SO4 and concentrated in vacuum. The residue was purified by column chromatography on silica gel (eluent: DCM / MeOH = 100 / 1 to 10 / 1, v / v) to give 1-(4-chloro-2-nitrophenyl)-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2-yl) methanesulfonamide (780 mg, 86.6% yield) as a yellow solid. LCMS: m / z = 418.95 [M-H]’. Step 6: 1-(2-amino-4-chlorophenyl)-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2- yl)methanesulfonamide

[00224] To a solution of 1-(4-chloro-2-nitrophenyl)-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2-yl)methanesulfonamide (780 mg, 1.85 mmol) and NH4CI (991.5 mg, 18.54 mmol) in MeOH (10 mL) was added Fe (517.6 mg, 9.27 mmol). The reaction mixture was stirred at 80 °C for 4 h. The mixture was filtered and concentrated in vacuum. The residue was purified by column chromatography on silica gel (eluent: DCM / MeOH = 100 / 1 to 20 / 1, v / v) to give 1-(2-amino-4-chlorophenyl)-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2-yl)methanesulfonamide (265 mg, 36.7% yield) as a yellow solid. LCMS: m / z = 391.00 [M+H]+. Step 7: 6-chloro-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide

[00225] To a solution of 1-(2-amino-4-chlorophenyl)-N-(5-(2-fluoroethoxy)-4- methoxypyrimidin-2-yl)methanesulfonamide (245 mg, 0.63 mmol) in 4 N HCI (3 mL) at 0 °C was added a solution of NaNO2 (64.9 mg, 0.94 mmol) in H2O (0.5 mL). The reaction mixture was stirred at 0 °C for 0.5 h. The mixture was neutralized to pH 7~8 with Na2CO3 (aq.) and extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine, dried over Na2SO4 and concentrated in vacuum. The residue was purified by prep-HPLC to give 6-chloro-N-(5-(2-fluoroethoxy)-4-methoxypyrimidin-2-yl)-1H-indazole-3-sulfonamide (46.5 mg, 18.4% yield) as a white solid. LCMS: m / z = 401.95 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 14.04 (s, 1H), 12.07 (s, 1H), 8.02 (d, J= 4.0 Hz, 1H), 7.87 (s, 1H), 7.74 (s, 1H), 7.31 (d, J= 4.0 Hz , 1H), 4.69-4.56 (m, 2H), 4.19-4.09 (m, 2H), 3.48 (s, 3H). Example 2: 6-chloro-N-(5-(3-fluoropropyl)-4-methoxypyrimidin-2-yl)-1 H-indazole-3- sulfonamide

[00226] The title compound was prepared according to the same procedures outlined for Example 1 but using 5-(3-fluoropropyl)-4-methoxypyrimidin-2-amine (Intermediate 2) in the sulfamidation step. LCMS: m / z = 400.00 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 13.69 (s, 1H), 8.00 (d, J= 8.7 Hz, 1H), 7.89 (s, 1H), 7.70 (d, J = 1.7 Hz, 1H), 7.26 (d, J= 8.1 Hz, 1H), 4.43 (t, J = 5.9 Hz, 1H), 4.32 (t, J = 5.9 Hz, 1H), 3.35 (s, 3H), 2.38 - 2.30 (m, 2H), 1.84 -1.68 (m, 2H). Example 3: 6-chloro-N-(5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-yl)-1 H-indazole-3- Step 1: 1-(4-chloro-2-nitrophenyl)-N-(5-(2,2-difluoroethyl)-4-methoxypyrimidin-2- Intermediate 3

[00227] To a solution of 5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-amine (Intermediate 3; 800 mg, 4.23 mmol) in DCM (15 mL) was added (4-chloro-2-nitrophenyl)methanesulfonyl chloride (Example 1 Step 3; 1.14 g, 4.23 mmol) and DIEA (2.73 g, 21.15 mmol). The reaction mixture was stirred at 25 °C for 16 h. The reaction mixture was diluted with 1 N HCI (50 mL), extracted with EtOAc (3 x 40 mL). The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentrated. The residue was purified by column chromatography on silica gel (eluent: DCM / MeOH = 20 / 1, v / v) to afford 1-(4-chloro-2-nitrophenyl)-N-(5-(2,2- difluoroethyl)-4-methoxypyrimidin-2-yl)methanesulfonamide (300 mg, 16.8 %) as a yellow solid. LCMS: m / z = 422.95 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 5 8.17-8.11 (m, 1H), 8.08 (s, 1H), 7.81 (d, J=8.2 Hz, 1H), 7.58 (d, J=8.4 Hz, 1H), 6.39-6.06 (m, 1H), 4.09-3.99 (m, 5H), 3.11 -3.00 (m, 2H). Step 2: 1-(2-amino-4-chlorophenyl)-N-(5-(2,2-difluoroethyl)-4-methoxypyrimidin-2- yl)methanesulfonamide

[00228] To a solution of 1-(4-chloro-2-nitrophenyl)-N-(5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-yl)methanesulfonamide (300 mg, 0.71 mmol) in MeOH (10 mL) was added Fe (199 mg, 3.55 mmol) and NH4CI (379 mg, 7.10 mmol). The reaction mixture was stirred at 80 °C for 4 h. The mixture was filtered and concentrated in vacuum. The residue was purified by column chromatography on silica gel (eluent: DCM / MeOH = 20 / 1, v / v) to afford 1-(2-amino-4-chlorophenyl)-N-(5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-yl) methanesulfonamide (180 mg, 64.5%) as a yellow solid. LCMS: m / z = 393.00 [M+H]+ Step 3: 6-chloro-N-(5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-yl)-1 H-indazole-3- sulfonamide

[00229] A solution of 1-(2-amino-4-chlorophenyl)-N-(5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-yl)methanesulfonamide (200 mg, 0.51 mmol) in AcOH (4 mL) was cooled to 0 °C, NaNO2 (70.3 mg, 1.01 mmol) in water (1.2 mL) was added. The reaction mixture was stirred at 25 °C for 1 h. The mixture was concentrated and purified by prep-HPLC to afford 6-chloro-N-(5-(2,2-difluoroethyl)-4-methoxypyrimidin-2-yl)-1H-indazole-3-sulfonamide (25 mg, 12.2%) as a white solid. LCMS: m / z = 404.00 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 13.78 (s, 1H), 8.04-7.97 (m, 2H), 7.72 (s, 1H), 7.28 (d, J= 8.7 Hz, 1H), 6.09 (tt, J = 56.5, 4.6 Hz, 1H), 3.37 (s, 3H), 2.88 (td, J = 17.3, 4.4 Hz, 2H). Example 4: 6-chloro-N-(5-(2-cyanoethyl)-4-methoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide / —N N \\ )— MeO H N-nh

[00230] The title compound was prepared according to the same procedures outlined for Example 1 but using 3-(2-(bis(4-methoxybenzyl)amino)-4-methoxypyrimidin-5- yl)propanenitrile (Intermediate 4) in the sulfamidation step. LCMS: m / z = 393.00 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 5 13.75 (s, 1H), 12.81 (s, 1H), 8.06 - 7.96 (m, 2H), 7.71 (s, 1H), 7.28 (d, J = 8.4 Hz, 1H), 3.37 (s, 3H), 2.70 - 2.62 (m, 2H), 2.61 - 2.54 (m, 2H). Example 5: 6-chloro-N-(5-(2,2-difluoroethoxy)-4-methoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide

[00231] The title compound was prepared according to the same procedures outlined for Example 1 but using 5-(2,2-difluoroethoxy)-4-methoxypyrimidin-2-amine (Intermediate 5) in the sulfamidation step. LCMS: m / z = 419.95 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 5 14.04 (s, 1H), 12.17 (s, 1H), 8.02 (d, J = 8.8 Hz, 1H), 7.92 (s, 1H), 7.73 (s, 1H), 7.31 (d, J = 8.7 Hz, 1H), 6.28 (tt, J = 54.4, 3.6 Hz, 1H), 4.20 (td, J= 14.6, 3.6 Hz, 2H), 3.49 (s, 3H). Example 6: 6-chloro-N-(5-(2,2-difluoroethoxy)-4,6-dimethoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide MeO ,O-^Z"N o o \ k ;s< kx ! z^n IN \ r MeO N H N—nh

[00232] The title compound was prepared according to the same procedures outlined for Example 3 but using 5-(2,2-difluoroethoxy)-4,6-dimethoxypyrimidin-2-amine (Intermediate 6) in the sulfamidation step. LCMS: m / z = 449.95 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 14.15 (s, 1H), 12.06 (s, 1H), 8.05 (d, J= 8.7 Hz, 1H), 7.82 (d, J = 1.6 Hz, 1H), 7.39 (dd, J = 8.7, 1.6 Hz, 1H), 6.16 (tt, J= 54.7, 3.8 Hz, 1H), 3.99 (td, J = 14.7, 3.8 Hz, 2H), 3.62 (s, 6H). Example 7: 6-chloro-N-(5-(difluoromethoxy)-4,6-dimethoxypyrimidin-2-yl)-1H-indazole-3-sulfonamide MeO H N—nh

[00233] The title compound was prepared according to the same procedures outlined for Example 3 but using 5-(difluoromethoxy)-4,6-dimethoxypyrimidin-2-amine (Intermediate 7) in the sulfamidation step. LCMS: m / z = 436.00 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 6 14.41 (s, 1H), 12.25 (s, 1H), 8.01 (d, J= 4.0 Hz, 1H), 7.75 (s, 1H), 7.31 (d, J= 4.0 Hz, 1H), 6.88-6.51 (m, 1H), 3.56 (s, 6H). Example 8: 6-chloro-N-(5-(2-cyanoethyl)-4,6-dimethoxypyrimidin-2-yl)-1 H-indazole-3-sulfonamide MeO N H N—nh

[00234] The title compound was prepared according to the same procedures outlined for Example 3 but using 3-(2-amino-4,6-dimethoxypyrimidin-5-yl)propanenitrile (Intermediate 8) in the sulfamidation step. LCMS: m / z = 422.95 [M+H]+; 1H NMR (400 MHz, DMSO-cfe) 5 14.11 (s, 1H), 12.09 (s, 1H), 8.04 (d, J= 8.7 Hz, 1H), 7.79 (d, J = 1.6 Hz, 1H), 7.36 (dd, J = 8.8, 1.7 Hz, 1H), 3.58 (s, 6H), 2.56-2.51 (m, 4H). Biological Investigations

[00235] The following assays can be used to illustrate the commercial utilities of the compounds according to the present invention. Biological Assays: hGPR1 / antagonist assays

[00236] GPR17 is a G-protein coupled receptor. GPR17 activation triggers Gq-type G-protein signalling resulting in endoplasmic reticulum calcium (Ca2+) stores release in cytosol which can be measured using Calcium 5 dye, a fluorescent dye of cytosolic Ca2+ levels. GPR17 activation can also recruit Gi-type G-protein signalling, resulting in a decrease of intracellular cyclic adenosine monophosphate (cAMP). Intracellular cAMP changes can be measured using HTFR cAMP dynamic assay kits. Using homogeneous time-resolved fluorescent technology (HTRF), the assay is based on competition between native cAMP produced by cells and cAMP labelled with a dye. Extensive details of the cell-lines and screening formats used in WO2018 / 122232 (pg 428-430), WO2024 / 042147 (pg 17-18), WO2022 / 254027 (pg 299-301) are directly applicable to the activity measurements determined for compounds according to the invention.

[00237] The data presented in Table 1 herein used screening through the commercially available GRP17 assay formats available at DiscoverX-Eurofins (PathHunter® and LeadHunter®).

[00238] Assay Protocol. GPCR cAMP Modulation using TR-FRET Cell Handling. Cell lines were expanded from freezer stocks according to standard procedures. Cells were seeded at the appropriate density in a total volume of 5 pL HBSS / 10mM HEPES containing 500pM IBMX into white walled, 384-well half area microplates shortly before testing. Antagonist format. For antagonist determination, cells were pre-incubated with sample followed by agonist challenge at the EC80 concentration. Intermediate dilution of sample stocks was performed to generate 4X sample in assay buffer. 2.5uL of 4X compound was added to the cells and incubated at room temperature for 30 minutes. 2.5 pL of 4X EC80 agonist was added to cells and incubated at room temperature for 30 minutes. For Gi-coupled GPCRs, EC80 forksolin was included. Signal Detection. Assay signal was generated through addition of 5pL D2 conjugate and 5pL cAMP-Antibody reagent followed by one hour incubation at room temperature. Microplates were read following signal generation with a PerkinElmer EnvisionTM instrument for TR-FRET signal detection with excitation at 340nm and emission at 615 and 665 nm. The signal ratio (RATIO) (Emission 665nm / 615nm) was calculated and used for data analysis. Data Analysis. Compound activity was analyzed using CBIS data analysis suite (Chemlnnovation, CA). , Percentage inhibition is calculated using the following formula: % Inhibition = 100% x (mean RATIO of test sample — mean RATIO of EC80 control) I (mean RATIO of forskolin positive control — mean RATIO of EC80

[00239] The EC50 values measured in this assay for the exemplified compounds is set out in the Table 1: Example EC50 (nM) 1 ### 2 ## 3 #### 4 ### 5 ### 6 #### 7 ### 8 #### Key #### 0 >EC50 >100 nM ### 100 >EC50 >250 nM ## 250 >EC50 >500 nM # 500 >EC50 >750 nM

[00240] Compounds according to the invention may show GPR17 antagonist activity with an EC50 <750nM. Preferred compounds according to the invention may show GPR17 antagonist activity with an EC50 <500nM. In vitro ADME Testing Procedure In vitro Inhibition of CYP2C19

[00241] The test compounds were solubilised to 10 mM in DMSO. The test compounds were then pre-incubated for 10 min at 37 °C at final concentrations of 0.05, 0.15, 0.5, 1.5, 3, 15, and 50 pM in pooled human liver microsomes (final concentration 0.1 mg / mL) in the presence of the CYP219 probe substrate, S-mephenytoin (final concentration 20 pM). The cofactor NADPH (1 mM) was subsequently added, and the plate further incubated for 20 min. The reaction was stopped by the addition of 400 mL of cold acetonitrile containing the internal standards, tolbutamide and Labetalol to precipitate the protein. The plates were centrifuged for 4000 rpm for 20 min, following which, 200 pL of supernatant were removed and added to 100 mL of water. Samples were then analysed by LC-MS / MS, by monitoring for the formation of the metabolite, 4’-hydroxy-S-mephenytoin in the absence and presence of the test compounds. The ICso value of each test compound was determined using XL fit by plotting the percent of vehicle control versus the test compound concentrations and using non-linear regression analysis of the data. The ICso value was determined using a 3- or 4-parameter logistic equation. ICso values were reported as “>50 pM” when % inhibition at the highest concentration (50 pM) was less than 50%. All assays had two replicates per compound and included a positive control inhibitor, (+)- / V-3-benzylnirvanol (final concentration 1 pM).

[00242] Compounds of the invention were compared to the CYP2C19 inhibition potency of matched pair indole comparisons 1,2 &3 (Compounds 1, 47 &179 from WO2022 / 180136), Table 2. Literature Comparison 1 (WO2022 / 180136 Example 1) Literature Comparison 2 (WO2022 / 180136 Example 47) Literature Comparison 3 (WO2022 / 180136 Example 179) Example CYP2C19 Inhibition IC50 Literature Comparison CYP2C19 Inhibition IC50 Fold reduction in CYP2C19 Inhibition IC50 1 * Literature comparison 1 ** ++ 3 * Literature comparison 2 ** ++ 4 * Literature comparison 3 * + Key ** *** **** 100 >IC50 >10 pM 10 >IC50 >1 pM 1 >IC50 >0.1 pM 0.1 >IC50 >0.01 pM +++ 50 >fold reduction >25 ++ 25 >fold reduction >10 + 10 >fold reduction >2 Table 2. CYP2C19 inhibition for literature compounds and Examples of the invention, along with the fold-reduction in activity at CYP2C19 for compounds of the invention, relative to their literature matched pair. EXAMPLE 9: Effects of Example 6 (“compound 6”) in a GALC + / - zebrafish model of Krabbe’s disease Model Development

[00243] The forward genetic method as per Solnica-Kreze et al., 1996 (Driever W, Solnica-Krezel L, Schier AF, Neuhauss SC, Malicki J, Stemple DL, Stainier DY, Zwartkruis F, Abdelilah S, Rangini Z, Belak J, Boggs C. A genetic screen for mutations affecting embryogenesis in zebrafish. Development. 1996 Dec; 123:37-46. PMID: 9007227.) was employed to develop mutant lines. Adult Zebrafish were subjected to the N-ethyl-N-nitrosourea (ENU) chemical mutagen to induce random mutagenesis, administered through a water dissolution method. Prior to spawning, the ENU induced male zebrafish and adult females were housed separately under standard laboratory husbandry conditions. Zebrafish founders were set for spawning at a spawning ratio of female to male fish 1:4 per breeding tank. The F1 progeny were screened, and the resulting mutants were inbred to generate stable lines. For the study, stable heterozygous founders were inbred to generate homozygous GALC+ / - mutants; Gene ID: 449649, which were used for the study. GALC+ / -mutant embryos were housed and maintained in embryo medium. Quality checks of embryonic development were performed using a Labomed LX400 brightfield microscope with Labomed Camera LC-5 1080P C-MOUNT WIFI CMOS. The embryos displaying an opaque discoloration were repudiated and only embryos with the best growth phase were selected for the study. The selected embryos were transferred to two-litre housing water and housed at a density of 80 per housing tank of 25 litre capacity, ensuring adequate space for swimming motion and minimizing crowding. Screening for mutants was carried out at 3 days post-fertilization (dpf) for the manifestation of behaviour phenotype with restricted movement, and the selected larvae were advanced for the study. During the larvae developmental stages (0 dpf to 5 dpf), the study tanks were conditioned (under a water temperature of 27 ± 1°C and pH between 7.2 and 7.4). Dose Selection and Dose Administration

[00244] Larvae in various groups were treated with compound 6 and the reference drug Copaxone (generic name: glatiramer acetate; approved for treatment of multiple sclerosis) to evaluate their efficacy. Larvae were observed continuously for phenotypic and behavioural changes. Test compounds were solubilized in a mixture of (Mother stock dilution—Distilled water (85%), DMSO (5%), and (10%) Virgin coconut oil). The stock concentration for test compounds was derived and executed for the dose administration concentration by dilution in 100% distilled water. Study groups treated with compound 6 and standard drug Copaxone were dosed from 5 dpf to 11 dpf with a 24-hour washout cycle. Screening

[00245] Efficacy screening was performed at a single timepoint of 12 dpf. 1) Behavioural Response Assay 1: Ataxia Stereotype

[00246] Ataxia Stereotype was defined as a postural imbalance and uncoordinated locomotor behaviour in zebrafish larvae, characterized by irregular swimming patterns, loss of equilibrium, reduced swim speed, and frequent pauses during movement. To evaluate this phenotype, larvae were carefully transferred from the housing tank to an individual well of a multi-well plate. The larvae underwent an acclimation period of 15 minutes to allow them to adjust to the new environment and reduce stress-induced variability. Following acclimation, larval movements were recorded for a defined observation period using a video recording system. The recorded videos were analyzed using behavioural tracking software to measure the number of bends per minute. The number of bends was calculated from the video frames, which in turn shed light on postural control and motor coordination. An increase in bends was indicative of uncoordinated erratic movements and postural instability associated with Ataxia Stereotype. Assay 2: Auditory Response

[00247] The auditory response assay was a behavioural test to evaluate the neuromotor function of zebrafish larvae in response to an auditory stimulus. Larvae (N = 24 per group) were assessed individually. Each larva was placed in the experimental chamber and allowed to acclimate for 5 minutes under controlled conditions, with no external stimuli applied during this period. Following acclimation, the larva was exposed to an auditory stimulus delivered once per minute for three consecutive minutes. This procedure was repeated for all larvae within the group. The latency to respond to each auditory stimulus was recorded, and the average data was subjected to subsequent analysis to assess neuromotor performance.

[00248] The latency was calculated as the difference between the response time stamp and the stimulus onset time stamp and was expressed in seconds. The analysis was performed using video tracking software. A lower latency value indicated higher sensory alertness, while an increased latency suggested sensory or neurological impairment in the larvae. Latency = Response time stamp - Stimulus onset time stamp Assay 3: Seizure

[00249] Seizures were characterized by sudden, uncontrolled electrical disturbances in the brain, leading to alterations in behaviour, motor activity, or consciousness. To assess seizure-like activity, zebrafish larvae were transferred from the housing tank to a well plate and allowed to acclimate for 5 minutes under controlled conditions. Following acclimation, the well plate was placed within a video recording unit, and larval behaviour was recorded continuously for 3 minutes. The recorded videos were processed to extract the x and y coordinates of each larva, which were analyzed for episodes of sudden high-velocity movements indicative of seizure-like activity. The number of such events per minute was quantified and tabulated for subsequent analysis. 2) Physiological Response Assay 4: Percentage Dysphagia Phenotype with constricted Gl Tract

[00250] Constriction of the gastrointestinal (Gl) tract was a characteristic feature associated with the dysphagia phenotype in zebrafish larvae. For assessment, larvae were sedated in a 0.03% MS-222 (tricaine methanesulfonate) solution for 2-3 minutes until complete cessation of movement was observed. Sedated larvae were then carefully transferred onto a clean microscope slide and positioned in the left lateral orientation. Observations were performed under a bright-field microscope to evaluate Gl tract morphology. Each larva was scored based on the presence or absence of the dysphagia phenotype as follows: Score 0 — Presence of dysphagia (constricted Gl tract) Score 1 — No phenotype (normal Gl tract) The scores were recorded and tabulated, and the average score was calculated to determine the percentage of larvae exhibiting Gl tract constriction. 3) Pathology Assay 5: Pathology - Brain

[00251] Histopathology of the whole larvae was performed across all the study groups, and a pathologic scoring system was used to characterize the disease progression and provide significant insight into treatment strategies. Briefly, at 12th dpf, after 7 doses of the test compounds, the larvae (N=4 per group) were collected from all study groups for histopathological examination. The larvae were euthanized in 0.4% tricaine for 12 minutes to initiate euthanasia. Following euthanasia, fixation of the larvae was performed immediately to prevent dehydration of cell morphology. For fixation, the larvae were gently immersed in a solution of 5% neutral buffered formalin (NBF) for a period of 48 hours, 5 maintaining a ratio of one larva per one millilitre of NBF. The fixed larvae were then subjected to tissue processing via dehydration in a graded series of ethanol from 70-100% and then blocked in paraffin solvent for embedding. The paraffin-embedded larvae were sectioned using a microtome (Abron Scientific-Advanced Microtomy AB-91-07) with a thickness of 10 microns and stained with Luxol Fast Blue (LFB) and Hematoxylin &Eosin (H&E) staining. 10 The tissue sections were observed under a light microscope at 20X and 40X magnification. Images were captured using a Labomed Camera installed with the Image View interface. The pathology scores were used to characterize the level of disease progression across the study groups, as shown in Table 3. Table 3 Grade Score Description Morphological Features Grade 0 0 Normal Normal nerve morphology with intact myelin sheaths, axons, and supporting cells; no pathological changes observed. Grade 1 1 Demyelination Loss or thinning of the myelin sheath surrounding axons; axonal structures remain largely intact; myelin vacuolation may be present. Grade 2 2 Endoneurial Fibrosis Excessive deposition of fibrous connective tissue within the endoneurium; leads to disrupted nerve fiber organization and potential compression of axons. Grade 3 3 Globoid Cell -Macrophage Infiltration Presence of large, multinucleated macrophage-like globoid cells; accumulation of lipid-laden macrophages indicating myelin degradation and inflammatory response. Grade 4 4 Reactive Stellate Astrogliosis Proliferation and hypertrophy of astrocytes with prominent stellate (star-shaped) morphology; indicates a reactive gliosis response to injury. Grade 5 5 Reduction of Axon Density Significant loss of axonal fibers resulting in decreased axon density; indicates severe neurodegeneration or chronic nerve damage. 4) Gene Expression Assay 6: Gene Expression - RT-PCR gpr17 Expression Levels in Brain; RT-PCR a) Sample Collection

[00252] Larvae were sedated with a 0.03% MS-222 solution for 2-3 minutes until movement ceased. After sedation, the fry were gently transferred onto a clean slide with the posterior side up and decapitated by means of a fine needle. The cut was made at the junction between the brainstem and the spinal cord. The eyes were carefully removed, thereby providing better visualization of the whole brain. Soft tissue was removed from the dorsal side of the brain. Samples of 6*3 pooled larvae were harvested and stored together in 100 pL acid phenol at -20° C until RNA extraction. b) RNA Extraction

[00253] The total RNA was extracted using the phenol-chloroform extraction method as described by Chomczynski, P., et al. The method is based on phase separation and aids in the isolation of desired RNA.

[00254] The sample was homogenized in 300 pL of Acid phenol. A volume of 250 pL of chloroform was added to the homogenate and vortexed for a few seconds. The sample was incubated in an ice bath for 15 minutes. After incubation, the sample was vortexed at high speed for 1 minute followed by centrifugation at high speed for 10 minutes. This yielded three distinct phases: the clear aqueous phase containing RNA, a thin interphase containing cellular debris, and the lower phase with organic substances. The aqueous phase containing RNA was transferred to a fresh centrifuge tube, and 100 pL of isopropanol was added followed by incubation in the ice bath for 40 minutes. At the end of the ice incubation, the sample was centrifuged at 16600 x g for 10 minutes to precipitate RNA. The supernatant was discarded, and the tube containing the RNA pellet was dried in the incubator at 40°C to evaporate isopropanol. The RNA quality was evaluated with gel electrophoresis, and the aliquots were directly used for reverse transcriptase reaction. c) Reverse Transcriptase

[00255] cDNA was synthesized from total RNA (20 pL final reaction volume) with oligo(dT)15 primer using Avian Myeloblastosis Virus (AMV) reverse transcriptase (First Strand cDNA Synthesis Kit; Roche) according to the manufacturer’s instructions. The cDNA tubes were stored at -20° C until use. Table 4: RT Reaction Mix RT Reaction mix Volume Concentration 10X Reaction Buffer 2 pl 1X 25 mM MgCI2 4 pl 5 mM Deoxynucleotide Mix 2 pl 1 mM Oligo-p(dT)i5 Primer 2 pl 0.04 A260 units (1.6 g) Rnase Inhibitor 1.0 pl 50 units AMV Reverse Transcriptase 0.8 pl >20 units Water, PCR Grade 8.2 pl - RNA sample 5 pl Total RNA isolated Total 25 pl

[00256] To study the gene expression, gpr17 gene was used. Beta-actin was selected as a control gene. Since many commonly used study genes are known to vary under experimental conditions, to quantify the gene expression changes in Zebrafish, the internal 5 control gene (Beta-actin) that stably expressed under different experimental conditions was used to normalise the study gene. All the primers used in the study were designed using NCBI primer blast tool. The primers were synthesized from Sigma Aldrich- Bangalore, India and the primers listed below used for the study assessment. Table 5: Primer Sequences Used to Quantify Gene Expression by Real-Time PCR Gene Primer Sequence Forward Primer Sequence Reverse Product Length gpr17 CCGCCAGAGAAACAACTCCT (SEQ ID NO: 1) TCTGACCTTGAGGGAGCGTA (SEQ ID NO: 2) 259 bp Betaactin GCATTGCTGACCGTATGCAG (SEQ ID NO: 3) GAAGCACTTCCTGTGGACGA (SEQ ID NO: 4) 203 bp d) PCR amplification

[00257] PCR amplification was performed using the cDNA as a template with a reaction volume of 20 pl as mentioned in Table 6 and the PCR conditions were set as tabulated in Table 7. All the PCR reactions were performed in triplicates and the negative control did not 15 contain any sample template. Table 6: cDNA to DNA synthesis PCR reaction mix PCR Reaction 20 pl Volume Concentration PCR Master Mix 10.0 pl 0.6 Units Primer Forward (Sigma) F (primer + TE Buffer) 2 pl 20 picomoles Primer Reverse (Sigma) R (primer + TE Buffer) 2 pl 20 picomoles PCR Grade water 4 pl - cDNA 2 pl 5 ng The PCR cycling parameters were set as follow, Table 7: PCR Conditions Steps Temperature Time Cycles Reaction heated to denature 94°C 2 min - Initial denaturation 95°C 5 min 1 Denaturation Cycle 95°C 30 seconds 30 Annealing Cycle 52°C 30 seconds 30 Extension Cycle 72°C 60 seconds 30 Final Extension 72°C 5 minutes 1

[00258] At the end of 30 cycles, a 6 pl aliquot of each sample will be mixed with 3 pl of gel loading buffer and electrophoresed on an 1.5% TBE agarose gel for 15 mins. The gel will be observed under the UV transilluminator for bands. For quantification, a 1 pl aliquot of the sample will be diluted in 2 ml distilled water and used for UV spectroscopy under 260 nm absorbance to determine the concentration of the DNA. Results

[00259] Using the GALC +1- zebrafish model of Krabbe disease, treatment with compound 6 at a dose of 30 mg / kg demonstrated significant efficacy across multiple functional and behavioural endpoints, in many cases the performance of compound 6 was also equivalent to or greater than reference molecule Copaxone.

[00260] In an ataxia assay measuring swimming behaviour per minute, compound 6 substantially improved motor coordination relative to vehicle-treated GALC+ / - mutants. Furthermore, compound 6 exhibited improved motor coordination equivalent to that exhibited by Copaxone.

[00261] In an auditory response test, GALC+ / - mutants exhibited marked delays in latency to response, compound 6 produced statistically significant reductions in latency, consistent with improved sensory processing. Furthermore, reference compound Copaxone did not significantly ameliorate the delays in latency to response.

[00262] Seizure frequency, elevated in untreated mutants, was significantly reduced by compound 6 achieving near-complete normalization towards wild-type levels.

[00263] Dysphagia scores were significantly improved following treatment, with compound 6. Furthermore, compound 6 demonstrated superior efficacy in the dysphagia scores compared to Copaxone.

[00264] Analysis of brain histology studies showed the GALC+ / - mutant had a loss or thinning of the myelin sheath surrounding axons; axonal structures remained largely intact and myelin vacuolation was present. The presence of large, multinucleated macrophagelike globoid cells were apparent; accumulation of lipid-laden macrophages indicating myelin degradation and inflammatory response were noted. Additionally reactive gliosis are observed. Treatment with compound 6 shows a marked reduction in myelin degradation resulting in an overall reduction in the pathology score.

[00265] Gene expression analysis showed that the GALC +1- mutant had a marked upregulation of the gpr17 gene which is completely normalised following treatment with compound 6.

[00266] Collectively, these results support the therapeutic potential of compound 6 in mitigating the neurological and functional deficits associated with Krabbe disease. Results are shown in Figures 1-6. EXAMPLE 10: Effects of Example 6 (“compound 6”) in an ARSA+A zebrafish model of Metachromatic Leukodystrophy Model Development

[00267] The forward genetic method as perSolnica-Kreze et al., 1996 [ (Driever W, Solnica-Krezel L, Schier AF, Neuhauss SC, Malicki J, Stemple DL, Stainier DY, Zwartkruis F, Abdelilah S, Rangini Z, Belak J, Boggs C. A genetic screen for mutations affecting embryogenesis in zebrafish. Development. 1996 Dec; 123:37-46. PMID: 9007227.)] was employed to develop mutant lines. Adult zebrafish were subjected to the N-ethyl-N-nitrosourea (ENU) chemical mutagen to induce random mutagenesis, administered through the water dissolution method. Prior to spawning, the ENU-induced male zebrafish and adult females were housed separately under standard laboratory husbandry conditions. Zebrafish founders were set for spawning at a spawning ratio of female to male fish 1:4 per breeding tank. The F1 progeny were screened, and the resulting mutants were inbred to generate stable lines. For the study, stable heterozygous founders were inbred to generate homozygous ARSA+ / - mutants; Gene ID: 541416, which were used for the study. ARSA+ / -mutant embryos were housed and maintained in embryo medium. Quality checks of the embryonic development were done using a Labomed LX400 brightfield microscope with Labomed Camera LC-5 1080P C-MOUNT WIFI CMOS. The embryos displaying an opaque discoloration were rejected, and only the embryos with the best growth phase were selected for the study. The selected embryos were transferred to two-litre housing water and housed at a density of 80 per housing tank of 25 litres capacity, ensuring adequate space for swimming motion and minimizing crowding. Screening for mutants was carried out at 3 days post-fertilization (dpf) for the manifestation of behavioural phenotype with restricted movement, and the selected larvae were advanced for the study. During the larvae developmental stages (0 dpf to 5 dpf), the study tanks were conditioned (under a water temperature of 27 ± 1°C and pH between 7.2-7.4). Dose Selection and Dose Administration

[00268] Larvae in various groups were treated with compound 6 and the reference drug Copaxone (generic name: glatiramer acetate; approved for treatment of multiple sclerosis) to evaluate their efficacy. Larvae were observed continuously for phenotypic and behavioural changes. Test compounds were solubilized in a mixture of (Mother stock dilution—Distilled water (85%), DMSO (5%), and (10%) Virgin coconut oil). The stock concentration for test compounds was derived and executed for the dose administration concentration by dilution in 100% distilled water. Study groups treated with compound 6 and standard drug Copaxone were dosed from 5 dpf to 11 dpf with a 24-hour washout cycle. Screening

[00269] Efficacy screening was performed at a single timepoint of 12 dpf. 1) Behavioural Response Assay 1: Convulsions

[00270] Convulsions in zebrafish larvae were characterized by sudden, uncontrolled, and repetitive muscular contractions, leading to erratic swimming behaviours such as rapid darting, spinning, high-frequency tail flicks, and loss of coordinated movement. The average turn angle served as a behavioural marker to distinguish normal swimming from seizure-like convulsive episodes in zebrafish larvae. During convulsive episodes, larvae displayed abrupt high-angle turns, erratic directional changes, and reduced straight swimming bouts. An increased average turn angle indicated hyperactivity, loss of motor control, or convulsive behaviour, while a low turn angle represented normal swimming patterns. To evaluate turn angles, zebrafish larvae were transferred from housing tanks to a well plate, acclimatized, and placed in the video recording unit. The recorded video frames were then analysed to calculate the average turn angle. Assay 2: Visual Acuity Response

[00271] Latency to visual stimuli in zebrafish larvae was measured as the time taken by the larvae to initiate a behavioural response following the presentation of a visual stimulus. Larvae were transferred from housing tanks to individual wells in a well plate and allowed to acclimatize for 5 to 10 minutes. A visual stimulus, a moving black-and-white pattern, was presented. Continuous video recording was performed before, during, and after stimulus presentation to capture the larval response. The video was analysed frame by frame to determine the time point at which the larvae exhibited the first detectable behavioural response, such as body displacement, change in swim direction, or tail flick, following the visual stimulus.

[00272] The latency was calculated as the difference between the response time stamp and the stimulus onset time stamp and was expressed in seconds. The analysis was performed using video tracking software. A lower latency value indicated higher sensory acuity or alertness, while an increased latency suggested sensory or neurological impairment in the larvae. Latency = Response time stamp - Stimulus onset time stamp Assay 3: Ataxia Stereotype

[00273] Ataxia Stereotype was defined as a postural imbalance and uncoordinated locomotor behaviour in zebrafish larvae, characterized by irregular swimming patterns, loss of equilibrium, reduced swim speed, and frequent pauses during movement. To evaluate this phenotype, larvae were carefully transferred from the housing tank to an individual well of a multi-well plate. The larvae underwent an acclimation period of 15 minutes to allow them to adjust to the new environment and reduce stress-induced variability. Following acclimation, larval movements were recorded for a defined observation period using a video recording system. The recorded videos were analysed using behavioural tracking software to measure the number of bends per minute. The number of bends was calculated from the video frames, which in turn shed light on postural control and motor coordination. An increase in bends was indicative of uncoordinated erratic movements and postural instability associated with Ataxia Stereotype. Assay 4: Predator Avoidance Test

[00274] The predator avoidance assay was a fear-aggravated test to evaluate spatial memory retention in response to threat. In this experimental setup, an adult male zebrafish (cannibalistic) was used as a predator to create a threatening stimulus and the tank. The tank was partially divided into two sections with the predator tank on the left. To study predator avoidance behaviour, the larvae were screened in two phases: Habituation and Test. Habituation

[00275] During habituation, the larvae were placed on the start point of the experimental tank and were allowed to explore the tank. When the larvae entered the left section of the tank, a transparent gate slider was used to close the section to prevent the larvae from escaping the threat. The larvae's behaviour toward the threat was observed as startle and erratic behaviour. The gate was kept closed for a 3-minute duration for habituation to take place, post which the larvae were released back to the respective housing tanks. Test- Predator Escape and Avoidance Behaviour

[00276] The larvae were employed for assessment within 2 hours of habituation. During the test, the larvae were released at the start point of the experimental tank and were observed for predator avoidance behaviour. Larvae that exhibited spatial memory avoided the left section of the experimental tank, which housed the predator. Larvae that continued to explore the left section of the tank were considered to show reduced spatial memory. Assay 5: Wall Hitting Behaviour

[00277] In wall-hitting behaviour, the larvae were unable to recognize their own reflection and tried to follow it. In this assay, the number of times the larvae showed wall-hitting behaviour and the total time in motion per minute were tabulated. To study wall-hitting behaviour, the 12 dpf larvae were acclimatized to the study well for 30 minutes prior to observation and screening. The well plate was placed on a backlight stage preceding the video processing. From the video, the larvae were observed for phenotypic signs where the number of wall-hitting behaviours per minute was calculated, and the values were tabulated. 2) Physiology Assay 6: Percentage Dysphagia Phenotype with Constricted Gl Tract

[00278] Constriction of the gastrointestinal (Gl) tract was a characteristic feature associated with the dysphagia phenotype in zebrafish larvae. For assessment, larvae were sedated in a 0.03% MS-222 (tricaine methanesulfonate) solution for 2-3 minutes until complete cessation of movement was observed. Sedated larvae were then carefully transferred onto a clean microscope slide and positioned in the left lateral orientation. Observations were performed under a bright-field microscope to evaluate Gl tract morphology. Each larva was scored based on the presence or absence of the dysphagia phenotype as follows: Score 0 — Presence of dysphagia (constricted Gl tract) Score 1 — No phenotype (normal Gl tract)

[00279] The scores were recorded and tabulated, and the average score was calculated to determine the percentage of larvae exhibiting Gl tract constriction. 3) Pathology Assay 7: Pathology - Brain

[00280] Histopathology of the whole larvae was performed across all the study groups, and a pathologic scoring system was used to characterize the disease progression and provide significant insight into treatment strategies. Briefly, at 12th dpf, post 7 doses of the test compounds, the larvae (N=4 per group) were collected from all study groups for histopathological examination. The larvae were euthanized in 0.4% tricaine for 12 minutes to initiate euthanasia. Following euthanasia, fixation of the larvae was performed immediately to prevent dehydration of cell morphology. For fixation, the larvae were gently immersed in a solution of 5% neutral buffered formalin (NBF) for a period of 48 hours, maintaining a ratio of one larva per one millilitre of NBF. The fixed larvae were then subjected to tissue processing via dehydration in a graded series of ethanol from 70-100% and then blocked in paraffin solvent for embedding. The paraffin-embedded larvae were sectioned using a microtome (Abron Scientific-Advanced Microtomy AB-91-07) with a thickness of 10 microns and stained with Luxol Fast Blue (LFB) and Hematoxylin &Eosin (H&E) staining. The tissue sections were observed under a light microscope at 20X and 40X magnification. Images were captured using a Labomed Camera installed with the Image View interface. The pathology scores were used to characterize the level of disease progression across the study groups, as shown in Table 8. Table 8 Grade Scores Pathology Description Morphology Grade 0 0 Normal No pathological changes observed. Intact myelin, normal axons, and healthy brain tissue. Grade 1 1 Demyelination Loss or thinning of myelin sheaths. Reduced LFB staining, loss of compact myelin. Grade 2 2 Axonal Spheroids Formation of swollen axonal structures. Spherical axonal swellings indicating axonal damage. Grade 3 3 Astrogliosis Hypertrophy and proliferation of astrocytes. Increased GFAP immunoreactivity. Grade 4 4 Sulfatide Deposits Accumulation of sulfatide lipids. Visible sulfatide deposits within brain tissue. Grade 5 5 Loss of Granular Neurons Reduction or loss of granular neurons. Decreased neuronal density, especially in cerebellum or cortical layers. 4) Gene Expression Assay 8: Gene Expression - RT-PCR gpr17 Expression Levels in Brain; RT-PCR a) Sample Collection

[00281] The larvae were sedated with a 0.03% MS-222 solution for 2-3 minutes until movement ceased. After sedation, the fry were gently transferred onto a clean slide with the posterior side up and decapitated by means of a fine needle. The cut was made at the junction between the brainstem and the spinal cord. The eyes were carefully removed, thereby providing better visualization of the whole brain. Soft tissue was removed from the dorsal side of the brain. Samples of 6*3 pooled larvae were harvested and stored together in 100 pL acid phenol at -20° C until RNA extraction. b) RNA Extraction

[00282] The total RNA was extracted using the phenol-chloroform extraction method as described by Chomczynski, P., et al. The method is based on phase separation and aids in the isolation of desired RNA. The sample was homogenized in 300 pL of Acid phenol. A volume of 250 pL of chloroform was added to the homogenate and vortexed for a few seconds. The sample was incubated in an ice bath for 15 minutes. After incubation, the sample was vortexed at high speed for 1 minute followed by centrifugation at high speed for 10 minutes. This yielded three distinct phases: the clear aqueous phase containing RNA, a thin interphase containing cellular debris, and the lower phase with organic substances. The aqueous phase containing RNA was transferred to a fresh centrifuge tube, and 100 pL of isopropanol was added followed by incubation in the ice bath for 40 minutes. At the end of the ice incubation, the sample was centrifuged at 16600 x g for 10 minutes to precipitate RNA. The supernatant was discarded, and the tube containing the RNA pellet was dried in the incubator at 40°C to evaporate isopropanol. The RNA quality was evaluated with gel electrophoresis, and the aliquots were directly used for reverse transcriptase reaction. c) Reverse Transcriptase

[00283] cDNA was synthesized from total RNA (20 pL final reaction volume) with oligo(dT)15 primer using Avian Myeloblastosis Virus (AMV) reverse transcriptase (First Strand cDNA Synthesis Kit; Roche) according to the manufacturer’s instructions. The cDNA tubes were stored at -20° C until use. Table 9: RT Reaction Mix RT Reaction mix Volume Concentration 10X Reaction Buffer 2 pl 1X 25 mM MgCI2 4 pl 5 mM Deoxynucleotide Mix 2 pl 1 mM Oligo-p(dT)i5 Primer 2 pl 0.04 A260 units (1.6 g) Rnase Inhibitor 1.0 pl 50 units AMV Reverse Transcriptase 0.8 pl >20 units Water, PCR Grade 8.2 pl - RNA sample 5 pl Total RNA isolated Total 25 pl

[00284] To study the gene expression, gpr17 gene was used. Beta-actin was selected as a control gene. Since many commonly used study genes are known to vary under experimental conditions, to quantify the gene expression changes in Zebrafish, the internal control gene (Beta-actin) that stably expressed under different experimental conditions was 5 used to normalise the study gene. All the primers used in the study were designed using NCBI primer blast tool. The primers were synthesized from Sigma Aldrich- Bangalore, India and the primers listed below used for the study assessment. Table 10: Primer Sequences Used to Quantify Gene Expression by Real-Time PCR Gene Primer Sequence Forward Primer Sequence Reverse Product Length gpr17 CCGCCAGAGAAACAACTCCT (SEQ ID NO: 1) TCTGACCTTGAGGGAGCGTA (SEQ ID NO: 2) 259 bp Betaactin GCATTGCTGACCGTATGCAG (SEQ ID NO: 3) GAAGCACTTCCTGTGGACGA (SEQ ID NO: 4) 203 bp 10 d) PCR amplification

[00285] PCR amplification was performed using the cDNA as a template with a reaction volume of 20 pl as mentioned in Table 11 and the PCR conditions were set as tabulated in Table 12. All the PCR reactions were performed in triplicates and the negative control did not contain any sample template. 15 Table 11: cDNA to DNA synthesis PCR reaction mix PCR Reaction 20 pl Volume Concentration PCR Master Mix 10.0 pl 0.6 Units Primer Forward (Sigma) F (primer + TE Buffer) 2 pl 20 picomoles Primer Reverse (Sigma) R (primer + TE Buffer) 2 pl 20 picomoles PCR Grade water 4 pl - cDNA 2 pl 5 ng

[00286] The PCR cycling parameters were set as follows: Table 12: PCR Conditions Steps Temperature Time Cycles Reaction heated to denature 94°C 2 min - Initial denaturation 95°C 5 min 1 Denaturation Cycle 95°C 30 seconds 30 Annealing Cycle 52°C 30 seconds 30 Extension Cycle 72°C 60 seconds 30 Final Extension 72°C 5 minutes 1

[00287] At the end of 30 cycles, a 6 pl aliquot of each sample will be mixed with 3 pl of gel loading buffer and electrophoresed on an 1.5% TBE agarose gel for 15 mins. The gel will be observed under the UV transilluminator for bands. For quantification, a 1 pl aliquot of the sample will be diluted in 2 ml distilled water and used for UV spectroscopy under 260 nm absorbance to determine the concentration of the DNA. Results

[00288] The data from these studies demonstrate that Compound 6 (30mg / kg) significantly improved several behavioural and physiological measures in the ARSA+ / - mutant zebrafish model compared to the untreated ARSA+ / - mutants.

[00289] In the convulsion test, ARSA+ / - mutants exhibited a significantly higher number of convulsion events per minute compared to wild-type zebrafish. Compound 6 notably reduced convulsion events, bringing them closer to wild-type levels.

[00290] For the visual acuity response, ARSA+ / - mutants had a much longer latency to respond to a visual stimulus. Compound 6 significantly reduced this latency, showing improved visual response in the mutants compared to untreated ARSA+ / - zebrafish.

[00291] In the ataxia stereotype test, ARSA+ / - mutants displayed a much higher number of bends per minute, indicating ataxia. Compound 6 significantly reduced the number of bends, improving motor coordination in the mutants.

[00292] The predator avoidance test revealed that ARSA+ / - mutants performed poorly, showing a significantly lower average score compared to wild-type. Compound 6 significantly improved predator avoidance, bringing the ARSA+ / - mutants closer to wild-type performance.

[00293] For wall hitting behaviour, ARSA+ / - mutants exhibited significantly more wallhitting, a sign of aggression. Compound 6 significantly reduced this behaviour in the mutants, showing a notable improvement.

[00294] In the dysphagia phenotype, ARSA+ / - mutants exhibited a more severe constriction of the gastrointestinal tract. Compound 6 alleviated this dysphagia phenotype to a significant extent, improving the condition of the ARSA+ / - mutants.

[00295] Analysis of brain histology studies showed the ARSA+ / - mutant showed loss or thinning of myelin sheaths, formation of swollen axonal structures, hypertrophy and proliferation of astrocytes, accumulation of sulfatide lipids and reduction or loss of granular neurons. Treatment with compound 6 showed remyelination, and improvements in the number of swollen axonal structures, hypertrophy and proliferation of astrocytes.

[00296] Gene expression analysis showed that the ARSA +1- mutant had a marked upregulation of the gpr17 gene which is completely normalised following treatment with compound 6.

[00297] Overall, Compound 6 showed strong therapeutic effects across all measured endpoints, significantly improving the behavioural and physiological phenotypes of the ARSA+ / - mutant zebrafish. Results are shown in Figures 7-14. EXAMPLE 11: Effects of Example 6 (“compound 6”) in an EIF2B1+ / - zebrafish model of Vanishing White Matter Disease Model Development

[00298] The forward genetic method as per Solnica-Kreze et al., 1996 (Driever W, Solnica-Krezel L, Schier AF, Neuhauss SC, Malicki J, Stemple DL, Stainier DY, Zwartkruis F, Abdelilah S, Rangini Z, Belak J, Boggs C. A genetic screen for mutations affecting embryogenesis in zebrafish. Development. 1996 Dec; 123:37-46. PMID: 9007227.) was employed to develop mutant lines. Adult zebrafish were subjected to the N-ethyl-N-nitrosourea (ENU) chemical mutagen to induce random mutagenesis, administered through a water dissolution method. Prior to spawning, the ENU-induced male zebrafish and adult females were housed separately under standard laboratory husbandry conditions. Zebrafish founders were set for spawning at a spawning ratio of female to male fish of 1:4 per breeding tank. The F1 progeny were screened, and the resulting mutants were inbred to generate stable lines. For the current study, stable heterozygous founders were inbred to generate homozygous EIF2B1+ / -; Gene ID: 415150, which were used for the study. EIF2B1+ / -mutant embryos were housed and maintained in embryo medium. Quality checks of embryonic development were performed using a Labomed LX400 brightfield microscope with Labomed Camera LC-5 1080P C-MOUNT WIFI CMOS. Embryos displaying opaque discolouration were discarded, and only embryos in optimal growth phases were selected for study. The selected embryos were transferred to two-litre housing water and housed at density of 80 per housing tank of 25-litre capacity, ensuring adequate space for swimming motion and minimising crowding. Screening for mutants was carried out on 3 days postfertilization (dpf) for the manifestation of behaviour phenotype with restricted movement, and the selected larvae were advanced for the study. During the larval development stages (0 dpf to 5 dpf), the study tanks were conditioned (under a water temperature of 27 ±1°C and pH between 7.2 and 7.4.

[00299] Larvae in various groups were treated with compound 6 and the reference drug Copaxone (generic name: glatiramer acetate; approved for treatment of multiple sclerosis) to evaluate efficacy. Larvae were observed continuously for phenotypic and behavioural changes. Test compounds were solubilised in a mixture of (Mother stock dilution - distilled water (85%), DMSO (5%), and (10%) virgin coconut oil). The stock concentration for test compounds was derived and executed for the dose administration concentration by dilution in 100% distilled water. Study groups treated with Compound 6 and standard drug Copaxone were dosed from 5 dpf to 11 dpf with a 24-hour washout cycle. Screening

[00300] Efficacy screening was performed at a single timepoint of 12 dpf. 1) Behavioural Response Assay 1: Temperature Sensitivity

[00301] This assay assessed thermal preference and neurobehavioural response by measuring time spent in a 30°C zone. The test arena was divided into three zones: cold (25°C), neutral (28°C), and hot (30°C). Larvae (N=24 per group) were individually acclimatised in the neutral zone for 10 minutes before being allowed to swim freely for 15-20 minutes while video recorded. Time spent in the hot zone was documented; decreased time indicated temperature sensitivity. Assay 2: Auditory Response

[00302] The auditory response assay was a behavioural test to evaluate the neuromotor function of zebrafish larvae in response to an auditory stimulus. Larvae (N = 24 per group) were assessed individually. Each larva was placed in the experimental chamber and allowed to acclimate for 5 minutes under controlled conditions, with no external stimuli applied during this period. Following acclimation, the larva was exposed to an auditory stimulus delivered once per minute for three consecutive minutes. This procedure was repeated for all larvae within the group. The latency to respond to each auditory stimulus was recorded, and the average data was subjected to subsequent analysis to assess neuromotor performance.

[00303] The latency was calculated as the difference between the response time stamp and the stimulus onset time stamp and was expressed in seconds. The analysis was performed using video tracking software. A lower latency value indicated higher sensory alertness, while an increased latency suggested sensory or neurological impairment in the larvae. Latency = Response time stamp - Stimulus onset time stamp Assay 3: Ataxia Stereotype

[00304] Ataxia Stereotype was defined as a postural imbalance and uncoordinated locomotor behaviour in zebrafish larvae, characterized by irregular swimming patterns, loss of equilibrium, reduced swim speed, and frequent pauses during movement. To evaluate this phenotype, larvae were carefully transferred from the housing tank to an individual well of a multi-well plate. The larvae underwent an acclimation period of 15 minutes to allow them to adjust to the new environment and reduce stress-induced variability. Following acclimation, larval movements were recorded for a defined observation period using a video recording system. The recorded videos were analyzed using behavioural tracking software to measure the number of bends per minute. The number of bends was calculated from the video frames, which in turn shed light on the postural control and motor coordination. An increase in bends was indicative of uncoordinated erratic movements and postural instability associated with Ataxia Stereotype. Assay 4: Predator Avoidance Test

[00305] The predator avoidance assay was a fear-aggravated test to evaluate spatial memory retention in response to threat. In this experimental setup, an adult male zebrafish (cannibalistic) was used as a predator to create a threatening stimulus and the tank. The tank was partially divided into two sections with the predator tank on the left. To study predator avoidance behaviour, the larvae were screened in two phases: Habituation and Test. Habituation

[00306] During habituation, the larvae were placed on the start point of the experimental tank and were allowed to explore the tank. When the larvae entered the left section of the tank, a transparent gate slider was used to close the section to prevent the larvae from escaping the threat. The larvae's behaviour toward the threat was observed as startle and erratic behaviour. The gate was kept closed for a 3-minute duration for habituation to take place, post which the larvae were released back to the respective housing tanks. Test- Predator Escape and Avoidance Behaviour

[00307] The larvae were employed for assessment within 2 hours of habituation. During the test, the larvae were released at the start point of the experimental tank and were observed for predator avoidance behaviour. Larvae that exhibited spatial memory avoided the left section of the experimental tank, which housed the predator. Larvae that continued to explore the left section of the tank were considered to show reduced spatial memory. Assay 5: Seizure

[00308] Seizures were characterized by sudden, uncontrolled electrical disturbances in the brain, leading to alterations in behaviour, motor activity, or consciousness. To assess seizure-like activity, zebrafish larvae were transferred from the housing tank to a well plate and allowed to acclimate for 5 minutes under controlled conditions. Following acclimation, the well plate was placed within a video recording unit, and larval behaviour was recorded continuously for 3 minutes. The recorded videos were processed to extract the x and y coordinates of each larva, which were analyzed for episodes of sudden high-velocity movements indicative of seizure-like activity. The number of such events per minute was quantified and tabulated for subsequent analysis. 2) Pathology Assay 6: Pathology - Brain

[00309] Histopathology of the whole larvae was performed across all the study groups, and a pathologic scoring system was used to characterize the disease progression and provide significant insight into treatment strategies. Briefly, at 12th dpf, after 7 doses of the test compounds, the larvae (N=4 per group) were collected from all study groups for histopathological examination. The larvae were euthanized in 0.4% tricaine for 12 minutes to initiate euthanasia. Following euthanasia, fixation of the larvae was performed immediately to prevent dehydration of cell morphology. For fixation, the larvae were gently immersed in a solution of 5% neutral buffered formalin (NBF) for a period of 48 hours, maintaining a ratio of one larva per one millilitre of NBF. The fixed larvae were then subjected to tissue processing via dehydration in a graded series of ethanol from 70-100% and then blocked in paraffin solvent for embedding. The paraffin-embedded larvae were sectioned using a microtome (Abron Scientific-Advanced Microtomy AB-91-07) with a thickness of 10 microns and stained with Luxol Fast Blue (LFB) and Hematoxylin &Eosin (H&E) staining. The tissue sections were observed under a light microscope at 20X and 40X magnification. Images were captured using a Labomed Camera installed with the Image View interface. The pathology scores were used to characterize the level of disease progression across the study groups, as shown in Table 13. Table 13 Score Grade Pathology Description Morphology Description 0 Normal No pathological changes observed Normal brain tissue architecture and morphology 1 Grade I Tissue vacuolisation Presence of vacuoles within brain parenchyma indicating mild cellular damage 2 Grade II Neuronal displacement with astrocytes bearing blunt processes Neurons misplaced or scattered from typical regions 3 Grade III Cystic white matter degeneration Cystic spaces in white matter indicating demyelination and tissue loss 4 Grade IV Periventricular and deep white matter loss Loss of white matter integrity in periventricular and deep brain regions 5 Grade V Deep cerebral matter loss Severe loss of deep cerebral structures with extensive degeneration 3) Gene Expression Assay 7: RT-PCR - gpr17 Expression Levels in Brain RT-PCR a) Sample Collection

[00310] Larvae were sedated with 0.03% MS-222 for 2-3 minutes until movement ceased. After sedation, the fry were gently transferred onto a clean slide with the posterior side up and decapitated by means of a fine needle. The cut was made at the junction between the brainstem and the spinal cord. The eyes were carefully removed, thereby providing better visualization of the whole brain. Soft tissue was removed from the dorsal side of the brain. Samples of 6*3 pooled larvae were harvested and stored together in 100 pL acid phenol at -20° C until RNA extraction. b) RNA Extraction

[00311] The total RNA was extracted using the phenol-chloroform extraction method as described by Chomczynski, P., et al. The method is based on phase separation and aids in the isolation of desired RNA.

[00312] The sample was homogenized in 300 pL of Acid phenol. A volume of 250 pL of chloroform was added to the homogenate and vortexed for a few seconds. The sample was incubated in an ice bath for 15 minutes. After incubation, the sample was vortexed at high speed for 1 minute followed by centrifugation at high speed for 10 minutes. This yielded three distinct phases: the clear aqueous phase containing RNA, a thin interphase containing cellular debris, and the lower phase with organic substances. The aqueous phase containing RNA was transferred to a fresh centrifuge tube, and 100 pL of isopropanol was added followed by incubation in the ice bath for 40 minutes. At the end of the ice incubation, the sample was centrifuged at 16600 x g for 10 minutes to precipitate RNA. The supernatant was discarded, and the tube containing the RNA pellet was dried in the incubator at 40°C to evaporate isopropanol. The RNA quality was evaluated with gel electrophoresis, and the aliquots were directly used for reverse transcriptase reaction. c) Reverse Transcription

[00313] cDNA was synthesized from total RNA (20 pL final reaction volume) with oligo(dT)15 primer using Avian Myeloblastosis Virus (AMV) reverse transcriptase (First Strand cDNA Synthesis Kit; Roche) according to the manufacturer’s instructions. The cDNA tubes were stored at -20° C until use. Table 14: RT Reaction Mix RT Reaction mix Volume Concentration 10X Reaction Buffer 2 pl 1X 25 mM MgCI2 4 pl 5 mM Deoxynucleotide Mix 2 pl 1 mM Oligo-p(dT)i5 Primer 2 pl 0.04 A260 units (1.6 g) Rnase Inhibitor 1.0 pl 50 units AMV Reverse Transcriptase 0.8 pl >20 units Water, PCR Grade 8.2 pl - RNA sample 5 pl Total RNA isolated Total 25 pl

[00314] To study the gene expression, gpr17 gene was used. Beta-actin was selected as a control gene. Since many commonly used study genes are known to vary under 5 experimental conditions, to quantify the gene expression changes in Zebrafish, the internal control gene (Beta-actin) that stably expressed under different experimental conditions was used to normalise the study gene. All the primers used in the study were designed using NCBI primer blast tool. The primers were synthesized from Sigma Aldrich- Bangalore, India and the primers listed below used for the study assessment. 10 Table 15: Primer Sequences Used to Quantify Gene Expression by Real-Time PCR Gene Primer Sequence Forward Primer Sequence Reverse Product Length gpr17 CCGCCAGAGAAACAACTCCT (SEQ ID NO: 1) TCTGACCTTGAGGGAGCGTA (SEQ ID NO: 2) 259 bp Betaactin GCATTGCTGACCGTATGCAG (SEQ ID NO: 3) GAAGCACTTCCTGTGGACGA (SEQ ID NO: 4) 203 bp d) PCR amplification

[00315] PCR amplification was performed using the cDNA as a template with a reaction volume of 20 pl as mentioned in Table 16 and the PCR conditions were set as tabulated in 15 Table 17. All the PCR reactions were performed in triplicates and the negative control did not contain any sample template. Table 16: cDNA to DNA synthesis PCR reaction mix PCR Reaction 20 pl Volume Concentration PCR Master Mix 10.0 pl 0.6 Units Primer Forward (Sigma) F (primer + TE Buffer) 2 pl 20 picomoles Primer Reverse (Sigma) R (primer + TE Buffer) 2 pl 20 picomoles PCR Grade water 4 pl - cDNA 2 pl 5 ng

[00316] The PCR cycling parameters were set as follow, Table 17: PCR Conditions Steps Temperature Time Cycles Reaction heated to denature 94°C 2 min - Initial denaturation 95°C 5 min 1 Denaturation Cycle 95°C 30 seconds 30 Annealing Cycle 52°C 30 seconds 30 Extension Cycle 72°C 60 seconds 30 Final Extension 72°C 5 minutes 1

[00317] At the end of 30 cycles, a 6 pl aliquot of each sample will be mixed with 3 pl of gel loading buffer and electrophoresed on an 1.5% TBE agarose gel for 15 mins. The gel will be observed under the UV transilluminator for bands. For quantification, a 1 pl aliquot of the sample will be diluted in 2 ml distilled water and used for UV spectroscopy under 260 nm absorbance to determine the concentration of the DNA. Results

[00318] In zebrafish larvae carrying the EIF2B1+ / - mutation, treatment with Compound 6 at a dose of 30 mg / kg resulted in significant improvement across multiple behavioural assays when compared to untreated EIF2B1 mutant controls.

[00319] In the temperature sensitivity assay, Compound 6 significantly reduced the time spent in the high-temperature zone (30°C), consistent with a reduction in abnormal thermal preference and enhanced thermosensory regulation.

[00320] In the auditory response test, Compound 6 significantly decreased the latency to respond to auditory stimuli, suggesting an improvement in neuromotor reflexes.

[00321] The ataxia stereotype assay showed that Compound 6 markedly reduced the average turn angle, reflecting improved motor coordination and reduced postural instability.

[00322] In the predator avoidance test, larvae treated with Compound 6 demonstrated a significant increase in avoidance behaviour, indicative of improved spatial memory and threat recognition.

[00323] In the seizure assay, Compound 6 significantly reduced the number of high-velocity seizure-like events per minute, indicating a marked suppression of seizure activity.

[00324] Histopathology of brain sections from EIF2B1 +1- mutants showed the presence of vacuoles within brain parenchyma indicating mild cellular damage, formation of cystic spaces within white matter indicating demyelination and tissue loss, Loss of white matter integrity in periventricular and deeper brain regions was also noted. Severe loss of deep cerebral structures with extensive neuronal and white matter degeneration were also observed. Treatment with compound 6 showed marked improvements in pathology with reduction in tissue vacuoles, demyelination, and loss of deep cerebral structures. Treatment with compound 6 also showed more restricted white matter degeneration, with a reduction in demyelination.

[00325] Gene expression analysis showed that the EIF2B1 +1- mutant had a marked upregulation of the gpr17 gene which is completely normalised following treatment with compound 6.

[00326] Together, these results demonstrate that Compound 6 effectively reversed multiple neurological and behavioural deficits in the EIF2B1 mutant zebrafish model. Results are shown in Figures 15-21. EXAMPLE 12: Effects of Example 6 (“compound 6”) in a SOD1G86,94A zebrafish model of Amyotrophic Lateral Sclerosis (ALS) Model Development

[00327] Mutant zebrafish lines were generated using a forward genetic approach as described by Solnica-Krezel et al., 1996 (Driever W, Solnica-Krezel L, Schier AF, Neuhauss SC, Malicki J, Stemple DL, Stainier DY, Zwartkruis F, Abdelilah S, Rangini Z, Belak J, Boggs C. A genetic screen for mutations affecting embryogenesis in zebrafish. Development. 1996 Dec; 123:37-46. PMID: 9007227.). Adult zebrafish were exposed to N-ethyl-N-nitrosourea (ENU), a potent chemical mutagen, administered via water dissolution to induce random germline mutations. Following mutagenesis, ENU-treated males and untreated wild-type females were maintained separately under standard laboratory husbandry conditions. Spawning was carried out at a female-to-male ratio of 1:4 per breeding tank. The resulting F1 progeny were screened for mutations, and identified mutants were inbred to establish stable lines.

[00328] For the present study, stable heterozygous sod1 mutant founders (superoxide dismutase 1 mutant SOD1G86,94A); Gene ID: 30553 were inbred to generate homozygous sod1 mutants. Embryos representing the ALS mutant line were maintained in embryo medium under standard conditions. Embryonic development quality was assessed using a Labomed LX400 brightfield microscope equipped with a Labomed LC-5 1080P C-MOUNT WiFi CMOS camera. Embryos exhibiting opaque discoloration or developmental abnormalities were excluded, while only morphologically normal embryos at optimal growth stages were selected for further study.

[00329] Selected embryos were transferred into two-litre volumes of conditioned water and reared at a stocking density of 80 embryos per 25-litre housing tank, ensuring adequate space for free swimming and minimizing crowding stress. Mutant screening was performed at 3 days post-fertilization (dpf) based on the presence of behavioural phenotypes, specifically reduced locomotor activity. Larvae exhibiting the mutant phenotype were selected for inclusion in the study. Throughout the early developmental period (0 to 5 dpf), all study tanks were maintained under controlled environmental conditions, with water temperature regulated at 27 ± 1°C and pH maintained between 7.2 and 7.4. Dose Selection and Dose Administration

[00330] Therapeutic intervention groups were treated with compound 6 and standard drug Rasagiline to evaluate their efficacy. Throughout the treatment period, the larvae were continuously monitored for phenotypic and behavioural changes.

[00331] Test compounds were solubilized in a mixture of (Mother stock dilution- Distilled water (85%), DMSO (5%) and (10%) Virgin coconut oil). The stock concentration for test compounds was derived and executed for the dose administration concentration by dilution in 100% distilled water. The experimental groups were dosed on 4 dpf to13 dpf with 24 hr washout cycle.

[00332] For therapeutic groups the dose was administered using the water dissolution method. Screening was performed on 14 dpf for behavioural and phenotype changes and the respective findings was recorded for further analysis. Screening

[00333] The efficacy screening of the test compound was performed at a single timepoint. 1) Behaviour Response Assay 1: Conditioned Response Score

[00334] Conditioned response is a form of associative learning wherein zebrafish larvae learn to associate a neutral stimulus a conditioned stimulus with a biologically significant event an unconditioned stimulus, leading to a measurable behavioural change upon subsequent exposure to the conditioned stimulus alone.

[00335] For the conditioning paradigm, there are two phases, Habituation and test phase. During habituation the larvae were exposed to a repetitive pairing of the conditioned stimulus such as an auditory tone along with an unconditioned stimulus like a mild tap (as detailed in the illustration below). After several pairing exposure as habituation, the larvae begin to exhibit a predictive behavioural response, such as an escape movement, increased swim speed, or freezing behaviour, in response to the conditioned stimulus alone. This was observed in the test phase as detailed in Figure 22.

[00336] The conditioned response was quantified by qualitative scoring by analysing changes in swim velocity, turn angle, or latency to respond following conditioned stimulus, using video tracking software. Assay 2: Swim Distance & Swim Velocity

[00337] To assess motor impairments associated with the SOD1 mutant zebrafish larvae, swim distance and swim velocity were measured as key behavioural endpoints. Larvae from both wild-type, mutant groups and treatment groups were individually placed in a 24-well plate containing fresh embryo medium and allowed to acclimate for 5 minutes. Following acclimatization, larval locomotor activity was recorded for 5 minutes using a video recording unit under controlled lighting and temperature conditions. The x, y coordinates of each larva were extracted from the video data, and the total swim distance (mm) was calculated as the cumulative distance travelled during the observation period. Average swim velocity (mm / s) was determined by dividing the total swim distance by the duration of observation. These parameters were analysed and compared between the control, SOD1 mutant and treated groups, where a reduction in swim distance and average swim velocity were considered indicative of impaired neuromuscular function in the mutant larvae. 2) Physiology Assay 3: Percentage Dysphagia Phenotype with constricted Gl Tract

[00338] Constriction of the gastrointestinal (Gl) tract was a characteristic feature associated with the dysphagia phenotype in zebrafish larvae. For assessment, larvae were sedated in a 0.03% MS-222 (tricaine methanesulfonate) solution for 2-3 minutes until complete cessation of movement was observed. Sedated larvae were carefully transferred onto a clean microscope slide and positioned in the left lateral orientation. Observations were performed under a bright-field microscope to evaluate Gl tract morphology. Each larva was scored based on the presence or absence of the dysphagia phenotype as follows: Score 0 —Presence of dysphagia (constricted Gl tract) Score 1 — No phenotype (normal Gl tract).

[00339] The scores were recorded and tabulated, and the average score was calculated to determine the percentage of larvae exhibiting Gl tract constriction. Assay 4: Percentage Respiratory Insufficiency Phenotype with Reduced Operculum Activity

[00340] Respiratory operculum rate was determined according to a protocol described by Ayoola and Fredrick (2012) (Ayoola, O.A and Fredrick, A. C. (2012). Effects of the Shape of Culture Tanks on Production of the African Catfish Clarias gariepinus Juveniles. Journal of Agriculture and Social Research, 12(1): 1-18) and Zaig et al. (2021) (Zaig S, da Silveira Scarpellini C, Montandon G. Respiratory depression, and analgesia by opioid drugs in freely behaving larval zebrafish. Elife. 2021 Mar 15; 10: e63407) with few modifications. Briefly, one single larva (14 dpf) was selected at random from each group at a time and transferred into a hollow capillary tube by capillary action along with embryo medium and acclimatized for 3 min. The capillary tube was placed under the stereo microscope and video was recorded for 3min with a DSLR model no NIKON D3300 attached to the microscope. To assess the operculum movement, the recorded video was manually analysed. The number of beats per minute (bpm) was determined by counting the complete cycles of opening and closing of the operculum, which is a thin bony flap covering the gill complex. Each complete cycle was considered as one beat. To calculate the respiratory insufficiency phenotype with reduced operculum activity, a score value was assigned based on the operculum movement. A score of 0 indicated normal operculum movement within the range of 100-155bpm. A score of 1 was assigned to individuals with irregular operculum movement, either below 100 bpm or above 155 bpm. Finally, the percentage of zebrafish displaying the respiratory insufficiency phenotype was calculated by dividing the number of individuals with a score of 1 by the total number of individuals analysed and multiplying the result by 100. 3)Pathology Assay 5: Pathology - Brain and Spine

[00341] Histopathology of the whole larvae was performed across all the study groups, and a pathologic scoring system was used to characterize the disease progression and to provide a significant insight into treatment strategies. Briefly, at 14th dpf, post 8 doses of the test compounds, the larvae (N=4 per group) were collected from all study groups for histopathological examination. The larvae were euthanized in 0.4% tricaine for 12 mins to initiate euthanasia. Following euthanasia, fixation of the larvae was performed immediately to prevent dehydration of cell morphology. For fixation, the larvae were gently immersed in a solution of 5% neutral buffered formalin (NBF) for a period of 48 hours, maintaining a ratio of one larva per one millilitre of NBF.

[00342] The fixed larvae were then subjected to tissue processing via dehydration in a graded series of ethanol from 70-100% and then blocked in paraffin solvent for embedding. The Paraffin embedded larvae were oriented along the dorsal side and was sectioned using a microtome (Abron Scientific-Advanced Microtomy AB-91-07) with a thickness of 10 microns along the anterior posterior axis and stained with LFB and H&E staining. The tissue sections were observed under light microscope at 20X and 40X magnification. Images were captured using Labomed Camera installed with the Image view interface. The pathology score was used to characterize the level of disease progression across the study groups as shown in Table 18. Table 18: Grade Score Pathology Description Morphology Grade 0 1 No pathology observed Normal myelin architecture; intact neuroaxonal structures Grade 1 2 Remyelination (Marked by LFB stain) Presence of thin myelin sheaths indicating remyelination; partial restoration of myelin integrity Grade 2 3 Demyelination (Marked by LFB stain) Areas of myelin loss; vacuolated regions with reduced LFB staining intensity Assay 6: IHC-Microglia

[00343] Immunohistochemistry (IHC) was used to detect specific biological molecules through antibody-antigen interactions. In this study, IHC was employed to identify the number of MBP per field. a) Sample Collection

[00344] After the dosing period, whole zebrafish larvae were collected for IHC examination. The larvae were euthanized by a 12-minute exposure to 0.4% ice-cold tricaine for rapid euthanasia. Immediately following euthanasia, the larvae were fixed to prevent dehydration and maintain cell morphology. The larvae were immersed in 10% Neutral Buffered Formalin (NBF) for 24 hours, using a sample size of one larva per millilitre of NBF. The fixed samples were then subjected to tissue processing involving an increasing ethanol gradient and xylene clearing to prepare paraffin blocks. These blocks were sectioned into 3-micron slices, which was then cleared and rehydrated using a decreasing ethanol gradient, followed by antigen retrieval and immunohistochemistry processing. b) Immunohistostaining

[00345] Following 24 hours of fixation, antigen retrieval was performed using 10 mM sodium citrate (pH 6.0) to expose the target proteins. A 5% milk solution was then used as the blocking agent. The samples were incubated at 4°C with the primary antibody, Anti-lba1 antibody [ab5076], for 24 hours. After washing in1XTBS-0.1% Tween 20, the samples were 5 incubated at room temperature for 1 hour with the secondary antibody, Donkey Anti-Goat IgG H&L (Alexa Fluor®488) [ab150129], Following a final wash, the samples was prepared for imaging using Labomed Model-Lx400 eFL LED Fluorescence microscope. Table 19: Grade Score Pathology Description Morphology (IHC Findings on Microglia - Total and Activated) Grade 1 1 Normal microglial distribution and resting state Sparse microglia with small cell bodies and ramified thin processes; no activated microglia observed Grade 2 2 Mild microglial activation Slight increase in total microglia count; few microglia showing thicker processes or amoeboid morphology indicating early activation Grade 3 3 Moderate microglial activation Noticeable increase in microglial density; activated microglia with enlarged cell bodies and retracted processes localized to specific regions Grade 4 4 Severe microglial activation and proliferation High density of microglia, predominantly activated form, amoeboid shape with clustering around degenerating neurons or lesions Grade 5 5 Extensive microglial activation with tissue damage Diffuse proliferation of activated microglia; strong IHC staining for activation markers (e.g., Iba1 / CD68); severe loss of ramified microglia and replacement by fully activated phenotype with phagocytic morphology 10   4) Gene Expression Assay 7: Gene Expression-RT-PCR gpr17 expression levels in Brain; RT-PCR a) Sample Collection

[00346] The larvae were sedated with 0.03% MS-222 solution for 2-3minutes until the movement cease. Post which, the fry were gently transferred on to a clean slide with the 15 posterior side up and decapitated by means of a fine needle and the cut was made at the junction between brain stem and the spinal cord. The eyes were carefully removed thereby providing a better visualization of the whole brain. As much possible soft tissue was removed from the dorsal side of the brain. The samples of 6*3 pool larvae were harvested and stored together in 100 pl acid phenol at -20° C until RNA extraction. b) RNA Extraction

[00347] The total RNA was extracted using phenol chloroform extraction method as described in Chomczynski, P., et al. The method was based on phase separation of the sample and aids in the isolation of desired RNA.

[00348] The sample was homogenized in 300 pl of Acid phenol. A volume of 250 pl of chloroform was added to the homogenate and vortexed for few seconds. The sample was incubated in the ice bath for 15 mins. After incubation, the sample was vortexed at highspeed for 1 minute followed by centrifuge at high speed for 10 mins. This yielded three distinct phases as follows - clear aqueous phase containing RNA, thin interphase containing cellular debris and lower phase with organic substances. The aqueous phase containing RNA was transferred to a fresh centrifuge, and 100 pl of isopropanol was added to the tube followed by incubation in ice bath for 40 mins. At the end of ice incubation, the sample was centrifuged at16600 x g for 10 mins to precipitate RNA. The supernatant was discarded and the tube containing RNA pellet was dried in the incubator at 40°C to evaporate isopropanol. The RNA quality was evaluated with gel electrophoresis and the aliquots was directly used for reverse transcriptase reaction. c) Reverse Transcriptase

[00349] cDNA v synthesized from total RNA (20 pl final reaction volume) with oligo(dT) 15 primer using AMV reverse transcriptase (First strand cDNA synthesis kit; Roche) according to manufacturer’s instruction as mentioned in (Table 20). The cDNA tubes were stored at -20° C until use. Table 20: RT Reaction mix Volume Concentration 10X Reaction Buffer 2 pl 1X 25 mM MgCI2 4 pl 5 mM Deoxynucleotide Mix 2 pl 1 mM Oligo-p(dT)i5 Primer 2 pl 0.04 A260 units (1.6 g) Rnase Inhibitor 1.0 pl 50 units AMV Reverse Transcriptase 0.8 pl >20 units Water, PCR Grade 8.2 pl - RNA sample 5 pl Total RNA isolated Total 25 pl

[00350] To study the gene expression, gpr17 gene was used. 18s rRNA was selected as control gene. Since many commonly used study genes were known to vary under experimental conditions, for quantifying the gene expression changes in Zebrafish, the internal control gene (Beta-actin) that stably expressed under different experimental conditions was used to normalize the study gene. All the primers used in the study were designed using NCBI primer blast tool. The primers were synthesized from Sigma Aldrich-Bangalore, India and the following primers listed below were used for the study assessment. Table 21: Primer Sequences Used to Quantify Gene Expression by Real-Time PCR Gene Primer Sequence Forward Primer Sequence Reverse Product Length gpr17 CCGCCAGAGAAACAACTCCT (SEQ ID NO: 1) TCTGACCTTGAGGGAGCGTA (SEQ ID NO: 2) 259 bp Betaactin GCATTGCTGACCGTATGCAG (SEQ ID NO: 3) GAAGCACTTCCTGTGGACGA (SEQ ID NO: 4) 203 bp d) PCR Amplification

[00351] PCR amplification was performed using the cDNA as template with a reaction volume of 20 pl as mentioned in Table 22 and the PCR conditions were set as tabulated in Table 23. All the PCR reactions were performed in triplicates and the negative control did 10 not contain any sample template. Table 22: cDNA to DNA synthesis PCR reaction mix PCR Reaction 20 pl Volume Concentration PCR Master Mix 10.0 pl 0.6 Units Primer Forward (Sigma) F (primer + TE Buffer) 2 pl 20 picomoles Primer Reverse (Sigma) R (primer + TE Buffer) 2 pl 20 picomoles PCR Grade water 4 pl - cDNA 2 pl 5 ng

[00352] The PCR cycling parameters were set as follow, Table 23: PCR Conditions Steps Temperature Time Cycles Reaction heated to denature 94°C 2 min - Initial denaturation 95°C 5 min 1 Denaturation Cycle 95°C 30 seconds 30 Annealing Cycle 52°C 30 seconds 30 Extension Cycle 72°C 60 seconds 30 Final Extension 72°C 5 minutes 1

[00353] At the end of 30 cycles, a 6 pl aliquot of each sample was mixed with 3 pl of gel loading buffer and electrophoresed on an 1.5% TBE agarose gel for 15 mins. The gel was observed under the UV transilluminator for bands. For quantification, a 1 pl aliquot of the sample was diluted in 2 ml distilled water and used for UV spectroscopy under 260 nm absorbance to determine the concentration of the DNA. Results

[00354] The data demonstrate that treatment with Compound 6 at 30 mg / kg in zebrafish expressing the SOD1G86R ALS mutant results in significant improvements across multiple phenotypic readouts relative to untreated SOD1 mutant controls.

[00355] Specifically, Compound 6 markedly improved the conditioned response score, indicative of enhanced learning or sensorimotor integration.

[00356] In locomotor assays, Compound 6 restored both swim distance and swim velocity to levels substantially greater than those observed in the SOD1 mutant group, suggesting a robust effect on motor function.

[00357] Additionally, the treatment significantly reduced the dysphagia phenotype associated with a constricted gastrointestinal tract, indicating a potential benefit on bulbar function.

[00358] Operculum movement, a proxy for respiratory-like activity in zebrafish, was also significantly increased following Compound 6 administration compared to the SOD1 mutant, further supporting its beneficial impact on neuromuscular coordination.

[00359] These findings collectively support the therapeutic potential of Compound 6 in reversing key ALS-related functional deficits in the zebrafish SOD1G86R model.

[00360] Furthermore analysis of the brains and spinal cords from SOD1G86R ALS mutant shows a severe demyelinated pathology with significant axonal degeneration. Treatment with compound 6 showed some remyelination and improvement in myelin integrity showing a partially neuroprotective effect. IHC studies to examine microglial activation showed that the SOD1G86R ALS mutant shows increased microglial density and increased microglial activation, treatment with compound 6 resulted in a lower level of microglial activation.

[00361] The SOD1G86R ALS mutant shows a marked upregulation of the gpr17 gene which is completely normalised following treatment with compound 6.

[00362] Results are shown in Figures 23-30.

Claims

1. A compound of the formula (I), or a pharmaceutically acceptable salt thereof:(I)wherein:R1 is independently selected from: halo, -CN, Ci-Ce alkyl, Ci-Ce haloalkyl, C3-C6 cycloalkyl, -O-Ci-Ce alkyl and -SO2-C1-C6 alkyl;R2 is independently selected from: H, halo, and -CN;R3 is selected from: halo, and -O-Ci-Ce alkyl;R4 is independently selected from: halo, -CN, Ci-Ce alkyl, -O-Ci-Ce alkyl, C3-C6 cycloalkyl, -O-C3-C6 cycloalkyl, and -O-Ci-Ce alkyl-Cs-Ce cycloalkyl;wherein said Ci-Ce alkyl, -O-Ci-Ce alkyl, C3-C6 cycloalkyl, -O-C3-C6 cycloalkyl, and -O-Ci-Ce alkyl-Cs-Ce cycloalkyl, are each independently optionally substituted with from 1 to 6 groups selected from: deuterium, -CN, halo, -O-C1-C3 alkyl, and -O-C1-C3 haloalkyl;R5 is selected from: H, halo, and -O-Ci-Ce alkyl;X1 is CR6; andR6 is independently selected from: H, halo, Ci-Ce alkyl, Ci-Ce haloalkyl, -O-Ci-Ce alkyl, and -O-Ci-Ce haloalkyl.

2. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein R6 is H.

3. The compound according to claim 1 or claim 2, or a pharmaceutically acceptable salt thereof, wherein R1 is chloro.

4. The compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R2 is H.

5. The compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R3 is halo.

6. The compound according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof, wherein R3 is -O-C1-C3 alkyl.

7. The compound according to any one of the preceding claims, or a pharmaceuticallyacceptable salt thereof, wherein R4 is independently selected from: C1-C3 alkyl and -O-C1-C3 alkyl.

8. The compound according to claim 7, wherein R4 is substituted with from 1 to 3 groups selected from: -CN and halo.

9. The compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R5 is H.

10. The compound according to any one of claims 1 to 8, or a pharmaceutically acceptable salt thereof, wherein R5 is -O-C1-C3 alkyl.

11. The compound according to claim 1, wherein the compound is selected from:, or apharmaceutically acceptable salt thereof.

12. A pharmaceutical composition comprising a compound or pharmaceutically acceptable salt thereof according to any one of claims 1 to 11, and a pharmaceutically acceptable excipient.

13. A compound or a pharmaceutically acceptable salt thereof according to any one ofclaims 1 to 11, or a pharmaceutical composition according to claim 12, for use as a medicament.

14. A compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 11, or a pharmaceutical composition according to claim 12, for use in the treatment or prophylaxis of a GPR17-associated disease15. A compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 11, or a pharmaceutical composition according to claim 12, for use in the treatment or prophylaxis of a disease selected from: multiple sclerosis (MS), neuromyelitis optica (Devic’s disease), neuromyelitis optica spectrum disorder (NMOSD), chronic relapsing inflammatory optic neuritis, acute disseminated encephalomyelitis, acute haemorrhagic leucoencephalitis (AHL), periventricular leukomalacia, e.g. periventricular leukomalacia demyelination due to viral infections, such as by HIV or progressive multifocal leucoencephalopathy, central pontine and extrapontine myelinolysis, demyelination due to traumatic brain injury and / or traumatic brain tissue damage, including compression-induced demyelination, e.g. by tumours, demyelination in response to hypoxia, e.g. polycythemia vera, demyelination in response to stroke or ischaemia or other cardiovascular diseases, demyelination due to exposure to carbon dioxide, cyanide, or other CNS toxins, Schilder’s disease, Balo concentric sclerosis, Perinatal encephalopathy; Neurodegenerative Diseases including: Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease (AD), Multiple system atrophy, Parkinson’s Disease, Spinocerebellar ataxia (SCA), Huntington’s Disease; psychiatric disorders such as schizophrenia and bipolar disorder; peripheral myelination diseases such as leukodystrophies (e.g. Pelizaeus-Merzbacher disease), peripheral demyelinating neuropathies, Dejerine-Sottas syndrome and Charcot-Marie-Tooth disease; and obesity.

Citation Information

Patent Citations

  • Azaindazoles useful as inhibitors of kinases

    WO2007059219A1

  • (AZA)indole-, benzothiophene-, and benzofuran-3-sulfonamides

    WO2018122232A1

  • Protein kinase MKK4 inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death

    WO2019149738A1

  • Compounds and methods of activating lipoprotein lipase

    WO2022159445A1

  • Novel pyrimidin-2-yl sulfonamide derivatives

    WO2022180136A1