Short peptide PRP1, and preparation method and use thereof
Patent Information
- Application Number
- NL2041042
- Authority / Receiving Office
- NL · NL
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2025-08-01
- Filing Date
- 2025-08-21
- Publication Date
- 2026-06-17
- Estimated Expiration
- 2045-08-21
AI Technical Summary
Existing methods for controlling tobacco PVY disease, including chemical and microbial approaches, are ineffective against systemic infections and have environmental drawbacks, while short peptides have not been adequately explored for this purpose.
A short peptide, PRP1, with an amino acid sequence ATKHIVGSIVAS, is synthesized and used to enhance tobacco resistance to PVY disease through injection during the seedling stage, combined with a recombinant vector and bacterial expression systems.
The peptide effectively reduces PVY virus amounts and enhances tobacco resistance, demonstrating significant inhibitory effects and environmental friendliness.
Abstract
Description
TECHNICAL FIELD
[0001] The present invention relates to the technical eld of genetic engineering, and more specically to a short peptide PRPl, and a preparation method and a use thereof. BACKGROUND ART
[0002] Potato virus Y (PVY) belongs to the Potyviridae family and the Potyvirus genus. The PVY has a wide host range and may infect a variety of Solanaceae plants. When tobacco plants are infected, symptoms such as leaf vein necrosis, mottled leaves and dwarng, resulting in tobacco PVY disease. Tobacco is one of the important economic crops and pillar industries in my country. As the main producing area in Hunan Province, the tobacco planting area has been continuously expanded in recent years. However, the occurrence of tobacco PVY disease has also been aggravated, seriously reducing the yield of tobacco and the quality of uecured tobacco leaves.
[0003] Aiming at the prevention and control of tobacco PVY disease, the prior art includes chemical prevention and control, microbial prevention and control and so on. The chemical prevention and control: commonly used chemicals include 3% hypersensitive protein microparticles, 2% cytosinpeptidemycin, and 5.6% pyrimidine-moroxydine, but the effectiveness depends on the timing of application. Only the early infection is inhibited, but the systemic infection is ineffective, and the broad spectrum is poor. Most of the medicinal agents are developed for tobacco mosaic virus (TMV), but the effect on PVY was not good. Microbial prevention and control: microbial preparations have poor stability, low environmental adaptability, large uctuation of eld control efcacy, scarce resources of weak strains, and the risk of restoring strong Virulence. Longterm use may induce virus variation and accelerate the emergence of drug resistant strains.
[0004] Short peptides are a class of small molecules composed of 220 amino acids that play an important role in plant life activities. Compared with other small molecules, short peptides have the signicant advantages of rich variety, signicant activity, and easy synthesis. However, there are few relevant studies on the use of a short peptide in the prevention and control of tobacco PVY disease.
[0005] Therefore, how to develop the short peptide for the prevention and control of tobacco PVY disease is a technical problem to be solved urgently by those skilled in the art. SUMMARY
[0006] In view of this, the present application provides a short peptide PRP1, and a preparation method and a use thereof, and the short peptide PRP1 may effectively control tobacco PVY disease, with obvious inhibitory effect and environmental friendliness.
[0007] A rst objective of the present application is to provide:
[0008] a short peptide PRP1, where an amino acid sequence of the short peptide PRP1 includes any one of the following:
[0009] 1) as shown in SEQ ID NO. 1; and
[0010] 2) or a sequence shown in SEQ ID NO. 1 after one or more bases are replaced, deleted and / or added, and the amino acid sequence still encodes a same functional protein.
[0011] As a preferred technical solution, a molecular weight of the short peptide PRP1 is 1182.65, an average hydrophilicity coefcient is 0.933, and a theoretical isoelectric point is 8.80.
[0012] Another objective of the present application is to provide a nucleic acid molecule, the nucleic acid molecule is a nucleic acid sequence encoding the short peptide PRP1 or a sequence completely complementary to the nucleic acid sequence.
[0013] Another objective of the present application is to provide a vector, and the vector includes the nucleic acid molecule.
[0014] Another objective of the present application is to provide a host cell, the host cell includes any one of the following:
[0015] 1) including the above nucleic acid molecule; and
[0016] 2) including the vector.
[0017] Another objective of the present application is to provide a recombinant bacterium, and the recombinant bacterium includes any one of the following:
[0018] 1) including the above nucleic acid molecule;
[0019] 2) including the above vector; and
[0020] 3) including the above host cell.
[0021] Another objective of the present application is to provide a use of the short peptide PRP1, and the use includes any one of the following:
[0022] 1) using in improving tobacco resistance to PVY; and
[0023] 2) using in preparing of medicines for preventing and / or treating tobacco PVY disease.
[0024] Another objective of the present application is to provide a use of the above nucleic acid molecule, the above vector, the above host cell or the above recombinant bacterium and the use includes any one of the following:
[0025] 1) using in preparation of short peptide PRP1;
[0026] 2) using in improving tobacco resistance to PVY; and
[0027] 3) using in preparing of medicines for preventing and / or treating tobacco PVY disease.
[0028] Another objective of the present application is to provide a medicine for preventing and / or treating tobacco PVY disease, including the above short peptide PRP1.
[0029] Another objective of the present application is to provide a preparation method of a short peptide PRP1, and the method includes any one of the following:
[0030] 1) prepared by sequential chemical synthesis;
[0031] 2) prepared by in vivo expression in prokaryotes; and
[0032] 3) prepared by in vivo expression in eukaryotes.
[0033] As can be seen from the technical solutions described above, the benecial effects of the present application compared to the prior art are as follows.
[0034] Through research, the present application identies a short peptide derived from an unknown protein that regulates tobacco resistance to PVY disease, named PVY resistance peptide (PRPl). Its amino acid sequence is ATKHIVGSIVAS, and the short peptide PRP1 is prepared by chemical synthesis. The use of short peptide injection during the seedling stage of tobacco may effectively reduce the amount of PVY Virus and improve the resistance of tobacco to PVY disease. BRIEF DESCRIPTION OF DRAWINGS
[0035] In order to more clearly describe the technical solutions in the embodiments of the present application or in the prior art, the drawings required for describing the embodiments or the prior art are briey described below. Obviously, the drawings in the following description show only some embodiments of the present application, and for those of ordinary skill in the art, other drawings may also be obtained from the provided drawings without creative labor.
[0036] FIG. 1 shows a chromatographic detection diagram and peak table of a prepared short peptide PRP1;
[0037] FIG. 2 shows a mass spectrum detection diagram of the prepared short peptide PRP1; and
[0038] FIG. 3 shows an identication diagram of PVY resistance of short peptide PRP1 injected into tobacco at a seedling stage; where A shows a symptom diagram of inoculated leaves after co- injection of PVY and PRPl small peptides into tobacco at the seedling stage, with H20 as a control, and small peptides are injected on a left side and H20 is injected on a right side; and B: Western Blotting is used to detect the leaf virus content of tobacco inoculated with small peptides PVY and PRP1 at the seedling stage. DETAILED DESCRIPTION OF EMBODIMENTS
[0039] The following technical solutions in the embodiments of the present application are described clearly and completely by reference to the drawings in the embodiments of the present application. It is obvious that the described embodiments are only some of the embodiments of the present application, rather than all embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative efforts are included in the scope of protection of the present application.
[0040] Example 1
[0041] Preparation of Short Peptide PRP1
[0042] The short peptide PRP1 was prepared using a solidstate synthesis of Fmoc, with Fmoc wang resin as a solid matrix, and a synthesis sequence was from (carboxyl end) to N end (amino end).
[0043] The synthesis method was as follows:
[0044] a 0.5 g dichlorotriphenylmethyl chloride resin was swelled with 10 mL DMF for 6090 min, then 0.36 g arginine and 100 uL DIA were added to react for 2 h, then 5 mL methanol and 100 L DIA were added to block an unreacted linker, and 5 mL 20% piperidine solution was used to remove a Fmoc protective group.
[0045] Subsequently, 0.45 g tryptophan, 0.58 g PyBoP, 0.15 g HoBT and 100 L DIEA were added sequentially to react for 2 h, and then 5 mL of 20% piperidine solution was used to remove the Fmoc protective group. This step was repeated to replace tryptophan with 0.42 g proline, 0.475 g isoleucine and 0.38 g leucine in sequence (the amino acid was rst reacted with DIEA each time, and then the F moc protective group was removed with piperidine). Finally, a cutting agent (TFA: water: triisopropylsilane = 95: 2.5: 2.5) was used for cutting, and the polypeptide was separated out in 10 mL of ether and nally freezedried in a freezedryer for later use.
[0046] The amino acid sequence of the short peptide PRP1 is ATKHIVGSIVAS, SEQ ID NO. 1.
[0047] A molecular weight of the short peptide PRP1 was determined to be 1182.65, an average hydrophilicity coefcient was 0.933, and a theoretical isoelectric point was 8.80 (FIG. 1 and FIG. 2).
[0048] Detection Process and Conditions of Chromatography and Mass Spectrometry:
[0049] chromatographic detection process and conditions: in the experiment, pump A was a 100% water solution containing 0.1% triuoroacetic acid, pump B was a 100% acetonitrile solution containing 0.1% triuoroacetic acid, a total ow rate was set at 1.0 mL / min, a detection wavelength was 214 nm, and an analytical column type was SHIMADZUInertsilODS-SP (4.6 >< 250 MM, SUM). A sample dissolution method was to take 0.5 mg of the sample, dissolved in 10% acetonitrile and 90% water to 0.5 mL, and an injection volume was 30 L. In addition, at the moment of 0.01 minute a pump module performed B.Cone operation with a value of 17; and at the moment of 20.00 minutes, the pump module performed B.Cone operation with the value of 37, thereby carrying out chromatographic detection and analysis.
[0050] Detection process and conditions of mass spectrometry: a sample was rst prepared, 0.1 mg of the sample was taken, dissolved in 50% acetonitrile and 50% water, and the volume was diluted to 0.5 mL. The mass spectrometry detection conditions were as follows: an injection volume was 1 L, an interface was ESL a pre-bias voltage was +4.5 kv, an atomizing gas ow rate was 1.50 L / min, a detector was 0.2 kv, a CDL temperature was 250°C, a transmission ow rate was 0.2 mL / min, a CDL voltage was 0 V, a module temperature was 200°C, and a mobile phase concentration was 50% water / 50% methanol.
[0051] Example 2
[0052] PVY Resistance Detection of Tobacco Seedlings Injected with Short Peptide PRP1
[0053] (1) Construction of PVY-GFP (pCamPVY-GZ-GFP) plasmid:
[0054] A: cDNA acquisition
[0055] The PVY isolates were taken from diseased tobacco plants in elds in Guizhou Province. Total RNA was extracted from tobacco tissues with TRIzol reagent (Invitrogen), treated with DNaseI without RNase, and cDNA was synthesized by reverse transcription with SuperScriptIV reverse transcriptase and specic primers. The specic primer sequences were as follows:
[0056] 3'-UTR-R: 5'-GTCTCCTGATTGAAGTTTACAGTCAC-3, SEQ ID N02; and
[0057] Oligo (dT) 18 oligonucleotide primers: 5' CAGGATCCAAGCTTTTTTTTTTTTTTTTTT5, SEQ ID NO. 3.
[0058] B : Acquisition of PVY Gene Fragment
[0059] The cDNA obtained in step A was used as a template, and the complete genome fragment of PVY was amplied by Phusion highdelity DNA polymerase using primers 5'-UTR-F and 3'- UTRR. The specic primer sequences were as follows:
[0060] 5'-UTRF: 5'-AAATTAAAACAACTCAATACAACATAAG-3', SEQ ID NO.4; and
[0061] 3'-UTR-R: 5'-GTCTCCTGATTGAAGTTTACAGTCAC-3, SEQ ID N05.
[0062] C: Construction of pPVYGZ Recombinant Vector
[0063] l) Amplication of pCambia0390 vector fragment
[0064] PCaTVBMV was used as a template, and pCam-NOS-F and pCam35S-R were used to amplify the pCambia0390 skeleton containing 35 S promoter from pCaTVBMV. The specic primer sequence was as follows:
[0065] pCam-NOS-F: 5'- CTTCAATCAGGAGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAACCCCGGGAATTCTAAGAGG-3', SEQ ID NO. 6;
[0066] pCam-3SS-R: 5'-GAGTTGTTTTAATTTCTCTCCAAATGAAATGAACTTCC-3', SEQ ID NO. 7; and
[0067] 2) Seamless Cloning and Construction of pPVYGZ
[0068] After PCR amplication, l L of DpnI restriction endonuclease was added, digested at 37°C for 2 h to remove the template plasmid residue, and then the PVY genome fragment obtained in step B was directionally cloned into pCambia0390 vector by using a seamless cloning system, and nally a recombinant plasmid pPVYGZ was successfully constructed.
[0069] D: Insertion of Introns for Stabilization
[0070] Plant introns were inserted into a key locus of PVY genome to prevent viral genes from being recognized as exogenous DNA in plant cells, enhancing the stability of expression, as follows:
[0071] a potato intron (GenBank: HM231144, intron l) was inserted at position 3387 / 3388 of the P3 gene of the PVY genome, and two potato introns (GenBank: A23739, intron 2; X55747, intron 3) were inserted at positions 3967 / 3968 and 5440 / 5441 of the CI gene, respectively.
[0072] 1) Segmental Amplication of Fragments Containing Introns
[0073] A specic construction process was as follows: rst, the intron fragments were amplied using the following primer pairs:
[0074] P3-intron1-F: 5'-TATGCAAGTTTACAGGTGAGTTTTCTAATCTGTATCCA-3', SEQ ID NO. 8;
[0075] intronl-P3-R: 5'- ATGTGAAATCGCGTTCAAGTTTGCGCTGAGAATACATCAAGATAAAGAAA-3', SEQ ID NO. 9;
[0076] P3-984F: 5'-ACTTGAACGCGATTTCAC-3', SEQ ID NO.10;
[0077] CI307-intron2-R: 5'- ATTATCAAATTCACACTTACCTGCTACACTAAGATGAACAGG3', SEQ ID NO. 11;
[0078] intron2-F: 5'-GTAAGTGTGAATTTGATAATTTGC-3', SEQ ID NO. 12;
[0079] intron2-R: 5'-CTGCAAGAACACCAGTTG-3' SEQ ID NO. 13;
[0080] intron2-CI308-F: 5'- TCCAACTGGTGTTCTTGCAGGATCTGTGCTTTTGATTGAACC-3', SEQ ID NO. 14;
[0081] CI 1 780-intron3 -R: 5'-ATGAATGAAGATTTGCTTACCTGCGGTGTAATCTTTTG-3', SEQ ID NO. 15;
[0082] intron3-F: 5'-GTAAGCAAATCTTCATTCATGA-3', SEQ ID NO. 16;
[0083] intron3R: 5'CTGTATAAACCTTAATGAATTAGCG3', SEQ ID NO. 17; and
[0084] using the above primers, ve fragments of intron 1, P3 (984) -CI (307) segment, intron 2, CI (308) C1 (1780) segment and intron 3 were obtained in sequence by PCR amplication;
[0085] 2) overlapping Extension PCR (SOE-PCR)
[0086] subsequently, the ve fragments were fused into a single continuous fragment using an overlapping extension PCR technology;
[0087] 3) pPVYGZ vector linearization
[0088] using primer pCam-intron3-CI-F: 5'- TTAAGGTTTATACAGAGAACATACAAAAACTTGAGAAAGTGAG3', SEQ ID NO. 18;
[0089] pCam-intronl-P3-R: 5'-CTGTAAACTTGCATATAGCTCCATG-3', SEQ ID NO. 19; and
[0090] the pPVYGZ plasmid constructed in step C was used to as a template for PCR amplication to obtain a linear vector skeleton fragment; and
[0091] 4) seamless Cloning and Construction of pCamPVYGZ
[0092] nally, a fusion fragment containing three introns (product of step 2) was inserted into a linearized vector (product of step 3) by a seamless cloning system, and the recombinant plasmid pCamPVYGZ was successfully constructed.
[0093] E: Insertion of GFP Reporter Gene
[0094] 1) Acquisition of Recombinant Fragment of SI-GFP-Sl
[0095] Primers GFP (SNTN)-F: 5'- TATGAAGTGCACCATCAAGGAAATagggccattacggccATGAGTAAAGGAGAAGAACTTTT CAC-3' SEQ ID NO. 20 were used; and
[0096] GFP (SNTN)-R: 5'- GATTGTGTCATTTCCTTGATGGTGCACTTCATAGGCCGAGGCGGCCTTTTTGTAGCTCA TCCATGCC-3', SEQ ID NO. 21; and through PCR amplication, SI restriction endonuclease cutting loci were introduced at both ends of the green uorescent protein (GFP) coding sequence to obtain SI-GFP-Sl recombinant fragments;
[0097] 2) vector Linearization
[0098] simultaneously, primers pCamCP-F: 5' -GGAAATGACACAATCGATGC-3', SEQ ID NO. 22 were used;
[0099] pCamNIb-R: 5'-ATGGTGCACTTCATAAGTATCGC-3, SEQ ID NO. 23; and
[00100] the linearized vector skeleton fragment was obtained by amplication from the recombinant plasmid pCamPVYGZ obtained in step D; and
[00101] 3) construction of PVY-GFP by seamless cloning
[00102] the SIGFPSI fragment was directionally inserted into the linearized vector skeleton fragment obtained in step 2) using a seamless cloning system, and nally the recombinant plasmid PVYGFP (pCamPVYGZGFP) was successfully constructed;
[00103] (note: the plasmid was constructed by Li Xiangdong's research group of Shandong Agricultural University and has been published in the paper 'Development and application of a full-length infectious clone of PVY isolate belonging to SYRl strain, De-Jie Cheng').
[00104] (2) Preparation of Tobacco Soaking Solution Containing PVYGFP
[00105] The GV3101 competent cells were placed on ice and thawed, and 1-5 L of PVY-GFP plasmid DNA (concentration 2 10 ng / L) was added; after gently mixing, an ice bath was performed for 5 min, liquid nitrogen freezing for 5 min, water bath heat shock at 37°C for 5 min, and ice bath cooling for 5 min were sequentially performed; then 400 L of antibioticfree YEP liquid medium was added, the cells were cultured at 28°C for l-2 h, 200 L of bacterial liquid was absorbed and coated on YEP solid medium containing rifampicin (50 g / rnL) and kanamycin (50 g / mL); the culture was inverted at 28°C for 2-3 days (colony diameter l-2mm); and single colonies were picked, colony PCR was performed with PVY or GFP specic primers, after the band size was conrmed to correct, it was cultured overnight in YEP liquid medium containing rifampicin (50 g / ml) and kanamycin (50 ug / ml), centrifuged at 5,000 rpm for 10 min, the supernatant was discarded, and the tobacco soaking solution was added, and the OD600 was adjusted to 0.1 to prepare the tobacco soaking solution containing PVY-GFP;
[00106] (3) Preparation of Working Solution of Short Peptide PRP1
[00107] The short peptide PRP1 powder was dissolved in water, and the working concentration was adjusted to 234.9734 M to prepare a short peptide PRP1 working solution;
[00108] (4) The Nicotiana benthamiana with the same growth condition was selected, and the circle injection range marks with the same size were made on the left and right sides of each cigarette with the same rank, the marked left treatment group of Nicotiana benthamiana was injected with 50 L short peptide PRP1 working solution, and the right control group was injected with 50 L sterile water; and
[00109] (5) Six hours after the injection, 100 L of tobacco soaking solution containing PVY- GFP was injected again, and the tobacco was placed in a greenhouse at a temperature of 26°C with a circadian rhythm of 16 h daylight / 8 h darkness for cultivation.
[00110] As shown in FIG. 3: 5 days after inoculation, under ultraviolet light, the virus emits uorescence, and the viral load in the left treatment group was signicantly lower than that in the right control group. Simultaneously, leaf proteins were extracted for immunblotting test. The results showed that the molecular weight of the virus in the treatment group injected with PRP1 was signicantly less than that in the control group, indicating that the resistance of tobacco to PVY disease was signicantly improved after injection of the short peptide PRP1.
[00111] Each embodiment in the present application is described in a progressive manner, the difference of each embodiment from each other is the focus of explanation. The same and similar parts between each of the embodiments can only be referred to each other.
[00112] The above description of the disclosed embodiments enables those skilled in the art to realize or use the present application. Various modications to these embodiments are obvious to those skilled in the art, and the general principles dened herein may be realized in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application is not to be limited to the embodiments shown herein, but is to be conformed to the widest scope consistent with the principles and novel features disclosed herein. bacco Corporation Hunan Branch Of China National Tobacco Corporation Tianbo IU Tianbo LIU SHORT PEPTIDE PRP1, AND PREPARATION METHOD AND USE HEREOF TECHNICAL FIELD 23 12 AA PAT source 1..12 mol_type protein organism synthetic construct ATKHIVGSIVAS 26 DNA PAT source 1..26 mol_type other DNA ganism synthetic construct gtctcctgattgaagtttacagtcac 30 DNA PAT source 1..30 ol_type other DNA organism synthetic construct caggatccaagctttttttttttttttttt 28 NA PAT source 1..28 mol_type other DNA organism synthetic construct aaattaaaacaactcaatacaacataag 26 DNA PAT source 1..26 mol_type other DNA ganism synthetic construct gtctcctgattgaagtttacagtcac 79 DNA PAT source 1..79 ol_type other DNA organism synthetic construct tcaatcaggagacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaccccgggaattct aagagg 38 DNA PAT source 1..38 mol_type other DNA organism synthetic construct agttgttttaatttctctccaaatgaaatgaacttcc 38 DNA PAT source 1..38 mol_type other NA organism synthetic construct tatgcaagtttacaggtgagttttctaatctgtatcca 50 DNA AT source 1..50 mol_type other DNA organism synthetic construct gtgaaatcgcgttcaagtttgcgctgagaatacatcaagataaagaaa 18 DNA PAT source 1..18 ol_type other DNA organism synthetic construct acttgaacgcgatttcac 42 DNA PAT urce 1..42 mol_type other DNA organism synthetic construct tatcaaattcacacttacctgctacactaagatgaacagg 24 DNA PAT source 1..24 mol_type her DNA organism synthetic construct gtaagtgtgaatttgataatttgc 18 DNA PAT urce 1..18 mol_type other DNA organism synthetic construct ctgcaagaacaccagttg 2 DNA PAT source 1..42 mol_type other DNA organism synthetic construct ccaactggtgttcttgcaggatctgtgcttttgattgaacc 38 DNA PAT source 1..38 mol_type her DNA organism synthetic construct atgaatgaagatttgcttacctgcggtgtaatcttttg 22 NA PAT source 1..22 mol_type other DNA organism synthetic construct aagcaaatcttcattcatga 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct ctgtataaaccttaatgaattagcg 43 DNA PAT source 1..43 mol_type her DNA organism synthetic construct aaggtttatacagagaacatacaaaaacttgagaaagtgag 25 DNA PAT source 1..25 mol_type her DNA organism synthetic construct ctgtaaacttgcatatagctccatg 65 DNA PAT urce 1..65 mol_type other DNA organism synthetic construct atgaagtgcaccatcaaggaaatagggccattacggccatgagtaaaggagaagaacttttcac 69 DNA PAT urce 1..69 mol_type other DNA organism synthetic construct attgtgtcatttccttgatggtgcacttcataggccgaggcggcctttttgtagagctcatccatgcc 20 DNA PAT urce 1..20 mol_type other DNA organism synthetic construct gaaatgacacaatcgatgc 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct atggtgcacttcataagtatcgc
Claims
1. A short peptide PRP1, characterized in that an amino acid sequence of the short peptide PRP1 is one of the following: 1) as shown by SEQ ID NO.]; and 2) as represented by the amino acid sequence of the sequence shown in SEQ ID NO.1 which still encodes the same functional protein after one or more bases have been replaced, removed and / or added.
2. The short peptide PRP1 according to claim 1, characterized in that it has a molecular weight of the short peptide PRP1 is 1182.65, an average hydrolicity coefficient is 0.933 and a theoretical isoelectric point is 8.
80.
3. A nucleic acid molecule, characterized in that the nucleic acid molecule has a nucleic acid sequence encoding the short peptide PRP1 according to any of claims 1 and 2 or a sequence that is completely complementary to the nucleic acid sequence.
4. A vector, characterized in that the vector comprises the material described in claim 3 nucleic acid molecule includes.
5. A host cell, characterised in that the host cell is one of the following: 1) comprising the nucleic acid molecule of claim 3; and 2) comprising the vector according to claim 4.
6. A recombinant bacterium, characterised in that the recombinant bacterium contains one of the next is: 1) comprising the nucleic acid molecule of claim 3; 2) comprising the vector according to claim 4; and 3) comprising the host cell of claim 5.
7. Use of the short peptide PRP1 according to any one of claims 1 and 2, characterized that the application is one of the following: 1) an application in improving tobacco resistance to potato virus Y; 2) an application in the preparation of medicinal products for the prevention and / or treatment of tobacco against potato virus Y disease.
8. A use of the nucleic acid molecule according to claim 3, the carrier according to claim 4, the host cell according to claim 5 or the recombinant bacterium according to claim 6, characterized in that the application is one of the following: 1) an application in the preparation of the short peptide PRP1; 2) an application in improving tobacco resistance to potato virus Y; 3) an application in the preparation of medicinal products for the prevention and / or treatment of tobacco against potato virus Y disease.
9. A medicinal product for the prevention and / or treatment of potato virus Y disease of the herb, characterized in that, comprising the short peptide PRP1 according to any of claims 1 and 2.
10. A preparation method for the short peptide PRP1, characterized in that the method comprises one of the following includes: 1) preparing by sequential chemical synthesis; 2) preparing by in vivo expression in prokaryotes; and 3) preparation by in vivo expression in eukaryotes. FIG. 1