Gene editing to improve joint function

Abstract

The present disclosure provides compositions and methods for treating joint disorders characterized by an inflammatory component. In some aspects, the compositions and methods are for preventing the progression of osteoarthritis and other arthritic conditions and for treating osteoarthritis and other arthritic conditions in mammalian joints.

Description

Technical field

[0001] Cross-reference to related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 052,881, filed July 16, 2020, and U.S. Provisional Patent Application No. 63 / 055,808, filed July 23, 2020; The contents of which are incorporated herein by reference in their entirety for all purposes.

[0002] Compositions and methods for treating synovial joint dysfunction are described herein. In addition, methods for gene editing synovial cells and / or synovial cells, chondrocytes, synovial macrophages, and synovial fibroblasts in the treatment of diseases such as osteoarthritis, and gene-edited synovial cells. Disclosed herein is the use of membrane cells and / or synoviocytes, chondrocytes, synovial macrophages, and synovial fibroblasts. [Background technology]

[0003] Treatment of osteoarthritis, degenerative joint disease, and other joint dysfunction is complex, and few long-term options exist for symptomatic relief or restoration of joint function. Osteoarthritis (OA) is a leading cause of pain-related disability. Neogi, Osteoarthritis Cartilage 2013;21:1145-53. All mammalian species are affected: working animals, livestock, and their owners all suffer OA-related discomfort, pain, and disability, depending on the extent of disease progression.

[0004] OA is a complex disease characterized by a progressive, disabling course. Systemic inflammation has been associated with OA and OA disease progression. Inflammation is caused by increased levels of pro-inflammatory cytokines. New methods and compositions for treating this disease are urgently needed. Disclosed herein are compositions and methods useful for treating OA and other inflammatory joint disorders. [Outline of the Invention]

[0005] The present disclosure provides compositions and methods for treating joint disorders characterized by an inflammatory component. In some aspects, the compositions and methods are for preventing progression of osteoarthritis and other arthritis and treating osteoarthritis and other arthritis in mammalian joints. According to exemplary embodiments, at least a portion of the joint synovial cells and / or synovial cells, chondrocytes, synovial macrophages, or synovial fibroblasts are genetically edited to reduce expression of inflammatory cytokines. be. In some aspects, at least a portion of the joint synoviocytes and / or synoviocytes, chondrocytes, synovial macrophages, or synovial fibroblasts are IL-1α, IL-1β, or IL-1α, IL- Gene edited to reduce expression of both 1β.

[0006] In some embodiments, gene editing silences or reduces expression of one or more cytokine and / or growth factor genes in at least a portion of cells comprising mammalian joints. In some aspects, the cells are synoviocytes. In some aspects, the cells are synovial fibroblasts. In some aspects, the cells are synoviocytes. In some aspects, the cells are chondrocytes. In some aspects, the cells are synovial macrophages.

[0007] In some embodiments, the one or more cytokine and / or growth factor genes are selected from the group comprising IL-1α and IL-1β.

[0008] In some embodiments, gene editing involves the use of programmable nucleases that mediate the generation of double-strand or single-strand breaks in one or more cytokine and / or growth factor genes.

[0009] In some embodiments, gene editing comprises one or more methods selected from CRISPR, TALE, zinc finger, and combinations thereof.

[0010] In some embodiments, gene editing comprises CRISPR technology.

[0011] In some embodiments, the CRISPR method is the CRISPR-Cas9 method.

[0012] In some embodiments, gene editing comprises TALE methods.

[0013] In some embodiments, gene editing comprises zinc finger technology.

[0014] In some embodiments, gene editing silences or reduces expression of one or more cytokine and / or growth factor genes in at least a portion of the cells comprising the joint. In some embodiments, the portion of the edited cells are synoviocytes. In one aspect, the portion of edited cells are synovial fibroblasts. In some embodiments, the portion of the edited cells are synoviocytes. In some embodiments, the portion of edited cells are chondrocytes. In some embodiments, the portion of edited cells are synovial macrophages.

[0015] In some embodiments, an adeno-associated virus (AAV) delivery system is used to deliver the gene editing system. In some embodiments, the AAV delivery system is injected intra-articularly.

[0016] Some aspects of the present disclosure provide pharmaceutical compositions for the treatment or prevention of joint diseases or conditions comprising a gene editing system and a pharmaceutically acceptable carrier. In one aspect, the gene editing system targets one or more loci selected from the group consisting of IL-1α, IL-1β, TNF-α, IL-6, IL-8, and IL-18 Contains one or more nucleic acids.

[0017] Embodiments provide a method of treating lameness in a dog, the method comprising administering a gene-editing composition, wherein the composition reduces the expression of IL-1α and IL-1β in the synovial cells of the lame joint. , chondrocytes, synovial macrophages, or a fraction of synovial fibroblasts.

[0018] In some embodiments, the above methods further comprise one or more features recited in any of the methods and compositions described herein. [Brief description of the drawing]

[0019] Embodiments of the present disclosure are further described with reference to the accompanying drawings. The drawings shown are not necessarily to scale, emphasis instead generally being placed upon illustrating the principles of the embodiments of the present disclosure.

[0020] [Fig. 1A] 100 ng of mouse DNA (gBlocks, Integrated DNA Technologies) designed against the Mus musculus Il1a and Il1b genes, cut by 0.5 μg of SpyCas9 (TrueCut™ Cas9 protein v2, ThermoFisher Scientific), and the Il1a gene (# 43-46) and 200 ng of phosphorothioate-modified single guide (sg) RNA targeted against the Il1b gene (#47-50) in vitro agarose gel electrophoresis analysis. [Fig. 1B] 100 ng of mouse DNA (gBlocks, Integrated DNA Technologies) designed for Mus musculus Il1a and Il1b genes, cut by 0.5 μg of SauCas9 (GeneSnipper™ Cas9, BioVision), and the Il1a gene (#51-53 ) and 200 ng of phosphorothioate-modified guide sgRNA against the Il1b gene (#54-56). [Figure 2A] Collectively, graphs displaying the editing efficiency of SpyCas9 and SauCas9 used with a range of guide RNAs in J774.2 (“J”) and NIH3T3 (“N”) cells are illustrated, FIG. In vivo cleavage of Il1a edited with 4×sgRNA (SpyCas9) in two separate pools (Pool1 and 2) across NIH3T3 (“N”) and J774.2 (“J”), FIG. , in vivo cleavage of Il1b edited with 4×sgRNA (SpyCas9) in two separate pools (Pool1 and 2) across two cell lines NIH3T3 (“N”) and J774.2 (“J”). Figure 2C was compiled with 3x sgRNA (SauCas9) in two separate pools (Pool 1 and 2) across two cell lines NIH3T3 ("N") and J774.2 ("J"). In vivo cleavage of Il1a and editing efficiency is determined using deconvolution of Sanger sequencing traces (ICE tools, Synthego) of each pool. [Fig.2B]Collectively, graphs displaying the editing efficiency of SpyCas9 and SauCas9 used with a range of guide RNAs in J774.2 (“J”) and NIH3T3 (“N”) cells are illustrated, FIG. In vivo cleavage of Il1a edited with 4×sgRNA (SpyCas9) in two separate pools (Pool1 and 2) across NIH3T3 (“N”) and J774.2 (“J”), FIG. , in vivo cleavage of Il1b edited with 4×sgRNA (SpyCas9) in two separate pools (Pool1 and 2) across two cell lines NIH3T3 (“N”) and J774.2 (“J”). Figure 2C was compiled with 3x sgRNA (SauCas9) in two separate pools (Pool 1 and 2) across two cell lines NIH3T3 ("N") and J774.2 ("J"). In vivo cleavage of Il1a and editing efficiency is determined using deconvolution of Sanger sequencing traces (ICE tools, Synthego) of each pool. [Figure 2C] Collectively, graphs displaying the editing efficiency of SpyCas9 and SauCas9 used with a range of guide RNAs in J774.2 (“J”) and NIH3T3 (“N”) cells are illustrated, FIG. In vivo cleavage of Il1a edited with 4×sgRNA (SpyCas9) in two separate pools (Pool1 and 2) across NIH3T3 (“N”) and J774.2 (“J”), FIG. , in vivo cleavage of Il1b edited with 4×sgRNA (SpyCas9) in two separate pools (Pool1 and 2) across two cell lines NIH3T3 (“N”) and J774.2 (“J”). Figure 2C was compiled with 3x sgRNA (SauCas9) in two separate pools (Pool 1 and 2) across two cell lines NIH3T3 ("N") and J774.2 ("J"). In vivo cleavage of Il1a and editing efficiency is determined using deconvolution of Sanger sequencing traces (ICE tools, Synthego) of each pool. [Fig.2D] Collectively, graphs displaying the editing efficiency of SpyCas9 and SauCas9 used with a range of guide RNAs in J774.2 (“J”) and NIH3T3 (“N”) cells are illustrated, FIG. In vivo cleavage of Il1a edited with 4×sgRNA (SpyCas9) in two separate pools (Pool1 and 2) across NIH3T3 (“N”) and J774.2 (“J”), FIG. , in vivo cleavage of Il1b edited with 4×sgRNA (SpyCas9) in two separate pools (Pool1 and 2) across two cell lines NIH3T3 (“N”) and J774.2 (“J”). Figure 2C was compiled with 3x sgRNA (SauCas9) in two separate pools (Pool 1 and 2) across two cell lines NIH3T3 ("N") and J774.2 ("J"). In vivo cleavage of Il1a and editing efficiency is determined using deconvolution of Sanger sequencing traces (ICE tools, Synthego) of each pool. [Fig.3] Figure 2 illustrates GFP expression measured using the IVIS system. Flux values ​​were based on the region of interest centered on the injected knee joint of the animal. Data are presented as the mean (SD) of four specimens per group. [Figure 4] 1 illustrates the design of the study described in Example 5 of the present disclosure. [Fig.5] 5 illustrates survival outcome measures obtained in the study described in Example 5 of the present disclosure. [Fig.6] In the study described in Example 5 of this disclosure, PBS, AAV-6 with scrambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with scrambled vector, or CRISPR-Cas guide 1 and 2 illustrate weight changes in mice treated with intra-articular (IA) injections of AAV-5 containing 2. [Fig. 7A] In the study described in Example 5 of this disclosure, PBS, AAV-6 with scrambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with scrambled vector, or CRISPR-Cas guide 1 (A) Change in knee caliper measurements from baseline in mouse joints over time and (B) ankle caliper measurements by AUC in mice treated with intra-articular (IA) injections of AAV-5 containing 2 and 2. collectively illustrate the average difference between . [Fig. 7B] In the study described in Example 5 of this disclosure, PBS, AAV-6 with scrambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with scrambled vector, or CRISPR-Cas guide 1 (A) Change in knee caliper measurements from baseline in mouse joints over time and (B) ankle caliper measurements by AUC in mice treated with intra-articular (IA) injections of AAV-5 containing 2 and 2. collectively illustrate the average difference between . [Fig. 8A] In the study described in Example 5 of this disclosure, PBS, AAV-6 with scrambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with scrambled vector, or CRISPR-Cas guide 1 Collectively illustrate changes in (A) von Frey measurements and (B) mean absolute thresholds for von Frey measurements obtained from mice treated with intra-articular (IA) injections of AAV-5, including 2 and 2. do. [Fig. 8B] In the study described in Example 5 of this disclosure, PBS, AAV-6 with scrambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with scrambled vector, or CRISPR-Cas guide 1 Collectively illustrate changes in (A) von Frey measurements and (B) mean absolute thresholds for von Frey measurements obtained from mice treated with intra-articular (IA) injections of AAV-5, including 2 and 2. do. [Fig.9] In the study described in Example 5 of this disclosure, PBS, AAV-6 with scrambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with scrambled vector, or CRISPR-Cas guide 1 2 illustrates the results of a qPCR assay for IL-1β expression in synovial fluid obtained from mice treated with intra-articular (IA) injections of AAV-5 containing 2. [Fig. 10A] Collectively illustrate immunohistochemistry for mouse IL-1β in synovial tissues of PBS-pretreated (A, B) and CRISPR-treated (C, D) MSU-injected animals. (FIGS. 10B and 10D) show isotype controls for each of FIGS. 10A and 10C, respectively. [Fig. 10B] Collectively illustrate immunohistochemistry for mouse IL-1β in synovial tissues of PBS-pretreated (A, B) and CRISPR-treated (C, D) MSU-injected animals. (FIGS. 10B and 10D) show isotype controls for each of FIGS. 10A and 10C, respectively. [Fig. 10C] Collectively illustrate immunohistochemistry for mouse IL-1β in synovial tissues of PBS-pretreated (A, B) and CRISPR-treated (C, D) MSU-injected animals. (FIGS. 10B and 10D) show isotype controls for each of FIGS. 10A and 10C, respectively. [Fig. 10D] Collectively illustrate immunohistochemistry for mouse IL-1β in synovial tissues of PBS-pretreated (A, B) and CRISPR-treated (C, D) MSU-injected animals. (FIGS. 10B and 10D) show isotype controls for each of FIGS. 10A and 10C, respectively. [Fig. 11A] Collectively exemplifies alignments between mouse, human, horse, cat, and canine IL-1 alpha genes. [Fig. 11B] Collectively exemplifies alignments between mouse, human, horse, cat, and canine IL-1 alpha genes. [Fig. 11C] Collectively exemplifies alignments between mouse, human, horse, cat, and canine IL-1 alpha genes. [Fig. 12A] Collectively exemplifies alignments between mouse, human, horse, cat, and canine IL-1 beta genes. [Fig. 12B] Collectively exemplifies alignments between mouse, human, horse, cat, and canine IL-1 beta genes. [Fig. 12C] Collectively exemplifies alignments between mouse, human, horse, cat, and canine IL-1 beta genes. [Fig. 12D] Collectively exemplifies alignments between mouse, human, horse, cat, and canine IL-1 beta genes. [Fig. 13A] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the human IL-1 alpha gene. [Fig. 13B] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the human IL-1 alpha gene. [Fig. 13C] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the human IL-1 alpha gene. [Fig. 13D] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the human IL-1 alpha gene. [Fig. 14A] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the human IL-1 beta gene. [Fig. 14B]Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the human IL-1 beta gene. [Fig. 14C] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the human IL-1 beta gene. [Fig. 14D] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the human IL-1 beta gene. [Fig. 14E] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the human IL-1 beta gene. [Fig. 15A] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the canine IL-1 alpha gene. [Fig. 15B] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the canine IL-1 alpha gene. [Fig. 15C] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the canine IL-1 alpha gene. [Fig. 16A] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the canine IL-1 beta gene. [Fig. 16B] Collectively illustrates exemplary CRISPR / Cas9crRNA sequences designed to edit the canine IL-1 beta gene. [Fig. 17A] Human IL-1 alpha gene (FIG. 7A), human IL-1 beta gene (FIG. 7B), canine IL-1 alpha gene (FIG. 7C), and canine IL-1 beta gene, as described in Example 8. FIG. 7D collectively illustrates the results of cell-based and in silico gene editing analysis of crRNA sequences targeting (FIG. 7D). °CRISPR cleavage position in frame of translation for amino acid (AA). *Optimized scores from Doench, Fusi et al. (2016). This score is optimized for 20 bp guides containing NGG. Scores range from 0-100. The higher, the better. **Specificity score from Hsu et al. (2013). Scores range from 0-100. The higher, the better. ***This score is based on experiments in U2OS. A high precision score (>0.4) suggests that DNA repair results are uniform and enriched for only a handful of unique genotypes. ****This score is based on experiments in U2OS. High (>80%) frameshift frequencies tend to throw protein-coding genes out of frame. Typical genomic frameshift frequencies are above 66%, as 1-bp insertions and 1-2 bp deletions are particularly common repair outcomes. ^ Composite Score = (Off-Target Score + Accuracy Score * 100 + Frameshift) / 3. †The pipe symbol “|” indicates the CRISPR cleavage site. Braces "{}" indicate an insertion. A hyphen "-" indicates a deletion. $ potential off-target sites. Scoring by Hsu et al. (2013). Off-target sites have a score of 100. [Fig. 17B] Human IL-1 alpha gene (FIG. 7A), human IL-1 beta gene (FIG. 7B), canine IL-1 alpha gene (FIG. 7C), and canine IL-1 beta gene, as described in Example 8. FIG. 7D collectively illustrates the results of cell-based and in silico gene editing analysis of crRNA sequences targeting (FIG. 7D). °CRISPR cleavage position in frame of translation for amino acid (AA). *Optimized scores from Doench, Fusi et al. (2016). This score is optimized for 20 bp guides containing NGG. Scores range from 0-100. The higher, the better. **Specificity score from Hsu et al. (2013). Scores range from 0-100. The higher, the better. ***This score is based on experiments in U2OS. A high precision score (>0.4) suggests that DNA repair results are uniform and enriched for only a handful of unique genotypes. ****This score is based on experiments in U2OS. High (>80%) frameshift frequencies tend to throw protein-coding genes out of frame. Typical genomic frameshift frequencies are above 66%, as 1-bp insertions and 1-2 bp deletions are particularly common repair outcomes. ^ Composite Score = (Off-Target Score + Accuracy Score * 100 + Frameshift) / 3. †The pipe symbol “|” indicates the CRISPR cleavage site. Braces "{}" indicate an insertion. A hyphen "-" indicates a deletion. $ potential off-target sites. Scoring by Hsu et al. (2013). Off-target sites have a score of 100. [Fig. 17C] Human IL-1 alpha gene (FIG. 7A), human IL-1 beta gene (FIG. 7B), canine IL-1 alpha gene (FIG. 7C), and canine IL-1 beta gene, as described in Example 8. FIG. 7D collectively illustrates the results of cell-based and in silico gene editing analysis of crRNA sequences targeting (FIG. 7D). °CRISPR cleavage position in frame of translation for amino acid (AA). *Optimized scores from Doench, Fusi et al. (2016). This score is optimized for 20 bp guides containing NGG. Scores range from 0-100. The higher, the better. **Specificity score from Hsu et al. (2013). Scores range from 0-100. The higher, the better. ***This score is based on experiments in U2OS. A high precision score (>0.4) suggests that DNA repair results are uniform and enriched for only a handful of unique genotypes. ****This score is based on experiments in U2OS. High (>80%) frameshift frequencies tend to throw protein-coding genes out of frame. Typical genomic frameshift frequencies are above 66%, as 1-bp insertions and 1-2 bp deletions are particularly common repair outcomes. ^ Composite Score = (Off-Target Score + Accuracy Score * 100 + Frameshift) / 3. †The pipe symbol “|” indicates the CRISPR cleavage site. Braces "{}" indicate an insertion. A hyphen "-" indicates a deletion. $ potential off-target sites. Scoring by Hsu et al. (2013). Off-target sites have a score of 100. [Fig. 17D] Human IL-1 alpha gene (FIG. 7A), human IL-1 beta gene (FIG. 7B), canine IL-1 alpha gene (FIG. 7C), and canine IL-1 beta gene, as described in Example 8. FIG. 7D collectively illustrates the results of cell-based and in silico gene editing analysis of crRNA sequences targeting (FIG. 7D). °CRISPR cleavage position in frame of translation for amino acid (AA). *Optimized scores from Doench, Fusi et al. (2016). This score is optimized for 20 bp guides containing NGG. Scores range from 0-100. The higher, the better. **Specificity score from Hsu et al. (2013). Scores range from 0-100. The higher, the better. ***This score is based on experiments in U2OS. A high precision score (>0.4) suggests that DNA repair results are uniform and enriched for only a handful of unique genotypes. ****This score is based on experiments in U2OS. High (>80%) frameshift frequencies tend to throw protein-coding genes out of frame. Typical genomic frameshift frequencies are above 66%, as 1-bp insertions and 1-2 bp deletions are particularly common repair outcomes. ^ Composite Score = (Off-Target Score + Accuracy Score * 100 + Frameshift) / 3. †The pipe symbol “|” indicates the CRISPR cleavage site. Braces "{}" indicate an insertion. A hyphen "-" indicates a deletion. $ potential off-target sites. Scoring by Hsu et al. (2013). Off-target sites have a score of 100. [Fig. 18A] Unedited (control) and double IL-1α / IL 6 h (FIGS. 18A and 18C) and 24 h (FIGS. 18B and 18D) after exposure to PBS or LPS, as described in Example 9. Collectively illustrates canine IL-1 alpha (FIGS. 18A and 18B) and canine IL-1 beta (FIGS. 18C and 18D) release from -1β KO (edited) canine chondrocytes. [Fig. 18B] Unedited (control) and double IL-1α / IL 6 h (FIGS. 18A and 18C) and 24 h (FIGS. 18B and 18D) after exposure to PBS or LPS, as described in Example 9. Collectively illustrates canine IL-1 alpha (FIGS. 18A and 18B) and canine IL-1 beta (FIGS. 18C and 18D) release from -1β KO (edited) canine chondrocytes. [Fig. 18C] Unedited (control) and double IL-1α / IL 6 h (FIGS. 18A and 18C) and 24 h (FIGS. 18B and 18D) after exposure to PBS or LPS, as described in Example 9. Collectively illustrates canine IL-1 alpha (FIGS. 18A and 18B) and canine IL-1 beta (FIGS. 18C and 18D) release from -1β KO (edited) canine chondrocytes. [Fig. 18D] Unedited (control) and double IL-1α / IL 6 h (FIGS. 18A and 18C) and 24 h (FIGS. 18B and 18D) after exposure to PBS or LPS, as described in Example 9. Collectively illustrates canine IL-1 alpha (FIGS. 18A and 18B) and canine IL-1 beta (FIGS. 18C and 18D) release from -1β KO (edited) canine chondrocytes. [Fig. 19A]Unedited (control) and double IL-1α / IL 6 h (FIGS. 19A and 19C) and 24 h (FIGS. 19B and 19D) after exposure to PBS or LPS, as described in Example 9. Collectively illustrates human IL-1 alpha (FIGS. 19A and 19B) and canine IL-1 beta (FIGS. 19C and 19D) release from -1β KO (edited) canine chondrocytes. [Fig. 19B] Unedited (control) and double IL-1α / IL 6 h (FIGS. 19A and 19C) and 24 h (FIGS. 19B and 19D) after exposure to PBS or LPS, as described in Example 9. Collectively illustrates human IL-1 alpha (FIGS. 19A and 19B) and canine IL-1 beta (FIGS. 19C and 19D) release from -1β KO (edited) canine chondrocytes. [Fig. 19C] Unedited (control) and double IL-1α / IL 6 h (FIGS. 19A and 19C) and 24 h (FIGS. 19B and 19D) after exposure to PBS or LPS, as described in Example 9. Collectively illustrates human IL-1 alpha (FIGS. 19A and 19B) and canine IL-1 beta (FIGS. 19C and 19D) release from -1β KO (edited) canine chondrocytes. [Fig. 19D] Unedited (control) and double IL-1α / IL 6 h (FIGS. 19A and 19C) and 24 h (FIGS. 19B and 19D) after exposure to PBS or LPS, as described in Example 9. Collectively illustrates human IL-1 alpha (FIGS. 19A and 19B) and canine IL-1 beta (FIGS. 19C and 19D) release from -1β KO (edited) canine chondrocytes.

[0021] While the above-identified drawings set forth the presently disclosed embodiments, other embodiments are also intended to be included in the discussion. This disclosure presents illustrative embodiments by way of representation and not limitation. Numerous other modifications and embodiments within the scope and spirit of the principles of the disclosed embodiments can be devised by those skilled in the art.

[0022] detailed description As described herein, embodiments of the present disclosure provide compositions and methods for improving joint function and treating joint disease. In certain embodiments, synovial fibroblasts, synoviocytes, chondrocytes, or synovial macrophages are genetically edited to contain proinflammatory cytokines, e.g., IL-1α, IL-1β, TNF-α, IL-6. , IL-8, IL-18, one or more matrix metalloproteinases (MMPs), or one or more components of the NLRP3 inflammasome. Embodiments are used to treat osteoarthritis and other inflammatory joint diseases. Embodiments are further useful for treating canine lameness due to osteoarthritis. Embodiments are further useful for treating lameness in horses due to joint disease. Embodiments are also useful for treating post-traumatic arthritis, gout, pseudogout, and other inflammation-mediated or immune-mediated joint diseases.

[0023] definition Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. All patents and publications referenced herein are incorporated by reference in their entirety.

[0024] The term "in vivo" refers to events that occur within the body of a subject.

[0025] The term "in vitro" refers to events that occur outside the body of a subject. In vitro assays include cell-based assays, in which live or dead cells are used, and can also include cell-free assays, in which intact cells are used.

[0026] The term "ex vivo" refers to events that involve treating or performing a treatment on cells, tissues, and / or organs that have been removed from the body of a subject. Suitably the cells, tissues and / or organs may be returned to the subject's body in surgical or therapeutic methods.

[0027] The term "IL-1" (also referred to herein as "IL1") refers to the proinflammatory cytokine known as interleukin-1, IL1-α and IL-1β, human and mammalian forms, conservative Includes all forms of IL-1, including amino acid substitutions, glycoforms, biosimilars, and variants thereof. IL-1α and IL-1β bind to the same receptor molecule called the type I IL-1 receptor (IL-1RI). A third ligand for this receptor exists. Interleukins that do not activate downstream signaling and therefore act as inhibitors of IL-1α and IL-1β signaling by competing with IL-1α and IL-1β signaling for receptor binding sites 1 receptor antagonist (IL-1Ra). See, for example, Dinarello, Blood 117:3720-32 (2011) and Weber et al., Science Signaling 3(105):cm1, doi:10.1126 / scisignal.3105cm1. IL-1 is described, for example, in Dinarello, Cytokine Growth Factor Rev. 8:253-65 (1997), the disclosure of which is incorporated herein by reference. For example, the term IL-1 encompasses the human recombinant form of IL-1. [Table 1-1] [Table 1-2]

[0028] The term "NLRP3 inflammasome" refers to a multiprotein complex involved in the activation of several inflammatory responses. The NMRP3 inflammasome promotes production of functional pro-inflammatory cytokines such as IL-1β and IL-18. The core components of the NLRP3 inflammasome are NLRP3, ASC (a CARD-containing apoptosis-associated speck-like protein), and caspase-1, Lee et al., Lipids Health Dis. 16:271 (2017) and Groslambert and Py , J. Inflamm. Res. 11:359-374 (2018).

[0029] The terms "matrix metalloprotease" and "MMP" refer to members of the matrix metalloprotease family of zinc endopeptidases, e.g., as characterized by Fanjul-Fernandez et al., Biochem. Defined as being any one of the members. In the art, family members are often referred to as prototypical MMPs, gelatinases, matrilysine, and / or furin-activatable MMPs. As used herein, "matrix metalloprotease" and "MMP" include, but are not limited to, MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP- 9, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15, MMP-16, MMP-17, MMP-18, MMP-19, MMP-20, MMP-21, It encompasses the entire MMP family, including MMP-23, MMP-25, MMP-26, MMP-27, and MMP-28.

[0030] As used herein, the terms "co-administration," "co-administer," "administered in combination," "administered in combination," "simultaneously," and "concurrently" refer to both active This includes administration of two or more active pharmaceutical ingredients to a subject such that the pharmaceutical ingredients and / or their metabolites are present in the subject at the same time (in preferred embodiments of the disclosure, e.g., at least One anti-inflammatory compound is functionally engineered to deliver the gene-editing nucleic acids described herein). Co-administration includes simultaneous administration of separate compositions, administration of separate compositions at different times, or administration in a composition in which two or more active pharmaceutical ingredients are present. Simultaneous administration in separate compositions and administration in a composition in which both agents are present are preferred.

[0031] The term "effective amount" or "therapeutically effective amount" refers to a composition described herein sufficient to effect its intended use, including but not limited to treating disease. or refers to the amount of a combination of compositions. A therapeutically effective amount will vary depending on the intended use (in vitro or in vivo), or the subject and disease state being treated (e.g., the subject's weight, age, or sex), the severity of the disease state, or the mode of administration. can. The term also applies to doses that will induce a particular response in target cells (eg, reduction of platelet adhesion and / or cell migration). A particular dose will depend on the particular composition selected, the administration regimen to be followed, whether the composition is administered in combination with other compositions or compounds, the timing of administration, the tissues to which it is administered, and the composition to which it is administered. It will vary depending on the physical delivery system being transported.

[0032] The terms "treatment," "treating," "treating," and the like refer to obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in terms of completely or partially preventing a disease or its symptoms and / or in terms of a partial or complete cure for disease and / or adverse effects caused by the disease. It can be therapeutic. For example, a composition, method, or system of the disclosure may be administered as a prophylactic treatment to a subject predisposed to a given condition (eg, arthritis). As used herein, "treatment" extends to any treatment of disease in a mammal, particularly a human, dog, cat, or horse, including (a) being predisposed to the disease but still having the disease; (b) inhibiting the disease, i.e. arresting the onset or progression of the disease; and (c) alleviating the disease, i.e. preventing the disease from occurring. Including causing regression and / or alleviating one or more disease symptoms. "Treatment" is also meant to encompass delivery of agents to provide a pharmacological effect, even in the absence of the disease or condition. For example, "treatment" includes delivery of a composition capable of inducing an immune response or conferring immunity in the absence of a disease state, eg, in the case of a vaccine. It is understood that the compositions and methods of the present disclosure are applicable to treat all mammals, including, but not limited to, human, canine, feline, equine, and bovine subjects. .

[0033] The term "heterologous" when used with reference to portions of a nucleic acid or protein indicates that the nucleic acid or protein comprises two or more subsequences that are not found in the same relationship to each other in nature. For example, nucleic acids are typically arranged to create new functional nucleic acids, e.g., promoters from one source and coding regions from another source, or unrelated genes arranged to create coding regions from a different source. produced recombinantly with two or more sequences from Similarly, a heterologous protein indicates that the protein comprises two or more subsequences (eg, fusion proteins) that are not found in the same relationship to each other in nature.

[0034] The terms "polynucleotide", "nucleotide" and "nucleic acid" are used interchangeably herein and refer to all forms of nucleic acids, oligonucleotides, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Point. Polynucleotides include genomic DNA, cDNA, and antisense DNA, as well as spliced ​​or unspliced ​​mRNA, rRNA, tRNA, lncRNA, RNA antagonists, and inhibitory DNA or RNA (e.g., RNAi, e.g., small or short hairpin (sh ) RNAs, microRNAs (miRNAs), aptamers, small or short interfering (si)RNAs, trans-splicing RNAs, or antisense RNAs). Polynucleotides also include non-coding RNAs, including, but not limited to, RNAi, miRNAs, lncRNAs, RNA antagonists, aptamers, and any other non-coding RNAs known to those of skill in the art. Polynucleotides include naturally occurring, synthetic, and deliberately altered or modified polynucleotides, as well as analogs and derivatives. The term "polynucleotide" also refers to polymeric forms of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof, and is synonymous with nucleic acid sequence. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any of the embodiments described herein involving polynucleotides are known or expected to constitute double-stranded forms, as well as double-stranded forms. and two complementary single-stranded forms. A polynucleotide can be single, double, or triple stranded, linear, or circular, and can be of any length. When discussing polynucleotides, the sequence or structure of a particular polynucleotide may be described herein according to the convention of providing the sequence in the 5' to 3' direction.

[0035] The terms "gene" or "nucleotide sequence encoding a polypeptide" refer to the segment of DNA involved in the production of a polypeptide chain. DNA segments may include regions preceding and following the coding regions (leader and trailer) involved in transcription / translation of the gene product and regulation of transcription / translation, as well as intervening sequences (introns) between individual coding segments (exons). . For example, a gene includes a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein or polypeptide after being transcribed and translated.

[0036] The term "homologous" in terms of nucleotide sequences includes nucleotide (nucleic acid) sequences that are either identical or substantially similar to a known reference sequence. In one embodiment, the term "nucleotide sequence homologous" is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% a known reference sequence. , is used to characterize sequences that have nucleic acid sequences that are at least 98%, at least 99%, or 100% identical.

[0037] "Heterologous" means derived from a genotypically distinct entity from the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter is removed from its native coding sequence and operably linked to a non-naturally occurring coding sequence that is linked to a heterologous promoter. Although the term "heterologous" is not always used herein with reference to a polynucleotide, even in the absence of the modifier "heterologous", a reference to a polynucleotide, notwithstanding the omission, is a heterologous polynucleotide. It is intended to include nucleotides.

[0038] The terms "sequence identity", "percent identity", and "sequence percent identity" (or synonyms such as "99% identity") in the context of two or more nucleic acids or polypeptides refer to sequence identity Nucleotides or amino acid residues that are the same or are the same when compared and aligned (introducing gaps where necessary) for maximum correspondence without considering any conservative amino acid substitutions as part of refers to two or more sequences or subsequences that have a specified percentage of Percent identity can be determined using sequence comparison software or algorithms, or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences. Suitable programs for determining percent sequence identity include, for example, the BLAST suite of programs available from the US Government's National Center for Biotechnology Information BLAST website. Comparisons between two sequences can be performed using either the BLASTN or BLASTP algorithms. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. ALIGN, ALIGN-2 (Genentech, South San Francisco, Calif.), or MegAlign available from DNASTAR are additional public software programs that can be used to align sequences. ClustalW and ClustalX can be used to generate alignments, Larkin et al., Bioinformatics 23:2947-2948 (2007), Goujon et al., Nucleic Acids Research, 38Suppl:W695-9 (2010), and McWilliam et al. al., Nucleic Acids Research 41 (Web Server issue): W597-600 (2013). Those skilled in the art can determine appropriate parameters for maximal alignment with a particular alignment software. In certain embodiments, the default parameters of the alignment software are used.

[0039] As used herein, the term "variant" includes, but is not limited to, one or more substitutions, deletions, and / or substitutions at specific positions within or adjacent to the amino acid sequence of the reference antibody. Or, it includes antibodies or fusion proteins that contain amino acid sequences that differ by addition from the amino acid sequence of the reference antibody. A variant may contain one or more conservative substitutions in its amino acid sequence compared to that of a reference antibody. Conservative substitutions can, for example, involve substitution of similarly charged or uncharged amino acids. A variant retains the ability to specifically bind the antigen of the reference antibody. The term variant also includes pegylated antibodies or proteins.

[0040] A "joint disease" is defined as a measurable abnormality in the cells or tissues of a joint that can lead to, for example, metabolic and molecular disorders that trigger anatomical and / or physiological changes in the joint. Includes, but is not limited to, radiological detection of joint space narrowing, subchondral sclerosis, subchondral cysts, and osteophyte formation.

[0041] “Joint disease” is defined in a human subject as symptoms, eg, subject-reported pain, stiffness, swelling, or stiffness, that drive the subject to seek medical intervention. For non-human mammals, "arthritis" is defined as, for example, lameness, observable changes in gait, weight bearing, allodynia, or exploratory behavior.

[0042] As used herein, sgRNA (single guide RNA) is RNA, preferably synthetic RNA, composed of a targeting sequence and a scaffold. Genome engineering experiments use it to guide Cas9 to specific loci. sgRNAs can be administered or formulated, for example, as synthetic RNAs or as nucleic acids containing sequences encoding the gRNAs that are subsequently expressed in target cells. Various tools can be used to design and / or optimize the sequences of sgRNAs, for example, to increase the specificity and / or accuracy of genome editing, as would be apparent to one skilled in the art. In general, candidate sgRNAs can be designed by identifying sequences within the target region with high predicted on-target efficiency and low off-target efficiency based on any of the available web-based tools. Candidate sgRNAs can be further evaluated by manual inspection and / or experimental screening. Examples of web-based tools include, without limitation, CRISPR Seek, CRISPR Design Tool, Cas-OFFinder, E-CRISP, ChopChop, CasOT, CRISPR Direct, CRISPOR, BREAKING-CAS, CrispRGold, and CCTop. See, eg, Safari, et al. Current Pharma. Biotechol. (2017) 18(13), which is incorporated herein by reference in its entirety for all purposes. Such tools are also available, for example, PCT Publication No. WO2014 / 093701A1 and Liu, et al., “Computational approached for effective CRISPR guide RNA design and evaluation”, Comput Struct Biotechnol J., 2020;18:35-44. , each of which is incorporated herein by reference in its entirety for all purposes.

[0043] As used herein, "Cas9" refers to CRISPR-associated protein and Cas9 nuclease is the active enzyme of the type II CRISPR system. "nCas9" refers to Cas9 with one of the two nuclease domains inactivated, either the RuvC or the HNH domain. nCas9 can only cleave a single strand of target DNA (a "nickase"). The term "Cas9" refers to an RNA-guided double-stranded DNA-binding nuclease protein or nickase protein, or variants thereof. As used herein, "Cas9" refers to both native and recombinant Cas9s. Wild-type Cas9 nuclease has two functional domains, eg RuvC and HNH, that cut different DNA strands. The Cas9 enzymes described herein may comprise an HNH or HNH-like nuclease domain and / or a RuvC or RuvC-like nuclease domain. Cas9 can induce double-strand breaks in genomic DNA (target loci) when both functional domains are active. Cas9 enzymes from Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, and Campylobacter in the group It may contain one or more catalytic domains of the Cas9 protein from the bacterium to which it belongs. In some embodiments, the two catalytic domains are from different bacterial species.

[0044] As used herein, "PAM" refers to the protospacer-adjacent motif, required for Cas9 to bind target DNA, immediately following the target sequence. Cas9 can be administered or formulated, for example, as a protein (eg, a recombinant protein) or as a nucleic acid containing sequences encoding the Cas9 protein that is subsequently expressed in target cells. Native Cas9 molecules recognize specific PAM sequences (eg, the PAM recognition sequences of S.pyogenes, S.thermophilus, S.mutans, S.aureus, and N.meningitidis). In one embodiment, the Cas9 molecule has the same PAM specificity as the native Cas9 molecule. In other embodiments, the Cas9 molecule has a PAM specificity not associated with native Cas9 molecules. In other embodiments, the PAM specificity of a Cas9 molecule is not associated with the native Cas9 molecule with which it has the closest sequence homology. For example, native Cas9 molecules can be modified such that PAM sequence recognition is modified to reduce off-target sites, improve specificity, or eliminate PAM recognition requirements. In one embodiment, the Cas9 molecule may be modified (e.g., to lengthen the PAM recognition sequence, improve Cas9 specificity to a high level of identity, reduce off-target sites, and / or or to increase specificity). In one embodiment, the length of the PAM recognition sequence is at least 4, 5, 6, 7, 8, 9, 10 or 15 amino acids long. In some embodiments, the Cas9 molecule can be modified to ablate PAM recognition.

[0045] An "expression cassette" is a nucleic acid construct, produced recombinantly or synthetically, that has a series of specific nucleic acid elements that permit transcription of a specific polynucleotide sequence in a host cell. The expression cassette or vector can be part of a plasmid, viral genome, or nucleic acid fragment. Typically, an expression cassette or vector comprises a polynucleotide that is transcribed and operably linked to a promoter.

[0046] The term "promoter" is used herein to refer to an array of nucleic acid regulatory sequences that direct transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as the TATA element in the case of a polymerase II type promoter. A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. Other elements that may be present in the expression vector include elements that enhance transcription (e.g., enhancers) and terminate transcription (e.g., terminators), as well as binding affinity specific for recombinant proteins produced from the expression vector. and elements that confer sex or antigenicity.

[0047] The term "operably linked" refers to a juxtaposition of genetic elements wherein the elements are in a relationship permitting them to operate in the expected manner. For example, a promoter is operably linked to a coding region if it helps to initiate transcription of the coding sequence. There can be intervening residues between the promoter and coding region as long as this functional relationship is maintained.

[0048] An "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, or other material is any component of the material or similar material found in nature or in which it was first prepared. refers to a preparation of material lacking at least a portion of Thus, for example, an isolated substance can be prepared by concentrating it from a source mixture using purification techniques. Concentration can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. As the concentration of embodiments of the present disclosure increases, more and more are isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other material, in some embodiments, is purified, e.g., about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99% or more pure.

[0049] As used herein, "AAV vector" refers to AAV vector nucleic acid sequences that encode various nucleic acid sequences, and in some embodiments, comprise variant or chimeric capsid polypeptides (i.e., AAV vectors are , including nucleic acid sequences encoding variant or chimeric capsid polypeptides). AAV vectors may also contain heterologous nucleic acid sequences not of AAV origin as part of the nucleic acid insert. This heterologous nucleic acid sequence typically contains a sequence of interest for genetic transformation of the cell. Generally, the heterologous nucleic acid sequence is flanked by at least one, and typically two, AAV inverted terminal repeats (ITRs). In certain embodiments, the Cas sequences, guide RNA sequences, and any other genetic elements (e.g., promoter sequences, PAM sequences, etc.) are on the same AAV vector or on two or more It may be on different AAV vectors. In certain embodiments, the Cas sequences, guide RNA sequences, and any other genetic elements (e.g., promoter sequences, PAM sequences, etc.) are on two or more different AAV vectors when administered to a subject. The AAV may be of the same serotype, or the AAV may be of two or more different serotypes (eg, AAV5 and AAV6).

[0050] "AAV virion" or "AAV virus" or "AAV virus particle" or "AAV vector particle" refers to a virus particle composed of at least one AAV capsid polypeptide and an encapsidated polynucleotide AAV transport vector. When the particle contains heterologous nucleic acid (ie, polynucleotides other than the wild-type AAV genome, such as transgenes to be delivered to cells), it may be referred to as an "AAV vector particle" or simply an "AAV vector." Thus, production of AAV virions or AAV particles entails production of AAV vectors, since the vectors are contained within the AAV virions or AAV particles.

[0051] As used herein, "carrier" or "vehicle" refers to carrier materials suitable for drug administration. Carriers and vehicles useful herein are any such materials known in the art that are non-toxic and do not interact with other components of the compositions in a detrimental manner, e.g., any liquids, gels, , solvents, liquid diluents, solubilizers, surfactants, and the like.

[0052] The phrase “pharmaceutically acceptable” refers to products that come into contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, commensurate with a reasonable benefit / risk ratio. Any such compounds, materials, compositions and / or dosage forms within the scope of sound medical judgment appropriate for use in the

[0053] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents. It is intended to include agents as well as inactive ingredients. The use of such pharmaceutically acceptable carriers or excipients for active pharmaceutical ingredients is well known in the art. Except insofar as any conventional pharmaceutically acceptable carrier or excipient is incompatible with the active pharmaceutical ingredient, its use in the therapeutic compositions of this disclosure is contemplated. Additional active pharmaceutical ingredients such as other drugs can also be incorporated into the described compositions and methods.

[0054] The term "pharmaceutically acceptable excipient" is intended to include vehicles and carriers with which the compound can be co-administered to facilitate the performance of its intended function. The use of such media for pharmaceutically active substances is well known in the art. Examples of such vehicles and carriers include solutions, solvents, dispersion media, retardants, emulsions and the like. Any other conventional carrier suitable for use with multibinding compounds also falls within the scope of this disclosure.

[0055] As used herein, the terms "a," "an," or "the" are generally interpreted to encompass both singular and plural forms.

[0056] The terms "about" and "approximately" mean within a statistically significant range of values. Such ranges can be within an order of magnitude, preferably within 50%, more preferably within 20%, more preferably still within 10%, even more preferably within 5% of a given value or range. Acceptable variations encompassed by the terms "about" or "approximately" will depend on the particular system under study and can be readily appreciated by those skilled in the art. Further, as used herein, the terms "about" and "approximately" are not and need not be exact in composition, amount, formulation, parameter, shape, and other amounts and characteristics. is meant to be an approximation, and / or may be larger or smaller, as desired, to reflect tolerances, conversion factors, rounding, measurement errors, etc., and other factors known to those skilled in the art. do. Generally, a dimension, size, formulation, parameter, shape, or other quantity or characteristic is "about" or "approximately," whether or not explicitly recited as such. Note that embodiments of very different sizes, shapes and dimensions may employ the described arrangement.

[0057] As used herein, the term "substantially" means at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, It can refer to a majority or majority, such as 99.5%, 99.9%, 99.99%, or at least about 99.999% or more.

[0058] When used in the appended claims, in their original and amended forms, the conjunctions “include,” “consist essentially of,” and “consist of” may include any additional Define the claims as to which, if any, elements or steps of the claims are excluded from the claims. The term "comprising" is intended to be inclusive or non-limiting and does not exclude any additional, non-listed elements, methods, steps or materials. The term "consisting of" excludes any element, step, or material other than those specified in the claim, and, in the latter case, excludes impurities normally associated with the specified material. The term "consisting essentially of" refers to elements, steps, or materials that do not materially affect the basic and novel characteristics of the claimed methods and compositions. limit. All compositions, methods, and kits described herein that embody the present disclosure, in alternative embodiments, use the connections "comprising," "consisting essentially of," and "consisting of." may be more specifically defined by any of the phrases.

[0059] Subjects treated by any of the methods or compositions described herein can be of any age and can be adults, infants, or children. In some cases, the subject is 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 years old, or within the range (eg, without limitation, 2-20 years old, 20-40 years old, or 40-90 years old). A subject can be a human or non-human subject. A particular class of subjects who can benefit from the compositions and methods of the disclosure include those over the age of 40, 50, or 60 years. Another class of subjects who can benefit from the compositions and methods of this disclosure are subjects with arthritis (eg, osteoarthritis).

[0060] Any of the compositions disclosed herein can be administered to non-human subjects, such as laboratory or domestic animals. Non-limiting examples of non-human subjects include laboratory or research animals, pets, wild or domestic animals, livestock, etc., e.g., dogs, goats, guinea pigs, hamsters, mice, pigs, non-human primates (e.g., gorillas). , monkeys, orangutans, lemurs, baboons, etc.), rats, sheep, horses, cows, and the like.

[0061] The present disclosure provides compositions useful for treating joint disorders with an inflammatory component. In some aspects, the compositions are useful for preventing progression of osteoarthritis and treating osteoarthritis in mammalian joints.

[0062] In some aspects, the pharmaceutical composition comprises a gene-editing system, which silences or reduces expression of at least one genetic locus associated with joint function in at least a portion of the cells comprising the joint.

[0063] In one aspect, the pharmaceutical composition comprises a gene editing system, wherein the gene editing system targets one or more of IL-1α and / or IL-1β. In some aspects, the pharmaceutical composition comprises a gene editing system, wherein the gene editing system is TNF-α, IL-6, IL-8, IL-18, matrix metalloprotease (MMP), or NLRP3 inflammasome targeting one or more of the components of

[0064] In some aspects, the pharmaceutical composition comprises a gene editing system, the use of a programmable nuclease wherein the gene editing mediates the generation of double-strand or single-strand breaks at at least one locus associated with joint function. including. In some embodiments, the gene editing system reduces gene expression at the target locus. In some embodiments, at least one locus associated with joint tissue is silenced or reduced in at least a portion of the cells comprising the joint.

[0065] In some aspects, the joint-comprising cells are synoviocytes. In some aspects, the cells are synovial macrophages. In some aspects, the cells are synovial fibroblasts. In some aspects, at least a portion of the synovial cells are edited. In some aspects, the joint-comprising cells are chondrocytes.

[0066] In some aspects, the pharmaceutical composition targets one or more cytokines and / or growth factor genes IL-1α, IL-1β, TNF-α, IL-6, IL-8, IL -18, a matrix metalloprotease (MMP), or a component of the NLRP3 inflammasome. In some embodiments, the components of the NLRP3 inflammasome comprise NLRP3, ASC (a CARD-containing apoptosis-associated speck-like protein), caspase-1, and combinations thereof.

[0067] Gene editing enhances expression of one or more cytokine and / or growth factor genes in at least a portion of the cells comprising the joint, wherein the cytokine and / or growth factor genes are IL-1Ra, TIMP-1, TIMP-2 , TIMP-3, TIMP-4, and combinations thereof.

[0068] In some embodiments, pharmaceutical compositions are provided for gene editing, wherein the gene editing mediates the generation of double-strand or single-strand breaks in one or more cytokine and / or growth factor genes. including the use of possible nucleases. In some embodiments, gene editing comprises one or more methods selected from CRISPR, TALE, zinc finger, and combinations thereof.

[0069] In one aspect, gene editing comprises CRISPR technology. In yet another aspect, the CRISPR method is a CRISPR-Cas9 method. In some aspects, Cas9 is mutated to enhance function.

[0070] Animal model of osteoarthritis Several animal models of osteoarthritis are known in the art. Exemplary, non-limiting animal models are summarized, but it is understood that a variety of models can be used. Many different species of animals have been used to mimic OA, for example studies have been conducted on mice, rats, rabbits, guinea pigs, dogs, pigs, horses, and even other animals. See, for example, Kuyinu et al., J Orthop Surg Res. 11:19 (2016) (hereinafter “Kuyinu, 2016”).

[0071] It is understood that various methods for inducing OA can be used in any mammal. Spontaneous induction, chemical induction, surgical induction, and non-invasive induction are commonly used in mice. For example, Kuyinu, 2016, Bapat et al., Clin Transl Med. 7:36 (2018) (hereinafter "Bapat, 2018"), and Poulet, Curr Rheumatol Rep 18:40 (2016). In horses, osteochondral fragment movement models, chemical induction, traumatic induction, and induction through overuse are commonly used. In sheep, surgical induction is most common, and in guinea pigs, surgical induction, chemical induction, and spontaneous (Durkin Hartley) methods are often used. For example, Bapat, 2018.

[0072] A destabilized medial meniscus (DMM) is often used in mice to model post-traumatic osteoarthritis, e.g. Culley et al., Methods Mol Biol. 2015). The DMM model mimics clinical meniscal injury, a known predisposition to the development of human OA, and allows the study of structural and biological changes over the course of the disease. Mice are attractive model organisms because mouse strains with defined genetic backgrounds can be used. Additionally, knockout or other genetically engineered mouse strains can be used to assess the importance of different molecular pathways in response to different OA treatment modalities and regimens. For example, STR / ort mice have characteristics that make them a strain particularly susceptible to developing OA, including increased levels of the inflammatory cytokine IL1β, Bapat et al., Clin Transl Med.7:36 (2018). These mice commonly develop OA in the knees, ankles, elbows, and temporomandibular joints, Jaeger et al., Osteoarthritis Cartilage 16:607-614 (2008). Other useful mutant strains of mice are known to those skilled in the art, for example the Col9a1(- / -) mouse, Allen et al., Arthritis Rheum, 60:2684-2693 (2009).

[0073] Another commonly used surgical model for OA is the anterior cruciate ligament transection (ACLT) model. Little and Hunter, Nat Rev Rheumatol., 9(8):485-497 (2013). The subject's ACL is surgically cut, causing joint destabilization. An anterior drawer test with a flexed joint is used to confirm that ligament transection has occurred. In some cases, other ligaments such as any of the posterior cruciate ligament, medial collateral ligament, lateral collateral ligament, and / or meniscus may be severed. As with the DMM model, different mouse strains can be used to investigate different molecular pathways.

[0074] Animals of various sizes can be selected for use, depending on the technical purpose. Rodents are useful because the time required for skeletal maturation is shorter, resulting in shorter onset of OA following surgery or other techniques that induce OA. Larger animals are particularly useful for evaluating therapeutic interventions. The anatomy of larger animals is very similar to humans, for example, in dogs the thickness of cartilage is less than about half that of humans, and this striking similarity suggests that such This is an example of why the study of cartilage degeneration and osteochondral defects is much more useful in large animal models. For example, McCoy, Vet. Pathol., 52:803-18 (2015), and Pelletier et al., Therapy, 7:621-34 (2010).

[0075] gene editing process Overview: Compositions for gene-editing synovial cells Embodiments of the present disclosure are directed to methods for genetically editing synoviocytes (synovial cells) to genetically engineer at least a portion of the synoviocytes within a joint to treat osteoarthritis or other joint disorders. Contains one or more steps to edit. As used herein, "gene editing," "gene editing," and "genome editing" refer to the permanent modification of DNA within the genome of a cell, e.g., the DNA is inserted into the genome of the cell. , refers to the type of genetic modification that is deleted, modified, or replaced. In some embodiments, gene editing silences (also called gene knockout) or inhibits / reduces (also called gene knockdown) the expression of a DNA sequence. In other embodiments, gene editing enhances expression of a DNA sequence (eg, by causing overexpression). According to embodiments of the present disclosure, gene editing techniques are used to reduce expression of pro-inflammatory genes or to silence pro-inflammatory genes and / or to enhance expression of regenerative genes.

[0076] interleukin According to additional embodiments, the gene-editing methods of the present disclosure use IL-1α, IL-1β, IL-4, IL-6, IL-8, IL-9, IL-10, IL-13, IL-18 , and TNF-α, to increase the expression of certain interleukins. Certain interleukins have been demonstrated to enhance the inflammatory response in joint tissue and be associated with disease progression.

[0077] Expression construct Expression constructs encoding one or both of the guide RNA and / or the Cas9 editing enzyme can be used in any effective carrier, e.g., any formulation or composition capable of effectively delivering the component genes to cells in vivo. can be administered at Approaches include electroporation and / or insertion in viral vectors, including, for example, recombinant retroviruses, adenoviruses, adeno-associated viruses, lentiviruses, and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids. be done. Viral vectors transfect cells directly, plasmid DNA is delivered naked or, e.g., in cationic liposomes (lipofectamine), or derivatized (e.g., antibody conjugated), Delivery may be aided by polylysine conjugates, gramacidin S, artificial viral envelopes, or other such intracellular carriers, as well as direct injection of genetic constructs or CaPO4 precipitates performed in vivo.

[0078] A preferred approach for in vivo introduction of nucleic acids into cells is through the use of viral vectors containing nucleic acids such as cDNA. Infection of cells with viral vectors has the advantage that the majority of target cells can receive the nucleic acid. In addition, molecules encoded within a viral vector, eg, by a cDNA contained within the viral vector, are efficiently expressed in cells that have taken up the viral vector nucleic acid.

[0079] Retroviral vectors and adeno-associated viral vectors can be used as recombinant gene delivery systems for the transfer of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells. In some cases, the delivered nucleic acid is stably integrated into the host's chromosomal DNA. In other cases, particularly for adeno-associated viral vectors, stable integration into host DNA can be a rare event, resulting in episomal transgene and transient expression of the transgene.

[0080] The development of specialized cell lines that produce only replication-deficient retroviruses (so-called "packaging cells") has increased the utility of retroviruses for gene therapy, and defective retroviruses can be used for gene transfer for gene therapy purposes. (for a review see Miller, Blood 76:271 (1990)). Replication-defective retroviruses can be packaged into virions that can be used to infect target cells through the use of helper viruses by standard techniques. Protocols for producing recombinant retroviruses and infecting cells with such viruses in vitro or in vivo are described in Ausubel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9. .10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE, and pEM, which are known to those skilled in the art. Examples of suitable packaging virus strains for preparing both anisotropic and amphotropic retroviral systems include ΨCrip, ΨCre, Ψ2, and ΨAm. Retroviruses have been used to introduce various genes into many different cell types, including epithelial cells, in vitro, and / or in vivo (e.g., each by reference in its entirety for all purposes). Eglitis, et al. (1985) Science 230:1395-1398, Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464, Wilson et al. (1988) Proc. USA85:3014-3018, Armentano et al. (1990) Proc.Natl.Acad.Sci.USA87:6141-6145, Huber et al. (1991) Proc.Natl.Acad.Sci.USA88: USA 88:8377-8381, Chowdhury et al. (1991) Science 254:1802-1805, van Beusechem et al. (1992) Proc. Natl. USA89:7640-7644, Kay et al. (1992) Human Gene Therapy 3:641-647, Dai et al. (1992) Proc.Natl.Acad.Sci.USA89:10892-10895, Hwu et al. (1993) J. Immunol. 150:4104-4115, U.S. Patent No. 4,868,116, U.S. Patent No. 4,980,286, PCT Application No. WO89 / 07136, PCT Application No. WO89 / 02468, PCT Application No. WO89 / 05345, and See PCT Application No. WO92 / 07573).

[0081] Another viral gene delivery system useful in the present methods utilizes adenovirus-derived vectors. The adenoviral genome can be engineered to encode and express a gene product of interest, but is inactivated with respect to its ability to replicate in the normal lytic virus life cycle. See, eg, Berkner et al., BioTechniques 6:616 (1988), Rosenfeld et al., Science 252:431-434 (1991), and Rosenfeld et al., Cell 68:143-155 (1992). Suitable adenoviral vectors include any strain of adenovirus (e.g. Ad2, Ad3, Ad5, or Ad7). Virus particles are relatively stable, amenable to purification and concentration, and can be modified to affect the spectrum of infectivity, as described above. In addition, the introduced adenoviral DNA (and the exogenous DNA contained therein) does not integrate into the genome of the host cell, but remains episomal, thereby allowing the introduced DNA to reach the host genome. It avoids potential problems that can result from insertional mutagenesis in situ incorporated within (eg, retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large compared to other gene delivery vectors (up to 8 kilobases) (Berkner et al., supra, Haj-Ahmand and Graham, J. Virol. 57: 267 (1986)).

[0082] Helper-dependent (HDAd) vectors also contain all adenoviruses deleted except for the origin of DNA replication at each end of the viral DNA, along with the packaging signal at the 5-prime end of the genome downstream of the left packaging signal. can be produced in sequence. HDAd vectors are constructed and propagated in the presence of a replication-competent helper adenovirus that provides the necessary early and late proteins required for replication.

[0083] Yet another viral vector system useful for delivery of nucleic acids is adeno-associated virus (AAV). Adeno-associated viruses are naturally defective viruses that require another virus, such as adenovirus or herpes virus, as a helper virus for efficient replication and productive life cycle. (For a review, see Muzyczka et al., Curr. Topics in Micro. and Immunol. 158:97-129 (1992). Adeno-associated virus also integrates its DNA into nondividing cells and frequently It is also one of the few viruses that exhibit stable integration (eg Flotte et al., Am. J. Respir. Cell. Mol. Biol. 7:349-356 (1992); Samulski et al., J. 63:3822-3828 (1989), and McLaughlin et al., J. Virol.62:1963-1973 (1989). Space for exogenous DNA is limited to approximately 4.5 kb, AAV vectors such as those described by Tratschin et al., Mol.Cell.Biol.5:3251-3260 (1985). can be used to introduce DNA into cells Various nucleic acids have been introduced into different cell types using AAV vectors (eg Hermonat et al., Proc. Natl. Acad. Sci. USA81: 6466-6470 (1984), Tratschin et al., Mol. Cell. Biol. 4: 2072-2081 (1985), Wondisford et al., Mol. Endocrinol. 51:611-619 (1984), and Flotte et al., J.Biol.Chem.268:3781-3790 (1993). The identification of Staphylococcus aureus (SaCas9) and other smaller Cas9 enzymes that can be readily produced, FDA-approved, and packaged into adeno-associated virus (AAV) vectors that have been tested in multiple clinical trials may lead to therapeutic applications. Opening new avenues for gene editing.

[0084] In some embodiments, nucleic acids encoding CRISPR IL-1α or IL-1β gene editing complexes (e.g., Cas9 or gRNA) can be tagged with antibodies against cell surface antigens of target cells on their surface. It is entrapped in liposomes (eg Lipofectin) that have a positive charge on the surface. These delivery vehicles can also be used to deliver Cas9 protein / gRNA complexes.

[0085] In a clinical setting, gene delivery systems for nucleic acids encoding CRISPR IL-1α or IL-1β gene editing complexes can be introduced into a subject by any of several methods, each well known in the art. . For example, a pharmaceutical preparation of a gene delivery system can be introduced systemically, eg, by intravenous injection, and the specific transduction of proteins in target cells primarily results in the expression of the gene delivery vehicle, the receptor gene. It will result from the specificity of transfection provided by the cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling it, or a combination thereof. In other embodiments, the initial delivery of the nucleic acid encoding the CRISPR IL-1α or IL-1β gene editing complex is more limited and introduction into the subject is highly localized. For example, a nucleic acid encoding a CRISPR IL-1α or IL-1β gene editing complex can be introduced by intra-articular injection into a joint exhibiting joint disease (eg, osteoarthritis). In some embodiments, the nucleic acid encoding the CRISPR IL-1α or IL-1β gene editing complex is administered during or after surgery, and in some embodiments the CRISPR IL-1α or IL-1β gene Sustained-release hydrogels containing nucleic acids encoding editing complexes prevent and reduce osteoarthritis by providing constant doses of nucleic acids encoding CRISPR IL-1α or IL-1β gene editing complexes over time , or at the end of the surgical procedure prior to closure to eliminate it.

[0086] Pharmaceutical preparations of nucleic acids encoding CRISPR IL-1α or IL-1β gene-editing complexes can consist essentially of the gene delivery system (e.g., a viral vector) in an acceptable diluent, or the gene delivery vehicle may include a sustained release matrix in which the is embedded. Alternatively, where the complete gene delivery system can be produced intact from a recombinant cell, eg, an adeno-associated virus vector, the pharmaceutical preparation can contain one or more cells that produce the gene delivery system.

[0087] Preferably, the CRISPR IL-1α or IL-1β editing complex is specific, i.e. it induces genomic modifications preferentially at the target site (IL-1α or IL-1β) and not at other sites. It does not induce, or very rarely induces alterations at other sites. In certain embodiments, the CRISPR IL-1α or IL-1β editing complex has an editing efficiency of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. have

[0088] sgRNAs for use in CRISPR / Cas systems for HR typically include a guide sequence (e.g. crRNA) that is complementary to the target nucleic acid sequence (target locus) and a Cas nuclease (e.g. Cas9 poly scaffolding sequences (eg, tracrRNA) that interact with the peptide) or variants or fragments thereof. Single guide RNA (sgRNA) can include crRNA and tracrRNA.

[0089] Exemplary target sequences for inducing genomic alterations in IL-1α or IL-1β genes by CRISPR-Cas editing complexes are provided in Tables 2 and 12. Exemplary guide RNAs for use in the compositions, methods, and systems of the present disclosure are provided in Tables 3 and 13. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6]

[0090] In certain embodiments, the sequence of the guide RNA (eg, single guide RNA or sgRNA) can be modified to increase editing efficiency and / or reduce off-target effects. In certain embodiments, the sequence of the guide RNA is about 1 base, about 2 bases, about 3 bases, about 4 bases, about 5 bases, about 5 bases, about 6 bases, about 7 bases, about 8 bases from the target sequence. It can vary by about 9 bases, about 10 bases, about 15 bases, or more than about 15 bases. In certain embodiments, the sequence of the guide RNA is about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9% from the target sequence. %, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, or about 20% super variable. As used herein, alterations forming a target sequence can refer to degrees of complementarity.

[0091] In certain embodiments, guide RNAs used with the compositions, methods, or systems of this disclosure are identical to the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. . In certain embodiments, the guide RNA for use with the compositions, methods, or systems of the present disclosure has at least about 95% of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. %identical. In certain embodiments, the guide RNA for use with the compositions, methods, or systems of the present disclosure has at least about 90% of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. %identical. In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure have at least about 85% of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. %identical. In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure are at least about 80 sequences set forth in any one of SEQ ID NOs: 21-34 and SEQ ID NOs: 168-297. %identical. In certain embodiments, the guide RNA for use with the compositions, methods, or systems of the present disclosure has at least about 75% of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. %identical. In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure are at least about 70 SEQ ID NOS: 21-34 and SEQ ID NOS: 168-297. %identical. In certain embodiments, the guide RNA for use with the compositions, methods, or systems of the present disclosure has at least about 65% of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. %identical. In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure are at least about 60 sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. %identical. In certain embodiments, the guide RNA for use with the compositions, methods, or systems of the present disclosure has at least about 55% of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. %identical. In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure are at least about 50 sequences set forth in any one of SEQ ID NOs: 21-34 and SEQ ID NOs: 168-297. %identical. In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure are at least about 45 sequences set forth in any one of SEQ ID NOs: 21-34 and SEQ ID NOs: 168-297. %identical. In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure are at least about 40 sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. %identical. In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure are at least about 35 sequences set forth in any one of SEQ ID NOs: 21-34 and SEQ ID NOs: 168-297. %identical. In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure are at least about 35 sequences set forth in any one of SEQ ID NOs: 21-34 and SEQ ID NOs: 168-297. %identical.

[0092] In certain embodiments, the guide RNA for use with the compositions, methods, or systems of the present disclosure has a single base substitution of the sequence shown in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure have two base substitutions of the sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure have three base substitutions of the sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure have four base substitutions of the sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure have four base substitutions of the sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure have six base substitutions of the sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure have seven base substitutions of the sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure have eight base substitutions of the sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, a guide RNA for use with a composition, method, or system of the disclosure has a 9-base substitution of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, a guide RNA for use with a composition, method, or system of the disclosure has a 10-base substitution of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, a guide RNA for use with a composition, method, or system of the disclosure has an 11 base substitution of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, a guide RNA for use with a composition, method, or system of the disclosure has a 12-base substitution of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, a guide RNA for use with a composition, method, or system of the disclosure has a 13 base substitution of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, a guide RNA for use with a composition, method, or system of the disclosure has a 14-base substitution of the sequence set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have In certain embodiments, guide RNAs for use with the compositions, methods, or systems of the present disclosure have 15 base substitutions of the sequences set forth in any one of SEQ ID NOs:21-34 and SEQ ID NOs:168-297. have

[0093] In certain embodiments, the guide RNA of the present disclosure is designed to knockdown expression of a target gene set forth in any one of SEQ ID NOs:7-20 and SEQ ID NOs:37-167, and / or can be knocked down. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1α gene by binding to at least a portion of exon 1 of the human IL-1α gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1α gene by binding to at least a portion of exon 2 of the human IL-1α gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1α gene by binding to at least a portion of exon 3 of the human IL-1α gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1α gene by binding to at least a portion of exon 4 of the human IL-1α gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1α gene by binding to at least a portion of exon 5 of the human IL-1α gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1α gene by binding to at least a portion of exon 6 of the human IL-1α gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1α gene by binding to at least a portion of exon 7 of the human IL-1α gene be able to. In certain embodiments, the guide RNAs of the present disclosure are designed to or knock down the human IL-1α gene by binding to at least a portion of exon 8 of the human IL-1α gene be able to.

[0094] In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1β gene by binding to at least a portion of exon 1 of the human IL-1β gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1β gene by binding to at least a portion of exon 2 of the human IL-1β gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1β gene by binding to at least a portion of exon 3 of the human IL-1β gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1β gene by binding to at least a portion of exon 4 of the human IL-1β gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1β gene by binding to at least a portion of exon 5 of the human IL-1β gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1β gene by binding to at least a portion of exon 6 of the human IL-1β gene be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the human IL-1β gene by binding to at least a portion of exon 7 of the human IL-1β gene be able to.

[0095] In certain embodiments, the guide RNA of the present disclosure is designed to knockdown expression of a target gene set forth in any one of SEQ ID NOs:7-20 and SEQ ID NOs:37-167, and / or can be knocked down. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1α gene by binding to at least a portion of exon 1 of the canine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1α gene by binding to at least a portion of exon 2 of the canine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1α gene by binding to at least a portion of exon 3 of the canine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1α gene by binding to at least a portion of exon 4 of the canine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1α gene by binding to at least a portion of exon 5 of the canine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1α gene by binding to at least a portion of exon 6 of the canine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1α gene by binding to at least a portion of exon 7 of the canine IL-1α gene. be able to.

[0096] In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1β gene by binding to at least a portion of exon 1 of the canine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1β gene by binding to at least a portion of exon 2 of the canine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1β gene by binding to at least a portion of exon 3 of the canine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1β gene by binding to at least a portion of exon 4 of the canine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1β gene by binding to at least a portion of exon 5 of the canine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1β gene by binding to at least a portion of exon 6 of the canine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1β gene by binding to at least a portion of exon 7 of the canine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the canine IL-1β gene by binding to at least a portion of exon 8 of the canine IL-1β gene. be able to.

[0097] In certain embodiments, the guide RNA of the present disclosure is designed to knockdown expression of a target gene set forth in any one of SEQ ID NOs:7-20 and SEQ ID NOs:37-167, and / or can be knocked down. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1α gene by binding to at least a portion of exon 1 of the equine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1α gene by binding to at least a portion of exon 2 of the equine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1α gene by binding to at least a portion of exon 3 of the equine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1α gene by binding to at least a portion of exon 4 of the equine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1α gene by binding to at least a portion of exon 5 of the equine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1α gene by binding to at least a portion of exon 6 of the equine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1α gene by binding to at least a portion of exon 7 of the equine IL-1α gene. be able to.

[0098] In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1β gene by binding to at least a portion of exon 1 of the equine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1β gene by binding to at least a portion of exon 2 of the equine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1β gene by binding to at least a portion of exon 3 of the equine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1β gene by binding to at least a portion of exon 4 of the equine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1β gene by binding to at least a portion of exon 5 of the equine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1β gene by binding to at least a portion of exon 6 of the equine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the equine IL-1β gene by binding to at least a portion of exon 7 of the equine IL-1β gene. be able to.

[0099] In certain embodiments, the guide RNA of the present disclosure is designed to knockdown expression of a target gene set forth in any one of SEQ ID NOs:7-20 and SEQ ID NOs:37-167, and / or can be knocked down. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1α gene by binding to at least a portion of exon 1 of the murine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1α gene by binding to at least a portion of exon 2 of the murine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1α gene by binding to at least a portion of exon 3 of the murine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1α gene by binding to at least a portion of exon 4 of the murine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1α gene by binding to at least a portion of exon 5 of the murine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1α gene by binding to at least a portion of exon 6 of the murine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1α gene by binding to at least a portion of exon 7 of the murine IL-1α gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1α gene by binding to at least a portion of exon 8 of the murine IL-1α gene. be able to.

[0100] In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1β gene by binding to at least a portion of exon 1 of the murine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1β gene by binding to at least a portion of exon 2 of the murine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1β gene by binding to at least a portion of exon 3 of the murine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1β gene by binding to at least a portion of exon 4 of the murine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1β gene by binding to at least a portion of exon 5 of the murine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1β gene by binding to at least a portion of exon 6 of the murine IL-1β gene. be able to. In certain embodiments, the guide RNA of the present disclosure is designed to or knocks down the murine IL-1β gene by binding to at least a portion of exon 7 of the murine IL-1β gene. be able to.

[0101] In some cases, sgRNAs are delivered to cells (e.g., primary cells for ex vivo therapy) using recombinant expression vectors containing a nucleotide sequence encoding a Cas nuclease (e.g., a Cas9 polypeptide) or variant or fragment thereof. In vitro cells, or in vivo cells, such as in a patient). In some embodiments, the sgRNA is conjugated to a Cas nuclease (e.g., a Cas9 polypeptide) or variant or fragment thereof, and used in cells (e.g., in vitro cells such as primary cells for ex vivo therapy, or patients, etc.). form a ribonucleoprotein (RNP)-based delivery system for introduction into in vivo cells). In other cases, sgRNAs are used in cells (e.g., in vitro cells such as primary cells for ex vivo therapy, or in patients, etc.) using mRNAs encoding Cas nucleases (e.g., Cas9 polypeptides) or variants or fragments thereof. in vivo cells).

[0102] Any heterologous or exogenous nucleic acid (eg, polynucleotides encoding target locus-specific sgRNAs and / or Cas9 polynucleotides) can be introduced into cells using any method known to those of skill in the art. Such methods include, but are not limited to, electroporation, nucleofection, transfection, lipofection, transduction, microinjection, electroinjection, electrofusion, nanoparticle bombardment, transformation, conjugation, and the like. .

[0103] The nucleic acid sequence of the sgRNA is any that has sufficient complementarity with the target polynucleotide sequence (e.g., the target DNA sequence) so as to hybridize with the target sequence and induce sequence-specific binding of the CRISPR complex to the target sequence. can be a polynucleotide sequence of In some embodiments, the degree of complementarity between the guide sequence of the sgRNA and its corresponding target sequence is about 50%, 60%, 75% when optimally aligned using a suitable alignment algorithm. %, 80%, 85%, 90%, 95%, 97.5%, 99% or more. Optimal alignment may be determined using any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, the Burrows-Wheeler Transform (e.g. , Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, SanDiego, Calif), SOAP (available at soap.genomics.org.cn), and Maq (maq.sourceforge available on .net) In some embodiments, the guide sequence is about 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides. nucleotide, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 75 nucleotides or more in length In some cases, the guide sequence is about 20 nucleotides in length. In other cases, the guide sequence is about 15 nucleotides in length.In other cases, the guide sequence is about 25 nucleotides in length.Sequence-specific binding of the CRISPR complex to the target sequence. The ability of a guide sequence to induce a CRISPR sequence can be assessed by any suitable assay, e.g., components of the CRISPR system sufficient to form a CRISPR complex containing the tested guide sequence can be provided to a host cell with the corresponding target sequence, such as by transfection with a vector that carries the target sequence, followed by evaluation of preferential cleavage within the target sequence. providing a component of a CRISPR complex that includes a control guide sequence that is different from the test guide sequence and the test guide sequence, and comparing the binding or cleavage rates at the target sequence between the test and control guide sequence reactions can be evaluated in vitro.

[0104] Nucleic acid sequences for sgRNAs can be selected using any of the web-based software described above. Considerations for choosing a DNA-targeting RNA include the PAM sequence for the Cas nuclease (eg, Cas9 polypeptide) used, and strategies for minimizing off-target modifications. Tools such as CRISPR design tools can provide sequences for preparing sgRNAs, assessing target modification efficiency, and / or assessing cleavage at off-target sites. Another consideration for choosing sequences for sgRNAs involves reducing the degree of secondary structure within the guide sequence. Secondary structure may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimum Gibbs free energy. Examples of suitable algorithms include mFold (Zuker and Stiegler, Nucleic Acids Res, 9(1981), 133-148), the UNAFold package (Markham et al, Methods Mol Biol, 2008, 453:3-31), and Vienna RNa Examples include RNAfold that forms a package.

[0105] sgRNAs are about 10 to about 500 nucleotides, e.g. nucleotide, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 210 nucleotides, 220 nucleotides, 230 nucleotides, 240 nucleotides, 250 nucleotides, 260 nucleotides, 270 nucleotides, 280 nucleotides, 290 nucleotides, 300 nucleotides, 310 nucleotides, 320 nucleotides, 330 nucleotides, 340 nucleotides, 350 nucleotides, 360 nucleotides , 370 nucleotides, 380 nucleotides, 390 nucleotides, 400 nucleotides, 410 nucleotides, 420 nucleotides, 430 nucleotides, 440 nucleotides, 450 nucleotides, 460 nucleotides, 470 nucleotides, 480 nucleotides, 490 nucleotides, or about 500 nucleotides. In some embodiments, the sgRNA is from about 20 to about 500 nucleotides, e.g. Nucleotide, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, 200 nucleotides, 205 nucleotides, 210 nucleotides, 215 nucleotides, 220 nucleotides, 225 nucleotides, 230 nucleotides, 235 nucleotides, 240 nucleotides, 245 nucleotides, 250 nucleotides, 255 nucleotides, 260 nucleotides, 265 nucleotides, 270 nucleotides, 275 nucleotides, 280 nucleotides, 285 nucleotides, 290 nucleotides, 295 nucleotides, 300 nucleotides, 305 nucleotides, 310 nucleotides, 315 nucleotides, 320 nucleotides , 325 nucleotides, 330 nucleotides, 335 nucleotides, 340 nucleotides, 345 nucleotides, 350 nucleotides, 355 nucleotides, 360 nucleotides, 365 nucleotides, 370 nucleotides, 375 nucleotides, 380 nucleotides, 385 nucleotides, 390 nucleotides, 395 nucleotides, 400 nucleotides, 405 nucleotides, 410 nucleotides, 415 nucleotides, 420 nucleotides, 425 nucleotides, 430 nucleotides, 435 nucleotides, 440 nucleotides, 445 nucleotides, 450 nucleotides, 455 nucleotides, 460 nucleotides, 465 nucleotides, 470 nucleotides, 475 nucleotides, 480 nucleotides, 485 nucleotides, 490 nucleotides, 495 nucleotides, or 500 nucleotides. In certain embodiments, the sgRNA is about 20 to about 100 nucleotides, such as about 20 nucleotides, such as 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides. , 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotide, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides, 51 nucleotides, 52 nucleotides, 53 nucleotides, 54 nucleotides, 55 nucleotides, 56 nucleotides, 57 nucleotides, 58 nucleotides, 59 nucleotides, 60 nucleotides, 61 nucleotides, 62 nucleotides, 63 nucleotides, 64 nucleotides, 65 nucleotides, 66 nucleotides, 67 nucleotides, 68 nucleotides, 69 nucleotides, 70 nucleotides, 71 nucleotides, 72 nucleotides, 73 nucleotides, 74 nucleotides, 75 nucleotides, 76 nucleotides, 77 nucleotides, 78 nucleotides , 79 nucleotides, 80 nucleotides, 81 nucleotides, 82 nucleotides, 83 nucleotides, 84 nucleotides, 85 nucleotides, 86 nucleotides, 87 nucleotides, 88 nucleotides, 89 nucleotides, 90 nucleotides, 91 nucleotides, 92 nucleotides, 93 nucleotides, 94 nucleotides, 95 nucleotides, 96 nucleotides, 97 nucleotides, 98 nucleotides, 99 nucleotides, or about 100 nucleotides.

[0106] The scaffold sequence is from about 10 to about 500 nucleotides, e.g. 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides , 200 nucleotides, 210 nucleotides, 220 nucleotides, 230 nucleotides, 240 nucleotides, 250 nucleotides, 260 nucleotides, 270 nucleotides, 280 nucleotides, 290 nucleotides, 300 nucleotides, 310 nucleotides, 320 nucleotides, 330 nucleotides, 340 nucleotides, 350 nucleotides, 360 It can be nucleotides, 370 nucleotides, 380 nucleotides, 390 nucleotides, 400 nucleotides, 410 nucleotides, 420 nucleotides, 430 nucleotides, 440 nucleotides, 450 nucleotides, 460 nucleotides, 470 nucleotides, 480 nucleotides, 490 nucleotides, or about 500 nucleotides. In some embodiments, the scaffold sequence is from about 20 to about 500 nucleotides, e.g. 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides, 180 nucleotides, 185 nucleotides, 190 nucleotides, 195 nucleotides, 200 nucleotides, 205 nucleotides, 210 nucleotides, 215 nucleotides, 220 nucleotides, 225 nucleotides, 230 nucleotides, 235 nucleotides , 240 nucleotides, 245 nucleotides, 250 nucleotides, 255 nucleotides, 260 nucleotides, 265 nucleotides, 270 nucleotides, 275 nucleotides, 280 nucleotides, 285 nucleotides, 290 nucleotides, 295 nucleotides, 300 nucleotides, 305 nucleotides, 310 nucleotides, 315 nucleotides, 320 nucleotide, 325 nucleotides, 330 nucleotides, 335 nucleotides, 340 nucleotides, 345 nucleotides, 350 nucleotides, 355 nucleotides, 360 nucleotides, 365 nucleotides, 370 nucleotides, 375 nucleotides, 380 nucleotides, 385 nucleotides, 390 nucleotides, 395 nucleotides, 400 nucleotides, 405 nucleotides, 410 nucleotides, 415 nucleotides, 420 nucleotides, 425 nucleotides, 430 nucleotides, 435 nucleotides, 440 nucleotides, 445 nucleotides, 450 nucleotides, 455 nucleotides, 460 nucleotides, 465 nucleotides, 470 nucleotides, 475 nucleotides, 480 nucleotides, 485 nucleotides , 490 nucleotides, 495 nucleotides, or 500 nucleotides. In certain embodiments, the scaffold sequence is from about 20 to about 100 nucleotides, such as about 20 nucleotides, such as 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides. nucleotide, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides, 51 nucleotides, 52 nucleotides, 53 nucleotides, 54 nucleotides, 55 nucleotides, 56 nucleotides, 57 nucleotides, 58 nucleotides, 59 nucleotides, 60 nucleotides, 61 nucleotides , 62 nucleotides, 63 nucleotides, 64 nucleotides, 65 nucleotides, 66 nucleotides, 67 nucleotides, 68 nucleotides, 69 nucleotides, 70 nucleotides, 71 nucleotides, 72 nucleotides, 73 nucleotides, 74 nucleotides, 75 nucleotides, 76 nucleotides, 77 nucleotides, 78 nucleotide, 79 nucleotides, 80 nucleotides, 81 nucleotides, 82 nucleotides, 83 nucleotides, 84 nucleotides, 85 nucleotides, 86 nucleotides, 87 nucleotides, 88 nucleotides, 89 nucleotides, 90 nucleotides, 91 nucleotides, 92 nucleotides, 93 nucleotides, 94 nucleotides, 95 nucleotides, 96 nucleotides, 97 nucleotides, 98 nucleotides, 99 nucleotides, or about 100 nucleotides.

[0107] The nucleotides of the sgRNA can contain modifications in the ribose (eg, sugar) group, phosphate group, nucleobase, or any combination thereof. In some embodiments, modifications at the ribose group include modifications at the 2' position of ribose.

[0108] In some embodiments, the nucleotide is 2'fluoro-arabinonucleic acid, tricyclic DNA (tc-DNA), peptide nucleic acid, cyclohexene nucleic acid (CeNA), locked nucleic acid (LNA), ethylene bridged nucleic acid (ENA), phosphodiene Amidate morpholinos, or combinations thereof.

[0109] Modified nucleotides or nucleotide analogs may include sugar and / or backbone ribonucleotides (ie, including modifications to the phosphate-sugar backbone). For example, the phosphodiester bond of natural or native RNA can include at least one of a nitrogen or sulfur heteroatom. In some backbone-ribonucleotides, the phosphoester groups connecting adjacent ribonucleotides can be replaced by groups such as phosphothioate groups. In some sugar-ribonucleotides, the 2' portion is H, OR, R, halo, SH, SR, H2, HR, R 2 OR is selected from ON, R is C 1 -C6 alkyl, alkenyl, or alkynyl; halo is F, CI, Br, or I;

[0110] In some embodiments, nucleotides contain sugar modifications. Non-limiting examples of sugar modifications include 2'-deoxy-2'-fluoro-oligobonucleotides (2'-fluoro-2'-deoxycytidine-5'-triphosphate, 2'-fluoro-2' -deoxyuridine-5'-triphosphate), 2'-deoxy-2'-deamine oligoribonucleotide (2'-amino-2'-deoxycytidine-5'-triphosphate, 2'-amino-2 '-deoxyuridine-5'-triphosphate), 2'-O-alkyl oligoribonucleotides, 2'-deoxy-2'-C-alkyl oligoribonucleotides (2'-O-methylcytidine-5'-triphosphate) phosphate, 2'-methyluridine-5'-triphosphate), 2'-C-alkyl oligoribonucleotides and their isomers (2'-alacitidine-5'-triphosphate, 2'-alauridine-5 '-triphosphate), azido-triphosphate (2'-azido-2'-deoxycytidine-5'-triphosphate, 2'-azido-2'-deoxyuridine-5'-triphosphate), and Combinations thereof are included.

[0111] In some embodiments, the sgRNA contains one or more 2'-fluoro, 2'-amino, and / or 2'-thio modifications. In some cases the modification is 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine , 2'-amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine, 5-amino-allyl-uridine, 5-bromo-uridine, 5-iodo-uridine, 5- methyl-cytidine, ribo-thymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine and / or 5-fluoro-uridine.

[0112] There are over 96 naturally occurring nucleoside modifications found on mammalian RNA. See, eg, Limbach et al., Nucleic Acids Research, 22(12):2183-2196 (1994). Nucleotides and the preparation of nucleotides and nucleosides are well known in the art, for example U.S. Pat. Nos. 5,132,418, 5,153,319, 5,262,530 and 5,700,642. Numerous nucleosides and nucleotides suitable for use as described herein are commercially available. A nucleoside can be an analogue of a naturally occurring nucleoside. In some cases, the analogs are dihydrouridine, methyladenosine, methylcytidine, methyluridine, methylpseudouridine, thiouridine, deoxycytodine, and deoxyuridine.

[0113] In some cases, the sgRNAs described herein comprise nucleobase ribonucleotides, ie, ribonucleotides containing at least one non-naturally occurring nucleobase in place of a naturally occurring nucleobase. Non-limiting examples of nucleobases that can be incorporated into nucleosides and nucleotides include m5C (5-methylcytidine), m5U (5-methyluridine), m6A (N6-methyladenosine), s2U (2-thiouridine), Um (2'-O-methyluridine), mlA (1-methyladenosine), m2A (2-methyladenosine), Am (2-1-O-methyladenosine), ms2m6A (2-methylthio-N6-methyladenosine), i6A (N6-isopentenyladenosine), ms2i6A (2-methylthio-N6 isopentenyladenosine), io6A (N6-(cis-hydroxyisopentenyl)adenosine), ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine), g6A (N6-glycinylcarbamoyladenosine), t6A (N6-threonylcarbamoyladenosine), ms2t6A (2-methylthio-N6-threonylcarbamoyladenosine), m6t6A (N6-methyl-N6-threonylcarbamoyladenosine) , hn6A (N6.-hydroxynorvalylcarbamoyladenosine), ms2hn6A (2-methylthio-N6-hydroxynorvalylcarbamoyladenosine), Ar(p) (2'-O-ribosyladenosine (phosphate)), I (inosine) , mil(1-methylinosine), m'lm(l,2'-O-dimethylinosine), m3C(3-methylcytidine), Cm(2T-o-methylcytidine), s2C(2-thiocytidine), ac4C (N4-acetylcytidine), f5C (5-fonnylcytidine), m5Cm (5,2-O-dimethylcytidine), ac4Cm (N4acetyl 2TO methylcytidine), k2C (lysidine), mlG (1-methylguanosine), m2G (N2-methylguanosine), m7G (7-methylguanosine), Gm (2'-O-methylguanosine), m22G (N2,N2-dimethylguanosine), m2Gm (N2,2'-O-dimethylguanosine), m22Gm (N2,N2,2'-O-trimethylguanosine), Gr(p) (2'-O-ribosylguanosine (phosphate)), yW (Wybutocin), o2yW (Peroxywibutocin), OHyW (Hydroxywibutocin) syn), OHyW* (under hydroxywibutsin), imG (wyocin), mimG (methylguanosine), Q (queosine), oQ (epoxyqueosine), galQ (galtactosyl-queosine), manQ (mannosyl-queosine), preQo (7-cyano-7-deazaguanosine), preQi (7-aminomethyl-7-deazaguanosine), G (alkaeosine), D (dihydrouridine), m5Um (5,2'-O-dimethyluridine) ), s4U (4-thiouridine), m5s2U (5-methyl-2-thiouridine), s2Um (2-thio-2'-O-methyluridine), acp3U (3-(3-amino-3-carboxypropyl)uridine ), ho5U (5-hydroxyuridine), mo5U (5-methoxyuridine), cmo5U (uridine 5-oxyacetic acid), mcmo5U (uridine 5-oxyacetic acid methyl ester), chm5U (5-(carboxyhydroxymethyl)uridine), mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester), mcm5U (5-methoxycarbonylmethyluridine), mcm5Um (S-methoxycarbonylmethyl-2-O-methyluridine), mcm5s2U (5-methoxycarbonylmethyl-2- thiouridine), nm5s2U (5-aminomethyl-2-thiouridine), mnm5U (5-methylaminomethyluridine), mnm5s2U (5-methylaminomethyl-2-thiouridine), mnm5se2U (5-methylaminomethyl-2-seleniumuridine) ), ncm5U (5-carbamoylmethyluridine), ncm5Um (5-carbamoylmethyl-2'-O-methyluridine), cmnm5U (5-carboxymethylaminomethyluridine), cnmm5Um (5-carboxymethylaminomethyl-2-L-O methyluridine), cmnm5s2U (5-carboxymethylaminomethyl-2-thiouridine), m62A (N6,N6-dimethyladenosine), Tm (2'-O-methylinosine), m4C (N4-methylcytidine), m4Cm (N4 ,2-O-dimethylcytidine), hm5C (5-hydroxymethylcytidine), m3U (3-methyluridine), cm5U (5-carboxymethyluridine), m6Am (N6,T-O-dimethyladenosine), rn62Am (N6,N6 ,0-2-trimethyladenosine), m2'7G (N2,7-dimethylguanosine), m2'2'7G (N2,N2,7-trimethylguanosine), m3Um (3,2T-O-dimethyluridine), m5D (5-methyldihydrouridine), f5Cm (5-formyl-2'-O-methylcytidine), mlGm (l,2'-O-dimethylguanosine), m'Am (1,2-O-dimethyladenosine) irino methyluridine), tm5s2U (S-taurinomethyl-2-thiouridine)), imG-14 (4-demethylguanosine), imG2 (isoguanosine), or ac6A (N6-acetyladenosine), hypoxanthine, inosine, 8-oxo -adenine, their 7-substituted derivatives, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5-aminouracil, 5-(C 1- C. 6 )-alkyluracil, 5-methyluracil, 5-(C 2 -C 6 )-alkenyluracil, 5-(C 2- C. 6 )-alkynyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(C 1- C. 6 )-alkylcytosine, 5-methylcytosine, 5-(C 2- C. 6 )-alkenylcytosine, 5-(C 2- C. 6 )-alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, N 2 -dimethylguanine, 7-deazaguanine, 8-azaguanine, 7-deaza-7-substituted guanine, 7-deaza-7-(C2-C6) alkynylguanine, 7-deaza-8-substituted guanine, 8-hydroxyguanine, 6 -thioguanine, 8-oxoguanine, 2-aminopurine, 2-amino-6-chloropurine, 2,4-diaminopurine, 2,6-diaminopurine, 8-azapurine, substituted 7-deazapurine, 7-deaza-7 -substituted purines, 7-deaza-8-substituted purines, and combinations thereof.

[0114] sgRNAs can be synthesized by any method known to those of skill in the art. In some embodiments, sgRNAs are chemically synthesized. Modified sgRNAs can be synthesized using 2'-O-thionocarbamate-protected nucleoside phosphoramidites. Methods are described, for example, in Dellinger et al., J. American Chemical Society, 133, 11540-11556 (2011), Threlfall et al., Organic & Biomolecular Chemistry, 10, 746-754 (2012), and Dellinger et al., J. American Chemical Society. , 125, 940-950 (2003). Modified sgRNAs are commercially available, eg, from TriLink BioTechnologies (San Diego, Calif.).

[0115] Additional detailed descriptions of useful sgRNAs are found, for example, in Hendel et al., Nat Biotechnol, 2015, 33(9):985-989 and Dever et al., Nature, 2016, 539:384-389. , the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0116] Those skilled in the art will appreciate that the guide RNAs disclosed in this disclosure can be used in combination with any Cas protein known in the art (e.g., from any suitable organism or bacterial species). would do.

[0117] The Cas protein can be a type I, II, III, IV, V, or VI Cas protein. A Cas protein may contain one or more domains. Non-limiting examples of domains include guide nucleic acid recognition and / or binding domains, nuclease domains (e.g. DNase or RNase domains, RuvC, HNH), DNA binding domains, RNA binding domains, helicase domains, protein-protein interaction domains. , and dimerization domains. A guide nucleic acid recognition and / or binding domain can interact with a guide nucleic acid. A nuclease domain may contain catalytic activity for nucleic acid cleavage. A nuclease domain may lack catalytic activity to prevent nucleic acid cleavage. Cas proteins may be chimeric Cas proteins fused to other proteins or polypeptides. A Cas protein may be, for example, a chimera of different Cas proteins containing domains from different Cas proteins.

[0118] Non-limiting examples of Cas proteins include c2c1, C2c2, c2c3, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9(Csn1 or Csx12), Cas10, Cas10d, Cas1O, Cas1Od, CasF, CasG, CasH, Cpf1, Csy1, Csy2, Csy3, Cse1(CasA), Cse2(CasB), Cse3(CasE), Cse4(CasC) , Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx1O, Csx16, CsaX, Csx3, Csx1, Csx15 , Csf1, Csf2, Csf3, Csf4, and Cul966, and homologues or modified versions thereof.

[0119] A Cas protein may be derived from any suitable organism. Non-limiting examples include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinae spiralis, Streptomyces viridochromo genes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, AlicyclobacHlus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Pseudomonas aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis , Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Kted onobacter racemifer, Methanohalobium estigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Leptotrichia shahii, and Francisella novicida. In some aspects, the organism is Streptococcus pyogenes (S. pyogenes). In some aspects, the organism is Staphylococcus aureus (S.aureus). In some aspects, the organism is Streptococcus thermophilus (S. thermophilus).

[0120] Cas proteins include, but are not limited to, Veillonella atypical, Fusobacterium nucleatum, Filifactor alocis, Solobacterium moorei, Coprococcus catus, Treponema denticola, Peptoniphilus duerdenii, Catenibacterium mitsuokai, Streptococcus mutans, Listeria innocua, Staphylococcus pseudintermedius, Acidaminococcus intestine, Olsen ella uli , Oenococcus kitaharae, Bifidobacterium bifidum, Lactobacillus rhamnosus, Lactobacillus gasseri, Finegoldia magna, Mycoplasma mobile, Mycoplasma gallisepticum, Mycoplasma ovipneumoniae, Mycoplasma canis, Mycoplasma synoviae, Eubacterium rectale, Streptococcus thermophilus, Eubacterium dolichum, Lactobacillus coryniformis subsp. Torquens, Ilyobacter polytropus, Ruminococcus albus, Akkermansia muciniphila, Acidothermus cellulolyticus, Bifidobacterium longum, Bifidobacterium dentium, Corynebacterium diphtheria, Elusimicrobium minutum, Nitratifractor salsuginis, Sphaerochaeta globus, Fibrobacter succinogenes subsp.Succinogenes, Bacteroides fragilis, Capnocytophaga ochracea, Rhod opseudomonas palustris, Prevotella micans, Prevotella ruminicola, Flavobacterium columnare, Aminomonas paucivorans, Rhodospirillum rubrum, Candidatus Puniceispirillum marinum, Verminephrobacter eiseniae, Ralstonia syzygii, Dinoroseobacter shibae, Azospirillum, Nitrobacter hamburgensis, Bradyrhizobium, Wolinella succinogenes, Campylobacter jejuni subsp. Jejuni, Helicobacter mustelae, Bac illus cereus, Acidovorax ebreus, Clostridium perfringens, Parvibaculum lavamentivorans, Multocida, Sutterella wadsworthensis, proteobacterium, Legionella pneumophila, Parasutterella excrementihominis, Wolinella succinogenes, and Francisella novicida. The term "derived" is defined in this case as modified from the naturally occurring various bacterial species to maintain a significant portion or significant homology to the naturally occurring various bacterial species. be. A significant portion is at least 10 contiguous nucleotides, at least 20 contiguous nucleotides, at least 30 contiguous nucleotides, at least 40 contiguous nucleotides, at least 50 contiguous nucleotides, at least 60 contiguous nucleotides, at least 70 contiguous nucleotides, at least 80 contiguous nucleotides, at least 90 contiguous nucleotides, or at least 100 contiguous nucleotides. Significant homology can be at least 50% homologous, the last 60% homologous, at least 70% homologous, at least 80% homologous, at least 90% homologous, or at least 95% homologous. Derived species may be modified while retaining the activity of the native species.

[0121] Gene editing method As noted above, embodiments of the present disclosure provide compositions and methods for treating joint disorders, wherein a portion of joint cells are genetically modified via gene editing to treat joint disorders. Embodiments of the present disclosure include nucleotide insertions (RNA or DNA), or recombinant proteins, for both promoting expression of one or more proteins and inhibiting expression of one or more proteins, and combinations thereof. It involves gene editing into a population of synoviocytes through insertion. Embodiments of the present disclosure also provide methods for delivering gene-editing compositions to joint cells, particularly gene-editing compositions to synovial cells. There are several gene editing techniques that can be used to genetically modify joint cells, which are suitable for use according to the present disclosure.

[0122] In some embodiments, the method of genetically modifying joint cells comprises the step of stable integration of genes for production of one or more proteins. In one embodiment, the method of genetically modifying a portion of the synovial cells of a joint comprises the step of retroviral transduction. In one embodiment, the method of genetically modifying a portion of the synovial cells of a joint comprises the step of retroviral transduction. Lentiviral transduction systems are known in the art, see, for example, Levine, et al., Proc. Nat'l Acad. Sci. 2006, 103, 17372-77, Zufferey, et al., Nat. 1997, 15, 871-75, Dull, et al., J. Virology 1998, 72, 8463-71, and US Patent No. 6,627,442, the disclosures of each of which are incorporated herein by reference. In one embodiment, the method of genetically modifying a portion of synovial cells of a joint comprises the step of gammaretroviral transduction. Gamma-retroviral transduction systems are known in the art and are described, for example, in Cepko and Pear, Cur. Prot. Mol. Biol. incorporated herein. In one embodiment, the method of genetically modifying a portion of synoviocytes of a joint comprises the step of transposon-mediated gene transfer. Transposon-mediated gene transfer systems are known in the art, wherein the transposase is provided as a DNA expression vector, or as an expressible RNA or protein, whereby long-term expression of the transposase results in transgenic cells, For example, transposase-free systems provided as mRNAs (eg, mRNAs containing caps and polyA tails). Suitable transposon-mediated gene transfer systems, including salmon-type Tel-like transposases (SB or Sleeping Beauty transposases), such as SB10, SB11, and SB100x, as well as engineered enzymes with increased enzymatic activity, include, for example, Hackett, et al., Mol. Therapy 2010, 18, 674-83 and US Pat. No. 6,489,458, the disclosures of each of which are incorporated herein by reference.

[0123] In some aspects, viral vectors or systems are used to introduce gene editing systems into cells, including joints. In some aspects, the cells are synovial fibroblasts. In some aspects, the viral vector is an AAV vector. In some aspects, the AAV vector is AAV1, AAV1 (Y705+731F+T492V), AAV2 (Y444+500+730F+T491V), AAV3 (Y705+731F), AAV4, AAV5, AAV5 (Y436+693+719F ), AAV6, AAV6 (VP3 variants Y705F / Y731F / T492V), AAV-7m8, AAV8, AAV8 (Y733F), AAV9, AAV9 (VP3 variant Y731F), AAV10 (Y733F), AAV-ShH10, and AAV-DJ / 8 A serotype selected from the group consisting of In some aspects, the AAV vector comprises a serotype selected from the group consisting of AAV1, AAV5, AAV6, AAV6 (Y705F / Y731F / T492V), AAV8, AAV9, and AAV9 (Y731F).

[0124] In some aspects, the viral vector is a lentivirus. In one aspect, the lentivirus is human immunodeficiency-1 (HIV-1), human immunodeficiency-2 (HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus. (BIV), Jambrana disease virus (JDV), equine infectious anemia virus (EIAV), and caprine arthritis encephalitis virus (CAEV).

[0125] In one embodiment, the method of genetically modifying a portion of synovial cells of a joint comprises stably integrating genes for production or inhibition (eg, silencing) of one or more proteins. In one embodiment, the method of genetically modifying a portion of the synovial cells of a joint comprises the step of liposome transduction. Cationic lipid N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA) and dioleoylphophotidylethanolamine (DOPE) in filtered water 1: Liposome transfection methods, such as those using 1 (w / w) liposome formulations, are known in the art and are described in Rose, et al., Biotechniques 1991, 10, 520-525, and Felgner, et al., Proc. Natl. USA, 1987,84,7413-7417 and U.S. Pat. Nos. 2004-2014, the disclosures of each of which are incorporated herein by reference. In one embodiment, the method of genetically modifying a portion of the synovial cells of a joint is described in U.S. Pat. the disclosure of each of which is incorporated herein by reference.

[0126] According to embodiments, the gene editing process may involve the use of programmable nucleases that mediate the generation of double-strand or single-strand breaks in one or more immune checkpoint genes. Such programmable nucleases enable precise genome editing by introducing breaks at specific genomic loci, i.e. they rely on the recognition of specific DNA sequences within the genome to form nuclease domains. is targeted to this location and mediates the generation of a double-strand break in the target sequence. Double-strand breaks in DNA then invoke endogenous repair mechanisms at the break site to mediate genome editing by either non-homologous end joining (NHEJ) or homology-directed repair (HDR). Repair of the break can thus result in the introduction of an insertion / deletion mutation that disrupts (eg, silences, suppresses, or enhances) the target gene product.

[0127] Major classes of nucleases developed to enable site-specific genome editing include zinc finger nucleases (ZFNs), transcription activator-like nucleases (TALENs), and CRISPR-associated nucleases (e.g., CRISPR-Cas9). mentioned. These nuclease systems can be divided into two broad categories based on their mode of DNA recognition. ZFNs and TALENs achieve specific DNA binding through protein-DNA interactions, whereas CRISPR systems such as Cas9 rely on short RNA guide molecules that directly base pair with target DNA and protein- DNA interactions target specific DNA sequences. See, for example, Cox et al., Nature Medicine, 2015, Vol.21, No.2.

[0128] Non-limiting examples of gene editing methods that can be used in accordance with the disclosed methods include CRISPR, TALE, and ZFN methods, which are described in more detail below.

[0129] CRISPR method A pharmaceutical composition for the treatment or prevention of a joint disease or condition comprising a gene editing system, wherein the gene editing system targets at least one genetic locus associated with joint function, A pharmaceutical composition that is partially gene edited by CRISPR methods (e.g., CRISPR-Cas9, CRISPR-Cas13a, or CRISPR / Cpf1 (also known as CRISPR-Cas12a). According to certain embodiments, joint synoviocytes are genetically Using the CRISPR method to edit silences or reduces expression of one or more immune checkpoint genes in at least a portion of the synovial cells of the joint.

[0130] CRISPR stands for "Clustered Regularly Interspaced Short Palindromic Repeats". Methods that use the CRISPR system for gene editing are also referred to herein as CRISPR methods. There are three types of CRISPR systems, types II, V, and VI, which incorporate RNA and Cas protein and can be used according to the present disclosure. Type II CRISPR (exemplified by Cas9) is one of the best characterized systems.

[0131] CRISPR technology was diverted from the natural defense mechanisms of bacteria and archaea (a domain of single-celled microorganisms). These organisms use CRISPR-derived RNA and various Cas proteins, including Cas9, to shred and destroy the DNA or RNA of foreign invaders, thereby thwarting attack by viruses and other foreign substances. CRISPR is a specialized region of DNA with two distinct features, the presence of nucleotide repeats and spacers. Repeated sequences of nucleotides are distributed throughout the CRISPR region, and short segments of foreign DNA (spacers) are interspersed among the repeats. In the type II CRISPR-Cas system, the spacer is integrated within the CRISPR genomic locus, transcribed into short CRISPR RNAs (crRNAs) and processed. These crRNAs anneal trans-activating crRNAs (tracrRNAs) and induce sequence-specific cleavage and silencing of pathogenic DNA by Cas proteins. Target recognition by the Cas9 protein requires a 'seed' sequence within the crRNA and a conserved dinucleotide-containing protospacer adjacent motif (PAM) sequence upstream of the crRNA binding region. The CRISPR-Cas system can thereby be retargeted to cleave virtually any DNA sequence by redesigning the crRNA. crRNA and tracrRNA in natural systems can be simplified to a single guide RNA (sgRNA) of approximately 100 nucleotides for use in genetic engineering. The CRISPR-Cas system is directly implantable into human cells by co-delivery of a plasmid expressing the Cas9 endonuclease and the necessary crRNA and tracrRNA (or sgRNA) components. Different variants of the Cas protein can be used to reduce targeting restrictions (eg orthologues of Cas9 such as Cpf1).

[0132] CRSIPR-Cas-mediated homologous recombination The CRISPR-Cas system for homologous recombination (HR) consists of a Cas nuclease (e.g., Cas9 nuclease) or a variant or fragment thereof, a guide sequence that targets the Cas nuclease to target genomic DNA, and a scaffold that interacts with the Cas nuclease. A DNA targeting RNA (eg, single guide RNA (sgRNA)) containing sequence and a donor template are included. The CRISPR-Cas system generates double-strand breaks at desired target loci in the cell's genome, harnessing the cell's intrinsic machinery to repair breaks induced by homology-directed repair (HDR). can be used for

[0133] CRISPR-Cas9 nucleases can facilitate locus-specific chromosomal integration of exogenous DNA delivered by AAV vectors. Typically, the size of exogenous DNA (eg, transgenes, expression cassettes, etc.) that can be incorporated is limited by the DNA packaging capacity of AAV vectors, which is approximately 4.0 kb. Including the two homologous arms required for homologous recombination, a single AAV vector can deliver only less than about 3.7 kb of exogenous DNA. The methods described herein allow delivery of exogenous DNA that is 4 kb or greater by splitting the nucleotide sequence between two different AAV vectors. A donor template is designed for sequential homologous recombination events that can incorporate and fuse two portions of the nucleotide sequence.

[0134] Homologous recombination of the present disclosure can be used for genome editing, including but not limited to CRISPR-Cas nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), engineered meganucleases. can be performed using the engineered nuclease system of In one aspect, a CRISPR-Cas based nuclease system is used. A detailed description of useful nuclease systems can be found, for example, in Gaj et al., Trends Biotechnol, 2013, Jul:31(7):397-405.

[0135] Any suitable CRISPR / Cas system can be used in the methods and compositions disclosed herein. The CRISPR / Cas system may be referred to using various nomenclature systems. Exemplary nomenclature systems are Makarova, K.S. et al, “An updated evolutionary classification of CRISPR-Cas systems,” Nat Rev Microbiol (2015) 13:722-736, and Shmakov, S. et al, “Discovery and Functional Characterization of Diverse Class2 CRISPR-Cas Systems, “Mol Cell (2015) 60:1-13. The CRISPR / Cas system can be Type I, II, III, IV, V, VI, or any other suitable CRISPR / Cas system. As used herein, a CRISPR / Cas system may be Class 1, Class 2, or any other suitably classified CRISPR / Cas system. Class 1 CRISPR / Cas systems may use complexes of multiple Cas proteins to provide regulatory effects. Class 1 CRISPR / Cas systems include, for example, Type I (e.g., I, IA, IB, IC, ID, IE, IF, IU), Type III (e.g., III, IIIA, IIIB, IIIC, IIID), and It may include types of CRISPR / Cas of type IV (eg, IV, IVA, IVB). Class 2 CRISPR / Cas systems can use a single large Cas protein to provide regulatory effects. Class 2 CRISPR / Cas systems can include, for example, type II (eg, II, IIA, IIB) and type V CRISPR / Cas types. CRISPR systems can be complementary to each other and / or can provide functional units in trans to facilitate targeting of the CRISPR locus.

[0136] In some embodiments, a nucleotide sequence encoding a Cas nuclease is present in a recombinant expression vector. In certain instances, the recombinant expression vector is a viral construct, such as a recombinant adeno-associated viral construct, a recombinant adenoviral construct, a recombinant lentiviral construct, and the like. For example, viral vectors can be based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, and the like. Retroviral vectors are derived from retroviruses such as murine leukemia virus, splenic necrosis virus, and Rous sarcoma virus, Harvey's sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, mammary tumor virus. It can be vector based. Useful expression vectors are known to those of skill in the art and many are commercially available. As examples for eukaryotic host cells, the following vectors pXTl, pSG5, pSVK3, pBPV, pMSG and pSVLSV40 are provided. However, any other vector may be used provided it is compatible with the host cell. For example, useful expression vectors containing nucleotide sequences encoding the Cas9 enzyme are commercially available from, eg, Addgene, Life Technologies, Sigma-Aldrich, and Origene.

[0137] Host cells are required to produce infectious AAV vectors, as well as to produce AAV virions based on the disclosed AAV vectors. A variety of host cells are known in the art and find use in the disclosed methods. Any host cell described herein or known in the art can be used with the compositions and methods described herein.

[0138] In some embodiments, host cells for use in producing infectious virions are any biological organism, including prokaryotic (e.g., bacterial) cells, and eutrophic, including insect, yeast, and mammalian cells. It may be selected from nuclear cells. A variety of cells can be used, such as mammalian cells, including mouse cells, and primate cells (eg, human cells). Particularly desirable host cells include, without limitation, A549, WEHI, 3T3, 10T1 / 2, BHK, MDCK, COS1, COS7, BSC1, BSC40, BMT10, VERO, WI38, HeLa, CHO, 293, Vero, NIH3T3, PC12 , Huh-7Saos, C2C12, RAT1, Sf9, L cells, HT1080, Human embryonic kidney (HEK), Human embryonic stem cells, Human adult tissue stem cells, Pluripotent stem cells, Induced pluripotent stem cells, Reprogramming stem cells, Organoids Any mammal, including cells such as stem cells, bone marrow stem cells, HLHepG2, HepG2, and primary fibroblasts, hepatocytes, and myoblasts from mammals, including humans, monkeys, mice, rats, rabbits, and hamsters selected from animal species. A requirement of the cells used is that they are capable of being infected or transfected with the AAV vector. In some embodiments, the host cell is one that has a cap that has rep and is stably transfected intracellularly.

[0139] In some embodiments, preparation of host cells according to the present disclosure involves techniques such as assembly of selected DNA sequences. This assembly can be accomplished using conventional techniques. Such techniques are well known and described in Sambrook et al., cited above, cDNA and genome cloning, use of overlapping oligonucleotide sequences of adenovirus and AAV genomes combined with the polymerase chain reaction, synthetic methods. , as well as any other suitable method for providing the desired nucleotide sequence.

[0140] In addition to the AAV vector, the host cell may contain sequences that drive expression of the AAV capsid polypeptide (serotype identical to that of the host cell and the AAV inverted terminal repeat (ITR) found within the AAV vector). , or in cross-complementary serotype rep sequences.AAV capsid and rep sequences can be obtained independently from AAV sources, by any method known to those of skill in the art, or as described herein. In addition, when pseudotyping an AAV vector in an AAV8 capsid, for example, sequences encoding each of the essential rep (replication) proteins can be supplied by AAV8, Alternatively, sequences encoding rep (replication) proteins may be provided by different AAV serotypes (eg, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, and / or AAV9).

[0141] In some embodiments, the host cell stably contains capsid proteins under the control of suitable promoters. In some embodiments, the capsid proteins are supplied to the host cell in trans. When delivered to a host cell in trans, the capsid protein can be delivered via a plasmid containing the necessary sequences to direct the expression of the selected capsid protein in the host cell. In some embodiments, when delivered to the host cell in trans, the vector encoding the capsid protein also carries other sequences necessary for packaging AAV, such as rep (replication) sequences.

[0142] In some embodiments, the host cell stably contains rep (replication) sequences under the control of a suitable promoter. In another embodiment, the rep (replication) protein is supplied to the host cell in trans. When delivered to a host cell in trans, the rep (replicating) protein may be delivered via a plasmid containing the necessary sequences to direct the expression of the selected rep (replicating) protein in the host cell. In some embodiments, when delivered to a host cell in trans, the vector encoding the capsid protein (also carries other sequences necessary for packaging the AAV vector, such as the rep (replication) sequence). do.

[0143] In some embodiments, the rep (replication) sequence and the capsid sequence can be transfected into the host cell on a single nucleic acid molecule and stably exist as an unintegrated episome within the cell. In another embodiment, the rep (replication) and capsid sequences are stably integrated into the chromosome of the cell. Another embodiment has the rep (replicating) and capsid sequences transiently expressed in the host cell. For example, a useful nucleic acid molecule for such transfection includes, in the 5′ to 3′ direction, the promoter, an optional spacer interposed between the promoter and the start site of the rep (replication) gene sequence, Includes AAV rep (replication) gene sequences, and AAV capsid gene sequences.

[0144] Although rep (replication) and capsid providing molecules may be present in the host cell transiently (i.e., through transfection), in some embodiments, rep (replication) and capsid proteins and their expression are regulated. One or both of the promoters are stably expressed within the host cell, eg, as episomes or by integration into the host cell's chromosome. The methods used to construct the embodiments of the present disclosure are conventional genetic or recombinant engineering techniques, such as those described in the references above.

[0145] Various methods of producing AAV virions are known in the art and can be used to produce AAV virions comprising the AAV vectors described herein. Generally, this involved inserting or transducing the AAV vector of the present disclosure into a host cell capable of packaging the AAV vector into AAV virions. Exemplary methods are described and referenced below, but any method known to those of skill in the art can be used to generate the AAV virions of the present disclosure.

[0146] AAV vectors containing heterologous nucleic acid (eg, donor template) and used to generate AAV virions can be constructed using methods well known in the art. For example, Koerber et al. (2009) Mol. Ther., 17:2088, Koerber et al. (2008) Mol. See For example, a heterologous sequence can be inserted directly into the AAV genome, with the major AAV open reading frame (ORF) excised therefrom. Other portions of the AAV genome can also be deleted, so long as sufficient portions of the ITRs remain to allow replication and packaging functions. Such constructs can be designed using techniques well known in the art. For example, U.S. Patent Nos. 5,173,414 and 5,139,941, International Patent Application Publication Nos. WO92 / 01070 (published January 23, 1992) and WO93 / 03769 (published March 4, 1993), Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996, Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press), Carter, B.J. (1992) Current Opinion in Biotechnology 3:533-539, Muzyczka, N. (1992) Curr. Topics Microbiol. Immunol. 158:97-129, Kotin, R.M. (1994) Human Gene Therapy 5:793-801, Shelling and Smith (1994) Gene Therapy 1:165-169, and Zhou et al. (1994) J.Exp.Med.179:1867-1875.

[0147] To produce AAV virions, AAV vectors are introduced into suitable host cells, such as by transfection, using known techniques. A number of transfection techniques are generally known in the art. See, for example, Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, See Elsevier, and Chu et al. (1981) Gene 13:197. Particularly suitable transfection methods include calcium phosphate co-precipitation (Graham et al. (1973) Virol. 52:456-467), direct microinjection into cultured cells (Capecchi, M.R. (1980) Cell 22:479-488). , electroporation (Shigekawa et al. (1988) BioTechniques 6:742-751), liposome-mediated gene transfer (Mannino et al. (1988) BioTechniques 6:682-690), lipid-mediated transduction (Felgner et al. (1987) Proc USA 84:7413-7417), and nucleic acid delivery using high-speed microprojectors (Klein et al. (1987) Nature 327:70-73).

[0148] Depending on the expression system used, any of a number of transcriptional and translational control elements can be used in expression vectors, including promoters, transcription enhancers, transcription terminators and the like. Useful promoters can be derived from viruses, or any organism, including prokaryotic or eukaryotic organisms. Suitable promoters include, but are not limited to, SV40 early promoter, mouse mammary tumor virus long terminal repeat (LTR) promoter, adenovirus major late promoter (Ad MLP), herpes simplex virus (HSV) promoter, cytomegalo Viral (CMV) promoter (CMV immediate early promoter region, CMVIE, etc.), Rous sarcoma virus (RSV) promoter, human U6 small nuclear molecule promoter (U6), enhanced U6 promoter, human HI promoter (HI), etc. are mentioned.

[0149] In some embodiments, polynucleotides encoding Cas nucleases may be used in the present disclosure. Such polynucleotides (eg, mRNA) can be obtained commercially, eg, from TriLink BioTechnologies, GE Dharmacon, ThermoFisher, and the like.

[0150] In certain embodiments, Cas nucleases (eg, Cas9 polypeptides) can be used in the present disclosure. Detailed descriptions of useful Cas9 polypeptides are found, for example, in Hendel et al., Nat Biotechnol, 2015, 33(9):985-989 and Dever et al., Nature, 2016, 539:384-389. , the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0151] In some embodiments, a Cas nuclease (eg, a Cas9 polypeptide) is complexed with an sgRNA to form a Cas ribonucleoprotein (eg, a Cas9 ribonucleoprotein). The molar ratio of Cas nuclease to sgRNA can be in any range that facilitates sequential homologous recombination of the targeted AAV vector and target locus. In some embodiments, the molar ratio of Cas9 polypeptide to sgRNA is about 1:5, 1:4, 1:3, 1:2.5, 1:2, or 1:1. In other embodiments, the molar ratio of Cas9 polypeptide to sgRNA is from about 1:2 to about 1:3. In certain embodiments, the molar ratio of Cas9 polypeptide to sgRNA is about 1:2.5.

[0152] Cas nuclease and variants or fragments thereof, Cas polypeptides or variants or fragments thereof, mRNA encoding Cas polypeptides or variants or fragments thereof, recombinant expression vectors comprising nucleotide sequences encoding Cas polypeptides or variants or fragments thereof or as Cas ribonucleoprotein into a cell (eg, a cell isolated from a subject or an in vivo cell such as a subject). Those skilled in the art will recognize that any method of delivering exogenous polynucleotides, polypeptides, or ribonucleoproteins can be used. Non-limiting examples of such methods include electroporation, nucleofection, transfection, lipofection, transduction, microinjection, electroinjection, electrofusion, nanoparticle bombardment, transformation, conjugation, and the like.

[0153] Non-limiting examples of genes that can be silenced or inhibited by permanently gene-editing synoviocytes via CRISPR include IL-1α, IL-1β, IL-4, IL-9, IL -10, IL-13, and TNF-α.

[0154] Non-limiting examples of genes that can be enhanced by permanently gene-editing synovial cells via CRISPR methods include IL-1α, IL-1β, IL-4, IL-9, IL-10, IL-13, and TNF-α.

[0155] Examples of systems, methods, and compositions for altering expression of target gene sequences by CRISPR methods and that can be used in accordance with embodiments of the present disclosure are disclosed in U.S. Pat. , 8,771,945, 8,889,356, 8,865,406, 8,999,641, 8,945,839, 8,932,814, 8,871,445, 8,906,616, and 8,895,308. Te , which are incorporated herein by reference. Resources for performing CRISPR methods, such as plasmids for expressing CRISPR-Cas9 and CRISPR-Cpf1, are commercially available from companies such as GenScript.

[0156] In one embodiment, the genetic modification of at least a portion of synovial cells of a joint as described herein can be performed using the CRISPR-Cpf1 system described in U.S. Pat. No. 9,790,490, the disclosure of incorporated herein by reference.

[0157] In one embodiment, the genetic modification of at least a portion of synoviocytes of a joint as described herein is performed using a CRISPR-Cas system comprising a single vector system as described in U.S. Pat. No. 9,907,863. , the disclosure of which is incorporated herein by reference. TAL method

[0158] A pharmaceutical composition for the treatment or prevention of a joint disease or condition comprising a gene editing system, wherein the gene editing system targets at least one locus associated with joint function; Further comprising gene editing at least a portion of the synoviocytes. According to a particular embodiment, the use of the TALE method to target at least one genetic locus associated with joint function to gene-edit at least a portion of the synovial cells of the joint. Alternatively, use of the TALE method while targeting at least one locus associated with joint function, wherein at least a portion of the synovial cells of the joint are gene edited to produce at least one gene associated with the joint function gene. Locus expression is enhanced in at least a portion of joint synovial cells.

[0159] TALE stands for "Transcription Activator-Like Effector" proteins, including TALENs ("Transcription Activator-Like Effector Nucleases"). Methods using the TALE system for gene editing may also be referred to herein as TALE methods. TALE is a naturally occurring protein derived from a phytopathogenic bacterium of the genus Xanthomonas and contains a DNA-binding domain composed of a series of 33-35 amino acid repeat domains, each of which recognizes a single base pair. TALE specificity is determined by two hypervariable amino acids known as repeat variable di-residues (RVDs). Modular TALE repeats are linked together to recognize contiguous DNA sequences. Specific RVDs within the DNA-binding domain provide structural features that recognize bases within the target locus and assemble predictable DNA-binding domains. The DNA binding domain of TALE is fused to the catalytic domain of the type IIS FokI endonuclease to create a targetable TALE nuclease. To induce site-directed mutagenesis, two individual TALEN arms separated by a 14-20 base pair spacer region bring FokI monomers into close proximity to dimerize and produce targeted double-strand breaks. .

[0160] Several large-scale systematic studies utilizing various assembly methods have shown that TALE repeats can be combined to recognize virtually any user-defined sequence. Custom-designed TALE arrays are also commercially available through Cellectis Bioresearch (Paris, France), Transposagen Biopharmaceuticals (Lexington, KY, USA), and Life Technologies (Grand Island, NY, USA). TALE and TALEN methods suitable for use in this disclosure are described in U.S. Patent Application Publication Nos. 2011 / 0201118A1, 2013 / 0117869A1, 2013 / 0315884A1, 2015 / 0203871A1, and 2016 / 0120906A1. and the disclosures of which are incorporated herein by reference.

[0161] Non-limiting examples of genes that can be silenced or inhibited by permanently gene-editing synoviocytes via the TALE method include IL-1α, IL-1β, IL-4, IL-9, IL -10, IL-13, and TNF-α.

[0162] Non-limiting examples of genes that can be enhanced by permanently gene-editing synovial cells via the TALE method include IL-1α, IL-1β, IL-4, IL-9, IL-10, IL-13, and TNF-α.

[0163] Examples of systems, methods, and compositions for altering expression of target gene sequences by the TALE method and that can be used in accordance with embodiments of the present disclosure are described in U.S. Pat. No. 8,586,526, which is incorporated by reference. incorporated herein by.

[0164] zinc finger method A pharmaceutical composition for the treatment or prevention of a joint disease or condition comprising a gene editing system, wherein the gene editing system targets at least one genetic locus associated with joint function, and the method comprises a zinc finger or a zinc Further comprising gene editing at least a portion of the joint synovial cells by finger nuclease method. According to a particular embodiment, the use of zinc finger technology to target at least one locus associated with joint function to gene-edit at least a portion of the synovial cells of the joint. Alternatively, the use of zinc finger technology while targeting at least one locus associated with joint function, wherein at least a portion of the synovial cells of the joint are gene edited to produce at least one gene associated with the joint function gene. Expression of the locus is enhanced in at least a portion of joint synovial cells.

[0165] Individual zinc fingers contain approximately 30 amino acids in a conserved ββα configuration. A few amino acids on the surface of the α-helix typically contact 3 bp of the major groove of DNA with varying levels of selectivity. Zinc fingers have two protein domains. The first domain is a DNA binding domain that contains eukaryotic transcription factors and contains zinc fingers. The second domain is a nuclease domain that contains the FokI restriction enzyme and is responsible for catalytic cleavage of DNA.

[0166] The DNA-binding domain of an individual ZFN typically contains 3-6 individual zinc finger repeats, each capable of recognizing 9-18 base pairs. If the zinc finger domains are specific to their intended target site, even a pair of three-finger ZFNs recognizing a total of 18 base pairs can theoretically target a single locus in the mammalian genome. obtain. One way to generate new zinc finger arrays is to combine smaller zinc finger "modules" of known specificity. The most common modular assembly process involves combining three separate zinc fingers, each capable of recognizing a 3 base pair DNA sequence, to generate a 3-finger array capable of recognizing a 9 base pair target site. Alternatively, selection-based approaches such as oligomerization pool engineering (OPEN) can be used to select new zinc finger arrays from randomized libraries that consider context-dependent interactions between neighboring fingers. Engineered zinc fingers are commercially available and Sangamo Biosciences (Richmond, CA, USA) partnered with Sigma-Aldrich (St. Louis, MO, USA) to develop a unique platform for zinc finger constructs (CompoZr( registered trademark)).

[0167] Non-limiting examples of genes that can be silenced or inhibited by permanently gene-editing synoviocytes via zinc finger technology include IL-1α, IL-1β, IL-4, IL-9, IL-10, IL-13, TNF-α. IL-6, IL-8, IL-18, matrix metalloprotease (MMP), or component of the NLRP3 inflammasome. In some embodiments, the components of the NLRP3 inflammasome comprise NLRP3, ASC (a CARD-containing apoptosis-associated speck-like protein), caspase-1, and combinations thereof.

[0168] Non-limiting examples of genes that can be enhanced by permanently gene-editing synovial cells via zinc finger technology include IL-1Ra, TIMP-1, TIMP-2, TIMP-3, TIMP-4. , and combinations thereof. In one aspect, the present disclosure provides compositions for upregulation of anti-inflammatory cytokines.

[0169] Examples of systems, methods, and compositions for altering expression of target gene sequences by zinc finger technology and that can be used in accordance with embodiments of the present disclosure are described in U.S. Patent Nos. 6,534,261; No. 6,794,136, No. 6,824,978, No. 6,866,997, No. 6,933,113, No. 6,979,539, No. 7,013,219, No. 7,030,215, No. 7,220,719, No. 7,241,573, No. 7,241,574 Nos. 7,585,849, 7,595,376, 6,903,185, and 6,479,626, which are incorporated herein by reference.

[0170] In some aspects, the cells can be gene-edited ex vivo, where the gene-editing targets one or more anti-inflammatory cytokine loci. In some aspects, the cells are synovial cells. In some aspects, the cells are mesenchymal stem cells. In some aspects, the cells are macrophages. In some aspects, the disclosure provides pharmaceutical compositions for the treatment or prevention of joint diseases or conditions comprising a population of gene-edited cells, wherein the gene-edited cells are associated with joint function. Edited by a gene editing system that targets at least one locus. In one aspect, the population of gene-edited cells is injected into the synovial joint.

[0171] Other examples of systems, methods, and compositions for altering expression of target gene sequences by zinc finger technology and that can be used in accordance with embodiments of the present disclosure can be found in Beane, et al., Mol.Therapy, 2015, 23 1380-1390, the disclosure of which is incorporated herein by reference.

[0172] exemplary embodiment In some embodiments, the present disclosure provides a pharmaceutical composition for the treatment or prevention of a joint disease or condition, wherein the composition comprises a therapeutically effective amount of clustered and regularly arranged short palindromes. It contains one or more nucleic acids encoding the sequence repeat (CRISPR) gene editing system. The system comprises a CRISPR-associated protein 9 (Cas9) protein and at least one guide RNA that targets the IL-1α or IL-1β gene, wherein the target sequence is the protospacer adjacent motif (PAM) sequence of the Cas9 protein. A guide RNA and a contiguous guide RNA.

[0173] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 2 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 2 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 2 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 2 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 2 of the human IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 2 of the human IL-1α gene.

[0174] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 3 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 3 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 3 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 3 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 3 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 3 of the human IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 3 of the human IL-1α gene.

[0175] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 4 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 4 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 4 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 4 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 4 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 4 of the human IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 4 of the human IL-1α gene.

[0176] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 5 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 5 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 5 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 5 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 5 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 5 of the human IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 5 of the human IL-1α gene.

[0177] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 6 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 6 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 6 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 6 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 6 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 6 of the human IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 6 of the human IL-1α gene.

[0178] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 7 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 7 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 7 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 7 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 7 of the human IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 7 of the human IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 7 of the human IL-1α gene.

[0179] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2 or exon 3 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2 or exon 4 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2 or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2 or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2 or exon 7 of the IL-1α gene.

[0180] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 3 or exon 4 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 3 or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 3 or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 3 or exon 7 of the IL-1α gene.

[0181] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 4 or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 4 or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 4 or exon 7 of the IL-1α gene.

[0182] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 5 or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 5 or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 6 or exon 7 of the IL-1α gene.

[0183] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 3, or exon 4 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 3, or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 3, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 3, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 4, or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 4, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 4, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 5, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 5, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 6, or exon 7 of the IL-1α gene.

[0184] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 3, exon 4, or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 3, exon 4, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 3, exon 4, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 3, exon 5, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 3, exon 5, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 3, exon 6, or exon 7 of the IL-1α gene.

[0185] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 4, exon 5, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 4, exon 5, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 4, exon 6, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and is complementary to target sequences in exon 5, exon 6, or exon 7 of the IL-1α gene.

[0186] In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 5 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 6 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 7 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 6 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 7 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 4, exon 6, or exon 7 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 5, exon 6, or exon 7 of the IL-1α gene including.

[0187] In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 6 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 7 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 3, exon 4, exon 6, or exon 7 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 3, exon 5, exon 6, or exon 7 of the IL-1α gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1α gene and is complementary to a target sequence in exon 4, exon 5, exon 6, or exon 7 of the IL-1α gene including.

[0188] In some embodiments, at least one guide RNA targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 3, exon 4, exon 5, or exon 6 of the IL-1α gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 7 of the IL-1α gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1α gene and is complementary to a target sequence in exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1α gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1α gene and is complementary to target sequences in exon 2, exon 4, exon 5, exon 6, or exon 7 of the IL-1α gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 5, exon 6, or exon 6 of the IL-1α gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 4, exon 6, or exon 7 of the IL-1α gene. Contains a certain crRNA sequence. In some embodiments, the at least one guide RNA targets the human IL-1α gene and targets sequences in exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1α gene. It contains crRNA sequences that are complementary.

[0189] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and has at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence has at least 85% identity with a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence has at least 90% identity with a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence has at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs:298-387.

[0190] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and has at least 75% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 90% identity with SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence is SEQ ID NO:301.

[0191] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and has at least 75% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence is SEQ ID NO:309.

[0192] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequence has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequence has at least 85% identity with a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequence has at least 90% identity with a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequence has at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequences are selected from the group consisting of SEQ ID NOs:388-496.

[0193] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 2 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 2 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 2 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 2 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 2 of the human IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 2 of the human IL-1β gene.

[0194] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 3 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 3 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 3 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 3 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 3 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 3 of the human IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 3 of the human IL-1β gene.

[0195] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 4 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 4 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 4 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 4 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 4 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 4 of the human IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 4 of the human IL-1β gene.

[0196] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 5 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 5 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 5 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 5 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 5 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 5 of the human IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 5 of the human IL-1β gene.

[0197] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 6 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 6 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 6 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 6 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 6 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence of exon 6 of the human IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 6 of the human IL-1β gene.

[0198] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 7 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 7 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 7 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 7 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 7 of the human IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence of exon 7 of the human IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 7 of the human IL-1β gene.

[0199] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2 or exon 3 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2 or exon 4 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2 or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2 or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2 or exon 7 of the IL-1β gene.

[0200] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 3 or exon 4 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 3 or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 3 or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 3 or exon 7 of the IL-1β gene.

[0201] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 4 or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 4 or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 4 or exon 7 of the IL-1β gene.

[0202] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 5 or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 5 or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 6 or exon 7 of the IL-1β gene.

[0203] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 3, or exon 4 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 3, or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 3, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 3, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 4, or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 4, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 4, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 5, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 5, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 2, exon 6, or exon 7 of the IL-1β gene.

[0204] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 3, exon 4, or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 3, exon 4, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 3, exon 4, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 3, exon 5, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 3, exon 5, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 3, exon 6, or exon 7 of the IL-1β gene.

[0205] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 4, exon 5, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 4, exon 5, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 4, exon 6, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and is complementary to target sequences in exon 5, exon 6, or exon 7 of the IL-1β gene.

[0206] In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 5 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 6 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 7 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 6 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 7 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 4, exon 6, or exon 7 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 5, exon 6, or exon 7 of the IL-1β gene including.

[0207] In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 6 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 7 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 3, exon 4, exon 6, or exon 7 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 3, exon 5, exon 6, or exon 7 of the IL-1β gene including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the human IL-1β gene and is complementary to a target sequence in exon 4, exon 5, exon 6, or exon 7 of the IL-1β gene including.

[0208] In some embodiments, at least one guide RNA targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 6 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 7 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1β gene and is complementary to a target sequence in exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 4, exon 5, exon 6, or exon 7 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 5, exon 6, or exon 6 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the human IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, exon 6, or exon 7 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, the at least one guide RNA targets the human IL-1β gene and targets sequences in exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1β gene. It contains crRNA sequences that are complementary.

[0209] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence is SEQ ID NO:462.

[0210] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence is SEQ ID NO:391.

[0211] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:393. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:393. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:393. In some embodiments, the crRNA sequence has at least 90% identity with SEQ ID NO:393. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:393. In some embodiments, the crRNA sequence is SEQ ID NO:393.

[0212] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:388. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:388. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:388. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:388. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:388. In some embodiments, the crRNA sequence is SEQ ID NO:388.

[0213] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:389. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:389. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:389. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:389. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:389. In some embodiments, the crRNA sequence is SEQ ID NO:389.

[0214] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence has at least 85% identity with a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence has at least 90% identity with a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence has at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs:522-590.

[0215] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence is SEQ ID NO:552.

[0216] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence is SEQ ID NO:554.

[0217] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to SEQ ID NO:578. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:578. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:578. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:578. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:578. In some embodiments, the crRNA sequence is SEQ ID NO:578.

[0218] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to SEQ ID NO:579. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:579. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:579. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:579. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:579. In some embodiments, the crRNA sequence is SEQ ID NO:579.

[0219] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and has at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence has at least 85% identity with a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence has at least 90% identity with a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence has at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs:497-551.

[0220] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and has at least 75% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence is SEQ ID NO:498.

[0221] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and has at least 75% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 90% identity with SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence is SEQ ID NO:506.

[0222] In some embodiments, the pharmaceutical composition comprises one or more viral vectors collectively comprising one or more nucleic acids as described herein. In some embodiments, the one or more viral vectors comprise a recombinant virus selected from retrovirus, adenovirus, adeno-associated virus, lentivirus, and herpes simplex virus-1. In some embodiments, one or more viral vectors comprise a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant AAV is of serotype 5 (AAV5). In some embodiments, the recombinant AAV is of serotype 6 (AAV6).

[0223] In some embodiments, the one or more viral vectors encode a first viral vector comprising a first of the one or more nucleic acids encoding a Cas9 protein and at least one guide RNA , a second viral vector comprising a second of the one or more nucleic acids. In some embodiments, the one or more viral vectors comprises a viral vector comprising a single nucleic acid, the single nucleic acid encoding a Cas9 protein and at least one guide RNA.

[0224] In some embodiments, the composition comprises one or more liposomes collectively containing one or more nucleic acids. In some embodiments, one or more nucleic acids are present in a naked state.

[0225] In some embodiments, the Cas9 protein is a S.pyogenes Cas9 polypeptide. In some embodiments, the Cas9 protein is a S. aureus Cas9 polypeptide.

[0226] In some embodiments, the composition is formulated for parenteral administration. In some embodiments, the composition is formulated for intra-articular injection into a joint of a subject.

[0227] In another aspect, the disclosure provides methods for treating or preventing a joint disease or condition in a subject in need thereof. The method includes administering to a joint of a subject a pharmaceutical composition comprising a pharmaceutically effective amount of a composition comprising one or more nucleic acids encoding a clustered regularly spaced short palindromic repeat (CRISPR) gene editing system. including administering. The system comprises a CRISPR-associated protein 9 (Cas9) protein and at least one guide RNA that targets the IL-1α or IL-1β gene, wherein the target sequence is the protospacer adjacent motif (PAM) sequence of the Cas9 protein. A guide RNA and a contiguous guide RNA.

[0228] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and has at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence has at least 85% identity with a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence has at least 90% identity with a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence has at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs:298-387. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs:298-387.

[0229] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and has at least 75% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 90% identity with SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence is SEQ ID NO:301.

[0230] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1α gene and has at least 75% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence is SEQ ID NO:309.

[0231] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequence has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequence has at least 85% identity with a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequence has at least 90% identity with a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequence has at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs:388-496. In some embodiments, the crRNA sequences are selected from the group consisting of SEQ ID NOs:388-496.

[0232] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence is SEQ ID NO:462.

[0233] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence is SEQ ID NO:391.

[0234] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:393. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:393. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:393. In some embodiments, the crRNA sequence has at least 90% identity with SEQ ID NO:393. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:393. In some embodiments, the crRNA sequence is SEQ ID NO:393.

[0235] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:388. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:388. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:388. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:388. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:388. In some embodiments, the crRNA sequence is SEQ ID NO:388.

[0236] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the human IL-1β gene and has at least 75% identity to SEQ ID NO:389. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:389. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:389. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:389. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:389. In some embodiments, the crRNA sequence is SEQ ID NO:389.

[0237] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence has at least 85% identity with a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence has at least 90% identity with a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence has at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs:522-590. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs:522-590.

[0238] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence is SEQ ID NO:552.

[0239] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence is SEQ ID NO:554.

[0240] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to SEQ ID NO:578. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:578. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:578. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:578. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:578. In some embodiments, the crRNA sequence is SEQ ID NO:578.

[0241] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and has at least 75% identity to SEQ ID NO:579. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:579. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:579. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:579. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:579. In some embodiments, the crRNA sequence is SEQ ID NO:579.

[0242] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 2 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 2 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 2 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 2 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 2 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 2 of the canine IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 2 of the canine IL-1α gene.

[0243] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 3 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 3 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 3 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 3 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 3 of the canine IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 3 of the canine IL-1α gene.

[0244] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 4 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 4 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 4 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 4 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 4 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 4 of the canine IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 4 of the canine IL-1α gene.

[0245] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 5 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 5 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 5 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 5 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 5 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 5 of the canine IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 5 of the canine IL-1α gene.

[0246] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 6 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 6 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 6 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 6 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 6 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 6 of the canine IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 6 of the canine IL-1α gene.

[0247] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 7 of the IL-1α gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 7 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 7 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 7 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 7 of the canine IL-1α gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 7 of the canine IL-1α gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 7 of the canine IL-1α gene.

[0248] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 2 or exon 3 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 2 or exon 4 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 2 or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 2 or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 2 or exon 7 of the IL-1α gene.

[0249] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3 or exon 4 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3 or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3 or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3 or exon 7 of the IL-1α gene.

[0250] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 4 or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 4 or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 4 or exon 7 of the IL-1α gene.

[0251] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 5 or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 5 or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 6 or exon 7 of the IL-1α gene.

[0252] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 3, or exon 4 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 3, or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 3, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 3, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 4, or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 4, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 4, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 5, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA targets the canine IL-1α gene and comprises a crRNA sequence complementary to a target sequence in exon 2, exon 5, or exon 7 of the IL-1α gene. . In some embodiments, at least one guide RNA targets the canine IL-1α gene and comprises a crRNA sequence complementary to a target sequence in exon 2, exon 6, or exon 7 of the IL-1α gene. .

[0253] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3, exon 4, or exon 5 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to target sequences in exon 3, exon 4, or exon 6 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3, exon 4, or exon 7 of the IL-1α gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3, exon 5, or exon 6 of the IL-1α gene. . In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3, exon 5, or exon 7 of the IL-1α gene. . In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 3, exon 6, or exon 7 of the IL-1α gene. .

[0254] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 4, exon 5, or exon 6 of the IL-1α gene. . In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 4, exon 5, or exon 7 of the IL-1α gene. . In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 4, exon 6, or exon 7 of the IL-1α gene. . In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1α gene and is complementary to a target sequence in exon 5, exon 6, or exon 7 of the IL-1α gene. .

[0255] In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 5 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 6 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 7 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 6 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 7 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 4, exon 6, or exon 7 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 5, exon 6, or exon 7 of the IL-1α gene Contains arrays.

[0256] In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 6 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 7 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 3, exon 4, exon 6, or exon 7 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 3, exon 5, exon 6, or exon 7 of the IL-1α gene Contains arrays. In some embodiments, the at least one guide RNA is a crRNA that targets the canine IL-1α gene and is complementary to a target sequence in exon 4, exon 5, exon 6, or exon 7 of the IL-1α gene Contains arrays.

[0257] In some embodiments, at least one guide RNA targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 3, exon 4, exon 5, or exon 6 of the IL-1α gene. contains a typical crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 3, exon 4, exon 5, or exon 7 of the IL-1α gene. contains a typical crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1α gene and is complementary to target sequences in exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1α gene. contains a typical crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 4, exon 5, exon 6, or exon 7 of the IL-1α gene. contains a typical crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1α gene and is complementary to a target sequence in exon 2, exon 3, exon 5, exon 6, or exon 6 of the IL-1α gene. contains a typical crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1α gene and is complementary to target sequences in exon 2, exon 3, exon 4, exon 6, or exon 7 of the IL-1α gene. contains a typical crRNA sequence. In some embodiments, the at least one guide RNA targets the canine IL-1α gene and targets sequences in exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1α gene. It contains a crRNA sequence complementary to it.

[0258] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and has at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence has at least 85% identity with a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence has at least 90% identity with a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence has at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs:497-551. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs:497-551.

[0259] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and has at least 75% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence is SEQ ID NO:498.

[0260] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and has at least 75% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 80% identity with SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 85% identity with SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 90% identity with SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence is SEQ ID NO:506.

[0261] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 2 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 2 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 2 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 2 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 2 of the canine IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 2 of the canine IL-1β gene.

[0262] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 3 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 3 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 3 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 3 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 3 of the canine IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 3 of the canine IL-1β gene.

[0263] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 4 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 4 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 4 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 4 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 4 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 4 of the canine IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 4 of the canine IL-1β gene.

[0264] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 5 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 5 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 5 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 5 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 5 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 5 of the canine IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 5 of the canine IL-1β gene.

[0265] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 6 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 6 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 6 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 6 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 6 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 6 of the canine IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 6 of the canine IL-1β gene.

[0266] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 7 of the IL-1β gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 7 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 7 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 7 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than two mismatches with the target sequence in exon 7 of the canine IL-1β gene. In some embodiments, the crRNA sequence forms no more than one mismatch with the target sequence in exon 7 of the canine IL-1β gene. In some embodiments, the crRNA sequences do not form mismatches with target sequences in exon 7 of the canine IL-1β gene.

[0267] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2 or exon 3 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2 or exon 4 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2 or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2 or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2 or exon 7 of the IL-1β gene.

[0268] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3 or exon 4 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3 or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3 or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3 or exon 7 of the IL-1β gene.

[0269] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 4 or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 4 or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 4 or exon 7 of the IL-1β gene.

[0270] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 5 or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 5 or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 6 or exon 7 of the IL-1β gene.

[0271] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 3, or exon 4 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 3, or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to target sequences in exon 2, exon 3, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to target sequences in exon 2, exon 3, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to target sequences in exon 2, exon 4, or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to target sequences in exon 2, exon 4, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 4, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to target sequences in exon 2, exon 5, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to target sequences in exon 2, exon 5, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 6, or exon 7 of the IL-1β gene.

[0272] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 4, or exon 5 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to target sequences in exon 3, exon 4, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 4, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 5, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 5, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 6, or exon 7 of the IL-1β gene.

[0273] In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 4, exon 5, or exon 6 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 4, exon 5, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 4, exon 6, or exon 7 of the IL-1β gene. In some embodiments, at least one guide RNA comprises a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 5, exon 6, or exon 7 of the IL-1β gene.

[0274] In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 5 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 6 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 7 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 6 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 7 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 4, exon 6, or exon 7 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 5, exon 6, or exon 7 of the IL-1β gene. including.

[0275] In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 6 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 7 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 4, exon 6, or exon 7 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 5, exon 6, or exon 7 of the IL-1β gene. including. In some embodiments, at least one guide RNA is a crRNA sequence that targets the canine IL-1β gene and is complementary to a target sequence in exon 4, exon 5, exon 6, or exon 7 of the IL-1β gene. including.

[0276] In some embodiments, at least one guide RNA targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 6 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 7 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1β gene and is complementary to a target sequence in exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 4, exon 5, exon 6, or exon 7 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 5, exon 6, or exon 6 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, at least one guide RNA targets the canine IL-1β gene and is complementary to a target sequence in exon 2, exon 3, exon 4, exon 6, or exon 7 of the IL-1β gene. Contains a certain crRNA sequence. In some embodiments, the at least one guide RNA targets the canine IL-1β gene and targets sequences in exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1β gene. It contains crRNA sequences that are complementary.

[0277] Generally, the crRNA sequences described herein may contain one or more nucleotide substitutions, eg, compared to the reverse complement of the target sequence. Guidance for making nucleotide substitutions can be found, for example, in Jiang et al. and Doudna (Jiang and Doudna, Annu. Rev. Biophys., 46:505-29 (2017)), the contents of which are for the purposes of , which is incorporated herein by reference in its entirety. Specifically, Jiang and Doudna demonstrated CRISPR / CRISPR activity ranging from the apo Cas9 protein (Fig. 3) to the Cas9-sgRNA complex bound to the target strand of the invading double-stranded DNA molecule (Figs. 5 and 7). The molecular structures generated for many different validations of the Cas9 system are considered to arrive at the detailed molecular model of CRISPR / Cas9 binding and cleavage in FIG. From these molecular models, one skilled in the art would know which nucleotide positions in the crRNA sequence are more tolerant of mismatches with the target sequence.

[0278] For example, Jiang teaches that the PAM proximal 10-12 nucleotides, also known as the "seed region" of the crRNA targeting sequence, are most important for robust CRISPR / Cas9 binding. Specifically, Jiang states that mismatches in the seed region "severely impair or completely abolish target DNA binding and cleavage, whereas close homology in the seed region leads to many mismatches elsewhere." Even if there is, it often leads to off-target binding events”, i.e., mismatches in the PAM-distal 8-10 nucleotides. Jiang, 512. Similarly, Jiang states that "[p]effect complementarity between the seed region of the sgRNA and the target DNA is required for Cas9-mediated DNA targeting and cleavage, whereas imperfect bases in the non-seed region It teaches that pairing is much more permissive with respect to target binding specificity.Id., citation omitted.

[0279] Thus, in some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure have a crRNA sequence within the PAM distal 8-10 nucleotides, e.g. including the above nucleotide substitutions. In some embodiments, the crRNA sequence comprises a single nucleotide substitution within the PAM distal 8-10 nucleotides, eg, to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises two nucleotide substitutions within the PAM distal 8-10 nucleotides, eg, to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 3 nucleotide substitutions within the PAM distal 8-10 nucleotides, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 4 nucleotide substitutions within the PAM distal 8-10 nucleotides, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 5 nucleotide substitutions within the PAM distal 8-10 nucleotides, eg, to any of SEQ ID NOs:298-590.

[0280] Thus, in some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure have 1 position within the first 8 positions of the crRNA sequence, e.g. Contains one or more nucleotide substitutions. In some embodiments, the crRNA sequence comprises a single nucleotide substitution within the first 8 positions of the crRNA sequence, eg, to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises two nucleotide substitutions within the first eight positions of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 3 nucleotide substitutions within the first 8 positions of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 4 nucleotide substitutions within the first 8 positions of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 5 nucleotide substitutions within the first 8 positions of the crRNA sequence, eg, to any of SEQ ID NOs:298-590.

[0281] Similarly, in some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure have: Contains one or more nucleotide substitutions. In some embodiments, the crRNA sequence comprises a single nucleotide substitution within the first 10 positions of the crRNA sequence, eg, to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 2 nucleotide substitutions within the first 10 positions of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 3 nucleotide substitutions within the first 10 positions of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 4 nucleotide substitutions within the first 10 positions of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 5 nucleotide substitutions within the first 10 positions of the crRNA sequence, eg, to any of SEQ ID NOs:298-590.

[0282] Furthermore, Jiang and Doudna postulate that base-pairing of the PAM distal nucleotides at positions 14-17 of the crRNA targeting sequence is important for cleavage activity after binding to the target sequence.

[0283] Thus, in some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure are within nucleotide positions 1-3 and 8-10 of the crRNA sequences, e.g., any of SEQ ID NOS:298-590. contains one or more nucleotide substitutions for In some embodiments, the crRNA sequence comprises a single nucleotide substitution within nucleotide positions 1-3 and 8-10 of the crRNA sequence, eg, to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises two nucleotide substitutions within nucleotide positions 1-3 and 8-10 of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises three nucleotide substitutions within nucleotide positions 1-3 and 8-10 of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises four nucleotide substitutions within nucleotide positions 1-3 and 8-10 of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, the crRNA sequence comprises 5 nucleotide substitutions within nucleotide positions 1-3 and 8-10 of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590.

[0284] Similarly, in some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure are within nucleotide positions 1-3 and 8 of the crRNA sequence, e.g., any of SEQ ID NOs:298-590. contains one or more nucleotide substitutions for In some embodiments, the crRNA sequence comprises a single nucleotide substitution within nucleotide positions 1-3 and 8 of the crRNA sequence, eg, to any of SEQ ID NOs:298-590. In some embodiments, crRNA. In some embodiments, the crRNA sequence comprises two nucleotide substitutions within nucleotide positions 1-3 and 8 of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, crRNA. In some embodiments, the crRNA sequence comprises three nucleotide substitutions within nucleotide positions 1-3 and 8 of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, crRNA. In some embodiments, the crRNA sequence comprises 4 nucleotide substitutions within nucleotide positions 1-3 and 8 of the crRNA sequence, eg, relative to any of SEQ ID NOs:298-590. In some embodiments, crRNA.

[0285] In still other embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure are, for example, any of SEQ ID NOs: 298-590, throughout the sequence of the crRNA, as determined through experimentation. contains one or more nucleotide substitutions for In some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure are, for example, any of SEQ ID NOs: 298-590, throughout the sequence of the crRNA, as determined through experimentation. contains a single nucleotide substitution for In some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure are, for example, any of SEQ ID NOs: 298-590, throughout the sequence of the crRNA, as determined through experimentation. contains two nucleotide substitutions for In some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure are, for example, any of SEQ ID NOs: 298-590, throughout the sequence of the crRNA, as determined through experimentation. contains three nucleotide substitutions for In some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure are, for example, any of SEQ ID NOs: 298-590, throughout the sequence of the crRNA, as determined through experimentation. contains four nucleotide substitutions for In some embodiments, the crRNA sequences used in the compositions and / or methods of the present disclosure are, for example, any of SEQ ID NOs: 298-590, throughout the sequence of the crRNA, as determined through experimentation. contains five nucleotide substitutions for

[0286] In some embodiments, the joint disease or condition is arthritis. In some embodiments, the arthritis is osteoarthritis.

[0287] In some embodiments, administering comprises intra-articular injection of the pharmaceutical composition into a joint of the subject. In some embodiments, the pharmaceutical composition is administered intraoperatively. In some embodiments, the pharmaceutical composition is administered after surgery. In some embodiments, the pharmaceutical composition is a sustained release pharmaceutical composition.

[0288] In some embodiments, the pharmaceutical composition comprises one or more viral vectors collectively comprising one or more nucleic acids as described herein. In some embodiments, the one or more viral vectors comprise a recombinant virus selected from retrovirus, adenovirus, adeno-associated virus, lentivirus, and herpes simplex virus-1. In some embodiments, one or more viral vectors comprise a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant AAV is of serotype 5 (AAV5). In some embodiments, the recombinant AAV is of serotype 6 (AAV6).

[0289] In some embodiments, the one or more viral vectors encode a first viral vector comprising a first of the one or more nucleic acids encoding a Cas9 protein and at least one guide RNA , a second viral vector comprising a second of the one or more nucleic acids. In some embodiments, the one or more viral vectors comprises a viral vector comprising a single nucleic acid, the single nucleic acid encoding a Cas9 protein and at least one guide RNA.

[0290] In some embodiments, the composition comprises one or more liposomes collectively containing one or more nucleic acids. In some embodiments, one or more nucleic acids are present in a naked state.

[0291] In some embodiments, the Cas9 protein is a S.pyogenes Cas9 polypeptide. In some embodiments, the Cas9 protein is a S. aureus Cas9 polypeptide. Methods of treating osteoarthritis and other diseases

[0292] The compositions and methods described herein can be used in methods for treating disease. In one embodiment they are for use in treating inflammatory joint disorders. They can also be used in treating other disorders described herein and in the following paragraphs. In one aspect, the compositions and methods are used to treat osteoarthritis (OA).

[0293] In some embodiments, the present disclosure is a method for treating or preventing a joint disease or condition, the method comprising introducing a gene editing system, wherein the gene editing system is associated with joint function. and targeting at least one genetic locus to In some embodiments, the joint disease is osteoarthritis. In one aspect, the method is used to treat a dog with osteoarthritis. In another aspect, the method is used to treat a mammal with degenerative joint disease. In some aspects, the methods are used to treat dogs or horses with joint disease. In some aspects, the method treats osteoarthritis, post-traumatic arthritis, post-infectious arthritis, rheumatoid arthritis, gout, pseudogout, autoimmune-mediated arthritis, inflammatory arthritis, inflammation-mediated and immune-mediated joint disease. used to treat

[0294] In some embodiments, the method includes genetically editing a portion of the joint synovial cells to produce IL-1α, IL-1β, IL-4, IL-9, IL-10, IL-13, and TNF-α. further comprising reducing or silencing the expression of one or more of In one aspect, the method further comprises genetically editing a portion of the joint synovial cells to reduce or silence the expression of one or more of IL-1α, IL-1β.

[0295] In one aspect, the method further comprises gene editing, wherein gene editing comprises one or more methods selected from CRISPR, TALE, zinc finger, and combinations thereof.

[0296] In some aspects, the method further comprises delivering gene editing using an AAV vector, lentiviral vector, or retroviral vector. In a preferred embodiment, the method comprises AAV1, AAV1 (Y705+731F+T492V), AAV2 (Y444+500+730F+T491V), AAV3 (Y705+731F), AAV5, AAV5 (Y436+693+719F), AAV6, Using AAV6 (VP3 variant Y705F / Y731F / T492V), AAV-7m8, AAV8, AAV8 (Y733F), AAV9, AAV9 (VP3 variant Y731F), AAV10 (Y733F), and AAV-ShH10 to deliver gene editing further includes In some aspects, the AAV vector comprises a serotype selected from the group consisting of AAV1, AAV5, AAV6, AAV6 (Y705F / Y731F / T492V), AAV8, AAV9, and AAV9 (Y731F).

[0297] Pharmaceutical compositions and methods of administration The methods described herein involve the use of pharmaceutical compositions comprising CRISPR gene (eg, IL-1α and / or IL-1β) editing complexes as active ingredients.

[0298] Depending on the method / route of administration, pharmaceutical dosage forms come in several types. These include many types of liquid, solid, and semi-solid dosage forms. Common pharmaceutical dosage forms include natural or herbal forms such as pills, tablets, or capsules, beverages or syrups, and botanicals or foods, among many others. In particular, the route of administration (ROA) of drug delivery depends on the dosage form of the substance in question. A liquid pharmaceutical dosage form is a liquid form of a dose of a drug or compound used as a pharmaceutical that is intended for administration or consumption.

[0299] In one embodiment, compositions of the present disclosure can be delivered to a subject subcutaneously (eg, intra-articular injection), cutaneously (eg, transdermally via a patch), and / or via an implant. Exemplary pharmaceutical dosage forms include, for example, pills, osmotic delivery systems, elixirs, emulsions, hydrogels, suspensions, syrups, capsules, tablets, orally dissolving tablets (ODTs), gel capsules, thin films, adhesive topicals. Patches, lollipops, lozenges, chewing gum, dry powder inhalers (DPI), vaporizers, nebulizers, metered dose inhalers (MDI), ointments, transdermal patches, intradermal implants, subcutaneous implants, and transdermal implants.

[0300] As used herein, "dermal delivery" or "cutaneous administration" refers to the pharmaceutical dosage form being delivered to or into the dermis (i.e., the layer of skin between the epidermis (which makes up the skin) and the subcutaneous tissue). It can refer to a route of administration administered via. "Subcutaneous delivery" can refer to a route of administration in which the pharmaceutical dosage form is at or below the subcutaneous tissue layer.

[0301] Methods of formulating suitable pharmaceutical compositions are known in the art, see, for example, Remington: The Science and Practice of Pharmacy, 21st ed., 2005, and the books in the series Drugs and the Pharmaceutical Sciences: a See Series of Textbooks and Monographs (Dekker, N.Y.). Solutions or suspensions used, for example, for parenteral, intradermal, or subcutaneous application may be prepared in sterile diluents such as water for injection, saline, fixed oils, polyethylene glycols, glycerine, propylene glycol, or other synthetic solvents. , antibacterial agents such as benzyl alcohol or methylparaben, antioxidants such as ascorbic acid or sodium bisulfate, chelating agents such as ethylenediaminetetraacetic acid, buffering agents such as acetates, citrates, phosphates, sodium chloride or glucose, etc. may include agents for modulating the toxicity of pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. A parenteral preparation can be enclosed in ampules, disposable syringes or multiple dose vials made of glass or plastic.

[0302] Pharmaceutical compositions suitable for injectable use may include sterile aqueous solutions (which are water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.), or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, mannitol, sorbitol, polyalcohols such as sodium chloride, in the composition. Prolonged absorption of an injectable composition can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

[0303] Sterile injectable solutions incorporate the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. can be prepared by Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and lyophilization, wherein the powder of active ingredient is admixed with any desired additions from a previously sterile-filtered solution. Obtained by adding ingredients.

[0304] A therapeutic compound that is or contains a nucleic acid can be administered by any method suitable for administering nucleic acid agents, such as DNA vaccines. These methods include gene guns, bioinjectors, and skin patches, as well as microparticulate DNA vaccine technology disclosed in US Pat. No. 6,194,389, and mammalian transdermal vaccines with powder form vaccines disclosed in US Pat. No. 6,168,587. Needle-free methods such as needle-free vaccination are included. In addition, intranasal delivery is possible, inter alia, as described in Hamajima et al., Clin. Immunol. Immunopathol., 88(2), 205-10 (1998). Liposomes (eg, described in US Pat. No. 6,472,375) and microencapsulation can also be used. Biodegradable targetable microparticle delivery systems can also be used (described, for example, in US Pat. No. 6,471,996).

[0305] The therapeutic compounds can be prepared with carriers that will protect the therapeutic compound against rapid elimination from the body, such as a sustained release formulation, including implants and microencapsulated delivery systems. Collagen, ethylene vinyl acetate, polyanhydrides (e.g., poly[1,3-bis(carboxyphenoxy)propane-co-sebacic acid] (PCPP-SA) substrates, fatty acid dimer-sebacic acid (FAD-SA) copolymers Biodegradable, biocompatible polymers can be used, such as, poly(lactide-co-glycolide), polyglycolic acid, collagen, polyol triesters, polyethylene glycol-coated liposomes, and polylactic acid. are prepared using standard techniques, or can be obtained commercially, for example, from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (selected cells with monoclonal antibodies against cellular antigens) (including liposomes targeted to cells) can also be used as pharmaceutically acceptable carriers, prepared by methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811. Semi-solid, gelling, softgel, or other formulations (including sustained release) may be used when administration to, for example, a surgical site is desired. Methods are known in the art and may involve the use of biodegradable biocompatible polymers, eg Sawyer et al., Yale J Biol Med.2006 December, 79(3-4):141-152. See

[0306] Pharmaceutical compositions can be included in a container, kit, pack, or dispenser together with instructions for administration.

Example

[0307] Embodiments encompassed herein will now be described with reference to the following examples. These examples are provided for illustrative purposes only and the disclosure contained herein should in no way be construed as limited to these examples, but rather It should be construed to include any and all variations that become apparent as a result of the teachings provided herein.

[0308] Example 1. Reducing IL-1 Expression by CRISPR Genetic Engineering in a Mouse Model of Osteoarthritis. 60 C57B mice are selected and distributed into 4 groups of 15 mice each. OA is induced in each of the mice using the DMM surgical method. Once mice developed OA, they were treated as follows: Group 1: CRISPR AAV vectors engineered to target IL-1α and IL-1β are injected directly into the OA joint to silence or reduce IL-1 protein expression. Group 2: Direct injection into the OA joint with CRISPR AAV vectors engineered at "nonsense" doses that do not affect IL-1 production, negative control. Group 3: CRISPR AAV vectors engineered to target IL-1Ra are injected directly into the OA joint to silence or reduce IL-1Ra protein expression. Group 4: Direct injection of OA joints into sterile buffered saline, control for injection process.

[0309] Mice are monitored before and after treatment to assess effects on their locomotion and exploratory activity. Changes in mechanical sensitivity and gait are also monitored. Allodynia and hindlimb grip strength may also be monitored.

[0310] Approximately 8 weeks later, animals are sacrificed and OA joint tissues are evaluated for gross histopathology and IL-1 expression by IHC. Biomarkers of inflammation, such as MMP-3 expression in OA joints, are also evaluated.

[0311] Group 1 mice treated with CRISPR AAV vectors engineered to target IL-1α and IL-1β and to silence or reduce IL-1 protein expression showed reduced IL-1 by IHC. levels, tissue regeneration by histopathology, and lower levels of inflammatory biomarkers than either of the three other groups. Group 3 mice will exhibit relatively higher levels of inflammatory biomarkers than either of the other three groups.

[0312] Example 2. Assess Guide Cleavage Efficiency for Mouse IL1A and IL1B In vitro cleavage assay CRISPR guide RNAs (phosphorothionate-modified sgRNAs, Table 3) were designed against exon 4 of Il1a and exon 4 of Il1b (Il1a-201ENSMUST00000028882.1 and Il1b-201ENSMUST00000028881.13, exons 4 of Il1a and See Table 2 for target sequences on exon 4 of Il1b). Using C57BL / 6 mouse genomic DNA, amplify exon 4 of Il1a and Il1b by PCR (Phusion High-Fidelity DNA polymerase, NEB cat#M0530S), Il1a primer sequence: CATTGGGAGGATGCTTAGGA (SEQ ID NO:620), Il1a primer Reverse sequence: GGCTGCTTTCTCTCCAACAG (SEQ ID NO:621), Il1b primer sequence: AGGAAGCCTGTGTCTGGTTG (SEQ ID NO:622), Il1b primer reverse sequence: TGGCATCGTGGAGATAAGCTG (SEQ ID NO:623). The amplicon was PCR purified (QiaQuick PCR purification kit cat#28106). Using 100ng of purified PCR product, 200ng of modified guide RNA (Sigma Aldrich), and 0.5ug of TrueCut Spy Cas9 protein V2 (Invitrogen A36498) or 0.5ug of Gene Snipper NLS Sau Cas9 (BioVision Cat#M1281-50-1) was used to determine guide cleavage efficiency using an in vitro cleavage assay. Two types of Cas9, S. pyogenes Cas9 and S. aureus Cas9, were compared for their editing ability. A 2% agarose gel was used for qualitative reading of the cleavage assay.

[0313] Edit cell line CRISPR guide RNAs (phosphorothionate-modified sgRNAs, Table 2) were designed against exon 4 of Il1a and exon 4 of Il1b (Il1a-201ENSMUST00000028882.1 and Il1b-201ENSMUST00000028881.13). Guide RNA cleavage efficiency was measured using Sanger sequencing and Synthego ICE (e.g., Inference of CRISPR Edits from Sanger Trace Data, Hsiau T, Maures T, Waite K, Yang), which is incorporated herein by reference for all purposes. J et al.biorxiv.2018), or TIDE to calculate the edit rate (incorporated herein by reference for all purposes, Easy quantitative assessment of genome editing by sequence trace decomposition, Brinkman E, Chen T, Amendola M and Van Steensel B. See Nucleic Acids res2014) web tools were used to determine pools of J774.2 and NIH3T3 cells. Experiments also compared the efficiency of S. pyogenes Cas9 and S. aureus Cas9. Cells were electroporated with 5ug TrueCut Spy Cas9 protein V2 (Invitrogen A36498) or 5ug EnGen Sau Cas9 protein (NEB M0654T) with 100pmol modified guide RNA (Sigma Aldrich). SF Nucleofector solution and program CM139 were used for J774.2 cells and SG Nucleofector solution and program EN158 were used for NIH3T3 cells. Cell pellets were harvested 3 days after electroporation and gDNA was extracted from each pool (Qiagen, DNeasy blood and tissue kit, 69506). Exon 4 of Il1a or Il1b was amplified in appropriate pools by PCR (Phusion High-Fidelity DNA polymerase, NEB, cat#M0530S). Il1a primer sequence: TGGTTTCAGGAAAACCCAAG (SEQ ID NO:624), Il1a primer reverse sequence: GCAGTATGGCCAAGAAAGGA (SEQ ID NO:625), Il1b primer sequence: AGGAAGCCTGTGTCTGGTTG (SEQ ID NO:622), Il1b primer reverse sequence: CTGGGCAAGAACATTGGATT (SEQ ID NO:626). Amplicons were subjected to Sanger sequencing and analyzed using either Synthego ICE or TIDE web tools to determine the absence of wild-type sequences in each clone and the presence of indels resulting in frameshifts in the cDNA sequences. determined to exist. [Table 4] [Table 5]

[0314] Each cRNA (see, eg, Table 3) was synthesized as a single guide RNA consisting of the above cRNA sequence fused to the tracrRNA sequence below (see, eg, SEQ ID NOs:35 and 36). In certain embodiments, A<>U is used to increase guide RNA activity.

[0315] Sau Cas9: GUUAUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUUU (SEQ ID NO: 35)

[0316] Spy Cas9:GUUUAAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (SEQ ID NO: 36)

[0317] In vitro cleavage assay FIG. 1A illustrates an agarose gel electrophoresis analysis of 100 ng of mouse DNA cleaved by 0.5 ug of Spy Cas9 and 200 ng of modified guide RNA 43-46 for Il1a gene and 47-50 for IL1B. DNA is cleaved at specific sites by cas9 using guide RNA to produce predictable banding patterns on agarose gels compared to uncleaved controls (not wishing to be bound by any particular theory). First, agarose gel electrophoresis on sg8* appears to indicate failed synthesis).

[0318] FIG. 1B illustrates an agarose gel electrophoresis analysis of 100 ng of mouse DNA cleaved with 0.5 ug of Sau Cas9 and 200 ng of modified guide RNA 51-53 for Il1a gene and 54-56 for Il1B. DNA is cleaved at specific sites by Cas9 using guide RNAs to produce predictable banding patterns on agarose gels compared to uncleaved controls.

[0319] Edit cell line Genomic DNA was extracted from the edited pools and Il1a or Il1b exon 4 was PCR amplified in the appropriate pools. PCR products were sent for Sanger sequencing and then deconvolved using TIDE or Synthego ICE software. The Spy Cas9 pool was deconvoluted using Synthego ICE. The software can determine the pattern of editing within each pool based on guide RNA sequences and PAM sites. It can distinguish between edits that cause in-frame deletions that can lead to truncated functional proteins and edits that cause frameshift mutations that can lead to true knockouts. The SauCas9 pool was analyzed by TIDE because the Synthego ICE software is unable to deconvolve the SauCas9 edits. TIDE analysis works in a similar fashion to ICE by determining patterns of editing within pools based on guide RNA and PAM sites. However, rather than giving a true knockout score, it gives an editing efficiency score that cannot distinguish between in-frame and frameshift editing patterns. Editing efficiency scores may therefore represent more than a guide RNA's ability to knock out a protein. SpyCas9 is a standard protein used for CRISPR gene editing. However, it is 4101bp compared to Sau Cas9 which is 3156bp. Due to size limitations of packaging some viruses such as AAV, it compares the editing capabilities of Sau Cas9 and SpyCas9, and the smaller Sau Cas9 was used in the vector designed for this project. Decided to see if I could get it.

[0320] Figures 2A-2D show Spy Cas9 (Figures 2A and 2B) and SauCas9 (Figures 2C and 2D) used with a range of guide RNAs in J774.2 ("J") and NIH3T3 ("N") cells. 4 illustrates a graph displaying the editing efficiency of . Editing efficiency was determined using Synthego ICE or TIDE Sanger deconvolution software. Figure 2A: Knockout efficiency of Il1a using guide RNAs 43-46 with J774.2 and SpyCas9 of NIH3T3. Synthego ICE was used to deconvolve the Sanger sequence traces and determine the knockout efficiency. Figure 2B: Knockout efficiency of Il1b using guide RNAs 47-50 with J774.2 and SpyCas9 from NIH3T3, not wishing to be bound by any particular theory, the data for sgRNA8 appear to indicate failed synthesis. . Synthego ICE was used to deconvolve the Sanger sequence traces and determine the knockout efficiency. Figure 2C: Knockout efficiency of Il1a using guide RNAs 51-53 with saCas9 in J774.2 and NIH3T3. Sanger sequence traces were deconvoluted using TIDE to determine editing efficiency. Figure 2D: Knockout efficiency of Il1b using guide RNAs 54-56 with Sau Cas9 in J774.2 and NIH3T3. Sanger sequence traces were deconvoluted using TIDE to determine editing efficiency.

[0321] Example 3. CRISPR engineering reduces IL-1β expression in a mouse uric acid model. Time course experiments to determine optimal pretreatment time A pilot experiment is performed to determine the optimal pretreatment time for mice with virus before exposing them to uric acid. Mice are injected intra-knee joints with GFP-tagged AAV5 vector. Viral load is then quantified by PCR and the location of viral infection is quantified by histology at 3, 5, and 7 days post-infection. In experiments that yielded reduction of IL-1b in a mouse uric acid model by CRISPR AAV vectors engineered to target IL-1b and to silence or reduce IL-1b expression, mice were injected with viral vectors. As the optimal lead-time to do so, a treatment time is chosen that gives robust expression of the virus in the joint.

[0322] Experiments to confirm CRISPR AAV (AAV-spCas9) knockdown of lL-1b expression and therapeutic efficacy in a uric acid model Mice are selected and divided into three groups: Group 1: Mice injected with a CRISPR AAV vector (AAV-spCas9) engineered to target IL-1b and to silence or reduce IL-1 protein expression. Group 2: mice injected with 'scrambled' guide RNA / Cas9 (AAV-spCas9), a CRISPR AAV vector engineered in amounts that would not affect IL-1 production, and Group 3: Mice injected with saline.

[0323] Mice are then exposed to uric acid after an optimal pretreatment time. Within 24 hours of uric acid injection, animals are sacrificed and joint tissue is analyzed for cytokine expression (eg, assessed for IL-1 expression by IHC). Joint tissue can also be evaluated for gross histopathology and expression of biomarkers of inflammation.

[0324] Group 1 mice treated with CRISPR AAV vectors engineered to target IL-1b and silence or reduce IL-1 protein expression showed reduced levels of IL-1 by IHC, and It will show lower levels of inflammatory biomarkers than either of the two other groups.

[0325] Example 4. Time course study of intra-articular injection of AAV in mice A study was conducted to evaluate the injection of AAV into the joints of male C57BL / 6 mice over time.

[0326] Materials and methods Identification and Preparation of Test Articles - eGFP AAVPrime™ Purified Adeno-Associated Viral Particles: GFP-tagged AAV5 GeneCopoeia™, Catalog No. AB201, Lot No. GC08222K1902, 1.18×10 13 genome copies / mL) and AAV6 (GeneCopoeia™, Catalog # AB401, Lot # GC09242K1905, 5.47 x 10 12 genome copies / mL) supplied by us. AAV-particles were shipped on dry ice and stored at -80°C upon receipt. Immediately prior to administration, AAV particles were reconstituted in phosphate-buffered saline (PBS without calcium and magnesium: Corning, Lot No. 11419005) for 10 μL / knee IA administration. See the study protocol (Appendix A) for additional details regarding test article preparation, storage, and handling.

[0327] Test System Identification—8-10 week old male C57BL / 6 mice (N=30) were obtained from Jackson Laboratory (Bar Harbor, ME). Mice were weighed and weighed approximately 24-29 grams (mean 26 g) at enrollment on study day 0. Animals were identified by distinct markings on the base of the tail that indicated the group and animal number. After randomization, all cages were labeled with appropriate color codes for protocol number, group number, and animal number (Appendix A).

[0328] Environment and Care - Upon arrival, animals were housed 3-5 per cage in polycarbonate cages with wood chip beds and hanging food and water bottles. Mice are housed in either shoebox cages with filter tops (static airflow, approximately 70 inches2 floor space) or individually ventilated pie cages (passive airflow, approximately 70-75 inches2 floor space). did. Animal care, including hygiene of rooms, cages, and equipment, conforms to the guidelines cited in the Guide for the Care and Use of Laboratory Animals (8th Edition). National Research Council, National Academy of Sciences, Washington, DC, 2011. , which is incorporated herein by reference in its entirety for all purposes.

[0329] Animals were acclimated for 4 days before pacing in the test. The attending veterinarian was on site or on standby during the live phase of the study. No concomitant drugs were administered.

[0330] During the acclimatization and testing period, animals were housed in a laboratory environment with temperatures ranging from 19°C to 25°C and relative humidity of 30% to 70%. An automatic timer provided 12 hours light and 12 hours dark. Animals were allowed free access to Envigo Teklad 8640 chow and fresh tap water.

[0331] Experimental Design—On study day 0, mice were randomized by body weight into treatment groups. After randomization, animals were dosed by intra-articular (IA) injection as shown in Table 4. Animal weights were measured as described in Section 8.5.1. Mice were euthanized for necropsy and tissue collection at three time points (days 3, 5, and 7) as described below in the section entitled "Necropsy Specimens". [Table 6]

[0332] Observations, measurements and specimens Weighing—Mice were weighed on study day 0 and again on days 1, 3, 5, and 7 for randomization. Weight measurements can be found in Table 6.

[0333] Necropsy Specimens - Mice were necropsied on study days 3, 5, and 7 as indicated in Table 5. [Table 7]

[0334] At necropsy, mice were exsanguinated via cardiac puncture followed by cervical dislocation. Left and right knees were harvested from all animals. Skin and muscle were removed from the joint while keeping the joint capsule intact. Joints were snap frozen separately in 15 mL conical tubes labeled with mouse number, date of collection, and right or left leg only. Knee joints were frozen at -80°C and stored for shipment.

[0335] Animal disposal - Animal carcasses were disposed of according to the BBP SOP.

[0336] Specimen and Raw Data Storage - Specimens (right and left knee joints), study data, and reports were delivered during or upon study completion.

[0337] Statement on impact of deviations on study quality and integrity - there were no deviations from the study protocol.

[0338] Results / Conclusion On study day 0, male C57BL / 6 mice received IA injections of GFP-tagged AAV5 (5 × 10 9 particles, 10 µL) into the right knee, IA injection of GFP-tagged AAV6 (5 × 10 9 particles, 10 μL) were received on the left knee. Animals were weighed on days 0, 1, 3, 5, and 7 of the study. Necropsy was performed on study days 3 (animals 1-10), 5 (animals 11-20), and 7 (animals 21-30), and right and left knee joints were collected for shipment. did. The live portion of the study, including animal weighing, dosing, and biosampling, was successfully completed. All animals survived until the end of the study.

[0339] References Guide for the Care and Use of Laboratory Animals (8th Edition). National Research Council, National Academy of Sciences, Washington, DC, 2011, which is incorporated herein by reference in its entirety for all purposes. [Table 8] [Table 9]

[0340] protocol test system Number of animals: 33 (30+3 extra) Species / Strain or Breeding: C57BL / 6 Vendor: Jackson Age / weight on arrival: 8-10 weeks old (about 20 grams) Gender: Male Age / weight range at study entry: at least 9 weeks prior to study entry Habituation: Habituation for at least 3 days after BBP arrival Containment: 3-5 animals / cage [Table 10] [Table 11]

[0341] Test article and vehicle information Unformulated test article storage conditions - GFP-tagged AAV5 (Group 1): -80°C, GFP-tagged AAV6 (Group 1): -80°C.

[0342] Vehicle information - GFP-tagged AAV5 (Group 1): PBS (w / o Ca and Mg), GFP-tagged AAV6 (Group 1): PBS (w / o Ca and Mg).

[0343] Test article formulation description and calculations - GFP-tagged AAV5 (Group 1): Dilute stock to appropriate concentration using PBS, GFP-tagged AAV6 (Group 1): Use PBS to appropriate concentration Dilute the stock to

[0344] Storage and Stability of Dosing Formulations and Vehicles - GFP-tagged AAV5 (Group 1): Dilute just prior to injection, GFP-tagged AAV6 (Group 1): Dilute just prior to injection.

[0345] Disposal of test articles after dosing - GFP-tagged AAV5 (Group 1): Discard formulation and retain stock solution for future studies; GFP-tagged AAV6 (Group 1): Discard formulation; Retain the stock solution for future testing. [Table 12]

[0346] autopsy information Kill schedule: Group 1 An1~10: Day 3 Group 1An11~20: Day 5 Group 1An21~30: Day 7 Method of euthanasia: Exsanguination by cardiac puncture followed by cervical dislocation. Time point: no time specified [Table 13] *Label tubes with mouse number, date of collection, and left or right leg only. Samples will be tested without reference to whether they are AAV-2 or AAV-5 injections. Keys will only be provided after PCR completion.

[0347] Sample analysis Tissue specimens - Hind limbs from AAV-injected mice were flash frozen and shipped. Upon arrival, specimens were transferred to a −80° C. freezer for storage.

[0348] GFP expression in target tissue-hindlimbs (pairs) were thawed at room temperature and imaged with the IVIS bioluminescence imaging system (Lumina III, Perkin Elmer). GFP fluorescence was quantified using excitation at 488 nm and measurement of emission at 510 nm. A total of 4 mice were evaluated at each time point (days 3, 5, and 7). Tissues from the remaining 6 animals at each time point were retained for subsequent confirmation of viral load using real-time PCR.

[0349] Results - As seen in Figure 3, there was a high level of GFP expression within the injected knee joints 3 days after injection. Viral load decreased slightly on day 5 and then rose again by day 7. Due to the limited sample size in this pilot study, there was no significant difference between AAV-5 and AAV-6 behavior.

[0350] Discussion—Data from this study support the use of either AAV-5 or AAV-6 for intra-articular delivery of CRISPR-Cas9 to mouse knee joints. Levels of both viral serotypes rose on days 5-7 and remained likely to rise further if follow-up was extended to 2 or 3 weeks. Additional studies are needed to confirm this, but data to date indicate that there should be an interval of at least 1 week prior to vector injection and exposure with intra-articular monoiodoacetate (MIA) crystals. It suggests something.

[0351] Background and Rationale—The monoiodoacetate (MIA)-induced OA model is used in this study for two reasons. First, spontaneous (spontaneous) OA is extremely rare in mice, whereas injection of MIA resulted in a relatively early onset, predictable and significant reduction in intra-articular inflammation, pain, and cartilage. It provides an inducible model of OA that provides good clinical correlation with the disease phenotype, including degeneration, seen in human OA patients. Second, in contrast to surgical models such as medial meniscal (DMM) destabilization and anterior cruciate ligament transection (ACLT), the MIA model does not involve surgical incision of the joint capsule and OA. It is much more relevant to the joint capsule of human patients with

[0352] Injection of MIA crystals in rodents reproduces OA-like lesions and dysfunction that can be analyzed and quantified by techniques such as behavioral testing and objective delayed assessment. MIA is an inhibitor of glyceraldehyde-3-phosphatase and the resulting alteration of cellular glycolysis ultimately causes death of cells within the joint, including chondrocytes. Chondrocyte death manifests as cartilage degeneration and alterations in proteoglycan staining. Mice injected with MIA usually exhibit pain-like behavior within 72 hours and cartilage loss by about 4 weeks post-injection. Increased IL-1 expression has been demonstrated within 2-3 days of injection in rats and mice.

[0353] Study Design - Mice are injected unilaterally (one joint per animal) with either MIA or saline vehicle control. Within each group, half of the animals are pretreated with an AAV-CRISPR-Cas9 vector targeting the murine IL-1 beta gene and the other half are injected with an AAV-CRISPR-Cas9 scrambled control. Animals in both groups are removed from the study at one of two time points: an earlier time point of 48 hours to allow assessment of the effects of therapy on levels of IL-1 in synovial fluid, and A later time point at 4 weeks to allow assessment of the effect of treatment on histological evidence of cartilage destruction and osteoarthritis.

[0354] Method Experimental Animals - A total of 80 mice are used in this study. Experimental procedures are reviewed and approved by the local IACUC. Mice are housed in microisolator cages, fed standard laboratory chow, and allowed free access to water.

[0355] MIA model and Anti-IL1 therapy-mice are acclimated for 7 days prior to testing. On the first day of testing, mice are anesthetized with an inhaled mixture of isoflurane in oxygen. Once anesthesia of the surgical surface is confirmed, the right hind limb is clipped and the skin is scrubbed with a surgical antiseptic. 40 mice (treated) received an intra-articular injection of an AAV-CRISPR-Cas9 vector targeting IL-1 and the remaining 40 animals (control) received an AAV-CRISPR-Cas9 scrambled control. Injected intra-articularly. Seven days later, half of the animals in each group are injected with MIA into the same joint and half with saline vehicle. This led to the establishment of 4 study arms: Group 1: Treated-MIA (20 mice) Group 2: Control-MIA (20 mice) Group 3: treated-vehicle (20 mice) Group 4: Control-vehicle (20 mice)

[0356] Ten mice per group are euthanized 48 hours after MIA challenge for knee joint IL-1 levels. The remaining animals are kept for 4 weeks to assess the effects of therapy on pain behavior (behavioral tests including the von Frey test), lameness (limb use), joint swelling (caliper measurements), and joint pathology (histopathology). will be accommodated.

[0357] Euthanasia and Tissue Collection - Mice are sacrificed by exsanguination followed by cervical dislocation. Joints are either laparotomy and lavaged for IL-1 measurement (48 hour group) or immersion fixed in 10% formalin for decalcified histopathology (4 week group).

[0358] Example 5. Efficacy of AAV-6 and AAV-5-mediated CRISPR treatment of MSU crystal-induced arthritis in mice Introduction and purpose The purpose of these studies is to identify compounds / proteins that inhibit inflammation induced by monosodium urate (MSU) crystal-induced interleukin-1J3 (IL-1J3) release. This is a simple prescreen that identifies the anti-inflammatory activity of various types of anti-inflammatory agents, particularly IL-1 pathway blockers such as interleukin receptor antagonists or antibodies that block IL-1 or IL1R1. (Torres R, et al. Hyperalgesia, synovitis and multiple biomarkers of inflammation are suppressed by interleukin1 inhibition in a novel animal model of gouty arthritis. Ann Rheym Dis.2009;68(10):1602-1608, which all (incorporated herein by reference in its entirety for the purposes of ). Gout is the most common form of inflammatory arthritis, with increasing prevalence worldwide (Roddy E and Doherty M. Epidemiology of Gout. Arthritis Research & Therapy.2010;12(6):223, see is incorporated herein by reference in its entirety for all purposes). Gouty arthritis is characterized by elevated intra- and periarticular serum uric acid concentrations and deposition of monosodium urate crystals (MSU), leading to swollen joints and severe pain (Sabina EP, Chandel S, and Rasool MK. Inhibition of monosodium urate crystal-induced inflammation by withaferin A.J Pharm Pharmaceut Sci. 2008;11(4):46-55, which is incorporated herein by reference in its entirety for all purposes). Current treatments include nonsteroidal anti-inflammatory drugs (NSAIDs), steroids, or colchicine. For some patients, these treatments are either ineffective in treating gout or may have adverse side effects (Sabina, 2008; Getting SJ, et al. Activation of melanocortin type3 receptor as a molecular mechanism). for adrenocorticotropic hormone efficacy in gouty arthritis.Arthritis&Rheumatism.2002;46(10):2765-2775, which is incorporated herein by reference in its entirety for all purposes). The MSU-induced inflammation model provides a good and simple screening tool to identify compounds that may have activity in more complex disease processes such as systemic arthritis and more complex IL-1 driven diseases. .

[0359] A study was conducted to evaluate the efficacy of adeno-associated virus (AAV)-mediated CRISPR therapy of monosodium urate (MSU) crystal-induced inflammation in mice. On study day 0, male C57BL / 6 mice received a placebo control (diluent, phosphate-buffered saline [PBS]), a mixture of two variants of AAV-6 (one carrying guide RNA1, the other carrying guide RNA2, 5 × 10 viral genome [vg] copies / mL), a mixture of two variants of AAV-5 (guide 1 + guide 2, 5 × 10 vg / mL), scrambled AAV-6 control (non-target A single (1×) intra-articular (IA) injection of 1×10 10 vg / mL), or scrambled AAV-5 control (1×10 10 vg / mL), carrying modified guide RNA was administered in the right knee. On study day 7, mice were injected with MSU crystals (25 mg / mL: 250 μg in 10 uL of PBS) into the right knee (same joint as treated). Mice were euthanized for necropsy approximately 6 hours after MSU injection on study day 7. Efficacy assessment was based on animal weight, von Frey test, and knee caliper measurements.

number

[0360] Mice IA-treated (once on day 0) with AAV-6 (guide 1 + 2: 5 × 10 vg / guide / knee) had a 7 At 6 hours after MSU injection on day 1, there was a statistically significant reduction (p=0.025) in referred pain measured by the von Frey test compared to the AAV-6 scrambled vector and PBS control groups (p=0.051 and PBS control, respectively). p=0.075), the result was almost significant. Area under the curve (AUC) calculations for von Frey assessments were not statistically different between groups. Animal weight gain and knee swelling were not statistically different between groups (Table 7). All animals survived until the end of the study. [Table 14] Values ​​represent group means and standard errors (SE). PBS = phosphate buffered saline control, AAV = adeno-associated virus, AUC = area under the curve *p<0.05 ANOVA (Tukey's post hoc test) vs. AAV-6 Guide 1 †p<0.05 ANOVA (Tukey's post hoc test) vs. PBS ‡p<0.05 ANOVA (Tukey's post hoc test) vs. AAV-5 scrambled vector §p<0.05 ANOVA (Tukey's post hoc test) vs. AAV-5 Guide 1

[0361] Summary of Clinical Outcomes - No significant differences were observed between groups over time. There is no clinical evidence that virus injection elicited a greater response than that seen in the vehicle group. There is no clinical evidence that viral injection modified the effects of MSU on joint swelling. The specific role of IL-1 in MSU-induced inflammation is unknown, so the lack of clinical efficacy may not be unexpected.

[0362] Summary of qPCR - qPCR data confirm that CRISPR editing with AAV-6 or AAV-5 is effective in restoring IL-1 beta mRNA expression to normal levels. Statistical significance is difficult to demonstrate given sample size. Confirmation of this effect can be obtained through IHC analysis of synovial tissue.

[0363] Regulatory compliance This study was conducted in accordance with the standard operating procedures (SOPs) of the test facility, the World Health Organization quality control guidelines in basic biomedical research, and all state and Conducted in compliance with federal regulations.

[0364] Institutional animal care and use This study is based on The Guide for the Care & Use of Laboratory An...

Claims

1. A pharmaceutical composition for the treatment or prevention of a joint disease or condition, comprising: a therapeutically effective amount of one or more nucleic acids encoding a clustered regularly interspaced short palindromic repeats (CRISPR) gene editing system, said system comprising: (i) a CRISPR-associated protein 9 (Cas9) protein; and (ii) at least one guide RNA targeting an IL-1α or IL-1β gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) sequence of the Cas9 protein.

2. the at least one guide RNA targets the human IL-1α gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.

3. the at least one guide RNA targets the human IL-1α gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.

4. the at least one guide RNA targets the human IL-1α gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.

5. the at least one guide RNA targets the human IL-1α gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence selected from the group consisting of SEQ ID NOs: 298-387.

6. the at least one guide RNA targets the human IL-1β gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.

7. the at least one guide RNA targets the human IL-1β gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.

8. the at least one guide RNA targets the human IL-1β gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.

9. the at least one guide RNA targets the human IL-1β gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence selected from the group consisting of SEQ ID NOs: 388-496.

10. the at least one guide RNA targets the canine IL-1α gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.

11. the at least one guide RNA targets the canine IL-1α gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.

12. the at least one guide RNA targets the canine IL-1α gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.

13. the at least one guide RNA targets the canine IL-1α gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence selected from the group consisting of SEQ ID NOs: 522-590.

14. the at least one guide RNA targets the canine IL-1β gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.

15. the at least one guide RNA targets the canine IL-1β gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.

16. the at least one guide RNA targets the canine IL-1β gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.

17. the at least one guide RNA targets the canine IL-1β gene; 2. The pharmaceutical composition of claim 1, wherein the at least one guide RNA comprises a crRNA sequence selected from the group consisting of SEQ ID NOs: 497-551.

18. The pharmaceutical composition of any one of claims 1 to 17, wherein the composition comprises one or more viral vectors that collectively comprise the one or more nucleic acids.

19. 20. The pharmaceutical composition of claim 18, wherein the one or more viral vectors comprise a recombinant virus selected from a retrovirus, an adenovirus, an adeno-associated virus, a lentivirus, and herpes simplex virus-1.

20. 20. The pharmaceutical composition of claim 18, wherein the one or more viral vectors comprise a recombinant adeno-associated virus (AAV).

21. 21. The pharmaceutical composition of claim 20, wherein the recombinant AAV is of serotype 5 (AAV5).

22. 21. The pharmaceutical composition of claim 20, wherein the recombinant AAV is of serotype 6 (AAV6).

23. the one or more viral vectors a first viral vector comprising a first nucleic acid of the one or more nucleic acids encoding the Cas9 protein; and a second viral vector comprising a second nucleic acid of the one or more nucleic acids encoding the at least one guide RNA.

24. 23. The pharmaceutical composition of any one of claims 18 to 22, wherein the one or more viral vectors comprise a viral vector comprising a single nucleic acid, the single nucleic acid encoding the Cas9 protein and the at least one guide RNA.

25. 18. The pharmaceutical composition of any one of claims 1 to 17, wherein the composition comprises one or more liposomes that collectively contain the one or more nucleic acids.

26. The pharmaceutical composition according to any one of claims 1 to 17, wherein the one or more nucleic acids are present in a naked state.

27. 27. The pharmaceutical composition of any one of claims 1 to 26, wherein the Cas9 protein is a S. pyogenes Cas9 polypeptide.

28. 27. The pharmaceutical composition of any one of claims 1 to 26, wherein the Cas9 protein is a S. aureus Cas9 polypeptide.

29. The pharmaceutical composition of any one of claims 1 to 28, wherein the composition is formulated for parenteral administration.

30. The pharmaceutical composition of any one of claims 1 to 28, wherein the composition is formulated for intra-articular injection into a joint of a subject.

31. 1. A method for treating or preventing a joint disease or condition in a subject in need thereof, said method comprising: and administering to the subject a pharmaceutical composition comprising a pharma- tically effective amount of a composition comprising one or more nucleic acids encoding a clustered regularly interspaced short palindromic repeats (CRISPR) gene editing system, the system comprising: (i) a CRISPR-associated protein 9 (Cas9) protein; and (ii) at least one guide RNA targeting an IL-1α or IL-1β gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) sequence of the Cas9 protein.

32. 32. The method of claim 31 , wherein the joint disease or condition is arthritis.

33. 33. The method of claim 32, wherein the arthritis is osteoarthritis.

34. The method of any one of claims 31 to 33, wherein the subject is a human.

35. the at least one guide RNA targets the human IL-1α gene; 35. The method of claim 34, wherein the at least one guide RNA comprises a crRNA sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.

36. the at least one guide RNA targets the human IL-1α gene; 35. The method of claim 34, wherein the at least one guide RNA comprises a crRNA sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.

37. the at least one guide RNA targets the human IL-1α gene; 35. The method of claim 34, wherein the at least one guide RNA comprises a crRNA sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.

38. the at least one guide RNA targets the human IL-1α gene; 35. The method of claim 34, wherein the at least one guide RNA comprises a crRNA sequence selected from the group consisting of SEQ ID NOs: 298-387.

39. the at least one guide RNA targets the human IL-1β gene; 35. The method of claim 34, wherein the at least one guide RNA comprises a crRNA sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.

40. the at least one guide RNA targets the human IL-1β gene; 35. The method of claim 34, wherein the at least one guide RNA comprises a crRNA sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.

41. the at least one guide RNA targets the human IL-1β gene; 35. The method of claim 34, wherein the at least one guide RNA comprises a crRNA sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.

42. the at least one guide RNA targets the human IL-1β gene; 35. The method of claim 34, wherein the at least one guide RNA comprises a crRNA sequence selected from the group consisting of SEQ ID NOs: 388-496.

43. The method of any one of claims 31 to 33, wherein the subject is a dog.

44. the at least one guide RNA targets the canine IL-1α gene; 44. The method of claim 43, wherein the at least one guide RNA comprises a crRNA sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.

45. the at least one guide RNA targets the canine IL-1α gene; 44. The method of claim 43, wherein the at least one guide RNA comprises a crRNA sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.

46. the at least one guide RNA targets the canine IL-1α gene; 44. The method of claim 43, wherein the at least one guide RNA comprises a crRNA sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.

47. the at least one guide RNA targets the canine IL-1α gene; 44. The method of claim 43, wherein the at least one guide RNA comprises a crRNA sequence selected from the group consisting of SEQ ID NOs: 522-590.

48. the at least one guide RNA targets the canine IL-1β gene; 44. The method of claim 43, wherein the at least one guide RNA comprises a crRNA sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.

49. the at least one guide RNA targets the canine IL-1β gene; 44. The method of claim 43, wherein the at least one guide RNA comprises a crRNA sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.

50. the at least one guide RNA targets the canine IL-1β gene; 44. The method of claim 43, wherein the at least one guide RNA comprises a crRNA sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.

51. the at least one guide RNA targets the canine IL-1β gene; 44. The method of claim 43, wherein the at least one guide RNA comprises a crRNA sequence selected from the group consisting of SEQ ID NOs: 497-551.

52. 52. The method of any one of claims 31-51, wherein said administering comprises an intra-articular injection of said pharmaceutical composition into said joint of said subject.

53. The method of any one of claims 31 to 52, wherein the pharmaceutical composition is administered during surgery.

54. The method of any one of claims 31 to 52, wherein the pharmaceutical composition is administered after surgery.

55. The method according to any one of claims 31 to 54, wherein the pharmaceutical composition is a sustained release pharmaceutical composition.

56. 56. The method of any one of claims 31-55, wherein the pharmaceutical composition comprises one or more viral vectors that collectively comprise the one or more nucleic acids.

57. 57. The method of claim 56, wherein the one or more viral vectors comprise a recombinant virus selected from a retrovirus, an adenovirus, an adeno-associated virus, a lentivirus, and herpes simplex virus-1.

58. 58. The method of claim 57, wherein the one or more viral vectors comprise a recombinant adeno-associated virus (AAV).

59. 59. The method of claim 58, wherein the recombinant AAV is of serotype 5 (AAV5).

60. 59. The method of claim 58, wherein the recombinant AAV is of serotype 6 (AAV6).

61. the one or more viral vectors a first viral vector comprising a first nucleic acid of the one or more nucleic acids encoding the Cas9 protein; and a second viral vector comprising a second nucleic acid of the one or more nucleic acids encoding the at least one guide RNA.

62. 61. The method of any one of claims 56-60, wherein the one or more viral vectors comprise a viral vector comprising a single nucleic acid, wherein the single nucleic acid encodes the Cas9 protein and the at least one guide RNA.

63. 56. The method of any one of claims 31-55, wherein the pharmaceutical composition comprises one or more liposomes that collectively contain the one or more nucleic acids.

64. The method of any one of claims 31 to 55, wherein the one or more nucleic acids are present in a naked state.

65. 65. The method of any one of claims 31-64, wherein the Cas9 protein is a S. pyogenes Cas9 polypeptide.

66. 65. The method of any one of claims 31-64, wherein the Cas9 protein is a S. aureus Cas9 polypeptide.

67. 1. A pharmaceutical composition for the treatment or prevention of a joint disease or condition, comprising a gene editing system, wherein the gene editing system targets at least one genetic locus associated with joint function.

68. 68. The pharmaceutical composition of claim 67, wherein the gene editing system targets one or more of IL-1α and / or IL-1β.

69. 69. The pharmaceutical composition of claim 67 or 68, wherein the gene editing system silences or reduces expression of at least one genetic locus associated with the joint function in at least a portion of the cells comprising the joint.

70. 68. The pharmaceutical composition of claim 67, wherein the at least one locus associated with joint function is a cytokine and / or growth factor locus.

71. 71. The pharmaceutical composition of claim 70, wherein the cytokine and / or growth factor locus is selected from the group consisting of IL-1 alpha, IL-1 beta, TNF-alpha, IL-6, IL-8, IL-18, matrix metalloproteases (MMPs), NLRP3, ASC (apoptosis-associated speck-like protein containing CARD), caspase-1, and combinations thereof.

72. 68. The pharmaceutical composition of claim 67, wherein the gene editing comprises the use of a programmable nuclease that mediates the generation of a double-stranded or single-stranded break in at least one locus associated with said joint function.

73. 73. The pharmaceutical composition of any one of claims 67-72, wherein the gene editing silences or reduces expression of the at least one genetic locus associated with a joint in at least a portion of the cells comprising the joint.

74. 74. The pharmaceutical composition of claim 73, wherein the one or more cytokine and / or growth factor genes are selected from the group consisting of IL-1 alpha, IL-1 beta, TNF-alpha, IL-6, IL-8, IL-18, matrix metalloproteases (MMPs), NLRP3, ASC (apoptosis-associated speck-like protein containing CARD), caspase-1, and combinations thereof.

75. 75. The pharmaceutical composition of any one of claims 67-74, wherein said gene editing increases expression of one or more cytokine and / or growth factor genes in at least a portion of said cells comprising said joint, said cytokine and / or growth factor genes selected from the group consisting of IL-1Ra, TIMP-1, TIMP-2, TIMP-3, TIMP-4, and combinations thereof.

76. 76. The pharmaceutical composition of any one of claims 67 to 75, wherein the gene editing comprises the use of a programmable nuclease that mediates the generation of double- or single-stranded breaks in the one or more cytokine and / or growth factor genes.

77. The pharmaceutical composition according to any one of claims 67 to 76, wherein the gene editing comprises one or more methods selected from the CRISPR method, the TALE method, the zinc finger method, and combinations thereof.

78. The pharmaceutical composition of any one of claims 67 to 76, wherein the gene editing comprises a CRISPR method.

79. The pharmaceutical composition of claim 78, wherein the CRISPR method is a CRISPR-Cas9 method.

80. The pharmaceutical composition of any one of claims 67 to 76, wherein the gene editing comprises a TALE method.

81. The pharmaceutical composition of any one of claims 67 to 76, wherein the gene editing comprises zinc finger method.

82. 1. A method for the treatment or prevention of a joint disease or condition, the method comprising introducing a gene editing system, wherein the gene editing system targets at least one genetic locus associated with joint function.

83. 83. The method of claim 82, wherein the gene editing system targets one or more of IL-1α and / or IL-1β.

84. 84. The method of claim 82 or 83, wherein the gene editing system silences or reduces expression of at least one genetic locus associated with the joint function in at least a portion of the cells comprising the joint.

85. 83. The method of claim 82, wherein the at least one locus associated with joint function is a cytokine and / or growth factor locus.

86. 86. The method of claim 85, wherein the cytokine and / or growth factor locus is selected from the group consisting of IL-1 alpha, IL-1 beta, TNF-alpha, IL-6, IL-8, IL-18, matrix metalloproteinases (MMPs), NLRP3, ASC (apoptosis-associated speck-like protein containing CARD), caspase-1, and combinations thereof.

87. 87. The method of any one of claims 82-86, wherein the gene editing comprises the use of a programmable nuclease that mediates the generation of a double-stranded or single-stranded break in at least one genetic locus associated with said joint function.

88. 88. The method of any one of claims 82-87, wherein the gene editing silences or reduces expression of the at least one genetic locus associated with a joint in at least a portion of the cells comprising the joint.

89. 89. The method of claim 88, wherein the one or more cytokine and / or growth factor genes are selected from the group consisting of IL-1 alpha, IL-1 beta, TNF-alpha, IL-6, IL-8, IL-18, matrix metalloproteases (MMPs), NLRP3, ASC (apoptosis-associated speck-like protein containing CARD), caspase-1, and combinations thereof.

90. 84. The method of any one of claims 82 or 83, wherein the gene editing increases expression of one or more cytokine and / or growth factor genes in at least a portion of the cells comprising the joint, the one or more cytokine and / or growth factor genes selected from the group consisting of IL-1Ra, TIMP-1, TIMP-2, TIMP-3, TIMP-4, and combinations thereof.

91. 87. The method of any one of claims 82-86, wherein the gene editing comprises the use of a programmable nuclease that mediates the generation of double- or single-stranded breaks in the one or more cytokine and / or growth factor genes.

92. The method according to any one of claims 82 to 91, wherein the gene editing comprises one or more methods selected from the CRISPR method, the TALE method, the zinc finger method, and combinations thereof.

93. The method of any one of claims 82 to 92, wherein the gene editing comprises a CRISPR method.

94. The method of claim 93, wherein the CRISPR method is a CRISPR-Cas9 method.

95. The method of any one of claims 82 to 91, wherein the gene editing comprises a TALE method.

96. The method of any one of claims 82 to 91, wherein the gene editing comprises zinc finger methodology.

97. 82. A method for treating lameness in a dog due to a joint disease, said method comprising administering to a dog in need thereof a composition according to any one of claims 67 to 81.

98. 98. The method of claim 97, wherein the composition is injected intra-articularly.

99. 82. A method for treating lameness in a horse due to joint disease, said method comprising administering to a horse in need thereof a composition according to any one of claims 67 to 81.

100. 100. The method of claim 99, wherein the composition is injected intra-articularly.

101. The method according to any one of claims 97 to 100, wherein the joint disease is an inflammatory joint disease.

102. 1. A method of treating a subject having arthritis, the method comprising administering to the subject a therapeutically effective amount of a clustered regularly interspaced short palindromic repeats (CRISPR) associated protein 9 (Cas9) and at least one guide RNA that targets a gene; wherein the gene is selected from the group consisting of IL-1α, IL-1β, and combinations thereof, and the at least one guide RNA targeting the gene is an RNA sequence complementary to a DNA sequence selected from the group consisting of SEQ ID NO:7 to SEQ ID NO:

20.

103. 103. The method of claim 102, wherein the arthritis is osteoarthritis.

104. The method of Claim 102, wherein the CRISPR gene editing complex comprises a Cas9 protein and a single guide RNA.

105. 105. The method of Claim 104, wherein the CRISPR gene editing complex comprises a Cas9 protein in complex with the single guide RNA.

106. The method of Claim 102, wherein the CRISPR gene editing complex comprises a Cas9 protein and a nucleic acid encoding at least one guide RNA that targets one or both of IL-1α and IL-1β.

107. 103. The method of Claim 102, wherein the Cas9 is administered as a nucleic acid comprising a sequence encoding a Cas9 protein.

108. 108. The method of Claim 107, wherein the nucleic acid comprising a sequence encoding the Cas9 protein is administered in a virus.

109. 109. The method of claim 108, wherein the virus is selected from the group consisting of a recombinant retrovirus, an adenovirus, an adeno-associated virus (AAV), and a lentivirus.

110. 110. The method of claim 109, wherein the virus is n adeno-associated virus (AAV).

111. 109. The method of claim 108, comprising administering a nucleic acid comprising a sequence encoding at least one guide RNA targeting one or both of IL-1α and IL-1β.

112. 112. The method of claim 111, wherein the nucleic acid comprising a sequence encoding the guide RNA is administered in a virus.

113. 113. The method of claim 112, wherein the virus is selected from the group consisting of a recombinant retrovirus, an adenovirus, an adeno-associated virus (AAV), and a lentivirus.

114. The method of claim 113, wherein the virus is n adeno-associated viruses (AAVs).

115. 103. The method of Claim 102, wherein the complex is administered as a single nucleic acid, preferably a viral vector, comprising a sequence encoding the Cas9 protein and a sequence encoding the at least one guide RNA, and wherein the Cas9 protein and the at least one guide RNA are expressed from the same nucleic acid.

116. 103. The method of claim 102, wherein the complex is administered with more than one nucleic acid, preferably more than one viral vector, a first nucleic acid comprising a sequence encoding the at least one guide RNA and a second nucleic acid comprising a sequence encoding the Cas9 protein, and wherein the at least one guide RNA and the Cas9 protein are expressed from separate nucleic acids.

117. 117. The method of claim 115 or 116, wherein the nucleic acid is a viral vector selected from the group consisting of a recombinant retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, and a lentiviral vector.

118. 118. The method of claim 117, wherein the virus is an adeno-associated virus (AAV) vector.

119. The method of claim 102, comprising administering a guide RNA that targets IL-1α.

120. The method of claim 102, comprising administering a guide RNA targeting IL-1β.

121. The method of claim 102, wherein the Cas9 is Streptococcus thermophilus (ST) Cas9 (StCas9), Treponema denticola (TD) (TdCas9), Streptococcus pyogenes (SP) (SpCas9), Staphylococcus aureus (SA) Cas9 (SaCas9), or Neisseria meningitidis (NM) Cas9 (NmCas9), or a variant thereof.

122. 122. The method of claim 121, wherein the Cas9 is SpCas9 or a variant thereof.

123. 123. The method of claim 122, wherein the SpCas9 is SpyCas9, or a variant thereof.

124. The method of claim 102, wherein the CRISPR gene editing complex is administered systemically or locally to the site of arthritis.

125. The method of claim 102, wherein the CRISPR gene editing complex is administered locally to a site of treatment selected from the group consisting of surgery, application of a topical ointment, and combinations thereof.

126. The method of claim 102, wherein the CRISPR gene editing complex is formulated for administration in a composition comprising a biodegradable and / or biocompatible polymer.

127. 127. The method of claim 126, wherein the biodegradable and / or biocompatible polymer is selected from the group consisting of collagen, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polyethylene glycol coated liposomes, and polylactic acid.

128. The method of claim 102, wherein the subject is a human.

129. 103. The method of claim 102, wherein the subject is a non-human subject selected from the group consisting of monkeys, baboons, cows, dogs, goats, gorillas, guinea pigs, hamsters, lemurs, mice, orangutans, pigs, rats, horses, and sheep.

130. The method of claim 102, wherein the editing efficiency of the CRISPR gene editing complex is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.

131. 1. A pharmaceutical composition comprising: a therapeutically effective amount of a CRISPR gene editing complex comprising a clustered regularly interspaced short palindromic repeats (CRISPR) associated protein 9 (Cas9) and at least one guide RNA that targets a gene; The pharmaceutical composition, wherein the gene is selected from the group consisting of IL-1α, IL-1β, and a combination thereof, and the at least one guide RNA targeting the gene is an RNA sequence complementary to a DNA sequence selected from the group consisting of SEQ ID NO:7 to SEQ ID NO:

20.

132. 1. A CRISPR / Cas9 mediated method for treating joint disease through genetic modification of a multicellular eukaryote, comprising local administration of a nucleic acid target sequence flanked by protospacer adjacent motifs (PAMs) and a non-native Cas9 protein, a) a first regulatory element operably linked to one or more nucleotide sequences encoding one or more CRISPR / Cas9 complex gRNAs that hybridize to the target sequence; b) a second regulatory element operably linked to a nucleotide sequence encoding a type II Cas protein; c) a viral vector capable of delivering components (a) and (b) to target joint cells, whereby co-expression of the nucleic acid components results in reduced inflammation in at least some cells of the joint.

133. 1. A method for treating a joint disease, comprising: a) a viral vector comprising a nucleotide sequence encoding a gRNA molecule, the gRNA molecule comprising a domain that targets the IL-1α gene or IL-1β; b) a viral vector comprising a nucleotide sequence encoding a Cas9 molecule; wherein said viral vector comprising a nucleotide sequence encoding a gRNA molecule and said viral vector comprising a Cas9 molecule are capable of being delivered to cells such that levels of IL-1α or IL-1β are reduced in at least some cells of a joint.

134. 1. A CRISPR-Cas nuclease comprising a single guide RNA having a sequence selected from the group consisting of SEQ ID NOs: 21-34 that binds to a target site in an IL-1α or IL-1β gene, wherein the nuclease cleaves and inactivates the gene.

135. 135. A method of inactivating endogenous IL-1α or IL-1β in a joint of a subject, the method comprising administering to the joint a CRISPR / Cas nuclease according to claim 134, wherein the nuclease cleaves and inactivates the IL-1α gene or the IL-1β gene.

136. A clustered regularly interspaced palindromic repeats (CRISPR) / Cas guide RNA (gRNA) comprising a targeting domain that is complementary to genomic interleukin-1 alpha (IL-1a), wherein the targeting domain is configured to disrupt a wild-type sequence.

137. A vector system comprising one or more packaged vectors, a) a first regulatory element operably linked to a sequence encoding the gRNA of claim 136; b) a second regulatory element operably linked to the nucleic acid encoding the Cas protein.

138. 1. A method for modifying a nucleic acid sequence encoding IL-1A in a cell, comprising: a) a viral vector comprising a nucleotide sequence encoding a gRNA molecule, the gRNA molecule comprising a domain that targets the IL-1α gene or IL-1β; and b) contacting the cell with a viral vector comprising a nucleotide sequence encoding a Cas9 molecule; wherein said viral vector comprising a nucleotide sequence encoding a gRNA molecule and said viral vector comprising a Cas9 molecule are capable of being delivered to cells such that levels of IL-1α or IL-1β are reduced in at least some cells of a joint.

139. A method for treating osteoarthritis in a subject, comprising locally administering to the subject the IL-1α gene or IL-1β vector system of claim 137.

140. 138. A method for reducing IL-1α gene or IL-1β expression in at least some cells of a joint, comprising introducing or expressing in said cells a vector system according to claim 137.

141. 13. The composition, method or system of any one of the preceding claims, wherein the guide RNA is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence as set forth in SEQ ID NOs: 21-34 and 168-297.

142. 2. The composition, method, or system of any one of the preceding claims, wherein the AAV is selected from the group consisting of AAV-5 and AAV-6.

Images