Compositions and methods for rapid identification and phenotypic antimicrobial susceptibility testing of bacteria and fungi

Abstract

The present invention relates to compositions and methods for using polymerase chain reaction (PCR) as a reporter assay to rapidly and simultaneously identify and phenotype bacteria for antimicrobial susceptibility (AST). The present invention uses a strategy that has demonstrated the ability to multiplex and handle multiple bacterial samples for antimicrobial susceptibility testing.

Description

Technical Field

[0001] Field of the Invention The present disclosure relates to the field of molecular diagnostics, and more particularly, to the identification and determination of antibacterial susceptibility of bacteria from biological samples.

Background Art

[0002] Background of the Invention There is an urgent need for the development or rapid and simple methods for detecting, identifying and determining the antibacterial susceptibility of bacterial pathogens in clinical samples for use as indicators for the diagnosis and treatment of infectious diseases. A good example of the need for such methods is bloodstream infection (BSI). BSI is ranked among the top 7 causes of death in North America and Europe, with an estimated 1.7 million sepsis events annually in the United States, 270,000 deaths annually, and contributing to annual US healthcare costs of $14 billion. It has been shown that reducing the time to directed antimicrobial therapy improves morbidity and mortality in septic patients, resulting in shorter length of stay (LOS) and reduced hospital costs. Faster susceptibility results enable more rapid de-escalation of antimicrobials, resulting in fewer adverse effects and less contribution to drug resistance. Therefore, there is still a need for the development of assays and test systems that provide rapid phenotypic antibacterial susceptibility results in BSI that enable clinicians to more rapidly provide the most appropriate antimicrobial therapy and improve patient outcomes.

[0003] Polymicrobial bloodstream infection (BSI), defined as the presence of at least two different microorganisms found in blood cultures, has been reported even more, and the proportion ranges from 6% to 32% of all BSI incidences. The mortality rate of inpatients with polymicrobial BSI ranges from 21% to 63%, which is approximately twice that of patients with single-organism infections.

[0004] Conventional antimicrobial susceptibility testing (AST) is performed by growing a given bacterium in the presence of a given antimicrobial agent, which can be done in both liquid culture and solid agar medium. The two most common methods of AST are: 1) microdilution and 2) disk diffusion (also known as Kirby-Bauer). Microdilution provides both quantitative (minimum inhibitory concentration) and qualitative (susceptibility, intermediate, and resistance) results. Disk diffusion provides only qualitative results.

[0005] The microdilution method is performed by incubating a given bacterium in the presence of multiple concentrations of an antimicrobial agent. After incubation, bacterial growth / absence of growth is observed at each concentration of the antimicrobial agent. The lowest concentration at which no growth is observed is the minimum inhibitory concentration (MIC), which has units of μg / mL. Established guidelines provide “breakpoints” where experimentally determined MIC values ​​for a particular bacterial group or species are interpreted as susceptible, intermediate, or resistant to a given antimicrobial agent.

[0006] The disk diffusion method is performed by creating a "bacterial flora" of a given bacterium on a solid agar plate, and then placing a single antibiotic disk on the agar plate. The antibiotic in the disk diffuses into the medium, and after incubation, a circular inhibition region forms around the disk. The diameter of the region, along with information about the bacterial species and antimicrobial agent, is used in conjunction with a reference-established diameter breakpoint to determine whether the pathogen is susceptible, intermediate, or resistant to the given antimicrobial agent.

[0007] Generally, the two most commonly used guidelines for interpreting AST results are those from: 1) the Clinical Laboratory Standards Institute (CLSI), and 2) the European Commission on Antimicrobial Susceptibility Testing (EUCAST). The United States uses CLSI guidelines, while European countries use EUCAST guidelines. The latest version of CLSI is M100 ED30, and the latest version of EUCAST is version 10. [Overview of the Initiative]

[0008] Summary of the Invention This invention relates to a polymerase chain reaction (PCR)-based rapid identification and antimicrobial susceptibility testing (ID / AST) system, which supports an automated workflow for specific assay panels that utilize PCR technology for rapid identification and / or determination of bacterial antimicrobial susceptibility, directly from positive blood cultures for use in clinical laboratories. The system also has the capability to utilize and analyze samples from other sample types, such as urinary tract infections and respiratory infections. The PCR-based rapid ID / AST system provides a workflow from reagent-assisted sample processing to result interpretation, using instrument, consumables, reagents, and data management capabilities. Target identification and antimicrobial susceptibility results are output from the system.

[0009] The present invention also relates to a PCR-based rapid ID / AST bloodstream infection (BSI) panel, which is an in vitro diagnostic test that utilizes PCR technology for rapid identification of selected bacteria or fungi and performs phenotypic antimicrobial susceptibility testing (AST) against a PCR-based rapid ID / AST system. The PCR-based rapid ID / AST BSI assay can be performed directly on positive blood culture samples, on pre-positive blood cultures, or potentially directly from patient serum. This assay is presented as an aid in the diagnosis and identification of antimicrobial susceptibility of certain pathogens that can cause bacteremia. The panel is designed to analyze the most common BSI Gram-negative and Gram-positive pathogens that have fungal potential. The configuration, which combines the ID strategy with a TaqMan 5' nuclease real-time PCR assay, should provide the ability to provide minimum inhibitory concentration (MIC) and susceptibility, intermediate, and resistance (SIR) information for multiple bacterial samples, single bacterial samples, and, if necessary, isolate testing.

[0010] These results should be used in conjunction with other clinical and laboratory findings. Standard experimental protocols should be followed for processing positive blood cultures, and the availability of isolates for supplemental testing should be ensured as needed. The present invention also relates to PCR-based rapid ID / AST phenotypic screening tests, which are in vitro diagnostic tests, utilizing PCR technology for rapid identification and phenotypic susceptibility testing of target pathogens or groups of pathogens for a single drug, a class of drugs, or a combination of drugs. PCR-based rapid ID / AST screening assays are performed directly from clinical samples or bacterial / fungal isolates. These assays indicate the presence of problematic drug-resistant pathogens, which is useful for patient and hospital safety. Examples of these types of tests are for methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant Staphylococcus aureus, vancomycin-resistant enterococcus (VRE), carbapenem-resistant Enterobacteriaceae (CRE), Candida auris, and MDR Neisseria gonorrhoeae.

[0011] Accordingly, one aspect of the present invention relates to a method using a quantitative real-time PCR assay as a reporter to simultaneously identify and determine the antimicrobial susceptibility of a group of bacteria or fungi having similar or identical clinical breakpoints to at least one antimicrobial agent or a class of antimicrobial agents. In one embodiment, the target group of bacteria or fungi is present in bloodstream infections (BSIs), gastrointestinal infections, respiratory infections, urinary tract infections, nasal infections, rectal infections, or wound infections. In one embodiment, the identification of the group of bacteria or fungi is by detecting a signal specific to the group of bacteria or fungi. In one embodiment, the specific signal is detected by using primer oligonucleotides and probe oligonucleotides that selectively hybridize with target genes derived from the group of bacteria or fungi rather than target genes not derived from the group of bacteria or fungi. In one embodiment, the target genes are selected from rplP, ompA, tuf, rpoB, ddl, ddlA, fdnG, sodA, gyrB, O-antigen acetylase, ecfX, tusA, CPE, sip, and nuc.

[0012] In another embodiment, the group of bacteria or fungi represents a taxonomic order. In one embodiment, the taxonomic order is Enterobacteriales. In another embodiment, the group of bacteria or fungi includes a taxonomic family. In one embodiment, the taxonomic family is selected from Enterobacteriaceae, Yersiniaceae, Morganellaceae, or a combination of the aforementioned families. In yet another embodiment, the group of bacteria or fungi includes a taxonomic genus. In one embodiment, the taxonomic genus is selected from Enterococcus, Candida, Pseudomonas, Acinetobacter, Staphylococcus, Stenotrophomonas, Streptococcus, Escherichia, Klebsiella, Enterobacter, Salmonella, Citrobacter, Serratia, Yersinia, Morganella, Providencia, or Proteus.

[0013] In another embodiment, a group of bacteria or fungi represents a taxonomic species. In one embodiment, the taxonomic species are Enterococcus faecalis (Efs), Enterococcus faecium (Efm), Escherichia coli (Eco), Klebsiella pneumoniae (kpn), Klebsiella oxytoca (Kox), Enterobacter cloacae (Ecl), Enterobacter aerogenes (Kae), Citrobacter freundii (Cfi), Citrobacter koseri (Cko), and Morganella morganii. * aureus)(Sau), Staphylococcus epidermidis(Sep), Stenotrophomonas maltophilia(Sma), Streptococcus pneumoniae(Spn), Streptococcus agalactia(StreptococcusSelected from *Streptococcus agalactiae* (Sag) or *Streptococcus pyogenes* (Spy).

[0014] In yet another embodiment, the method further includes verifying the identification of a group of bacteria or fungi using additional primer and probe oligonucleotides that selectively hybridize a second target gene from a group of target bacteria or fungi rather than a second target gene that is not from a group of bacteria or fungi, or determining the mechanism of an antimicrobial susceptibility phenotype, toxin phenotype, or pathogenicity phenotype, or a step selected from both the verification and determination steps. In yet another embodiment, the method further includes simultaneously identifying and determining the antimicrobial susceptibility of one or more groups of bacteria or fungi, each of which has similar or identical clinical breakpoints to at least one antimicrobial agent or one class of antimicrobial agents.

[0015] In another embodiment, the present invention relates to a method of using a quantitative real-time PCR assay as a reporter to simultaneously identify and determine the susceptibility of Enterobacteriaceae bacteria to an antimicrobial agent or a class of antimicrobial agents by using primer oligonucleotides and probe oligonucleotides that selectively hybridize to a target gene that is a taxonomic order of Enterobacteriaceae rather than to a target gene that is not a taxonomic order of Enterobacteriaceae. In one embodiment, the target gene is selected from rplP, gyrB, and rpoB. In one embodiment, the primer oligonucleotides and probe oligonucleotides that selectively hybridize to a target gene that is a taxonomic order of Enterobacteriaceae rather than to a target gene that is not a taxonomic order of Enterobacteriaceae include a nucleotide sequence comprising SEQ ID NOs: 1-16. In one embodiment, the primer oligonucleotides and probe oligonucleotides that selectively hybridize to gyrB of Enterobacteriaceae rather than to gyrB of non-Enterobacteriaceae include a nucleotide sequence comprising SEQ ID NOs: 8-10.

[0016] In another embodiment, the present invention relates to a method of using a multiplexed quantitative real-time PCR assay as a reporter to simultaneously identify and determine the antimicrobial susceptibility of multiple bacterial or fungal strains from a biological sample, i.e., a multimicrobial biological sample. In one embodiment, the biological sample is selected from whole blood, plasma, serum, red blood cell fraction, saliva, cerebrospinal fluid, semen, feces, urine, nasal swab, wound swab, skin swab, rectal swab, bile, lymph, sputum, lavage fluid, or a combination thereof. In one embodiment, the biological sample is whole blood, plasma, serum, or a combination thereof. In one embodiment, the biological sample is cultured before performing the PCR assay. In another embodiment, the biological sample is a bacterial or fungal isolate. In another embodiment, multiple bacterial or fungal strains are grouped into at least one group of bacteria or fungi having similar or identical clinical breakpoints for at least one antimicrobial or antimicrobial class. In one embodiment, multiple bacterial or fungal strains are grouped into one or more groups of bacteria or fungi, each group of bacteria or fungi having similar or identical clinical breakpoints with respect to at least one antimicrobial agent or one class of antimicrobial agents.

[0017] In another embodiment, the identification of multiple bacterial strains is performed using multiple strain-specific 5' nuclease (TaqMan®) oligonucleotide probes labeled with fluorescent dyes having different emission wavelengths. In one embodiment, the identification of multiple bacterial strains is performed using TAGS (Temperature Assisted Generation of Signal) technology. In another embodiment, the method further includes a step of verifying the identification of multiple bacterial or fungal strains, or a step of determining the mechanism of antimicrobial susceptibility phenotype, toxin phenotype, or pathogenicity phenotype, or a step selected from both the verification and determination steps.

[0018] In another embodiment, the present invention relates to a method for simultaneously identifying and determining susceptibility, intermediate, and resistance (SIR) information of target bacterial or fungal strains or target groups of bacteria or fungi to an antimicrobial agent or class of antimicrobial agents using a quantitative PCR assay, wherein the identification of target strains or target groups and the determination of SIR information are derived from one or more mathematical relationships related to PCR data. In one embodiment, the mathematical relationship is selected from threshold cycle (Ct), gradient, sigmoid curve fitting inflection, absolute fluorescence intensity (AFI), or endpoint relative intensity (ERI). In another embodiment, the mathematical relationship is a relative expression of various antimicrobial agent concentrations or between various antimicrobial agents, selected from ΔCt, 2^(ΔCt), ΔInflection, ΔAFI, or ΔERI. In one embodiment, the mathematical relationship is a combination of mathematical relationships selected from threshold cycle (Ct), gradient, sigmoid curve fitting inflection, absolute fluorescence intensity (AFI), or endpoint relative intensity (ERI). In yet another embodiment, the mathematical relationship is a combination of various antimicrobial agent concentrations or relative expressions between various antimicrobial agents, selected from ΔCt, 2^(ΔCt), ΔInflection, ΔAFI, or ΔERI. In yet another embodiment, the method further includes a step of verifying the identification of a target bacterial or fungal strain or a target group of bacteria or fungi, or a step of determining the mechanism of an antimicrobial agent susceptibility phenotype, a toxin phenotype, or a pathogenicity phenotype, or both of the verification and determination steps. In yet another embodiment, the method further includes identifying and determining the antimicrobial agent susceptibility of one or more target bacterial or fungal strains or one or more target groups of bacteria or fungi, where each target strain or target group has a similar or identical clinical breakpoint to at least one antimicrobial agent or one class of antimicrobial agents. [Brief explanation of the drawing]

[0019] [Figure 1]In the absence of an antimicrobial agent (shown as the reference), bacteria proceed with genomic DNA replication. In the presence of the antimicrobial agent, resistant bacteria replicate with a similar genomic copy number to the reference, while susceptible bacteria have inhibited replication and a lower copy number. This difference in growth provides a phenotypic readout that can be determined by qPCR. [Figure 2A] Raw qPCR data are presented as growth curves where fluorescence (e.g., from a TaqMan probe) is measured at each PCR cycle. For resistant isolates, the growth curves are observed similarly regardless of the 4-hour incubation period at various antimicrobial concentrations, while for susceptible isolates, a dose-dependent decrease in fluorescence intensity and an increase in the number of cycles required for the signal to cross the background (threshold) level (this is commonly referred to as the cycle threshold or Ct value) are observed. [Figure 2B] The same qPCR data is expressed based on Ct values, where resistant isolates show little to no change in Ct values ​​as a function of antimicrobial agent concentration, while susceptible isolates show a dose-dependent increase in Ct values ​​by detecting fewer replicating bacteria. [Figure 3A] Mathematical relationships such as "gradient," "Ct," "inflection," "absolute fluorescence intensity (AFI)," and "endpoint relative intensity (ERI)" describe the behavior of the raw qPCR amplification curve. [Figure 3B] These characteristics can be further evaluated as a function of antimicrobial exposure by converting the values ​​obtained in the presence of the antimicrobial agent back to the values ​​obtained in the absence of the antimicrobial agent. Then, using the relative changes in these characteristics such as "ΔCt," "Δinflection," or "ΔAFI," the strain MIC to a given drug can be determined, and the resistance and susceptibility of the strain can be determined using approved breakpoints. [Figure 4] A partitioning model was used to classify bacterial isolates as either resistant or susceptible. The partitioning utilizes the Gini index to determine which features and thresholds maximize the variance between the two classes. Only two partitions were used to prevent overfitting, and a two-dimensional graphical representation was enabled for easier visualization. [Figure 5] A PCR assay using the primers and probes shown in Table III that target the gyrB gene was tested against common Gram-negative pathogens. Growth curves were observed only for the species that make up the Enterobacterales (including Escherichia coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, and P. mirabilis). No significant amplification was observed for non-target organisms. [Figure 6] A PCR assay using the primers and probes shown in Table II that target the rplP gene was tested against common Gram-negative pathogens. Growth curves were observed only for the species that make up the Enterobacterales. No significant amplification was observed for non-target organisms. [Figure 7] A PCR assay using the primers and probes shown in Table IV that target the rpoB gene was tested against common Gram-negative pathogens. Growth curves were observed only for the species that make up the Enterobacterales. No significant amplification was observed for non-target organisms. [Figure 8] A PCR assay using the primers and probes shown in Table V that target the ompA gene was tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pittii. Growth curves were observed only for the common pathogens belonging to the genus Acinetobacter (A. baumannii and A. pittii). No significant amplification was observed for non-target organisms. [Figure 9] A PCR assay using the primers and probes shown in Table VI that target the rpoB gene was tested against common Gram-negative pathogens. Growth curves were observed only for the common pathogens belonging to the genus Acinetobacter. No significant amplification was observed for non-target organisms. [Figure 10]The PCR assay using the primers and probes shown in Table VII targeting the gyrB gene was tested against common Gram-negative pathogens. Growth curves were observed only for common pathogens belonging to the genus Acinetobacter. No significant amplification was observed for non-target organisms. [Figure 11] The PCR assay using the primers and probes shown in Table VIII targeting the tuf gene was tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pittii. Growth curves were observed only for pathogens belonging to the genus Pseudomonas (Pseudomonas aeruginosa). No significant amplification was observed for non-target organisms. [Figure 12] The PCR assay using the primers and probes shown in Table IX targeting the gyrB gene was tested against common Gram-negative pathogens. Growth curves were observed only for pathogens belonging to the genus Pseudomonas (Pseudomonas aeruginosa). No significant amplification was observed for non-target organisms. [Figure 13] The PCR assay using the primers and probes shown in Table X targeting the rpoB gene was tested against common Gram-negative pathogens. Growth curves were observed only for pathogens belonging to the genus Pseudomonas (Pseudomonas aeruginosa). No significant amplification was observed for non-target organisms. [Figure 14] The PCR assay using the primers and probes shown in Table XI targeting the fdnG gene was tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pittii. Growth curves were observed only for the species Stenotrophomonas maltophilia. No significant amplification was observed for non-target organisms. [Figure 15]PCR assays using primers and probes shown in Table XII, targeting the gyrB gene, were tested against common Gram-negative pathogens. Growth curves were observed only for the species Stenotrophomonas maltophilia. No significant amplification was observed for non-target organisms. [Figure 16] PCR assays using primers and probes targeting the tuf gene, as shown in Table XIII, were tested against common Gram-negative pathogens. Growth curves were observed only for the species Stenotrophomonas maltophilia. No significant amplification was observed for non-target organisms. [Figure 17] PCR assays using primers and probes shown in Table XV that target the rpoB gene were tested against common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. piogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Growth curves were observed only for pathogens belonging to the genus Enterococcus (E. faecium and E. faecalis). No significant amplification was observed for non-target organisms. [Figure 18] PCR assays using primers and probes shown in Table XVI that target the ddl gene were tested against common Gram-positive pathogens. Growth curves were observed only for pathogens belonging to the genus Enterococcus (E. faecium and E. faecalis). No significant amplification was observed for non-target organisms. [Figure 19] PCR assays using primers and probes shown in Table XVII that target the gyrB gene were tested against common Gram-positive pathogens. Growth curves were observed only for pathogens belonging to the genus Enterococcus (E. faecium and E. faecalis). No significant amplification was observed for non-target organisms. [Figure 20]PCR assays using primers and probes disclosed in Table XVIII that target the CPE gene were tested against common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. piogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Growth curves were observed only for pathogens belonging to the Staphylococcus aureus species. No significant amplification was observed for non-target organisms. [Figure 21] PCR assays using primers and probes shown in Table XIX, targeting the gyrB gene, were tested against common Gram-positive pathogens. Growth curves were observed only for pathogens belonging to the Staphylococcus aureus species. No significant amplification was observed for non-target organisms. [Figure 22] PCR assays using primers and probes shown in Table XX, targeting the ddlA gene, were tested against common Gram-positive pathogens. Growth curves were observed only for pathogens belonging to the Staphylococcus aureus species. No significant amplification was observed for non-target organisms. [Figure 23] PCR assays using primers and probes shown in Table XXII that target the gyrB gene were tested against common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. pyogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Growth curves were observed only for pathogens belonging to the Streptococcus agalactia species. No significant amplification was observed for non-target organisms. [Figure 24] PCR assays using primers and probes shown in Table XXIII, targeting the sip gene, were tested against common Gram-positive pathogens. Growth curves were observed only for pathogens belonging to the Streptococcus agalactia species. No significant amplification was observed for non-target organisms. [Figure 25]PCR assays using primers and probes shown in Table XXIV that target the ddlA gene were tested against common Gram-positive pathogens. Growth curves were observed only for pathogens belonging to the species Streptococcus agalactia. No significant amplification was observed for non-target organisms. [Figure 26] PCR assays using primers and probes shown in Table XXVI that target the RDN18(18s rRNA) gene were tested against common fungal pathogens: Candida albicans and Candida auris. Growth curves were observed only for pathogens within the Candida genus. Tests were also conducted on Gram-negative and Gram-positive organisms, but no significant amplification was observed (data not shown). [Figure 27] PCR assays using primers and probes shown in Table XXVII, targeting the RDN58 (5.8 srRNA) gene, were tested against common fungal pathogens: Candida albicans and Candida auris. Growth curves were observed only for pathogens within the Candida genus. Tests were also conducted on Gram-negative and Gram-positive organisms, but no significant amplification was observed (data not shown). [Figure 28] PCR assays using primers and probes shown in Table XXVIII that target the 16s gene were tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityii. Growth curves were observed for all Gram-negative pathogens. [Figure 29] PCR assays using primers and probes shown in Table XXVIII that target the 16s gene were tested against common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. pyogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Growth curves were observed for all Gram-positive pathogens. [Figure 30-1]The minimum inhibitory concentration (MIC) breakpoints established for Gram-negative bacterial organisms, as determined by the Clinical Laboratory Standards Institute (CLSI) document M100 ED 30. Breakpoints are used to interpret MIC results from antimicrobial susceptibility testing and to classify the "grouping" of organisms as susceptible, intermediate, or resistant to a given antimicrobial agent. The grouping of organisms can be at various levels, including but not limited to species, genus, order, or specific biochemical characteristics. [Figure 30-2] The minimum inhibitory concentration (MIC) breakpoints established for Gram-negative bacterial organisms, as determined by the Clinical Laboratory Standards Institute (CLSI) document M100 ED 30. Breakpoints are used to interpret MIC results from antimicrobial susceptibility testing and to classify the "grouping" of organisms as susceptible, intermediate, or resistant to a given antimicrobial agent. The grouping of organisms can be at various levels, including but not limited to species, genus, order, or specific biochemical characteristics. [Figure 31] The minimum inhibitory concentration (MIC) breakpoints established for Gram-positive bacterial organisms, as determined by the Clinical Laboratory Standards Institute (CLSI) document M100 ED 30. Breakpoints are used to interpret MIC results from antimicrobial susceptibility testing and to classify the "grouping" of organisms as susceptible, intermediate, or resistant to a given antimicrobial agent. The grouping of organisms can be at various levels, including but not limited to species, genus, order, or specific biochemical characteristics. [Figure 32]The minimum inhibitory concentration (MIC) breakpoint for fungal organisms (yeast) is determined by the Clinical Laboratory Standards Institute (CLSI) document M60 ED 1. Breakpoints are used to interpret MIC results from antifungal susceptibility testing (AFST) and to classify organisms as susceptible, intermediate, or resistant to a given antifungal agent. Grouping of organisms can be at various levels, including but not limited to species, genus, order, or specific biochemical characteristics. It should be noted that while AFST is recommended for Candida auris, neither the CLSI nor the CDC has currently established a breakpoint for this species. AFST is attributed to closely related Candida species and uses expert opinion to determine the susceptibility of Candida auris isolates to specific antifungal agents. [Figure 33] Rapid identification and phenotypic susceptibility testing of Enterobacteriaceae using three different target genes (gyrB, rplP, and rpoB) and three classes of antimicrobial agents: fluoroquinolones (CIP), aminoglycosides (GEN), and carbapenems (MEM). [Figure 34] Rapid identification and phenotypic susceptibility testing of Pseudomonas aeruginosa using three different target genes (tuf, gyrB, rpoB) and three classes of antimicrobial agents: fluoroquinolones (CIP), aminoglycosides (GEN), and carbapenems (MEM). [Figure 35] Rapid identification and phenotypic susceptibility testing of Acinetobacter using three different target genes (ompA, rpoB, and gyrB) and three classes of antimicrobial agents: fluoroquinolones (CIP), aminoglycosides (GEN), and carbapenems (MEM). [Figure 36] Rapid identification and phenotypic susceptibility testing of Staphylococcus aureus using three different target genes (gyrB, ddlA, tuf) and one class of antimicrobial agents: cephalosporin (FOX). [Figure 37]Rapid identification and phenotypic susceptibility testing of Enterococcus faecium using three different target genes (rpoB, ddl, and gyrB) and two classes of antimicrobial agents: beta-lactam (AMP) and glycopeptide (VAN). [Figure 38] Primers and probes targeting the RDN18 and RDN58 genes for rapid identification of Candida and phenotypic antimicrobial susceptibility testing. [Figure 39] Primers and probes targeting the 16s gene for rapid identification and phenotypic antimicrobial susceptibility testing of any given Gram-negative or Gram-positive bacteria. [Figure 40A] Comprehensive and exclusive performance of Gram-negative pathogen PCR multiplex master mixes. [Figure 40B] Breakpoint groups, channels, and dye wavelengths and names for multiplex PCR assays. [Figure 41A] Comprehensive and exclusive performance of Gram-positive pathogen PCR multiplex master mixes. [Figure 41B] Breakpoint groups, channels, and dye wavelengths and names for multiplex PCR assays. [Figure 42] Thresholds for distinguishing susceptibility from resistance may be specific to each primer / probe set and are determined using statistical separation of populations, as outlined in Figure 4. Thresholds associated with ciprofloxacin susceptibility are shown for A) Acinetobacter baumannii (Abi), B) Enterobacteriaceae (Entero), and C) Pseudomonas aeruginosa (Pae), based on Ct fluorescence values, relative fluorescence intensity (RFI), and changes in the preceding slope of Ct fluorescence values ​​at three different antibiotic concentrations. [Figure 43]A) Distribution of resistant and susceptible isolates is shown for A. baumannii (Abi), E. cloaca (Ecl), Escherichia coli (Eco), K. aerogenes (Kae), K. pneumoniae (Kpn), and Pseudomonas aeruginosa (Pae). B) Interspecies susceptibility, specificity, and category matching of ciprofloxacin using the thresholds in Figure 42, where susceptibility and specificity are as defined in Example 21. [Figure 44] Thresholds for distinguishing susceptibility from resistance may be specific to each primer / probe set and are determined using statistical separation of populations, as outlined in Figure 4. Thresholds related to gentamicin susceptibility are shown for A) Acinetobacter baumannii (Abi), B) Enterobacteriaceae (Entero), and C) Pseudomonas aeruginosa (Pae), and are based on the inflection cycle of curves fitted to raw fluorescence data, changes in absolute fluorescence intensity (AFI), and goodness of fit. [Figure 45] A) Distribution of resistant and susceptible isolates is shown for A. baumannii (Abi), E. cloaca (Ecl), Escherichia coli (Eco), K. aerogenes (Kae), K. pneumoniae (Kpn), and Pseudomonas aeruginosa (Pae). B) Interspecies susceptibility, specificity, and category matching of gentamicin using the thresholds in Figure 44, where susceptibility and specificity are as defined in Example 21. [Figure 46] Thresholds for distinguishing susceptibility from resistance may be specific to each primer / probe set and are determined using statistical separation of populations, as outlined in Figure 4. Thresholds related to meropenem susceptibility are shown for A) Acinetobacter baumannii (Abi), B) Enterobacteriaceae (Entero), and C) Pseudomonas aeruginosa (Pae), and are based on the change in Ct value, absolute Ct value, and absolute fluorescence intensity (AFI) for no antibiotic and lowest antibiotic concentration. [Figure 47]A) Distribution of resistant and susceptible isolates is shown for A. baumannii (Abi), E. cloaca (Ecl), Escherichia coli (Eco), K. aerogenes (Kae), K. pneumoniae (Kpn), and Pseudomonas aeruginosa (Pae). B) Interspecies susceptibility, specificity, and category matching of meropenem using the thresholds in Figure 46, with susceptibility and specificity as defined in Example 21. [Figure 48] A) A workflow for testing isolates directly from positive blood culture samples prepared according to a standard assay workflow, which involves adding bacteria to whole blood, separating red blood cells, inoculating the plasma containing the bacteria into commercially available blood culture bottles, incubating overnight, and then testing the isolates directly from the sample. B) Changes in Ct values ​​as a function of antibiotic (gentamicin) against various resistant and susceptible isolates demonstrate that phenotypic results can be obtained directly from positive blood cultures with bacteria. [Figure 49A] Multibacterial ASTs in a 1:1 ratio of two Gram-negative bacteria (Kpn and Abi) with various susceptibility combinations were co-incubated together in the absence or presence of three different antibiotics at varying concentrations. Each species exhibited appropriate phenotypes in the corresponding detection channels, as indicated by the delta CT threshold for isolating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multibacterial scenarios. [Figure 49B] Multibacterial ASTs in a 1:1 ratio of two Gram-negative bacteria (Kpn and Abi) with various susceptibility combinations were co-incubated together in the absence or presence of three different antibiotics at varying concentrations. Each species exhibited appropriate phenotypes in the corresponding detection channels, as indicated by the delta CT threshold for isolating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multibacterial scenarios. [Figure 50A]Multibacterial ASTs in a 1:1 ratio of one Gram-negative organism (Kpn) and one Gram-positive organism (Sar) with different susceptibility combinations were co-incubated together in the absence or presence of three different antibiotics at varying concentrations. Each species exhibited appropriate phenotypes in the corresponding detection channel, as indicated by the delta CT threshold for isolating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multibacterial scenarios. N / A indicates no clinically relevant interpretation for the corresponding bacterium-drug combination. [Figure 50B] Multibacterial ASTs in a 1:1 ratio of one Gram-negative organism (Kpn) and one Gram-positive organism (Sar) with different susceptibility combinations were co-incubated together in the absence or presence of three different antibiotics at varying concentrations. Each species exhibited appropriate phenotypes in the corresponding detection channel, as indicated by the delta CT threshold for isolating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multibacterial scenarios. N / A indicates no clinically relevant interpretation for the corresponding bacterium-drug combination. [Figure 51A] Multibacterial ASTs in a 1:1 ratio of one Gram-negative organism (Kpn) and one fungal organism (Cal) with a different susceptibility combination were co-incubated together in the absence or presence of three different antibiotics at varying concentrations. The Gram-negative species exhibited appropriate phenotypes in the corresponding detection channels, as indicated by the delta CT threshold for separating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multibacterial scenarios. N / A indicates no clinically relevant interpretation for the corresponding bio-drug combination. Cal shows susceptibility to fluconazole. [Figure 51B]Multibacterial ASTs in a 1:1 ratio of one Gram-negative organism (Kpn) and one fungal organism (Cal) with a different susceptibility combination were co-incubated together in the absence or presence of three different antibiotics at varying concentrations. The Gram-negative species exhibited appropriate phenotypes in the corresponding detection channels, as indicated by the delta CT threshold for separating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multibacterial scenarios. N / A indicates no clinically relevant interpretation for the corresponding bio-drug combination. Cal shows susceptibility to fluconazole. [Figure 52A] Multibacterial ASTs in a 1:1 ratio from two Gram-positive organisms (Efs and Sar) with various susceptibility combinations were co-incubated together in the absence or presence of a single antibiotic at various concentrations. Both species exhibited appropriate phenotypes in their corresponding detection channels, as indicated by the delta CT threshold for separating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multibacterial scenarios. [Figure 52B] Multibacterial ASTs in a 1:1 ratio from two Gram-positive organisms (Efs and Sar) with various susceptibility combinations were co-incubated together in the absence or presence of a single antibiotic at various concentrations. Both species exhibited appropriate phenotypes in their corresponding detection channels, as indicated by the delta CT threshold for separating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multibacterial scenarios. [Figure 53A] Multimicrobial ASTs in a 1:1 ratio of one Gram-positive organism (Sar) and one fungal organism (Cal) with a different susceptibility combination were co-incubated together in the absence or presence of a single antibiotic at various concentrations. The Gram-positive species exhibited appropriate phenotypes in the corresponding detection channels, as indicated by the delta CT threshold for separating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multimicrobial scenarios. N / A indicates no clinically relevant interpretation for the corresponding bio-drug combination. Cal shows susceptibility to fluconazole. [Figure 53B]Multimicrobial ASTs in a 1:1 ratio of one Gram-positive organism (Sar) and one fungal organism (Cal) with a different susceptibility combination were co-incubated together in the absence or presence of a single antibiotic at various concentrations. The Gram-positive species exhibited appropriate phenotypes in the corresponding detection channels, as indicated by the delta CT threshold for separating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for various multimicrobial scenarios. N / A indicates no clinically relevant interpretation for the corresponding bio-drug combination. Cal shows susceptibility to fluconazole. [Figure 54] PCR assays using primers and probes shown in Table XXXIX, targeting the blaKPC, blaVIM, blaNDM, and blaOXA-48 genes, were tested against Gram-negative pathogens with known carbapenem resistance mechanisms. Positive (Pos) signals were observed only for the targeted resistance mechanisms. [Figure 55] PCR assays using primers and probes disclosed in Table XL, targeting the citC gene of P. stuartii and the invA gene of Salmonella, were tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, C. freundei, P. stuartii, P. rettgeri, S. enterica, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityi. Only species-specific growth curves were observed. These results represent a non-limiting example of a species-specific detection set that would enable improved breakpoint-based AST calling for several specific species within the Enterobacterales order. [Figure 56]PCR assays using primers and probes disclosed in Table XLI, targeting the gyrB gene of S. agalactia, the ddlA gene of S. agalactia, the tuf gene of Streptococcus pneumoniae, and the speB gene of S. pyogenes, were tested against common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. pyogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Only species-specific growth curves were observed. These results represent a non-limiting example of a species-specific detection set that enables improved breakpoint-based AST calls for several specific species within the genera Staphylococcus and Streptococcus. [Figure 57] The left panel shows that thresholds for distinguishing susceptible and resistant strains in ID-AST PCR assays using non-species-specific primer / probe sets (e.g., sets that hybridize to target genes of the Enterobacteriaceae order) can be confounded by species-specific differences in phenotypic expression. The right panel shows that the use of species-specific primer / probe sets that provide species identification allows for separate interpretations for each individual species, leading to improved categorical consensus against CLSI criteria. [Figure 58] A data interpretation strategy involves fitting a sigmoid function to raw PCR curve data and then calculating the curve parameters and features. Features are then compared between the presence and absence of various antibiotic concentrations to derive relative feature changes. These relative change features, along with ground truth MICs, are then input into separate machine learning algorithms to train a predictive model. The trained models then participate as a voting ensemble to return the final predicted MIC. [Figure 59] This diagram illustrates how species ID, antimicrobial susceptibility testing, resistance mechanism detection, and universal 16s rRNA phenotypic information are combined to return results. The species ID is used to select an appropriate algorithm for MIC prediction, and then the susceptibility information is determined by comparing it with appropriate breakpoints from regulatory bodies. [Modes for carrying out the invention]

[0020] Detailed description of the invention definition The disclosed method may include performing at least one cycling step, which involves amplifying one or more portions of a nucleic acid molecule gene target from a sample using one or more primer pairs. As used herein, “sample” or “biological sample” means a sample including, but not limited to, whole blood, plasma, serum, red blood cell fraction, saliva, cerebrospinal fluid, semen, feces, urine, rectal swab, bile, lymph, sputum, lavage fluid, or combinations thereof. As used herein, “primer” means an oligonucleotide primer that specifically anneals to a target bacterial gene and initiates DNA synthesis from the target bacterial gene under appropriate conditions to produce the respective amplification product. Each primer under consideration anneals to a target within or adjacent to the respective target nucleic acid molecule such that at least a portion of each amplification product contains the nucleic acid sequence corresponding to the target. One or more amplification products are produced on the condition that one or more target bacterial gene nucleic acids are present in the sample, and consequently, the presence of one or more target bacterial gene amplification products indicates the presence of that bacterial strain in the sample. The amplification products should contain nucleic acid sequences complementary to one or more detectable probes of the target bacterial gene. As used herein, “probe” refers to an oligonucleotide probe that specifically anneals to a nucleic acid sequence encoding a target bacterial gene. Each cycling step comprises an amplification step, a hybridization step, and a detection step, in which the sample comes into contact with one or more detectable probes to detect the presence or absence of a bacterial strain in the sample.

[0021] As used herein, the term “amplify” refers to the process of synthesizing a nucleic acid molecule complementary to one or both strands of a template nucleic acid molecule. Amplifying a nucleic acid molecule typically involves denaturing the template nucleic acid, annealing the primers to the template nucleic acid at a temperature below the primer melting temperature, and enzymatically extending from the primers to produce an amplification product. Amplification typically requires the presence of deoxyribonucleoside triphosphate, a DNA polymerase enzyme (e.g., Platinum® Taq), and appropriate buffers and / or cofactors (e.g., MgCl2 and / or KCl) for optimal activity of the polymerase enzyme.

[0022] As used herein, the term “primer” refers to oligomeric compounds, primarily oligonucleotides, as well as modified oligonucleotides capable of “priming” DNA synthesis by template-dependent DNA polymerases, i.e., for example, oligonucleotides whose 3' end provides a free 3'-OH group, thereby allowing a deoxynucleoside triphosphate to be used to establish a 3'-5' phosphodiester bond, thereby releasing pyrophosphate, and to which further “nucleotides” can be bound by template-dependent DNA polymerases. Thus, apart from presumably intended functions, there is no fundamental difference between “primer,” “oligonucleotide,” or “probe.”

[0023] The term "hybridize" refers to the annealing of one or more probes to an amplification product. Hybridization conditions typically include a temperature lower than the melting temperature of the probes but that avoids nonspecific hybridization of the probes.

[0024] The term "5'-3' nuclease activity" typically refers to the activity of nucleic acid polymerases involved in nucleic acid chain synthesis, where nucleotides are removed from the 5' end of the nucleic acid chain.

[0025] The term "thermally stable polymerase" refers to a polymerase enzyme that is thermally stable, catalyzing the formation of primer extension products complementary to the template, and not irreversibly denaturing the double-stranded template nucleic acid when exposed to high temperatures for the time required to cause denaturation. Generally, synthesis begins at the 3' end of each primer and proceeds along the template strand in the 5' to 3' direction. Thermostable polymerases have been isolated from *Thermus flavus*, *T. ruber*, *T. thermophilus*, *T. aquaticus*, *T. lacteus*, *T. rubens*, *Bacillus stearothermophilus*, and *Methanothermus fervidus*. Nevertheless, thermostable polymerases can also be used in PCR assays if the enzyme is supplemented.

[0026] The term "complementary nucleic acid" refers to a nucleic acid that is the same length as a given nucleic acid and is exactly complementary to it.

[0027] When used in relation to nucleic acids, the terms "extension" or "lengthening" refer to the incorporation of additional nucleotides (or other similar molecules) into the nucleic acid. For example, nucleic acids are extended as needed by incorporating nucleotides, typically by biocatalysts such as polymerases that add nucleotides to the 3' end of the nucleic acid.

[0028] In the context of two or more nucleic acid sequences, the terms “identical” or “percent identical” refer to two or more sequences or subsequences that, when compared or aligned for the greatest match measured, for example, using one of the sequence comparison algorithms available to those skilled in the art, or by visual inspection, are identical or have a specific percentage of identical nucleotides. An exemplary algorithm suitable for determining percent sequence identity and percent sequence similarity is the BLAST program, which is disclosed, for example, in Altschul et al. (1990) "Basic local alignment search tool" J.Mol.Biol.215:403-410, Gish et al. (1993) "Identification of protein coding regions by database similarity search" Nature Genet.3:266-272, Madden et al. (1996) "Applications of network BLAST server" Meth.Enzymol.266:131-141, Altschul et al. (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs" Nucleic Acids Res.25:3389-3402, and Zhang et al. (1997) "PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation" Genome Res.7:649-656.

[0029] In the context of oligonucleotides, a "modified nucleotide" refers to a change in which at least one nucleotide in an oligonucleotide sequence is replaced by a different nucleotide that provides the oligonucleotide with desired properties. Exemplary modified nucleotides that may be substituted in oligonucleotides described herein include, for example, C5-methyl-dC, C5-ethyl-dC, C5-methyl-dU, C5-ethyl-dU, 2,6-diaminopurine, C5-propynyl-dC, C5-propynyl-dU, C7-propynyl-dA, C7-propynyl-dG, C5-propargylamino-dC, C5-propargylamino-dU, C7-propargylamino-dA, C7-propargylamino-dG, 7-deaza-2-deoxyxanthosine, pyrazolopyrimidine analogs, pseudo-dU, nitropyrrole, nitroindole, 2'-O-methylribo U, 2'-O-methylribo C, N4-ethyl-dC, and N6-methyl-dA. Many other modified nucleotides that may be substituted in oligonucleotides are mentioned herein or are known in the art. In certain embodiments, the modified nucleotide substitution modifies the melting temperature (Tm) of the oligonucleotide compared to the melting temperature of the corresponding unmodified oligonucleotide. Furthermore, certain modified nucleotide substitutions, in some embodiments, can reduce nonspecific nucleic acid amplification (e.g., minimizing primer dimer formation) and increase the yield of the intended target amplicon. Examples of these types of nucleic acid modifications are disclosed, for example, in U.S. Patent No. 6,001,611.

[0030] "TAGS," or "Temperature Assisted Generation of Signal" (disclosed in U.S. Patent Application Publication No. 2018 / 0073064), is a multiplexing technique that enables the measurement of multiple individual targets within each fluorescence channel by collecting fluorescence data at various temperatures during a thermal cycle. Consequently, TAGS multiplexing using two or three temperature channels can double or triple the number of degradable targets per photochannel. In principle, this technique can be applied to any quantitative PCR (qPCR) instrument capable of collecting more than one fluorescence read per PCR cycle.

[0031] The term "antimicrobial agent" typically refers to a drug or medication used to treat microbial infections by killing microorganisms or inhibiting their growth. Antimicrobial agents may include antibiotics for treating bacterial infections, antifungals for treating fungal infections, antiprotozoal agents for treating protozoan infections, and antivirals for treating viral infections. Antimicrobial agents are classified in several different ways (called "antimicrobial classes"), including by mechanism of action (e.g., inhibition of cell wall synthesis, inhibition of protein or nucleic acid synthesis, disruption of cell membranes), by source (e.g., from natural sources or synthetic products), and by chemical structure (e.g., β-lactams, aminoglycosides, macrolides, quinolones, etc.).

[0032] Examples, though not limited to, include: allylamines, amidinopenicillins, aminocyclitols, aminoglycosides, amphenicols, ansamycins, B-3-glucan synthase inhibitors, carbapenems, cephalosporins, crisylcyclines, cyclic polypeptides, glycopeptides, imidazoles, lincosamides, lipopeptides, macrolides and ketolides, monobactams, nitrofurantoins, nitroimidazoles, oxazolidinones, penicillins, phosphonic acid derivatives, pluromutilins, polyenes, polymyxins, pseudomonates, quinolones, liminofenadines, steroid antibacterial agents, streptogramins, sulfonamides, dihydrofolate reductase inhibitors, and combinations thereof, sulfones, tetracyclines, and triazoles.

[0033] Examples of antibacterial drugs or agents include, but are not limited to, naphthifine, mesilinam, spectinomycin, chloramphenicol, rifampicin, caspofungin, meropenem, ceftriaxone, cefepime, ceftarine, tigecycline, bacitracin, vancomycin, miconazole, clindamycin, daptomycin, erythromycin, telithromycin, aztreonam, nitrofurantoin, metronidazole, linezolid, ampicillin, fosfomycin, letapamulin, amphotericin-B, colistin, mupirocin, ciprofloxacin, clofazimine, fusidic acid, quinupristin / dalhoptin, sulfamethoxazole, trimethoprim, dapzon, chlortetracycline, and fluconazole.

[0034] The term "minimum inhibitory concentration" or "MIC" refers to the lowest concentration of an antimicrobial agent required to inhibit the growth of an organism. In classical culture-based tests, the MIC is determined when bacteria are added to wells containing growth medium and various concentrations of antimicrobial agents. The MIC is found by doubling the concentration of the antimicrobial agent in each sequential well and identifying the well with the lowest antimicrobial agent concentration at which no visible growth occurs after the incubation period. The term "breakpoint" refers to a selected concentration of an antimicrobial agent that defines whether certain bacteria are susceptible or resistant to the antimicrobial agent. If the MIC is below the susceptibility breakpoint, the bacteria are considered susceptible to the antimicrobial agent. If the MIC is greater than this value, the bacteria are considered intermediate or resistant to the antimicrobial agent.

[0035] Breakpoints are an integral part of modern microbiology laboratory practice and are used to define susceptibility and resistance to antimicrobial agents. Depending on the test method, they are expressed as either concentration (mg / liter or μg / ml) or zone diameter (mm). Generally, all susceptibility testing methods require breakpoints, also known as interpretation criteria, so that the test results can be interpreted as susceptible, intermediate, or resistant and thus reported to a wide range of clinicians. A “clinical breakpoint” refers to the concentration (MIC) at which a strain is more likely to be successfully treated is isolated from a bacterium more likely to be unsuccessful. In their simplest form, these breakpoints are obtained from prospective human clinical studies comparing the MIC of an infectious pathogen to the outcome.

[0036] Detection and identification of infectious pathogens This disclosure provides a method for detecting infectious pathogens, such as bacterial strains that cause bloodstream infections. The method comprises the steps of amplifying a portion of a target gene by PCR using strain-specific, species-specific, genus-specific, family-specific, or order-specific primer sequences, and detecting the amplification product using strain-specific, species-specific, genus-specific, family-specific, or order-specific probe nucleic acid sequences. The selection of target genes was the result of in silico searches of publicly available sequence databases, as well as literature searches for nucleic acid sequences that are specific to a species (e.g., Escherichia coli) or order (e.g., Enterobacterales) and distinguish from other strains and families. As a result of the search, the following target genes were identified.

[0037] Enterobacter order: rplP, ompA, tuf, gyrB, rpoB Enterobacteriaceae: rplP, ompA, tuf, gyrB, rpoB Enterococcus genus: tuf, rpoB, sodA, ddl, gyrB Pseudomonas genus: gyrB, O-antigen acetylase, rpoB, ecfX, tuf Acinetobacter genus: ompA, tusA, rpoB, gyrB Stenotrophomonas maltophilia: fdnG, gyrB, tuf Staphylococcus aureus: CPE, gyrB, nuc, rpoB, tuf, ddlA Staphylococcus epidermidis: altE, femA Coagulase-negative staphylococci: rpoB, tuf, sodA Streptococcus genus: tuf, gyrB, sip, ddlA Pneumococcus: lytA, SP2020, piaB Proteus mirabilis: UreR, UreC Candida albicans: ACT, RPB-1, 5.8s ribosomal RNA, 18s ribosomal RNA

[0038] Primers and probes are provided for amplifying the rplP gene encoding the ribosomal L16 protein for the detection of bacteria belonging to the order Enterobacterales or the family Enterobacteriaceae (SEQ ID NOs: 1-3, Table I). The addition of a second probe (SEQ ID NO: 4, Table I) further extends the inclusion of other common pathogens of the order Enterobacterales, such as Serratia marcescens strains and Proteus mirabilis strains. Highly specific pathogen-grouping target genes in a sample can also be detected using nucleic acids other than those exemplified herein. For example, functional variants can be evaluated for specificity and / or sensitivity by those skilled in the art using routine methods. Representative functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of an oligonucleotide comprises a nucleic acid having a sequence selected from SEQ ID NOs: 1-4, a substantially identical variant thereof having at least, for example, 80%, 90%, or 95% sequence identity with one of SEQ ID NOs: 1-4, or complementary and variant forms of SEQ ID NOs: 1-4.

[0039] [Table 1]

[0040] Detection of bacteria belonging to the order Enterobacterales may also include other primers and probes for amplifying the rplP gene (SEQ ID NOs. 5-7, Table II), as well as primers and probes for amplifying the gyrB gene encoding the DNA gyrase subunit B protein (SEQ ID NOs. 8-10, Table III), and primers and probes for amplifying the rpoB gene encoding DNA-dependent RNA polymerase (SEQ ID NOs. 11-16, Table IV). Typical functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of oligonucleotides includes nucleic acids having sequences selected from SEQ ID NOs. 5-7, 8-10, and 11-16, substantially identical variants thereof having at least, for example, 80%, 90%, or 95% sequence identity with one of SEQ ID NOs. 5-7, 8-10, and 11-16, or complements and variants of SEQ ID NOs. 5-7, 8-10, and 11-16.

[0041] [Table 2]

[0042] [Table 3]

[0043] [Table 4]

[0044] For the detection of bacteria belonging to the species Acinetobacter baumannii (Abi), primers and probes are provided for amplifying the ompA gene encoding outer membrane protein A (see Table V). Nucleic acids other than those exemplified herein may also be used to detect Acinetobacter-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and / or sensitivity by those skilled in the art using routine methods. Representative functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of oligonucleotides includes a nucleic acid having a sequence selected from SEQ ID NOs: 17-19, 20-22, 29-31, one of SEQ ID NOs: 17-19, 20-22, 29-31 and a substantially identical variant thereof having at least, for example, 80%, 90%, or 95% sequence identity, or complements and variants of SEQ ID NOs: 17-19, 20-22, 29-31.

[0045] [Table 5]

[0046] The detection of Acinetobacter baumannii may also include primers and probes for amplifying the rpoB gene (SEQ ID NOs. 23-25, Table VI) and primers and probes for amplifying the gyrB gene (SEQ ID NOs. 26-28, Table VII). Typical functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of oligonucleotides includes nucleic acids having sequences selected from SEQ ID NOs. 23-25, 26-28, one of SEQ ID NOs. 23-25, 26-28 and substantially identical variants thereof having at least, for example, 80%, 90%, or 95% sequence identity, or complements and variants of SEQ ID NOs. 23-25, 26-28.

[0047] [Table 6]

[0048] [Table 7]

[0049] For the detection of bacteria belonging to the Pseudomonas species (Pae), primers and probes are provided for amplifying the tuf gene encoding the elongation factor (SEQ ID NOs. 32-34, Table VIII), primers and probes for amplifying the gyrB gene (SEQ ID NOs. 35-37, Table IX), and primers and probes for amplifying the rpoB gene (SEQ ID NOs. 38-40, Table X). Other nucleic acids besides those exemplified herein may also be used to detect Pseudomonas-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and / or sensitivity by those skilled in the art using routine methods. Representative functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of an oligonucleotide comprises a nucleic acid having a sequence selected from SEQ ID NOs: 32-34, 35-37, 38-40, one of SEQ ID NOs: 32-34, 35-37, 38-40 and substantially identical variants thereof having at least, for example, 80%, 90%, or 95% sequence identity, or complements and variants of SEQ ID NOs: 32-34, 35-37, 38-40.

[0050] [Table 8]

[0051] [Table 9]

[0052] [Table 10]

[0053] For the detection of bacteria belonging to the species Stenotrophomonas maltophilia (S. maltophilia), primers and probes for amplifying the fdnG gene (SEQ ID NOs. 41-43, Table XI), primers and probes for amplifying the gyrB gene (SEQ ID NOs. 44-46, Table XII), and primers and probes for amplifying the tuf gene (SEQ ID NOs. 47-49, Table XIII) are provided. Nucleic acids other than those exemplified herein may be used to detect Stenotrophomonas genus-specific pathogen grouping target genes in a sample. For example, functional variants may be evaluated for specificity and / or sensitivity by those skilled in the art using routine methods. Representative functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of an oligonucleotide comprises a nucleic acid having a sequence selected from SEQ ID NOs: 41-43, 44-46, 47-49, one of SEQ ID NOs: 41-43, 44-46, 47-49 and substantially identical variants thereof having at least, for example, 80%, 90%, or 95% sequence identity, or complementary and variant forms of SEQ ID NOs: 41-43, 44-46, 47-49.

[0054] [Table 11]

[0055] [Table 12]

[0056] [Table 13]

[0057] For the detection of bacteria belonging to the genus Enterococcus, primers and probes for amplifying the tuf gene (SEQ ID NOs. 50-52, Table XIV), primers and probes for amplifying the rpoB gene (SEQ ID NOs. 53-55, Table XV), primers and probes for amplifying the ddl gene encoding xxxx (SEQ ID NOs. 56-61, Table XVI), and primers and probes for amplifying the gyrB gene (SEQ ID NOs. 62-66, Table XVII) are provided. Nucleic acids other than those exemplified herein may also be used to detect Enterococcus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and / or sensitivity by those skilled in the art using routine methods. Representative functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of an oligonucleotide comprises a nucleic acid having a sequence selected from SEQ ID NOs. 50-52, 53-55, 56-61, 62-66, one of SEQ ID NOs. 50-52, 53-55, 56-61, 62-66 and substantially identical variants thereof having at least, for example, 80%, 90%, or 95% sequence identity, or complements and variants of SEQ ID NOs. 50-52, 53-55, 56-61, 62-66.

[0058] [Table 14]

[0059] [Table 15]

[0060] [Table 16]

[0061] [Table 17]

[0062] Primers and probes for amplifying the CPE gene encoding a protein involved in capsule formation (SEQ ID NOs. 67-69, 72, Table XVIII), primers and probes for amplifying the gyrB gene (SEQ ID NOs. 73-75, Table XIX), and primers and probes for amplifying the ddlA gene (SEQ ID NOs. 76-78, Table XX) are provided for the detection of bacteria belonging to the Staphylococcus genus. Primers and probes for amplifying the tuf gene (SEQ ID NOs. 79-81, Table XXII) are provided for the detection of bacteria belonging to the Staphylococcus genus. Nucleic acids other than those exemplified herein may also be used to detect Staphylococcus genus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and / or sensitivity by those skilled in the art using routine methods. Representative functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of an oligonucleotide comprises a nucleic acid having a sequence selected from SEQ ID NOs. 67-69, 72, 73-75, 76-78, 79-81, one of SEQ ID NOs. 67-69, 72, 73-75, 76-78, 79-81 and substantially identical variants thereof having at least, for example, 80%, 90%, or 95% sequence identity, or complements and variants of SEQ ID NOs. 67-69, 72, 73-75, 76-78, 79-81.

[0063] [Table 18]

[0064] [Table 19]

[0065] [Table 20]

[0066] [Table 21]

[0067] For the detection of bacteria belonging to the species Streptococcus agalactia (S. agalactia), primers and probes for amplifying the gyrB gene (SEQ ID NOs. 121-123, Table XXII), primers and probes for amplifying the sip gene encoding a surface immunogenic protein (SEQ ID NOs. 82-84, Table XXIII), and primers and probes for amplifying the ddlA gene (SEQ ID NOs. 85-87, Table XXIV) are provided. For the detection of bacteria belonging to the genus Streptococcus, primers and probes for amplifying the tuf gene (SEQ ID NOs. 100-102, Table XXV) are provided. Nucleic acids other than those exemplified herein may also be used to detect Streptococcus-specific pathogen grouping target genes in a sample. For example, functional variants can be evaluated for specificity and / or sensitivity by those skilled in the art using routine methods. Representative functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of an oligonucleotide comprises a nucleic acid having a sequence selected from SEQ ID NOs: 121-123, 82-84, 85-87, 100-102, one of SEQ ID NOs: 121-123, 82-84, 85-87, 100-102 and substantially identical variants thereof having at least, for example, 80%, 90%, or 95% sequence identity, or complements and variants of SEQ ID NOs: 121-123, 82-84, 85-87, 100-102.

[0068] [Table 22]

[0069] [Table 23]

[0070] [Table 24]

[0071] [Table 25]

[0072] For the detection of common fungal pathogens: Candida albicans and Candida auris, primers and probes for amplifying the 18s ribosomal RNA (18s rRNA) gene (SEQ ID NOs. 88-90, Table XXVI), and primers and probes for amplifying the 5.8s ribosomal RNA (5.8s rRNA) gene (SEQ ID NOs. 91-93, Table XXVII) are provided. Candida-specific pathogen grouping target genes in a sample may be detected using nucleic acids other than those exemplified herein. For example, functional variants may be evaluated for specificity and / or sensitivity by those skilled in the art using routine methods. Representative functional variants may include, for example, one or more deletions, insertions, and / or substitutions in the target gene primers and probes disclosed herein. More specifically, each embodiment of an oligonucleotide comprises a nucleic acid having a sequence selected from SEQ ID NOs. 88-90, 91-93, one of SEQ ID NOs. 88-90, 91-93 and substantially identical variants thereof having at least, for example, 80%, 90%, or 95% sequence identity, or complements and variants of SEQ ID NOs. 88-90, 91-93.

[0073] [Table 26]

[0074] [Table 27]

[0075] For the detection of all types of bacteria, primer and probe combinations (SEQ ID NOs. 94-96, Table XXVIII) are provided to amplify conserved regions in 16s ribosomal RNA (16s rRNA) genes.

[0076] [Table 28]

[0077] In one embodiment, the above-described set of primers and probes is used not only for the detection and identification of infectious bacterial strains but also for performing antimicrobial susceptibility testing (AST) assays. Accordingly, the present invention discloses a method and composition for performing a quantitative real-time PCR reaction in which bacterial identification (ID) and testing of its antimicrobial susceptibility (AST) are simultaneously determined in a single assay setting.

[0078] Functionally active variants of any of the primers and / or probes disclosed herein can be identified by using the primers and / or probes in the disclosed methods. The functionally active variants of the primers and / or probes disclosed herein relate to primers and / or probes that provide similar or higher specificity and sensitivity in the disclosed methods or kits compared to the respective sequences of the disclosed primers and / or probes.

[0079] Variants can be altered from the sequences of the primers and probes disclosed herein by, for example, by the addition, deletion, or substitution of one or more nucleotides at the 5' and / or 3' ends of each sequence of the primers and / or probes disclosed herein. As detailed above, the primers (and / or probes) may be chemically modified, i.e., the primers and / or probes may contain modified nucleotides or non-nucleotide compounds. Thus, the probe (or primer) is a modified oligonucleotide. A “modified nucleotide” (or “nucleotide analog”) differs from a natural “nucleotide” by several modifications, but still consists of a base or base-like compound, a pentofuranosyl sugar or pentofuranosyl sugar-like compound, a phosphate moiety or phosphate-like moiety, or a combination thereof. For example, a “modified nucleotide” can be obtained by attaching a “label” to the base portion of a “nucleotide.” The natural base in the “nucleotide” may be replaced with, for example, 7-deazapurine, and a “modified nucleotide” can also be obtained in this application. The terms “modified nucleotide” or “nucleotide analog” are used interchangeably in this application. "Modified nucleosides" (or "nucleoside analogs") differ from natural nucleosides due to some modification, as outlined above for "modified nucleotides" (or "nucleotide analogs").

[0080] Oligonucleotides, including modified oligonucleotides and oligonucleotide analogs that amplify nucleic acid molecules encoding any of the target genes, can be designed using computer programs such as OLIGO (Molecular Biology Insights Inc., Cascade, Colorado). Key features in designing oligonucleotides to be used as amplification primers include, but are not limited to, appropriately sized amplification products to facilitate detection (e.g., by electrophoresis), similar melting temperatures for the members of a pair of primers, and the length of each primer (i.e., primers must be long enough to anneal with sequence specificity and initiate synthesis, but not so long that fidelity decreases during oligonucleotide synthesis). Typically, oligonucleotide primers are 8–50 nucleotides long (e.g., 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, or 50 nucleotides). In some embodiments, oligonucleotide primers are 40 nucleotides or less in length.

[0081] In addition to a set of primers, this method may use one or more probes to detect the presence or absence of a target gene. The term "probe" refers to a synthetically or biologically produced nucleic acid (DNA or RNA) that, by design or selection, is made possible to hybridize specifically (i.e., preferentially) to, in this case, the target gene nucleic acid, under defined predetermined stringencies. The "probe" may be referred to as a "detection probe," meaning that it detects the target nucleic acid.

[0082] In some embodiments, the disclosed target gene probes may be labeled with at least one fluorescent label. In one embodiment, the target gene probe may be labeled with a donor fluorescent moiety, e.g., a fluorescent dye, and a corresponding acceptor moiety, e.g., a quencher. In one embodiment, the probe comprises or consists of a fluorescent moiety, and the nucleic acid sequence comprises or consists of the probe sequence disclosed herein.

[0083] The design of oligonucleotides used as probes can be carried out in a manner similar to that of primers. Embodiments may use a single probe or a pair of probes for the detection of the amplification product. Depending on the embodiment, the probe(s) used may include at least one label and / or at least one quencher moiety. Similar to primers, probes typically have similar melting temperatures, and the length of each probe must be sufficient for sequence-specific hybridization to occur, but not so long as to degrade fidelity during synthesis. Oligonucleotide probes are generally 15–40 nucleotides long (e.g., 16, 18, 20, 21, 22, 23, 24, or 25).

[0084] Polymerase chain reaction (PCR) Conventional PCR techniques are disclosed in U.S. Patents 4,683,202, 4,683,195, 4,800,159, and 4,965,188. PCR typically uses two oligonucleotide primers that bind to a selected nucleic acid template (e.g., DNA or RNA). In some embodiments, useful primers include oligonucleotides that can act as starting points for nucleic acid synthesis within the disclosed target gene nucleic acid sequence. Primers can be purified from restriction digests by conventional methods or produced synthetically. While single-stranded primers are preferred for maximum amplification efficiency, double-stranded primers may also be used. Double-stranded primers are first denatured, i.e., processed to separate the strands. One method of denaturing double-stranded nucleic acids is by heating.

[0085] If the template nucleic acid is double-stranded, it is necessary to separate the double strands before it can be used as a template in PCR. Strand separation can be achieved by any suitable denaturation method, including physical, chemical, or enzymatic means. One method for separating nucleic acid strands involves heating until the nucleic acid is predominantly denatured (e.g., denaturation of 50%, 60%, 70%, 80%, 90%, or more than 95%). The heating conditions required to denaturate the template nucleic acid depend, for example, the buffer salt concentration, as well as the length and nucleotide composition of the nucleic acid being denatured, but are typically in the range of about 90°C to about 105°C, depending on the reaction characteristics such as temperature and nucleic acid length. Denaturation typically takes place for about 30 seconds to 4 minutes (e.g., 1 minute to 2 minutes 30 seconds, or 1.5 minutes).

[0086] If the double-stranded template nucleic acid is denatured by heat, the reaction mixture is cooled to a temperature that promotes annealing of each primer to its target sequence on the disclosed target gene nucleic acid molecule. The annealing temperature is typically about 35°C to about 65°C (e.g., about 40°C to about 60°C, or about 45°C to about 50°C). The annealing time may be about 10 seconds to about 1 minute (e.g., about 20 seconds to about 50 seconds, or about 30 seconds to about 40 seconds). The reaction mixture is then adjusted to a temperature that promotes or optimizes polymerase activity, i.e., a temperature sufficient for extension from the annealed primers to occur and produce a product complementary to the template nucleic acid. The temperature must be sufficient to synthesize extension products from each primer annealed to the nucleic acid template, but should not be so high as to denature the extension products from their complementary templates (for example, the temperature for extension is generally in the range of about 40°C to about 80°C (e.g., about 50°C to about 70°C, about 60°C)). The extension time can be about 10 seconds to about 5 minutes (e.g., about 30 seconds to about 4 minutes, about 1 minute to about 3 minutes, about 1 minute 30 seconds to about 2 minutes).

[0087] PCR assays can use nucleic acids such as RNA or DNA (cDNA). The template nucleic acid does not need to be purified and can be a trace fraction of a complex mixture of nucleic acids found in human cells. Nucleic acid molecules can be extracted from biological samples by conventional techniques, such as those described in Diagnostic Molecular Microbiology: Principles and Applications (Persing et al., eds., 1993, American Society for Microbiology, Washington DC). Nucleic acids can be obtained from any number of sources, such as plasmids, or from natural sources including bacteria, yeast, protozoan viruses, organelles, or higher organisms such as plants or animals.

[0088] Oligonucleotide primers are combined with PCR reagents under reaction conditions that induce primer extension. For example, a chain extension reaction typically includes 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 15 mM MgCl2, 0.001% (w / v) gelatin, 0.5–1.0 μg of prototyped template DNA, 50 pmol of each oligonucleotide primer, 2.5 U of Taq polymerase, and 10% DMSO. The reaction product usually contains 150–320 μM each of dATP, dCTP, dTTP, dGTP, or one or more of these analogs.

[0089] The newly synthesized chains form double-stranded molecules that can be used in subsequent steps of the reaction. The steps of chain separation, annealing, and extension can be repeated as many times as necessary to produce the desired amount of amplification product corresponding to the target nucleic acid molecule. Limiting factors of the reaction are the amount of primers, thermostable enzymes, and nucleoside triphosphates present during the reaction. The cycling steps (i.e., denaturation, annealing, and extension) are preferably repeated at least once. For detection applications, the number of cycling steps depends, for example, on the nature of the sample. If the sample is a complex mixture of nucleic acids, more cycling steps will be required to amplify the target sequence sufficiently for detection. Generally, the cycling steps are repeated at least about 20 times, but may be 40, 60, or even 100 times.

[0090] Fluorescence resonance energy transfer (FRET) FRET technology (e.g., U.S. Patents 4,996,143, 5,565,322, 5,849,489, and 6,162,603) is based on the concept that energy transfer occurs between two fluorescent moieties, which can be visualized or otherwise detected and / or quantified, when a donor fluorescent moiety and a corresponding acceptor fluorescent moiety are positioned within a certain distance of each other. Typically, the donor transfers energy to the acceptor when excited by irradiation with light of a suitable wavelength. Typically, the acceptor re-emits the transferred energy in the form of irradiation with light of a different wavelength. In certain systems, non-fluorescent energy can be transferred between the donor and acceptor moieties via a biomolecule containing a substantially non-fluorescent donor moiety (see, e.g., U.S. Patent 7,741,467).

[0091] In one example, an oligonucleotide probe may contain a donor fluorescent moiety and a corresponding quencher, which may or may not be fluorescent, that dissipates energy transferred in a form other than light. If the probe is intact, energy transfer typically occurs between the donor and acceptor moieties so that fluorescence emission from the donor moiety is quenched by the acceptor moiety. During the extension step of the polymerase chain reaction, the probe bound to the amplified product is cleaved by the 5'-to-3' nuclease activity of, for example, Taq polymerase, so that fluorescence emission from the donor moiety is no longer quenched. Exemplary probes for this purpose are described, for example, in U.S. Patents 5,210,015, 5,994,056, and 6,171,785. Commonly used donor-acceptor pairs include the FAM-TAMRA pair. Commonly used quenchers are DABCYL and TAMRA. Commonly used dark quenchers include BlackHole Quenchers® (BHQ), (Biosearch Technologies, Inc., Novato, California), Iowa Black® (Integrated DNA Tech., Inc., Coralville, Iowa), and BlackBerry® Quencher 650 (BBQ-650), (Berry & Assoc, Dexter, Michigan).

[0092] In another example, two oligonucleotide probes, each containing a fluorescent moiety, can hybridize to an amplification product at a specific location determined by the complementarity of the oligonucleotide probes to the target nucleic acid sequence. When the oligonucleotide probes hybridize to the amplification product nucleic acid at the appropriate location, a FRET signal is generated. The hybridization temperature can range from approximately 35°C to approximately 65°C for approximately 10 seconds to approximately 1 minute.

[0093] Fluorescence analysis can be performed using, for example, a photon-counting epifluorescence microscope system (equipped with appropriate dichroic mirrors and filters for monitoring fluorescence emission over a specific range), a photon-counting photomultiplier tube system, or a fluorophotometer. Excitation to initiate energy transfer or to enable direct detection of the phosphor can be performed using an argon-ion laser, a high-intensity mercury (Hg) arc lamp, a fiber optic light source, or other high-intensity light sources appropriately filtered for excitation over a desired range.

[0094] When used herein with respect to the donor portion and the corresponding acceptor portion, "corresponding" refers to an acceptor fluorescent portion or dark quencher having an absorbance spectrum that overlaps with the emission spectrum of the donor fluorescent portion. The maximum wavelength of the emission spectrum of the acceptor fluorescent portion must be at least 100 nm greater than the maximum wavelength of the excitation spectrum of the donor fluorescent portion. This allows for efficient non-irradiation energy transfer between them.

[0095] The fluorescent donor and corresponding acceptor portions are generally selected for (a) highly efficient Forster energy transfer, (b) a large final Stokes shift (>100 nm), (c) a shift of emission to the red portion of the visible spectrum (>600 nm) as much as possible, and (d) a shift of emission to wavelengths higher than the Raman water fluorescence emission produced by excitation at the donor excitation wavelength. For example, a donor fluorescent portion can be selected that has its maximum excitation wavelength near the laser line (e.g., helium-cadmium 442 nm or argon 488 nm), a high extinction coefficient, a high quantum yield, and good overlap with the excitation spectrum of the corresponding acceptor fluorescent portion. The corresponding acceptor fluorescent portion can be selected that has a high extinction coefficient, a high quantum yield, good overlap of its excitation with the emission of the donor fluorescent portion, and emission in the red portion of the visible spectrum (>600 nm).

[0096] Representative donor fluorescent moieties that can be used with various acceptor fluorescent moieties in FRET technology include fluorescein, Lucifer Yellow, β-phycoerythrin, 9-acridine isothiocyanate, Lucifer Yellow VS, 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid, 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin, succinyl-1-pyrene butyrate, and 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid derivatives. Typical acceptor fluorescence moieties include LC Red 640, LC Red 705, Cy5, Cy5.5, lysamine rhodamine B sulfonyl chloride, tetramethylrhodamine isothiocyanate, rhodamine x isothiocyanate, erythrosine isothiocyanate, fluorescein, diethylenetriamine pentaacetate, or other chelates of lanthanide ions (e.g., europium or terbium), depending on the donor fluorescence moiety used. Donor and acceptor fluorescence moieties can be obtained, for example, from Molecular Probes (Junction City, Oregon) or Sigma Chemical Co. (St. Louis, Missouri).

[0097] The donor and acceptor fluorescent moieties can be bound to a suitable probe oligonucleotide via linker arms. The length of each linker arm is important because it affects the distance between the donor and acceptor fluorescent moieties. The length of a linker arm may be the distance in angstroms (Å) from the nucleotide base to the fluorescent moiety. Generally, linker arms are approximately 10 Å to 25 Å. The linker arms may be of the type described in International Publication 84 / 03285. International Publication 84 / 03285 also discloses methods for binding linker arms to specific nucleotide bases and methods for binding fluorescent moieties to linker arms.

[0098] Acceptor fluorescent moieties such as LC Red 640 can be combined with oligonucleotides containing aminolinkers (e.g., C6-aminophosphoramidite available from ABI (Foster City, California) or Glen Research (Sterling, Virginia)) to produce, for example, LC Red 640-labeled oligonucleotides. Common linkers used to conjugate donor fluorescent moieties such as fluorescein to oligonucleotides include thiourea linkers (from FITC, e.g., fluorescein-CPG from Glen Research or ChemGene (Ashland, Massachusetts)), amide linkers (fluorescein-NHS-ester derived, such as CX-fluorescein-CPG from BioGenex (San Ramon, California)), or 3'-amino-CPGs that require fluorescein-NHS-ester conjugation after oligonucleotide synthesis.

[0099] As described herein, amplification products can be detected using labeled hybridization probes utilizing FRET technology. One FRET format utilizes TaqMan® technology to detect the presence or absence of amplification products, and therefore the presence or absence of target genes. TaqMan® technology utilizes a single-strand hybridization probe labeled with, for example, a fluorescent dye and a quencher, which may or may not be fluorescent. When the first fluorescent moiety is excited with light of an appropriate wavelength, the absorbed energy is transferred to a second fluorescent moiety or dark quencher according to the FRET principle. The second fluorescent moiety is generally a quencher molecule. During the annealing step of the PCR reaction, the labeled hybridization probe binds to the target DNA (i.e., the amplification product) and is subsequently degraded during the extension step, for example, by the 5'-to-3' nuclease activity of Taq polymerase. As a result, the fluorescent moiety and the quencher moiety become spatially separated from each other. As a result, excitation of the first fluorescent moiety in the absence of a quencher can be used to detect fluorescence emission from the first fluorescent moiety. For example, the ABI PRISM® 7700 sequence detection system (Applied Biosystems) is suitable for carrying out the method disclosed herein for detecting the presence or absence of a target gene in a sample using TaqMan® technology.

[0100] Molecular beacons, combined with FRET, can also be used to detect the presence of amplification products using real-time PCR. Molecular beacon technology uses hybridization probes labeled with a first and a second fluorescent moiety. The second fluorescent moiety is typically a quencher, and the fluorescent label is usually located at each end of the probe. Molecular beacon technology uses probe oligonucleotides that have a sequence (e.g., a hairpin) that allows for secondary structure formation. As a result of the formation of the secondary structure within the probe, both fluorescent moieties are spatially close when the probe is in solution. After hybridization to the target nucleic acid (i.e., amplification product), the secondary structure of the probe is disrupted, and the fluorescent moieties separate from each other, thereby allowing the emission of the first fluorescent moiety to be detected after excitation with light of the appropriate wavelength.

[0101] Another common form of FRET technology utilizes two hybridization probes. Each probe can be labeled with a different fluorescent moiety and is generally designed to hybridize in close proximity to each other within a target DNA molecule (e.g., an amplification product). The donor fluorescent moiety, e.g., fluorescein, is excited at 470 nm by the light source of a LightCycler® instrument. During FRET, fluorescein transfers its energy to an acceptor fluorescent moiety, e.g., LightCycler®-Red640 (LC Red640) or LightCycler®-Red705 (LC Red705). The acceptor fluorescent moiety then emits longer wavelength light, which is detected by the optical detection system of the LightCycler® instrument. Efficient FRET can only occur if the fluorescent moieties are in direct, local proximity and the emission spectrum of the donor fluorescent moiety overlaps with the absorption spectrum of the acceptor fluorescent moiety. The intensity of the emitted signal can be correlated with the number of original target DNA molecules (e.g., the number of target strains / family genomes). When amplification of the target nucleic acid occurs and an amplification product is produced, the hybridizing process yields a detectable signal based on FRET between members of the probe pair.

[0102] Generally, the presence of FRET indicates the presence of the target gene in the sample, while the absence of FRET indicates the absence of the target gene in the sample. However, insufficient sample collection, delayed transport, inappropriate transport conditions, or the use of specific collection swabs (calcium alginate or aluminum shafts) are all conditions that can affect the success and / or accuracy of the test results. Using the method disclosed herein, detection of FRET within, for example, 45 cycles indicates the presence of the target strain / family of interest.

[0103] Typical biological samples that can be used to implement this method include, but are not limited to, respiratory specimens, fecal specimens, blood specimens, skin swabs, nasal swabs, wound swabs, blood cultures, and skin and soft tissue infections. Methods for collecting and storing biological samples are known to those skilled in the art. Biological samples can be processed (e.g., by nucleic acid extraction methods and / or kits known in the art) to release target gene nucleic acids, or in some cases, the biological samples can be brought into direct contact with PCR reaction components and appropriate oligonucleotides.

[0104] Melting curve analysis is an additional step that can be included in cycle profiling. Melting curve analysis is based on the fact that DNA melts at a characteristic temperature called the melting temperature (Tm), which is defined as the temperature at which half of the DNA double helix separates into single helixes. The melting temperature of DNA depends primarily on its nucleotide composition. Therefore, DNA molecules rich in G and C nucleotides have a higher Tm than DNA molecules rich in A and T nucleotides. The melting temperature of a probe can be determined by detecting the temperature at which the signal is lost. Similarly, the annealing temperature of a probe can be determined by detecting the temperature at which the signal is generated. The melting temperature of the probe from the amplification product can confirm the presence or absence of the target strain / family of interest in the sample.

[0105] Between each thermocycler run, control samples may also be cycled. A positive control sample may amplify a target nucleic acid control template (other than the amplified product of the described target gene) using, for example, control primers and probes. A positive control sample may also amplify a plasmid construct containing, for example, the target nucleic acid molecule. Such plasmid controls may be amplified internally (e.g., within the sample) or in a separate sample run alongside the patient sample, using the same primers and probes used to detect the intended target. Such controls are indicators of the success or failure of amplification, hybridization, and / or FRET reaction. Each thermocycler run may also include a negative control lacking, for example, the target template DNA. The negative control can measure contamination. This ensures that the system and reagents do not produce false-positive signals. Thus, the control reaction can easily determine, for example, the ability of the primers to anneal and initiate extension by sequence specificity, as well as the ability of the probes to hybridize by sequence specificity and for FRET to occur.

[0106] In one embodiment, the method includes a step to avoid contamination. For example, an enzymatic method utilizing uracil-DNA glycosylase is described in U.S. Patents No. 5,035,996, No. 5,683,896, and No. 5,945,313 for reducing or eliminating contamination between one thermocycler operation and the next.

[0107] This method can be carried out using conventional PCR methods combined with FRET technology. In one embodiment, a LightCycler® instrument is used. The following patent applications describe real-time PCR used with LightCycler® technology: International Publications 97 / 46707, 97 / 46714, and 97 / 46712.

[0108] LightCycler® can be operated using a PC workstation and can utilize the Windows NT operating system. The signal from the sample is obtained as the machine sequentially positions the capillaries on the optical unit. The software can display the fluorescence signal in real time immediately after each measurement. Fluorescence acquisition time is 10–100 milliseconds (msec). After each cycling step, a quantitative display of fluorescence versus cycle count can be continuously updated for all samples. The generated data can be saved for further analysis.

[0109] As an alternative to FRET, amplified products can be detected using double-stranded DNA-binding dyes such as fluorescent DNA-binding dyes (e.g., SYBR® Green or SYBR® Gold (Molecular Probes)). Upon interaction with double-stranded nucleic acids, these fluorescent DNA-binding dyes emit a fluorescent signal after being excited by light of an appropriate wavelength. Alternatively, double-stranded DNA-binding dyes such as nucleic acid intercalation dyes can be used. When using double-stranded DNA-binding dyes, melting curve analysis is usually performed to confirm the presence of amplified products.

[0110] Embodiments of this disclosure are not limited to the configuration of one or more commercially available devices.

[0111] Real-time PCR for phenotypic antimicrobial susceptibility testing (AST) While quantitative real-time PCR (qPCR or qRT-PCR) can identify and quantify bacteria in a sample with high specificity and sensitivity, its reliability in performing phenotypic-based AST using bacterial growth in the presence of an antimicrobial agent has not been consistently demonstrated. This invention utilizes mathematical relationships derived from PCR growth curves to determine whether a tested bacterial strain is susceptible, intermediate, or resistant (SIR) to a given antimicrobial agent. The principle behind phenotypic AST testing using PCR is shown in Figure 1. In the absence of the antimicrobial agent (shown as reference), bacteria are undergoing genomic DNA replication. In the presence of the antimicrobial agent, resistant bacteria replicate with a similar genomic copy number to the reference, while susceptible bacteria have inhibited replication and a lower copy number. This difference in growth provides a phenotypic readout that can be determined by qPCR.

[0112] Raw data from hypothetical qPCR experiments in which either resistant or susceptible bacterial strains were incubated for 4 hours with various concentrations of antimicrobial agents shown in Figure 2. In Figure 2A, the raw qPCR data are shown as growth curves where fluorescence (e.g., fluorescence from a TaqMan® probe) is measured at each PCR cycle. For resistant isolates, the growth curves are observed similarly regardless of the 4-hour incubation at various antimicrobial agent concentrations, while for susceptible isolates, a dose-dependent decrease in fluorescence intensity and an increase in the number of cycles required for the signal to cross the background (threshold) level (this is commonly referred to as the cycle threshold or Ct value) are observed. In Figure 2B, the same qPCR data are presented based on the Ct value, where resistant isolates show little to no change in the Ct value as a function of antimicrobial agent concentration, while susceptible isolates show a dose-dependent increase in the Ct value by detecting fewer replicating bacteria.

[0113] By using qPCR data and examining the various mathematical relationships shown in Figure 3, it is possible to determine whether a strain is susceptible, intermediate, or resistant to a given antimicrobial agent. Figure 3A shows mathematical relationships such as “slope,” “Ct,” “inflection,” “absolute fluorescence intensity (AFI),” and “endpoint relative intensity (ERI),” which represent the behavior of the raw qPCR amplification curve. As shown in Figure 3B, these features can be further evaluated as a function of antimicrobial agent exposure by relating the values ​​obtained in the presence of the antimicrobial agent to the values ​​obtained in the absence of the antimicrobial agent. Then, using the relative changes of these features, such as ΔCt or ΔAFI, the strain MIC for a given drug can be determined, and approved breakpoints can be used to determine strain resistance and susceptibility.

[0114] Based on the differences calculated in mathematical features, bacterial isolates were classified as resistant or susceptible using a simplified distribution model, as shown in Figure 4. The splitting utilizes the Gini exponent to determine which features and thresholds maximize the variance between the two classes. Only two splits are used to prevent overfitting, and a two-dimensional graphic representation is enabled for easier visualization. [Examples]

[0115] The following examples, tables, and figures are provided to aid in understanding the subject matter, and the true scope of that subject matter is described in the appended claims. It is understood that modifications to the prescribed procedures can be made without departing from the spirit of the invention.

[0116] Example 1 PCR conditions Real-time PCR detection of target genes was performed using the cobas® 6800 / 8800 system platform (Roche Molecular Systems, Inc., Pleasanton, California). The final concentrations of the amplification reagents are shown below:

[0117] [Table 29]

[0118] The table below shows typical thermal profiles used in PCR amplification reactions:

[0119] [Table 30]

[0120] The pre-PCR program included incubations at 55°C, 60°C, and 65°C for initial denaturation and reverse transcription of the RNA template. Incubation at the three temperatures offers the advantage of transcribing slightly mismatched target sequences (such as genetic variants of an organism) at lower temperatures, while suppressing RNA secondary structure formation at higher temperatures, thus resulting in more efficient transcription. The PCR cycling was divided into two measurements, each applying a single-step setting (combining annealing and extension). The first five cycles at 55°C allowed for increased inclusivity by pre-amplifying slightly mismatched target sequences, while the 45 cycles of the second measurement enhanced specificity by using an annealing / extension temperature of 58°C.

[0121] Example 2 PCR using primers / probes to detect Enterobacteria Using the PCR conditions described in Example 1, PCR assays employing the forward primer RM_ENTF (SEQ ID NO: 1), the reverse primer RM_ENTRP (SEQ ID NO: 2), and two probes targeting the rplP gene, RM_ETP02 (SEQ ID NO: 3) and RM_ETP02B (SEQ ID NO: 4), were tested against five bacterial strains from the Enterobacterales order: Escherichia coli, K. pneumoniae, E. cloaca, S. marcescens, and P. mirabilis, and two bacterial strains from the non-Enterobacterales order: Pseudomonas aeruginosa and A. baumannii. The concentrations of the starting materials used ranged from 1e8 to 5e8 CFU / ml for the cultures of all strains (overnight cultures pre-stored in glycerol), except for S. marcescens, which used DNA (approximately 1e7 copies / μl). No sample preparation of the cultures was performed. The results of this experiment showed that growth curves were observed only for five strains of the Enterobacterales family, but not for two non-intestinal bacterial strains, thereby demonstrating a good inclusive and exclusive profile for this particular combination of primers and probes for detecting the Enterobacterales. Similar experiments were conducted to test Pseudomonas aeruginosa-specific primers and probes (SEQ ID NOs. 5-8) and A. baumannii-specific primers and probes (SEQ ID NOs. 9-11), which also showed good specificity and exclusiveness (data not shown).

[0122] PCR assays using forward primer SEGP1899 (SEQ ID NO: 8), reverse primer SEGP1901 (SEQ ID NO: 9), and probe SEGP2016 (SEQ ID NO: 10), targeting the gyrB gene, were tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityi. Gram-positive organisms were also tested, but no significant amplification was observed (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. As shown in Figure 5, growth curves were observed only for species comprising the Enterobacteres order (including Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, and P. mirabilis). No significant amplification was observed for non-target organisms (S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityii), thereby demonstrating a good inclusive and exclusive profile for this particular combination of primers and probes for detecting the Enterobacteres order.

[0123] PCR assays were performed on other primer and probe combinations designed to target the rplP gene of the Enterobacteres order. PCR assays using forward primer SEGP2891 (SEQ ID NO: 5), reverse primer SEGP2892 (SEQ ID NO: 6), and probe SEGP2893 (SEQ ID NO: 7), which target the rplP gene, were tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityi. Gram-positive organisms were also tested, but no significant amplification was observed (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. As shown in Figure 6, growth curves were observed only for species constituting the Enterobacteres order (including Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, and P. mirabilis). No significant amplification was observed for non-target organisms (S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityii), thereby demonstrating a good inclusive and exclusive profile for this particular combination of primers and probes for detecting the Enterobacteres order.

[0124] Similar results were obtained in PCR assays using forward primer SEGP2799 (SEQ ID NO: 11), reverse primer SEGP2800 (SEQ ID NO: 12), SEGP2802 (SEQ ID NO: 13), and SEGP2821 (SEQ ID NO: 14), in combination with probes SEGP2804 (SEQ ID NO: 15) and SEGP2822 (SEQ ID NO: 16) that target the rpoB gene. As shown in Figure 7, growth curves were observed only for species constituting the Enterobacteres order (including Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, and P. mirabilis). No significant amplification was observed for non-target organisms (S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityii), thereby demonstrating a good inclusive and exclusive profile for this particular combination of primers and probes for detecting the Enterobacteres order.

[0125] Example 3 PCR using primers / probes to detect Acinetobacter species PCR assays using forward primer SEGP2603 (SEQ ID NO: 20), reverse primer SEGP2606 (SEQ ID NO: 21), and probe SEGP2769 (SEQ ID NO: 22), targeting the ompA gene, were tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityii. Gram-positive organisms were also tested but did not show significant amplification (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. As shown in Figure 8, growth curves were observed only for dominant pathogens belonging to the genera Acinetobacter (A. baumannii and A. pityii). No significant amplification was observed for non-target organisms (Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, and Pseudomonas aeruginosa), thereby demonstrating a good inclusive and exclusive profile for this particular combination of primer and probe for detecting Acinetobacter.

[0126] Similar results were obtained in PCR assays using forward primer SEGP2590 (SEQ ID NO: 23), reverse primer SEGP2593 (SEQ ID NO: 24), and probe SEGP2594 (SEQ ID NO: 25) targeting the rpoB gene (shown in Figure 9), as well as in PCR assays using forward primer SEGP2626 (SEQ ID NO: 26), reverse primer SEGP2628 (SEQ ID NO: 27), and probe SEGP2629 (SEQ ID NO: 28) targeting the gyrB gene (shown in Figure 10). These experiments demonstrate good inclusivity and exclusivity profiles for both primer and probe combinations for detecting Acinetobacter.

[0127] Example 4 PCR using primers / probes to detect Pseudomonas aeruginosa PCR assays using forward primer SEGP2341 (SEQ ID NO: 32), reverse primer SEGP2342 (SEQ ID NO: 33), and probe SEGP2343 (SEQ ID NO: 34), targeting the tuf gene, were tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityi. Gram-positive organisms were also tested but did not show significant amplification (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. As shown in Figure 11, growth curves were observed only for pathogens belonging to the genus Pseudomonas (Pseudomonas aeruginosa). No significant amplification was observed for non-target organisms (Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, A. baumannii, and A. pitti), thereby demonstrating a good inclusive and exclusive profile for this particular combination of primer and probe for detecting Pseudomonas aeruginosa.

[0128] Similar results were obtained in PCR assays using forward primer SEGP2630 (SEQ ID NO: 35), reverse primer SEGP2631 (SEQ ID NO: 36), and probe SEGP2632 (SEQ ID NO: 37) targeting the gyrB gene (shown in Figure 12), as well as in PCR assays using forward primer SEGP2634 (SEQ ID NO: 38), reverse primer SEGP2637 (SEQ ID NO: 39), and probe SEGP2640 (SEQ ID NO: 40) targeting the rpoB gene (shown in Figure 13). These experiments demonstrate good inclusivity and exclusivity profiles for both primer and probe combinations for detecting Pseudomonas aeruginosa.

[0129] Example 5 PCR using primers / probes to detect Stenotrophomonas maltophilia PCR assays using forward primer SEGP2532 (SEQ ID NO: 41), reverse primer SEGP2538 (SEQ ID NO: 42), and probe SEGP2544 (SEQ ID NO: 43), targeting the fdnG gene, were tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityi. Gram-positive organisms were also tested but did not show significant amplification (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. As shown in Figure 14, growth curves were observed only for Streptomyces maltophilia (S. maltophilia). No significant amplification was observed for non-target organisms (Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, Pseudomonas aeruginosa, A. baumannii, and A. pitti), thereby demonstrating a good inclusive and exclusive profile for this particular combination of primer and probe for detecting S. maltophilia.

[0130] Similar results were obtained in PCR assays using forward primer SEGP2578 (SEQ ID NO: 44), reverse primer SEGP2579 (SEQ ID NO: 45), and probe SEGP2580 (SEQ ID NO: 46) targeting the gyrB gene (shown in Figure 15), as well as in PCR assays using forward primer SEGP2572 (SEQ ID NO: 47), reverse primer SEGP2573 (SEQ ID NO: 48), and probe SEGP2574 (SEQ ID NO: 49) targeting the tuf gene (shown in Figure 16). These experiments demonstrate good inclusivity and exclusivity profiles for both primer and probe combinations for detecting S. maltophilia.

[0131] Example 6 PCR using primers / probes to detect Enterococcus species PCR assays using forward primer SEGP2522 (SEQ ID NO: 53), reverse primer SEGP2525 (SEQ ID NO: 54), and probe SEGP2770 (SEQ ID NO: 55), targeting the rpoB gene, were tested against common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. piogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Gram-negative organisms were also tested but did not show significant amplification (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. Amplification curves were observed only for pathogens belonging to the genus Enterococcus (E. faecium and E. faecalis), as shown in Figure 17. No significant amplification was observed for non-target organisms (S. agalactia, Streptococcus pneumoniae, S. pyogenes, Staphylococcus aureus, and S. epidermidis), thereby demonstrating a good inclusive and exclusive profile for this particular combination of primer and probe for detecting Enterococcus species.

[0132] Similar results were obtained in PCR assays using forward primers SEGP1624 (SEQ ID NO: 56) and SEGP1627 (SEQ ID NO: 57), reverse primers SEGP1625 (SEQ ID NO: 58) and SEGP1628 (SEQ ID NO: 59), and probes SEGP1626 (SEQ ID NO: 60) and SEGP1629 (SEQ ID NO: 61), targeting the ddl gene (shown in Figure 18). Good specificity was also observed in PCR assays using forward primers SEGP2882 (SEQ ID NO: 62) and SEGP2884 (SEQ ID NO: 63), reverse primers SEGP2885 (SEQ ID NO: 64) and SEGP2886 (SEQ ID NO: 65), and probe SEGP2888 (SEQ ID NO: 66), targeting the gyrB gene (shown in Figure 19). These experiments demonstrate good inclusivity and exclusivity profiles for both primer and probe combinations for detecting Enterococcus.

[0133] Example 7 PCR using primers / probes to detect Staphylococcus aureus PCR assays using forward primer SEGP1490 (SEQ ID NO: 67), reverse primer SEGP1491 (SEQ ID NO: 68), and probe SEGP1492 (SEQ ID NO: 72), targeting the CPE gene, were tested against common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. piogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Gram-negative organisms were also tested, but no significant amplification was observed (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. As shown in Figure 20, significant growth curves were observed only for pathogens belonging to the Staphylococcus aureus species. No significant amplification was observed for non-target organisms (S. agalactia, Streptococcus pneumoniae, S. piogenes, E. faecium, E. faecalis, and S. epidermidis), thereby demonstrating a good inclusivity and exclusivity profile for this particular combination of primer and probe for detecting Staphylococcus aureus.

[0134] Similar results were obtained in PCR assays using forward primer SEGP2792 (SEQ ID NO: 73), reverse primer SEGP2793 (SEQ ID NO: 74), and probe SEGP2794 (SEQ ID NO: 75) targeting the gyrB gene (shown in Figure 21), as well as in PCR assays using forward primer SEGP2932 (SEQ ID NO: 76), reverse primer SEGP2933 (SEQ ID NO: 77), and probe SEGP2935 (SEQ ID NO: 78) targeting the ddlA gene (shown in Figure 22). These experiments demonstrate good inclusivity and exclusivity profiles for both primer and probe combinations for detecting Staphylococcus aureus.

[0135] Example 8 PCR using primers / probes to detect Streptococcus agalactia PCR assays using forward primer SEGP2921 (SEQ ID NO: 121), reverse primer SEGP2922 (SEQ ID NO: 122), and probe SEGP2923 (SEQ ID NO: 123), targeting the gyrB gene, were tested against common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. pyogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Gram-negative organisms were also tested but did not show significant amplification (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. As shown in Figure 23, significant growth curves were observed only for pathogens belonging to the Streptococcus agalactia species. No significant amplification was observed for non-target organisms (Streptococcus pneumoniae, S. piogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis), thereby demonstrating a good inclusivity and exclusivity profile for this particular combination of primer and probe for detecting the genus S. agalactia.

[0136] Similar results were obtained in PCR assays using forward primer SEGP2204 (SEQ ID NO: 82), reverse primer SEGP2205 (SEQ ID NO: 83), and probe SEGP2206 (SEQ ID NO: 84) targeting the sip gene (shown in Figure 24), as well as in PCR assays using forward primer SEGP2947 (SEQ ID NO: 85), reverse primer SEGP2949 (SEQ ID NO: 86), and probe SEGP2951 (SEQ ID NO: 87) targeting the ddlA gene (shown in Figure 25). These experiments demonstrate good inclusivity and exclusivity profiles for both primer and probe combinations for detecting S. agalactia.

[0137] Example 9 PCR using primers / probes to detect Candida species PCR assays using forward primer SEGP1712 (SEQ ID NO: 88), reverse primer SEGP1713 (SEQ ID NO: 89), and probe SEGP1716 (SEQ ID NO: 90), targeting RDN18 (18s rRNA), were tested against common fungal pathogens: Candida albicans and Candida auris. Gram-negative and Gram-positive organisms were also tested, but no significant amplification was observed (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. Significant amplification curves were observed only for pathogens belonging to the Candida genus, as shown in Figure 26. No significant amplification was observed for non-target organisms, thereby demonstrating a good inclusive and exclusive profile for this particular combination of primers and probes for detecting Candida.

[0138] PCR assays using forward primer SEGP1718 (SEQ ID NO: 91), reverse primer SEGP1719 (SEQ ID NO: 92), and probe SEGP1722.1 (SEQ ID NO: 93), targeting the RDN58 (5.8s rRNA) gene, were tested against C. albicans and C. auris. Tests were also performed on Gram-negative and Gram-positive organisms, but no significant amplification was observed (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. Significant amplification curves were observed only for pathogens belonging to the Candida genus, as shown in Figure 27. No significant amplification was observed for non-target organisms, thereby demonstrating a good inclusive and exclusive profile for this particular combination of primers and probes for detecting Candida.

[0139] Example 10 PCR for detecting common Gram-negative and Gram-positive pathogens PCR assays using forward primer SEGP1830 (SEQ ID NO: 94), reverse primer SEGP1831 (SEQ ID NO: 95), and probe SEGP1895.1 (SEQ ID NO: 96), targeting the 16s gene, were tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityi. Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. Amplification curves were observed for all Gram-negative pathogens, as shown in Figure 28, thereby demonstrating this particular combination of primer and probe for detecting common Gram-negative pathogens.

[0140] The same combination of primers and probes targeting the 16s gene was also tested at the same concentrations against common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. piogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Amplification curves were observed for all Gram-positive pathogens, as shown in Figure 29, thereby demonstrating this particular combination of primers and probes for detecting common Gram-positive pathogens.

[0141] Example 11: Interpretation of AST results

[0142] Generally, the two most commonly used guidelines for interpreting antimicrobial susceptibility testing (AST) results are those from: 1) the Clinical Laboratory Standards Institute (CLSI), and 2) the European Commission on Antimicrobial Susceptibility Testing (EUCAST). The United States uses the CLSI guidelines, while European countries use the EUCAST guidelines. The latest version from CLSI is M100 ED30 "Performance Criteria for Antimicrobial Susceptibility Testing, No. 30 版This document is available at URL:clsi.org / standards / products / microbiology / documents / m100. The current version from EUCAST is version 10, "The European Committee on Antimicrobial Susceptibility Testing, Breakpoint Tables for Interpretation of MIC and Zone Diameter, version 10.0, 2020," and is available at URL:www.eucast.org / fileadmin / src / media / PDFs / EUCAST_files / Breakpoint_tables / v_10.0_Breakpoint_Tables.pdf.

[0143] The minimum inhibitory concentration (MIC) breakpoints established in Figures 30-1 and 30-2 are expressed as μg / mL for many Gram-negative bacterial organisms (Enterobacteriales, Pseudomonas aeruginosa, Acinetobacter, S. maltophilia), as determined by Clinical and Laboratory Standards Institute (CLSI) document M100 ED30. Breakpoints are used to interpret MIC results from antimicrobial susceptibility testing and to classify the "grouping" of organisms as susceptible, intermediate, or resistant to a given antimicrobial agent. The grouping of organisms can be at various levels, including but not limited to species, genus, order, or specific biochemical characteristics.

[0144] The minimum inhibitory concentration (MIC) breakpoints established in Figure 31 are shown as μg / mL for many Gram-positive bacterial organisms (Staphylococcus aureus and S. rugdunensis, S. epidermidis, Enterococcus species, Streptococcus pneumoniae, Streptococcus β-hemolytic, and Viridans streptococcus), as determined by the Clinical and Laboratory Standards Institute (CLSI) document M100 ED30. Breakpoints are used to interpret MIC results from antimicrobial susceptibility testing and to classify the "grouping" of organisms as susceptible, intermediate, or resistant to a given antimicrobial agent. The grouping of organisms can be at various levels, including but not limited to species, genus, order, or specific biochemical characteristics. The minimum inhibitory concentration (MIC) breakpoints established in Figure 32 are shown as μg / mL for fungi (Candida albicans, Candida brabulata, Candida crusei, Candida tropicalis, Candida auris) as determined by the Clinical and Laboratory Standards Institute (CLSI) document M60 ED1. Breakpoints are used to interpret MIC results from antifungal susceptibility testing (AFST) and to classify organisms as susceptible, intermediate, or resistant to a given antifungal agent. Organism grouping can be at various levels, including but not limited to species, genus, order, or specific biochemical characteristics. It should be noted that while AFST is recommended for Candida auris, neither the CLSI nor the CDC has currently established a breakpoint for this species. AFST is based on closely related Candida species and uses expert opinion to determine the susceptibility of Candida auris isolates to specific antifungal agents.

[0145] Example 12: PCR ID / AST assay protocol Methods and materials a. Prepare the antimicrobial (Abx) plates in advance and store them at -80°C until needed. i. Diluent - Cation-modified Mueller-Hinton broth (CAMHB) ii. Final volume - 50 μl / well iii. Remove from -80°C and thaw at room temperature for 30 minutes before use.

[0146] [Table 31]

[0147] b. Overnight incubation in CAMHB: -37°C / 16-18 hours / 500rpm i. 10 μl glycerol stock + 490 μl CAMHB in a 2 mL 96-well deep-well plate. c. Standardize the culture to 1.00E+06 CFU / mL by optical density (OD). Prepare the test plate by adding 50 μl of the standardized test isolate to the appropriate wells of the Abx plate as outlined.

[0148] [Table 32]

[0149] e. Incubate the test plate at 37°C for 4 hours without shaking. f. Prepare the PCR reagents according to Table IV. Add 45 μl of the master mix to each well of the PCR assay plate. h. After incubation, stamp 5 μl / well of the test plate onto the PCR assay plate. i. Final volume - 50 μl / well i. For the test plates, continue incubation at 37°C for 12-16 hours without shaking to determine the minimum inhibitory concentration (MIC) for the reference method. Load the J.PCR assay plate into the cobas(registered trademark) z480 instrument and run the assay under the conditions shown in Table IV. k. After incubation, the MIC test plates were read to determine phenotypic susceptibility / moderate / tolerance.

[0150] Example 13: Real-time PCR ID and AST assay of Enterobacteriaceae. Rapid identification and phenotypic susceptibility testing of Enterobacteriales were performed using three different target genes, gyrB, rplP, and rpoB, as well as three classes of antimicrobial agents: ciprofloxacin (fluoroquinolone), gentamicin (aminoglycoside), and meropenem (carbapenem). The primer / probe sets used were as follows: For gyrB, SEQ ID NO: 8 (forward primer), SEQ ID NO: 9 (reverse primer), SEQ ID NO: 10 (probe); for rplP, SEQ ID NO: 5 (forward primer), SEQ ID NO: 6 (reverse primer), SEQ ID NO: 7 (probe); for rpoB, SEQ ID NO: 11 (forward primer), SEQ ID NOs: 12-14 (reverse primers), SEQ ID NOs: 15-16 (probes). The susceptibility of K. pneumoniae strains 0143 (antimicrobial-resistant strain) and 16565 (antimicrobial-susceptible strain) to given antimicrobial agents was determined by interpreting the Clinical and Laboratory Standards Institute (CLSI) document M100 ED30, respectively. Each strain was inoculated at 5e5 CFU / mL into wells containing various concentrations of indicated antimicrobial agents, incubated for 4 hours, and then subjected to PCR-based rapid ID / AST testing using the protocol of Example 12.

[0151] The results are shown in Figure 33. The percentage on the Y axis, indicated as "Abx Level 1 Dilution Change," was determined using the calculation 2^-(Abx_Level_1_Ct-Reference_Ct) or 2^-(ΔCt). The Abx level indication is not related to the actual concentration used, but rather indicates which 2x dilution is being referenced, given that Abx Level 1 is the lowest concentration and each level up is twice as high (see Table XXXI). As an example of how the dilution change is calculated, if the Reference_Ct value (i.e., the Ct value without the antibacterial agent) is 20 and the Abx_Level_1_Ct value is 22, then the dilution change = 2^-(22-20) = 2^-2 = 1 / 2 × 1 / 2 = 25%. Based on these calculations, strains resistant to antimicrobial agents with lower ΔCt values ​​had higher "multiplier change" values ​​than strains susceptible to antimicrobial agents with higher ΔCt values, and in Figure 33, Abx level 1 was able to yield the best isolation between the resistant strain Kpn0143 and the susceptible strain Kpn16565. These data further demonstrate that all three gene targets (gyrB, rplB, rpoB) can be used to obtain correct susceptibility results for both Kpn strains when determining susceptibility or resistance to ciprofloxacin, gentamicin, and meropenem. However, any given target gene may function better or worse to determine susceptibility or resistance to a given antimicrobial agent. In summary, these results indicate that various target genes and alleles can be used for rapid PCR-based ID / AST of Enterobacter species, as long as the primers and probes can demonstrate the correct inclusivity and exclusivity criteria for Enterobacter species, as shown in Example 2, Figures 5-7.

[0152] Example 14: Real-time PCR ID and AST assay of Pseudomonas aeruginosa Rapid identification and phenotypic antimicrobial susceptibility testing of Pseudomonas aeruginosa were performed using three different target genes, tuf, gyrB, and rpoB, and three classes of antimicrobial agents, ciprofloxacin, gentamicin, and meropenem. The primer / probe sets used were as follows: for tuf, SEQ ID NO: 32 (forward primer), SEQ ID NO: 33 (reverse primer), SEQ ID NO: 34 (probe); for gyrB, SEQ ID NO: 35 (forward primer), SEQ ID NO: 36 (reverse primer), SEQ ID NO: 37 (probe); for rpoB, SEQ ID NO: 38 (forward primer), SEQ ID NO: 39 (reverse primer), SEQ ID NO: 40 (probe). The antimicrobial susceptibility of Pseudomonas aeruginosa strains 16657 (resistant) and 17816 (susceptible) was interpreted according to Clinical and Laboratory Standards Institute (CLSI) document M100 ED30 to determine resistance and susceptibility to a given antimicrobial agent, respectively. Each strain was inoculated at 5e5 CFU / mL into wells containing various concentrations of the indicated antimicrobial agent, incubated for 4 hours, and then subjected to a rapid PCR-based ID / AST test using the protocol of Example 12. As shown in Figure 34, the results indicate that while some target alleles appear to function better for some antimicrobial agents, all three gene targets can be utilized to obtain correct susceptibility results for the two Pseudomonas aeruginosa strains. In summary, these results suggest that various target genes and alleles can be used for rapid PCR-based ID / AST if they provide correct inclusion and exclusivity criteria for Pseudomonas aeruginosa (see Figures 11-13).

[0153] Example 15: Real-time PCR ID and AST assay of Acinetobacter baumannii Rapid identification and phenotypic antimicrobial susceptibility testing of Acinetobacter baumannii were performed using three different target genes, ompA, rpoB, and gyrB, and three classes of antimicrobial agents, ciprofloxacin, gentamicin, and meropenem. The primer / probe sets used were as follows: For ompA, SEQ ID NO: 20 (forward primer), SEQ ID NO: 21 (reverse primer), SEQ ID NO: 22 (probe); for rpoB, SEQ ID NO: 23 (forward primer), SEQ ID NO: 24 (reverse primer), SEQ ID NO: 25 (probe); for gyrB, SEQ ID NO: 26 (forward primer), SEQ ID NO: 27 (reverse primer), SEQ ID NO: 28 (probe). Antimicrobial susceptibility of A. baumannii strains 17694 (resistant) and 16421 (susceptible) was interpreted according to the Clinical and Laboratory Standards Institute (CLSI) document M100 ED30 to determine resistance and susceptibility to a given antimicrobial agent, respectively. Each strain was inoculated into wells containing various concentrations of the indicated antimicrobial agent at 5e5 CFU / mL, incubated for 4 hours, and then subjected to a PCR-based rapid ID / AST test using the protocol of Example 12. As shown in Figure 35, the results indicate that while some target alleles appear to function better for some antimicrobial agents, all three gene targets can be utilized to obtain correct susceptibility results for both Abi strains. In summary, these results suggest that various target genes and alleles can be used in rapid PCR-based ID / AST tests if they provide correct inclusivity and exclusivity criteria for A. baumannii (see Figures 8-10).

[0154] Example 16: Real-time PCR ID and AST assay of Staphylococcus aureus Rapid identification and phenotypic antimicrobial susceptibility testing of Staphylococcus aureus were performed using three different target genes (gyrB, ddlA, and tuf) and one class of antimicrobial agent: cefoxitin (cephalosporin). The primer / probe sets used were as follows: For gyrB, SEQ ID NO: 73 (forward primer), SEQ ID NO: 74 (reverse primer), and SEQ ID NO: 75 (probe); for ddlA, SEQ ID NO: 76 (forward primer), SEQ ID NO: 77 (reverse primer), and SEQ ID NO: 78 (probe); and for tuf, SEQ ID NO: 79 (forward primer), SEQ ID NO: 80 (reverse primer), and SEQ ID NO: 81 (probe). The antimicrobial susceptibility of Staphylococcus aureus strains 15509 (resistant) and 16405 (susceptible) was interpreted according to Clinical and Laboratory Standards Institute (CLSI) document M100 ED30 to determine resistance and susceptibility to a given antimicrobial agent, respectively. Each strain was inoculated at 5e5 CFU / mL into wells containing various concentrations of the indicated antimicrobial agent, incubated for 4 hours, and then subjected to a rapid PCR-based ID / AST test using the protocol of Example 12. The results, as shown in Figure 36, show that while some target alleles appear to function better, all three gene targets can be utilized to obtain correct susceptibility results for both Staphylococcus aureus strains. In summary, these results indicate that various target genes and alleles can be used for rapid PCR-based ID / AST if they provide correct inclusion and exclusion criteria for Staphylococcus aureus (see Figures 21-22).

[0155] Example 17: Real-time PCR ID and AST assay of Enterococcus faecium Rapid identification and phenotypic susceptibility testing of Enterococcus faecium were performed using three different target genes (rpoB, ddl, gyrB) and two classes of antimicrobial agents, ampicillin (beta-lactam) and vancomycin (glycopeptide). The primer / probe sets used were as follows: For rpoB, SEQ ID NO: 53 (forward primer), SEQ ID NO: 54 (reverse primer), SEQ ID NO: 55 (probe); for ddl, SEQ ID NOs: 56-57 (forward primer), SEQ ID NOs: 58-59 (reverse primer), SEQ ID NOs: 60-61 (probe); for gyrB, SEQ ID NOs: 62-63 (forward primer), SEQ ID NOs: 64-65 (reverse primer), SEQ ID NO: 66 (probe). The antimicrobial susceptibility of E. faecium strains 18483 (resistant) and 18446 (susceptible) was interpreted according to Clinical and Laboratory Standards Institute (CLSI) document M100 ED30 to determine resistance and susceptibility to a given antimicrobial agent, respectively. Each strain was inoculated at 5e5 CFU / mL into wells containing various concentrations of indicated antimicrobial agents, and after 4 hours of incubation, subjected to rapid PCR-based ID / AST testing using the protocol of Example 12. The results, as shown in Figure 37, show that while some target alleles appear to function better, all three gene targets can be utilized to obtain correct susceptibility results for both E. faecium strains. In summary, these results indicate that various target genes and alleles can be used for rapid PCR-based ID / AST testing if they provide correct inclusivity and exclusivity criteria for E. faecium (see Figures 17-19).

[0156] Example 18: Real-time PCR ID and AST assay of Candida species Rapid identification of Candida and phenotypic antimicrobial susceptibility testing can be performed using the target genes RDN18 (18s ribosomal RNA) and RDN58 (5.8s ribosomal RNA) with the following primers and probes, as shown in Figure 38. For RDN18, use SEQ ID NO: 88 (forward primer), SEQ ID NO: 89 (reverse primer), SEQ ID NO: 90 (probe); for RDN58, use SEQ ID NO: 91 (forward primer), SEQ ID NO: 92 (reverse primer), SEQ ID NO: 93 (probe). The precise inclusion and exclusivity criteria for Candida are shown in Figures 26-27.

[0157] Example 19 General-purpose real-time PCR ID and AST assay By targeting the widely conserved 16s ribosomal RNA gene, rapid identification and phenotypic susceptibility testing of any given Gram-negative or Gram-positive bacterium can be performed using the primers and probes shown in Figure 39, namely SEQ ID NO: 94 (forward primer), SEQ ID NO: 95 (reverse primer), and SEQ ID NO: 96 (probe).

[0158] Example 20 Multiplex PCR ID assay using breakpoint group Figure 40A shows the inclusiveness and exclusivity performance of the Gram-negative pathogen PCR multiplex master mix. The Acinetobacter PCR detection set utilizes forward primer SEGP2603 (SEQ ID NO: 20), reverse primer SEGP2606 (SEQ ID NO: 21), and probe SEGP2769 (SEQ ID NO: 22), targeting the ompA gene (see Table V), and assay results are reported in Channel 1. The Pseudomonas aeruginosa PCR detection set utilizes forward primer SEGP2341 (SEQ ID NO: 32), reverse primer SEGP2342 (SEQ ID NO: 33), and probe SEGP2343 (SEQ ID NO: 34), targeting the tuf gene (see Table VIII), and assay results are reported in Channel 2. The Enterobacter order PCR detection set utilizes forward primer SEGP1899 (SEQ ID NO: 8), reverse primer SEGP1901 (SEQ ID NO: 9), and probe SEGP2016 (SEQ ID NO: 10), targeting the gyrB gene (see Table III), and assay results are reported in Channel 3. The general bacterial PCR detection set utilizes forward primer SEGP1830 (SEQ ID NO: 94), reverse primer SEGP1831 (SEQ ID NO: 95), and probe SEGP1895.1 (SEQ ID NO: 96), targeting the 16srRNA gene (see Table XXVIII), and assay results are reported in Channel 4. Finally, the general internal control PCR detection set uses forward primer SEGP1952 (ACAACCGCGCCATACATGTCAAGA<t_BB_dC> ;Sequence ID 97), Reverse primer SEGP1953 (GTCGGGCCGCTTATACAGTACCA<t_BB_dC> ;Sequence ID 98) and probe SEGP1954(<CY5.5> TGCGCGTCCCG<BHQ_2> TTTTGATACTTCGTAACGGTGC <phos>Using Sequence ID No. 99, assay results are reported in channel 5. Breakpoint groups, channels, and dye wavelengths are summarized in Figure 40B. Genomic DNA concentrations were approximately 2–10 ng / μL for all samples. Multiplex reactions were tested against genomic DNA isolated from common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloaca, K. oxytoka, K. aerogenes, S. marcescens, P. mirabilis, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pityi. Furthermore, no significant amplification was observed with genomic DNA isolated from common Gram-positive pathogens (data not shown). As designed, amplification curves were observed in the correct channels for the desired pathogens, indicating that the multiplex reaction exhibits very strong inclusiveness and exclusivity.

[0159] Figure 41A shows the inclusiveness and exclusivity performance of the Gram-positive pathogen PCR multiplex master mix. The Streptococcus PCR detection set utilizes forward primer SEGP1705 (SEQ ID NO: 100), reverse primer SEGP1706 (SEQ ID NO: 101), and probe SEGP1709.1 (SEQ ID NO: 102), targeting the tuf gene (see Table XXV), and assay results are reported in Channel 1. The Staphylococcus PCR detection set utilizes forward primer SEGP1835 (SEQ ID NO: 79), reverse primer SEGP1836 (SEQ ID NO: 80), and probe SEGP1838 (SEQ ID NO: 81), targeting the tuf gene (see Table XXI), and assay results are reported in Channel 2. The Enterococcus PCR detection set utilizes forward primer SEGP2522 (SEQ ID NO: 53), reverse primer SEGP2525 (SEQ ID NO: 54), and probe SEGP2770 (SEQ ID NO: 55), targeting the rpoB gene (see Table XV), and assay results are reported in channel 3. The general bacterial PCR detection set utilizes forward primer SEGP1830 (SEQ ID NO: 94), reverse primer SEGP1831 (SEQ ID NO: 95), and probe SEGP1895.1 (SEQ ID NO: 96), targeting the 16srRNA gene (see Table XXVIII), and assay results are reported in channel 4. Finally, the general internal control PCR detection set utilizes forward primer SEGP1952 (SEQ ID NO: 97), reverse primer SEGP1953 (SEQ ID NO: 98), and probe SEGP1954 (SEQ ID NO: 99), and assay results are reported in channel 5. The breakpoint groups, channels, and dye wavelengths are summarized in Figure 41B. The genomic DNA concentration was approximately 2–10 ng / μL for all samples. Multiplex reactions were tested against purified genomic DNA from common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. piogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. Furthermore, no significant amplification was observed with genomic DNA isolated from common Gram-negative pathogens (data not shown).As designed, the amplification curves are observed in the correct channels for the desired pathogen, indicating that the multiple reactions exhibit very strong inclusiveness and exclusivity.

[0160] Example 21: Analysis of PCR-AST assay Figure 42 includes graphs from a series of PCR-AST assays on diverse Gram-negative strains, showing various thresholds that can be used to distinguish between susceptible and resistant isolates of multiple pathogen populations, separated into different channels and interpreted using statistical isolation of populations, as outlined in Figure 4. Thresholds related to ciprofloxacin susceptibility are: The data describes A) Acinetobacter baumannii (Abi) using primers / probes of sequence numbers 17-19 targeting the ompA gene, B) Enterobacteria (Entero) using primers / probes of sequence numbers 1-3 targeting the rplP gene, and C) Pseudomonas aeruginosa (Pae) ​​using primers / probes as shown in Table XXXIII targeting the O-acetylase gene, based on the change in Ct value with 2 μg / mL ciprofloxacin compared to a control without ciprofloxacin (ΔCt), ΔCt with 0.5 μF Ig / mL ciprofloxacin and 1 μg / mL ciprofloxacin, and the previous slope (slope) of the Ct fluorescence value with 0.5 μg / mL ciprofloxacin and ΔCt with 1 μg / mL ciprofloxacin.

[0161] [Table 33]

[0162] Figure 43A) shows the distribution of resistant and susceptible isolates tested for Enterobacteres, subdivided into Abi, Pae, and strains E. cloaca (Ecl), Escherichia coli (Eco), K. aerogenes (Kae), and K. pneumoniae (Kpn). Figure 43B) shows interspecies susceptibility, specificity, and category agreement of ciprofloxacin using the thresholds in Figure 42. Susceptibility is defined as total positive / (total positive + false negative); specificity is defined as total negative / (total negative + false positive); and category agreement is defined as (total positive + total negative) / (total positive + false negative + total negative + false positive).

[0163] Figure 44 includes graphs from a second PCR-AST assay showing thresholds related to gentamicin susceptibility for A) Abi, B) Entero, and C) Pae using their respective primer / probe sets, based on the degree of curve fit to biofluorescence data at 1 μg / mL gentamicin injection cycles, changes in absolute fluorescence intensity (ΔAFI) at 1 μg / mL and 8 μg / mL gentamicin, and ΔAFI at 16 μg / mL and 4 μg / mL gentamicin. Figure 45A) shows the distribution of resistant and susceptible isolates tested for Abi, Pae, and Enterobacter species subdivided into Enterobacter cloaca (Ecl), Escherichia coli (Eco), Klebsiella aerogenes (Kae), and Klebsiella pneumoniae (Kpn). Figure 45B) shows interspecies gentamicin susceptibility, specificity, and category agreement using the thresholds in Figure 44.

[0164] Figure 46 includes graphs from a third PCR-AST assay showing thresholds related to meropenem sensitivity for A) Abi, B) Entero, and C) Pae, using each primer / probe set, based on the change in Ct value at 4 μg / mL meropenem compared to a control without meropenem (ΔCt), the change in Ct value at 4 μg / mL meropenem compared to the lowest meropenem concentration at 0.25 μg / mL (ΔAbx-Ct) and the absolute Ct value at 0.25 μg / mL meropenem (Ct), as well as absolute fluorescence intensity (AFI) at 1 μg / mL meropenem and ΔCt at 4 μg / mL meropenem. Figure 47A) shows the distribution of resistant and susceptible isolates tested for Abi, Pae, and Enterobacteres Ecl, Eco, Kae, and Kpn. Figure 47B) shows interspecies gentamicin susceptibility, specificity, and category agreement using the thresholds shown in Figure 46.

[0165] Figure 48A) describes a workflow for testing bacterial isolates directly from positive blood culture samples, prepared by adding a certain concentration of bacteria to whole blood, separating red blood cells, inoculating the plasma containing the bacteria into a commercially available blood culture bottle, incubating overnight, and then following the PCR-AST assay protocol described in Example 12 for testing isolates known to be resistant or susceptible to gentamicin. Figure 48B) shows the results of this experiment, distinguishing resistant isolates from susceptible isolates using changes in Ct values ​​(ΔCt), demonstrating that phenotypic results can be obtained directly on bacteria from positive blood cultures.

[0166] Example 22: Multiple ID-AST PCR assay of multiple bacterial samples The A.Kpn / Abi multiplex PCR ID-AST assay was performed on multibacterial samples co-incubated with three different antibiotics at varying concentrations, either in the absence or in the presence of cyproflaxocin, gentamicin, and meropenem, using two Gram-negative organisms with different susceptibility combinations, Klebsiella pneumoniae (Kpn) and Acinetobacter baumannii (Abi), in a 1:1 ratio. Kpn signal detection was performed using an ATTO-labeled probe, and Abi signal detection was performed using a HEX-labeled probe. The primers and probes used in this assay are shown in Table XXXIV, and the results are shown in Figure 49. Each species exhibited appropriate phenotypes in the corresponding detection channels, as indicated by the delta-CT threshold for separating susceptible and resistant strains, thereby providing accurate antimicrobial susceptibility results for various multibacterial scenarios.

[0167] [Table 34]

[0168] The B.Kpn / Sar multiplex PCR ID-AST assay was performed on multibacterial samples co-incubated with three different antibiotics—ciprofloxacin, cefoxitin, and meropenem—at varying concentrations, either in the absence or in the presence of one Gram-negative organism, Klebsiella pneumoniae (Kpn), and one Gram-positive organism, Staphylococcus aureus (Sar), in a 1:1 ratio. Kpn signals were detected using HEX-labeled probes, and Sar signals were detected using FAM-labeled probes. The primers and probes used in this assay are shown in Table XXXV, and the results are shown in Figure 50. N / A indicates no clinically relevant interpretation for the corresponding bacterium-drug combination. Each species exhibited appropriate phenotypes in the corresponding detection channel, as indicated by the delta-CT threshold for separating susceptible and resistant strains, thereby providing accurate antimicrobial susceptibility results for various multibacterial scenarios.

[0169] [Table 35]

[0170] The C.Kpn / Cal multiplex PCR ID-AST assay was performed on multiple bacterial samples co-incubated together in the absence or presence of two different antibiotics, ciprofloxacin and meropenem, at varying concentrations, using one Gram-negative organism, Klebsiella pneumoniae (Kpn), and one fungal organism, Candida albicans (Cal), with different susceptibility combinations, in a 1:1 ratio. Kpn signal detection was performed using a HEX-labeled probe, and Cal signal detection was performed using a FAM-labeled probe. The primers and probes used in this assay are shown in Table XXXVI, and the results are shown in Figure 51. N / A indicates no clinically relevant interpretation for the corresponding bio-drug combination. Cal susceptibility to fluconazole is shown. Kpn strains exhibited appropriate phenotypes in the corresponding detection channels, as indicated by the delta-Ct threshold for separating susceptible and resistant isolates, providing accurate antimicrobial susceptibility results.

[0171] [Table 36]

[0172] The D.Efs / Sar multiplex PCR ID-AST assay was performed on multiple bacterial samples co-incubated with two Gram-positive organisms, Enterococcus faecalis (Efs) and Staphylococcus aureus (Sar), in a 1:1 ratio, in different susceptibility combinations, either in the absence or presence of vancomycin. Efs signal detection was performed using a HEX-labeled probe, and Sar signal detection was performed using a FAM-labeled probe. The primers and probes used in this assay are shown in Table XXXVII, and the results are shown in Figure 52. Both species exhibited appropriate phenotypes in their corresponding detection channels, as indicated by the delta-Ct thresholds that separated susceptible and resistant isolates, providing accurate antimicrobial susceptibility results for this multiple bacterial population.

[0173] [Table 37]

[0174] The E.Sar / Cal multiplex PCR ID-AST assay was performed on multiple bacterial samples co-incubated together in the absence or presence of various concentrations of cefoxitin, using one Gram-positive organism, Staphylococcus aureus (Sar), and one fungal organism, Candida albicans (Cal), in a 1:1 ratio, each possessing different susceptibility combinations. Sar signal detection was performed using a FAM-labeled probe, and Cal signal detection was performed using a HEX-labeled probe. The primers and probes used in this assay are shown in Table XXXVIII, and the results are shown in Figure 53. N / A indicates no clinically relevant interpretation for the corresponding bio-drug combination. Cal susceptibility to fluconazole is shown. Sar strains exhibited appropriate phenotypes in the corresponding detection channels, as indicated by the delta-Ct threshold that separates susceptible and resistant isolates, providing accurate antimicrobial susceptibility results.

[0175] [Table 38]

[0176] Example 23: PCR assay for determining the mechanism of carbapenem resistance PCR assays targeting the blaKPC, blaVIM, blaNDM, and blaOXA-48 genes were tested against Gram-negative pathogens with known mechanisms of carbapenem resistance: K. pneumoniae, E. cloacae, Pseudomonas aeruginosa, A. baumannii, Escherichia coli, and K. aerogenes. The primers and probes used in this assay are shown in Table XXXIX. The concentration of genomic DNA was about 2-10 ng / μL for all samples except the no-template controls. The results of this experiment are shown in Figure 54. Growth curves shown as positive (Pos) in the figure were observed only for the targeted resistance mechanisms. No significant amplification was observed for non-targeted resistance mechanisms, thereby demonstrating a good inclusivity and exclusivity profile for this particular combination of primers and probes for detecting common mechanisms of carbapenem resistance.

[0177] [Table 39]

[0178] Example 24: Species-specific PCR ID-AST assay A PCR assay using the forward primer SEGP2164 (SEQ ID NO: 115), reverse primer SEGP2166 (SEQ ID NO: 116), and probe SEGP2167 (SEQ ID NO: 117) targeting the citC gene of P. stuartii, and the forward primer SEGP2119 (SEQ ID NO: 118), reverse primer SEGP2121 (SEQ ID NO: 119), and probe SEGP2120 (SEQ ID NO: 120) targeting the invA gene of Salmonella was tested against common Gram-negative pathogens: Escherichia coli, K. pneumoniae, E. cloacae, K. oxytoca, K. aerogenes, S. marcescens, P. mirabilis, C. freundii, P. stuartii, P. rettgeri, S. enterica, S. maltophilia, Pseudomonas aeruginosa, A. baumannii, and A. pittii. The sequences are shown in Table XL below. Tests were also performed on Gram-positive organisms and no significant amplification was shown (data not shown). The concentration of genomic DNA was approximately 2 - 10 ng / μL for all samples except the template-free control which was 0 ng / μL. As shown in Figure 55, the significant amplification curves were species-specific. No significant amplification was observed for non-target organisms, thereby demonstrating good inclusivity and exclusivity profiles for the four combinations of primers and probes for detecting each Gram-negative target species. These results represent a non-limiting example of a species-specific detection set that enables improvement of AST calls based on breakpoints for several specific species belonging to the Enterobacterales. CLSI guidelines indicate that some Enterobacterales species such as those shown here are resistant to certain aminoglycoside drugs, while most Enterobacterales species are not resistant.

[0179]

Table 40

[0180] Forward primer SEGP2921 (SEQ ID NO: 121), reverse primer SEGP2922 (SEQ ID NO: 122), and probe SEGP2923 (SEQ ID NO: 123) targeting the gyrB gene of S. agalactia; forward primer SEGP2947 (SEQ ID NO: 85), reverse primer SEGP2949 (SEQ ID NO: 86), and probe SEGP2951 (SEQ ID NO: 87) targeting the ddlA gene of S. agalactia; forward primer SEGP2777 (SEQ ID NO: 124), reverse primer SEGP2923 (SEQ ID NO: 123) targeting the tuf gene of Streptococcus pneumoniae; reverse primer SEGP2921 (SEQ ID NO: 121), reverse primer SEGP2922 (SEQ ID NO: 122), and probe SEGP2923 (SEQ ID NO: 123) targeting the gyrB gene of S. agalactia; forward primer SEGP2947 (SEQ ID NO: 85), reverse primer SEGP2949 (SEQ ID NO: 86), and probe SEGP2951 (SEQ ID NO: 87) targeting the tuf gene of Streptococcus pneumoniae. PCR assays using SEGP2778 (SEQ ID NO: 125) and probe SEGP2779 (SEQ ID NO: 126), as well as forward primer SEGP2113 (SEQ ID NO: 127), reverse primer SEGP2114 (SEQ ID NO: 128), and probe SEGP2115 (SEQ ID NO: 129), targeting the speB gene of S. piogenes, were tested on purified genomic DNA from common Gram-positive pathogens: S. agalactia, Streptococcus pneumoniae, S. piogenes, E. faecium, E. faecalis, Staphylococcus aureus, and S. epidermidis. The sequences are shown in Table XLI below. Gram-negative organisms were also tested but did not show significant amplification (data not shown). Genomic DNA concentrations were approximately 2–10 ng / μL for all samples, except for the untemplated control which was 0 ng / μL. As shown in Figure 56, significant amplification curves were species-specific. No significant amplification was observed for non-target organisms, thereby demonstrating good inclusivity and exclusivity profiles for the four primer-probe combinations for detecting each Gram-positive target species. These results represent a non-limiting example of a species-specific detection set that enables improved breakpoint-based AST calls for several specific species belonging to the genera Staphylococcus and Streptococcus (see CLSI breakpoint table in Figure 31), and by having these ID wells, a more general ID / AST detection set, such as the one shown in Figure 41, may be available.

[0181] [Table 41]

[0182] Figure 57 illustrates the impact of using species-specific primer / probe sets for accurate calling in PCR ID-AST assays. The left panel shows that the use of non-species-specific primers and probes fails to distinguish between susceptible and resistant strains. In contrast, the right panel shows that the use of species-specific primer / probe sets, which provide identification, allows for separate interpretations for each individual species, resulting in improved category agreement with CLSI breakpoint guidelines.

[0183] Example 25: Interpretation of PCR ID-AST assay data Figure 58 illustrates the workflow of a PCR ID-AST assay data interpretation strategy, which involves fitting a sigmoid function to raw PCR curve data and then calculating curve parameters and features. Features are then compared between the presence and absence of various antibiotic concentrations to derive relative feature changes. Regression modeling of features and changes across the overall antibiotic levels is also used to generate additional features corresponding to feature-response relationships, and may include the use of standard least squares, ridge regression, Lasso, Elastic Net, Bayesian regression, or logistic regression models. Features are then assembled into dataframes and input into separate machine learning algorithms, along with ground truth MIC or ground truth S / I / R, to train predictive models, which may include neural networks, dendritic models, support vector machines, or nearest neighbor methods. Training consists of splitting the data into training and holdout test sets, then splitting the training set k-fold using cross-validation to explore appropriate hyperparameter spaces for each classifier type. A model is then selected based on the mean cross-validation score and performance on the holdout test set. The trained models then join as an ensemble to return the final predicted MIC, which can be interpreted based on unweighted votes, weighted votes, mean probabilities, weighted probabilities, or by downstream classifiers of the aforementioned classifier types.

[0184] Figure 59 shows how the results are returned by combining species ID, antimicrobial susceptibility testing, resistance mechanism detection, and universal 16s rRNA phenotypic information. The species ID is used to select an appropriate algorithm for MIC prediction, and then the susceptibility information is determined by comparing it with appropriate breakpoints from regulatory bodies. Therefore, the detection of resistance mechanisms associated with the tested antibiotic may influence the returned susceptibility results depending on whether their presence matches the predicted MIC. If a species ID is unavailable, 16s rRNA phenotypic information may be used to return a general MIC without a susceptibility result, which can be used in combination with a species ID determined by an alternative method such as mass spectrometry.

[0185] There are concrete examples of using algorithmic elements to improve breakpoint-based AST calls. One example is the use of resistance mechanism detection to refine phenotypic result calls. Each resistance mechanism may have one or more antibiotic substrates associated with its activity, which are known in advance. These mechanisms may also have varying timeframes over which their activity can be detected. Some of these resistance mechanisms may not exhibit strong activity within 4 hours and may only be detectable phenotypically after much longer incubation times (12-24 hours). For these resistance mechanisms, an organism may be identified as susceptible to a given drug simply because the resistance mechanism has not fully manifested within the 4-hour period. Detecting these types of resistance mechanisms via separate PCR wells allows for correction of inconsistent phenotypic results. A specific example is Serratia marcescens, which encodes an SME carbapenemase resistance mechanism that is induceable but may not be induced within the 4-hour period. Therefore, these resistant S. marcescens strains may appear phenotypically susceptible to meropenem, but detection of the SME gene allows for the prediction of the correct phenotype, which is meropenem-resistant. Another example is the use of phenotypic susceptibility from one or more antibiotics to predict susceptibility to other antibiotics. Since resistance mechanisms often have overlapping substrate specificity, this means that susceptibility to some antibiotics directly correlates to susceptibility to others. Similarly, resistance to some antibiotics directly correlates to resistance to others. This is similar to the Expert Rules system used by many AST product manufacturers, but the data collected from the PCR ID-AST assay of the present invention is used as an aid to other methods of interpreting phenotypic results. A specific example would be that a strain susceptible to the antibiotic ertapenem would always be susceptible to the antibiotic meropenem, due to the carbapenemase properties and substrate specificity for the degradation of ertapenem. Similarly, a strain resistant to meropenem would also be resistant to ertapenem for the same reason.

[0186] While the aforementioned inventions have been described in some detail to clarify and understand them, it will be apparent to those skilled in the art that various modifications of form and detail are possible by reading this disclosure. For example, all the technologies and apparatus described above can be used in various combinations.< / phos>

Claims

A method for simultaneously identifying and determining the antimicrobial susceptibility of a target group of bacteria or fungi having the same minimum inhibitory concentration (MIC) to at least one antimicrobial agent, comprising: Performing a single quantitative real-time PCR assay as a reporter in the presence of at least one concentration of at least one antimicrobial agent, using primer oligonucleotides and probe oligonucleotides that hybridize more selectively to a target gene derived from the target group of bacteria or fungi compared to a target gene not derived from the target group of bacteria or fungi; Identifying the signal generated in the single quantitative real-time PCR assay specific to the target group of bacteria or fungi; comprising wherein the target group of bacteria or fungi includes a taxonomic order, a taxonomic family, a taxonomic genus, or a taxonomic species. Here, the target genes for determining the Enterobacterales order are rplP, ompA, tuf, gyrB, or rpoB; the target genes for determining the Enterobacteriaceae family are rplP, ompA, tuf, gyrB, or rpoB; the target genes for determining the Enterococcus genus are tuf, rpoB, sodA, ddl, or gyrB; the target genes for determining the Pseudomonas genus are gyrB, O-antigen acetylase, rpoB, ecfX, or tuf; the target genes for determining the Acinetobacter genus are ompA, tusA, rpoB, or gyrB; the target genes for determining Stenotrophomonas maltophilia are fdnG, gyrB, or tuf; the target genes for determining Staphylococcus aureus are CPE, gyrB, nuc, rpoB, tuf, or ddlA; the target genes for determining Staphylococcus epidermidis are altE, or femA; the target genes for determining Coagulase-negative Staphylococci are rpoB, tuf, or sodA; the target genes for determining the Streptococcus genus are tuf, gyrB, sip, or ddlA; the target genes for determining Streptococcus pneumoniae are lytA, SP2020, or piaB; the target genes for determining Proteus mirabilis are UreR, or UreC; and / or the target genes for determining Candida albicans are ACT, RPB-1, 5.8s ribosomal RNA, or 18s ribosomal RNA, a method. A step of verifying the identification of the target group of the bacterium or fungus, using additional primer oligonucleotides and probe oligonucleotides that hybridize more selectively to a second target gene derived from the target group of the target bacterium or fungus as compared to a second target gene not derived from the target group of the bacterium or fungus; A step of determining the mechanism of an antibacterial susceptibility phenotype, a toxin phenotype, or a pathogenicity phenotype; or Both the step of verifying and the step of determining The method according to claim 1, further comprising a step selected from the above.

3. The method according to claim 1 or 2, further comprising simultaneously identifying and determining the antibacterial susceptibilities of two or more target groups of bacteria or fungi, wherein each target group of bacteria or fungi has the same minimum inhibitory concentration (MIC) against at least one antibacterial agent.

4. The method according to any one of claims 1 to 3, wherein the target group of the bacterium or fungus is present in a bloodstream infection (BSI), a gastrointestinal infection, a respiratory infection, a urinary tract infection, a nasal infection, a rectal infection, or a wound infection.

5. The method according to any one of claims 1 to 4, wherein the single quantitative real-time PCR assay is a single multiplexed quantitative real-time PCR assay for simultaneously identifying and determining the antibacterial susceptibilities of multiple bacteria or fungal strains derived from a biological sample of multiple bacteria.

6. The method according to claim 5, wherein the biological sample of multiple bacteria is selected from whole blood, plasma, serum, red blood cell fraction, saliva, cerebrospinal fluid, semen, urine, feces, rectal swab, nasal swab, wound swab, skin swab, bile, lymph fluid, sputum, washing fluid, or a combination thereof.

7. The method according to claim 5, wherein the biological sample of multiple bacteria is cultured before performing the PCR assay.

8. The method according to any one of claims 5 to 7, wherein the multiple bacterial strains or fungal strains are grouped into at least one group of bacteria or fungi having the same minimum inhibitory concentration (MIC) against at least one antibacterial agent.

9. The method according to any one of claims 5 to 7, wherein the multiple bacterial strains or fungal strains are grouped into two or more groups of bacteria or fungi, and each group of bacteria or fungi has the same minimum inhibitory concentration (MIC) against at least one antibacterial agent.

10. The method according to any one of claims 5 to 9, wherein the identification of the plurality of bacterial strains or fungal strains utilizes a plurality of strain-specific 5'-nuclease (TaqMan) oligonucleotide probes, each probe is labeled with a fluorescent dye, and each fluorescent dye has an emission wavelength different from that of another fluorescent dye. **Claim 11**: Primers and probe oligonucleotides that selectively hybridize to the rplP, gyrB, or rpoB target genes belonging to the Enterobacterales taxon rather than to target genes not belonging to the Enterobacterales taxon are selected from the group consisting of nucleotide sequences including SEQ ID NOs: 1 to 16; and / or, primers and probe oligonucleotides that selectively hybridize to the tuf, rpoB, ddl, or gyrB target genes belonging to the genus Enterococcus rather than to target genes not belonging to the genus Enterococcus are selected from the group consisting of nucleotide sequences including SEQ ID NOs: 50 to 66; and / or, primers and probe oligonucleotides that selectively hybridize to the tuf, ompA, rpoB, or gyrB target genes belonging to the genus Acinetobacter rather than to target genes not belonging to the genus Acinetobacter are selected from the group consisting of nucleotide sequences including SEQ ID NOs: 17 to 28; and / or, primers and probe oligonucleotides that selectively hybridize to the tuf, gyrB, or rpoB target genes belonging to the genus Pseudomonas rather than to target genes not belonging to the genus Pseudomonas are selected from the group consisting of nucleotide sequences including SEQ ID NOs: 32 to 40; and / or, primers and probe oligonucleotides that selectively hybridize to the fdnG, gyrB, or tuf target genes belonging to the Stenotrophomonas maltophilia species rather than to target genes not belonging to the Stenotrophomonas maltophilia species are selected from the group consisting of nucleotide sequences including SEQ ID NOs: 41 to 49; and / or, Primers and probe oligonucleotides that selectively hybridize to a CPE, gyrB, or ddlA target gene belonging to the species Staphylococcus aureus more than to a target gene not belonging to the species Staphylococcus aureus are selected from the group consisting of nucleotide sequences containing SEQ ID NOs: 67-69 and 72-78; and / or, The method according to any one of claims 1 to 10, wherein primers and probe oligonucleotides that selectively hybridize to a tuf target gene belonging to the genus Streptococcus more than to a target gene not belonging to Streptococcus are selected from the group consisting of nucleotide sequences containing SEQ ID NOs: 100-102.

Images