Non-viral expression systems and methods of use thereof

HK40134767APending Publication Date: 2026-07-10ENGAGE BIOLOGICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
HK · HK
Patent Type
Applications
Current Assignee / Owner
ENGAGE BIOLOGICS INC
Filing Date
2026-05-11
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Current non-viral gene expression systems face limitations in achieving long duration and high levels of transgene expression while avoiding safety concerns associated with constitutive expression of Epstein-Barr nuclear antigen-1 (EBNA1), which is linked to cancer pathophysiology.

Method used

A non-viral system comprising mRNA encoding a DNA-binding protein with chromatin-binding domains and a DNA-binding domain of EBNA1, combined with a recombinant expression vector containing EBV origin of replication elements, to enhance transgene expression without constitutive EBNA1 expression.

Benefits of technology

This system significantly increases transgene expression levels and duration, achieving up to several-fold higher expression compared to traditional systems, while minimizing safety risks associated with EBNA1 expression.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure provides a non-viral expression system for enhancing expression of a transgene in a cell, the system comprising an mRNA encoding a DNA binding protein comprising one or more chromatin binding domains and a DNA binding domain (DBD) of an Epstein-Barr nuclear antigen-1 (EBNA1) polypeptide or an Epstein-Barr nuclear antigen-1 (EBNA1) homolog of a non-human primate (NHP) Lymphocryptovirus (LCV), and a recombinant expression vector comprising a transgene and a polynucleotide comprising at least one DNA binding element (DBE) of an Epstein-Barr virus (EBV) origin of replication (OriP) or a DBE of an NHP LCV. The disclosure further provides delivery vehicles comprising the non-viral expression systems described herein and vitro, ex vivo, and in vivo methods for increasing expression of the transgene in a cell using the system and delivery systems. Also provided herein are methods for selective expression of a transgene in a target tissue and / or target cell population using the systems and delivery systems described herein.
Need to check novelty before this filing date? Find Prior Art

Description

NON-VIRAL EXPRESSION SYSTEMS AND METHODS OF USE THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 479,531 filed on January 11, 2023, U.S. Provisional Application No.63 / 580,677 filed on September 5, 2023, and U.S. Provisional Application No.63 / 599,484 filed on November 15, 2023, the contents of which are incorporated herein by reference in their entireties. BACKGROUND

[0002] Nonviral gene expression systems may broadly be classified as DNA or mRNA-based systems, both of which have drawbacks. DNA systems benefit from a comparatively longer duration of expression (e.g., weeks or longer) and comparatively greater control over expression (e.g., via the use of tissue or tumor-specific promoters), but are limited by low levels of nuclear import and low transgene expression levels. mRNA systems benefit from comparatively high levels of gene expression but are limited by short durations of expression (e.g., less than a week), and comparatively less control over cell type or tissue-specific expression. Thus, there remains a need for long duration, high expression nonviral gene expression systems.

[0003] Epstein-Barr virus (EBV)-based vectors are self-replicating episomal plasmids that permit long-term expression of exogenous genes in mammalian cells. Indeed, EBV-based vectors have been used to improve the efficiency and duration of expression of transgene expression (see, e.g., Belt, et al (1991); Mazda, et al (1997); Tu, et al (2000); Mazda (2002)). EBV-based vectors typically encode the Epstein-Barr nuclear antigen-1 (EBNA1) protein and comprise an EBV origin of replication (OriP). The EBNA1 protein comprises a DNA binding domain (DBD) that binds to DNA binding elements (DBEs) present in the OriP. Once expressed, the EBNA1 protein functions to bind the EBV-based vector via the OriP to facilitate replication and episomal maintenance.

[0004] Synthetic plasmids have been developed comprising a nucleotide sequence encoding EBNA1 protein and an OriP. Such systems decrease the apparent dilution of plasmid DNA during successive rounds of cellular replication and increase overall protein production. However, the therapeutic potential of such plasmids is limited, in part due to potential safety concerns associated with constitutive EBNA1 expression. EBV has been implicated in the pathophysiology of multiple cancers, most notably B cell cancers. Constitutive expression ofEBNA1 alone has been found to be sufficient for transformation of B cells. EBV is also implicated in nasopharyngeal cancer, gastric cancers, and others. This limits the therapeutic potential of EBNA1 and OriP containing DNA-based therapies.

[0005] Accordingly, there remains a need for a non-viral system that harnesses the advantages of EBV-based vectors for long-term and efficient transgene expression, without the risk of constitutive expression of EBNA1 that is associated with deleterious outcomes. SUMMARY

[0006] In some aspects, the present disclosure provides a non-viral system for increasing expression of at least one transgene in a cell, the system comprising: (i) an mRNA comprising an open reading frame (ORF) encoding a DNA-binding protein comprising (a) one or more chromatin-binding domains; and (b) a DNA-binding domain (DBD) of an Epstein-Barr nuclear antigen-1 (EBNA1) polypeptide, wherein (i)(a) and (b) are operably linked; (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DNA binding elements (DBEs) of an Epstein-Barr virus (EBV) origin of replication (OriP), wherein (ii)(a) and (b) are operably linked.

[0007] In some aspects, the disclosure provides a method for increasing expression of at least one transgene in a cell comprising contacting the cell with a system comprising: (i) an mRNA comprising an ORF encoding a DNA-binding protein, wherein the DNA-binding protein comprises (a) one or more chromatin-binding domains; and (b) a polypeptide comprising an EBNA1 DBD, wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DBEs of an EBV OriP, wherein (ii)(a) and (b) are operably-linked, thereby increasing expression of the at least one transgene in the cell.

[0008] In some aspects, the disclosure provides a method for increasing expression of at least one transgene in a dividing cell comprising contacting the cell with a system comprising: (i) an mRNA comprising an ORF encoding a DNA-binding protein, wherein the DNA-binding protein comprises (a) one or more chromatin-binding domains; and (b) a polypeptide comprising an EBNA1 DBD, wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DBEs of an EBV OriP, wherein (ii)(a) and (b) are operably-linked, thereby increasing expression of the at least one transgene in the dividing cell.

[0009] In some aspects, the disclosure provides a non-viral system for expression of a transgene, wherein the system comprises: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DNA binding domain (DBD) of an Epstein- Barr nuclear antigen-1 (EBNA1) homolog, wherein the EBNA1 homolog is of a non-human primate (NHP) lymphocryptovirus (LCV), and (b) a chromatin-binding domain; wherein (i)(a) and (i)(b) are operably-linked; (ii) a recombinant expression vector comprising (a) a transgene; and (b) a DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, and / or a DBE of an NHP LCV, or a variant thereof, wherein (ii)(a) and (ii)(b) are operably- linked.

[0010] In some aspects, the disclosure provides a method for increasing expression of a transgene in a dividing cell comprising contacting the cell with a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog, wherein the EBNA1 homolog is of a NHP LCV, and (b) a chromatin-binding domain; wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) a transgene; and (b) a DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, and / or a DBE of an NHP LCV, or a variant thereof, wherein (ii)(a) and (b) are operably-linked, thereby increasing expression of the transgene in the dividing cell. In some embodiments, the DBE comprises an EBV DBE or a variant or a fragment thereof. In some embodiments, the DBE comprises an NHP LCV DBE or a variant or a fragment thereof.

[0011] In some aspects, the disclosure provides a method for selectively expressing a transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA- binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog, wherein the EBNA1 homolog is of an NHP LCV, and (b) a chromatin-binding domain; wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) a transgene; and (b) a DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, and / or a DBE of an NHP LCV, or a variant thereof, wherein (ii)(a) and (b) are operably-linked. In some embodiments, the DBE comprises an EBV DBE or a variant or a fragment thereof. In some embodiments, the DBE comprises an NHP LCV DBE or a variant or a fragment thereof.

[0012] In some aspects, the disclosure provides a non-viral system for expression of a transgene, wherein the system comprises: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DNA binding domain (DBD) of an Epstein- Barr nuclear antigen-1 (EBNA1) homolog, wherein the EBNA1 homolog is of a non-human primate (NHP) lymphocryptovirus (LCV), and (b) a chromatin-binding domain; wherein (i)(a) and (i)(b) are operably-linked; (ii) a recombinant expression vector comprising (a) a transgene; and (b) a DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, and / or a DBE of an NHP LCV, or a variant thereof, wherein (ii)(a) and (ii)(b) are operably- linked.

[0013] In some aspects, the disclosure provides a non-viral system for expression of a transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog, or a variant thereof, wherein the EBNA1 homolog is of a NHP LCV, wherein the DBD is a sequence represented by the formula: N′-[Xaa1]w-[A]-[Xaa2]x-[B]-[Xaa3]y-[C]-[Xaa4]z-C′, wherein Xaa1, Xaa2, Xaa3, and Xaa4 are any amino acid, wherein w, x, y, and z are integers referring to the number of amino acid residues, wherein w = 40-70, wherein x = 0-15, wherein y = 0-15, wherein z = 30-60, wherein [A], [B], and [C] are respectively a first, second, and third sequence motifs, wherein the first sequence motif has at least about 80% similarity to KX48X49X50YX51LRRX52 (SEQ ID NO: 284), wherein X48is T, I, N, or W; X49is C, S, P; X50is V, L, C, or I; X51is N or S; and X52 is C,G, or A, wherein the second sequence motif has at least about 80% similarity to RX61X62X63LX64RLPX65(SEQ ID NO: 285), wherein X61is A, L, S, or I; X62is T or S; X63is P or T; X64is G, S, or F; and X65is Y or F, and wherein the third sequence motif has at least about 80% similarity to GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71is Q or E; X72is G or T; X73is L, M, or I; and X74is R, K, M, or L, and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, and / or a DBE of an NHP LCV, or a variant thereof, and wherein (ii)(a) and (ii)(b) are operably-linked.

[0014] In some aspects, the disclosure provides a method for increasing expression of a transgene in a dividing cell comprising contacting the cell with a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a)a DBD of an EBNA1 homolog, or a variant thereof, wherein the EBNA1 homolog is of a NHP LCV, wherein the DBD is a sequence represented by the formula: N′-[Xaa1]w-[A]-[Xaa2]x- [B]-[Xaa3]y-[C]-[Xaa4]z-C′, wherein Xaa1, Xaa2, Xaa3, and Xaa4 are any amino acid, wherein w, x, y, and z are integers referring to the number of amino acid residues, wherein w = 40-70, wherein x = 0-15, wherein y = 0-15, wherein z = 30-60, wherein [A], [B], and [C] are respectively a first, second, and third sequence motifs, wherein the first sequence motif has at least about 80% similarity to KX48X49X50YX51LRRX52 (SEQ ID NO: 284), wherein X48 is T, I, N, or W; X49is C, S, P; X50is V, L, C, or I; X51is N or S; and X52is C,G, or A, wherein the second sequence motif has at least about 80% similarity to RX61X62X63LX64RLPX65(SEQ ID NO: 285), wherein X61is A, L, S, or I; X62is T or S; X63is P or T; X64is G, S, or F; and X65is Y or F, and wherein the third sequence motif has at least about 80% similarity to GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71is Q or E; X72is G or T; X73is L, M, or I; and X74is R, K, M, or L, and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, and / or a DBE of an NHP LCV, or a variant thereof, and wherein (ii)(a) and (ii)(b) are operably-linked. In some embodiments, the DBE comprises an EBV DBE or a variant or a fragment thereof. In some embodiments, the DBE comprises an NHP LCV DBE or a variant or a fragment thereof.

[0015] In some aspects, the disclosure provides a method for selectively expressing a transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA- binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog, or a variant thereof, wherein the EBNA1 homolog is of a NHP LCV, wherein the DBD is a sequence represented by the formula: N′-[Xaa1]w-[A]-[Xaa2]x-[B]-[Xaa3]y-[C]-[Xaa4]z-C′, wherein Xaa1, Xaa2, Xaa3, and Xaa4 are any amino acid, wherein w, x, y, and z are integers referring to the number of amino acid residues, wherein w = 40-70, wherein x = 0-15, wherein y = 0-15, wherein z = 30-60, wherein [A], [B], and [C] are respectively a first, second, and third sequence motifs, wherein the first sequence motif has at least about 80% similarity to KX48X49X50YX51LRRX52(SEQ ID NO: 284), wherein X48is T, I, N, or W; X49is C, S, P; X50is V, L, C, or I; X51is N or S; and X52is C,G, or A, wherein the second sequence motif has at least about 80% similarity to RX61X62X63LX64RLPX65(SEQ ID NO: 285), wherein X61is A, L, S, or I; X62is T or S; X63is P or T; X64is G, S, or F; and X65is Y or F, and wherein the third sequence motif has at least about 80% similarity to GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71is Q or E;X72is G or T; X73is L, M, or I; and X74is R, K, M, or L, and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, and / or a DBE of an NHP LCV, or a variant thereof, and wherein (ii)(a) and (ii)(b) are operably-linked. In some embodiments, the DBE comprises an EBV DBE or a variant or a fragment thereof. In some embodiments, the DBE comprises an NHP LCV DBE or a variant or a fragment thereof.

[0016] In some embodiments of any of the foregoing or related aspects, the first sequence motif has at least about 90% similarity to KX48X49X50YX51LRRX52 (SEQ ID NO: 284). In some embodiments, the first sequence motif has at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to KX48X49X50YX51LRRX52 (SEQ ID NO: 284), wherein X48is T, I, N, or W; X49is C, S, P; X50is V, L, C, or I; X51is N or S; and X52is C,G, or A. In some embodiments, the first sequence motif is KX48X49X50YX51LRRX52 (SEQ ID NO: 284), wherein X48is T, I, N, or W; X49is C, S, P; X50is V, L, C, or I; X51is N or S; and X52is C,G, or A. In some embodiments, the first sequence motif is X48X49X50YX51LRRX52 (SEQ ID NO: 284). In some embodiments, the first sequence motif has at least 80% similarity to a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293). In some embodiments, the first sequence motif has at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293). In some embodiments, the first sequence motif is a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293).

[0017] In some embodiments of any of the foregoing or related aspects, the second sequence motif has at least about 90% similarity to RX61X62X63LX64RLPX65(SEQ ID NO: 285). In some embodiments, the second sequence motif is RX61X62X63LX64RLPX65(SEQ ID NO: 285). In some embodiments, the second sequence motif has at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to RX61X62X63LX64RLPX65(SEQ ID NO: 285),wherein X61is A, L, S, or I;X62is T or S; X63is P or T;X64is G, S, or F; andX65is Y or F. In some embodiments, the second sequence motif is RX61X62X63LX64RLPX65(SEQ ID NO: 285), wherein X61is A, L, S, or I; X62is T or S; X63is P or T; X64is G, S, or F; and X65is Y or F. In some embodiments, the second sequence motif has at least 80% similarity to a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), and RISPLFRLPY (SEQ ID NO: 300). In some embodiments, the second sequence motif has at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), and RISPLFRLPY (SEQ ID NO: 300). In some embodiments, the second sequence motif is a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), and RISPLFRLPY (SEQ ID NO: 300).

[0018] In some embodiments of any of the foregoing or related aspects, the third sequence motif has at least about 90% similarity to GPX71PX72PX73X74ES (SEQ ID NO: 286). In some embodiments, the third sequence motif is GPX71PX72PX73X74ES (SEQ ID NO: 286). In some embodiments, the third sequence motif has at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71is Q or E; X72is G or T; X73is L, M, or I; and X74is R, K, M, or L. In some embodiments, the third sequence motif is GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71is Q or E; X72is G or T; X73is L, M, or I; and X74is R, K, M, or L. In some embodiments, the third sequence motif has at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a sequence selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES (SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304), and GPQPGPILES (SEQ ID NO: 305). In some embodiments, the third sequence motif has at least 80% similarity to a sequence selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES (SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304), and GPQPGPILES (SEQ ID NO: 305). In some embodiments, the third sequence motif is a sequence selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES (SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304), and GPQPGPILES (SEQ ID NO: 305).

[0019] In some embodiments of any of the foregoing or related aspects, w = 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, or 58, 59, 60. In some embodiments, x = 6, 7, 8, 9, or 10. In some embodiments, y = 4, 5, 6, 7, or 8. In some embodiments, z = 48, 49, 50, 51, 52, or 53.

[0020] In some embodiments of any of the foregoing or related aspects, [Xaa1]wcomprises the amino acid sequence X1X2X3GGX4X5X6X7X8RGX9X10X11X12X13X14X15KX16X17X18X19X20X21X22X23X24X25LLX26RX27X28X29X30X31X32TX33X34X35X36X37WX38X39X40X41X42X43X44X45X46X47 (SEQ ID NO: 306), wherein X1is R, G, P, or K; X2is K or P; X3is K or R; X4is W, V, or -; X5is F or -; X6is G, -, or Y; X7 is K, -, R, or V; X8 is H, -, R, or G; X9 is Q, E, or C; X10 is G or P; X11 is G, A, or R; X12is S, K, R, Y, A, or G; X13is -, C, or G; X14is N, H, F, or S; X15is P, G, K, or -; X16is F or Y; X17 is E, T, D, or Q; X18 is N, T, K, G, or S; X19 is I, T, M, or L; X20 is A or G; X21 is E, K, Q, N, or D; X22is G, N, or S; X23is L, F, or I; X24is R, T, K, or S; X25is A, V, or K; X26is A, N, D, S, or R; X27 is–- or K; X28 is S, R, C, K, or P; X29 is H, Q, D, or E; X30 is V, S, A, or I; X31 is E, P, or Q; X32is R or T; X33is T, S, or N; X34is D, N, T, P, or E; X35is E or T; X36is G or A; X37 is T, R, N, D, G, S. or E; X38 is V, M, P, K, G, or C; X39 is A, N, F, Y, or C; X40 is G or A; X41 is V or L; X42 is F, M, L, or I; X43 is V, A, or I; X44 is Y or V; X45 is G or N; X46 is G, L, P, or Y; X47 is S, -, or C; and “-” is a deletion. In some embodiments, [Xaa2]x comprises the amino acid sequence X53X54X55X56X57X58X59X60 (SEQ ID NO: 307), wherein X53 is T, L, I, or M; X54 is A, G, or S; X55is L, C, V, or I; X56is A or C; X57is I, A, V, or C; X58is P or N; X59is Q, E, W, or G; and X60 is C, V, or G. In some embodiments, [Xaa3]y comprises the amino acid sequence GX66X67X68X69X70(SEQ ID NO: 308), wherein X66is M, S, Y, H, I, or T; X67is A, S, or T; X68 is P, F, or W; X69 is G or E; and X70 is P, T, A, or G. In some embodiments, [Xaa4]z comprises the amino acid sequence X75X76X77X78FX79X80FX81X82X83X84X85X86X87X88X89X90X91X92X93X94X95X96X97X98X99X100 X101PX102PX103X104X105X106X107VX108X109X110X111FX112X113X114X115X116X117LP (SEQ ID NO: 309), wherein X75 is I, S, T, C, or G; X76 is V, T, D, E, or W; X77 is C, W, or S; X78 is Y or G; X79is M, L, or I; X80is V, F, or Y; X81is L, T, or V; X82is Q, P, or N; X83is T, S, or C; X84is H, S, M, G, P, or W; X85 is I, L, Q, E, or P; X86 is F or S; X87 is A or G; X88 is E, D, or L; X89 is V, D, C, or W; X90is L, I, or V; X91is K or A; X92is D or Q; X93is A or C; X94is I, L, or V; X95 is K, R, V, G, or L; X96 is D or V; X97 is L or Y; X98 is V, C, I, or L; X99 is M, T, S, or A; X100is T, A, or H; X101is K, H, or R; X102is A, G, L, Q, or P; X103is T or A; X104is C, R, S, or G; X105 is N, S, or D; X106 is I, T, V, or M; X107 is R, Q, or K; X108 is T, V, or S; X109 is V, L, F, or T; X110is C, M, or I; X111is S, N, T, E, or R; X112is D, E, T, or N; X113is D, G, or P; X114isG, S, or P; X115is–- or G; X116is V, I, or L; X117is D, P, M, E, or H, and “-” is a deletion. In some embodiments, the DBD comprises the amino acid sequence of SEQ ID NO: 310.

[0021] In some aspects, the disclosure provides a non-viral system for expression of a transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DNA binding domain (DBD) of a NHP LCV Epstein- Barr nuclear antigen-1 (EBNA1) homolog or a variant thereof, wherein the DBD comprises an amino acid sequence having at least about 80% similarity to SEQ ID NO: 322, and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a NHP LCV DBE or a variant thereof, wherein (ii)(a) and (b) are operably-linked. In some embodiments, the DBD comprises SEQ ID NO: 322. In some embodiments, the DBD consists of SEQ ID NO: 322.

[0022] In some aspects, the disclosure provides a method for increasing expression of a transgene in a dividing cell comprising contacting the cell with a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DNA binding domain (DBD) of a NHP LCV Epstein-Barr nuclear antigen-1 (EBNA1) homolog or a variant thereof, wherein the DBD comprises an amino acid sequence having at least about 80% similarity to SEQ ID NO: 322, and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a NHP LCV DBE or a variant thereof, wherein (ii)(a) and (b) are operably-linked. In some embodiments, the DBD comprises SEQ ID NO: 322. In some embodiments, the DBD consists of SEQ ID NO: 322.

[0023] In some aspects, the disclosure provides a method for selectively expressing a transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA- binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of a NHP LCV EBNA1 homolog or a variant thereof, wherein the DBD comprises an amino acid sequence having at least about 80% similarity to SEQ ID NO: 322, and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a NHP LCV DBE or a variant thereof, wherein(ii)(a) and (b) are operably-linked. In some embodiments, the DBD comprises SEQ ID NO: 322. In some embodiments, the DBD consists of SEQ ID NO: 322.

[0024] In some embodiments of any of the foregoing or related aspects, the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 322. In some embodiments, the DBD comprises SEQ ID NO: 322. In some embodiments, the DBD consists of SEQ ID NO: 322.

[0025] In some aspects, the disclosure provides non-viral system for expression of a transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA- binding protein comprises (a) a DNA binding domain (DBD) of a NHP LCV Epstein-Barr nuclear antigen-1 (EBNA1) homolog or a variant thereof, wherein the DBD comprises an amino acid sequence having at least about 80% similarity to an amino acid sequence selected from SEQ ID NOs 215-220, and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising an EBV DBE or a variant thereof, wherein (ii)(a) and (b) are operably-linked. In some embodiments, the DBD comprises an amino acid sequence selected from SEQ ID NOs 215-220. In some embodiments, the DBD consists of an amino acid sequence selected from SEQ ID NOs 215-220.

[0026] In some aspects, the disclosure provides a method for increasing expression of a transgene in a dividing cell comprising contacting the cell with a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DNA binding domain (DBD) of a NHP LCV Epstein-Barr nuclear antigen-1 (EBNA1) homolog or a variant thereof, wherein the DBD comprises an amino acid sequence having at least about 80% similarity to an amino acid sequence selected from SEQ ID NOs 215-220, and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising an EBV DBE or a variant thereof, wherein (ii)(a) and (b) are operably-linked. In some embodiments, the DBD comprises an amino acid sequence selected from SEQ ID NOs 215-220. In some embodiments, the DBD consists of an amino acid sequence selected from SEQ ID NOs 215-220.

[0027] In some aspects, the disclosure provides a method for selectively expressing a transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DNA binding domain (DBD) of a NHP LCV Epstein- Barr nuclear antigen-1 (EBNA1) homolog or a variant thereof, wherein the DBD comprises an amino acid sequence having at least about 80% similarity to an amino acid sequence selected from SEQ ID NOs 215-220, and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising an EBV DBE or a variant thereof, wherein (ii)(a) and (b) are operably-linked. In some embodiments, the DBD comprises an amino acid sequence selected from SEQ ID NOs 215-220. In some embodiments, the DBD consists of an amino acid sequence selected from SEQ ID NOs 215-220.

[0028] In some embodiments of any of the foregoing or related aspects, the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to an amino acid sequence selected from SEQ ID NOs: 215-220. In some embodiments, the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 215. In some embodiments, the DBD comprises SEQ ID NO: 215. In some embodiments, the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 216. In some embodiments, the DBD comprises SEQ ID NO: 216. In some embodiments, the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 217. In some embodiments, the DBD comprises SEQ ID NO: 217. In some embodiments, the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 218. In some embodiments, the DBD comprises SEQ ID NO: 218. In some embodiments, the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 219. In some embodiments, the DBD comprises SEQ ID NO: 219. In some embodiments, the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 220. In some embodiments, the DBD comprises SEQ ID NO: 220.

[0029] In some aspects, the disclosure provides a non-viral system for expression of a transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog or a variant thereof,wherein the EBNA1 homolog is of a NHP LCV; and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a sequence represented by the formula 5ʹ-[D1]-[L1]-[D2]-[L2]-[D3]-[L3]-([Dn]-[Ln])x-3ʹ, wherein [D1], [D2], [D3], and [Dn] each comprise TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to TAGCATATGCTA (SEQ ID NO: 51), or a nucleotide sequence having at least 80% identity to TAGCATATGCTA (SEQ ID NO: 51); wherein [L1], [L2], [L3], and [Ln] are each selected from: a phosphate linkage and a spacer sequence of 1-56 nucleotides, and wherein x indicates the number of ([Dn]-[Ln]) units in the sequence and is an integer of 1- 47, and wherein (ii)(a) and (b) are operably-linked.

[0030] In some aspects, the disclosure provides a method for increasing expression of a transgene in a dividing cell comprising contacting the cell with a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog or a variant thereof, wherein the EBNA1 homolog is of a NHP LCV; and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a sequence represented by the formula 5ʹ-[D1]-[L1]-[D2]-[L2]-[D3]- [L3]-([Dn]-[Ln])x-3ʹ, wherein [D1], [D2], [D3], and [Dn] each comprise TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to TAGCATATGCTA (SEQ ID NO: 51), or a nucleotide sequence having at least 80% identity to TAGCATATGCTA (SEQ ID NO: 51); wherein [L1], [L2], [L3], and [Ln] are each selected from: a phosphate linkage and a spacer sequence of 1-56 nucleotides, and wherein x indicates the number of ([Dn]-[Ln]) units in the sequence and is an integer of 1-47, and wherein (ii)(a) and (b) are operably-linked.

[0031] In some aspects, the disclosure provides a method for selectively expressing a transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA- binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog or a variant thereof, wherein the EBNA1 homolog is of a NHP LCV; and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a sequence represented by the formula 5ʹ-[D1]-[L1]-[D2]-[L2]-[D3]-[L3]-([Dn]-[Ln])x-3ʹ, wherein [D1], [D2], [D3], and [Dn]each comprise TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to TAGCATATGCTA (SEQ ID NO: 51), or a nucleotide sequence having at least 80% identity to TAGCATATGCTA (SEQ ID NO: 51); wherein [L1], [L2], [L3], and [Ln] are each selected from: a phosphate linkage and a spacer sequence of 1-56 nucleotides, and wherein x indicates the number of ([Dn]-[Ln]) units in the sequence and is an integer of 1- 47, and wherein (ii)(a) and (b) are operably-linked.

[0032] In some embodiments of any of the foregoing or related aspects, the NHP is of the family Hominoidea or Cercopithecoidea. In some embodiments, the NHP is of the family Hominoidea. In some embodiments, the NHP (e.g., the NHP is of the family Hominoidea) is selected from the group consisting of species listed in Table 2.

[0033] In some embodiments of any of the foregoing or related aspects, the NHP is of the family Cercopithecoidea. In some embodiments, the NHP (e.g., NHP is of the family Cercopithecoidea) is selected from the group consisting of species listed in Table 3.

[0034] In some embodiments of any of the foregoing or related aspects, the LCV (e.g., the LCV of an NHP of the family Hominoidea or Cercopithecoidea) is selected from Cercocebus atys lymphocryptovirus 1, Cercopithecus hamlyni lymphocryptovirus 1, Cercopithecus cephus lymphocryptovirus 1, Cercopithecus neglectus lymphocryptovirus 1, Cercopithecus neglectus lymphocryptovirus 2, Cercopithecus nictitans lymphocryptovirus 1, Chlorocebus aethiops lymphocryptovirus 1, Chlorocebus aethiops lymphocryptovirus 2, Colobus guereza lymphocryptovirus 1, Colobus polykomos lymphocryptovirus 1, Erythrocebus patas lymphocryptovirus 1, Gorilla gorilla lymphocryptovirus 1, Gorilla gorilla lymphocryptovirus 2, Hylobates lar lymphocryptovirus 1, Hylobates muelleri lymphocryptovirus 1, Lophocebus albigena lymphocryptovirus 1, Lophocebus aterrimus lymphocryptovirus 1, Macaca fascicularis lymphocryptovirus 1, Macaca fuscata lymphocryptovirus 1, Macaca fuscata lymphocryptovirus 2, Macaca tibetana lymphocryptovirus 2, Mandrillus sphinx lymphocryptovirus 1, Mandrillus sphinx lymphocryptovirus 2, Miopithecus talapoin lymphocryptovirus 1, Pan paniscus lymphocryptovirus 1, Pan troglodytes lymphocryptovirus 1, Papioithecs lymphocryptovirus 1, Papio hamadryas lymphocryptovirus 2, Piliocolobus badius lymphocryptovirus 1, Piliocolobus badius lymphocryptovirus 2, Pongo pygmaeus lymphocryptovirus 1, Pongo pygmaeus lymphocryptovirus 2, Semnopithecus entellus lymphocryptovirus 1, Symphalangus syndactylus lymphocryptovirus 1, and Symphalangus syndactylus lymphocryptovirus 2.

[0035] In some embodiments of any of the foregoing or related aspects, the LCV (e.g., the LCV of an NHP of the family Hominoidea or Cercopithecoidea) is selected from gorillinegammaherpesvirus 1, macacine gammaherpesvirus 4, macacine gammaherpesvirus 10, macacine gammaherpesvirus 13, panine gammaherpesvirus 1, paniine gammaherpesvirus 1, and pongine gammaherpesvirus 2.

[0036] In some aspects, the disclosure provides a non-viral system for expression of a transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog or a variant, wherein the EBNA1 homolog is of a NHP LCV, wherein the NHP is of the parvorder Platyrrhini; and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a DBE or a variant thereof, wherein the DBE is present in the genome of the NHP LCV, wherein (ii)(a) and (b) are operably-linked.

[0037] In some aspects, the disclosure provides a method for increasing expression of a transgene in a dividing cell comprising contacting the cell with a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog or a variant, wherein the EBNA1 homolog is of a NHP LCV, wherein the NHP is of the parvorder Platyrrhini; and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a DBE or a variant thereof, wherein the DBE is present in the genome of the NHP LCV, wherein (ii)(a) and (b) are operably-linked.

[0038] In some aspects, the disclosure provides a method for selectively expressing a transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA- binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog or a variant, wherein the EBNA1 homolog is of a NHP LCV, wherein the NHP is of the parvorder Platyrrhini; and (b) a chromatin binding domain, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the transgene; and (b) a DNA binding polynucleotide comprising a DBE or a variant thereof, wherein the DBE is present in the genome of the NHP LCV, wherein (ii)(a) and (b) are operably-linked.

[0039] In some embodiments of any of the foregoing or related aspects, the DBE (e.g., the DBE is present in the genome of the NHP LCV) comprises: (i) CGCCAACAAACGTTG (SEQID NO: 317), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 317, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 317; (ii) CAACACCCAGTCACGCAGTCTCAAGGGTCCT (SEQ ID NO: 318), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 318, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 318; (iii) TTTGTTGGCGCCAACAAA (SEQ ID NO: 319), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 319, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 319; and / or (iv) AATGTTGGCGCCAACAAA(SEQ ID NO: 336), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 336, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 336.

[0040] In some embodiments of any of the foregoing or related aspects, the DNA binding polynucleotide (e.g., the DNA binding polynucleotide comprising a DBE or a variant thereof, wherein the DBE is present in the genome of the NHP LCV) comprises a nucleotide sequence having at least about 70% identity to SEQ ID NO: 316. In some embodiments, the DNA binding polynucleotide comprises SEQ ID NO: 316.

[0041] In some embodiments of any of the foregoing or related aspects, the NHP (e.g., the NHP is of the parvorder Platyrrhini) is selected from the group consisting of species listed in Table 4.

[0042] In some embodiments of any of the foregoing or related aspects, the LCV (e.g., the NHP is of the parvorder Platyrrhini) is selected from Ateles paniscus lymphocryptovirus1, Callithrix penicillata lymphocryptovirus1, Leontopithecus rosalia lymphocryptovirus1, Pithecia pithecia lymphocryptovirus1, Saimiri sciureus lymphocryptovirus2, and Saimiri sciureus lymphocryptovirus3.

[0043] In any of the foregoing or related embodiments, the LCV (e.g., the LCV of an NHP of the parvorder Platyrrhini) is callitrichine gammaherpesvirus 3. In some embodiments, the DBD comprises an amino acid sequence set forth in SEQ ID NO: 322, or an amino acid sequence having at least about 80% similarity to SEQ ID NO: 322. In some embodiments, the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 322.

[0044] In some aspects, the disclosure provides a non-viral system for expression of a transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, and (ii) a recombinant expression vector comprising (a) a transgene; and (b) a DNA binding polynucleotide, wherein (I) the DNA-binding protein comprises an amino acid sequencehaving at least about 80% similarity to an amino acid sequence selected from SEQ ID NOs 215-220 and the DNA binding polynucleotide comprise a sequence having at least about 80% identity to SEQ ID NO: 69; (II) the DNA-binding protein comprises an amino acid sequence selected from SEQ ID NOs 215-220 and the DNA binding polynucleotide comprises SEQ ID NO: 69; (III) the DNA-binding protein comprises an amino acid sequence having at least about 80% similarity to SEQ ID NO 311 and the DNA binding polynucleotide comprise a sequences having at least about 80% identity to SEQ ID NO: 316; or (IV) the DNA-binding protein comprises SEQ ID NO 311 and the DNA binding polynucleotide comprises SEQ ID NO: 316.

[0045] In some aspects, the disclosure provides a method for increasing expression of a transgene in a dividing cell comprising contacting the cell with a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, and (ii) a recombinant expression vector comprising (a) a transgene; and (b) a DNA binding polynucleotide, wherein (I) the DNA- binding protein comprises an amino acid sequence having at least about 80% similarity to an amino acid sequence selected from SEQ ID NOs 215-220 and the DNA binding polynucleotide comprise a sequence having at least about 80% identity to SEQ ID NO: 69; (II) the DNA- binding protein comprises an amino acid sequence selected from SEQ ID NOs 215-220 and the DNA binding polynucleotide comprises SEQ ID NO: 69; (III) the DNA-binding protein comprises an amino acid sequence having at least about 80% similarity to SEQ ID NO 322 and the DNA binding polynucleotide comprise a sequences having at least about 80% identity to SEQ ID NO: 316; or (IV) the DNA-binding protein comprises SEQ ID NO 322 and the DNA binding polynucleotide comprises SEQ ID NO: 316.

[0046] In some aspects, the disclosure provides a method for selectively expressing a transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA- binding protein, or a recombinant expression vector comprising the nucleic acid, and (ii) a recombinant expression vector comprising (a) a transgene; and (b) a DNA binding polynucleotide, wherein (I) the DNA-binding protein comprises an amino acid sequence having at least about 80% similarity to an amino acid sequence selected from SEQ ID NOs 215-220 and the DNA binding polynucleotide comprise a sequence having at least about 80% identity to SEQ ID NO: 69; (II) the DNA-binding protein comprises an amino acid sequence selected from SEQ ID NOs 215-220 and the DNA binding polynucleotide comprises SEQ ID NO: 69; (III) the DNA-binding protein comprises an amino acid sequence having at least about 80% similarity to SEQ ID NO 311 and the DNA binding polynucleotide comprise a sequenceshaving at least about 80% identity to SEQ ID NO: 316; or (IV) the DNA-binding protein comprises SEQ ID NO 311 and the DNA binding polynucleotide comprises SEQ ID NO: 316.

[0047] In some embodiments of any of the foregoing or related aspects, the DNA-binding protein comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to an amino acid sequence selected from SEQ ID NOs 215-220 and the DNA binding polynucleotide comprise a sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 69. In some embodiments, the DNA-binding protein comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO 322 and the DNA binding polynucleotide comprise a sequences having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 316.

[0048] In some embodiments of any of the foregoing or related aspects, expression of the at least one transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30- fold, about 40-fold, about 45-fold, about 50-fold as compared to introducing the recombinant expression vector alone. In some embodiments, expression of the at least one transgene is increased by about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45- fold, about 50-fold about 55-fold, about 60-fold, about 65-fold, about 70-fold, about 75-fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, or about 100-fold, about 110-fold, about 120-fold, about 130-fold, about 140-fold, about 150-fold, about 160-fold, about 170- fold, about 180-fold, about 190-fold, about 200-fold, about 250-fold, about 300-fold, about 350-fold, about 400-fold, about 450-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1x103-fold, about 5x103-fold, or about 1x104-fold as compared to introducing the recombinant expression vector alone. In some embodiments, expression of the at least one transgene is increased by about 10-fold to about 100-fold, about 10-fold to about 500-fold, about 10-fold to about 1x103-fold, about 100-fold to about 500-fold, about 100- fold to about 1x103-fold, about 100-fold to about 2x103-fold, about 100-fold to about 5x103- fold, or about 1x103-fold to about 1x104-fold as compared to introducing the recombinant expression vector alone. In some embodiments, expression of the at least one transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold as compared to introducing the system to a control cell contacted with a mitosis inhibitor. In some embodiments, expression of the at least one transgene is increased by about 10-fold to about 100-fold, about 10-fold to about 500-fold, about 10-fold to about 1x103-fold, about 100-fold to about 500-fold, about 100-fold to about 1x103-fold, about100-fold to about 2x103-fold, about 100-fold to about 5x103-fold, or about 1x103-fold to about 1x104-fold as compared to introducing the system to a control cell contacted with a mitosis inhibitor. In some embodiments, expression of the at least one transgene is increased by about 10-fold to about 102-fold, about 10-fold to about 103-fold, about 102-fold to about 103-fold, about 102-fold to about 104-fold, or about 103-fold to about 104-fold, as compared to introducing the system to a control cell contacted with a mitosis inhibitor. In some embodiments, the introducing is ex vivo. In some embodiments, the introducing is in vivo.

[0049] In some aspects, the disclosure provides a method for selectively expressing at least one transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) an mRNA comprising an ORF encoding a DNA-binding protein, wherein the DNA-binding protein comprises (a) one or more chromatin-binding domains; and (b) a polypeptide comprising an EBNA1 DBD, wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DBEs of an EBV OriP, wherein (ii)(a) and (b) are operably linked, thereby selectively expressing the at least one transgene in the target tissue and / or target cell population.

[0050] In some embodiments of any of the foregoing or relates aspects, the target tissue comprises tumor tissue. In some embodiments, the target cell population comprises tumor cells. In some embodiments, the system is administered systemically. In some embodiments, the system is administered intratumorally. In some embodiments, expression of the at least one transgene in the target tissue and / or target cell population is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 150-fold, or about 200-fold as compared to administering the recombinant expression vector alone. In some embodiments, expression of the at least one transgene in the target tissue and / or target cell population is increased by about 10-fold to about 100-fold as compared to administering the recombinant expression vector alone. In some embodiments, expression of the at least one transgene in the target tissue and / or target cell population is increased by about 10-fold to about 200-fold as compared to administering the recombinant expression vector alone. In some embodiments, expression of the at least one transgene in the target tissue and / or target cell population is increased by about 10-fold, about 20-fold, about 30-fold, about 40- fold, or about 50-fold as compared to administering the recombinant expression vector alone. In some embodiments, the at least one transgene is not substantially expressed in a non-target tissue and / or a non-target cell population. In some embodiments, expression of the at least one transgene in a non-target tissue and / or a non-target cell population is substantially equivalentto administering the recombinant expression vector alone. In some embodiments, the non- target tissue comprises liver tissue and / or the non-target cell population comprises hepatocytes. In some embodiments, expression of the at least one transgene in the target tissue and / or the target cell population is at least about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold higher as compared to the non-target tissue and / or non-target cell population. In some embodiments, expression of the at least one transgene in the target tissue and / or the target cell population is about 10-fold to about 50-fold, about 10-fold to about 100-fold, about 50- fold to about 100-fold, about 50-fold to about 200-fold, about 100-fold to about 200-fold, about 100-fold to about 300-fold, about 100-fold to about 500-fold, or about 100-fold to about 103- fold higher as compared to the non-target tissue and / or non-target cell population. In some embodiments, expression of the at least one transgene in the target tissue and / or the target cell population is about 10-fold to about 100-fold, about 10-fold to about 500-fold, about 10-fold to about 1x103-fold, about 100-fold to about 500-fold, about 100-fold to about 1x103-fold, about 100-fold to about 2x103-fold, about 100-fold to about 5x103-fold, or about 1x103-fold to about 1x104-fold higher as compared to the non-target tissue and / or non-target cell population.

[0051] In some embodiments of any of the foregoing or related aspects, the DBD comprises or consists of an amino acid sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 18. In some embodiments, the DBD of an EBNA1 polypeptide comprises or consists of an amino acid sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 18. In some embodiments, the amino acid sequence has at least about 80% identity to SEQ ID NO: 18. In some embodiments, the amino acid sequence has at least about 90% identity to SEQ ID NO: 18. In some embodiments, the DBD comprises SEQ ID NO: 18. In some embodiments, the DBD consists of SEQ ID NO: 18. In some embodiments, the DBD of an EBNA1 polypeptide comprises SEQ ID NO: 18. In some embodiments, the DBD of an EBNA1 polypeptide consists of SEQ ID NO: 18. In some embodiments, the one or more chromatin binding domains is operably linked to the N-terminus of the polypeptide comprising the EBNA1 DBD. In some embodiments, the polypeptide comprising the DBD is operably linked to the N-terminus of the one or more chromatin binding domains. In some embodiments, the DNA-binding protein further comprises one or more NLSs. In some embodiments, the polypeptide comprises or consists of an amino acid having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, theamino acid sequence has 80% identity to amino acid residues 459 to 607 of SEQ ID NO: 1. In some embodiments, the amino acid sequence has 90% identity to amino acid residues 459 to 607 of SEQ ID NO: 1. In some embodiments, the polypeptide comprises or consists of an amino acid sequence corresponding to amino acid residues 459 to 607 of SEQ ID NO: 1. In some embodiments, the polypeptide comprises or consists of an amino acid having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the amino acid sequence has 80% identity to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the amino acid sequence has 90% identity to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the polypeptide comprises or consists of an amino acid sequence corresponding to amino acid residues 459 to 641 of SEQ ID NO: 1.

[0052] In some embodiments of any of the foregoing or related aspects, the one or more chromatin binding domains binds to at least one element of human chromatin. In some embodiments, the one or more chromatin binding domains binds to at least one element of the nuclear matrix or nuclear lamina. In some embodiments, the one or more chromatin binding domains binds to euchromatin, heterochromatin, or both. In some embodiments, the one or more chromatin binding domains binds to genomic DNA, a histone protein, a nucleosome, or a combination thereof. In some embodiments, the one or more chromatin binding domains are selected from a bromodomain, a PHD finger domain, a chromodomain, a MBT domain, a tudor domain, a PWWP domain, an ADD domain, a Zf-CW domain, an ankyrin repeat domain, a WD40 domain, and a combination thereof. In some embodiments, the one or more chromatin binding domains comprises an AT-hook. In some embodiments, the AT-hook is from HMGA1, HMGA2, AF-17, SETBP1, TTF-I interacting peptide 5, SC1, X box-binding regulatory factor, LIM / homeodomain protein LH-2, Retinoblastoma-binding protein 1, ELF3, DFS70, ZNF213, Peregrin, Methyl-CpG-binding protein 2, and MLLT10. In some embodiments, the one or more chromatin binding domains comprises a histone protein or portion thereof. In some embodiments, the histone protein or portion thereof is an H1.1 protein or portion thereof, an H1.2 protein or portion thereof, an H1.3 protein or portion thereof, an H1.4 protein or portion thereof, an H1.5 protein or portion thereof, an H1.6 protein or portion thereof, an H1.7 protein or portion thereof, an H1.8 protein or a portion thereof, an H1.9 protein or a portion thereof, or an H1.10 protein or a portion thereof. In some embodiments, the one or more chromatin binding domains comprises an IL-33 chromatin-binding sequence. In some embodiments, the one or more chromatin binding domains comprises a chromatin binding domain of a Karposi’ssarcoma-associated herpesvirus (KSHV) latency-associated nuclear antigen (LANA) or a human papillomavirus H (HPV) E2 protein.

[0053] In some embodiments, the one or more chromatin binding domains are selected from EBNA1 domain A, EBNA domain B, and a combination thereof. In some embodiments, the one or more chromatin binding domains comprises SEQ ID NO: 14 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 14. In some embodiments, the one or more chromatin binding domains comprises SEQ ID NO: 16 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 16. In some embodiments, the one or more chromatin binding domains comprise (i) SEQ ID NO: 14 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 14; and (ii) SEQ ID NO: 16 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 16, wherein (i) and (ii) are operably linked. In some embodiments, (i) is upstream of (ii). In some embodiments, (ii) is upstream of (i).

[0054] In some embodiments of any of the foregoing or related aspects, the one or more chromatin-binding domains comprises a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A and B are each independently selected from SEQ ID NO: 14, an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 14, SEQ ID NO: 16, and an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 16, and wherein L, if present, is a spacer between A and B.

[0055] In some embodiments of any of the foregoing or related aspects, the chromatin binding domain comprises an amino acid sequence selected from SEQ ID NOs: 338-340 and 347, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 338-340 and 347. In some embodiments, the chromatin binding domain comprises an amino acid sequence selected from SEQ ID NOs: 341-346, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 341-346. In some embodiments, the chromatin binding domain comprise (i) an amino acid sequence selected from SEQ ID NOs: 338-340 and 347, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 338-340 and 347; and (ii) an amino acid sequence selected from SEQ ID NOs: 341-346, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 341-346, wherein (i) and (ii) are operably linked. In some embodiments, (i) is upstream of (ii). In some embodiments, (ii) is upstream of (i). In some embodiments, the chromatin binding domain comprises a sequence of linked amino acids according to the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A and B are each independently an aminoacid sequence set forth in SEQ ID NOs: 338-346 and 347 or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 338- 346 and 347, and wherein L, if present, is a spacer between A and B.

[0056] In some aspects, the disclosure provides a non-viral system for increasing expression of a transgene in a cell, the system comprising: (i) an mRNA comprising an open reading frame (ORF) encoding a DNA-binding protein comprising (a) one or more chromatin-binding domains comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]- Cʹ, wherein A and B are each independently selected from SEQ ID NO: 14, an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 14, SEQ ID NO: 16, and an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 16, and wherein L, if present, is a spacer between A and B; and (b) a DNA-binding domain (DBD) of an Epstein-Barr nuclear antigen-1 (EBNA1) polypeptide, wherein (i)(a) and (b) are operably linked; (ii) a recombinant expression vector comprising (a) at least one transgene; and (b) a polynucleotide comprising one or more DNA binding elements (DBEs) of an Epstein-Barr virus (EBV) origin of replication (OriP), wherein (ii)(a) and (b) are operably linked. In some embodiments, the DBD comprises SEQ ID NO: 18, or an amino acid sequence having at least about 80% identity to SEQ ID NO: 18.

[0057] In any of the foregoing or related aspects, the one or more chromatin binding domains is operably linked to the N-terminus of the DBD. In some embodiments, the DBD is operably linked to the N-terminus of the one or more chromatin binding domains. In some embodiments of any of the foregoing or related aspects, the DBD is directly fused to the chromatin binding domain. In some embodiments, the DBD is linked to the chromatin binding domain via a linker. In some embodiments, the linker is a peptide linker. In some embodiments, the peptide linker is a Gly-Ser linker. In some embodiments, the chromatin binding domain is operably-linked to the N-terminus of the DBD. In some embodiments, the DBD is operably-linked to the N- terminus of the chromatin binding domain. In some embodiments, the DNA-binding protein comprises one chromatin binding domain. In some embodiments, the DNA-binding protein comprises two or more chromatin binding domains. In some embodiments, the DNA-binding protein further comprises one or more nuclear localization sequences (NLSs). In some embodiments, the one or more NLSs are positioned at the N-terminus, at the C-terminus, between the one or more chromatin-binding domains and the DBD, or a combination thereof. In some embodiments, the one or more NLSs is selected from a monopartite NLS, a bipartite NLS, a non-classical NLS, and a combination thereof. In some embodiments, the one or more NLSs is selected from a c-Myc NLS, SV40 NLS, a nucleoplasmin NLS, a 53BP1 NLS, anING4 NLS, an IER5 NLS, and an ERK5 NLS. In some embodiments, the one or more NLSs comprises the amino acid sequence of SEQ ID NO: 17. In some embodiments, the one or more NLSs comprises an amino acid sequence having at least about 90% identity to an amino acid sequence selected from SEQ ID NOs: 17 and 35-50. In some embodiments, the DNA-binding protein comprises SEQ ID NO: 1 or an amino acid sequence having at least 80% identity to SEQ ID NO: 1. In some embodiments, the DNA-binding protein comprises or consists of an amino acid sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 3. In some embodiments, the amino acid sequence has at least about 80% identity to SEQ ID NO: 3. In some embodiments, the amino acid sequence has at least about 90% identity to SEQ ID NO: 3. In some embodiments, the DNA-binding protein comprises or consists of SEQ ID NO: 3.

[0058] In some embodiments of any of the foregoing or related aspects, the DNA-binding protein is a variant of an EBNA1 polypeptide, wherein the variant comprises (a) one or more EBNA1 chromatin binding domains, (b) an EBNA1 DBD, and (c) one or more modifications of an EBNA1 domain selected from a Gly-Ala repeat region, an NLS, a transactivation (TA) domain, and a combination thereof. In some embodiments, the DNA binding protein comprising a DBD of an EBNA1 polypeptide is a variant of an EBNA1 polypeptide, wherein the variant comprises (a) one or more EBNA1 chromatin binding domains, (b) an EBNA1 DBD, and (c) one or more modifications of an EBNA1 domain selected from a Gly-Ala repeat region, an NLS, a transactivation (TA) domain, and a combination thereof.

[0059] In some embodiments of an of the foregoing or related aspects, the DNA binding protein comprises or consists of an amino acid sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to an amino acid sequence selected from SEQ ID NOs: 3, 7-11, 130, 133, 136, 139, 142, 145, 150, and 153. In some embodiments, the amino acid sequence has at least about 80% identity to an amino acid sequence selected from SEQ ID NOs: 3, 7-11, 130, 133, 136, 139, 142, 145, 150, and 153. In some embodiments, the amino acid sequence has at least about 90% identity to an amino acid sequence selected from SEQ ID NOs: 3, 7-11, 130, 133, 136, 139, 142, 145, 150, and 153. In some embodiments, the amino acid sequence is selected from SEQ ID NOs: 3, 7-11, 130, 133, 136, 139, 142, 145, 150, and 153.

[0060] In some embodiments of an of the foregoing or related aspects, the ORF comprises or consists of a nucleotide sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to anyone of SEQ ID NOs: 24-29, 129, 132, 135, 138, 141, 144, 149, and 152. In some embodiments, the nucleotide sequence has at least about 80% identity to any one of SEQ ID NOs: 24-29, 129, 132, 135, 138, 141, 144, 149, and 152. In some embodiments, the nucleotide sequence has at least about 90% identity to any one of SEQ ID NOs: 24-29, 129, 132, 135, 138, 141, 144, 149, and 152. In some embodiments, the nucleotide sequence is any one of SEQ ID NOs: 24-29, 129, 132, 135, 138, 141, 144, 149, and 152.

[0061] In some aspects, the disclosure provides a non-viral system for increasing expression of at least one transgene in a cell, the system comprising: (i) an mRNA comprising an open reading frame (ORF) encoding an Epstein-Barr nuclear antigen-1 (EBNA1) polypeptide comprising from N-terminus to C-terminus: (a) a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A and B are each a chromatin binding domain and L is a spacer between A and B, (b) a nuclear localization signal (NLS), and (c) a DNA binding domain (DBD), wherein (a), (b), and (c) are operably linked, and wherein the EBNA1 polypeptide comprises a substitution of all or a part of the sequence of linked amino acids with one or more heterologous chromatin binding domains, and (ii) a recombinant expression vector comprising (a) at least one transgene; and (b) a polynucleotide comprising one or more DNA binding elements (DBEs) of an Epstein-Barr virus (EBV) origin of replication (OriP), wherein (ii)(a) and (b) are operably linked. In some embodiments, the DBD comprises SEQ ID NO: 18, or an amino acid sequence having at least about 80% identity to SEQ ID NO: 18. In some embodiments, the EBNA1 polypeptide further comprises a deletion of the NLS.

[0062] In some aspects, the disclosure provides a non-viral system for increasing expression of a transgene in a cell, the system comprising: (i) an mRNA comprising an ORF encoding a DNA-binding protein comprising (a) one or more heterologous chromatin-binding domains; and (b) a polypeptide comprising an EBNA1 DBD, wherein (i)(a) and (b) are operably-linked; and (ii) a recombinant expression vector comprising (a) at least one transgene; and (b) a polynucleotide comprising one or more DBEs of an EBV OriP, wherein (ii)(a) and (b) are operably-linked. In some embodiments, the DBD comprises SEQ ID NO: 18.

[0063] In some embodiments of any of the foregoing or related aspects, the DBD comprises an amino acid sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 18. In some embodiments, the EBNA1 DBD the DBD comprises an amino acid sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 18. In some embodiments, the DBD comprises an amino acid sequence having at least about 80% identity to SEQ ID NO:18. In some embodiments, the EBNA1 DBD comprises an amino acid sequence having at least about 80% identity to SEQ ID NO: 18. In some embodiments, the DBD comprises an amino acid sequence having at least about 90% identity to SEQ ID NO: 18. In some embodiments, the EBNA1 DBD comprises an amino acid sequence having at least about 90% identity to SEQ ID NO: 18. In some embodiments, the polypeptide comprises an amino acid corresponding to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the polypeptide comprising an EBNA1 DBD comprises an amino acid corresponding to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the polypeptide comprises an amino acid sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the polypeptide comprising an EBNA1 DBD comprises an amino acid sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the polypeptide comprises an amino acid sequence having at least about 80% identity to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the polypeptide comprising an EBNBA1 DBD comprises an amino acid sequence having at least about 80% identity to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the polypeptide comprises an amino acid sequence having at least about 90% identity to amino acid residues 459 to 641 of SEQ ID NO: 1. In some embodiments, the polypeptide comprising an EBNA1 DBD comprises an amino acid sequence having at least about 90% identity to amino acid residues 459 to 641 of SEQ ID NO: 1.

[0064] In some embodiments of any of the foregoing or related aspects, the one or more heterologous chromatin binding domains binds to at least one element of the nuclear matrix or nuclear lamina. In some embodiments, the one or more heterologous chromatin binding domains binds to at least one element of human chromatin. In some embodiments, the one or more heterologous chromatin binding domains binds to euchromatin, heterochromatin, or both. In some embodiments, the one or more chromatin binding domains binds to genomic DNA, a histone protein, a nucleosome, or a combination thereof. In some embodiments, the one or more heterologous chromatin binding domains are selected from a bromodomain, a PHD finger domain, a chromodomain, a MBT domain, a tudor domain, a PWWP domain, an ADD domain, a Zf-CW domain, an ankyrin repeat domain, a WD40 domain, and a combination thereof. In some embodiments, the one or more heterologous chromatin binding domains comprises an AT-hook. In some embodiments, the AT-hook is from HMGA1, HMGA2, AF-17, SETBP1,TTF-I interacting peptide 5, SC1, X box-binding regulatory factor, LIM / homeodomain protein LH-2, Retinoblastoma-binding protein 1, ELF3, DFS70, ZNF213, Peregrin, Methyl-CpG- binding protein 2, and MLLT10. In some embodiments, the one or more heterologous chromatin binding domains comprises a histone protein or portion thereof. In some embodiments, the histone protein or portion thereof is an H1.1 protein or portion thereof, an H1.2 protein or portion thereof, an H1.3 protein or portion thereof, an H1.4 protein or portion thereof, an H1.5 protein or portion thereof, an H1.6 protein or portion thereof, an H1.7 protein or portion thereof, an H1.8 protein or a portion thereof, an H1.9 protein or a portion thereof, or an H1.10 protein or a portion thereof. In some embodiments, the one or more heterologous chromatin binding domains comprises an IL-33 chromatin-binding sequence. In some embodiments, the one or more heterologous chromatin binding domains comprises a chromatin binding domain of a Karposi’s sarcoma-associated herpesvirus (KSHV) latency-associated nuclear antigen (LANA) or a human papillomavirus H (HPV) E2 protein. In some embodiments, the one or more heterologous chromatin binding domains comprises KSHV LANA. In some embodiments, the one or more heterologous chromatin binding domains is operably-linked to the N-terminus of the polypeptide, or wherein the polypeptide is operably- linked to the N-terminus of the one or more heterologous chromatin binding domains.

[0065] In some embodiments of any of the foregoing or related aspects, the DNA-binding protein further comprises one or more NLSs. In some embodiments, the one or more NLSs are positioned at the N-terminus, at the C-terminus, between the one or more heterologous chromatin-binding domains and the polypeptide, or a combination thereof. In some embodiments, the one or more NLSs is selected from a monopartite NLS, a bipartite NLS, a non-classical NLS, and a combination thereof.

[0066] In some aspects, the disclosure provides a non-viral system for increasing expression of a transgene in a cell, the system comprising: (i) an mRNA comprising an ORF encoding a DNA-binding protein, wherein the DNA binding protein is a variant of an EBNA1 polypeptide, wherein the variant comprises (a) one or more EBNA1 chromatin binding domains, (b) an EBNA1 DBD, and (c) one or more modifications of an EBNA1 domain selected from a Gly- Ala repeat region, an NLS, a transactivation (TA) domain, and a combination thereof, and (ii) a recombinant expression vector comprising (a) at least one transgene; and (b) a polynucleotide comprising one or more DBEs of an EBV OriP, wherein (ii)(a) and (b) are operably linked.

[0067] In some embodiments of any of the foregoing or related aspects, the EBNA1 variant comprises one or more modifications selected from a deletion, an insertion, a substitution, and a combination thereof. In some embodiments, the one or more modifications comprises adeletion of the Gly-Ala repeat region or a portion thereof. In some embodiments, the one or more modifications comprises a deletion of the NLS or portion thereof. In some embodiments, the one or more modifications comprises a substitution of the NLS or portion thereof. In some embodiments, the NLS is substituted with a heterologous NLS. In some embodiments, the heterologous NLS is a human NLS. In some embodiments, the heterologous NLS is an NLS encoded by a human gene. In some embodiments, the one or more modifications comprises a deletion of the TA domain or a portion thereof. In some embodiments, the one or more modifications comprises a substitution of the TA domain or a portion thereof. In some embodiments, the one or more modifications comprises a deletion of the full TA domain. In some embodiments, the one or more modifications comprises a deletion or substitution of one or more antigens in the TA domain. In some embodiments, the one or more antigens comprises a sequence motif having the amino acid sequence of SEQ ID NO: 101. In some embodiments, the one or more modifications comprises a deletion of the NLS or portion thereof and a deletion of the TA domain or portion thereof. In some embodiments, the one or more modifications comprises a substitution of the NLS or portion thereof and a deletion of the TA domain or portion thereof.

[0068] In some aspects, the disclosure provides a non-viral system for increasing expression of a transgene in a cell, the system comprising: (i) an mRNA comprising an open reading frame (ORF) encoding a DNA binding protein, wherein the DNA binding protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 3 and 7-11 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in any one of SEQ ID NOs: 3 and 7-11; (ii) a recombinant expression vector comprising (a) at least one transgene; and (b) a polynucleotide comprising one or more DNA binding elements (DBEs) of an Epstein-Barr virus (EBV) origin of replication (OriP), wherein (ii)(a) and (b) are operably linked.

[0069] In some aspects, the disclosure provides a non-viral system for increasing expression of a transgene in a cell, the system comprising: (i) an mRNA comprising an ORF encoding a DNA binding protein, wherein the DNA binding protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 3, 7-11, 130, 133, 136, 139, 142, 145, 150, and 153 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in any one of SEQ ID NOs: 3, 7-11, 130, 133, 136, 139, 142, 145, 150, and 153; (ii) a recombinant expression vector comprising (a) at least one transgene; and (b) a polynucleotide comprising one or more DBEs of an EBV OriP, wherein (ii)(a) and (b) are operably linked.

[0070] In some embodiments of any of the foregoing or related aspects, the DBD selectively binds to the DNA binding polynucleotide or a portion thereof. In some embodiments, the DBDis about 140 to about 160 amino acid residues in length. In some embodiments, the DBD comprises an amino acid sequence having not more than about 90% similarity to SEQ ID NO: 18. In some embodiments, the DBD of an EBNA1 homolog comprises an amino acid sequence having not more than about 90% identity to SEQ ID NO: 18. In some embodiments, the DBD comprises at least about 15 to about 149 mismatches relative to SEQ ID NO: 18. In some embodiments, the DBD of an EBNA1 homolog comprises at least about 15 to about 149 mismatches relative to SEQ ID NO: 18. In some embodiments, the DBD lacks a contiguous sequence of 10 amino acids present in SEQ ID NO: 18. In some embodiments, the DBD of an EBNA1 homolog lacks a contiguous sequence of 10 amino acids present in SEQ ID NO: 18. In some embodiments, the DBD lacks a sequence set forth in SEQ ID NOs: 221, 227, 233, 239, 246, 252, 258, 264, 270, and 276. In some embodiments, the DBD of an EBNA1 homolog lacks a sequence set forth in SEQ ID NOs: 221, 227, 233, 239, 246, 252, 258, 264, 270, and 276

[0071] In some embodiments of any of the foregoing or related aspects, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 3 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 3. In some embodiments, the ORF comprises SEQ ID NO: 24 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 24. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 7 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 7. In some embodiments, the ORF comprises SEQ ID NO: 25 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 25. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 8 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the ORF comprises SEQ ID NO: 27 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 27. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 9 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the ORF comprises SEQ ID NO: 28 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 28. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 10 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the ORF comprises SEQ ID NO: 26 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 26. In some embodiments, the DNA binding proteincomprises an amino acid sequence set forth in SEQ ID NO: 11 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 11. In some embodiments, the ORF comprises SEQ ID NO: 29 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 29. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 130 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 130. In some embodiments, the ORF comprises SEQ ID NO: 129 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 129. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 133 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 133. In some embodiments, the ORF comprises SEQ ID NO: 132 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 132. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 136 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 136. In some embodiments, the ORF comprises SEQ ID NO: 135 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 135. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 139 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 139. In some embodiments, the ORF comprises SEQ ID NO: 138 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 138. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 142 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 142. In some embodiments, the ORF comprises SEQ ID NO: 141 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 141. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 145 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 145. In some embodiments, the ORF comprises SEQ ID NO: 144 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 144. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 150 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 150. In some embodiments, the ORF comprises SEQ ID NO: 149 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 149. In some embodiments, the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 153 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 153. In someembodiments, the ORF comprises SEQ ID NO: 152 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 152.

[0072] In some embodiments of any of the foregoing or related aspects, the DBE is an EBV DBE or a variant thereof. In some embodiments, the EBV DBE comprises TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 51, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 51. In some embodiments, the DNA binding polynucleotide comprising a NHP LCV DBE, or a variant thereof, comprises a sequence having at least about 80% identity to SEQ ID NO: 316. In some embodiments, the DNA binding polynucleotide comprising a NHP LCV DBE, or a variant thereof, comprises SEQ ID NO: 316. In some embodiments, the DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, comprises SEQ ID NO: 69, or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 69. In some embodiments, the DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, comprises SEQ ID NO: 71, or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 71. In some embodiments, the DNA binding polynucleotide comprising a DBE of an EBV, or a variant thereof, comprises a family of repeats (FR) of the EBV OriP or a portion of the FR, wherein the recombinant expression vector lacks a dyad symmetry (DS) of the EBV OriP.

[0073] In some embodiments of any of the foregoing or related aspects, the DBE is an NHP LCV DBE or a variant thereof. In some embodiments of any of the foregoing or related aspects, the NHP LCV DBE comprises (i) CGCCAACAAACGTTG (SEQ ID NO: 317), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 317, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 317. In some embodiments, the NHP LCV DBE comprises CAACACCCAGTCACGCAGTCTCAAGGGTCCT (SEQ ID NO: 318), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 318, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 318. In some embodiments, the NHP LCV DBE comprises TTTGTTGGCGCCAACAAA (SEQ ID NO: 319), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 319, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 319. In some embodiments, the NHP LCV DBE comprises AATGTTGGCGCCAACAAA(SEQ ID NO: 336), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 336, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 336.

[0074] In some embodiments of any of the foregoing or related aspects, the one or more DBEs comprise TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 51, or a nucleotide sequence having at least 80% identityto SEQ ID NO: 51. In some embodiments, the polynucleotide comprises 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, or 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 DBEs. In some embodiments, the polynucleotide comprises a sequence represented by the formula: 5ʹ-(C-D)n-3ʹ, wherein (i) C comprises TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 51, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 51; (ii) D comprises CCCAGATATAGATTAGGA (SEQ ID NO: 61), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 61, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 61; and (iii) n is an integer of 1 to 30. In some embodiments, the polynucleotide comprises SEQ ID NO: 69 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 69. In some embodiments, the polynucleotide comprises SEQ ID NO: 70 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 70. In some embodiments, the polynucleotide comprises a first nucleotide sequence operatively linked to a second nucleotide sequence, wherein (i) the first nucleotide sequence comprises SEQ ID NO: 69 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 69; and (ii) the second nucleotide sequence comprises SEQ ID NO: 70 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 70. In some embodiments, the first nucleotide sequence is upstream the second nucleotide sequence. In some embodiments, the first nucleotide sequence is downstream the second nucleotide sequence. In some embodiments, the polynucleotide comprises SEQ ID NO: 2 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 2. In some embodiments, the polynucleotide comprises a nucleotide sequence having at least about 70% identity to nucleotides 107-1821 of SEQ ID NO: 2.

[0075] In some embodiments of any of the foregoing or related aspects, the polynucleotide comprises at least 4 DBEs, and wherein the DBEs are the same or different. In some embodiments, the polynucleotide comprises 4 to 50, 4 to 40, 4 to 30, 4 to 20, 4 to 10, or 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 DBEs. In some embodiments, the at least 4 DBEs are contiguous. In some embodiments, the at least 4 DBEs are operably linked via a spacer sequence. In some embodiments, the spacer sequence is about 1-56 nucleotides in length. In some embodiments, the spacer sequence is 25-35 nucleotides in length. In some embodiments, the spacer sequence comprises an AT-content of at least about 50% or higher. In some embodiments, each DBE comprises a 3ʹ spacer sequence, wherein the length of the DBE and the 3ʹspacer sequence is about 20-50 nucleotides.

[0076] In some embodiments of any of the foregoing or related aspects, the polynucleotide comprises a sequence according to the formula 5ʹ-[D1]-[L1]-[D2]-[L2]-[D3]-[L3]-([Dn]-[Ln])x-3ʹ, wherein [D1], [D2], [D3], and [Dn] each comprise TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 51, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 51; wherein [L1], [L2], [L3], and [Ln] are each selected from: a phosphate linkage and a spacer sequence of 1-56 nucleotides, and wherein x indicates the number of ([Dn]-[Ln]) units in the sequence and is an integer of 1-47. In some embodiments, x is 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17. In some embodiments, [D1], [D2], [D3], and [Dn] are the same or different. In some embodiments, the spacer sequence is 25- 35 nucleotides in length. In some embodiments, the spacer sequence comprises or consists of a nucleotide sequence set forth in Table 9. In some embodiments, [D1]-[L1], [D2]-[L2], [D3]- [L3], and / or [Dn]-[Ln] have a length of about 20 to about 50 nucleotides. In some embodiments, the spacer sequence comprises a AT-content of greater than 50%. In some embodiments, [L1], [L2], [L3], and [Ln] are the same or different. In some embodiments, [L1], [L2], [L3], and [Ln] each comprise or consist of a nucleotide sequence set forth in Table 9, a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to a nucleotide sequence set forth in Table 9, or a nucleotide sequence having at least about 80% identity to a nucleotide sequence set forth in Table 9. In some embodiments, the DNA binding polynucleotide comprises SEQ ID NO: 69, or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 69. In some embodiments, the DNA binding polynucleotide comprises SEQ ID NO: 71, or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 71.

[0077] In some embodiments of any of the foregoing or related aspects, the polynucleotide comprises a family of repeats (FR) of the EBV OriP or a portion of the FR. In some embodiments, the polynucleotide consists of the then FR or a portion of the FR. In some embodiments, the recombinant expression vector lacks a dyad symmetry (DS) of the EBV OriP.

[0078] In some embodiments of any of the foregoing or related aspects, the nucleic acid comprises one DNA binding polynucleotide. In some embodiments, the nucleic acid comprises more than one DNA binding polynucleotide.

[0079] In some embodiments of any of the foregoing or related aspects, the polynucleotide is about 0.1 kb, about 0.2 kb, about 0.3 kb, about 0.4 kb, about 0.5 kb, about 0.6 kb, about 0.7 kb, about 0.8 kb, about 0.9 kb, about 1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, or about 2 kb in length. In some embodiments, the fusion protein is 100 to 500 residues, 100 to 600 residues, 100 to 700 residues, 100 to 800 residues, 100 to 900 residues, 100 to 1,000 residues, 200 to 500 residues, 200 to 600 residues, 200 to 700 residues, 200 to 800 residues, 200 to 900 residues, 200 to 1,000residues, 300 to 500 residues, 300 to 600 residues, 300 to 700 residues, 300 to 800 residues, 300 to 900 residues, or 300 to 1,000 residues in length. In some embodiments, the DNA binding protein is 100 to 500 residues, 100 to 600 residues, 100 to 700 residues, 100 to 800 residues, 100 to 900 residues, 100 to 1,000 residues, 200 to 500 residues, 200 to 600 residues, 200 to 700 residues, 200 to 800 residues, 200 to 900 residues, 200 to 1,000 residues, 300 to 500 residues, 300 to 600 residues, 300 to 700 residues, 300 to 800 residues, 300 to 900 residues, or 300 to 1,000 residues in length. In some embodiments, the DNA binding protein is about 160 to about 200 residues, about 160 to about 250 residues, about 160 to about 300 residues, about 160 to about 350 residues, about 160 to about 350 residues, about 160 to about 400 residues, about 160 to about 450 residues, or about 160 to about 500 residues in length. In some embodiments, the mRNA is present at about 20%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, or about 70% of the total nucleic acid. In some embodiments, the mRNA is present at about 5%, 10%, 15%, 20%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, or about 70% by mass of the total nucleic acid. In some embodiments, the mRNA is present at about 10% to about 20% or about 10% to about 40% by mass of the total nucleic acid. In some embodiments, the mRNA and the recombinant expression vector are present at a 1:1 w / w ratio. In some embodiments, the mRNA and the recombinant expression vector are present at a 1:1 molar ratio. In some embodiments, the recombinant expression vector is a plasmid DNA. In some embodiments, the recombinant expression vector is a linear DNA vector. In some embodiments, the mRNA, the recombinant expression vector, or both are formulated in a lipid nanoparticle (LNP). In some embodiments, the mRNA and the recombinant expression vector are formulated in the same LNP. In some embodiments, the mRNA and the recombinant expression vector are individually formulated in LNP. In some embodiments, the cell is a dividing cell. In some embodiments, wherein when the system is introduced to the cell, the DNA-binding protein is transcribed from the mRNA and the DBD binds to the one or more DBEs. In some embodiments, binding of the DBD to the one or more DBEs results in (i) tethering the recombinant expression vector to chromatin during mitosis, (ii) increased nuclear uptake of the recombinant expression vector, (iii) increased replication of the recombinant expression vector, (iv) increased transactivation of the recombinant expression vector, or (v) a combination of (i)-(iv), as compared to introducing to the cell the recombinant expression vector alone. In some embodiments, binding of the DBD to the one or more DBEs results in (i) tethering the recombinant expression vector to chromatin during mitosis, (ii) increased nuclear uptake of the recombinant expression vector, (iii) increased transcription of the transgene encoded in the recombinant expression vector, or (iv)a combination of (i)-(iii), as compared to introducing to the cell the recombinant expression vector alone. In some embodiments, expression of the at least one transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold, about 55-fold, about 60-fold, about 65-fold, about 70-fold, about 75-fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, about 100-fold, about 110-fold, about 120- fold, about 130-fold, about 140-fold, about 150-fold, about 160-fold, about 170-fold, about 180-fold, about 190-fold, or about 200-fold as compared to introducing to the cell the recombinant expression vector alone. In some embodiments, expression of the at least one transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold, about 55-fold, about 60-fold, about 65-fold, about 70-fold, about 75-fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, about 100- fold, about 110-fold, about 120-fold, about 130-fold, about 140-fold, about 150-fold, about 160-fold, about 170-fold, about 180-fold, about 190-fold, about 200-fold, about 250-fold, about 300-fold, about 350-fold, about 400-fold, about 450-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1x103-fold, about 5x103-fold, or about 1x104- fold as compared to introducing to the cell the recombinant expression vector alone. In some embodiments, expression of the at least one transgene in the cell is increased by at least about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold as compared to introducing the system to a control cell contacted with a mitosis inhibitor.

[0080] In some embodiments of any of the foregoing or related aspects, the at least one transgene encodes a non-coding RNA (ncRNA), a polypeptide, or a combination thereof. In some embodiments, the at least one transgene encodes a ncRNA selected from a ribosomal RNA, a transfer RNA, an immunostimulatory RNA, and a small RNA. In some embodiments, the small RNA is selected from an antisense oligonucleotide, a small interfering RNA, a short hairpin RNA, a microRNA, a small nucleolar RNA, and a small nuclear RNA. In some embodiments, the at least one transgene encodes a polypeptide. In some embodiments, the polypeptide is selected from intracellular polypeptide, a secreted polypeptide, a membrane- bound polypeptide, and a transmembrane polypeptide. In some embodiments, the polypeptide is selected from a hormone, an antibiotic, an enzyme, a signaling protein, a structural protein. In some embodiments, the polypeptide is an immunomodulatory polypeptide. In some embodiments, the immunomodulatory polypeptide is selected from a cytokine, a chemokine, an immune cell activator, a multispecific immune cell engager, an antibody or antigen binding fragment thereof, and a TME modulator. In some embodiments, the immunomodulatory polypeptide is a cytokine. In some embodiments, the immunomodulatory polypeptide is anantibody or antigen binding fragment thereof. In some embodiments, the immunomodulatory polypeptide is an immune checkpoint inhibitor.

[0081] In some embodiments of any of the foregoing or related aspects, the transgene is operably linked to a promoter. In some embodiments, the promoter is a cancer-specific promoter. In some embodiments, the promoter is a tumor-specific promoter. In some embodiments, the polynucleotide is 5’ of the at least one transgene. In some embodiments, the polynucleotide is 3’ of the at least one transgene. In some embodiments, the recombinant expression vector comprises at least one second polynucleotide comprising one or more DBEs of an EBV OriP.

[0082] In some embodiments of any of the foregoing or related aspects, the non-viral expression system comprises the DNA-binding protein as a polypeptide. In some embodiments, the DNA-binding protein and the recombinant expression vector are in the same composition. In some embodiments, the DNA-binding protein and the recombinant expression vector are in different compositions. In some embodiments, the DNA-binding protein and the recombinant expression vector are formulated in different lipid nanoparticles (LNPs). In some embodiments, the DNA-binding protein and the recombinant expression vector are formulated in the same LNP.

[0083] In some embodiments of any of the foregoing or related aspects, the non-viral expression system comprises the nucleic acid encoding the DNA-binding protein. In some embodiments, the nucleic acid is an mRNA comprising an open reading frame (ORF) encoding the DNA-binding protein. In some embodiments, the mRNA and the recombinant expression vector are present at a 10:1 to a 1:10 molar ratio. In some embodiments, the mRNA has a mass percent of about 5% to about 60% of the total nucleic acid. In some embodiments, the nucleic acid and the recombinant expression vector are in the same composition. In some embodiments, the nucleic acid and the recombinant expression vector are in different compositions. In some embodiments, the nucleic acid and the recombinant expression vector are formulated in different LNPs. In some embodiments, the nucleic acid and the recombinant expression vector are formulated in the same LNP.

[0084] In some embodiments of any of the foregoing or related aspects, the non-viral expression system comprises the recombinant expression comprising the nucleic acid encoding the DNA binding protein. In some embodiments, the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are in the same composition. In some embodiments, the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are in different compositions. In some embodiments,the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are formulated in different LNPs. In some embodiments, the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are formulated in the same LNP.

[0085] In some embodiments of any of the foregoing or related aspects, the recombinant expression vector is a plasmid DNA. In some embodiments, the recombinant expression vector is a close-ended linear DNA vector. In some embodiments, the transgene is operably linked to a promoter, optionally wherein the promoter is a tumor-specific promoter.

[0086] In some aspects, the disclosure provides an LNP comprising the non-viral system described herein.

[0087] In some aspects, the disclosure provides a cell comprising a non-viral system described herein or an LNP described herein. In some embodiments, the cell is a dividing cell.

[0088] In some aspects, the disclosure provides a pharmaceutical composition comprising the non-viral system described herein, and a pharmaceutically acceptable carrier.

[0089] In some aspects, the disclosure provides a pharmaceutical composition comprising the LNP described herein, and a pharmaceutically acceptable carrier.

[0090] In some embodiments, the disclosure provides a pharmaceutical composition comprising the cell described herein, and a pharmaceutically acceptable carrier.

[0091] In some embodiments, the disclosure provides a method of increasing expression of at least one transgene in a cell comprising contacting the cell with the non-viral system described herein, the LNP described herein, or the pharmaceutical composition described herein, wherein upon introducing to the cell the system, the LNP, or the pharmaceutical composition, the DNA- binding protein is transcribed from the mRNA and the DBD binds to the one or more DBEs, thereby increasing expression of the at least one transgene in the cell. In some embodiments, the cell is a dividing cell.

[0092] In some aspects, the disclosure provides a method of increasing expression of a transgene in a cell comprising contacting the cell with a non-viral system described herein, an LNP described herein, or a pharmaceutical composition described herein, wherein upon introducing to the cell the system, the LNP, or the pharmaceutical composition, the DNA- binding protein, or the DNA-binding protein produced from the nucleic acid or the recombinant expression vector encoding the DNA-binding protein, binds to the DNA binding polynucleotide, or a portion thereof, thereby increasing expression of the transgene in the cell. In some embodiments, the cell is a dividing cell.

[0093] In some aspects, the disclosure provides a method for increasing expression of a transgene in a dividing cell comprising contacting the cell with a non-viral expression system described herein, an LNP described herein, or a pharmaceutical composition described herein.

[0094] In some embodiments of any of the foregoing or related aspects, the cell (e.g., the dividing cell) is contacted ex vivo. In some embodiments, the cell (e.g., the dividing cell) is contacted in vivo. In some embodiments, the cell is contacted ex vivo. In some embodiments, the cell is contacted in vivo. In some embodiments, binding of the DBD to the one or more DBEs results in (i) increased nuclear uptake of the recombinant expression vector, (ii) increased replication of the recombinant expression vector, (iii) increased transactivation of the recombinant expression vector, or (iv) a combination of (i)-(iii), as compared to introducing to the cell the recombinant expression vector alone. In some embodiments, binding of the DBD to the one or more DBEs results in (i) increased nuclear uptake of the recombinant expression vector, (ii) increased transcription of the transgene encoded in the recombinant expression vector, (iii) a combination of (i)-(ii), as compared to introducing to the cell the recombinant expression vector alone. In some embodiments, binding of the DNA binding protein to the DNA binding polynucleotide, or a portion thereof, results in (i) increased nuclear uptake of the recombinant expression vector, (ii) tethering of the recombinant expression vector to chromatin, (iii) increased retention of the recombinant expression vector in the nucleus during mitosis, (iv) increased transcription of the transgene encoded in the recombinant expression vector, or (v) a combination of (i)-(iv), as compared to contacting the cell with the recombinant expression vector. In some embodiments, expression of the at least one transgene is increased by at least about 40-fold, about 45-fold, about 50-fold, about 55-fold, about 60-fold, about 65- fold, about 70-fold, about 75-fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, about 100-fold, about 110-fold, about 120-fold, about 130-fold, about 140-fold, about 150- fold, about 160-fold, about 170-fold, about 180-fold, about 190-fold, or about 200-fold as compared to introducing to the cell with the recombinant expression vector alone. In some embodiments, expression of the at least one transgene is increased by at least about 40-fold, about 45-fold, about 50-fold, about 55-fold, about 60-fold, about 65-fold, about 70-fold, about 75-fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, about 100-fold, about 110- fold, about 120-fold, about 130-fold, about 140-fold, about 150-fold, about 160-fold, about 170-fold, about 180-fold, about 190-fold, about 200-fold, , about 250-fold, about 300-fold, about 350-fold, about 400-fold, about 450-fold, about 500-fold, about 600-fold, about 700- fold, about 800-fold, about 900-fold, about 1x103-fold, about 5x103-fold, or about 1x104-fold as compared to introducing to the cell with the recombinant expression vector alone. In someembodiments, expression of the transgene is increased by at least about 40-fold, about 45-fold, about 50-fold, about 55-fold, about 60-fold, about 65-fold, about 70-fold, about 75-fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, about 100-fold, about 110-fold, about 120- fold, about 130-fold, about 140-fold, about 150-fold, about 160-fold, about 170-fold, about 180-fold, about 190-fold, about 200-fold, about 250-fold, about 300-fold, about 350-fold, about 400-fold, about 450-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1x103-fold, about 5x103-fold, or about 1x104-fold as compared to contacting the cell with the recombinant expression vector. In some embodiments, the expression of the transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold as compared to introducing the recombinant expression vector alone. In some embodiments, expression of the transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold as compared to introducing the system to a control cell contacted with a mitosis inhibitor. In some embodiments, expression of the transgene is increased by about 10-fold to about 102-fold, about 10-fold to about 103-fold, about 102-fold to about 103-fold, about 102- fold to about 104-fold, or about 103-fold to about 104-fold, as compared to introducing the system to a control cell contacted with a mitosis inhibitor.

[0095] In some aspects, the disclosure provides a method of treating a disease or disorder to a subject, the method comprising administering to a subject an effective amount of the non-viral system described herein, the LNP described herein, the cell described herein, or the pharmaceutical composition described herein. In some embodiments, the subject has cancer. In some embodiments, the effective amount is administered systemically. In some embodiments, the effective amount is administered intratumorally.

[0096] In some aspects, the disclosure provides a method for selectively expressing a transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a non-viral expression system described herein, an LNP described herein, a cell described herein, or a pharmaceutical composition described herein. In some embodiments of any of the foregoing or related aspects, the target tissue comprises tumor tissue. In some embodiments, the target cell population comprises tumor cells. In some embodiments, the system is administered systemically. In some embodiments, the system is administered intratumorally. In some embodiments, expression of the transgene in the target tissue and / or target cell population is increased by about 10-fold to about 100-fold as compared to administering the recombinant expression vector alone. In some embodiments, expression of the transgene in the target tissue and / or target cell population is increased by about 10-fold,about 20-fold, about 30-fold, about 40-fold, or about 50-fold as compared to administering the recombinant expression vector alone. In some embodiments, the transgene is not substantially expressed in a non-target tissue and / or a non-target cell population. In some embodiments, expression of the transgene in a non-target tissue and / or a non-target cell population is substantially equivalent to administering the recombinant expression vector alone. In some embodiments, the non-target tissue comprises liver tissue and / or the non-target cell population comprises hepatocytes. In some embodiments, expression of the transgene in the target tissue and / or the target cell population is at least about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold higher as compared to the non-target tissue and / or non-target cell population. In some embodiments, expression of the transgene in the target tissue and / or the target cell population is about 10-fold to about 50-fold, about 10-fold to about 100-fold, about 50-fold to about 100-fold, about 50-fold to about 200-fold, about 100-fold to about 200-fold, about 100-fold to about 300-fold, about 100-fold to about 500-fold, or about 100-fold to about 103-fold higher as compared to the non-target tissue and / or non-target cell population.

[0097] In some aspects, the disclosure provides use of the non-viral system described herein, the LNP described herein, the cell described herein, or the pharmaceutical composition described herein for treating a disease or disorder in a subject. In some aspects, the disclosure provides use of the non-viral system described herein, the LNP described herein, the cell described herein, or the pharmaceutical composition described herein in the manufacture of a medicament for treating a disease or disorder in a subject.

[0098] In some aspects, the disclosure provides use of a non-viral system described herein, an LNP described herein, a cell described herein, or a pharmaceutical composition described herein for selectively expressing a transgene in a target tissue and / or target cell population in a subject.

[0099] In some aspects, the disclosure provides use of a non-viral system described herein, an LNP described herein, a cell described herein, or a pharmaceutical composition described herein in the manufacture of a medicament for treating a disease or disorder in a subject.

[0100] In some aspects the disclosure provides a kit comprising a container comprising the non-viral system described herein, the LNP described herein, the cell described herein, or the pharmaceutical composition described herein, and a package insert comprising instructions for contacting a cell with the system, the LNP, the cell, or the pharmaceutical composition for increasing expression of a transgene. In some embodiments, the contacting is ex vivo. In some embodiments, the contacting is in vivo.

[0101] In some aspects, the disclosure provides a kit comprising a container the non- viral system described herein, the LNP described herein, the cell described herein, or the pharmaceutical composition described herein, and a package insert comprising instructions for administering the system, the LNP, the cell, or the pharmaceutical composition to a subject for treating a disease or disorder.

[0102] In some aspects, the disclosure provides a kit comprising a non-viral system described herein, an LNP described herein, or a pharmaceutical composition described herein, and a package insert comprising instructions for administering the system, the LNP, or the pharmaceutical composition to a subject for selectively expressing a transgene in a target tissue and / or target cell population. BRIEF DESCRIPTION OF THE DRAWINGS

[0103] FIG. 1 shows a graphical representation of cellular expression of a transgene following transfection with an exemplary hybrid mRNA / DNA nonviral gene expression system of the disclosure. mRNA comprising an open reading frame encoding an EBNA1 polypeptide described herein (1.04) and a non-viral vector (1.05) encoding a DNA binding element (1.06) and transgene are formulated as a lipid nanoparticle (LNP) (1.07) and introduced to a target cell (1.08). The exemplary EBNA1 polypeptide encoded by the mRNA (1.04) comprises one or more chromatin binding domains (1.01) operably linked (1.03) to an EBNA1 DNA binding domain (DBD) (1.02). Once in the cytoplasm, EBNA1 mRNA is translated into EBNA1 protein (1.09). Exemplary functions of EBNA1 protein include binding to the DNA binding element (1.10), association with chromosomal DNA during S-phase of the cell cycle (1.11-1.12), increasing nuclear retention following mitosis (1.13), and increasing transgene expression.

[0104] FIG. 2A shows average peak luminescence (four highest values) for HepG2 liver cancer cells transfected in vitro with mRNA encoding EBNA1 polypeptide with a Gly- Ala repeat region truncation (“C211” or “EBNA1 mRNA”) and one of two different plasmid DNA (pDNA) constructs encoding luciferase and having an OriP (“C198” or “C220”) alone or in the presence of the mitosis inhibitor aphidicolin (“Aph”). mRNA and pDNA were co- formulated in an LNP. Control cells were treated with LNP-formulated pDNA (C198 or C220) alone or neither mRNA or pDNA.

[0105] FIGs. 2B-2E provide graphs showing average peak luminescence for HepG2 (FIG.2B), A375 (FIG. 2C), CT26 (FIG. 2D), or H1299 (FIG. 2E) cells transfected in vitrowith EBNA1 C211 mRNA and luciferase encoding pDNA having an OriP FR (FR+ pDNA) (C673) co-formulated in an LNP. Control cells were transfected with LNP-formulated C673 pDNA alone. Cells were transfected in media alone or media containing Aph to model dividing and non-dividing cells respectively.

[0106] FIG. 3 shows the average in vivo luminescence at day 1 and day 3 in vitro following administration of EBNA1 mRNA (C211) and C198 co-formulated as an LNP. Positive control was mRNA encoding luciferase (C605) and formulated as an LNP or in MessengerMax transfection reagent. C198 was administered alone formulated as an LNP or in lipofectamine.

[0107] FIG. 4 shows the difference in luciferase expression between Balb / c mice or C57bl / 6 mice intravenously administered with EBNA1 mRNA (C211) / C198 or Control mRNA / C198 formulated as an LNP, or saline control. Luciferase expression was measured using IVIS and represented as relative light units (RLU) emanating from the location of the liver.

[0108] FIGs. 5A-5B shows a time series of luminescence (RLU) by each specified condition (at days following transfection of HepG2 cells with LNP co-formulated EBNA1 mRNA (C211) and C198 pDNA, control mRNA and C198 pDNA, or C198 pDNA only). Conducted with control Cre mRNA where specified. Data were plotted as average luminescence for peak concentrations (four replicates) on a log RLU scale (FIG. 5A), and maximum luminescence (single point, maximum value per condition) on a linear RLU scale (FIG.5B).

[0109] FIGs. 6A-6B shows a time series of luminescence (RLU) by each specified condition (at days following transfection of HepG2 cells with the LNPs described in FIGs.5A- 5B followed by a wash step). LNPs were allowed to incubate with target cells overnight prior to the wash step. Data were plotted as average luminescence for peak concentration (two replicates) on a log RLU scale (FIG.6A), and maximum luminescence (single point, maximum value per condition) on a linear RLU scale (FIG.6B).

[0110] FIG. 7 shows luminescence (RLU) by condition 24 hours after transfection in the non-small cell lung cancer (NSCLC) cell line H1299. Cells were transfected with LNP formulated C211 EBNA1 mRNA and C198 pDNA, control mRNA and C198 pDNA, C198 pDNA only, or mRNA encoding luciferase (C605). “No LNP” control cells were untreated. Data were plotted as average luminescence for peak concentrations (four replicates) on a log RLU scale.

[0111] FIG. 8 shows HiBit tag luminescence (RLU) by condition 5 days after transfection across four separate cell lines (HepG2, A431, Hep3B, and H1299). Cells were transfected with LNP formulations containing C211 EBNA1 mRNA and pDNA encoding a HiBit-tagged bispecific T cell engager and having a EBV OriP (C490). Control cells were transfected with LNP-formulated C490 pDNA only. Data were plotted as average luminescence for peak concentrations (four replicates) on a log RLU scale.

[0112] FIG. 9 shows tumor bioluminescence at days 1-28 after intratumoral injection of luciferase pDNA in NCG mice bearing HepG2 tumors. Mice received an LNP formulation of C211 EBNA1 mRNA and C198 pDNA or control mRNA and C198 pDNA. Control mice received no injection. Bioluminescence was measured by IVIS.

[0113] FIG. 10 shows the average luminescence dose-response curve 24 hours post- transfection with the fusion construct C558 (mRNA encoding a fusion protein comprising a chromatin binding domain (CBD) of the latency associated nuclear antigen (LANA) fused the EBNA1 DBD). HepG2 tumor cells were transfected with a C558 LANA CBD-EBNA1 DBD mRNA or C211 EBNA1 mRNA and C198 pDNA formulated in lipofectamine. Control cells were transfected with C198 pDNA only.

[0114] FIGs. 11A-11B shows peak luminescence as fold-change relative to control (FIG. 11A) and by concentration (FIG. 11B) at 24 hours following lipofectamine-mediated transfection with EBNA1 mRNA (C211) or fusion construct mRNAs and OriP+ luciferase- encoding pDNA (C198). Fusion construct mRNAs encoded a fusion protein comprising (i) a EBNA1 amino acid residues 1-15, a LANA CBD, and an EBNA1 DBD (C558), (ii) a LANA CBD and EBNA1 DBD (C581), (iii) an IL33 AT-hook CBD and EBNA1 DBD (C569), (iv) a histone H1 CBD and EBNA1 DBD (C577), or (v) a E2 CBD and EBNA1 DBD (C587). Control cells were transfected with pDNA alone.

[0115] FIG.11C shows peak luminescence at 24 hours and 6 days post-transfection of HepG2 cells with EBNA1 mRNA (C211) or fusion construct mRNAs (C558, C569, C577, C581, or C587) co-administered with OriP+luciferase pDNA (C198), relative to DNA alone.

[0116] FIG. 12A provides a graph showing luciferase expression in the tumor of xenograft mice bearing HepG2 tumors over time following a single intratumoral injection of an LNP formulation containing EBNA1 mRNA (C211) and luciferase encoding pDNA having an OriP FR (FR+ pDNA) (C673), C673 pDNA only, or control mRNA encoding luciferase (C605). Luciferase expression was measured using bioluminescence imaging and represented as radiance (photons / sec / cm^2 / steradian) averaged across mice in each cohort.

[0117] FIG. 12B provides representative bioluminescent images of mice described in FIG.12A.

[0118] FIGs. 12C-12D provide graphs showing average bioluminescent signal in the tumor or liver of mice described in FIG.12A (FIG.12C) or the ratio of tumor to liver signal of the same mice (FIG.12D).

[0119] FIGs. 13A-13B provide graphs showing peak luminescence in HepG2 cells (FIG.13A) or H1299 cells (FIG.13B) transfected in vitro with pDNA containing a FR+ repeat array and encoding luciferase under control of a CMV promoter (C673) or an alpha fetoprotein (AFP) promoter (C780) and EBNA1 mRNA (C211) formulated in lipofectamine. AFP is abundantly expressed by liver cancer cells (e.g., HepG2). Control cells were transfected with pDNA only (C673 or C780) or mRNA encoding luciferase (C605). Luciferase expression as measured at day 1 or 5 following transfection.

[0120] FIG. 14A provides a graph showing luciferase expression in the tumor of xenograft mice bearing HepG2 tumors following a single intratumoral injection of an LNP formulation containing EBNA1 mRNA (C211) and luciferase encoding FR+ pDNA under control of an alpha fetoprotein (AFP) promoter (C780). Luciferase expression was measured as in FIG.12A.

[0121] FIG.14B provides representative bioluminescent images of the mice described in FIG.14A.

[0122] FIG. 15 provides a graph showing tumor volume over time in B16F10-tumor bearing mice administered a single intratumoral injection of an LNP formulation containing EBNA1 mRNA (C211) and a combination of FR+ pDNAs encoding murine single-chain IL- 12 (scIL12), interferon-α (IFNα), granulocyte-macrophage colony-stimulating factor (GM- CSF), and IL-15 sushi. Positive control mice were administered a single intratumoral injection of LNP-formulated mRNAs encoding scIL12, IFNα, GM-CSF, and IL-15 sushi and negative control mice were administered a single intratumoral injection of LNP-formulated pDNA encoding luciferase.

[0123] FIGs. 16A-16D provides graphs showing in vitro luciferase expression in HepG2 (FIG.16A), H1299 (FIG. 16B), CT26 (FIG. 16C), or A375 (FIG.16D) tumor cells at day 5 following transfection with an LNP formulation containing EBNA1 mRNA (C211) and luciferase encoding FR+ pDNA (C673) or EBNA1 mRNA (C211) and luciferase encoding FR+ linear, close-ended DNA. Control cells were transfected with an LNP-formulation containing pDNA only or linear DNA only.

[0124] FIG. 17A provides a graph showing in vitro luciferase expression in H1299 cells at 1 and 5 days following lipofectamine-mediated transfection with luciferase-encoding FR+ pDNA (C673) and mRNA encoding EBNA1 (C211) or an mRNA encoding an EBNA1 variant (EBNA1 having a deletion of the transactivation (TA) domain (C804 “EBNA1 ∆TA domain”); deletion of the TA domain and NLS (C805 “EBNA1 ∆NLS-TA domain”); deletion of the NLS (C807; “EBNA1 ∆NLS”); or substitution of the NLS with a c-myc NLS (C806; “EBNA1 C-Myc NLS”)). Control cells were transfected with mRNA encoding luciferase (C605) or pDNA (C673) only.

[0125] FIG. 17B provides a graph showing in vitro luciferase expression in HepG2 cells at 1 and 5 days following lipofectamine-mediated transfection with luciferase-encoding FR+ pDNA (C673) and mRNA encoding EBNA1 (C211) or mRNA encoding an EBNA1 variant (EBNA1 having a deletion of a putative autoantigen motif (C778) or portion thereof (C779)). Control cells were transfected with pDNA (C673) only.

[0126] FIG.18 provides representative histology images of livers harvested from mice at three days following administration of a single intravenous injection of an LNP formulation containing mRNA encoding a minimal EBNA1 (C804) and FR+ pDNA encoding GFP (C983) or mRNA encoding GFP.

[0127] FIGs. 19A-19C provide graphs showing in vitro luciferase expression in HepG2 (FIG. 19A), A375 (FIG. 19B), and Hepa1-6 (FIG. 19C) cells over time following transfection with an LNP formulation containing mRNA (C211 mRNA encoding EBNA1, or C804 mRNA encoding minimal EBNA1) and luciferase encoding FR+ pDNA (C673). Control cells were transfected with LNP-formulated pDNA only.

[0128] FIGs. 20A-20B provides graphs showing in vitro luciferase expression in HepG2 (FIG.20A) and H1299 (FIG.20B) cells at 1 day following transfection with an LNP formulation containing an EBNA1 mRNA (C211) and luciferase encoding pDNA having a full-length OriP (C590) or OriP FR (C608). Control cells were transfected with LNP- formulated pDNA (C608 or C590) only.

[0129] FIGs. 21A-21B provide graphs showing in vitro luciferase expression in B16F10 (FIG.21A) and HepG2 (FIG.21B) cells at 1 day following transfection with an LNP formulation or lipofectamine formulation of EBNA1 mRNA (C211) and luciferase-encoding FR+ pDNA (C608). Control cells received pDNA only formulated in an LNP or lipofectamine.

[0130] FIGs.22A-22B provide graphs showing in vitro luciferase expression in H1299 (FIG. 22A) and HepG2 (FIG. 22B) cells at 6 days following transfection with an LNP formulation containing mRNA encoding a fusion protein comprising an EBNA1 DBD andheterologous CBD (HMGA-1 CBD (C566); 5xAT-hook CBD (C570); or histoneH1 CBD (C577)) and FR+ pDNA encoding luciferase (C608). Control cells were transfected with LNP- formulated pDNA only.

[0131] FIG.23 provides a graph showing in vivo tumor luminescence in subcutaneous A375 human melanoma tumors engrafted on NCG mice, following intratumoral administration of LNPs encapsulating an FR+ pDNA encoding luciferase and mRNA encoding either C804 EBNA1 ∆TA domain (“IT Delta TA”) or C211 EBNA1 (“IT EBN WT”). The control received no injection (“NA Neg Ctrl”).

[0132] FIGs 24A-24B shows luminescence by condition 5 days after transfection by lipofectamine in the HepG2 cells (FIG. 24A) or H1299 (FIG. 24B) cell lines. Cells were transfected with EBNA1 mRNA and pDNAs encoding luciferase and containing a repeat array of an OriP DBE of different length.

[0133] FIGs 25A-25D show luminescence by condition 5 days after transfection by lipofectamine in the HepG2 (FIG. 25A and FIG 25C) and H1299 (FIG.25B and FIG.25D) cell lines. Cells were transfected with EBNA1 mRNA (except control condition) and pDNAs encoding luciferase and containing one or more repeat arrays of an OriP DBE. The properties of the repeat array were varied between conditions, including spacing of the DBEs (FIGs.25A- 25B), and number and position of DBE arrays relative to transgene (FIGs.25C-25D).

[0134] FIGs. 26A-26D provide graphs showing in vitro luciferase expression in HepG2 (FIG.26A), Hep3B (FIG.26B), Hepa1-6 (FIG.26C), or B16F10 (FIG.26D) cells at days 1, 3, and 5 following transfection with LNP encapsulating mRNA encoding EBNA1 (mC1036) or an EBNA1 homolog derived from baboon LCV (mC1033), rhesus LCV (mC1037), arctoides LCV (mC1061), cynomolgus LCV (mC1062), or gorilla / rhesus LCV (mC1068) and pDNA encoding a luciferase transgene and containing an EBV OriP FR (pC673). Control cells were transfected with LNP containing pC673 only.

[0135] FIGs. 27A-27C provide graphs showing in vitro luciferase expression in HepG2 (FIG. 27A), Hep3B (FIG. 27B), or Hepa1-6 (FIG. 27C) at day 5 following lipofectamine-mediated transfection with (i) mRNA encoding truncated EBNA1 (mC11) and pC673; (ii) mRNA encoding an EBNA homolog from marmoset LCV (mC1035) and pC673; (iii) mC1035 and pDNA encoding a luciferase transgene and containing a marmoset LCV OriP FR (pC1072); or (iv) mC211 and pC1072. Control cells were transfected with pC1072 or pC673 alone.

[0136] FIGs.28A-28B provide graphs showing in vitro luciferase expression in A375 (FIG. 28A) or H1299 (FIG. 28B) cells at days 1, 3, and 5 following transfection with LNPencapsulating (i) truncated EBNA1 mRNA (mC211) and luciferase encoding pDNA having an EBV OriP FR (pC673); (ii) mRNA encoding an EBNA1 homolog from arctoides LCV (mC1061) and pC673; (iii) mRNA encoding EBNA1 homolog from marmoset EBNA1 (mC1035) and luciferase-encoding pDNA having a marmoset LCV OriP FR (pC1072). Control cells were transfected with LNP encapsulating pC673 or pC1072 alone. DETAILED DESCRIPTION

[0137] The present disclosure relates, at least in part, to non-viral expression systems comprising (i) a DNA binding protein (e.g., as a polypeptide or a nucleic acid or recombinant expression vector encoding the polypeptide) comprising a DNA binding domain (DBD) and a chromatin binding domain, and (ii) a recombinant expression vector comprising a transgene and a DNA binding polynucleotide comprising a DNA binding element (DBE) that binds the DBD, wherein the non-viral expression system provides an enhanced level and / or duration of expression of the transgene when introduced to a cell as compared to introducing the recombinant expression vector alone. Without being bound by theory, once introduced to the cell, the DNA binding protein mediates increased nuclear uptake of the recombinant expression vector and / or tethering of the recombinant expression vector to chromatin during mitosis, thereby retaining the recombinant expression vector in the nucleus and enabling enhanced transgene expression.

[0138] As described herein, it was discovered that the level and duration of expression of a non-viral recombinant expression vector comprising at least one transgene is enhanced when engineered to comprise a polynucleotide comprising one or more Epstein Barr virus (EBV) DNA binding elements (DBEs) and introduced with an mRNA encoding a polypeptide comprising one or more chromatin binding domains and at least one EBNA1 DNA binding domain (DBD). In some embodiments, polypeptides of the disclosure comprising at least one EBNA1 DBD are referred to herein as “DNA binding proteins.” According to the present disclosure, once introduced to a cell, the DNA binding protein is transcribed and mediates nuclear uptake, episomal replication, and / or transactivation of the non-viral vector, thereby enhancing the level and duration of expression of the transgene as compared to introduction of the non-viral vector alone. Although the system is amenable to expression of the DNA binding protein using a DNA vector, such systems are potentially deleterious due to constitutive expression of the DNA binding protein that creates a risk of altering the cellular state (e.g., via transformation to a malignant state). An advantage of the systems described herein is the useof an mRNA to encode the DNA binding protein, which allows for expression of the DNA binding protein for a sufficient duration to achieve the desired outcome (i.e., high level of expression of the transgene for an extended duration), without risk of constitutive expression. As further demonstrated herein, it was surprisingly found that the desired outcome was substantially equivalent or even improved if the system combined the non-viral recombinant expression vector with an mRNA encoding an EBNA1 fusion protein comprising an EBNA1 DBD and one or more heterologous chromatin binding domain as compared to an mRNA encoding a full-length EBNA1 protein or fragment thereof.

[0139] Moreover, although exemplary systems of the disclosure were shown to increase expression of a transgene in non-dividing cells (e.g., dividing cells contacted with a mitosis inhibitor) as compared to the non-viral vector alone, the greatest increase was observed in dividing cells. These results demonstrate introducing the system achieves the desired outcome regardless of cellular proliferation state, but may be enhanced if introduced to cells undergoing active cell division (e.g., mitotic cells). Without being bound by theory, a recombinant expression vector introduced to non-dividing cells is excluded from the nucleus; whereas in dividing cells, which have a disassembled nuclear envelop, the recombinant expression vector is able to associate with chromosomal DNA to undergo processing. As a result, the recombinant expression vector is preferentially expressed in dividing cells as compared to non-dividing cells. As shown herein, this effect is substantially enhanced by co- introducing the recombinant expression vector with an mRNA encoding a DNA binding protein described herein capable of binding to one or more EBV DBEs present on the vector.

[0140] As described herein, it was discovered that upon administration (e.g., systemic administration) of a system of the disclosure (e.g., a system comprising an mRNA encoding an EBNA1 polypeptide and a recombinant expression vector comprising a polypeptide-encoding transgene and a polynucleotide comprising one or more DBEs of an EBV OriP) to a test subject having a tumor, the level and duration of expression of a polypeptide-encoding transgene was increased in the tumor as compared to that in control subjects that received the recombinant expression vector alone or an mRNA encoding the polypeptide. In contrast to control subjects administered either the recombinant expression vector or the mRNA, in which levels of expression in tumor were respectively low for an extended duration and high for a short duration, the test subjects demonstrated a level of expression in tumor that was high for an extended duration. Surprisingly, it was further demonstrated that transgene expression in the test subjects was preferentially localized to tumor tissue, with levels of transgene expression in non-tumor tissue (e.g., liver tissue) substantially equivalent to background (e.g., as comparedto the same tissue in a control or untreated subject). This result was observed whether the system was administered by intratumoral injection or systemic (e.g., intravenous) injection. Additionally, it was distinct from that observed in control subjects administered the recombinant expression vector, in which transgene expression in the tumor was low, or the mRNA, in which transgene expression in non-tumor tissue was high. Thus, in some embodiments, the systems of the disclosure are effective for providing a level of expression in cells undergoing cell division that is enhanced as compared to that observed in quiescent and / or non-dividing cells, and as such, are amenable to selective expression following in vivo administration (e.g., systemic administration) in tissues comprising cells undergoing cell division as compared to tissues substantially comprising quiescent and / or non-dividing cells. Without being bound by theory, such systems are effective for enhancing expression in tumor tissue as compared to non-tumor tissue following in vivo administration (e.g., systemic administration) as tumor tissue is composed of rapidly dividing cells (e.g., rapidly dividing tumor cells), whereas non-tumor tissue substantially comprises quiescent and / or non-dividing cells (e.g., liver tissue).

[0141] The present disclosure is further based, at least in part, on identification of components of the DNA binding protein encoded by the mRNA of the system and the polynucleotide comprising one or more DBEs of an EBV OriP presented by the recombinant expression vector that yield the desired enhancement in expression when introduced to a cell as compared to the recombinant expression vector introduced alone. While a system comprising an mRNA encoding a native EBNA1 polypeptide and a recombinant expression vector comprising a transgene and native EBV OriP was found to substantially increase expression of the transgene when introduced to a cell culture as compared to introducing the recombinant expression vector alone, it was further discovered that modification of one or more domains of the EBNA1 polypeptide and / or the EBV OriP was achieved without detriment to the desired outcome of enhancing transgene expression. As demonstrated herein, an mRNA encoding (i) a fusion protein comprising one or more non-EBNA1 (“heterologous") chromatin binding domains and an EBNA1 DBD, or (ii) a variant of an EBNA1 polypeptide comprising one or more EBNA1 chromatin binding domains, an EBNA1 DBD, and at least one modification (e.g., deletion, insertion, and / or substitution) of the NLS, TA domain, and / or Gly- Arg repeat region, was effective for increasing expression of a transgene present on a recombinant expression vector comprising one or more DBEs of an EBV OriP. Indeed, it was shown an encoded variant of an EBNA1 polypeptide having a modified (e.g., deleted) TA domain was effective for achieving this outcome. Without being bound by theory, a variant ofan EBNA1 polypeptide comprising a modified (e.g., deleted) TA domain has the further desirable benefit of reduced immunogenicity when encoded by an mRNA administered to a subject (e.g., a human subject), as the TA domain comprises one or more antigens that are thought to trigger a deleterious immune response.

[0142] Furthermore, a recombinant expression vector comprising an FR region of an EBV OriP, but lacking the DS region, was shown to yield the desired increase in transgene expression when introduced to a cell with an mRNA encoding a DNA binding protein described herein. The DS region present in the EBV genome has been implicated in plasmid replication. Without being bound by theory, a system of the disclosure comprising a recombinant expression vector lacking the DS region does not undergo replication, thereby providing an improved safety profile that is desirable in certain in vivo applications by reducing the risk of the recombinant expression vector replicating and persisting indefinitely.

[0143] Accordingly, in some aspects, the present disclosure provides a non-viral system for enhancing expression of a transgene, the system comprising an mRNA encoding a DNA binding protein and a non-viral recombinant expression vector comprising a transgene and a polynucleotide comprising one or more EBV DBEs. In some embodiments, the DNA binding protein comprises at least one EBNA1 DBD and one or more chromatin binding domains. In some embodiments, the DNA binding protein comprises at least one EBNA1 DBD and one or more EBNA1 chromatin binding domains. In some embodiments, the DNA binding protein comprises a full-length EBNA1 polypeptide. In some embodiments, the DNA binding protein comprises a truncated EBNA1 polypeptide. In some embodiments, the DNA binding protein comprises at least one EBNA1 DBD and one or more heterologous chromatin binding domains described herein.

[0144] As described herein, a DNA binding protein comprising an EBNA1 DBD effectively achieves the desired cellular function(s) to yield increased and extended expression of a transgene-encoding recombinant expression vector comprising an EBV DBE as compared to the recombinant expression vector alone. However, and without being bound by theory, such systems are susceptible to diminished efficacy in individuals previously exposed to EBV as result of an immune response against EBNA1, such as a memory T cell response against peptide antigens present in EBNA1. The immune response induced by re-exposure to EBNA1 or a portion thereof (e.g., a DBD thereof), has the potential to trigger a T cell-mediated response against cells transfected with the EBNA1 or portion thereof (e.g., a DBE thereof), potentially resulting in undesirable cell death of otherwise healthy transfected cells.

[0145] As described herein, it was surprisingly discovered that systems comprising a DNA binding protein and recombinant expression vector, wherein the DNA binding protein comprises a DBD from an EBNA1 homolog, wherein the EBNA1 homolog is derived from an LCV infecting an NHP host and the recombinant expression vector comprises a DBE from EBV or from the same LCV, results in enhanced transgene expression compared to the recombinant expression vector alone, despite the EBNA1 homolog having relatively low sequence homology to EBNA1 (e.g., about 50% to about 65% sequence identity to EBNA1).

[0146] Moreover, it was further demonstrated that a non-viral expression system of the disclosure comprising a DNA binding protein comprising a DBD of an EBNA1 homolog, wherein the EBNA1 homolog is derived from an LCV infecting an NHP of the family Hominoidea or Cercopithecoidea (also known as apes or Old World monkeys respectively; see, e.g., representative species listed in Table 22), effectively increased expression of a transgene-encoding recombinant expression vector comprising an array of EBV DBEs in a manner comparable to a control system comprising the recombinant expression vector and a DNA binding protein comprising an EBNA1 DBD.

[0147] Additionally, it was found that expression of a transgene-encoding recombinant expression vector was increased in the presence of a DNA binding protein comprising a DBD of an EBNA1 homolog, wherein the EBNA1 homolog is derived from an LCV infecting an NHP of the parvorder Platyrrhini (also known as New World monkeys; e.g., Callithrix jacchus, also known as the common marmoset) and the recombinant expression vector comprises an array of DBEs derived from the genome of the same LCV.

[0148] As described herein, a system comprising a DNA binding protein of the disclosure (e.g., a DNA binding protein comprising a chromatin binding domain and a DBD of an EBNA1 homolog described herein) functions to increases expression a recombinant expression vector of the disclosure (e.g., a recombinant expression vector comprising a transgene and an array of EBV DBEs or an array of DBEs from an NHP LCV), while reducing the risk of an EBNA1-associated immune response following in vivo administration due to the complete or partial absence of EBNA1 T cell epitopes in the DNA binding protein (e.g., one or more of the EBNA1 T cell epitopes listed in Table 26). Without being bound by theory, the reduced immune recognition of a system of the disclosure in an individual previously exposed to EBV enables the system to be administered to the individual to achieve increased and durable transgene expression, without the risk of an EBV-associated immune response directed to transfected cells that express components of the system (e.g., transfected cells expressing the DNA binding protein).

[0149] Accordingly, in some aspects, the present disclosure provides a non-viral system for enhancing expression of a transgene, the system comprising a DNA binding protein, or a nucleic acid or a recombinant expression vector encoding the DNA binding protein, and a non-viral recombinant expression vector comprising a transgene and a DNA binding polynucleotide, wherein the DNA binding protein comprises a DBD of an EBNA1 homolog of an NHP LCV, or a variant thereof, and wherein the DNA binding polynucleotide comprises a DBE of EBV or an NHP LCV. In some embodiments, the DNA binding protein comprises a DBE of an EBNA1 homolog or a variant thereof, wherein the EBNA1 homolog is of an NHP LCV. In some embodiments, the NHP is of the family Hominoidea. In some embodiments, the NHP is an ape. In some embodiments, the NHP is of the family Cercopithecoidea. In some embodiments, the NHP is an Old World monkey. In some embodiments, the NHP is of the parvorder Platyrrhini. In some embodiments, the NHP is of the family Callitrichidae. In some embodiments, the NHP is of the family Cebidae. In some embodiments, the NHP is of the family Aotidae. In some embodiments, the NHP is of the family Pitheciidae. In some embodiments, the NHP is of the family Atelidae. In some embodiments, the NHP is a New World monkey. In some embodiments, the DNA binding protein further comprises a chromatin binding domain. In some embodiments, the chromatin binding domain is an EBNA1 chromatin binding domain. In some embodiments, the chromatin binding domain is an NHP LCV chromatin binding domain. In some embodiments, the chromatin binding domain is a heterologous chromatin binding domain described herein.

[0150] In some embodiments, the DNA binding polynucleotide comprises a DBE of EBV (e.g., 1, 2, 3, 4, 5, or more EBV DBEs). In some embodiments, the DNA binding polynucleotide comprises an array of EBV DBEs. In some embodiments, the DNA binding polynucleotide comprises a DBE of an NHP LCV (e.g., 1, 2, 3, 4, 5, or more NHP LCV DBEs). In some embodiments, the DNA binding polynucleotide comprises an array of NHP LCV DBEs.

[0151] In some embodiments, the system comprises a nucleic acid encoding the DNA binding protein. In some embodiments, the system comprises a mRNA encoding the DNA binding protein. In some embodiments, the system comprises a recombinant expression vector encoding the DNA binding protein. In some embodiments, the system comprises the DNA binding protein as a polypeptide.

[0152] In some aspects, the disclosure provides a delivery vehicle comprising a system described herein. In some embodiments, the delivery vehicle comprises one or more LNPs. In some embodiments, the DNA binding protein and the transgene-encoding recombinantexpression vector are co-formulated as an LNP, wherein the DNA binding protein is a polypeptide or encoded by a nucleic acid or recombinant expression vector. In some embodiments, the DNA binding protein and the transgene-encoding recombinant expression vector are formulated as separate LNPs. In some embodiments, the DNA binding protein is encoded by an mRNA. In some embodiments, the mRNA and non-viral recombinant expression vector are co-formulated as an LNP. In some embodiments, the mRNA and non- viral recombinant expression vector are formulated as separate LNPs.

[0153] In some embodiments, the disclosure provides a method of increasing an expression level of a transgene in a cell, comprising introducing to the cell a system described herein. In some embodiments, the cell is a dividing cell. In some embodiments, the cell is a non-dividing cell.

[0154] In some embodiments, the disclosure provides an in vivo method for increasing expression of a transgene in a target cell population and / or target tissue in a subject, comprising administering to the subject a system described herein or a delivery vehicle comprising the system described herein. In some embodiments, the target cell population comprises tumor cells. In some embodiments, the target tissue comprises cancerous tissue. In some embodiments, expression of the transgene is enhanced in the target cell population and / or target tissue as compared to a non-target cell population and / or non-target tissue.

[0155] In some embodiments, the disclosure provides a method for treating a disease or disorder in a subject comprising administering to the subject a system described herein or a delivery vehicle comprising the system described herein. In some embodiments, the subject has cancer. In some embodiments, the administering comprises intratumoral injection. Definitions

[0156] As used herein, the term “a” or “an” refers to one, or more than one, of that entity. In some embodiments, “a” refers to plural referents. As such, the terms “a” or “an”, “one or more” and “at least one” can be used interchangeably herein. In addition, reference to “an element” by the indefinite article “a” or “an” does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there is one and only one of the elements.

[0157] As used herein, a “DNA binding protein” refers to a polypeptide comprising at least one DNA binding domain (DBD), wherein the DBD comprises a nucleotide sequence that binds to a target DNA (e.g., a single- or double-stranded DNA). In some embodiments, theDNA binding protein comprises a DNA binding domain (DBD) and a chromatin binding domain, wherein the DBD comprises a nucleotide sequence that binds to a target DNA (e.g., a single- or double-stranded DNA). In some embodiments, the nucleotide sequence binds to the target DNA with a binding affinity sufficient to achieve binding under physiological conditions in a mammalian cell. In some embodiments, the binding affinity is micromolar or lower (e.g., 10-6M to 10-9M). In some embodiments, the binding affinity is nanomolar or lower (e.g., less than 10-9M). Methods for measuring binding affinity of a DNA binding protein to a target nucleic acid are further described herein. In some embodiments, the target DNA is a DNA binding polynucleotide described herein. In some embodiments, the target DNA is a polynucleotide comprising an array of DBEs, wherein the DBE comprises a sequence that binds to the DBD.

[0158] As used herein, the term “chromatin binding domain” refers to an agent that associates with, binds to, and / or localizes to chromatin, chromatin-associated structures, the nuclear lamina, and / or the nuclear matrix.

[0159] As used herein, the term “DNA binding polynucleotide” refers to a polynucleotide comprising an array of sequence elements, wherein each sequence element of the array comprises a DBE described herein or a variant thereof or a fragment thereof. The term “DNA binding polynucleotide” is used interchangeably herein with the term “polynucleotide comprising one or more DBEs” or “polynucleotide comprising a DBE.” In some embodiments, the polynucleotide comprises an array of DBEs (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more DBEs).

[0160] As used herein, the term “polynucleotide” refers to a polymer of nucleotides / nucleosides joined together, e.g., by a phosphodister linkage between 5ʹ and 3ʹ carbon atoms. As used herein, the term “internucleoside linkage” refers to a linkage joining one nucleotide / nucleoside unit of a polynucleotide to another nucleotide / nucleoside unit. In some embodiments, the linkage is a phosphodiester linkage. In some embodiments, the linkage is a modified linkage, e.g., a phosphorothioate linkage.

[0161] As used herein, the term “sequence element” refers to a segment of nucleotides / nucleosides in a polynucleotide, wherein the segment or a portion thereof comprises a biological activity / function. In some embodiments, the biological activity / function comprises binding to a DNA binding protein described herein. In some embodiments, a sequence element is at least 5 nucleotides / nucleosides in length and up to 100 nucleotides / nucleosides in length. In some embodiments, the sequence element comprises a DBE that binds to a DNA binding element described herein.

[0162] As used herein, the term “nucleoside” refers to a molecule comprising a purine or pyrimidine base covalently linked to a ribose or deoxyribose sugar (e.g., adenosine, guanosine, cytidine, uridine, and thymidine).

[0163] As used herein the term “nucleotide” refers to a nucleoside comprising one or more phosphate groups joined in ester linkages to the sugar moiety (e.g., nucleoside monophosphates, disphosphates, and triphosphates).

[0164] As used herein, the term “array” refers to a tandem arrangement of two or more sequence elements, wherein the two or more sequence elements are operably linked (e.g., by a phosphate linkage, or analog thereof, or by a spacer sequence). In some embodiments, the array comprises at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, or at least about 10 sequence elements. In some embodiments, the sequence elements in the array have the same sequence. In some embodiments, the sequence elements in the array do not have the same sequence. In some embodiments, a portion (e.g., about 20% or more) of or a majority (i.e., 50% or more) of the sequence elements in the array have the same sequence. In some embodiments, a portion (e.g., about 20% or more) of or a majority (i.e., 50% or more) of the sequence elements in the array do not have the same sequence. In some embodiments, an array comprises a tandem arrangement of two or more DBEs, wherein the two or more DBEs are operably linked (e.g., by a phosphate linkage, or analog thereof, or by a spacer sequence). In some embodiments, the array comprises at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, or at least about 10 DBEs. In some embodiments, the DBEs in the array have the same sequence. In some embodiments, the DBEs in the array do not have the same sequence. In some embodiments, a portion of (e.g., about 20% or more) or a majority of (i.e., 50% or more) the DBEs in the array have the same sequence. In some embodiments, a portion of (e.g., about 20% or more) or a majority of (i.e., 50% or more) the DBEs in the array do not have the same sequence. In some embodiments, each DBE is selected from a DBE of an EBV OriP described herein, a fragment thereof, and a variant thereof. In some embodiments, the DBE is selected from a DBE of an NHP LCV described herein, a fragment thereof, and a variation thereof. In some embodiments, the DBEs in the array are arranged in a manner (e.g., having a number, orientation, sequence similarity, and / or spacing) that results in a polynucleotide that binds to the DNA binding protein, e.g., as determined by a method of measuring binding interactions described herein.

[0165] As used herein, the term “DBE” or “DNA binding element” refers to a polynucleotide sequence that binds to a DNA binding protein described herein, e.g., under physiological conditions.

[0166] As used herein, “a fragment of the DBE” is understood to mean a sequence shorter than the DBE (e.g., a truncation of the DBE comprising one or more deletions at the 5ʹend, the 3ʹend, and / or an internal region) that retains binding to the DNA binding protein (e.g., retains substantially equivalent binding to the DNA binding protein as compared to the DBE). In some embodiments, the fragment of the DBE comprises one or more deletions at the 5ʹend, the 3ʹend, and / or an internal region.

[0167] As used herein, a “variant of the DBE” is understood to mean a sequence comprising one or more mismatches relative to the DBE that retains binding to the DNA binding protein (e.g., retains substantially equivalent binding to the DNA binding protein as compared to the DBE). In some embodiments, the variant of the DBE comprises 1, 2, 3, 4, 5, or more mismatches relative to the DBE. In some embodiments, the variant comprises 1 or 2 mismatches relative to the DBE. In some embodiments, the variant comprises at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to the DBE. In some embodiments, the variant comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the DBE.

[0168] As used herein, the term “EBV DBE,” interchangeably used with “DBE of EBV,” refers to a repeating sequence element present in an origin of replication (OriP) of the EBV genome. Representative repeating sequence elements present in the OriP of the EBV genome are set forth in Table 8. In some embodiments, the repeating sequence element is a DBE that binds to a DNA binding protein described herein (e.g., a DNA binding protein comprising a DBD of EBNA1 or a DBD of an EBNA1 homolog). The terms “EBV DBE” or “DBE of EBV” are used interchangeably herein with the terms “OriP DBE” and “EBV OriP DBE.” Methods for measuring binding of a repeating sequence element to a DNA binding protein are further described herein.

[0169] As used herein, a “consensus sequence” refers to a sequence having the most frequent residues found at each position of a sequence alignment. Methods to generate a consensus sequence are known in the art. For example, in some embodiments, a consensus sequence is generated by aligning a series of related sequences, determining the frequency of each nucleobase occurring at each position of the alignment, and selecting the nucleobase that occurs most frequently at each position.

[0170] As used herein, an “OriP DBE consensus sequence” refers to a sequence having the most frequent residues found at each position of a sequence alignment formed from repeating sequence elements present in the OriP of the EBV genome. In some embodiments, the repeating sequence elements are set forth in SEQ ID NOs: 52-60. In some embodiments, the OriP DBE consensus sequence is set forth in SEQ ID NO: 8.

[0171] As used herein, a “fragment of an OriP DBE consensus sequence” refers to a sequence shorter than the OriP DBE consensus sequence (e.g., a truncation of the OriP DBE sequence comprising one or more deletions at the 3ʹend, the 5ʹend, and / or an internal region). In some embodiments, a fragment of an OriP DBE consensus sequence comprises one or more deletions at the 3ʹend, the 5ʹend, and / or an internal region of SEQ ID NO: 51.

[0172] As used herein, a ”variant of an OriP DBE consensus sequence” refers to a sequence comprising one or more mismatches relative to the OriP DBE consensus sequence (e.g., the OriP DBE consensus sequence SEQ ID NO: 51). In some embodiments, the variant of the OriP DBE consensus sequence comprises 1, 2, 3, 4, 5, or more mismatches relative to the OriP DBE consensus sequence (e.g., the OriP DBE consensus sequence SEQ ID NO: 51). In some embodiments, the variant comprises 1 or 2 mismatches relative to the OriP DBE consensus sequence (e.g., the OriP DBE consensus sequence SEQ ID NO: 51). In some embodiments, the variant comprises at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to the OriP DBE consensus sequence (e.g., the OriP DBE consensus sequence SEQ ID NO: 51). In some embodiments, the variant comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the OriP DBE consensus sequence (e.g., the OriP DBE consensus sequence SEQ ID NO: 51).

[0173] As used herein, the term “DBE of an NHP LCV,” interchangeably used with “NHP LCV DBE,” refers to a repeating sequence element present in a genome of an NHP LCV. In some embodiments, the repeating sequence element is a DBE that binds to a DNA binding protein described herein (e.g., a DNA binding protein comprising a DBD of EBNA1 or a DBD of an EBNA1 homolog). Methods for identifying a repeating sequence element present in the genome of an NHP LCV are further described herein.

[0174] As used herein, the term “NHP LCV,” interchangeably used with “LCV of an NHP,” refers to a virus of the genera Lymphocryptovirus in the subfamily Gammaherpesvirinae, wherein the virus is identified as infecting an NHP.

[0175] As used herein, the term “NHP” or “non-human primate” refers to an animal of the order Primates. In some embodiments, the NHP is a simian (i.e., an NHP of the infraorderSimiiformes). In some such embodiments, the NHP is selected from the group consisting of the Integrated Taxonomic Information System (IT IS) Taxonomic Serial No.: 943778 (Simiiformes). In some embodiments, the NPH is selected from a group consisting of species listed in Table 1. As understood by the skilled artisan, the IT IS refers to a public database (accessible via the world wide web: gbif.org) that provides taxonomic information on plants, animals, fungi, and microbes.

[0176] As used herein, the term “EBNA1” refers to wild-type EBNA1 unless otherwise specified.

[0177] As used herein, the term “wild-type EBNA1” refers to the native protein encoded by the EBV genome that functions in replication and partitioning of the viral genome during a latent EBV infection. EBNA1 is about 641 amino acid residues in length. Amino acid and nucleotide sequence information for EBNA1 str accessible via one or more public databases using the identification number P03211 (UniProt) and gene ID 3783709 (NCBI). The genome sequence for EBV (also known as human gammaherpesvirus 4) is accessible via reference sequence NC_007605.1 (NCBI; ncbi.nlm.nih.gov / nuccore / NC_007605.1?from=95662&to=97587), which further provides the coding sequence for the EBNA1 polypeptide. The portion of the EBV reference genome corresponding to EBNA1 is set forth by coordinates 95662 to 97587 (according to the EBV reference genome identified by NCBI reference sequence NC_007605.1). In some embodiments, the EBNA1 polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the EBNA1 polypeptide comprises or consists of an amino acid sequence encoded by a nucleotide sequence set forth in SEQ ID NO: 12.

[0178] As used herein, the term “functional fragment of an EBNA1 polypeptide” and “functional variant of an EBNA1 polypeptide” refer respectively to a truncated EBNA1 polypeptide or an altered EBNA1 polypeptide that maintains one or more functional properties of the wild-type EBNA1 polypeptide. In some embodiments, the one or more functional properties of a wild-type EBNA1 polypeptide comprises (i) binding to an EBV DBE; (ii) binding to chromatin; (iii) transport into the cell nucleus; (iv) tethering of DBE-containing DNA to chromatin; (v) retention of DBE-containing DNA in the nucleus during or following mitosis; or (vi) a combination of (i)-(v). In some embodiments, the one or more functional properties of a EBNA1 polypeptide described herein are determined according to methods further described herein. In some embodiments, the one or more functional properties of a wild- type EBNA1 polypeptide result in a desired outcome when introduced to a cell in combination with a recombinant expression vector comprising a transgene and the EBV OriP. In someembodiments, the desired outcome is improved or enhanced as compared to introducing the recombinant expression vector alone. In some embodiments, the desired outcome is selected from (i) replication of the recombinant expression vector; (ii) episomal maintenance of the recombinant expression vector; (iii) nuclear transport of the recombinant expression vector; (iv) tethering of the recombinant expression vector to chromatin; (v) retention of the recombinant expression vector in the nucleus following mitosis; and (vi) a combination of (i)- (v). Methods for determining whether the desired outcome is achieved are further described herein.

[0179] As used herein, the term “homologous,” “homologous sequences,” “homolog,” and “ortholog” are used interchangeably and referrer to sequences that functionally related, as indicated by (i) shared ancestry, (ii) a substantial degree of sequence identity, and / or (iii) the presence of a substantially similar biological function. In some embodiments, sequence homology between amino acid sequences or between nucleic acid sequences is defined based upon a shared ancestry. For examples, in some embodiments, two nucleic acids have a shared ancestry due to a speciation event (orthologs) or a duplication event (paralogs). In some embodiments, sequence homology between amino acid sequences or between nucleic acid sequences is defined based upon a high degree of sequence similarity. Substantial sequence similarity suggests that two sequences are related by divergent evolution from a common ancestor. Alignment of multiple sequences is performed to identify homologous regions. Methods to perform sequence alignment are known in the art, and further described herein.

[0180] As used herein, the term “sequence similarity,” “similarity,” “sequence identity,” and identity” refer to the overall relatedness between nucleic acids or polypeptides. “Percent identity” refers to the number of identical nucleic acid residues or amino acids over a defined length in a given alignment of nucleic acid or polypeptide sequences. “Percent similarity” refers to the number of amino acids over a defined length in a given alignment that are identical or conservative amino acid substitutions. Calculation of the percent identity of two nucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identicalpositions shared by the sequences, taking into account the number of gaps, and the length of each gap which needs to be introduced for optimal alignment of the two sequences. The percent similarity between two sequences is performed using a similarity-scoring matrix such as EBLOSUM62 (aka “BLOSUM 62,” accessible via the world wide web: ebi.ac.uk / Tools / psa / emboss_needle / ). The similarity-scoring matrix provides a substitution matrix for sequence alignment of proteins for the purpose of identifying whether an amino acid substitution is conservative or non-conservative. In some embodiments, the similarity-scoring matrix is a BLOSUM (Blocks Substitution Matrix). A BLOSUM is constructed based on local alignments of conserved regions of protein families, which are then counted based upon the relative frequency of amino acid and their substitution probabilities. A log-odds score for each of the 210 possible substitution pairs of 20 standard amino acids is tabulated and reflected in the matrix. The possible substitution pairs are arranged pair-wise in a matrix of (i) residues and (j) residues, with a BLOSUM score for a substitution of an (i)th residue with a (j)th residue. In some embodiments, the scores range from +11 to -4. A higher BLOSUM score indicates the substitution is conservative and a lower BLOSUM score indicates the substitution is non- conservative. For example, in some embodiments, a conservative substitution of serine (S) with threonine (T) or substitution of leucine (L) with isoleucine (I) has a positive BLOSUM score (e.g., +1 for S to T and +2 for L to I). Methods for generating a BLOSUM are further described in Henikoff, et al (1992) PNAS 89:10915.

[0181] Methods to perform sequence alignment for determining percent identity or similarity are known in the art and described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991. Exemplary algorithms for performing sequence alignment include, but are not limited to, the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) , the GAP program in the GCG program package (see Devereux et al., Nucleic Acids Research, 12(1): 387,1984), BLASTP, BLASTN, and FASTA (see Altschul, S. F. et al., J. Molec. Biol., 215, 403, 1990).

[0182] As used herein, the term “chimeric” in reference to a DNA binding protein comprising a EBNA1 DBD refers to a polypeptide comprising (i) one or more chromatin binding domains and (ii) at least one EBNA1 DBD, wherein (i) and (ii) are mutuallyheterologous in that they do not occur together in the same arrangement in a wild-type EBNA1 polypeptide. For example, in some embodiments, the polypeptide comprises (i) and (ii) in an arrangement that does not occur in a wild-type EBNA1 polypeptide. In some embodiments, the polypeptide comprises a different order, orientation, and / or spacing of (i) and (ii) as compared to domains having a substantially similar function that are present in a wild-type EBNA1 polypeptide. In some embodiments, the chimeric DNA binding protein comprises (i) one or more EBNA1 chromatin binding domains and (ii) at least one EBNA1 DBD, wherein the arrangement of (i) and (ii) are different than domains having a substantially similar function that are present in a wild-type EBNA1 polypeptide. In some embodiments, the chimeric DNA binding protein comprises (i) one or more chromatin binding domains and (ii) at least one EBNA1 DBD, wherein (i) and (ii) are mutually heterologous in that the one or more chromatin binding domains are not derived from an EBNA1 polypeptide. In some embodiments, (i) and (ii) are operably linked, optionally via a linker. In some embodiments, the chimeric DNA binding protein comprises one or more additional domains described herein, e.g., a nuclear localization signal, transactivation domain, or transcription factor binding domain.

[0183] As used herein, the term “chimeric” in reference to a DNA binding protein comprising a DBD derived from an EBNA1 homolog, or a variant thereof, wherein the EBNA1 homolog if of an NHP LCV, refers to a polypeptide comprising (i) a chromatin binding domain and (ii) the DBD , wherein (i) and (ii) are mutually heterologous in that they do not occur together in the same arrangement in the wild-type EBNA1 homolog. For example, in some embodiments, the polypeptide comprises (i) and (ii) in an arrangement that does not occur in the wild-type EBNA1 homolog. In some embodiments, the polypeptide comprises a different order, orientation, and / or spacing of (i) and (ii) as compared to domains having a substantially similar function that are present in the wild-type EBNA1 homolog. In some embodiments, the chimeric DNA binding protein comprises (i) a chromatin binding domain of the EBNA1 homolog and (ii) a DBD of the EBNA1 homolog, wherein the arrangement of (i) and (ii) are different than domains having a substantially similar function that are present in the wild-type EBNA1 homolog. In some embodiments, the chimeric DNA binding protein comprises (i) a chromatin binding domain and (ii) a DBD of an EBNA1 homolog, wherein (i) and (ii) are mutually heterologous in that the chromatin binding domain is not derived from the EBNA1 homolog. In some embodiments, (i) and (ii) are operably linked, optionally via a linker. In some embodiments, the chimeric DNA binding protein comprises one or more additional domains described herein, e.g., a nuclear localization signal, transactivation domain, or transcription factor binding domain.

[0184] As used herein, the term “heterologous” refers to a substance coming from a source other than its native source. For example, the term “heterologous chromatin binding domain” as used in reference to a chimeric DNA binding protein described herein refers to a chromatin binding domain from a source other than the source of the DBD present in the DNA binding protein. In some embodiments, wherein the DBD is derived from an EBNA1 homolog of an NHP LCV described herein, the heterologous chromatin binding domain is a chromatin binding domain from a source other than the EBNA1 homolog.

[0185] As used herein, the term “at least a portion” or “fragment” of a nucleic acid or a polypeptide refers to a portion of a reference sequence having the minimal size characteristic for the said nucleic acid or polypeptide and up to the full-length reference sequence. The term “at least a portion” or “fragment” in reference to a wild-type EBNA1 refers to a portion of full- length EBNA1 comprising the EBNA1 DBD. In some embodiments, the fragment is a truncated EBNA1 (e.g., EBNA1 truncated at the N-terminus, the C-terminus, and / or an internal site) comprising the EBNA1 DBD. The term “at least a portion” or “fragment” in reference to an EBNA1 homolog refers to a portion of full-length EBNA1 homolog comprising the DBD. In some embodiments, the fragment is a truncated EBNA1 homolog (e.g., the EBNA1 homolog truncated at the N-terminus, the C-terminus, and / or an internal site) comprising the DBD.

[0186] As used herein, the term “variant” of a nucleic acid or a polypeptide refers to a sequence variant of a reference sequence that maintains a desired biological function of the reference sequence. The term “variant” in reference to EBNA1 refers to an EBNA1 altered by nucleotide substitution, deletion, and / or insertion that maintains a biological function / activity of EBNA1. The term “variant” in reference to an EBNA1 homolog described herein refers to an EBNA1 homolog altered by nucleotide substitution, deletion, and / or insertion that maintains a biological function / activity of the wild-type EBNA1 homolog.

[0187] As used herein, the term “biological function,” used interchangeably with “functional property” in reference to a wild-type EBNA1 or EBNA1 homolog refers to a desirable characteristic when introduced to a cell as part of a system described herein (e.g., a system comprising the wild-type EBNA1 or EBNA1 homolog, or a nucleic acid or recombinant expression vector encoding said EBNA1 or EBNA1 homolog, and a transgene-encoding recombinant expression vector comprising a DNA binding polynucleotide that binds the EBNA1 or EBNA1 homolog). In some embodiments, the desirable characteristics results in enhanced expression (e.g., an increased level and / or duration of expression) of the transgene- encoding recombinant expression vector as compared to the recombinant expression vector introduced alone. In some embodiments, the functional property is selected from (i) binding toa DNA binding polynucleotide described herein; (ii) binding to chromatin; (iii) transport into the cell nucleus; (iv) tethering of a DNA binding polynucleotide to chromatin; (v) retention of the DNA binding polynucleotide in the nucleus during or following mitosis; and (vi) a combination of (i)-(v). In some embodiments, the functional property is determined according to a method further described herein. In some embodiments, the functional properties of a wild- type EBNA1 homolog result in enhanced expression (e.g., an increased level and / or duration of expression) when introduced to a cell in combination with a recombinant expression vector comprising a transgene and a DBE of an EBV or NHP LCV.

[0188] As used herein, a "plasmid," refers to a circular double stranded DNA loop into which additional DNA segments can be ligated

[0189] As used herein, the term "vector" refers to a nucleic acid sequence capable of transporting another nucleic acid to which it has been linked for expression in a host cell. Generally, the term refers to a nucleic acid suitable for cloning and expression of a nucleotide sequence. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked.

[0190] As used herein, the term “recombinant expression vector” refers to a vector comprising a transgene and one or more additional components to enable expression of the transgene when introduced to a cell. Systems of the Disclosure for Enhanced Gene Expression

[0191] In some aspects, the present disclosure provides a system for enhancing expression of a transgene in a cell or population of cells, the system comprising (i) an mRNA encoding a DNA binding protein, wherein the DNA binding protein comprises one or more chromatin binding domains and at least one EBNA1 DBD, and (ii) a recombinant expression vector comprising at least one transgene and a polynucleotide comprising one or more EBV DBEs.

[0192] In some aspects, the present disclosure provides a system for enhancing expression of a transgene, the system comprising (i) a DNA binding protein, or a nucleic acid or a recombinant expression vector encoding the DNA binding protein, wherein the DNA binding protein comprises a DBD of an EBNA1 homolog, or a variant thereof or a fragment thereof, and a chromatin binding domain, wherein the EBNA1 homolog is of an NHP LCV, and (ii) a recombinant expression vector comprising a transgene and a DNA binding polynucleotide comprising a DNA binding element (DBE) of an Epstein-Barr virus (EBV or aDBE of an NHP LCV. In some embodiments, the DNA binding protein comprises a DBD of an EBNA1 homolog, or a variant thereof or a fragment thereof, and a chromatin binding domain, wherein the EBNA1 homolog is derived from an NHP LCV.

[0193] In some embodiments, the DNA binding protein has a first targeting function mediated by the DBD. In some embodiments, the DNA binding protein has a first targeting function mediated by the at least one EBNA1 DBD. In some embodiments, the DNA binding protein has a first targeting function mediated by the DBD of an EBNA1 homolog, or a variant or a fragment thereof. In some embodiments, the first targeting function localizes and associates the DNA binding protein to the recombinant expression vector when a system described herein is introduced to a cell (e.g., a mammalian cell). In some embodiments, the recombinant expression vector comprises at least one transgene for expression in the cell and a polynucleotide comprising one or more DBEs (e.g., one or more DBEs from an EBV OriP). In some embodiments, the polynucleotide comprises an EBV DBE, or a fragment or a variant thereof. In some embodiments, the polynucleotide comprisers an NHP LCV DBE, or a fragment or a variant thereof. In some embodiments, the DBD binds to the DNA binding polynucleotide with a binding affinity sufficient to mediate association of the DNA binding protein to the recombinant expression vector under physiological conditions. In some embodiments, the DNA binding protein comprises at least one EBNA1 DBD and the DNA binding polynucleotide comprises an EBV DBE (e.g., an array of EBV DBEs). In some embodiments, the at least one EBNA1 DBD binds to the polynucleotide with a binding affinity sufficient to mediate association of the DNA binding protein to the recombinant expression vector under physiological conditions. In some embodiments, the DNA binding protein comprises at least one DBD of an EBNA1 homolog and the DNA binding polynucleotide comprises an EBV DBE (e.g., an array of EBV DBEs) or an NHP LCV DBE (e.g., an array of NHP LCV DBEs). In some embodiments, the at least one DBD of the EBNA1 homolog binds to the polynucleotide with a binding affinity sufficient to mediate association of the DNA binding protein to the recombinant expression vector under physiological conditions. In some embodiments, the DNA binding protein has a second targeting function mediated by the one or more chromatin binding domains. In some embodiments, the second targeting function localizes and associates the DNA binding protein, or a complex of the DNA binding protein and the recombinant expression vector, to chromatin, a chromatin-associated structure, the nuclear lamina, and / or the nuclear matrix in the cell. Methods to evaluate targeting a chromatin- associated structure, the nuclear lamina, and / or the nuclear matrix in a cell are known in the art and further described herein.

[0194] FIG. 1 provides a schematic illustrating exemplary functions of the DNA binding protein that result in increased expression of the at least one transgene present in the recombinant expression vector upon introducing a system described herein to a cell as compared to introducing the recombinant expression vector alone. In some embodiments, the DNA binding protein increases nuclear uptake of the recombinant expression vector when a system described herein is introduced to a cell. In some embodiments, the DNA binding protein tethers the recombinant expression vector to chromatin when a system described herein is introduced to a cell. In some embodiments, the DNA binding protein increases retention of the recombinant expression vector in the nucleus during mitosis when a system described herein is introduced to a cell.

[0195] In some embodiments, upon contacting a cell with a system of the disclosure, the portion of the recombinant expression vector comprising a polynucleotide comprising one or more DBEs (e.g., one or more DBEs of an EBV OriP) forms a complex with the DNA binding protein or a plurality of DNA binding proteins. Without being bound by theory, formation of the complex results in enhanced expression of the system due to enhanced nuclear uptake, retention in the nuclease during cell mitosis, and / or increased tethering to chromatin. DNA Binding Proteins

[0196] In some aspects, the systems described herein comprise a DNA binding protein, a nucleic acid (e.g., mRNA) encoding the DNA binding protein, or a recombinant expression vector comprising a nucleic acid encoding the DNA binding protein. In some embodiments, the DNA binding protein comprises a chromatin binding domain and an DBD. In some embodiments, the DBD comprises a DBD of EBNA1, or a variant or fragment thereof. In some embodiments, the DBD comprises a DBD of an EBNA1 homolog, or a variant or fragment thereof, wherein the EBNA1 homolog is derived from an NHP LCV described herein.

[0197] In some embodiments, the disclosure provides a DNA binding protein comprising one or more chromatin binding domains and at least one EBNA1 DBD, a nucleic acid (e.g., mRNA) encoding the DNA binding protein, or a recombinant expression vector comprising a nucleic acid encoding the DNA binding protein. In some embodiments, the disclosure provides an mRNA encoding a DNA binding protein comprising one or more chromatin binding domains and at least one EBNA1 DBD. In some embodiments, the DNA binding protein comprises a full-length or truncated EBNA1 polypeptide. In some embodiments, the EBNA1 polypeptide is a wild-type EBNA1 polypeptide. In someembodiments, the EBNA1 polypeptide is a variant EBNA1 polypeptide. In some embodiments, the variant comprises a modification (e.g., a deletion, an insertion, and / or a substitution) of a domain present in wild-type EBNA1 (e.g., a modification of the TA domain, the NLS domain, and / or the Gly-Arg repeat region). In some embodiments, the DNA binding protein comprises a chimeric polypeptide comprising one or more chromatin binding domain and a polypeptide comprising at least one EBNA1 DBD. In some embodiments, the DNA binding protein is a chimeric polypeptide comprising a chromatin binding domain (e.g., 1, 2, 3, or 4 chromatin binding domains) and an EBNA1 DBD, or a variant or a fragment thereof. In some embodiments, the one or more chromatin binding domains are derived from an EBNA1 polypeptide. In some embodiments, the one or more chromatin binding domains are not from an EBNA1 polypeptide.

[0198] In some aspects, the systems described herein comprise a DNA binding protein, or a nucleic acid or recombinant expression vector encoding the DNA binding protein, wherein the DNA binding protein comprises DBD of an EBNA1 homolog, or a variant thereof or a fragment thereof, wherein the EBNA1 homolog is derived from an NHP LCV, and a chromatin binding domain. In some embodiments, the DNA binding protein comprises one DBD. In some embodiments, the DNA binding protein comprises more than one DBD. In some embodiments, the DNA binding protein comprises one chromatin binding domain. In some embodiments, the DNA binding protein comprises more than one chromatin binding domain. In some embodiments, the DNA binding protein comprises a full-length or truncated EBNA1 homolog, wherein the EBNA1 homolog is of an NHP LCV described herein. In some embodiments, the EBNA1 homolog is a wild-type EBNA1 homolog (i.e., a native EBNA1 homolog encoded by the NHP LCV genome). In some embodiments, the EBNA1 homolog comprises a modification (e.g., a deletion, an insertion, and / or a substitution) relative to the wild-type EBNA1 homolog. In some embodiments, the DNA binding protein is a chimeric polypeptide comprising a chromatin binding domain (e.g., 1, 2, 3, or 4 chromatin binding domains) and an EBNA1 homolog DBD, or a variant or a fragment thereof. In some embodiments, the one or more chromatin binding domains are derived from an EBNA1 polypeptide. In some embodiments, the one or more chromatin binding domains are derived from an EBNA1 homolog of an NHP LCV described herein. In some embodiments, the one or more chromatin binding domains are not from an EBNA1 polypeptide or from an EBNA1 homolog. EBNA1 Proteins

[0199] In some embodiments, the disclosure provides an EBNA1 polypeptide, or a variant or a fragment thereof. In some embodiments, the disclosure provides an mRNA comprising an ORF encoding an EBNA1 polypeptide. In some embodiments, the EBNA1 polypeptide is a wild-type EBNA1 polypeptide. In some embodiments the EBNA1 polypeptide has the same length or substantially the same-length as the wild-type EBNA1 polypeptide.

[0200] In some embodiments, the EBNA1 polypeptide comprises an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 1. In some embodiments, the EBNA1 polypeptide comprises an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 1. In some embodiments, the EBNA1 polypeptide comprises SEQ ID NO: 1. In some embodiments, the EBNA1 polypeptide comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 12. In some embodiments, the EBNA1 polypeptide comprises an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 12. In some embodiments, the EBNA1 polypeptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 12.

[0201] In some embodiments, the disclosure provides an mRNA comprising an ORF encoding an EBNA1 polypeptide, wherein the ORF comprises a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 12. In some embodiments, the ORF comprises a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 12. In some embodiments, the ORF comprises SEQ ID NO: 12.

[0202] In some embodiments, the disclosure provides a functional fragment of an EBNA1 polypeptide and / or a functional variant of an EBNA1 polypeptide. In some embodiments, the disclosure provides an mRNA comprising an ORF encoding a functional fragment of an EBNA1 polypeptide or a functional variant of an EBNA1 polypeptide. The one or more functional properties of wild-type EBNA1 polypeptide are mediated by one or more domains. In some embodiments, the EBNA1 polypeptide comprises from N-terminus to C- terminus: an N-terminal domain (corresponding to amino acid residues 1 to about 39 of SEQ ID NO: 1); a Gly-Arg Repeat Region 1 (corresponding to residues about 33 to about 89 of SEQ ID NO: 1); a Gly-Ala Repeat Region 1 (corresponding to residues about 90 to about 324 ofSEQ ID NO: 1); a Gly-Arg Repeat Region 2 (corresponding to residues about 325 to about 380 of SEQ ID NO: 1) comprising a looping domain (corresponding to residues about 325 to about 376 of SEQ ID NO: 1); a DBD (corresponding to residues about 459 to about 607 of SEQ ID NO: 1); and an acidic tail C terminal region (corresponding to residues about 608 to about 641 of SEQ ID NO: 1). The EBNA1 polypeptide comprises two chromatin-binding regions (“domain A” and “domain B”), a nuclear localization signal (NLS), and a DNA binding domain. In some embodiments, domain A corresponds to residues about 33 to about 89 of SEQ ID NO: 1. In some embodiments, domain B corresponds to residues about 325 to about 378of SEQ ID NO: 1. In some embodiments, the EBNA1 NLS corresponds to residues about 379 to about 386 of SEQ ID NO: 1. In some embodiments, the EBNA1 DBD corresponds to residues about 459 to about 607 of SEQ ID NO: 1. Additionally, the EBNA1 polypeptide comprises a transactivation domain (“TA domain”). In some embodiments, the TA domain corresponds to residues about 393 to about 450 of SEQ ID NO: 1.

[0203] The TA domain has been implicated as having one or more antigens that are immunogenic in humans. In particular, EBNA1 has been shown to contain an antigen that induces generation of antibodies capable of cross-reacting with human tissues, thereby inducing autoimmune responses that contribute to the undesirable disease or condition. For example, as described in Lanz, T. V et al., 2022, Nature, Vol. 603, Issue 7900, pp. 321–327, antibodies generated against an antigen in the TA domain of EBNA1 cross-react with glial cell adhesion molecule (GlialCAM). The antigen identified corresponds to amino acid residue about 386 to about 405 of SEQ ID NO: 1. As another example, as described in Thomas, et al (2023) Sci Adv 9:eadg3032, antibodies generated against a second antigen in the TA domain of EBNA1 cross-react with alpha-crystallin B (CRYAB). The second antigen corresponds to amino acid residue about 393 to about 412. The generation of cross-reactive antibodies in subjects with an EBV infection is thought to contribute to the etiology of certain disease, such as MS (see Barr-Or, et al (2020) Trends Mol Med 26:296). Moreover, and without being bound by theory, deletion of the TA domain or portion thereof may reduce the capability of an EBNA1 polypeptide to cause chromosomal damage. As described in Li, et al (2023) Nature 616:504, it has been demonstrated that genomic instability is associated with EBNA1 binding to genomic regions comprising a repeat array of DBEs with sequence similarity to a DBE of an EBV OriP, which is mitigated for EBNA1 having a deletion of the TA domain or portion thereof.

[0204] Accordingly, in some embodiments, an mRNA of the disclosure encoding an EBNA1 polypeptide (e.g., a variant or fragment of an EBNA1 polypeptide) comprising a deletion of the TA domain or a portion thereof (e.g., a portion corresponding to amino acidresidue about 393 to about 412 of SEQ ID NO: 1, a portion corresponding to amino acid residue about 386 to about 405 of SEQ ID NO: 1, a portion corresponding to amino acid residue about 394 to about 399 of SEQ ID NO: 1, or a portion corresponding to amino acid residue about 386 to about 405) has one or more desirable properties for use in vivo, including reduced risk of inducing a deleterious immune response (e.g., an autoimmune response) and / or genomic instability.

[0205] In some embodiments, the disclosure provides an mRNA comprising an ORF encoding a functional fragment of an EBNA1 polypeptide. In some embodiments, the functional fragment comprises a truncated sequence shorter than wild-type EBNA1, wherein the truncated sequence comprises a portion of wild-type EBNA1 that retains its functional activity. In some embodiments, the truncated sequence comprises a deletion of an amino terminal region of wild-type EBNA1. In some embodiments, the truncated sequence comprises a deletion of a carboxy terminal region of wild-type EBNA1. In some embodiments, the truncated sequence comprises a deletion of an internal region of wild-type EBNA1.

[0206] In some embodiments, the truncated sequence comprises a deletion of (i) the Gly-Ala Repeat Region 1 (corresponding to residues about 90 to about 324 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 residues thereof); (ii) the NLS (corresponding to residues about 379 to about 386 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 10, 9, 8, 7, 6, or 5 residues thereof); (iii) the N-terminal domain (corresponding to amino acid residues 1 to about 39 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 residues thereof); (iv) the Gly-Arg Repeat Region 2 (corresponding to residues about 325 to about 380 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 residues thereof); (v) the C terminal region (corresponding to residues about 608 to about 641 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 residues thereof); (vi) the Gly-Arg Repeat Region 1 (corresponding to residues about 33 to about 89 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 residues thereof); or (vii) a combination of (i)-(vi).

[0207] In some embodiments, the truncated sequence comprises a deletion of (i) the Gly-Ala Repeat Region 1 (corresponding to residues about 90 to about 324 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 residues thereof); (ii) the NLS(corresponding to residues about 379 to about 386 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 10, 9, 8, 7, 6, or 5 residues thereof); (iii) the N-terminal domain (corresponding to amino acid residues 1 to about 39 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 residues thereof); (iv) the Gly-Arg Repeat Region 2 (corresponding to residues about 325 to about 380 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 residues thereof); (v) the C terminal region (corresponding to residues about 608 to about 641 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 residues thereof); (vi) the Gly-Arg Repeat Region 1 (corresponding to residues about 33 to about 89 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 residues thereof); (viii) the TA domain (corresponding to residues about 393 to about 450 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 residues thereof), or (viii) a combination of (i)-(vii). In some embodiments, the truncated sequence is about 160 to about 300, about 160 to about 350, about 160 to about 400, about 160 to about 450, about 160 to about 500, about 300 to about 400, about 300 to about 450, about 300 to about 500, or about 400 to about 500 amino acids in length. In some embodiments, the truncated sequence is about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, about 300, about 310, about 320, about 330, about 340, about 350, about 360, about 370, about 380, about 390, about 400, about 410, about 420, about 430, about 440, about 450, about 460, about 470, about 480, about 490, or about 500 amino acids in length. In some embodiments, the truncated sequence is about 160 to about 400 amino acids in length. In some embodiments, the truncated sequence is about 200 to about 400 amino acids in length.

[0208] In some embodiments, the truncated sequence comprises at least one EBNA1 chromatin-binding domain (e.g., EBNA1 domain A and / or EBNA1 domain B) or portion thereof and the EBNA1 DBD or a portion thereof, wherein the truncated sequence comprises a deletion of (i) the N-terminal domain (corresponding to amino acid residues 1 to about 39 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 residues thereof), (ii) the Gly-Ala Repeat Region 1 (corresponding to residues about 90 to about 324 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 residuesthereof), (iii) the NLS (corresponding to residues about 379 to about 386 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 10, 9, 8, 7, 6, or 5 residues thereof), (iv) the TA domain (corresponding to residues about 393 to about 450 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 residues thereof), (v) the C terminal region (corresponding to residues about 608 to about 641 of SEQ ID NO: 1) or a portion thereof (e.g., a sequence of about 30, 25, 20, 15, 10, 9, 8, 7, 6, or 5 residues thereof); or (vi) a combination of (i)-(v).

[0209] In some embodiments, the truncated sequence comprises at least one chromatin- binding domain (e.g., domain A and / or domain B) or portion thereof and the EBNA1 DBD or a portion thereof. In some embodiments, the truncated sequence comprises domain A or a portion thereof and the EBNA1 DBD or a portion thereof. In some embodiments, the truncated sequence comprises an amino acid sequence corresponding to residues about 33 to about 89 of SEQ ID NO: 1 or a portion thereof and residue 459 to about 607 of SEQ ID NO: 1 or a portion thereof. In some embodiments, the functional fragment of an EBNA1 polypeptide comprises SEQ ID NO: 14 or a portion thereof and SEQ ID NO: 18 or a portion thereof. In some embodiments, the truncated sequence comprises domain B or a portion thereof and the EBNA1 DBD or a portion thereof. In some embodiments, the truncated sequence comprises an amino acid sequence corresponding to residues about 325 to about 378 of SEQ ID NO: 1 or a portion thereof and an amino acid sequence corresponding to residue 459 to about 607 of SEQ ID NO: 1 or a portion thereof. In some embodiments, the functional fragment of an EBNA1 polypeptide comprises SEQ ID NO: 16 or a portion thereof and SEQ ID NO: 18 or a portion thereof. In some embodiments, the truncated sequence comprises domain A, domain B, and the EBNA1 DBD. In some embodiments, the truncated sequence comprises an amino acid sequence corresponding to residues about 33 to about 89 of SEQ ID NO: 1 or a portion thereof, an amino acid sequence corresponding to residues about 325 to about 378 of SEQ ID NO: 1 or a portion thereof, and an amino acid sequence corresponding to residue 459 to about 607 of SEQ ID NO: 1 or a portion thereof. In some embodiments, the functional fragment of an EBNA1 polypeptide comprises SEQ ID NO: 14 or a portion thereof, SEQ ID NO: 16 or a portion thereof, and SEQ ID NO: 18 or a portion thereof. In some embodiments, the truncated sequence comprises at least one chromatin-binding domain (e.g., domain A and / or domain B), the NLS, and the DBD. In some embodiments, the truncated sequence comprises domain A, the NLS, and the DBD. In some embodiments, the truncated sequence comprises domain B, the NLS, and the DBD. In some embodiments, the truncated sequence comprises domain A, domain B, the NLS, and the DBD.

[0210] In some embodiments, the truncated sequence comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 3. In some embodiments, the truncated sequence comprises an amino acid sequence set forth in SEQ ID NO: 3. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 24. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by SEQ ID NO: 24.

[0211] In some embodiments, the truncated sequence comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 130. In some embodiments, the truncated sequence comprises an amino acid sequence set forth in SEQ ID NO: 130. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 129. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by SEQ ID NO: SEQ ID NO: 129.

[0212] In some embodiments, the truncated sequence comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 133. In some embodiments, the truncated sequence comprises an amino acid sequence set forth in SEQ ID NO: 133. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 132. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by SEQ ID NO: SEQ ID NO: 132.

[0213] In some embodiments, the truncated sequence comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 137. In some embodiments, the truncated sequence comprises an amino acid sequence set forth in SEQ ID NO: 137. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 138. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by SEQ ID NO: SEQ ID NO: 138.

[0214] In some embodiments, the truncated sequence comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about99% identity to SEQ ID NO: 143. In some embodiments, the truncated sequence comprises an amino acid sequence set forth in SEQ ID NO: 143. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 144. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by SEQ ID NO: SEQ ID NO: 144.

[0215] In some embodiments, the truncated sequence comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 140. In some embodiments, the truncated sequence comprises an amino acid sequence set forth in SEQ ID NO: 140. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 141. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by SEQ ID NO: SEQ ID NO: 141.

[0216] In some embodiments, the truncated sequence comprises a substitution of the EBNA1 NLS or a portion thereof (e.g., an EBNA NLS having the amino acids sequence of SEQ ID NO: 7 or a portion thereof) with a heterologous EBNA1 NLS (e.g., a heterologous NLS describe herein, e.g., a c-myc NLS). In some embodiments, the truncated sequence comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 134. In some embodiments, the truncated sequence comprises an amino acid sequence set forth in SEQ ID NO: 134. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 135. In some embodiments, the truncated sequence comprises an amino acid sequence encoded by SEQ ID NO: SEQ ID NO: 135.

[0217] In some embodiments, the disclosure provides an mRNA comprising an ORF encoding a functional variant of an EBNA1 polypeptide or a portion thereof. In some embodiments, the functional variant comprises the sequence of a full-length or truncated EBNA1 polypeptide with one or more alterations. In some embodiments, the one or more alterations comprises substitution of one or more amino acid residues. In some embodiments, the functional variant comprises SEQ ID NO: 1 with one or more conservative amino acid substitutions. In some embodiments, the functional variant comprises a portion of SEQ ID NO: 1 with one or more conservative amino acid substitutions. In some embodiments, the functionalvariant comprises SEQ ID NO: 3 with one or more conservative amino acid substitutions. In some embodiments, the functional variant comprises SEQ ID NO: 130 with one or more conservative amino acid substitutions. In some embodiments, the functional variant comprises SEQ ID NO: 131 with one or more conservative amino acid substitutions. In some embodiments, the functional variant comprises SEQ ID NO: 137 with one or more conservative amino acid substitutions. In some embodiments, the functional variant comprises SEQ ID NO: 140 with one or more conservative amino acid substitutions. In some embodiments, the functional variant comprises SEQ ID NO: 143 with one or more conservative amino acid substitutions.

[0218] In some embodiments, the functional variant comprises domain A or a portion thereof and the EBNA1 DBD or a portion thereof, wherein domain A and / or the EBNA1 DBD comprise one or more alterations. In some embodiments, the functional variant comprises domain A or a portion thereof and the EBNA1 DBD or a portion thereof, wherein domain A comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 55, about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 14. In some embodiments, the functional variant comprises domain A or a portion thereof and the EBNA1 DBD or a portion thereof, wherein the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 145, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 amino acid residues present in SEQ ID NO: 18. In some embodiments, the functional variant comprises domain A or a portion thereof and the EBNA1 DBD or a portion thereof, wherein domain A comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 55, about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 14 and the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 145, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 amino acid residues present in SEQ ID NO: 18. In some embodiments, the functional variant comprises domain B or a portion thereof and the EBNA1 DBD or a portion thereof, wherein domain B and / or the EBNA1 DBD comprise one or more alterations. In some embodiments, the functional variant comprises domain B or a portion thereof and the EBNA1 DBD or a portion thereof, wherein domain B comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of atleast about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 16. In some embodiments, the functional variant comprises domain B or a portion thereof and the EBNA1 DBD or a portion thereof, wherein the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 145, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 amino acid residues present in SEQ ID NO: 18. In some embodiments, the functional variant comprises domain B or a portion thereof and the EBNA1 DBD or a portion thereof, wherein domain B comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 16 and the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 145, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 amino acid residues present in SEQ ID NO: 18.

[0219] In some embodiments, the functional variant comprises domain A or a portion thereof, domain B or a portion thereof, and the EBNA1 DBD or a portion thereof, wherein domain A, domain B and / or the EBNA1 DBD comprise one or more alterations. In some embodiments, the functional variant comprises domain A or a portion thereof, domain B or a portion thereof, and the EBNA1 DBD or a portion thereof, wherein (i) domain A comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 55, about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 15; (ii) domain B comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 16; (iii) the DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 145, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 amino acid residues present in SEQ ID NO: 18; or (iv) a combination of (i)-(iii). EBNA1 Homologs

[0220] In some embodiments, the DNA binding protein comprises a wild-type EBNA1 homolog, or a fragment thereof or a variant thereof, wherein the EBNA1 homolog is derivedfrom an NHP LCV, and wherein the DNA binding protein comprises a DBD of the wild-type EBNA1 homolog, or a fragment thereof or a variant thereof.

[0221] In some embodiments, the EBNA1 homolog is identified in a public database such as GenBank. GenBank is a genetic sequence database that provides an annotated collection of publicly available DNA sequences (see Nucleic Acids Res (2013) 41:D36). Sequence data from GenBan is retrieved by searching for sequence identifiers and annotations with Entrez nucleotide (ncbi.nlm.nih.gov / nucleotide / ), performing a search and alignment of GenBank sequences to a query sequence using BLAST (blast.ncbi.nlm.nih.gov / blast.cgi), or downloading sequences using NCBI e-utilities (ncbi.nlm.nih.gov / books / NBK25501 / ). In some embodiments, the EBNA1 homolog is identified from an NHP LCV using methods further described herein. (i) NHP LCVs

[0222] In some embodiments, the EBNA1 homolog is derived from an NHP LCV. LCVs have been identified from infections of numerous NHP species, including those in the wild and held in captivity. LCV infection, as measured by seropositivity (detection of anti- LCV antibodies in serum), is greater than about 95% in Old World monkeys and greater than about 50% in New World monkeys (see Fogg, et al (2005) J. Virol 79:10069)

[0223] In some embodiments, the NHP is a simian (i.e., one of the infraorder Simiiformes). In some such embodiments, the NHP identified by IT IS Taxonomic Serial No.: 943778 (Simiiformes). In some such embodiments, the NHP is a species selected from the group consisting of species listed in Table 1. Table 1: NHP species in the infraorder Simmiformes (IT IS Taxonomic Serial No. 943778)

[0224] In some embodiments, the NHP is of the Superfamily Hominoidea (also referred to as apes). In some embodiments, the NHP is identified by IT IS Taxonomic Serial No.: 943782. In some embodiments, the NHP is a species selected from the group consisting of species listed in Table 2. Table 2: NHP species in the Superfamily Hominoidea (IT IS Taxonomic Serial No: 943782)

[0225] In some embodiment, the NHP is of the Superfamily Cercopithecoidea (also referred to as Old World Monkeys). In some embodiments, the NHP is identified by IT IS Taxonomic Serial No.: 943783. In some embodiments, the NHP is a species selected from the group consisting of species listed in Table 3. Table 3: NHP species in the Superfamily Cercopithecoidea (IT IS Taxonomic Serial No: 943783)

[0226] In some embodiments, the NHP is of the Parvorder Platyrrhini (also referred to as New World Monkeys). In some embodiments, the NHP is selected from the group consisting of species set forth in Table 4. In some embodiments the NHP of the Parvorder Platyrrhini is of the Family Callitrichidae. In some embodiments the NHP of the Parvorder Platyrrhini is of the Family Cebidae. In some embodiments the NHP of the Parvorder Platyrrhini is of the Family Aotidae. In some embodiments the NHP of the Parvorder Platyrrhini is of the Family Pitheciidae. In some embodiments the NHP of the Parvorder Platyrrhini is of the Family Atelidae. Table 4: NHP species in the Parvorder Platyrrhini

[0227] In some embodiments, the NHP is of the Family Callitrichidae. In some embodiments, the NHP is identified by IT IS Taxonomic Serial No.: 572774. In some embodiments, the NHP is a species selected from Callimico goeldii, Callithrix aurita, Callithrix flaviceps, Callithrix geoffroyi, Callithrix jacchus, Callithrix kuhlii, Callithrix penicillata, Cebuella niveiventris, Cebuella pygmaea, Leontocebus cruzlimai, Leontocebus fuscicollis, Leontocebus fuscus, Leontocebus illigeri, Leontocebus lagonotus, Leontocebus leucogenys, Leontocebus nigricollis, Leontocebus nigrifrons, Leontocebus tripartitus, Leontocebus weddelli, Leontopithecus caissara, Leontopithecus chrysomelas, Leontopithecus chrysopygus, Leontopithecus rosalia, Mico acariensis, Mico argentatus, Mico chrysoleucos, Mico emiliae, Mico humeralifer, Mico humilis, Mico intermedius, Mico leucippe, Mico marcai, Mico mauesi, Mico melanurus, Mico munduruku, Mico nigriceps, Mico rondoni, Mico saterei, Mico schneideri, Oedipomidas geoffroyi, Oedipomidas leucopus, Oedipomidas oedipus, Saguinus bicolor, Saguinus martinsi, Saguinus midas, Saguinus niger, Saguinus ursula, Tamarinus imperator, Tamarinus inustus, Tamarinus kulina, Tamarinus labiatus, Tamarinus mystax, Tamarinus pileatus, and Tamarinus subgrisescens.

[0228] In some embodiments, the NHP is of the Family Cebidae. In some embodiments, the NHP is identified by IT IS Taxonomic Serial No.: 180093. In some embodiments, the NHP is a species selected from Cebus aequatorialis, Cebus albifrons, Cebus brunneus, Cebus capucinus, Cebus castaneus, Cebus cesarae, Cebus cuscinus, Cebus imitator, Cebus kaapori, Cebus leucocephalus, Cebus malitiosus, Cebus olivaceus, Cebus unicolor, Cebus versicolor, Cebus yuracus, Saimiri boliviensis, Saimiri cassiquiarensis, Saimiri collinsi, Saimiri macrodon, Saimiri oerstedii, Saimiri sciureus, Saimiri ustus, Saimiri vanzolinii, Sapajus apella, Sapajus cay, Sapajus cucullatus, Sapajus flavius, Sapajus libidinosus, Sapajus nigritus, Sapajus robustus, and Sapajus xanthosternos.

[0229] In some embodiments, the NHP is of the Family Aotidae. In some embodiments, the NHP is identified by IT IS Taxonomic Serial No.: 943784. In some embodiments, the NHP is a species selected from Aotus azarae, Aotus brumbacki, Aotus griseimembra, Aotus jorgehernandezi, Aotus lemurinus, Aotus miconax, Aotus nancymai, Aotus nigriceps, Aotus trivirgatus, Aotus vociferans, and Aotus zonalis.

[0230] In some embodiments, the NHP is of the Family Pitheciidae. In some embodiments, the NHP is identified by IT IS Taxonomic Serial No.: 612144. In some embodiments, the NHP is a species selected from Cacajao amuna, Cacajao ayresi, Cacajao calvus, Cacajao hosomi, Cacajao melanocephalus, Cacajao novaesi, Cacajao rubicundus, Cacajao ucayalii, Callicebus barbarabrownae, Callicebus coimbrai, Callicebus melanochir, Callicebus nigrifrons, Callicebus personatus, Cheracebus lucifer, Cheracebus lugens, Cheracebus medemi, Cheracebus regulus, Cheracebus torquatus, Chiropotes albinasus, Chiropotes chiropotes, Chiropotes israelita, Chiropotes sagulatus, Chiropotes satanas, Chiropotes utahicki, Pithecia aequatorialis, Pithecia albicans, Pithecia cazuzai, Pithecia chrysocephala, Pithecia hirsuta, Pithecia inusta, Pithecia irrorata, Pithecia isabela, Pithecia milleri, Pithecia mittermeieri, Pithecia monachus, Pithecia napensis, Pithecia pissinattii, Pithecia pithecia, Pithecia rylandsi, Pithecia vanzolinii, Plecturocebus aureipalatii, Plecturocebus baptista, Plecturocebus bernhardi, Plecturocebus brunneus, Plecturocebus caligatus, Plecturocebus caquetensis, Plecturocebus cinerascens, Plecturocebus cupreus, Plecturocebus discolor, Plecturocebus donacophilus, Plecturocebus grovesi, Plecturocebus hoffmannsi, Plecturocebus miltoni, Plecturocebus modestus, Plecturocebus moloch, Plecturocebus oenanthe, Plecturocebus olallae, Plecturocebus ornatus, Plecturocebus pallescens, Plecturocebus stephennashi, Plecturocebus toppini, Plecturocebus urubambensis, and Plecturocebus vieirai.

[0231] In some embodiments, the NHP is of the Family Atelidae. In some embodiments, the NHP is identified by IT IS Taxonomic Serial No.: 943785. In some embodiments, the NHP is a species selected from Alouatta arctoidea, Alouatta belzebul, Alouatta caraya, Alouatta discolor, Alouatta guariba, Alouatta macconnelli, Alouatta nigerrima, Alouatta palliata, Alouatta pigra, Alouatta sara, Alouatta seniculus, Alouatta ululata, Ateles belzebuth, Ateles chamek, Ateles fusciceps, Ateles geoffroyi, Ateles hybridus, Ateles marginatus, Ateles paniscus, Brachyteles arachnoides, Brachyteles hypoxanthus, Lagothrix flavicauda, and Lagothrix lagothricha.

[0232] In some embodiments, the NHP is characterized as a host of virus in the subfamily Gammaherpesvirinae. In some embodiments, the NHP is characterized as a host to a virus of the genus Lymphocryptovirus (LCV). In some embodiments, the NHP is characterized as a host to an LCV identified by the International Committee on Taxonomy of Viruses (ICTV). Exemplary LCVs identified by the ICTV include, but are not limited to, those listed in Table 5. Table 5: LCVs identified by the ICTV

[0233] In some embodiments, the NHP is characterized as a host of an LCV infection, but for which a virus obtained from the NHP has not been identified by the ICTV as belonging to the genus Lymphocryptovirus. In some embodiments, the virus obtained from the NHPshares substantial sequence homology with EBV or an NHP LCV described herein. Examples of such NHPs include, but are not limited to, Saguinus midas, Saimiri sciureus, Pithecia Pithecia, Alouatta seniculus, Hylobates leucogenys, Hylobates lar, Semnopithecus entellus, Mandrillus sphinx, Colobus guereza, Piliocolobus badius, Cercocebus aterrimus, Macaca mulatta, Macaca fascicularis, Macaca fuscata, Macaca fuscata, Macaca silenus, Macaca sylvanus, Macaca tibetana, Erythrocebus patas, Cebus albifrons, Ateles paniscus, or Callithrix penicillate (see, e.g., de Thoisy, et al (2003) J Virol 77:9009; Ehlers, et al (2003) J. Virol 77:10695).

[0234] In some embodiments, the NHP is characterized as a host of an LCV infection, wherein a portion of the LCV genomic sequence is available (see, e.g., Ehlers, et al (2010) J Gen Virol 91:630-642). Exemplary NHPs include, but are not limited to, those listed in Table 6. Table 6: LCVs from NHPs having partially assembled genomes(ii) Methods to Identify an EBNA1 Homolog from an NHP LCV

[0235] Methods to obtain an EBNA1 homolog from an NHP LCV are known in the art. In some embodiments, the method comprises obtaining a genomic sequence of an LCV of an NHP. In some embodiments, the genomic sequence is identified in a public genome database, such as GenBank.

[0236] In some embodiments, the genomic sequence is identified by sequencing an infected cell obtained from an NHP. As understood by the skilled artisan, LCVs primarily infect B lymphocytes, which provide a source material from which viral DNA is obtained. While B lymphocytes may be harvested, isolated, and used directly for untargeted NGS sequencing, the relative sequencing depth needed would result in high cost. Thus, upstreamenrichment of viral DNA is often preferred. Methods known in the art for doing so include, but are not limited to, generation of lymphoblastoid cell lines (LCLs) and isolation of LCV episomes.

[0237] An exemplary method to generate an LCL include, but are not limited to, the following. Peripheral blood is collected from an infected NHP and mononuclear cells are isolated using standard methods (e.g., density centrifugation using Ficoll-Hypaque gradients). The cells are cultured for a number of weeks using standard methods (e.g., 106cells per mL in RPMI-1640 medium for 6 weeks), to isolate a proliferative population highly enriched for LCV-transformed cells (e.g., defined as surviving and replicating under conditions in which non-transformed B lymphocytes would not substantially survive and replicate). In some embodiments, monoclonal isolation of a proliferative population is performed. In some embodiments, the method is performed as described for LCV from Gorilla (see Neubauer, et al (1979) J Virol 31:845), LCV from Chimpanzee (see Gerber et al (1976) J Virol 19:1090), and LCV from Marmoset (Deinhardt et al (1979) Primates Med 10:163).

[0238] An exemplary method to isolate an LCV episome include, but are not limited to, restriction digest of LCV DNA (e.g., LCV DNA isolated from an LCL), ligation thereof into a cosmid destination vector, and subsequent amplification. In some embodiments, the method is performed as described for inkling LCVs from Marmoset (see Rivailler et al (2002) J Virol 76:12055 and Gyu Cho et al (2001) PNAS 98:1224) and from Rhesus (see Rivailler et al (2002) J Virol 76:421).

[0239] A further exemplary method to isolate an LCV episome include those used to isolate extrachromosomal circulate DNA. In some embodiments, the method comprises isolating nuclei, harvesting DNA from the nucleic (e.g., using a plasmid midi-prep kit), digesting single-stranded DNA (e.g., using Exo VII), and removing linear double stranded DNA (e.g., using ATP-dependent DNase). In some embodiments, the method is one described in Gagne, Isolation of circular DNA from cell culture, world wide web: protocols.io / view / isolation-of-circular-dna-from-cell-culture-iwacfae; Quinn and Trevor (1997) BioTechniques 23:1044; Moller (2020) Methods Mol Biol 2119:165; Moller, et al (2016) J Vis Exp 110:54239.

[0240] In some embodiments, LCV DNA (e.g., LCV DNA harvested from an infected NHP B cell, an LCL, or an LCV episome) is sequenced using next generation sequencing (NGS) methods known in the art. For example, in some embodiments, LCV DNA is used to generate a whole genome sequencing library that is sequence by NGS (see, e.g., methods for genomic sequencing of a lymphoblastoid cell line as described in Garcia-Perez, et al (2021)Nat Comm 12:3116). In some embodiments, the LCV DNA is sequenced using a long read platform (i.e., Oxford Nanopore or PacBio HiFi). In some embodiments, a long read platform provides the benefit of resolving sequence elements present in the LCV DNA (e.g., repetitive elements such as the Gly-Arg-rich region in the EBNA1 homolog or an array of DBEs). In some embodiments, a long read platform provides the sequence for an EBNA1 homolog encoded by the LCV genome.

[0241] In some embodiments, the LCV sequencing data is assembled according to methods known in the art. In some embodiments, the raw sequencing data is converted to a standard nucleotide sequence format (e.g., FASTQ or FASTA) using a base-calling approach suitable to the sequencing platform used to generate the data. In some embodiments, the LCV sequencing data is obtained from a long-read platform (i.e., Oxford Nanopore or PacBio HiFi) and the sequence of the EBNA1 homolog is determined without genome assembly. In some embodiments, the LCV sequencing data is obtained from a long-read platform or a short-read platform, and a primary LCV genome assembly is generated. In some embodiments, the LCV genome assembly is generated using a de novo assembler program known in the art. Exemplary de novo assembler programs include, but are not limited to, Velvet (see Zerbino (2010) Curr Protoc Bioinformatics Unit 11.5). In some embodiments, the VelvetOptimiser script is used to automatically determine optimal assembly parameters for the generated raw read data. As appreciated by the ordinarily skilled artisan, identification of a DBD of an EBNA1 homolog is achieved using a fully assembled or a partially assembled LCV genome, so long as the partially assembled LCV genome comprises a coding sequence for an EBNA1 homolog or fragment thereof comprising the DBD.

[0242] In some embodiments, the EBNA1 homolog in the LCV genome is determined using an alignment method. Methods for generating sequence alignments are known in the art. In some embodiments, all open reading frames (ORFs) are identified by searching the LCV genome for all instances of ATG followed by an in-frame stop codon, with a minimum number of codons in-between (e.g., a minimum of about 200 codons). In some embodiments, the ORF nucleotide sequence is converted to a corresponding amino acid sequences. Algorithms to extract ORFs from genomic sequence data are known in the art and include, but are not limited to, orfipy (see Singh and Wurtele (2021) Bioinformatics 37:3019). In some embodiments, the ORF amino acid sequences obtained from the LCV genome are then aligned to wild-type EBNA1 using an alignment tool, e.g., protein BLAST. Performing a sequence alignment is within the skill of the ordinary artisan using, e.g., resources publicly available via the world wide web: blast.ncbi.nlm.nih.gov.

[0243] In some embodiments, the sequence alignment requires a full-length protein. As appreciated by one of ordinary skill in the art, a challenge in assembling EBNA1 homologs is the presence of sequence elements homologous to the Gly-Arg-rich region of wild-type EBNA1, which in some cases precludes simple full-length EBNA1 alignment from NGS data. To surmount this challenge, TBLASTN is used. TBLASTN is a mode of BLAST that aligns a protein sequence query to a nucleotide reference sequence, wherein the nucleotide reference sequence is translated in all six frames and the regions of the genome nucleotide sequence are returned that have similarity to the DBD query. The returned genomic nucleotide sequences are curated by extending the codon sequence in both orientations until a full or partial ORF is identified. In some embodiments, the protein sequence query is EBNA1 or a portion thereof (e.g., a DBD thereof). In some embodiments, the protein sequence query is an EBNA1 homolog or portion thereof (e.g., a DBD thereof). In some embodiments, the nucleotide reference sequence is an LCV genome, e.g., an LCV genome assembled according to a method described herein. In some embodiments, a partial ORF identified in the LCV genome is sufficient to determine the sequence of an EBNA1 homolog DBD encoded therein. In some embodiments, a partial ORF is extended by generating primers to extend into and amplify the unknown sequence of the LCV genome using a known sequencing method (e.g., Sanger sequencing or long-read sequencing). (iii) Exemplary EBNA1 Homologs

[0244] In some embodiments, the EBNA1 homolog is derived from an LCV infecting an NHP of the infraorder Simiiformes. In some embodiments, the EBNA1 homolog is derived from an LCV infecting an NHP of the family Hominoidea. In some embodiments, the EBNA1 homolog is derived from an LCV infecting an NHP of the family Cercopithecoidea. In some embodiments, the EBNA1 homolog is derived from an LCV identified in Table 5. In some embodiments, the EBNA1 homolog is derived from an LCV identified in Table 6. In some embodiments, the EBNA1 homolog is derived from an LCV infecting an NHP of the parvorder Platyrrhini. family Callitrichidae. In some embodiments the NHP of the Parvorder Platyrrhini is of the Family Cebidae. In some embodiments the NHP of the Parvorder Platyrrhini is of the Family Aotidae. In some embodiments the NHP of the Parvorder Platyrrhini is of the Family Pitheciidae. In some embodiments the NHP of the Parvorder Platyrrhini is of the Family Atelidae.

[0245] In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% similarity to a wild-type EBNA1 (e.g., a wild-type EBNA1 polypeptide as set forth in SEQ ID NO: 1). In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50%, about 60%, about 70%, about 80%, about 90% or about 95% similarity to a wild-type EBNA1 (e.g., a wild-type EBNA1 polypeptide as set forth in SEQ ID NO: 1). In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% to about 70% similarity to a wild-type EBNA1 (e.g., a wild-type EBNA1 polypeptide as set forth in SEQ ID NO: 1). In some embodiments, the EBNA1 homolog comprises a sequence having at least about 55% to about 65% similarity to a wild-type EBNA1 (e.g., a wild-type EBNA1 polypeptide as set forth in SEQ ID NO: 1).

[0246] In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% identity to a wild-type EBNA1 (e.g., a wild-type EBNA1 polypeptide as set forth in SEQ ID NO: 1). In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50%, about 60%, about 70%, about 80%, about 90% or about 95% identity to a wild-type EBNA1 (e.g., a wild-type EBNA1 polypeptide as set forth in SEQ ID NO: 1). In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% to about 70% identity to a wild-type EBNA1 (e.g., a wild-type EBNA1 polypeptide as set forth in SEQ ID NO: 1). In some embodiments, the EBNA1 homolog comprises a sequence having at least about 55% to about 65% identity to a wild-type EBNA1 (e.g., a wild-type EBNA1 polypeptide as set forth in SEQ ID NO: 1).

[0247] In some embodiments, the EBNA1 homolog comprises a sequence lacking a T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a DBD, wherein the DBD comprises a sequence lacking a T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence having no more than one T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a DBD, wherein the DBD comprises a sequence having no more than one T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence having no more than two T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a DBD, wherein the DBD comprises a sequence having no more than two T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence element having sequence homology to a T cell epitope present in EBNA1, wherein the sequence element comprises at least 1, 2, 3, 4, or 5 mismatches relative to the T cell epitope. In some embodiments, a T cell epitope present in EBNA (e.g., a T cell epitope present in theEBNA1 DBD) is set forth in Table 26. In some embodiments, the T cell epitope present in EBNA1 is selected from SEQ ID NOs: 221, 227, 233, 239, 246, 252, 258, 264, 270, and 276.

[0248] In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% similarity to EBNA1, wherein the sequence lacks a T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% identity to EBNA1, wherein the sequence lacks a T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% similarity to EBNA1, wherein the sequence comprises no more than one T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% identity to EBNA1, wherein the sequence comprises no more than one T cell epitope present in EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% similarity to EBNA1, wherein the sequence comprises no more than two T cell epitopes present in EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence having at least about 50% identity to EBNA1, wherein the sequence comprises no more than two T cell epitopes present in EBNA1. In some embodiments, the EBNA1 homolog comprises a DBD, wherein the DBD comprises a sequence having at least about 50% similarity to an EBNA1 DBD described herein, wherein the sequence lacks a T cell epitope present in the EBNA1 DBD. In some embodiments, the EBNA1 homolog comprises a DBD, wherein the DBD comprises a sequence having at least about 50% identity to an EBNA1 DBD described herein, wherein the sequence lacks a T cell epitope present in the EBNA1 DBD. In some embodiments, the EBNA1 homolog comprises a DBD, wherein the DBD comprises a sequence having at least about 50% similarity to an EBNA1 DBD described herein, wherein the sequence comprises no more than one T cell epitope present in the EBNA1 DBD. In some embodiments, the EBNA1 homolog comprises a DBD, wherein the DBD comprises a sequence having at least about 50% identity to an EBNA1 DBD described herein, wherein the sequence comprises no more than one T cell epitope present in the EBNA1 DBD. In some embodiments, the EBNA1 homolog comprises a DBD, wherein the DBD comprises a sequence having at least about 50% similarity to an EBNA1 DBD described herein, wherein the sequence comprises no more than two T cell epitope present in the EBNA1 DBD. In some embodiments, the EBNA1 homolog comprises a DBD, wherein the DBD comprises a sequence having at least about 50% identity to an EBNA1 DBD described herein, wherein the sequence comprises no more than two T cell epitope present in the EBNA1 DBD.

[0249] In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at leastabout 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 282. In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 282. In some embodiments, the EBNA1 homolog comprises SEQ ID NO: 282. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 320. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 320. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 320. In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 283. In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 283. In some embodiments, the EBNA1 homolog comprises SEQ ID NO: 283. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 321. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 321. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 321.

[0250] In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 194. In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 194. In some embodiments, the EBNA1 homolog comprises SEQ ID NO: 194. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 205. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by anucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 205. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 205.

[0251] In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 195. In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 195. In some embodiments, the EBNA1 homolog comprises SEQ ID NO: 195. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 207. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 207. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 207.

[0252] In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 196. In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 196. In some embodiments, the EBNA1 homolog comprises SEQ ID NO: 196. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 209. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 209. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 209.

[0253] In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 197. In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity toSEQ ID NO: 197. In some embodiments, the EBNA1 homolog comprises SEQ ID NO: 197. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 211. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 211. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 211.

[0254] In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 311. In some embodiments, the EBNA1 homolog comprises an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 311. In some embodiments, the EBNA1 homolog comprises SEQ ID NO: 311. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 313. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 313. In some embodiments, the EBNA1 homolog comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 313. (iv) DNA Binding Domain of an EBNA1 Homolog

[0255] In some embodiments, the DNA binding protein comprises a DBD of an EBNA1 homolog described herein, or a variant thereof or a fragment thereof.

[0256] In some embodiments, the DBD comprises a sequence represented by the formula N′-[Xaa1]w-[A]-[Xaa2]x-[B]-[Xaa3]y-[C]-[Xaa4]z-C′, wherein Xaa1, Xaa2, Xaa3, and Xaa4 are any amino acid, wherein w, x, y, and z are integers referring to the number of amino acid residues, wherein w = 40-70, wherein x = 0-15, wherein y = 0-15, wherein z = 30-60, wherein [A], [B], and [C] are respectively a first, second, and third sequence motifs. In some embodiments, the first, second, and third sequence motifs correspond to regions of the EBNA1 homolog having substantial sequence similarity to regions in wild-type EBNA1. In some embodiments, w = 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, or 58, 59, 60. In some embodiments,x = 6, 7, 8, 9, or 10. In some embodiments, y = 4, 5, 6, 7, or 8. In some embodiments, z = 48, 49, 50, 51, 52, or 53.

[0257] In some embodiments, the first sequence motif is at least about 5, 6, 7, 8, 9, 10, 11, or 12 amino acid residues in length. In some embodiments, the first sequence motif if about 10 amino acid residues in length. In some embodiments, the first sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 514 to 523 of wild-type EBNA1 (e.g., amino acid residues 514 to 523 of SEQ ID NO: 1). In some embodiments, the first sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 514 to 523 of wild-type EBNA1 (e.g., amino acid residues 514 to 523 of SEQ ID NO: 1). In some embodiments, the first sequence motif comprises or consists of amino acid residues 514 to 523 of SEQ ID NO: 1).

[0258] In some embodiments, the first sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 514 to 523 as defined in a consensus sequence set forth in Table 7. In some embodiments, the first sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 514 to 523 as defined in a consensus sequence set forth in Table 7. In some embodiments, the first sequence motif comprises or consists of amino acid residues 514 to 523 as defined in a consensus sequence set forth in Table 7.

[0259] In some embodiments, the first sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to KX48X49X50YX51LRRX52(SEQ ID NO: 357), X48, X49, X50, X51, and X52 are defined as in consensus 1 set forth in Table 7. In some embodiments, the first sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to KX48X49X50YX51LRRX52(SEQ ID NO: 284), X48, X49, X50, X51, and X52are defined as in consensus 2 set forth in Table 7. In some embodiments, the first sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to KX48X49X50YX51LRRX52 (SEQ ID NO: 357), X48, X49, X50, X51, and X52are defined as in consensus 1 set forth in Table 7. In some embodiments, the first sequence motif comprises or consists of a sequence having at least about60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to KX48X49X50YX51LRRX52(SEQ ID NO: 284), X48, X49, X50, X51, and X52are defined as in consensus 2 set forth in Table 7. In some embodiments, the first sequence motif comprises or consists of KX48X49X50YX51LRRX52(SEQ ID NO: 357), wherein X48, X49, X50, X51, and X52 are defined as in consensus 1 set forth in Table 7. In some embodiments, the first sequence motif comprises or consists of KX48X49X50YX51LRRX52(SEQ ID NO: 284), wherein X48, X49, X50, X51, and X52 are defined as in consensus 2 set forth in Table 7. In some embodiments, X48 is T, I, N, or W; X49is C, S, P; X50is V, L, C, or I; X51is N or S; and X52is C,G, or A. In some embodiments, X48 is T, I, or N; X49 is S, C, or P; X50 is L, C, I, or V; Y is Y; X51 is N; and X52 is G or C.

[0260] In some embodiments, the first sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293). In some embodiments, the first sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293). In some embodiments, the first sequence motif comprises or consists of a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293).

[0261] In some embodiments, the second sequence motif is at least about 5, 6, 7, 8, 9, 10, 11, or 12 amino acid residues in length. In some embodiments, the second sequence motif if about 10 amino acid residues in length. In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 532 to 541 of wild-type EBNA1 (e.g., amino acid residues 532 to 541 of SEQ ID NO: 1). In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about99% identity to amino acid residues 532 to 541 of wild-type EBNA1 (e.g., amino acid residues 532 to 541 of SEQ ID NO: 1). In some embodiments, the second sequence motif comprises or consists of amino acid residues 532 to 541 of SEQ ID NO: 1).

[0262] In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 532 to 541 of a consensus sequence listed in Table 7. In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 532 to 541 of a consensus sequence listed in Table 7. In some embodiments, the second sequence motif comprises or consists of amino acid residues 532 to 541 of a consensus sequence listed in Table 7.

[0263] In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to RX61X62X63LX64RLPX65(SEQ ID NO: 358), wherein X61; X62; X63; X64; and X65are as in consensus 1 as set forth in Table 7. In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to RX61X62X63LX64RLPX65(SEQ ID NO: 285), wherein X61; X62; X63; X64; and X65are as in consensus 2 as set forth in Table 7. In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to RX61X62X63LX64RLPX65(SEQ ID NO: 358), wherein X61; X62; X63; X64; and X65are as in consensus 1 as set forth in Table 7. In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to RX61X62X63LX64RLPX65(SEQ ID NO: 285), wherein X61; X62; X63; X64; and X65are as in consensus 2 as set forth in Table 7. In some embodiments, the second sequence motif comprises or consists of RX61X62X63LX64RLPX65(SEQ ID NO: 358), wherein X61; X62; X63; X64; and X65are as in consensus 1 as set forth in Table 7. In some embodiments, the second sequence motif comprises or consists of RX61X62X63LX64RLPX65(SEQ ID NO: 285), wherein X61; X62; X63; X64; and X65are as in consensus 2 as set forth in Table 7. In some embodiments, X61is A, L, S, or I; X62is T or S; X63is P or T; X64is G, S, or F; and X65is Y or F. In some embodiments, X61is L, A, or S; X62is T; X63is P, or T; X64is S, or G; and X65is F, or Y; G is G.

[0264] In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), and RISPLFRLPY (SEQ ID NO: 300). In some embodiments, the second sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), and RISPLFRLPY (SEQ ID NO: 300). In some embodiments, the second sequence motif comprises or consists of a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), and RISPLFRLPY (SEQ ID NO: 300).

[0265] In some embodiments, the third sequence motif is at least about 5, 6, 7, 8, 9, 10, 11, or 12 amino acid residues in length. In some embodiments, the third sequence motif if about 10 amino acid residues in length. In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 548 to 557 of wild-type EBNA1 (e.g., amino acid residues 548 to 557 of SEQ ID NO: 1). In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 548 to 557 of wild-type EBNA1 (e.g., amino acid residues 532 to 541 of SEQ ID NO: 1). In some embodiments, the third sequence motif comprises or consists of amino acid residues 548 to 557 of SEQ ID NO: 1).

[0266] In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 548 to 557 of a consensus sequence listed in Table 7. In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 548 to 557 of a consensus sequence listed in Table 7. In some embodiments, the third sequence motifcomprises or consists of amino acid residues 548 to 557 of a consensus sequence listed in Table 7.

[0267] In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to GPX71PX72PX73X74ES (SEQ ID NO: 359), wherein X71; X72; X73; and X74are defined as in consensus 1 set forth in Table 7. In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71; X72; X73; and X74are defined as in consensus 2 set forth in Table 7. In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to GPX71PX72PX73X74ES (SEQ ID NO: 359), wherein X71; X72; X73; and X74are defined as in consensus 1 set forth in Table 7. In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71; X72; X73; and X74are defined as in consensus 2 set forth in Table 7. In some embodiments, the third sequence motif comprises or consists of GPX71PX72PX73X74ES (SEQ ID NO: 359), wherein X71; X72; X73; and X74are defined as in consensus 1 set forth in Table 7. In some embodiments, the third sequence motif comprises or consists of GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71; X72; X73; and X74are defined as in consensus 2 set forth in Table 7. In some embodiments, X71is Q or E; X72is G or T; X73is L, M, or I; and X74is R, K, M, or L. In some embodiments, X71is Q, or E; X72is G, or T; X73is L, or M; and X74is R, K, or M.

[0268] In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to a sequence selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES (SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304), and GPQPGPILES (SEQ ID NO: 305). In some embodiments, the third sequence motif comprises or consists of a sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a sequence selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES (SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304), and GPQPGPILES (SEQ ID NO: 305). In some embodiments, the third sequence motif comprises or consists a selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES(SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304), and GPQPGPILES (SEQ ID NO: 305).

[0269] In some embodiments, w = 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, or 58, 59, 60. In some embodiments, x = 6, 7, 8, 9, or 10. In some embodiments, y = 4, 5, 6, 7, or 8. In some embodiments, z = 48, 49, 50, 51, 52, or 53.

[0270] In some embodiments, [Xaa1]wcomprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 459 to 513 of wild-type EBNA1 (e.g., amino acid residues 459 to 513 of SEQ ID NO: 1). In some embodiments, [Xaa1]w comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 459 to 513 of wild-type EBNA1 (e.g., amino acid residues 459 to 513 of SEQ ID NO: 1). In some embodiments, [Xaa1]w comprises or consist of amino acid residues 459 to 513 of wild-type EBNA1 (e.g., amino acid residues 459 to 513 of SEQ ID NO: 1).

[0271] In some embodiments, [Xaa1]w comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 459 to 513 of a consensus sequence listed in Table 7. In some embodiments, [Xaa1]w comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 459 to 513 of a consensus sequence listed in Table 7. In some embodiments, [Xaa1]wcomprises or consist of amino acid residues 459 to 513 of a consensus sequence listed in Table 7.

[0272] In some embodiments, [Xaa1]wcomprises or consists of X1X2X3GGX4X5X6X7X8RGX9X10X11X12X13X14X15KX16X17X18X19X20X21X22X23X24X25LLX26RX27X28X29X30X31X32TX33X34X35X36X37WX38X39X40X41X42X43X44X45X46X47(SEQ ID NO: 360), wherein X1; X2; X3; X4; X5; X6; X7; X8; X9; X10; X11; X12; X13; X14; X15; X16; X17; X18; X19; X20; X21; X22; X23; X24; X25; X26; X27; X28; X29; X30; X31; X32; X33; X34; X35; X36; X37; X38; X39 X40; X41; X42; X43; X44; X45; X46; and X47 are defined as in consensus 1 set forth in Table 7. In some embodiments, [Xaa1]wcomprises or consists of SEQ ID NO: 306, wherein X1; X2; X3; X4; X5; X6; X7 ; X8; X9; X10; X11; X12; X13; X14; X15; X16; X17; X18; X19; X20; X21; X22; X23; X24; X25; X26; X27; X28; X29; X30; X31; X32; X33; X34; X35; X36; X37; X38; X39X40; X41; X42; X43; X44; X45; X46; and X47 are defined as in consensus 2 set forth in Table 7. In some embodiments, X1is R, G, P, or K; X2is K or P; X3is K or R; X4is W, V, or -; X5is F or -; X6is G, -, or Y; X7is K, -, R, or V; X8 is H, -, R, or G; X9 is Q, E, or C; X10 is G or P; X11 is G, A, or R; X12 is S, K,R, Y, A, or G; X13 is -, C, or G; X14 is N, H, F, or S; X15 is P, G, K, or -; X16 is F or Y; X17 is E, T, D, or Q; X18is N, T, K, G, or S; X19is I, T, M, or L; X20is A or G; X21is E, K, Q, N, or D; X22 is G, N, or S; X23 is L, F, or I; X24 is R, T, K, or S; X25 is A, V, or K; X26 is A, N, D, S, or R; X27is - or K; X28is S, R, C, K, or P; X29is H, Q, D, or E; X30is V, S, A, or I; X31is E, P, or Q; X32 is R or T; X33 is T, S, or N; X34 is D, N, T, P, or E; X35 is E or T; X36 is G or A; X37 is T, R, N, D, G, S. or E; X38is V, M, P, K, G, or C; X39is A, N, F, Y, or C; X40is G or A; X41is V or L; X42 is F, M, L, or I; X43 is V, A, or I; X44 is Y or V; X45 is G or N; X46 is G, L, P, or Y; X47 is S, -, or C; and “-” is a deletion. In some embodiments, X1is R, G, K, or P; X2is K, or P; X3is R, or K; X4 is W, or -; X5 is F; X6 is G, or Y; X7 is R, K, or V; X8 is G, R, or H; X9 is Q, C, or E; X10is G; X11is G, or R; X12is S, A, R, Y, or G; X13is G, or -; X14is N, S, or F; X15is P, K, or -; X16 is F, or Y; X17 is E, D, or Q; X18 is N, T, G, S, or K; X19 is I, M, or L; X20 is A, or G; X21is E, D, N, K, or Q; X22is G, N, or S; X23is L, F, or I; X24is R, S, K, or T; X25is A, K, or V; X26 is A, D, R, or S; X27 is -, or K; X28 is S, P, K, or C; X29 is H, D, Q, or E; X30 is V, I, or A; X31is E, P, or Q; X32is R, or T; X33is T, or N; X34is D, E, or P; X35is E, or T; X36is G, or A; X37 is T, S, G, N, E, or D; X38 is V, G, K, P, or C; X39 is A, C, F, or Y; X40 is G, or A; X41 is V, or L; X42 is F, I, L, or M; X43 is V, or I; X44 is Y; X45 is G; X46 is G, P, or Y; X47 is S, C, or -; and “-” is a deletion.

[0273] In some embodiments, [Xaa2]x comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 524 to 531 of wild-type EBNA1 (e.g., amino acid residues 524 to 531 of SEQ ID NO: 1). In some embodiments, [Xaa2]xcomprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 524 to 531 of wild-type EBNA1 (e.g., amino acid residues 524 to 531 of SEQ ID NO: 1). In some embodiments, [Xaa2]xcomprises or consist of amino acid residues 524 to 531 of wild-type EBNA1 (e.g., amino acid residues 524 to 531 of SEQ ID NO: 1).

[0274] In some embodiments, [Xaa2]xcomprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 524 to 531 of a consensus sequence listed in Table 7. In some embodiments, [Xaa2]x comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 524 to 531 of a consensus sequence listed in Table 7. In some embodiments, [Xaa2]xcomprises or consist of amino acid residues 524 to 531 of a consensus sequence listed in Table 7.

[0275] In some embodiments, [Xaa2]x comprises or consists of X53X54X55X56X57X58X59X60(SEQ ID NO: 361), wherein X53; X54; X55; X56; X57; X58; X59; and X60 are defined in consensus 1 as set forth in Table 7. In some embodiments, [Xaa2]x comprises or consists of X53X54X55X56X57X58X59X60(SEQ ID NO: 307), wherein X53; X54; X55; X56; X57; X58; X59; and X60 are defined in consensus 2 as set forth in Table 7. In some embodiments, X53 is T, L, I, or M; X54is A, G, or S; X55is L, C, V, or I; X56is A or C; X57is I, A, V, or C; X58is P or N; X59 is Q, E, W, or G; and X60 is C, V, or G.

[0276] In some embodiments, [Xaa3]ycomprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 542 to 547 of wild-type EBNA1 (e.g., amino acid residues 542 to 547 of SEQ ID NO: 1). In some embodiments, [Xaa3]y comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 542 to 547 of wild-type EBNA1 (e.g., amino acid residues 542 to 547 of SEQ ID NO: 1). In some embodiments, [Xaa3]y comprises or consist of amino acid residues 542 to 547 of wild-type EBNA1 (e.g., amino acid residues 542 to 547 of SEQ ID NO: 1).

[0277] In some embodiments, [Xaa3]y comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 542 to 547 of a consensus sequence listed in Table 7. In some embodiments, [Xaa3]y comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 542 to 547 of a consensus sequence listed in Table 7. In some embodiments, [Xaa3]ycomprises or consist of amino acid residues 542 to 547 of a consensus sequence listed in Table 7.

[0278] In some embodiments, [Xaa3]ycomprises or consists of GX66X67X68X69X70(SEQ ID NO: 362), wherein X66; X67; X68; X69; and X70 are defined in consensus 1 as set forth in Table 7. In some embodiments, [Xaa3]ycomprises or consists of GX66X67X68X69X70(SEQ ID NO: 308), wherein X66; X67; X68; X69; and X70 are defined in consensus 2 as set forth in Table 7. In some embodiments, X66is M, S, Y, H, I, or T; X67is A, S, or T; X68is P, F, or W; X69 is G or E; and X70 is P, T, A, or G. In some embodiments, X66 is M, I, Y, T, or H; X67 is A, T, or S; X68is P, or W; X69is G, or E; and X70is P, G, A, or T.

[0279] In some embodiments, [Xaa4]z comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 558 to 607 of wild-type EBNA1 (e.g.,amino acid residues 558 to 607 of SEQ ID NO: 1). In some embodiments, [Xaa4]z comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 558 to 607 of wild-type EBNA1 (e.g., amino acid residues 558 to 607 of SEQ ID NO: 1). In some embodiments, [Xaa4]z comprises or consist of amino acid residues 558 to 607 of wild-type EBNA1 (e.g., amino acid residues 558 to 607 of SEQ ID NO: 1).

[0280] In some embodiments, [Xaa4]z comprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% similarity to amino acid residues 558 to 607 of a consensus sequence listed in Table 7. In some embodiments, [Xaa4]zcomprises or consist of an amino acid sequence having at least about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to amino acid residues 558 to 607 of a consensus sequence listed in Table 7. In some embodiments, [Xaa4]z comprises or consist of amino acid residues 558 to 607 of a consensus sequence listed in Table 7.

[0281] In some embodiments, [Xaa4]z comprises or consists of X75X76X77X78FX79X80FX81X82X83X84X85X86X87X88X89X90X91X92X93X94X95X96X97X98X99X100 X101PX102PX103X104X105X106X107VX108X109X110X111FX112X113X114X115X116X117LP (SEQ ID NO: 363), wherein X75; X76; X77; X78; X79; X80; X81; X82; X83; X84; X85; X86 ; X87; X88; X89; X90; X91; X92; X93;X94; X95; X96; X97; X98; X99; X100; X101; X102; X103; X104; X105; X106; X107; X108; X109; X110; X111; X112; X113; X114; X115 X116; and X117 are defined in consensus 1 as set forth in Table 7. In some embodiments, [Xaa4]zcomprises or consists of SEQ ID NO: 309, wherein X75; X76; X77; X78; X79; X80; X81; X82; X83; X84; X85; X86 ; X87; X88; X89; X90; X91 ; X92 ; X93;X94; X95; X96; X97; X98; X99; X100; X101; X102; X103; X104; X105; X106; X107; X108; X109; X110; X111; X112; X113; X114; X115 X116; and X117 are defined in consensus 2 as set forth in Table 7. In some embodiments, X75is I, S, T, C, or G; X76is V, T, D, E, or W; X77is C, W, or S; X78is Y or G; X79 is M, L, or I; X80 is V, F, or Y; X81 is L, T, or V; X82 is Q, P, or N; X83 is T, S, or C; X84is H, S, M, G, P, or W; X85is I, L, Q, E, or P; X86is F or S; X87is A or G; X88is E, D, or L; X89 is V, D, C, or W; X90 is L, I, or V; X91 is K or A; X92 is D or Q; X93 is A or C; X94 is I, L, or V; X95is K, R, V, G, or L; X96is D or V; X97is L or Y; X98is V, C, I, or L; X99is M, T, S, or A; X100 is T, A, or H; X101 is K, H, or R; X102 is A, G, L, Q, or P; X103 is T or A; X104 is C, R, S, or G; X105is N, S, or D; X106is I, T, V, or M; X107is R, Q, or K; X108is T, V, or S; X109is V, L, F, or T; X110 is C, M, or I; X111 is S, N, T, E, or R; X112 is D, E, T, or N; X113 is D, G, or P; X114 is G, S, or P; X115is - or G; X116is V, I, or L; X117is D, P, M, E, or H, and “-” is a deletion. In some embodiments, X75 is I, G, S, T, or C; X76 is V, W, D, or E; X77 is C, or S; X78 is Y; X79is M, L, or I; X80 is V, Y, or F; X81 is L, or V; X82 is Q, N, or P; X83 is T, S, or C; X84 is H, W, P, M, H, or G; X85is I, P, E, L, or Q; X86is F, or S; X87is A, or G; X88is E, or L; X89is V, W, or C; X90 is L, or V; X91 is K; X92 is D, or Q; X93 is A, or C; X94 is I, or V; X95 is K, L, G, or R; X96is D, or V; X97is L, or Y; X98is V, I, or L; X99is M, S, or A; X100is T, H, or A; X101is K, or R; X102 is A, P, or Q; X103 is T, or A; X104 is C, G, or S; X105 is N, S, or D; X106 is I, M, V, or T; X107is R, K, or Q; X108is T, or S; X109is V, T, L, or F; X110is C, or I; X111is S, R, E, or T; X112 is D, N, T, or E; X113 is D, G, or P; X114 is G, P, or S; X115 is -; X116 is V, I, or L; X117is D, H, E, or M; and “-” is a deletion.

[0282] In some embodiments, the DBD comprises or consists of a sequence as defined in consensus 1 set forth in Table 7. In some embodiments, the DBD comprises or consists of a sequence as defined in consensus 2 set forth in Table 7. In some embodiments, the DBD comprises or consists of SEQ ID NO: 310. In some embodiments, the DBD comprises or consists of SEQ ID NO: 364.

[0283] In some embodiments, the DBD comprises or consists of a sequence having at least about 50% identity to a wild-type EBNA1 DBD. In some embodiments, the EBNA1 comprises a sequence comprising at least about 50%, about 60%, about 70%, about 80%, about 90% or about 95% identity to a wild-type EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence comprising at least about 50% to about 70% identity to a wild-type EBNA1. In some embodiments, the EBNA1 homolog comprises a sequence comprising at least about 55% to about 65% identity to a wild-type EBNA1.

[0284] In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 215. In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 215. In some embodiments, the DBD comprises or consists of SEQ ID NO: 215. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 349. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 349. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 349.

[0285] In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 216. In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 216. In some embodiments, the DBD comprises or consists of SEQ ID NO: 216. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 350. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 350. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 350.

[0286] In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 217. In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 217. In some embodiments, the DBD comprises or consists of SEQ ID NO: 217. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 351. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 351. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 351.

[0287] In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 218. In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 218. In some embodiments, the DBD comprises or consists ofSEQ ID NO: 218. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 352. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 352. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 352.

[0288] In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 219. In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 219. In some embodiments, the DBD comprises or consists of SEQ ID NO: 219. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 353. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 353. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 353.

[0289] In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 220. In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 220. In some embodiments, the DBD comprises or consists of SEQ ID NO: 220. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 354. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 354. In some embodiments, the DBDcomprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 354.

[0290] In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to SEQ ID NO: 322. In some embodiments, the DBD comprises or consists of an amino acid sequence having at least about 90%, about 95%, about 98%, about 99% identity to SEQ ID NO: 322. In some embodiments, the DBD comprises or consists of SEQ ID NO: 322. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 323. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by a nucleotide sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 323. In some embodiments, the DBD comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 323.

[0291] In some embodiments, the DBD is at least about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, or about 200 amino acid residues in length. In some embodiments, the DBD is about 120 to about 180 amino acid residues in length. In some embodiments, the DBD is about 130 to about 160 amino acid residues in length. In some embodiments, the DBD is about 140 to about 160 amino acid residues in length. Table 7: Consensus sequence for EBNA1 and Exemplary EBNA1 HomologsChimeric DNA Binding Proteins

[0292] In some embodiments, the disclosure provides a chimeric DNA binding protein comprising one or more chromatin binding domains and at least one EBNA1 DBD, or a variant or a fragment thereof. In some embodiments, the disclosure provides an mRNA comprising an ORF encoding a chimeric DNA binding protein comprising one or more chromatin binding domains and at least one EBNA1 DBD. In some embodiments, the disclosure provides an mRNA comprising an ORF encoding a DNA binding protein comprising one or more chromatin-binding domains operably linked to at least one EBNA1 DBD.

[0293] In some embodiments, the DNA binding protein is chimeric, wherein the DNA binding protein comprises a DBD of an EBNA1 homolog described herein, or a variant or a fragment thereof, and a chromatin binding domain. In some embodiments, the DNA binding protein comprises the DBD and a chromatin binding domain derived from the EBNA1 homolog, wherein the DBD and the chromatin binding domain are arranged in a different order, orientation, and / or spacing as compared to domains comprising a substantially similar function and / or sequence present in the EBNA1 homolog. In some embodiments, the DNA binding protein comprises a DBD of an EBNA1 homolog, or a variant or a fragment thereof, and a chromatin binding domain, wherein the DBD and the chromatin binding domain are mutually heterologous (i.e., do not occur together in the wild-type EBNA1 homolog). In some embodiments, the chromatin binding domain is operably linked to the DBD.

[0294] In some embodiments, the DNA binding protein is 100 to 500 residues, 100 to 600 residues, 100 to 700 residues, 100 to 800 residues, 100 to 900 residues, 100 to 1,000 residues, 200 to 500 residues, 200 to 600 residues, 200 to 700 residues, 200 to 800 residues, 200 to 900 residues, 200 to 1,000 residues, 300 to 500 residues, 300 to 600 residues, 300 to 700 residues, 300 to 800 residues, 300 to 900 residues, or 300 to 1,000 residues in length.

[0295] In some embodiments, the DNA binding protein comprises one or more chromatin binding domains described herein operably linked to a polypeptide comprising an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 8, wherein the DNA binding protein is at least about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, or about 200 amino acid residues in length. In some embodiments, the DNA binding protein comprises one or more chromatin binding domains described herein operably linked to a polypeptide comprising SEQ ID NO: 8, wherein the DNA binding protein is at least about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180,about 190, or about 200 amino acid residues in length. In some embodiments, the one or more chromatin binding domain is selected from EBNA1 domain A or a portion thereof, EBNA domain B or a portion thereof. In some embodiments, the DNA binding protein comprises one or more heterologous chromatin binding domains described herein.

[0296] In some embodiments, the DNA binding protein comprises a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) described herein operably linked to a DBD of an EBNA1 homolog described herein, wherein the DNA binding protein is at least about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, or about 200 amino acid residues in length. In some embodiments, the chromatin binding domain is derived from the EBNA1 homolog. In some embodiments, the EBNA1 homolog-derived chromatin binding domain is an arginine-glycine rich sequence (i.e., at least about 50% arginine-glycine content). In some embodiments, the EBNA1 homolog- derived chromatin binding domain is about 30 to about 80 amino acids. In some embodiments, the EBNA1 homolog-derived chromatin binding domain is about 40 to about 70 amino acids. In some embodiments, the EBNA1 homolog-derived chromatin binding domain is at least 50% similar to CBD Domain A or CBD Domain B from EBNA1. In some embodiments, the EBNA1 homolog-derived chromatin binding domain is selected from Table 25. In some embodiments, the EBNA1 homolog-derived chromatin binding domain is at least 70% similar to a sequence selected from Table 25. In some embodiments, the chromatin binding domain comprises a portion of the EBNA1 homolog N-terminal to the DBD. In some embodiments, the chromatin binding domain comprises a EBNA1 domain A or a portion thereof and / or an EBNA1 domain B or a portion thereof. In some embodiments, the DNA binding protein comprises a heterologous chromatin binding domain described herein. (i) EBNA1 and EBNA1 Homolog Chromatin Binding Domains

[0297] In some embodiments, the DNA binding protein comprises (i) one or more chromatin binding domains selected from EBNA1 domain A or a portion thereof, EBNA domain B or a portion thereof, and a combination thereof; and (ii) at least one EBNA1 DBD, wherein (i) and (ii) are operably linked.

[0298] In some embodiments, the DNA binding protein comprises (i) one or more chromatin-binding domains comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A and B are each independently selected from EBNA1 domain A or a portion thereof and EBNA domain B or a portion thereof, wherein L, if present,is a spacer between A and B; (ii) and (ii) at least one EBNA1 DBD, wherein (i) and (ii) are operably linked.

[0299] In some embodiments, the DNA binding protein comprises (i) one or more chromatin-binding domains comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A is an EBNA1 domain A or portion thereof, wherein B is selected from EBNA1 domain A or a portion thereof and EBNA domain B or a portion thereof, wherein L, if present, is a spacer between A and B; (ii) and (ii) at least one EBNA1 DBD, wherein (i) and (ii) are operably linked.

[0300] In some embodiments, the DNA binding protein comprises (i) one or more chromatin-binding domains comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A is an EBNA1 domain B or portion thereof, wherein B is selected from EBNA1 domain A or a portion thereof and EBNA domain B or a portion thereof, wherein L, if present, is a spacer between A and B; (ii) and (ii) at least one EBNA1 DBD, wherein (i) and (ii) are operably linked.

[0301] In some embodiments, the DNA binding protein comprises (i) one or more chromatin-binding domains comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A is an EBNA1 domain A or portion thereof, wherein B is an EBNA1 domain A or a portion thereof, wherein L, if present, is a spacer between A and B; (ii) and (ii) at least one EBNA1 DBD, wherein (i) and (ii) are operably linked.

[0302] In some embodiments, the DNA binding protein comprises (i) one or more chromatin-binding domains comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A is an EBNA1 domain A or portion thereof, wherein B is an EBNA1 domain B or a portion thereof, wherein L, if present, is a spacer between A and B; (ii) and (ii) at least one EBNA1 DBD, wherein (i) and (ii) are operably linked.

[0303] In some embodiments, the DNA binding protein comprises from N-terminus to C-terminus: the one or more chromatin binding domains and an EBNA1 DBD. In some embodiments, the DNA binding protein comprises from N-terminus to C-terminus: the EBNA1 DBD and the one or more chromatin binding domains.

[0304] In some embodiments, the DNA binding protein further comprises one or more NLSs. In some embodiments, the DNA binding protein comprises at least one NLSs N-terminal to the one or more chromatin binding domains and the EBNA1 DBD. In some embodiments, the DNA binding protein comprises at least one NLSs C-terminal to the one or more chromatin binding domains and the EBNA1 DBD. In some embodiments, the NLS is inserted between the one or more chromatin binding domains and the EBNA1 DBD.

[0305] In some embodiments, the EBNA1 DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 145, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 amino acid residues present in SEQ ID NO: 18.

[0306] In some embodiments, the EBNA1 DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 18.

[0307] In some embodiments, the EBNA1 DBD comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 93.

[0308] In some embodiments, the EBNA1 DBD comprises SEQ ID NO: 18. In some embodiments, the EBNA1 DBD comprises an amino acid sequence encoded by SEQ ID NO: 93.

[0309] In some embodiments, the EBNA1 DBD comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to an amino acid sequence corresponding to residues about 459 to about 607 of SEQ ID NO: 1.

[0310] In some embodiments, the EBNA1 DBD comprises an amino acid sequence corresponding to residues about 459 to about 607 of SEQ ID NO: 1.

[0311] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising an EBNA1 domain A or a portion thereof and / or an EBNA1 domain B or a portion thereof; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0312] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a homolog of an EBNA1 domain A or a portion thereof and / or a homolog of an EBNA1 domain B or a portion thereof; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked. In some embodiments, the homolog of an EBNA1 domain A comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a sequence selected from SEQ ID NOs: 337-340 and 347. In some embodiments, the homolog of an EBNA1 domain A comprises a sequence selected from SEQ ID NOs: 337-340 and 347. In some embodiments, homolog of an EBNA1 domain B comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about95%, about 98%, or about 99% identity to a sequence selected from SEQ ID NOs: 341-346. In some embodiments, the homolog of an EBNA1 domain A comprises a sequence selected from SEQ ID NOs: 341-346.

[0313] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A and B are each independently selected from an EBNA1 domain A or a portion thereof and an EBNA1 domain B or a portion thereof, wherein L, if present, is a spacer between A and B; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0314] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A is an EBNA1 domain A or a portion thereof, wherein B is selected from an EBNA1 domain A or a portion thereof and an EBNA1 domain B or a portion thereof, wherein L, if present, is a spacer between A and B; (ii) and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0315] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A is an EBNA1 domain B or portion thereof, wherein B is selected from EBNA1 domain A or a portion thereof and an EBNA1 domain B or a portion thereof, wherein L, if present, is a spacer between A and B; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0316] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A is an EBNA1 domain A or portion thereof, wherein B is an EBNA1 domain A or a portion thereof, wherein L, if present, is a spacer between A and B; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0317] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A is an EBNA1 domain A or portion thereof, wherein B is an EBNA1 domain B or a portion thereof, whereinL, if present, is a spacer between A and B; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0318] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A is an EBNA1 domain B or portion thereof, wherein B is an EBNA1 domain A or a portion thereof, wherein L, if present, is a spacer between A and B; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0319] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A and B are each independently selected from a homolog of an EBNA1 domain A or a portion thereof and a homolog of an EBNA1 domain B or a portion thereof, wherein L, if present, is a spacer between A and B; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0320] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A and B are each independently selected from an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a sequence selected from SEQ ID NOs: 337-347, wherein L, if present, is a spacer between A and B; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0321] In some embodiments, the DNA binding protein comprises (i) a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) comprising a sequence of linked amino acids comprising the formula Nʹ-[A]-[L]-[B]-Cʹ, wherein A and B are each independently selected from SEQ ID NOs: 337-347, wherein L, if present, is a spacer between A and B; and (ii) a DBD of an EBNA1 homolog described herein, wherein (i) and (ii) are operably linked.

[0322] In some embodiments, the DNA binding protein comprises from N-terminus to C-terminus: a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)) and a DBD of an EBNA1 homolog described herein. In some embodiments, the DNA binding protein comprises from N-terminus to C-terminus: a DBD of an EBNA1 homolog described herein and a chromatin binding domain (e.g., 1, 2, 3, 4, or more chromatin binding domain(s)).

[0323] In some embodiments, the DNA binding protein further comprises an NLS. In some embodiments, the DNA binding protein comprises an NLS N-terminal to the chromatin binding domain and the DBD. In some embodiments, the DNA binding protein comprises an NLS C-terminal to the chromatin binding domain and the DBD. In some embodiments, the NLS is inserted between the chromatin binding domain and the DBD.

[0324] In some embodiments the EBNA1 domain A comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 55, about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 14. In some embodiments the EBNA1 domain A comprises a contiguous sequence of at least about 55, about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 14. In some embodiments, the EBNA1 domain A comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 15. In some embodiments, the EBNA1 domain A comprises SEQ ID NO: 14. In some embodiments, the EBNA1 domain A comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity an amino acid sequence corresponding to residues about 33 to about 89 of SEQ ID NO: 1. In some embodiments, the EBNA1 domain A comprises an amino acid sequence corresponding to residues about 33 to about 89 of SEQ ID NO: 1. In some embodiments, the EBNA1 domain A comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 89. In some embodiments, the EBNA1 domain A comprises an amino acid sequence encoded by SEQ ID NO: 89.

[0325] In some embodiments the EBNA1 domain B comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to a contiguous sequence of at least about 55, about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 16. In some embodiments the EBNA1 domain B comprises a contiguous sequence of at least about 55, about 50, about 45, about 40, about 35, or about 30 amino acid residues present in SEQ ID NO: 16. In some embodiments, the EBNA1 domain B comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 16. In some embodiments, the EBNA1 domain B comprises SEQ ID NO: 16. In some embodiments, the EBNA1 domain B comprises an amino acid sequence having at least about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity an amino acid sequencecorresponding to residues about 328 to about 376 of SEQ ID NO: 1. In some embodiments, the EBNA1 domain B comprises an amino acid sequence corresponding to residues about 328 to about 376 of SEQ ID NO: 1. In some embodiments, the EBNA1 domain B comprises an amino acid sequence encoded by a nucleotide sequence having at least about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99% identity to SEQ ID NO: 91. In some embodiments, the EBNA1 domain B comprises an amino acid sequence encoded by SEQ ID NO: 91. (ii) Heterologous Chromatin Binding Domains

[0326] In some embodiments, the disclosure provides a DNA binding protein comprising one or more heterologous chromatin-binding domains operably linked to at least one EBNA1 DBD. In some embodiments, the disclosure provides an mRNA comprising an ORF encoding a DNA binding protein comprising one or more heterologous chromatin- binding domains operably linked to at least one EBNA1 DBD. In some embodiments, the DNA binding protein comprising a heterologous chromatin-binding domain (e.g., 1, 2, 3, 4, or more heterologous chromatin binding domain(s)) operably linked to a DBD of an EBNA1 homolog described herein.

[0327] In some embodiments, the one or more heterologous chromatin binding domains bind to the nuclear matrix (i.e., the network of fibers within the nucleus). In some embodiments, the one or more heterologous chromatin binding domains comprise a polypeptide of the nuclear matrix. In some embodiments, the one or more heterologous chromatin binding domains binds to euchromatin, heterochromatin, or both. In some embodiments, the one or more heterologous chromatin binding domains comprise a ...

Claims

CLAIMS 1. A non-viral system for increasing expression of at least one transgene in a cell, the system comprising: (i) an mRNA comprising an open reading frame (ORF) encoding a DNA-binding protein comprising (a) one or more chromatin-binding domains; and (b) a DNA-binding domain (DBD) of an Epstein-Barr nuclear antigen-1 (EBNA1) polypeptide, wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DNA binding elements (DBEs) of an Epstein-Barr virus (EBV) origin of replication (OriP), wherein (ii)(a) and (b) are operably-linked.

2. The non-viral system of claim 1, wherein the one or more chromatin binding domains binds to at least one element of human chromatin.

3. The non-viral system of claim 1 or 2, wherein the one or more chromatin binding domains binds to at least one element of the nuclear matrix or nuclear lamina.

4. The non-viral system of any one of claims 1-3, wherein the one or more chromatin binding domains binds to euchromatin, heterochromatin, or both.

5. The non-viral system of any one of claims 1-4, wherein the one or more chromatin binding domains binds to genomic DNA, a histone protein, a nucleosome, or a combination thereof.

6. The non-viral system of any one of claims 1-5, wherein the one or more chromatin binding domains are selected from a bromodomain, a PHD finger domain, a chromodomain, a MBT domain, a tudor domain, a PWWP domain, an ADD domain, a Zf-CW domain, an ankyrin repeat domain, a WD40 domain, and a combination thereof.

7. The non-viral system of any one of claims 1-5, wherein the one or more chromatin binding domains comprises an AT-hook.

8. The non-viral system of claim 7, wherein the AT-hook is from HMGA1, HMGA2, AF-17, SETBP1, TTF-I interacting peptide 5, SC1, X box-binding regulatory factor, LIM / homeodomain protein LH-2, Retinoblastoma-binding protein 1, ELF3, DFS70, ZNF213, Peregrin, Methyl-CpG-binding protein 2, or MLLT10.

9. The non-viral system of any one of claims 1-5, wherein the one or more chromatin binding domains comprises a histone protein or portion thereof.

10. The non-viral system of any one of claims 1-5, wherein the one or more chromatin binding domains comprises an IL-33 chromatin-binding sequence.

11. The non-viral system of any one of claims 1-5, wherein the one or more chromatin binding domains comprises a chromatin binding domain of a Karposi’s sarcoma-associated herpesvirus (KSHV) latency-associated nuclear antigen (LANA) or a human papillomavirus H (HPV) E2 protein.

12. The non-viral system of any one of claims 1-5, wherein the one or more chromatin binding domains are selected from EBNA1 domain A, EBNA domain B, and a combination thereof.

13. The non-viral system of any one of claims 1-5, wherein the one or more chromatin binding domains comprises SEQ ID NO: 14 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO:

14.

14. The non-viral system of any one of claims 1-5, wherein the one or more chromatin binding domains comprises SEQ ID NO: 16 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO:

16.

15. The non-viral system of any one of claims 1-5, wherein the one or more chromatin binding domains comprise (i) SEQ ID NO: 14 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 14; and (ii) SEQ ID NO: 16 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 16, wherein (i) and (ii) are operably linked.

16. The non-viral system of claim 15, wherein (i) is upstream of (ii).

17. The non-viral system of claim 15, wherein (ii) is upstream of (i).

18. The non-viral system of any one of claims 1-5, wherein the one or more chromatin- binding domains comprises a sequence of linked amino acids comprising the formula Nʹ-[A]- [L]-[B]-Cʹ, wherein A and B are each independently selected from SEQ ID NO: 14, an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 14, SEQ ID NO: 16, and an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 16, and wherein L, if present, is a spacer between A and B.

19. The non-viral system of any one of claims 1-18, wherein the DBD comprises SEQ ID NO: 18[EBNA1 DBD], or an amino acid sequence having at least about 80% identity to SEQ ID NO:

18. [bracketed text to be removed when finalizing] 20. The non-viral system of any one of claims 1-19, wherein the one or more chromatin binding domains is operably-linked to the N-terminus of the DBD.

21. The non-viral system of any one of claims 1-19, wherein the DBD is operably-linked to the N-terminus of the one or more chromatin binding domains.

22. The non-viral system of any one of claims 1-21, wherein the DNA-binding protein further comprises one or more nuclear localization sequences (NLSs).

23. The non-viral system of claim 22, wherein the one or more NLSs are positioned at the N-terminus, at the C-terminus, between the one or more chromatin-binding domains and the DBD, or a combination thereof.

24. The non-viral system of claim 22 or 23, wherein the one or more NLSs is selected from a monopartite NLS, a bipartite NLS, a non-classical NLS, and a combination thereof.

25. The non-viral system of any one of claims 22-24, wherein the one or more NLSs is selected from a c-Myc NLS, SV40 NLS, a nucleoplasmin NLS, a 53BP1 NLS, an ING4 NLS, an IER5 NLS, and an ERK5 NLS.

26. The non-viral system of any one of claims 22-24, wherein the one or more NLSs comprises an amino acid sequence having at least about 90% identity to an amino acid sequence selected from SEQ ID NOs: 17 and 37-50.

27. The non-viral system of any one of claims 1-5 and 12-26, wherein the DNA-binding protein comprises SEQ ID NO: 3[truncated EBNA1 C211] or an amino acid sequence having at least 80% identity to SEQ ID NO:

3.

28. The non-viral system of claim 1, wherein the DNA binding protein is a variant of an EBNA1 polypeptide, wherein the variant comprises (a) one or more EBNA1 chromatin binding domains, (b) an EBNA1 DBD, and (c) one or more modifications of an EBNA1 domain selected from a Gly-Ala repeat region, an NLS, a transactivation (TA) domain, and a combination thereof.

29. The non-viral system of claim 28, wherein the one or more modifications is selected from a deletion, an insertion, a substitution, and a combination thereof.

30. The non-viral system of claim 28, wherein the one or more modifications comprises a deletion of the Gly-Ala repeat region or a portion thereof.

31. The non-viral system of any one of claims 28-30, wherein the one or more modifications comprises a deletion of the NLS or portion thereof.

32. The non-viral system of any one of claims 28-30, wherein the one or more modifications comprises a substitution of the NLS or portion thereof.

33. The non-viral system of claim 32, wherein the NLS is substituted with a heterologous NLS, optionally a human NLS.

34. The non-viral system of any one of claims 28-33, wherein the one or more modifications comprises a deletion of the TA domain or a portion thereof.

35. The non-viral system of any one of claims 28-33, wherein the one or more modifications comprises a substitution of the TA domain or a portion thereof.

36. The non-viral system of any one of claims 28-33, wherein the one or more modifications comprises a deletion of the full TA domain.

37. The non-viral system of any one of claims 28-33, wherein the one or more modifications comprises a deletion or substitution of one or more antigens in the TA domain.

38. The non-viral system of claim 37, wherein the one or more antigens comprises a sequence motif having the amino acid sequence of SEQ ID NO:

101.

39. The non-viral system of any one of claims 28-33, wherein the one or more modifications comprises a deletion of the NLS or portion thereof and a deletion of the TA domain or portion thereof.

40. The non-viral system of any one of claims 28-33, wherein the one or more modification comprises a substitution of the NLS or portion thereof and a deletion of the TA domain or portion thereof.

41. A non-viral system for increasing expression of a transgene in a cell, the system comprising: (i) an mRNA comprising an ORF encoding a DNA binding protein, wherein the DNA binding protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 3, 7- 11, 130, 133, 136, 139, 142, 145, 150, and 153 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in any one of SEQ ID NOs: 3, 7-11, 130, 133, 136, 139, 142, 145, 150, and 153; (ii) a recombinant expression vector comprising (a) at least one transgene; and (b) a polynucleotide comprising one or more DBEs of an EBV OriP, wherein (ii)(a) and (b) are operably linked.

42. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 3 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO: 3.

43. The non-viral system of claim 42, wherein the ORF comprises SEQ ID NO: 24 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

24.

44. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 7 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

7.

45. The non-viral system of claim 44, wherein the ORF comprises SEQ ID NO: 25 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

25.

46. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 8 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

8.

47. The non-viral system of claim 46, wherein the ORF comprises SEQ ID NO: 27 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

27.

48. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 9 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

9.

49. The non-viral system of claim 48, wherein the ORF comprises SEQ ID NO: 28 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

28.

50. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 10 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

10.

51. The non-viral system of claim 50, wherein the ORF comprises SEQ ID NO: 26 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 26.

52. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 11 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

11.

53. The non-viral system of claim 52, wherein the ORF comprises SEQ ID NO: 29 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

29.

54. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 130 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

130.

55. The non-viral system of claim 54, wherein the ORF comprises SEQ ID NO: 129 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

129.

56. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 133 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

133.

57. The non-viral system of claim 56, wherein the ORF comprises SEQ ID NO: 132 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

132.

58. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 136 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

136.

59. The non-viral system of claim 58, wherein the ORF comprises SEQ ID NO: 135 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

135.

60. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 139 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

139.

61. The non-viral system of claim 60, wherein the ORF comprises SEQ ID NO: 138 or a nucleotide sequence having at least about 70% identity to SEQ ID NO: 138.

62. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 142 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

142.

63. The non-viral system of claim 62, wherein the ORF comprises SEQ ID NO: 141 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

141.

64. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 145 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

145.

65. The non-viral system of claim 64, wherein the ORF comprises SEQ ID NO: 144 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

144.

66. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 150 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

150.

67. The non-viral system of claim 66, wherein the ORF comprises SEQ ID NO: 149 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

149.

68. The non-viral system of claim 41, wherein the DNA binding protein comprises an amino acid sequence set forth in SEQ ID NO: 153 or an amino acid sequence having at least 80% identity to an amino acid sequence set forth in SEQ ID NO:

153.

69. The non-viral system of claim 68, wherein the ORF comprises SEQ ID NO: 152 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

152.

70. A non-viral system for expression of at least one transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DNA binding domain (DBD) of an Epstein-Barr nuclear antigen-1 (EBNA1) homolog or a variant thereof, wherein the EBNA1 homolog is of a non-humanprimate (NHP) lymphocryptovirus (LCV), wherein the DBD is a sequence represented by the formula: N′-[Xaa1]w-[A]-[Xaa2]x-[B]-[Xaa3]y-[C]-[Xaa4]z-C′, wherein Xaa1, Xaa2, Xaa3, and Xaa4 are any amino acid, wherein w, x, y, and z are integers referring to the number of amino acid residues, wherein w = 40-70, wherein x = 0-15, wherein y = 0-15, wherein z = 30-60, wherein [A], [B], and [C] are respectively a first, second, and third sequence motifs, wherein the first sequence motif has at least about 80% similarity to KX48X49X50YX51LRRX52(SEQ ID NO: 284), wherein X48is T, I, N, or W; X49is C, S, P; X50is V, L, C, or I; X51 is N or S; and X52 is C,G, or A, wherein the second sequence motif has at least about 80% similarity to RX61X62X63LX64RLPX65(SEQ ID NO: 285) , wherein X61is A, L, S, or I; X62is T or S; X63is P or T; X64is G, S, or F; and X65is Y or F, and wherein the third sequence motif has at least about 80% similarity to GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71is Q or E; X72 is G or T; X73is L, M, or I; and X74is R, K, M, or L, and (b) one or more chromatin binding domains, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DBEs selected from an EBV OriP DBE, or a variant thereof, and an NHP LCV DBE, or a variant thereof, and wherein (ii)(a) and (ii)(b) are operably-linked.

71. The non-viral system of claim 70, wherein the first sequence motif has at least about 90% similarity to KX48X49X50YX51LRRX52(SEQ ID NO: 284).

72. The non-viral system of claim 70 or 71, wherein the first sequence motif is KX48X49X50YX51LRRX52 (SEQ ID NO: 284).

73. The non-viral system of any one of claims 70-72, wherein the first sequence motif has at least 80% similarity to a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293).

74. The non-viral system of any one of claims 70-73, wherein the first sequence motif is a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293).

75. The non-viral system of any one of claims 70-74, wherein the second sequence motif has at least about 90% similarity to RX61X62X63LX64RLPX65(SEQ ID NO: 285).

76. The non-viral system of any one of claims 70-74, wherein the second sequence motif is RX61X62X63LX64RLPX65(SEQ ID NO: 285).

77. The non-viral system of any one of claims 70-74, wherein the second sequence motif has at least 80% similarity to a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), andRISPLFRLPY (SEQ ID NO: 300).

78. The non-viral system of any one of claims 70-74, wherein the second sequence motif is a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), and RISPLFRLPY (SEQ ID NO: 300).

79. The non-viral system of any one of claims 70-78, wherein the third sequence motif has at least about 90% similarity to GPX71PX72PX73X74ES (SEQ ID NO: 286).

80. The non-viral system of any one of claims 70-78, wherein the third sequence motif is GPX71PX72PX73X74ES (SEQ ID NO: 286).

81. The non-viral system of any one of claims 70-78, wherein the third sequence motif has at least 80% similarity to a sequence selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES (SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304), and GPQPGPILES (SEQ ID NO: 305).

82. The non-viral system of any one of claims 70-78, wherein the third sequence motif is a sequence selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES (SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304) and GPQPGPILES (SEQ ID NO: 305).

83. The non-viral system of any one of claims 70-82, wherein w = 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, or 58, 59, 60.

84. The non-viral system of any one of claims 70-83, wherein x = 6, 7, 8, 9, or 10.

85. The non-viral system of any one of claims 70-84, wherein y = 4, 5, 6, 7, or 8.

86. The non-viral system of any one of claims 70-85, wherein z = 48, 49, 50, 51, 52, or 53.

87. The non-viral system for expression of any one of claims 70-86, wherein [Xaa1]w comprises the amino acid sequence X1X2X3GGX4X5X6X7X8RGX9X10X11X12X13X14X15KX16X17X18X19X20X21X22X23X24X25LLX26RX27X28X29X30X31X32TX33X34X35X36X37WX38X39X40X41X42X43X44X45X46X47(SEQ ID NO: 306), wherein X1 is R, G, P, or K; X2 is K or P; X3 is K or R; X4 is W, V, or -; X5 is F or -; X6 is G, -, or Y; X7 is K, -, R, or V; X8 is H, -, R, or G; X9 is Q, E, or C; X10 is G or P; X11 is G, A, or R; X12 is S, K, R, Y, A, or G; X13 is -, C, or G; X14 is N, H, F, or S; X15 is P, G, K, or -; X16 is F or Y; X17 is E, T, D, or Q; X18 is N, T, K, G, or S; X19 is I, T, M, or L; X20 is A or G; X21 is E, K, Q, N, or D; X22is G, N, or S; X23is L, F, or I; X24is R, T, K, or S; X25is A, V, or K; X26is A, N, D, S, or R; X27 is–- or K; X28 is S, R, C, K, or P; X29 is H, Q, D, or E; X30 is V, S, A, or I; X31is E, P, or Q; X32is R or T; X33is T, S, or N; X34is D, N, T, P, or E; X35is E or T; X36is G or A; X37 is T, R, N, D, G, S. or E; X38 is V, M, P, K, G, or C; X39 is A, N, F, Y, or C; X40 is G or A; X41is V or L; X42is F, M, L, or I; X43is V, A, or I; X44is Y or V; X45is G or N; X46is G, L, P, or Y; X47 is S, -, or C; and “-” is a deletion.

88. The non-viral system for expression of any one of claims 70-87, wherein [Xaa2]x comprises the amino acid sequence X53X54X55X56X57X58X59X60 (SEQ ID NO: 307), wherein X53 is T, L, I, or M; X54 is A, G, or S; X55is L, C, V, or I; X56is A or C; X57is I, A, V, or C; X58is P or N; X59is Q, E, W, or G; and X60 is C, V, or G.

89. The non-viral system for expression of any one of claims 70-88, wherein [Xaa3]y comprises the amino acid sequenceGX66X67X68X69X70 (SEQ ID NO: 308), wherein X66 is M, S, Y, H, I, or T; X67 is A, S, or T; X68is P, F, or W; X69is G or E; and X70is P, T, A, or G.

90. The non-viral system for expression of any one of claims 70-89, wherein [Xaa4]zcomprises the amino acid sequence X75X76X77X78FX79X80FX81X82X83X84X85X86X87X88X89X90X91X92X93X94X95X96X97X98X99X100X101PX102PX103X104X105X106X107VX108X109X110X111FX112X113X114X115X116X117LP (SEQ ID NO: 309), wherein X75is I, S, T, C, or G; X76is V, T, D, E, or W; X77is C, W, or S; X78is Y or G; X79 is M, L, or I; X80 is V, F, or Y; X81 is L, T, or V; X82 is Q, P, or N; X83 is T, S, or C; X84is H, S, M, G, P, or W; X85is I, L, Q, E, or P; X86is F or S; X87is A or G; X88is E, D, or L; X89 is V, D, C, or W; X90 is L, I, or V; X91 is K or A; X92 is D or Q; X93 is A or C; X94 is I, L, or V; X95is K, R, V, G, or L; X96is D or V; X97is L or Y; X98is V, C, I, or L; X99is M, T, S, or A; X100 is T, A, or H; X101 is K, H, or R; X102 is A, G, L, Q, or P; X103 is T or A; X104 is C, R, S, or G; X105is N, S, or D; X106is I, T, V, or M; X107is R, Q, or K; X108is T, V, or S; X109is V, L, F, or T; X110 is C, M, or I; X111 is S, N, T, E, or R; X112 is D, E, T, or N; X113 is D, G, or P; X114 is G, S, or P; X115 is–- or G; X116 is V, I, or L; X117deletion.

91. The non-viral system of claim 70, wherein the DBD comprises the amino acid sequence of SEQ ID NO:

310.

92. The non-viral system of any one of claims 70-91, wherein the one or more DBEs is an EBV DBE or a variant thereof.

93. The non-viral system of any one of claims 70-91, wherein the one or more DBEs is an NHP LCV DBE or a variant thereof.

94. A non-viral system for expression of at least one transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DNA binding domain (DBD) of a NHP LCV Epstein-Barr nuclear antigen-1 (EBNA1) homolog or a variant thereof, wherein the DBD comprises an amino acid sequence having at least about 80% similarity to SEQ ID NO: 322[marmoset LCV DBD], and (b) one or more chromatin binding domains, wherein (i)(a) and (i)(b) are operably linked, and(ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising a NHP LCV DBE or a variant thereof, wherein (ii)(a) and (b) are operably-linked.

95. The non-viral system of claim 94, wherein the DBD comprises SEQ ID NO:

322.

96. The non-viral system of claim 94, wherein the DBD consists of SEQ ID NO:

322.

97. The non-viral system of any one of claims 93-96, wherein the DBE comprises (i) CGCCAACAAACGTTG (SEQ ID NO: 317), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 317, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 317; (ii) CAACACCCAGTCACGCAGTCTCAAGGGTCCT (SEQ ID NO: 318), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 318, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 318; (iii) TTTGTTGGCGCCAACAAA (SEQ ID NO: 319), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 319, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 319; or (iv) AATGTTGGCGCCAACAAA(SEQ ID NO: 336), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 336, or a nucleotide sequence having at least 80% identity to SEQ ID NO:

336.

98. The non-viral system of any one of claims 93-97, wherein the polynucleotide comprises a sequence having at least about 80% identity to SEQ ID NO: 316[marmoset LCV FR].

99. The non-viral system of any one of claims 93-97, wherein the DNA binding polynucleotide comprises SEQ ID NO:

316.

100. A non-viral system for expression of at least one transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DNA binding domain (DBD) of a NHP LCV Epstein-Barr nuclear antigen-1 (EBNA1) homolog or a variant thereof, wherein the DBD comprises an amino acidsequence having at least about 80% similarity to an amino acid sequence selected from SEQ ID NOs 215-220, and (b) one or more chromatin binding domains, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising an EBV OriP DBE or a variant thereof, wherein (ii)(a) and (b) are operably-linked.

101. The non-viral system of claim 100, wherein the DBD comprises an amino acid sequence selected from SEQ ID NOs 215-220.

102. The non-viral system of claim 101, wherein the DBD consists of an amino acid sequence selected from SEQ ID NOs 215-220.

103. The non-viral system of any one of claims 1-92 and 100-102, wherein the DBE comprises TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 51, or a nucleotide sequence having at least 80% identity to SEQ ID NO:

51.

104. The non-viral system of any one of claims 1-103, wherein the DNA binding polynucleotide comprises at least 4 DBEs, and wherein the DBEs are the same or different.

105. The non-viral system of any one of claims 1-104, wherein the DNA binding polynucleotide comprises 4 to 50, 4 to 40, 4 to 30, 4 to 20, 4 to 10, or 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 DBEs.

106. The non-viral system of claim 104 or 105, wherein the at least 4 DBEs are contiguous.

107. The non-viral system of claim 105 or 106, wherein the at least 4 DBEs are operably linked via a spacer sequence.

108. The non-viral system of claim 107, wherein the spacer sequence is about 1-56 nucleotides in length.

109. The non-viral system of claim 107 or 108, wherein the spacer sequence is 25-35 nucleotides in length.

110. The non-viral system of any one of claims 107-109, wherein the spacer sequence comprises an AT-content of at least about 50% or higher.

111. The non-viral system of any one of claims 107-110, wherein each DBE comprises a 3ʹ spacer sequence, and wherein the length of the DBE and the 3ʹspacer sequence is about 20-50 nucleotides.

112. The non-viral system of any one of claims 1-92 and 100-102, wherein the polynucleotide comprises a sequence represented by the formula: 5ʹ-(C-D)n-3ʹ, wherein (i) C comprises TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 51, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 51; (ii) D comprises CCCAGATATAGATTAGGA (SEQ ID NO: 61), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 61, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 61; and (iii) n is an integer of 1 to 30.

113. The system of any one of claims 1-92 and 100-102, wherein the polynucleotide comprises a sequence according to the formula 5ʹ-[D1]-[L1]-[D2]-[L2]-[D3]-[L3]-([Dn]-[Ln])x- 3ʹ, wherein [D1], [D2], [D3], and [Dn] each comprise TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 51, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 51; wherein [L1], [L2], [L3], and [Ln] are each selected from: a phosphate linkage and a spacer sequence of 1-56 nucleotides, and wherein x indicates the number of ([Dn]-[Ln]) units in the sequence and is an integer of 1-47.

114. A non-viral system for expression of at least one transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog or a variant thereof, wherein theEBNA1 homolog is of a NHP LCV; and (b) one or more chromatin binding domains, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising a sequence represented by the formula 5ʹ-[D1]-[L1]-[D2]-[L2]-[D3]-[L3]-([Dn]-[Ln])x-3ʹ, wherein [D1], [D2], [D3], and [Dn] each comprise TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to TAGCATATGCTA (SEQ ID NO: 51), or a nucleotide sequence having at least 80% identity to TAGCATATGCTA (SEQ ID NO: 51); wherein [L1], [L2], [L3], and [Ln] are each selected from: a phosphate linkage and a spacer sequence of 1-56 nucleotides, and wherein x indicates the number of ([Dn]-[Ln]) units in the sequence and is an integer of 1-47, and wherein (ii)(a) and (b) are operably-linked.

115. The non-viral system of claim 114, wherein the NHP is of the family Hominoidea or Cercopithecoidea.

116. The non-viral system of claim 114 or 115, wherein the NHP is of the family Hominoidea.

117. The non-viral system of any one of claims 114-116, wherein the NHP is selected from the group consisting of species listed in Table 2.

118. The non-viral system of claim 114 or 115, wherein the NHP is of the family Cercopithecoidea.

119. The non-viral system of claim 118, wherein the NHP is selected from the group consisting of species listed in Table 3.

120. The non-viral system of claim 114, wherein the LCV is selected from Cercocebus atys lymphocryptovirus 1, Cercopithecus hamlyni lymphocryptovirus 1, Cercopithecus cephus lymphocryptovirus 1, Cercopithecus neglectus lymphocryptovirus 1, Cercopithecus neglectus lymphocryptovirus 2, Cercopithecus nictitans lymphocryptovirus 1, Chlorocebus aethiopslymphocryptovirus 1, Chlorocebus aethiops lymphocryptovirus 2, Colobus guereza lymphocryptovirus 1, Colobus polykomos lymphocryptovirus 1, Erythrocebus patas lymphocryptovirus 1, Gorilla gorilla lymphocryptovirus 1, Gorilla gorilla lymphocryptovirus 2, Hylobates lar lymphocryptovirus 1, Hylobates muelleri lymphocryptovirus 1, Lophocebus albigena lymphocryptovirus 1, Lophocebus aterrimus lymphocryptovirus 1, Macaca fascicularis lymphocryptovirus 1, Macaca fuscata lymphocryptovirus 1, Macaca fuscata lymphocryptovirus 2, Macaca tibetana lymphocryptovirus 2, Mandrillus sphinx lymphocryptovirus 1, Mandrillus sphinx lymphocryptovirus 2, Miopithecus talapoin lymphocryptovirus 1, Pan paniscus lymphocryptovirus 1, Pan troglodytes lymphocryptovirus 1, Papio435ithecs lymphocryptovirus 1, Papio hamadryas lymphocryptovirus 2, Piliocolobus badius lymphocryptovirus 1, Piliocolobus badius lymphocryptovirus 2, Pongo pygmaeus lymphocryptovirus 1, Pongo pygmaeus lymphocryptovirus 2, Semnopithecus entellus lymphocryptovirus 1, Symphalangus syndactylus lymphocryptovirus 1, and Symphalangus syndactylus lymphocryptovirus 2.

121. The non-viral system of claim 114, wherein the LCV is selected from gorilline gammaherpesvirus 1, macacine gammaherpesvirus 4, macacine gammaherpesvirus 10, macacine gammaherpesvirus 13, panine gammaherpesvirus 1, paniine gammaherpesvirus 1, and pongine gammaherpesvirus 2.

122. The non-viral system of any one of claims 113-121, wherein x is 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17.

123. The system of any one of claims 113-122, wherein [D1], [D2], [D3], and [Dn] are the same or different.

124. The system of any one of claims 113-123, wherein the spacer sequence is 25-35 nucleotides in length.

125. The system of any one of claims 113-124, wherein [D1]-[L1], [D2]-[L2], [D3]-[L3], and / or [Dn]-[Ln] have a length of about 20 to about 50 nucleotides.

126. The system of any one of claims 113-125, wherein the spacer sequence comprises a AT-content of greater than 50%.

127. The system of any one of claims 113-126, wherein [L1], [L2], [L3], and [Ln] are the same or different.

128. The non-viral system of any one of claims 1-92 and 100-127, wherein the DNA binding polynucleotide comprises SEQ ID NO: 69[EBV FR region], or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

69.

129. The non-viral system of any one of claims 1-92 and 100-127, wherein the DNA binding polynucleotide comprises SEQ ID NO: 71[full length OriP], or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

71.

130. The non-viral system of any one of claims 1-92 and 100-127, wherein the DNA binding polynucleotide comprises a family of repeats (FR) of the EBV OriP or a portion of the FR, and wherein the recombinant expression vector lacks a dyad symmetry (DS) of the EBV OriP.

131. A non-viral system for expression of at least one transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog or a variant, wherein the EBNA1 homolog is of a NHP LCV, wherein the NHP is of the parvorder Platyrrhini; and (b) one or more chromatin binding domains, wherein (i)(a) and (i)(b) are operably linked, and (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a DNA binding polynucleotide comprising one or more DBEs, or a variant thereof, wherein the DBE is present in a genome of the NHP LCV, wherein (ii)(a) and (b) are operably-linked.

132. The non-viral system of claim 131, wherein the NHP is selected from the group consisting of species listed in Table 4.

133. The non-viral system of claim 131, wherein the LCV is selected from Ateles paniscus lymphocryptovirus1, Callithrix penicillata lymphocryptovirus1, Leontopithecus rosalia lymphocryptovirus1, Pithecia pithecia lymphocryptovirus1, Saimiri sciureus lymphocryptovirus2, and Saimiri sciureus lymphocryptovirus3.

134. The non-viral system of any one of claims 131-133, wherein the DNA binding polynucleotide comprises two or more DBEs, wherein the DBEs are the same or different.

135. The non-viral system of any one of claims 131-133, wherein the DNA binding polynucleotide comprises at least 4 DBEs, and wherein the DBEs are the same or different.

136. The non-viral system of any one of claims 131-135, wherein the DNA binding polynucleotide comprises 4 to 50, 4 to 40, 4 to 30, 4 to 20, 4 to 10, or 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 DBEs.

137. The non-viral system of any one of claims 134-136, wherein the DBEs of the array are contiguous.

138. The non-viral system of any one of claims 134-136, wherein the DBEs are operably linked via a spacer sequence.

139. The non-viral system of claim 138, wherein the spacer sequence is about 1-56 nucleotides in length.

140. The non-viral system of any one of claims 131-139, wherein the DBE comprises: (i) CGCCAACAAACGTTG (SEQ ID NO: 317), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 317, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 317; (ii) CAACACCCAGTCACGCAGTCTCAAGGGTCCT (SEQ ID NO: 318), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 318, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 318; (iii) TTTGTTGGCGCCAACAAA (SEQ ID NO: 319), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 319, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 319; or (iv) AATGTTGGCGCCAACAAA(SEQ ID NO: 336), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 336, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 336.

141. The non-viral system of any one of claims 131-140, wherein the DNA binding polynucleotide comprises a nucleotide sequence having at least about 70% identity to SEQ ID NO: 316[marmoset LCV DBE repeat array].

142. The non-viral system of any one of claims 131-140, wherein the DNA binding polynucleotide comprises SEQ ID NO:

316.

143. The non-viral system of any one of claims 131-142, wherein the LCV is callitrichine gammaherpesvirus 3.

144. The non-viral system of any one of claims 131-143, wherein the DBD comprises an amino acid sequence set forth in SEQ ID NO: 322[marmoset LCV DBD], or an amino acid sequence having at least about 80% similarity to SEQ ID NO:

322.

145. The non-viral system of any one of claims 1-144, wherein the DBD selectively binds to the DNA binding polynucleotide or a portion thereof.

146. The non-viral system of any one of claims 1-145, wherein the DBD is about 140 to about 160 amino acid residues in length.

147. The non-viral system of any one of claims 70-146, wherein the DBD comprises an amino acid sequence having not more than about 90% similarity to SEQ ID NO: 18[EBNA1 DBD].

148. The non-viral system of any one of claims 70-146, wherein the DBD comprises at least about 15 to about 149 mismatches relative to SEQ ID NO:

18.

149. The non-viral system of any one of claims 70-146, wherein the DBD lacks a contiguous sequence of 10 amino acids present in SEQ ID NO:

18.

150. The non-viral system of claim 70-149, wherein the DBD lacks a sequence set forth in SEQ ID NOs: 221, 227, 233, 239, 246, 252, 258, 264, 270, and 276.

151. The non-viral system of any one of claims 70-150, wherein the one or more chromatin binding domains binds to at least one element of human chromatin.

152. The non-viral system of any one of claims 70-151, wherein the one or more chromatin binding domains binds to at least one element of the nuclear matrix or nuclear lamina.

153. The non-viral system of any one of claims 70-152, wherein the one or more chromatin binding domains binds to euchromatin, heterochromatin, or both.

154. The non-viral system of any one of claims 70-153, wherein the one or more chromatin binding domains binds to genomic DNA, a histone protein, a nucleosome, or a combination thereof.

155. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains is selected from a bromodomain, a PHD finger domain, a chromodomain, a MBT domain, a tudor domain, a PWWP domain, an ADD domain, a Zf-CW domain, an ankyrin repeat domain, a WD40 domain, and a combination thereof.

156. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains comprises an AT-hook.

157. The non-viral system of claim 156, wherein the AT-hook is from HMGA1, HMGA2, AF-17, SETBP1, TTF-I interacting peptide 5, SC1, X box-binding regulatory factor, LIM / homeodomain protein LH-2, Retinoblastoma-binding protein 1, ELF3, DFS70, ZNF213, Peregrin, Methyl-CpG-binding protein 2, or MLLT10.

158. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains comprises a histone protein or portion thereof.

159. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains comprises an IL-33 chromatin-binding sequence.

160. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains comprises a chromatin binding domain of a Karposi’s sarcoma-associatedherpesvirus (KSHV) latency-associated nuclear antigen (LANA) or a human papillomavirus H (HPV) E2 protein.

161. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains is selected from EBNA1 domain A, EBNA domain B, a homolog of an EBNA1 domain A, a homolog of an EBNA1 domain B, and a combination thereof.

162. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains comprises SEQ ID NO: 14[EBNA1 domain A], or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO:

14.

163. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains comprises SEQ ID NO: 16[EBNA1 domain B], or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO:

16.

164. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains comprise (i) SEQ ID NO: 14 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 14; and (ii) SEQ ID NO: 16, or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 16, wherein (i) and (ii) are operably linked.

165. The non-viral system of any one of claims 1 and 70-154, wherein the one or more chromatin binding domains comprises an amino acid sequence selected from SEQ ID NOs: 338-340 and 347[old world monkey LCV domain As], or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 338-340 and 347.

166. The non-viral system of any one of claims 1 and 70-154, wherein the one or more chromatin binding domains comprises an amino acid sequence selected from SEQ ID NOs: 341-346[old world monkey LCV domain Bs], or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 341- 346.

167. The non-viral system of any one of claims 1 and 70-154, wherein the one or more chromatin binding domains comprise (i) an amino acid sequence selected from SEQ ID NOs: 338-340 and 347, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 338-340 and 347; and (ii) an amino acid sequence selected from SEQ ID NOs: 341-346, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 341- 346, wherein (i) and (ii) are operably linked.

168. The non-viral system of claim 164 or 167, wherein (i) is upstream of (ii).

169. The non-viral system of claim 164 or 167, wherein (ii) is upstream of (i).

170. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains comprises a sequence of linked amino acids according to the formula Nʹ- [A]-[L]-[B]-Cʹ, wherein A and B are each independently selected from SEQ ID NO: 14, an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 14, SEQ ID NO: 16, and an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 16, and wherein L, if present, is a spacer between A and B.

171. The non-viral system of any one of claims 70-154, wherein the one or more chromatin binding domains comprises a sequence of linked amino acids according to the formula Nʹ- [A]-[L]-[B]-Cʹ, wherein A and B are each independently an amino acid sequence set forth in SEQ ID NOs: 338-347 or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 338-347, and wherein L, if present, is a spacer between A and B.

172. The non-viral system of any one of claims 70-171, wherein the DBD is directly fused to the one or more chromatin binding domains.

173. The non-viral system of any one of claims 70-171, wherein the DBD is linked to the one or more chromatin binding domains via a linker.

174. The non-viral system of claim 173, wherein the linker is a peptide linker.

175. The non-viral system of claim 173, wherein the peptide linker is a Gly-Ser linker.

176. The non-viral system of any one of claims 70-175, wherein the one or more chromatin binding domains is operably-linked to the N-terminus of the DBD.

177. The non-viral system of any one of claims 70-175, wherein a C-terminus of the DBD is operably-linked to the one or more chromatin binding domains.

178. The non-viral system of any one of claims 70-177, wherein the DNA-binding protein comprises one chromatin binding domain.

179. The non-viral system of any one of claims 70-177, wherein the DNA-binding protein comprises two or more chromatin binding domains.

180. The non-viral system of any one of claims 70-179, wherein the DNA-binding protein further comprises one or more nuclear localization sequences (NLSs), and wherein the one or more NLSs are positioned at the N-terminus, at the C-terminus, between the one or more chromatin-binding domains and the DBD, or a combination thereof.

181. The non-viral system of claim 180, wherein the one or more NLSs is selected from a monopartite NLS, a bipartite NLS, a non-classical NLS, and a combination thereof.

182. The non-viral system of any one of claims 70-181, wherein the one or more NLSs is selected from a c-Myc NLS, SV40 NLS, a nucleoplasmin NLS, a 53BP1 NLS, an ING4 NLS, an IER5 NLS, and an ERK5 NLS, or wherein the one or more NLSs comprises an amino acid sequence having at least about 90% identity to an amino acid sequence selected from SEQ ID NOs: 17 and 35-50.

183. A non-viral system for expression of at least one transgene, the system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, and (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide, wherein(I) the DNA-binding protein comprises an amino acid sequence having at least about 80% similarity to an amino acid sequence selected from SEQ ID NOs 215-220 and the polynucleotide comprise a sequence having at least about 80% identity to SEQ ID NO: 69; (II) the DNA-binding protein comprises an amino acid sequence selected from SEQ ID NOs 215-220 and the polynucleotide comprises SEQ ID NO: 69; (III) the DNA-binding protein comprises an amino acid sequence having at least about 80% similarity to SEQ ID NO 322 and the polynucleotide comprise a sequence having at least about 80% identity to SEQ ID NO: 316; or (IV) the DNA-binding protein comprises SEQ ID NO 322 and the polynucleotide comprises SEQ ID NO:

316.

184. The non-viral system of any one of claims 1-183, wherein the recombinant expression vector comprises one polynucleotide.

185. The non-viral system of any one of claims 1-183, wherein the recombinant expression vector comprises more than one polynucleotide.

186. The non-viral system of any one of claims 1-185, wherein the at least one transgene encodes a non-coding RNA (ncRNA), a polypeptide, or a combination thereof.

187. The non-viral system of any one of claims 1-186, wherein the at least one transgene encodes a ncRNA selected from a ribosomal RNA, a transfer RNA, an immunostimulatory RNA, and a small RNA.

188. The non-viral system of claim 187, wherein the small RNA is selected from an antisense oligonucleotide, a small interfering RNA, a short hairpin RNA, a microRNA, a small nucleolar RNA, and a small nuclear RNA.

189. The non-viral system of any one of claims 1-186, wherein the at least one transgene encodes a polypeptide.

190. The non-viral system of claim 189, wherein the polypeptide is selected from intracellular polypeptide, a secreted polypeptide, a membrane-bound polypeptide, and a transmembrane polypeptide.

191. The non-viral system of claim 189 or 190, wherein the polypeptide is selected from a hormone, an antibiotic, an enzyme, a signaling protein, and a structural protein.

192. The non-viral system of any one of claims 189-191, wherein the polypeptide is an immunomodulatory polypeptide.

193. The non-viral system of claim 192, wherein the immunomodulatory polypeptide is selected from a cytokine, a chemokine, an immune cell activator, a multispecific immune cell engager, an antibody or antigen binding fragment thereof, and a TME modulator.

194. The non-viral system of claim 192 or 193, wherein the immunomodulatory polypeptide is a cytokine.

195. The non-viral system of claim 192 or 193, wherein the immunomodulatory polypeptide is an antibody or antigen binding fragment thereof.

196. The non-viral system of claim 192 or 193, wherein the immunomodulatory polypeptide is an immune checkpoint inhibitor.

197. The non-viral system of any one of claims 1-196, wherein the polynucleotide is about 0.1 kb, about 0.2 kb, about 0.3 kb, about 0.4 kb, about 0.5 kb, about 0.6 kb, about 0.7 kb, about 0.8 kb, about 0.9 kb, about 1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, or about 2 kb in length.

198. The non-viral system of any one of claims 1-197, wherein the DNA binding protein is 100 to 500 residues, 100 to 600 residues, 100 to 700 residues, 100 to 800 residues, 100 to 900 residues, 100 to 1,000 residues, 200 to 500 residues, 200 to 600 residues, 200 to 700 residues, 200 to 800 residues, 200 to 900 residues, 200 to 1,000 residues, 300 to 500 residues, 300 to 600 residues, 300 to 700 residues, 300 to 800 residues, 300 to 900 residues, or 300 to 1,000 residues in length.

199. The non-viral system of any one of claims 1-69, 103-113 and 184-198, wherein the mRNA is present at about 5%, 10%, 15%, 20%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, or about 70% by mass of the total nucleic acid.

200. The non-viral system of any one of claims 1-69, 103-113 and 184-198, wherein the mRNA is present at about 10% to about 20% or about 10% to about 40% by mass of the total nucleic acid.

201. The non-viral system of any one of claims 1-69, 103-113 and 184-200, wherein the mRNA and the recombinant expression vector are present at a 1:1 molar ratio.

202. The system of any one of claims 1-69, 103-113 and 184-201, wherein the recombinant expression vector is a plasmid DNA.

203. The system of any one of claims 1-69, 103-113 and 184-201, wherein the recombinant expression vector is a linear DNA vector.

204. The non-viral system of any one of claims 1-69, 103-113 and 184-203, wherein the mRNA, the recombinant expression vector, or both are formulated in a lipid nanoparticle (LNP).

205. The non-viral system of claim 204, wherein the mRNA and the recombinant expression vector are formulated in the same LNP.

206. The non-viral system of claim 204, wherein the mRNA and the recombinant expression vector are individually formulated in LNPs.

207. The non-viral system of any one of claims 1-69, 103-113 and 184-206, wherein when the system is introduced to the cell, the DNA-binding protein is transcribed from the mRNA and the DBD binds to the one or more DBEs.

208. The non-viral system of any one of claims 1-69, 103-113 and 184-207, wherein binding of the DBD to the one or more DBEs results in (i) tethering the recombinant expression vector to chromatin during mitosis, (ii) increased nuclear uptake of therecombinant expression vector, (iii) increased transcription of the transgene encoded in the recombinant expression vector, or (iv) a combination of (i)-(iii), as compared to introducing to the cell the recombinant expression vector alone.

209. The non-viral system of claim 207 or 208, wherein expression of the at least one transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold, about 55-fold, about 60-fold, about 65-fold, about 70-fold, about 75-fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, about 100-fold, about 110-fold, about 120-fold, about 130-fold, about 140-fold, about 150- fold, about 160-fold, about 170-fold, about 180-fold, about 190-fold, about 200-fold, about 250-fold, about 300-fold, about 350-fold, about 400-fold, about 450-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1x103-fold, about 5x103-fold, or about 1x104-fold as compared to introducing to the cell the recombinant expression vector alone.

210. The non-viral system of claim 207 or 208, wherein expression of the at least one transgene in the cell is increased by at least about 5-fold, about 6-fold, about 7-fold, about 8- fold, about 9-fold, or about 10-fold as compared to introducing the system to a control cell contacted with a mitosis inhibitor.

211. The non-viral system of any one of claims 70-198, comprising the DNA-binding protein as a polypeptide.

212. The non-viral system of claim 211, wherein the DNA-binding protein and the recombinant expression vector are in the same composition.

213. The non-viral system of claim 211, wherein the DNA-binding protein and the recombinant expression vector are in different compositions.

214. The non-viral system of claim 211, wherein the DNA-binding protein and the recombinant expression vector are formulated in different lipid nanoparticles (LNPs).

215. The non-viral system of claim 211, wherein the DNA-binding protein and the recombinant expression vector are formulated in the same LNP.

216. The non-viral system of any one of claims 70-198, comprising the nucleic acid encoding the DNA-binding protein.

217. The non-viral system of claim 216, wherein the nucleic acid is an mRNA comprising an open reading frame (ORF) encoding the DNA-binding protein.

218. The non-viral system of claim 217, wherein the mRNA and the recombinant expression vector are present at a 10:1 to a 1:10 molar ratio.

219. The non-viral system of claim 217, wherein the mRNA and the recombinant expression vector are present at an about 1:1 molar ratio.

220. The non-viral system of claim 217 or 218, wherein the mRNA has a mass percent of about 5% to about 60% of the total nucleic acid.

221. The non-viral system of any one of claims 216-220, wherein the nucleic acid and the recombinant expression vector are in the same composition.

222. The non-viral system of any one of claims 216-220, wherein the nucleic acid and the recombinant expression vector are in different compositions.

223. The non-viral system of any one of claims 216-220, wherein the nucleic acid and the recombinant expression vector are formulated in different LNPs.

224. The non-viral system of any one of claims 216-220, wherein the nucleic acid and the recombinant expression vector are formulated in the same LNP.

225. The non-viral system of any one of claims 70-198, comprising the recombinant expression comprising the nucleic acid encoding the DNA binding protein.

226. The non-viral system of claim 225, wherein the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are in the same composition.

227. The non-viral system of claim 225, wherein the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are in different compositions.

228. The non-viral system of claim 225, wherein the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are formulated in different LNPs.

229. The non-viral system of claim 225, wherein the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are formulated in the same LNP.

230. The non-viral system of any one of claims 70-229, wherein the recombinant expression vector is a plasmid DNA or a close-ended linear DNA vector.

231. The non-viral system of any one of claims 1-230, wherein the transgene is operably linked to a promoter, optionally wherein the promoter is a tumor-specific promoter.

232. The non-viral system of any one of claims 70-198 and 211-231, wherein when the non-viral system is introduced to a cell, the DNA-binding protein, or the DNA-binding protein produced from the nucleic acid or the recombinant expression vector encoding the DNA-binding protein, binds to the DNA binding polynucleotide of the recombinant expression vector, thereby increasing expression of the at least one transgene.

233. The non-viral system of claim 232, wherein the DNA-binding protein (i) increases nuclear uptake of the recombinant expression vector, (ii) tethers the recombinant expression vector to chromatin, (iii) increases the retention of the recombinant expression vector in the nucleus during mitosis, or (iv) a combination of (i)-(iii).

234. The non-viral system of claim 232 or 233, wherein expression of the at least one transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold as compared to introducing the recombinant expression vector to the cell in the absence of the DNA-binding protein, the nucleic acid encoding the DNA-binding protein, or the recombinant expression vector encoding the DNA- binding protein.

235. The non-viral system of any one of claims 232-234, wherein expression of the at least one transgene is increased by about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold about 55-fold, about 60-fold, about 65-fold, about 70- fold, about 75-fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, or about 100- fold, about 110-fold, about 120-fold, about 130-fold, about 140-fold, about 150-fold, about 160-fold, about 170-fold, about 180-fold, about 190-fold, or about 200-fold.

236. The non-viral system of any one of claims 1-235, wherein the polynucleotide is 5′ of the at least one transgene.

237. The non-viral system of any one of claims 1-235, wherein the polynucleotide is 3′ of the at least one transgene.

238. The non-viral system of any one of claims 1-93, 100-130, and 145-237, wherein the recombinant expression vector comprises at least one second polynucleotide comprising one or more DBEs of an EBV OriP.

239. An LNP comprising the non-viral system of any one of claims 1-203, 207-213, 216- 222, 225-227, and 230-238.

240. A cell comprising the non-viral system of any one of claims 1-238 or the LNP of claim 239.

241. The cell of claim 240, wherein the cell is a dividing cell.

242. A pharmaceutical composition comprising the non-viral system of any one of claims 1-238, and a pharmaceutically acceptable carrier.

243. A pharmaceutical composition comprising the LNP claim 239, and a pharmaceutically acceptable carrier.

244. A pharmaceutical composition comprising the cell of claim 240 or 241, and a pharmaceutically acceptable carrier.

245. A method of increasing expression of at least one transgene in a cell comprising contacting the cell with the non-viral system of any one of claims 1-238, the LNP of claim 239, or the pharmaceutical composition of claim 242 or 243, wherein upon introducing to the cell the system, the LNP, or the pharmaceutical composition, the DBD binds to the one or more DBEs, thereby increasing expression of the at least one transgene in the cell.

246. The method of claim 245, wherein the cell is a dividing cell.

247. The method of claim 245 or 246, wherein the cell is contacted ex vivo.

248. The method of claim 245 or 246, wherein the cell is contacted in vivo.

249. The method any one of claims 245-248, wherein binding of the DBD to the one or more DBEs results in (i) increased nuclear uptake of the recombinant expression vector, (ii) increased transcription of the transgene encoded in the recombinant expression vector, or (iii) a combination of (i)-(ii), as compared to introducing to the cell the recombinant expression vector alone.

250. The method of any one of claims 245-249, wherein expression of the at least one transgene is increased by at least about 40-fold, about 45-fold, about 50-fold, about 55-fold, about 60-fold, about 65-fold, about 70-fold, about 75-fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, about 100-fold, about 110-fold, about 120-fold, about 130-fold, about 140-fold, about 150-fold, about 160-fold, about 170-fold, about 180-fold, about 190- fold, about 200-fold, about 250-fold, about 300-fold, about 350-fold, about 400-fold, about 450-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1x103-fold, about 5x103-fold, or about 1x104-fold as compared to introducing to the cell with the recombinant expression vector alone.

251. A method of treating a disease or disorder to a subject, the method comprising administering to a subject an effective amount of the non-viral system of any one of claims 1- 238, the LNP of claim 239, the cell of claim 240 or 241, or the pharmaceutical composition of any one of claims 242-244.

252. The method of claim 251, wherein the subject has cancer.

253. The method of claim 251 or 252, wherein the effective amount is administered systemically.

254. The method of claim 252, wherein the effective amount is administered intratumorally.

255. Use of the non-viral system of any one of claims 1-238, the LNP of claim 239, the cell of claim 240 or 241, or the pharmaceutical composition of any one of claims 242-244 for treating a disease or disorder in a subject.

256. Use of the non-viral system of any one of claims 1-238, the LNP of claim 239, the cell of claim 240 or 241, or the pharmaceutical composition of any one of claims 242-244 in the manufacture of a medicament for treating a disease or disorder in a subject.

257. A kit comprising a container comprising the non-viral system of any one of claims 1- 238, the LNP of claim 239, the cell of claim 240 or 241, or the pharmaceutical composition of any one of claims 242-244, and a package insert comprising instructions for contacting a cell with the system, the LNP, the cell, or the pharmaceutical composition for increasing expression of at least one transgene.

258. The kit of claim 257, wherein the contacting is ex vivo.

259. The kit of claim 257, wherein the contacting is in vivo.

260. A kit comprising a container the non-viral system of any one of claims 1-238, the LNP of claim 239, the cell of claim 240 or 241, or the pharmaceutical composition of any oneof claims 242-244, and a package insert comprising instructions for administering the system, the LNP, the cell, or the pharmaceutical composition to a subject for treating a disease or disorder.

261. A method for increasing expression of at least one transgene in a dividing cell comprising contacting the cell with a system comprising: (i) an mRNA comprising an ORF encoding a DNA-binding protein, wherein the DNA-binding protein comprises (a) one or more chromatin-binding domains; and (b) a polypeptide comprising an EBNA1 DBD, wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DBEs of an EBV OriP, wherein (ii)(a) and (b) are operably-linked, thereby increasing expression of the at least one transgene in the dividing cell.

262. A method for increasing expression of at least one transgene in a dividing cell comprising contacting the cell with a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog, wherein the EBNA1 homolog is of a NHP LCV, and (b) one or more chromatin-binding domains; wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DBEs selected from a DBE of an EBV, or a variant thereof, and a DBE of an NHP LCV, or a variant thereof, wherein (ii)(a) and (b) are operably- linked, thereby increasing expression of the at least one transgene in the dividing cell.

263. The method of claim 261 or 262, wherein expression of the at least one transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold as compared to introducing the recombinant expression vector alone.

264. The method of claim 261 or 262, wherein expression of the at least one transgene is increased by about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about45-fold, about 50-fold about 55-fold, about 60-fold, about 65-fold, about 70-fold, about 75- fold, about 80-fold, about 85-fold, about 90-fold, about 95-fold, or about 100-fold, about 110- fold, about 120-fold, about 130-fold, about 140-fold, about 150-fold, about 160-fold, about 170-fold, about 180-fold, about 190-fold, about 200-fold, about 250-fold, about 300-fold, about 350-fold, about 400-fold, about 450-fold, about 500-fold, about 600-fold, about 700- fold, about 800-fold, about 900-fold, about 1x103-fold, about 5x103-fold, or about 1x104-fold as compared to introducing the recombinant expression vector alone.

265. The method of claim 261 or 262, wherein expression of the at least one transgene is increased by at least about 5-fold, about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 45-fold, about 50-fold as compared to introducing the system to a control cell contacted with a mitosis inhibitor.

266. The method of claim 261 or 262, wherein expression of the at least one transgene is increased by about 10-fold to about 102-fold, about 10-fold to about 103-fold, about 102-fold to about 103-fold, about 102-fold to about 104-fold, or about 103-fold to about 104-fold, as compared to introducing the system to a control cell contacted with a mitosis inhibitor.

267. The method of any one of claims 261-266, wherein the introducing is ex vivo.

268. The method of any one of claims 261-266, wherein the introducing is in vivo.

269. A method for selectively expressing at least one transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) an mRNA comprising an ORF encoding a DNA-binding protein, wherein the DNA-binding protein comprises (a) one or more chromatin-binding domains; and (b) a polypeptide comprising an EBNA1 DBD, wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DBEs of an EBV OriP, wherein (ii)(a) and (b) are operably linked, thereby selectively expressing the at least one transgene in the target tissue and / or target cell population.

270. A method for selectively expressing at least one transgene in a target tissue and / or target cell population in a subject, comprising administering to the subject a system comprising: (i) a DNA-binding protein, a nucleic acid encoding the DNA-binding protein, or a recombinant expression vector comprising the nucleic acid, wherein the DNA-binding protein comprises (a) a DBD of an EBNA1 homolog, wherein the EBNA1 homolog is of an NHP LCV, and (b) one or more chromatin-binding domains; wherein (i)(a) and (b) are operably-linked; (ii) a recombinant expression vector comprising (a) the at least one transgene; and (b) a polynucleotide comprising one or more DBEs selected from a DBE of an EBV, or a variant thereof, and a DBE of an NHP LCV, or a variant thereof, wherein (ii)(a) and (b) are operably- linked.

271. The method of claim 269 or 270, wherein the target tissue comprises tumor tissue.

272. The method of any one of claims 269-271, wherein the target cell population comprises tumor cells.

273. The method of any one of claims 269-272, wherein the system is administered systemically.

274. The method of claim 271 or 272, wherein the system is administered intratumorally.

275. The method of any one of claims 269-274, wherein expression of the at least one transgene in the target tissue and / or target cell population is increased by about 10-fold to about 100-fold as compared to administering the recombinant expression vector alone.

276. The method of any one of claims 269-274, wherein expression of the at least one transgene in the target tissue and / or target cell population is increased by about 10-fold, about 20-fold, about 30-fold, about 40-fold, or about 50-fold as compared to administering the recombinant expression vector alone 277. The method of any one of claims 269-276, wherein the at least one transgene is not substantially expressed in a non-target tissue and / or a non-target cell population.

278. The method of any one of claims 269-276, wherein expression of the at least one transgene in a non-target tissue and / or a non-target cell population is substantially equivalent to administering the recombinant expression vector alone.

279. The method of claim 277 or 278, wherein the non-target tissue comprises liver tissue and / or the non-target cell population comprises hepatocytes.

280. The method of any one of claims 277-279, wherein expression of the at least one transgene in the target tissue and / or the target cell population is at least about 10-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold higher as compared to the non-target tissue and / or non-target cell population.

281. The method of any one of claims 277-280, wherein expression of the at least one transgene in the target tissue and / or the target cell population is about 10-fold to about 50- fold, about 10-fold to about 100-fold, about 50-fold to about 100-fold, about 50-fold to about 200-fold, about 100-fold to about 200-fold, about 100-fold to about 300-fold, about 100-fold to about 500-fold, or about 100-fold to about 103-fold higher as compared to the non-target tissue and / or non-target cell population.

282. The method of any one of claims 262-268 and 270-281, wherein the NHP is of the family Hominoidea or Cercopithecoidea.

283. The method of any one of claims 262-268 and 270-281, wherein the NHP is of the family Hominoidea.

284. The method of claim 283, wherein the NHP is selected from the group consisting of species listed in Table 2.

285. The method of any one of claims 262-268 and 270-281, wherein the NHP is of the family Cercopithecoidea.

286. The method of claim 285, wherein the NHP is selected from the group consisting of species listed in Table 3.

287. The method of any one of claims 262-268 and 270-281, wherein the NHP is of the parvorder Platyrrhini.

288. The method of claim 287, wherein the NHP is selected from the group consisting of species listed in Table 4.

289. The method of claim 287, wherein the LCV is selected from Ateles paniscus lymphocryptovirus1, Callithrix penicillata lymphocryptovirus1, Leontopithecus rosalia lymphocryptovirus1, Pithecia pithecia lymphocryptovirus1, Saimiri sciureus lymphocryptovirus2, and Saimiri sciureus lymphocryptovirus33.

290. The method of any one of claims 262-268 and 270-289, wherein the DBD is a sequence represented by the formula: N′-[Xaa1]w-[A]-[Xaa2]x-[B]-[Xaa3]y-[C]-[Xaa4]z-C′, wherein Xaa1, Xaa2, Xaa3, and Xaa4 are any amino acid, wherein w, x, y, and z are integers referring to the number of amino acid residues, wherein w = 40-70, wherein x = 0-15, wherein y = 0-15, wherein z = 30-60, wherein [A], [B], and [C] are respectively a first, second, and third sequence motifs, wherein the first sequence motif has at least about 80% similarity to KX48X49X50YX51LRRX52 (SEQ ID NO: 284), wherein X48 is T, I, N, or W; X49 is C, S, P; X50 is V, L, C, or I; X51is N or S; and X52is C,G, or A, wherein the second sequence motif has at least about 80% similarity to RX61X62X63LX64RLPX65(SEQ ID NO: 285) , wherein X61is A, L, S, or I; X62is T or S; X63is P or T; X64is G, S, or F; and X65is Y or F, and wherein the third sequence motif has at least about 80% similarity to GPX71PX72PX73X74ES (SEQ ID NO: 286), wherein X71is Q or E; X72 is G or T; X73is L, M, or I; and X74is R, K, M, or L.

291. The method of claim 290, wherein the first sequence motif is KX48X49X50YX51LRRX52 (SEQ ID NO: 284).

292. The method of claim 290 or 291, wherein the first sequence motif has at least 80% similarity to a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293).

293. The method of any one of claims 290-292, wherein the first sequence motif is a sequence selected from KTSLYNLRRG (SEQ ID NO: 287), KTCCYNLRRC (SEQ ID NO: 288), KIPIYNLRRG (SEQ ID NO: 289), KTSCYNLRRC (SEQ ID NO: 290), KTCVYNLRRC (SEQ ID NO: 291), KNSCYNLRRC (SEQ ID NO: 292), and KWPLYSLRRA (SEQ ID NO: 293).

294. The method of any one of claims 290-293, wherein the second sequence motif is RX61X62X63LX64RLPX65(SEQ ID NO: 285).

295. The method of any one of claims 290-294, wherein the second sequence motif has at least 80% similarity to a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), and RISPLFRLPY (SEQ ID NO: 300).

296. The method of any one of claims 290-295, wherein the second sequence motif is a sequence selected from RLTPLSRLPF (SEQ ID NO: 294), RATPLSRLPY (SEQ ID NO: 295), RSTTLGRLPY (SEQ ID NO: 296), RLTPLGRLPF (SEQ ID NO: 297), RATPLGRLPY (SEQ ID NO: 298), RLTPLSRLPY (SEQ ID NO: 299), and RISPLFRLPY (SEQ ID NO: 300).

297. The method of any one of claims 290-296, wherein the third sequence motif is GPX71PX72PX73X74ES (SEQ ID NO: 286).

298. The method of any one of claims 290-296, wherein the third sequence motif has at least 80% similarity to a sequence selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES (SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304), and GPQPGPILES (SEQ ID NO: 305).

299. The method of any one of claims 290-296, wherein the third sequence motif is a sequence selected from GPQPGPLRES (SEQ ID NO: 301), GPQPGPLKES (SEQ ID NO: 302), GPQPGPMRES (SEQ ID NO: 303), GPEPTPLMES (SEQ ID NO: 304) and GPQPGPILES (SEQ ID NO: 305).

300. The method of any one of claims 290-299, wherein w = 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, or 58, 59, 60.

301. The method of any one of claims 290-300, wherein x = 6, 7, 8, 9, or 10.

302. The method of any one of claims 299-301, wherein y = 4, 5, 6, 7, or 8.

303. The method of any one of claims 299-302, wherein z = 48, 49, 50, 51, 52, or 53.

304. The non-viral system for expression of any one of claims 299-303, wherein [Xaa1]w comprises the amino acid sequence X1X2X3GGX4X5X6X7X8RGX9X10X11X12X13X14X15KX16X17X18X19X20X21X22X23X24X25LLX26RX27X28X29X30X31X32TX33X34X35X36X37WX38X39X40X41X42X43X44X45X46X47(SEQ ID NO: 306), wherein X1 is R, G, P, or K; X2 is K or P; X3 is K or R; X4 is W, V, or -; X5 is F or -; X6 is G, -, or Y; X7is K, -, R, or V; X8is H, -, R, or G; X9is Q, E, or C; X10is G or P; X11is G, A, or R; X12 is S, K, R, Y, A, or G; X13 is -, C, or G; X14 is N, H, F, or S; X15 is P, G, K, or -; X16 is F or Y; X17is E, T, D, or Q; X18is N, T, K, G, or S; X19is I, T, M, or L; X20is A or G; X21is E, K, Q, N, or D; X22 is G, N, or S; X23 is L, F, or I; X24 is R, T, K, or S; X25 is A, V, or K; X26 is A, N, D, S, or R; X27is–- or K; X28is S, R, C, K, or P; X29is H, Q, D, or E; X30is V, S, A, or I; X31 is E, P, or Q; X32 is R or T; X33 is T, S, or N; X34 is D, N, T, P, or E; X35 is E or T; X36 is G or A; X37 is T, R, N, D, G, S. or E; X38 is V, M, P, K, G, or C; X39 is A, N, F, Y, or C; X40 is G or A; X41 is V or L; X42 is F, M, L, or I; X43 is V, A, or I; X44 is Y or V; X45 is G or N; X46 is G, L, P, or Y; X47 is S, -, or C; and “-” is a deletion.

305. The non-viral system for expression of any one of claims 299-304, wherein [Xaa2]x comprises the amino acid sequence X53X54X55X56X57X58X59X60 (SEQ ID NO: 307), wherein X53 is T, L, I, or M; X54 is A, G, or S; X55is L, C, V, or I; X56is A or C; X57is I, A, V, or C; X58is P or N; X59is Q, E, W, or G; and X60 is C, V, or G.

306. The non-viral system for expression of any one of claims 299-305, wherein [Xaa3]y comprises the amino acid sequence GX66X67X68X69X70 (SEQ ID NO: 308), wherein X66 is M, S, Y, H, I, or T; X67 is A, S, or T; X68is P, F, or W; X69is G or E; and X70is P, T, A, or G.

307. The non-viral system for expression of any one of claims 299-306, wherein [Xaa4]zcomprises the amino acid sequence X75X76X77X78FX79X80FX81X82X83X84X85X86X87X88X89X90X91X92X93X94X95X96X97X98X99X100X101PX102PX103X104X105X106X107VX108X109X110X111FX112X113X114X115X116X117LP (SEQ IDNO: 309), wherein X75 is I, S, T, C, or G; X76 is V, T, D, E, or W; X77 is C, W, or S; X78 is Y or G; X79is M, L, or I; X80is V, F, or Y; X81is L, T, or V; X82is Q, P, or N; X83is T, S, or C; X84 is H, S, M, G, P, or W; X85 is I, L, Q, E, or P; X86 is F or S; X87 is A or G; X88 is E, D, or L; X89is V, D, C, or W; X90is L, I, or V; X91is K or A; X92is D or Q; X93is A or C; X94is I, L, or V; X95 is K, R, V, G, or L; X96 is D or V; X97 is L or Y; X98 is V, C, I, or L; X99 is M, T, S, or A; X100is T, A, or H; X101is K, H, or R; X102is A, G, L, Q, or P; X103is T or A; X104is C, R, S, or G; X105 is N, S, or D; X106 is I, T, V, or M; X107 is R, Q, or K; X108 is T, V, or S; X109 is V, L, F, or T; X110is C, M, or I; X111is S, N, T, E, or R; X112is D, E, T, or N; X113is D, G, or P; X114is G, S, or P; X115 is–- or G; X116 is V, I, or L; X117 is D, P, M, E, or H, and “-” is a deletion.

308. The method of claim 299, wherein the DBD comprises the amino acid sequence of SEQ ID NO:

310.

309. The method of any one of claims 262-268 and 270-281, wherein the DBD comprises an amino acid sequence having at least about 80% similarity to SEQ ID NO: 322[marmoset LCV DBD].

310. The method of any one of claims 262-268 and 270-281, wherein the DBD comprises SEQ ID NO:

322.

311. The method of any one of claims 262-268 and 270-281, wherein the DBD comprises an amino acid sequence having at least about 80% similarity to an amino acid sequence selected from SEQ ID NOs 215-220.

312. The method of any one of claims 262-268 and 270-281, wherein the DBD comprises an amino acid sequence selected from SEQ ID NOs 215-220.

313. The method of any one of claims 262-268 and 270-281, wherein the DBE is an EBV DBE or a variant thereof.

314. The method of any one of claims 262-268 and 270-281, wherein the DBE is an NHP LCV DBE or a variant thereof.

315. The method of claim 313, wherein the DBE comprises TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 51, or a nucleotide sequence having at least 80% identity to SEQ ID NO:

51.

316. The method of claim 314, wherein the DBE comprises (i) CGCCAACAAACGTTG (SEQ ID NO: 317), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 317, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 317; (ii) CAACACCCAGTCACGCAGTCTCAAGGGTCCT (SEQ ID NO: 318), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 318, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 318; (iii) TTTGTTGGCGCCAACAAA (SEQ ID NO: 319), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 319, or a nucleotide sequence having at least 80% identity to SEQ ID NO: 319; or (iv) AATGTTGGCGCCAACAAA(SEQ ID NO: 336), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 336, or a nucleotide sequence having at least 80% identity to SEQ ID NO:

336.

317. The method of any one of claims 261, 263-269, and 271-281, wherein the DBD comprises SEQ ID NO: 18, or an amino acid sequence having at least about 80% identity to SEQ ID NO:

18.

318. The method of any one of claims 261-317, wherein the one or more chromatin binding domains is operably linked to the N-terminus of the polypeptide, or wherein the polypeptide is operably linked to the N-terminus of the one or more chromatin binding domains.

319. The method of any one of claims 261-318, wherein the DNA-binding protein further comprises one or more NLSs.

320. The method of any one of claims 261-319, wherein the one or more chromatin binding domains bind to at least one element of the nuclear matrix or nuclear lamina.

321. The method of any one of claims 261-320, wherein the one or more chromatin binding domains binds to euchromatin, heterochromatin, or both.

322. The method of any one of claims 261-321, wherein the one or more chromatin binding domains binds to genomic DNA, a histone protein, a nucleosome, or a combination thereof.

323. The method of any one of claims 261-321, wherein the one or more chromatin binding domains are selected from a bromodomain, a PHD finger domain, a chromodomain, a MBT domain, a tudor domain, a PWWP domain, an ADD domain, a Zf-CW domain, an ankyrin repeat domain, a WD40 domain, and a combination thereof.

324. The method of any one of claims 261-322, wherein the one or more chromatin binding domains comprises an AT-hook.

325. The method of claim 324, wherein the AT-hook is from HMGA1, HMGA2, AF-17, SETBP1, TTF-I interacting peptide 5, SC1, X box-binding regulatory factor, LIM / homeodomain protein LH-2, Retinoblastoma-binding protein 1, ELF3, DFS70, ZNF213, Peregrin, Methyl-CpG-binding protein 2, or MLLT10.

326. The method of any one of claims 261-322, wherein the one or more chromatin binding domains comprises a histone protein or portion thereof.

327. The method of any one of claims 261-322, wherein the one or more chromatin binding domains comprises an IL-33 chromatin-binding sequence.

328. The method of any one of claims 261-322, wherein the one or more chromatin binding domains comprises a chromatin binding domain of a Karposi’s sarcoma-associated herpesvirus (KSHV) latency-associated nuclear antigen (LANA) or a human papillomavirus H (HPV) E2 protein.

329. The method of any one of claims 261-322, wherein the one or more chromatin binding domains are selected from EBNA1 domain A, EBNA domain B, and a combination thereof.

330. The method of any one of claims 261-322, wherein the one or more chromatin binding domains comprises SEQ ID NO: 14 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO:

14.

331. The method of any one of claims 261-322, wherein the one or more chromatin binding domains comprises SEQ ID NO: 16 or an amino acid sequence having at least about 80% sequence identity to SEQ ID NO:

16.

332. The method of any one of claims 261-322, wherein the one or more chromatin- binding domains comprises a sequence of linked amino acids comprising the formula Nʹ-[A]- [L]-[B]-Cʹ, wherein A and B are each independently selected from SEQ ID NO: 14, an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 14, SEQ ID NO: 16, and an amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 16, and wherein L, if present, is a spacer between A and B.

333. The method of any one of claims 261-322, wherein the DNA-binding protein comprises SEQ ID NO: 3 or an amino acid sequence having at least 80% identity to SEQ ID NO:

3.

334. The method of any one of claims 261-322, wherein the chromatin binding domain comprises an amino acid sequence selected from SEQ ID NOs: 338-340 and 347, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 338-340 and 347.

335. The method of any one of claims 261-322, wherein the chromatin binding domain comprises an amino acid sequence selected from SEQ ID NOs: 341-346, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 341-346.

336. The method of any one of claims 261-322, wherein the chromatin binding domain comprise (i) an amino acid sequence selected from SEQ ID NOs: 338-340 and 347, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 338-340 and 347; and (ii) an amino acid sequence selected fromSEQ ID NOs: 341-346, or an amino acid sequence having at least about 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 341-346, wherein (i) and (ii) are operably linked.

337. The method of claim 336, wherein (i) is upstream of (ii), or wherein (ii) is upstream of (i).

338. The method of any one of claim 261, 263-269, and 271-281, wherein the DNA- binding protein is a variant of an EBNA1 polypeptide, wherein the variant comprises (a) one or more EBNA1 chromatin binding domains, (b) the EBNA1 DBD, and (c) one or more modifications of an EBNA1 domain selected from a Gly-Ala repeat region, an NLS, a transactivation (TA) domain, and a combination thereof.

339. The method of claim 338, wherein the one or more modifications is selected from a deletion, an insertion, a substitution, and a combination thereof.

340. The method of claim 338 or 339, wherein the one or more modifications comprises a deletion of the Gly-Ala repeat region or a portion thereof.

341. The method of any one of claims 338-340, wherein the one or more modifications comprises a deletion of the NLS or portion thereof.

342. The method of any one of claims 338-341, wherein the one or more modifications comprises a substitution of the NLS or portion thereof.

343. The method of claim 342, wherein the NLS is substituted with a heterologous NLS, optionally a human NLS.

344. The method of any one of claims 338-343, wherein the one or more modifications comprises a deletion of the TA domain or a portion thereof.

345. The method of any one of claims 338-343, wherein the one or more modifications comprises a substitution of the TA domain or a portion thereof.

346. The method of any one of claims 338-343, wherein the one or more modifications comprises a deletion of the full TA domain.

347. The method of any one of claims 338-343, wherein the one or more modifications comprises a deletion or substitution of one or more antigens in the TA domain.

348. The method of claim 347, wherein the one or more antigens comprises a sequence motif having the amino acid sequence of SEQ ID NO:

101.

349. The method of any one of claims 338-340, wherein the one or more modifications comprises a deletion of the NLS or portion thereof and a deletion of the TA domain or portion thereof.

350. The method of any one of claims 338-340, wherein the at least one modification comprises a substitution of the NLS or portion thereof and a deletion of the TA domain or portion thereof.

351. The method of any one of claims 261, 263-269, and 271-281, wherein the DNA binding protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 3, 7- 11, 130, 133, 136, 139, 142, 145, 150, and 153 or an amino acid sequence having at least about 80% identity to an amino acid sequence set forth in any one of SEQ ID NOs: 3, 7-11, 130, 133, 136, 139, 142, 145, 150, and 153.

352. The method of any one of claims 261, 263-269, and 271-281, wherein the ORF comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 24-29, 129, 132, 135, 138, 141, 144, 149, and 152, or a nucleotide sequence having at least about 70% identity to a nucleotide sequence set forth in an any one of SEQ ID NOs: 24-29, 129, 132, 135, 138, 141, 144, 149, and 152.

353. The method of any one of claims 261-352, wherein the polynucleotide comprises at least 4 DBEs, and wherein the DBEs are the same or different.

354. The method of any one of claims 261-352, wherein the polynucleotide comprises 4 to 50, 4 to 40, 4 to 30, 4 to 20, 4 to 10, or 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 DBEs.

355. The method of claim 353 or 354, wherein the at least 4 DBEs are contiguous.

356. The method of claim 353 or 354, wherein the at least 4 DBEs are operably linked via a spacer sequence.

357. The method of claim 356, wherein the spacer sequence is about 1-56 nucleotides in length.

358. The method of claim 356, wherein the spacer sequence is 25-35 nucleotides in length.

359. The system of any one of claims 356-358, wherein each DBE comprises a 3ʹ spacer sequence, and wherein the length of the DBE and the 3ʹspacer sequence is about 20-50 nucleotides.

360. The method of any one of claims 261-352, wherein the DNA binding polynucleotide comprising a sequence represented by the formula 5ʹ-[D1]-[L1]-[D2]-[L2]-[D3]-[L3]-([Dn]-[Ln])x-3ʹ, wherein [D1], [D2], [D3], and [Dn], wherein [D1], [D2], [D3], and [Dn] each comprise the DBE; wherein [L1], [L2], [L3], and [Ln] are each selected from: a phosphate linkage and a spacer sequence of 1-56 nucleotides, and wherein x indicates the number of ([Dn]-[Ln]) units in the sequence and is an integer of 1-47 361. The method of claim 360, wherein x is 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17.

362. The system of claim 360 or 361, wherein [D1], [D2], [D3], and [Dn] are the same or different.

363. The system of any one of claims 360-362, wherein the spacer sequence is 25-35 nucleotides in length.

364. The system of any one of claims 360-363, wherein [D1]-[L1], [D2]-[L2], [D3]-[L3], and / or [Dn]-[Ln] have a length of about 20 to about 50 nucleotides.

365. The system of any one of claims 360-364, wherein the spacer sequence comprises a AT-content of greater than 50%.

366. The system of any one of claims 360-365, wherein [L1], [L2], [L3], and [Ln] are the same or different.

367. The method of any one of claims 261, 263-269, 271-281, and 317-366, wherein the one or more DBEs comprise TAGCATATGCTA (SEQ ID NO: 51), a nucleotide sequence having 1, 2, 3, or 4 mismatches relative to SEQ ID NO: 51, or a nucleotide sequence having at least 80% identity to SEQ ID NO:

51.

368. The method of any one of claims 261, 263-269, 271-281, and 317-367, wherein the polynucleotide comprises SEQ ID NO: 69 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

69.

369. The method of any one of claims 261, 263-269, 271-281, and 317-366, wherein the polynucleotide consists of SEQ ID NO: 69 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

69.

370. The method of any one of claims 261, 263-269, 271-281, and 317-366, wherein the polynucleotide comprises SEQ ID NO: 2 or a nucleotide sequence having at least about 70% identity to SEQ ID NO:

2.

371. The method of any one of claims 261, 263-269, 271-281, and 317-366, wherein the polynucleotide comprises a family of repeats (FR) or a portion thereof of the EBV OriP, and wherein the recombinant expression vector lacks a dyad symmetry (DS) of the EBV OriP.

372. The method of any one of claims 261-371, wherein the polynucleotide is about 0.1 kb, about 0.2 kb, about 0.3 kb, about 0.4 kb, about 0.5 kb, about 0.6 kb, about 0.7 kb, about 0.8 kb, about 0.9 kb, about 1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, or about 2 kb in length.

373. The method of any one of claims 261-372, wherein the DNA binding protein is 100 to 500 residues, 100 to 600 residues, 100 to 700 residues, 100 to 800 residues, 100 to 900 residues, 100 to 1,000 residues, 200 to 500 residues, 200 to 600 residues, 200 to 700 residues, 200 to 800 residues, 200 to 900 residues, 200 to 1,000 residues, 300 to 500 residues, 300 to 600 residues, 300 to 700 residues, 300 to 800 residues, 300 to 900 residues, or 300 to 1,000 residues in length.

374. The method of any one of claims 261, 263-269, 271-281, and 317-373, wherein the mRNA is present at about 5%, 10%, 15%, 20%, about 30%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, or about 70% by mass of the total nucleic acid.

375. The method of any one of claims 261, 263-269, 271-281, and 317-373, wherein the mRNA is present at about 10% to about 20% by mass of the total nucleic acid.

376. The method of any one of claims 261, 263-269, 271-281, and 317-373, wherein the mRNA is present at about 10% to about 40% by mass of the total nucleic acid.

377. The method of any one of claims 261, 263-269, 271-281, and 317-373, wherein the mRNA and the recombinant expression vector are present at a 1:1 molar ratio.

378. The system of any one of claims 261, 263-269, 271-281, and 317-377, wherein the recombinant expression vector is a plasmid DNA.

379. The system of any one of claims 261, 263-269, 271-281, and 317-377, wherein the recombinant expression vector is a linear DNA vector.

380. The method of any one of claims 261, 263-269, 271-281, and 317-379, wherein the mRNA, the recombinant expression vector, or both are formulated in a lipid nanoparticle (LNP).

381. The method of claim 380, wherein the mRNA and the recombinant expression vector are formulated in the same LNP.

382. The method of claim 380, wherein the mRNA and the recombinant expression vector are individually formulated in LNPs.

383. The method of any one of claims 261-382, wherein the at least one transgene encodes a non-coding RNA (ncRNA), a polypeptide, or a combination thereof.

384. The method of any one of claims 261-382, wherein the at least transgene encodes a ncRNA selected from a ribosomal RNA, a transfer RNA, an immunostimulatory RNA, and a small RNA.

385. The method of claim 384, wherein the small RNA is selected from an antisense oligonucleotide, a small interfering RNA, a short hairpin RNA, a microRNA, a small nucleolar RNA, and a small nuclear RNA.

386. The method of any one of claims 261-382, wherein the at least one transgene encodes a polypeptide.

387. The method of claim 386, wherein the polypeptide is selected from intracellular polypeptide, a secreted polypeptide, a membrane-bound polypeptide, and a transmembrane polypeptide.

388. The method of claim 386 or 387, wherein the polypeptide is selected from a hormone, an antibiotic, an enzyme, a signaling protein, and a structural protein.

389. The method of any one of claims 386-388, wherein the polypeptide is an immunomodulatory polypeptide.

390. The method of claim 389, wherein the immunomodulatory polypeptide is selected from a cytokine, a chemokine, an immune cell activator, a multispecific immune cell engager, an antibody or antigen binding fragment thereof, and a TME modulator.

391. The method of claim 389, wherein the immunomodulatory polypeptide is a cytokine.

392. The method of claim 389, wherein the immunomodulatory polypeptide is an antibody or antigen binding fragment thereof.

393. The method of claim 389, wherein the immunomodulatory polypeptide is an immune checkpoint inhibitor.

394. The method of any one of claims 262-268, 270-316, 318-373, and 383-393, comprising the DNA-binding protein as a polypeptide.

395. The method of claim 394, wherein the DNA-binding protein and the recombinant expression vector are in the same composition.

396. The method of claim 394, wherein the DNA-binding protein and the recombinant expression vector are in different compositions.

397. The method of claim 394, wherein the DNA-binding protein and the recombinant expression vector are formulated in different lipid nanoparticles (LNPs).

398. The method of claim 394, wherein the DNA-binding protein and the recombinant expression vector are formulated in the same LNP.

399. The method of any one of claims 262-268, 270-316, 318-373, and 383-393, comprising the nucleic acid encoding the DNA-binding protein.

400. The method of claim 399, wherein the nucleic acid is an mRNA comprising an open reading frame (ORF) encoding the DNA-binding protein.

401. The method of claim 400, wherein the mRNA and the recombinant expression vector are present at a 10:1 to a 1:10 molar ratio.

402. The method of claim 400 or 401, wherein the mRNA has a mass percent of about 5% to about 60% of the total nucleic acid.

403. The method of any one of claims 399-402, wherein the nucleic acid and the recombinant expression vector are in the same composition.

404. The method of any one of claims 399-402, wherein the nucleic acid and the recombinant expression vector are in different compositions.

405. The method of any one of claims 399-402, wherein the nucleic acid and the recombinant expression vector are formulated in different LNPs.

406. The method of any one of claims 399-402, wherein the nucleic acid and the recombinant expression vector are formulated in the same LNP.

407. The method of any one of claims 262-268, 270-316, 318-373, and 383-393, comprising the recombinant expression comprising the nucleic acid encoding the DNA binding protein.

408. The method of claim 407, wherein the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are in the same composition.

409. The method of claim 407, wherein the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are in different compositions.

410. The method of claim 407, wherein the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are formulated in different LNPs.

411. The method of claim 407, wherein the recombinant expression vector and the recombinant expression vector encoding the DNA binding protein are formulated in the same LNP.

412. The method of any one of claims 262-411, wherein the recombinant expression vector is a plasmid DNA.

413. The method of any one of claims 262-411, wherein the recombinant expression vector is a close-ended linear DNA vector.

414. The method of any one of claims 262-413, wherein the transgene is operably linked to a promoter, optionally wherein the promoter is a tumor-specific promoter.

415. The method of any one of claims 262-414, wherein the DNA binding polynucleotide is 5’ of the transgene.

416. The method of any one of claims 262-414, wherein the DNA binding polynucleotide is 3’ of the transgene.