Method for determining peelability of astringent coat of castanea plants, and primer set for determining peelability of astringent coat of castanea plants

JP2024010393A5Pending Publication Date: 2025-06-05NAT AGRI & FOOD RES ORG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2022111709
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2022-07-12
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

Existing methods for determining the astringent peeling property of Castanea plants are inefficient and inaccurate, requiring large-scale field cultivation and using DNA markers that are not closely linked to the peeling gene locus, leading to inclusion of difficult-to-peel seedlings in breeding programs.

Method used

A method using specific primers (SEQ ID NO: 1 and SEQ ID NO: 2) for PCR to accurately determine the astringent peeling property by measuring the length of amplified DNA regions, allowing for early identification of seedlings with the correct allele, and a primer set for detecting this region.

Benefits of technology

Enables high-accuracy selection of seedlings with astringent peeling properties, significantly reducing the time and resources required for breeding by directly targeting the causative gene locus, ensuring only easily peelable plants are selected.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000015_0000
    Figure 00000015_0000
  • Figure 00000015_0001
    Figure 00000015_0001
Patent Text Reader

Abstract

To provide a novel method for determining the peelability of the astringent coat of Castanea plants, and a novel primer set for use in determining the peelability of the astringent coat.SOLUTION: A method for determining the peelability of the astringent coat of Castanea plants includes the step for determining the peelability of the astringent coat on the basis of the length of the DNA region amplified by PCR, using primers with the base sequence of SEQ ID NO: 1 and primers with the base sequence of SEQ ID NO: 2, in the DNA of Castanea plants.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to a method for determining the peeling ability of a Chestnut plant, and a primer set for determining the peeling ability of a Chestnut plant. [Background technology]

[0002] The Japanese chestnut (Castanea crenata Sieb. et Zucc.) has a larger fruit than the Chinese chestnut (Castanea mollissima) and European chestnut (Castanea sativa), but has a drawback in that the astringent skin is difficult to peel from the flesh. This is an obstacle to household consumption and processing, and while the import of Chinese chestnut processed products such as Tianjin sweet chestnuts has increased in recent years, the consumption of Japanese chestnuts has decreased significantly. Therefore, the main breeding goal of Japanese chestnuts is to improve the peeling ability. With the development of "Porotan" and then "Porosuke," the harvest period of Japanese chestnuts, which have an easily peelable astringent skin, has been extended, but both are early-ripening varieties, and it is desirable to develop mid-ripening and late-ripening varieties. For these reasons, there is a need to improve the efficiency of breeding by selecting chestnuts with easy-to-peel astringent skin properties using DNA markers.

[0003] The genetic pattern of the ability to peel the astringent skin of Japanese chestnut has been clarified (Non-Patent Document 1), and it is known to be controlled by a single major gene. Markers linked to the ability to peel the astringent skin have also been developed (Non-Patent Document 2). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Takada et al., “Inheritance of the Easy-peeling Pellicle Trait of Japanese ChestnutCultivar Porotan”, HortScience, (2012) Volume 47(7) :845-847 [Non-Patent Document 2] Nishio et al., “Mapping and pedigree analysis of the gene that controls the easy peel pellicle trait inJapanese chestnut (Castanea crenata Sieb. et Zucc.)”, Tree Genetics &Geneomes, (2013) Volume 9: 723-730 Summary of the Invention [Problem to be solved by the invention]

[0005] However, in order to evaluate the ability of Japanese chestnuts to peel, it is necessary to plant the seeds in a field after sowing, grow the trees large, and then use the fruits that have borne fruit. For this reason, it is necessary to maintain and manage a large number of seedlings, including those whose astringent skin is difficult to peel, in the breeding field.

[0006] In addition, existing DNA markers linked to the gene locus that controls pellicle peeling (peeling (sometimes referred to as pellicle-peeling locus or p locus)) are distant from the gene locus that controls pellicle peeling, so even if seedlings that are easy to peel are selected, seedlings that are difficult to peel may be included. Furthermore, since the genotype of the linked marker does not correspond to the phenotype and genotype of pellicle peeling, there is a problem that, depending on the mating combination, there is no marker polymorphism between the parents, making marker selection impossible in the first place.

[0007] In view of the above circumstances, an object of the present invention is to provide a novel method for determining the peeling ability of Castanea plants, and a novel primer set for use in determining the peeling ability. [Means for solving the problem]

[0008] Means for Solving the Problems The present inventors have conducted intensive research to solve the above problems, and as a result have discovered a chromosomal DNA marker that enables highly accurate determination of astringent peeling ability, thereby completing the present invention.

[0009] That is, the present invention relates to, for example, the following inventions. [1] A method for determining peeling ability in a Castanea plant, comprising: The method includes determining peeling ability based on the length of a DNA region in the DNA of a chestnut plant that is amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2. [2] The method according to [1], comprising determining that the Chestnut plant is astringent and peel-prone if the length of the amplified DNA region is 366 to 368 bases in both of a pair of homologous chromosomes. [3] The method according to [2], comprising determining that the chestnut plant is astringent and peel-prone if the length of the amplified DNA region is 367 bases in both of a pair of homologous chromosomes. [4] Determining peeling ability based on the length of the amplified DNA region in the DNA of the chestnut plant, amplifying DNA of a chestnut plant using a primer set for detecting the length of the amplified DNA region; The method according to any one of [1] to [3], comprising a step of determining astringent peeling ability based on the amplification length of a DNA amplification product. [5] The above primer set is The method described in [4], comprising a primer consisting of a nucleotide sequence having a base sequence having 90% or more sequence identity to SEQ ID NO: 1, and a primer consisting of a nucleotide sequence having a base sequence having 90% or more sequence identity to SEQ ID NO: 2. [6] A step of determining peeling ability based on the amplification length of the DNA amplification product, The method according to [4] or [5], comprising determining that the chestnut plant is easily peeled if the amplified length of the DNA amplification product in both of a pair of homologous chromosomes is the same or differs by only one base length compared to that of a cultivar that is easily peeled. [7] A step of determining peeling ability based on the amplification length of the DNA amplification product, The method according to any one of [4] to [6], comprising determining that the chestnut plant is easily peeled when the amplification length of the DNA amplification product in both of a pair of homologous chromosomes is identical compared to that of a variety that is easily peeled. [8] The method according to [6] or [7], wherein the astringent peeling-prone variety is selected from the group consisting of Porotan, Porosuke and Yakko. [9] A method for producing a chestnut plant, comprising determining peeling ability by the method according to any one of [1] to [8].

[10] A primer set for determining the peeling ability of chestnut plants, for detecting the length of a DNA region amplified by PCR using a primer consisting of the base sequence of sequence number 1 and a primer consisting of the base sequence of sequence number 2.

[11] The primer set described in

[10] , comprising a primer consisting of nucleotides having a base sequence having 90% or more sequence identity with SEQ ID NO: 1, and a primer consisting of nucleotides having a base sequence having 90% or more sequence identity with SEQ ID NO: 2.

[12] [9] A chestnut plant obtained by the method described in [9].

[13]

[12] A fruit or seed obtained from a Chestnut plant. Effect of the Invention

[0010] According to the present invention, seedlings having Japanese chestnut astringency-prone peeling alleles can be identified at an early stage using DNA markers.

[0011] In addition, because this marker is located closer to the causative gene locus (Peeling locus) than conventional linked markers, it is possible to select with higher accuracy. Furthermore, because a correlation is observed between the length of the amplification product and the peeling allele, it is possible to estimate the genotype of peeling.

[0012] According to the present invention, seedlings having a Japanese chestnut astringent peeling proneness allele can be selected with high accuracy, and therefore the time required for breeding selection can be significantly reduced compared to conventional breeding or existing linked markers. [Brief description of the drawings]

[0013] [Figure 1] This is a diagram showing the relationship between "Porotan", "Tanzawa", "Kunimi" and "Ishizuchi", and the phenotype and genotype of astringent peeling. In the diagram, (easy) means easy astringent peeling, and (difficult) means difficult astringent peeling. [Diagram 2] This figure shows the relative positions of the peeling locus, existing markers (PRD52, PRD58), and a new marker (CmSca06716) in a linkage map (LG.1, chromosome 1) constructed from a population of "Porotan" x chestnut Tsukuba 43. The numbers indicate the genetic distances (cM) between markers. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] The term "chestnut plant" refers to a plant of the genus Chestnut, belonging to the family Fagaceae, subfamily Castanea. Examples of the chestnut plant include Japanese chestnut (Castanea crenata Sieb. et Zucc.), Chinese chestnut (Castanea mollissima), American chestnut (Castanea dentata), and European chestnut (Castanea sativa). The method of the present embodiment is particularly effective for Japanese chestnut, which has a tendency to have astringent skin that is difficult to peel off from the fruit, so the chestnut plant is preferably Japanese chestnut or derived from Japanese chestnut.

[0015] In this specification, unless otherwise specified, "plant" includes the whole plant, plant cells, plant protoplasts, plant callus, or plant parts, such as embryos, pollen, ovules, gametes, seeds, leaves, flowers, branches, fruits, stems, roots, anthers, etc. In addition, in Chestnut plants, the burrs are called involucre, which corresponds to the skin of other fruits. Furthermore, the outer skin corresponds to the flesh of other fruits, and the astringent skin and the fruit (flesh) inside it correspond to the seed. In this specification, "chestnut fruit" means the parts including the outer skin, astringent skin, and flesh, unless otherwise specified. In this specification, "seedling" means a plant that has germinated from a seed obtained by crossing or the like.

[0016] The astringent skin peeling property means the ease of peeling the astringent skin of a chestnut fruit after heating. The astringent skin peeling property can be judged by whether or not the astringent skin can be peeled off from a heated chestnut fruit. Before heating, a cut (e.g., 3.5 mm deep, 2 cm to 3 / 4 cm long) is made in the outer skin of the fruit with a blade such as a knife, and the heated chestnut fruit can be classified as easily peelable if the astringent skin can be peeled off by hand using a knife, and difficult to peel if the astringent skin cannot be peeled off. Heating may be performed, for example, using boiling water for 2 to 3 minutes, or using an oven toaster (e.g., 500 W to 800 W or 600 W) for 7 to 15 minutes.

[0017] Examples of varieties with astringent peeling tendency include, but are not limited to, Japanese chestnut varieties "Porotan" (Agricultural and Forestry Certification Variety Registration Number: Chestnut Norin 8, Variety Registration Number: 15658), "Porosuke" (Variety Registration Number: 26828), and "Yakko." Astringent peeling tendency is controlled by a recessive (latent) major gene p at a single locus, and when this gene becomes homozygous (pp), the product becomes astringent peeling tendency.

[0018] Examples of varieties that are difficult to peel include, but are not limited to, "Tanzawa", "Kunimi", "Tsukuba" and "Ishizuchi". "Tanzawa" and "Kunimi" have the recessive major gene in the heterozygous form (Pp). "Tsukuba" and "Ishizuchi" do not have the recessive major gene and have the genotype of PP.

[0019] <Method for determining whether astringent skin is peeled off in chestnut plants> As one embodiment, the present invention provides a method for determining peeling ability in a Castanea plant. The method of this embodiment includes determining peeling ability based on the length of a DNA region in the DNA of a Castanea plant that is amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2. The Castanea plant to be determined may be, for example, a hybridized Castanea plant, or a hybridized Castanea plant of a Japanese chestnut or a Castanea plant derived from a Japanese chestnut.

[0020] The present invention is based on the discovery that the peeling ability can be determined by using the length of the DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2 as an indicator (367 bp in the case of Porotan). The DNA region includes SSR (Simple Sequence Repeat). The primer consisting of the base sequence of SEQ ID NO: 1 and the primer consisting of the base sequence of SEQ ID NO: 2 are shown below. Forward primer CCACTCCTCTCAGTCCCTCA (5'→3', SEQ ID NO: 1) Reverse primer CAGTCGGTTTTGGCCTTTGG (5'→3', SEQ ID NO: 2)

[0021] The DNA amplification reaction in "amplifying by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" is not particularly limited as long as it can be amplified by PCR using the primer pair, but may be, for example, a PCR method which is an amplification reaction under non-isothermal conditions, or a real-time PCR method which applies the same. For example, DNA may be extracted from a test Chestnut plant, and the DNA may be used as a template to amplify a DNA fragment by PCR using the primer set. The composition of the reaction solution, the temperature and reaction time of the temperature cycle conditions, etc. when performing the DNA amplification reaction can be appropriately set by a person skilled in the art in consideration of the type of nucleic acid amplification method, the Tm value of the primer, the specifications of the equipment used, etc. In the case of the PCR method, for example, the reaction solution may contain, in addition to the template, the primer set, and DNA polymerase, one or more selected from the group consisting of deoxynucleoside triphosphate (dNTP), magnesium ion, one or more salts, Tris buffer (Tris-HCL), EDTA, glycerol, and a pH buffer. Furthermore, for example, the nucleic acid amplification reaction may be carried out under conditions of an initial denaturation step at 90°C to 98°C for 30 to 180 seconds, followed by 20 to 50 cycles of a denaturation step at 90°C to 98°C for 5 to 180 seconds, an annealing step at 55°C to 68°C for 10 to 60 seconds, and an extension step at 70°C to 75°C for 30 to 700 seconds, each cycle consisting of these steps, and a final extension step at 68°C to 72°C for 120 to 360 seconds. Alternatively, the nucleic acid amplification reaction may be carried out under the conditions of, for example, an initial denaturation step at 95°C to 98°C for 60 to 120 seconds, followed by a denaturation step at 95°C to 98°C for 20 to 30 seconds, an annealing step at 55°C to 60°C for 20 to 30 seconds, and an extension step at 70°C to 75°C for 30 to 60 seconds, each of which is considered as one cycle, for 38 to 42 cycles, and a final extension step at 68°C to 72°C for 240 to 300 seconds. The amplification of the DNA region by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2 can be confirmed, for example, by agarose gel electrophoresis, fragment analysis, or DNA sequencing. The length of the amplified DNA fragment can be confirmed, for example, by comparison with a molecular weight marker, fragment analysis, or DNA sequencing.For example, the resulting amplification products may be analyzed using a suitable instrument (e.g., a DNA sequencer such as the Applied Biosystems 3130xl Genetic Analyzer). Genotyping may also be performed using, for example, GeneMapper software. This method allows the identification of differences of several bases that cannot be visually determined by agarose gel electrophoresis.

[0022] In this specification, the one-letter code for nucleotide bases is used according to the base designation established by the International Union of Pure and Applied Chemistry (IUPAC). Primers may consist of bases A, G, C, T or analogs, or degenerate bases (M, R, W, S, Y, K).

[0023] As used herein, "sequence identity" refers to the percentage (%) of identical bases in the total overlapping DNA sequences in the optimal alignment of two DNA sequences using a mathematical algorithm known in the art. For example, EMBOSS Needle (provided by EMBL-EBI, URL: https: / / www.ebi.ac.uk / Tools / psa / emboss_needle / ) can be used to create the alignment and calculate the sequence identity.

[0024] The judgment of astringent peeling ability may be made by comparison with varieties which are easy to peel or varieties which are difficult to peel, or may be made based on a predetermined standard value.

[0025] Since the tendency to peel astringent skins easily is controlled by a recessive major gene p at a single locus, and when this gene becomes homozygous (pp), the plant becomes prone to peeling astringent skins easily, the above conditions must be met in both of a pair (two) of homologous chromosomes in order to be prone to peeling astringent skins. In other words, even if the length of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" in one of the two homologous chromosomes in a chestnut plant is identical to that of a variety that easily peels astringent skins, if the DNA region in the other chromosome is identical to that of a variety that does not easily peel astringent skins, the chestnut plant will not be prone to peel astringent skins easily, but will be difficult to peel astringent skins.

[0026] For example, the method may include determining that the chestnut plant is easily peeled when the length of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" of the chestnut plant to be determined (test chestnut plant) is the same as or differs by only one base length from the DNA region of the astringent peeling-prone variety in both of a pair of homologous chromosomes. Also, for example, the method may include determining that the chestnut plant is easily peeled when the length of the DNA region of the astringent peeling-prone variety in both of a pair of homologous chromosomes is the same as that of the astringent peeling-prone variety. For example, the method may include determining that the chestnut plant is easily peeled when the length of the amplified DNA region of the astringent peeling-prone variety in both of a pair of homologous chromosomes is 366 bases to 368 bases, or determining that the chestnut plant is easily peeled when the length of the amplified DNA region of the astringent peeling-prone variety in both of a pair of homologous chromosomes is 367 bases.

[0027] Also, for example, when the length of "the DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" of the Chestnut plant to be determined differs by 3 bases or more from the corresponding DNA region of an easily peelable variety in at least one of a pair of homologous chromosomes, the Chestnut plant may be determined to be not easily peelable or to be difficult to peel. A difference of 3 bases or more may be, for example, a difference of 4 bases or more, 5 bases or more, or 6 bases or more, or a difference of 3 bases or more, 4 bases or more, 5 bases or more, or 6 bases or more.

[0028] Also, for example, in at least one of a pair of homologous chromosomes, when the length of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" of the chestnut plant to be determined is the same as or differs by only one base length from a difficult-to-peel variety, the chestnut plant may be determined to be not easily peeled or difficult to peel. In at least one of a pair of homologous chromosomes, when the length of the DNA region is the same as that of a difficult-to-peel variety, the chestnut plant may be determined to be not easily peeled or difficult to peel. Here, when there is a difference in the length of the DNA region between the homologous chromosomes of the difficult-to-peel variety, the length of the shorter DNA region is compared.

[0029] When comparing with varieties that are easy to peel or varieties that are difficult to peel, for example, primers can be designed that sandwich the above-mentioned DNA region, and DNA can be amplified using the DNA of the Chestnut plant to be evaluated and the DNA of the varieties that are easy to peel and / or the varieties that are difficult to peel, and the length of the amplification product of the Chestnut plant can be compared with the length of the amplification product of the varieties that are easy to peel and / or the varieties that are difficult to peel.

[0030] In the astringent peeling varieties "Porotan" and "Yakko", the length of "the DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" in both of a pair of homologous chromosomes is 367 bases long. Therefore, the DNA region in the astringent peeling variety may be, for example, 366 to 368 bases long, or may be 367 bases long.

[0031] In the difficult-to-peel variety "Tanzawa," the length of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" in one of a pair of homologous chromosomes is 363 bases long, and the length of the DNA region in the other is 367 bases long. Therefore, when "Tanzawa" is used as a difficult-to-peel variety, the length of the DNA region is the shorter 363 bases long as a standard. In "Kunimi," the length of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" in one of a pair of homologous chromosomes is 359 bases long, and the length of the DNA region in the other is 367 bases long. Therefore, when "Kunimi" is used as a difficult-to-peel variety, the length of the DNA region is the shorter 359 bases long as a standard. In "Tsukuba," the length of "the DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" in both of a pair of homologous chromosomes is 359 bases long, and the length of the DNA region in the other is 379 bases long. Therefore, when "Tsukuba" is used as a variety that is difficult to peel, the length of the DNA region is 359 bases long as a standard. In "Ishizuchi," the length of "the DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" in one of a pair of homologous chromosomes is 359 bases long, and the length of the DNA region in the other is 379 bases long. Therefore, when "Ishizuchi" is used as a variety that is difficult to peel, the length of the DNA region is 359 bases long as a standard. Therefore, the DNA region in a difficult-to-peel variety (the shorter one if there is a difference in the length of the DNA region between homologous chromosomes) may be, for example, 358 to 364 bases in length, 359 to 363 bases in length, or 359 or 363 bases in length.

[0032] When the astringent peeling property is judged based on a predetermined reference value, for example, when the length of the DNA region of the chestnut plant to be judged is the same or only one base length difference in both of a pair of homologous chromosomes compared to a predetermined reference value, the chestnut plant may be judged to be easily peeled. Also, for example, when the length of the DNA region of the chestnut plant to be judged is the same in both of a pair of homologous chromosomes compared to a predetermined reference value, the chestnut plant may be judged to be easily peeled. Also, for example, when the length of the DNA region of the chestnut plant to be judged is different from a predetermined reference value by 3 base lengths or more in at least one of a pair of homologous chromosomes, the chestnut plant may be judged to be not easily peeled or to be difficult to peel. The case where the difference is 3 base lengths or more may be, for example, 4 base lengths or more, 5 base lengths or more, 6 base lengths or more, or 3 base lengths or more, 4 base lengths or more, 5 base lengths or more, or 6 base lengths or more. The predetermined reference value in these cases may be set based on the DNA region in a variety that is easily peeled, and may be, for example, 366 to 368 bases long, or 367 bases long. The reference value may be determined from the average value of a plurality of varieties that are easily peeled.

[0033] Also, for example, in at least one of a pair of homologous chromosomes, when the length of the DNA region of the chestnut plant to be determined is the same as or differs by only one base length compared to a predetermined reference value, the method may include determining that the chestnut plant is not easily peeled or is difficult to peel. In at least one of a pair of homologous chromosomes, when the length of the DNA region is the same as or differs by only one base length compared to a predetermined reference value, the method may include determining that the chestnut plant is not easily peeled or is difficult to peel. The predetermined reference value in these cases may be set based on the DNA region in a difficult-to-peel variety, and may be, for example, 358 bases to 364 bases, 359 bases to 363 bases, or 359 bases or 363 bases. The reference value may be determined from the average value of a plurality of difficult-to-peel varieties.

[0034] In the method of this embodiment, the peeling property may be determined based on the length of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2". In the description of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2", the primer consisting of the base sequence of SEQ ID NO: 1 and the primer consisting of the base sequence of SEQ ID NO: 2 are used only to identify the DNA region, and do not exclude the use of primers other than the primer consisting of the base sequence of SEQ ID NO: 1 and the primer consisting of the base sequence of SEQ ID NO: 2. The method of this embodiment may, for example, include the peripheral region (e.g., the outer region) of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2". For example, the peeling property may be determined based on the length of the DNA region by including the 5' and / or 3' regions of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2". Therefore, a primer set for detecting the length of "the DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" may be designed to include a region outside the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" and to sandwich said region.

[0035] In the method of the present embodiment, for example, determining the peeling property based on the length of the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" in the DNA of a chestnut plant may include a step of amplifying the DNA of a test chestnut plant using a primer set for detecting the length of the amplified DNA region, and a step of determining the peeling property based on the amplification length of the DNA amplification product. The step of determining the peeling property based on the amplification length of the DNA amplification product may include, for example, determining that the chestnut plant is peeling-prone when the amplification length of the DNA amplification product is the same or differs by only one base length in both of a pair of homologous chromosomes compared to a variety that is peeling-prone, and the step of determining the peeling property based on the amplification length of the DNA amplification product may include determining that the chestnut plant is peeling-prone when the amplification length of the DNA amplification product is the same in both of a pair of homologous chromosomes compared to a variety that is peeling-prone.

[0036] The length of each primer is not particularly limited as long as it is capable of amplifying the target DNA region, but may be, for example, 15 to 50 bases, 18 to 50 bases, 19 to 45 bases, 20 to 40 bases, 20 to 30 bases, etc., and the sequence based on the genomic sequence of a Chestnut plant in each primer may be 10 to 30 bases, 15 to 25 bases, 18 to 20 bases, etc.

[0037] A primer set for detecting the length of "a DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO:1 and a primer consisting of the base sequence of SEQ ID NO:2" may, for example, include a primer consisting of nucleotides containing a base sequence having 90% or more sequence identity to the sequence shown in SEQ ID NO:1, and a primer consisting of nucleotides containing a base sequence having 90% or more sequence identity to the sequence shown in SEQ ID NO:2, or may be a primer set including a primer consisting of nucleotides having at its 3' end a base sequence having 90% or more sequence identity to the sequence shown in SEQ ID NO:1, and a primer consisting of nucleotides having at its 3' end a base sequence having 90% or more sequence identity to the sequence shown in SEQ ID NO:2.

[0038] The sequence identity to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5 may be 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100%. In addition, the base sequence having 90% or more sequence identity to SEQ ID NO: 1 and / or the base sequence having 90% or more sequence identity to SEQ ID NO: 2 may be, for example, 19 to 21 bases long, or 20 bases long. In addition, each primer may contain a base sequence that is a specific sequence, or a base sequence that contains 0 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 nucleotide addition or deletion at the 3' end or 5' end.

[0039] A primer consisting of nucleotides having a base sequence at the 3' end that has 90% or more sequence identity with SEQ ID NO: 1 may have this sequence at the 3' end, and may further include a nucleotide sequence, etc., at the 5' end. Similarly, a primer consisting of nucleotides having a base sequence at the 3' end that has 90% or more sequence identity with SEQ ID NO: 2 may have this sequence at the 3' end, and may further include a nucleotide sequence, etc., at the 5' end. For example, a forward primer is 5'-(further nucleotide sequence, etc.) CCACTCCTCTCAGTCCCTCA (SEQ ID NO:1)-3', The reverse primer is 5'-(further nucleotide sequence etc.) CAGTCGGTTTTGGCCTTTGG (SEQ ID NO:2)-3' may be also possible.

[0040] The additional nucleotide sequence may be based on the genome sequence of a Chestnut plant, or may be a sequence unrelated to the genome sequence. When a primer having an additional nucleotide sequence is used, the length of the amplified product is increased by the additional nucleotide sequence. For example, when a primer consisting of the forward nucleotides shown in SEQ ID NO: 3 and a reverse primer consisting of the nucleotides shown in SEQ ID NO: 4 are used, the universal sequence is 20 bp longer than the Chestnut genome sequence, and the pig-tail sequence is 7 bp longer than the Chestnut genome sequence, so the length of the amplified product is also 27 bp longer than the Chestnut genome sequence.

[0041] In this embodiment, the DNA amplification reaction when amplifying the DNA of a chestnut plant is not particularly limited, and may be, for example, a PCR method, which is an amplification reaction under non-isothermal conditions, or a real-time PCR method corresponding thereto. For example, DNA may be extracted from a test chestnut plant, and a DNA fragment may be amplified by a PCR method using a primer set and the DNA as a template. DNA can be extracted from leaves of a chestnut plant or the like by a conventional method. The reaction solution composition, temperature and reaction time of the temperature cycle conditions when performing a DNA amplification reaction can be appropriately set by a person skilled in the art in consideration of the type of nucleic acid amplification method, the Tm value of the primer, the specifications of the equipment used, and the like. In the case of the PCR method, for example, the reaction solution may contain, in addition to the template, the above-mentioned primer set, and DNA polymerase, one or more selected from the group consisting of deoxynucleoside triphosphate (dNTP), magnesium ion, one or more salts, Tris buffer (Tris-HCL), EDTA, glycerol, and a pH buffer. Alternatively, the nucleic acid amplification reaction may be carried out under conditions of, for example, a denaturation step at 90°C to 98°C for 5 seconds to 180 seconds, followed by an annealing step at 55°C to 68°C for 10 seconds to 60 seconds, and an extension step at 70°C to 75°C for 30 seconds to 700 seconds, with each cycle consisting of 20 to 50 cycles. The fact that the "DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2" has been amplified can be confirmed, for example, by agarose gel electrophoresis, fragment analysis, or DNA sequencing. The length of the amplified DNA fragment can be confirmed, for example, by comparison with a molecular weight marker or DNA sequencing.

[0042] Each primer may have a label detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Detectable labels include, for example, biotin for detection with labeled avidin (e.g., fluorescently labeled streptavidin), haptens, fluorescent dyes (e.g., fluorescein, Texas Red, and rhodamine), electron-dense reagents, enzymes (e.g., horseradish peroxidase and alkaline phosphatase), and radioisotopes (e.g., 32 P,3 H, 14 C and 125 I) can be mentioned. The label may be located, for example, on the 5'-terminus side of the base sequence having 90% or more sequence identity with SEQ ID NO: 1 or the base sequence having 90% or more sequence identity with SEQ ID NO: 2 of the primer, or may be labelled via a linker.

[0043] The step of determining the peeling property based on the amplification length of the DNA amplification product is the step of determining the peeling property as described above. The determination may be performed by a person, or may be set to be performed by software or equipment. The method of this embodiment may further include a step of displaying the determination result. When the determination is performed by software or equipment, the determination result may be displayed on the screen of a PC or equipment.

[0044] <How to create chestnut plants> As an embodiment, the present invention also provides a method for producing a chestnut plant, which includes determining whether astringent peeling is possible by the above-mentioned determination method. The method for producing a chestnut plant may further include selecting a chestnut plant determined to be easily peeled. As described above, the tendency to easily peel astringent is controlled by a recessive major gene p at a single locus, and when this gene becomes homozygous (pp), the plant becomes easily peeled. By selecting a chestnut plant having homozygous pp, a chestnut plant easily peeled can be produced. The chestnut plant to be determined may be a progeny of a cross between a Japanese chestnut or a progeny of a cross between a Japanese chestnut or a chestnut plant derived from a Japanese chestnut. The progeny Chestnut plant may be a first generation hybrid (F1) obtained by crossing Chestnut plants containing p on at least one of the homologous chromosomes (i.e., homozygous pp or heterozygous Pp), or a second generation hybrid (F2) or later plant obtained by further crossing, such as F3 or F4. For example, it may be a first generation (BC1) plant obtained by backcrossing an F1 with a Chestnut plant that is easily peeled, or a second generation (BC2) or later plant obtained by further backcrossing.

[0045] The method for producing the present invention may include, for example, crossing an easily peelable chestnut plant with an easily peelable chestnut plant, crossing an easily peelable chestnut plant with a difficult to peelable chestnut plant (heterotype Pp), or crossing a difficult to peelable chestnut plant (heterotype Pp) with a difficult to peelable chestnut plant (heterotype Pp). As the easily peelable chestnut plant and the difficult to peelable chestnut plant, a variety whose peelability is already known may be used, or a chestnut plant whose peelability has been determined by the above-mentioned method may be used. In addition, further crossing may be performed after selection. For example, in order to obtain a progeny plant having better characteristics, for example, inbreeding, backcrossing, and continuous backcrossing may be performed. For example, the selected Chestnut plant having an easily peelable astringent bark may be crossed with a Chestnut plant having an easily peelable astringent bark or a Chestnut plant having a difficult to peel astringent bark (heterozygous Pp).

[0046] According to the method of the present embodiment, a chestnut plant, particularly a chestnut plant that is easily peeled, can be obtained. When the chestnut plant is a seedling, it can be further grown to obtain fruits or seeds.

[0047] As specific aspects of the production method according to this embodiment, the above-mentioned specific aspects including the description of the discrimination method can be applied without any restrictions.

[0048] <Primer set for determining peeling ability of chestnut plants> As one embodiment, the present invention also provides a primer set for determining the peeling ability of a chestnut plant, for detecting the length of a DNA region amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2 in the DNA of a chestnut plant. The above-mentioned specific aspects and the like can be applied to such a primer set without limitation. For example, the primer set may include a primer consisting of nucleotides containing a base sequence having 90% or more sequence identity with SEQ ID NO: 1, and a primer consisting of nucleotides containing a base sequence having 90% or more sequence identity with SEQ ID NO: 2, and may further include a primer having a detectable label (e.g., a fluorescent dye). In this case, the detectable label may be included on the 5'-end side of the sequence complementary to the genome sequence in the forward primer (e.g., a base sequence having 90% or more sequence identity with SEQ ID NO: 1) or the sequence complementary to the genome sequence in the reverse primer (e.g., a base sequence having 90% or more sequence identity with SEQ ID NO: 2). The sequence identity to SEQ ID NO:1 and SEQ ID NO:2 may be 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0049] The DNA amplification method using the primer set and the method for determining the peeling property are as described above. In addition, the specific aspects of the present embodiment, including the description of the determination method, can be applied without limitation to the specific aspects described above. EXAMPLES

[0050] [Reference example: Existing markers for Japanese chestnut peeling ability] Figure 1 shows the relationship between "Porotan", "Tanzawa", "Kunimi" and "Ishizuchi", and the phenotype and genotype of peeling ability. Genotype analysis was carried out as follows using existing markers PRD52 and PRD58 (Non-Patent Document 2). Figure 2 shows the positional relationship between peeling, the gene locus that controls peeling ability, and existing markers (PRD52, PRD58).

[0051] DNA was extracted from leaves of Japanese chestnut cultivars "Porotan," "Yakko," "Tanzawa," "Kunimi," "Tsukuba," and "Ishizuchi" using the DNeasy Plant Mini Kit (QIAGEN).

[0052] DNA extracted from each variety was used to carry out DNA amplification by PCR under the conditions described in Non-Patent Document 2. The primer sets used were the PRD52 primer set and the PRD58 primer set described in Non-Patent Document 2, slightly modified from the viewpoint of the stability of the amplified product. The repeat regions targeted by each primer set used were the same as those of the PRD52 primer set and the PRD58 primer set described in Non-Patent Document 2.

[0053] The relationship between the obtained DNA amplification products and the phenotype and genotype of peeling ability is shown in Table 1. The two numerical values ​​separated by a slash in the amplification product length indicate the amplification product length in each of a pair of homologous chromosomes.

[0054] [Table 1]

[0055] In Table 1, for example, when PRD52 is used, the amplified product length is the same for "Porotan," which is easy to peel, and "Tanzawa," which is difficult to peel. Also, for example, when PRD58 is used, the amplified product length is different between "Porotan" and "Yakko." Thus, it was found that the phenotype and the amplified product length did not correspond when either the PRD52 or PRD58 primer set was used.

[0056] [Example 1 New primer set (1)] A primer set was prepared by adding a universal sequence and a pig-tail sequence to the 5'-end of the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2 for the new marker (CmSca06716), respectively, and genotype analysis was performed as follows. The positional relationship between the peeling locus and the new marker is shown in Figure 2. Compared to the existing marker, it can be seen that the new marker is located very close to the peeling locus.

[0057] DNA was extracted from the Japanese chestnut varieties "Porotan," "Yakko," "Tanzawa," "Kunimi," "Tsukuba," and "Ishizuchi" in the same manner as in the reference example.

[0058] SSR-PCR analysis was performed by nested-PCR with reference to the method of Schuelke M et al. Nat Biotechnol (2000) 18: 233-234. The reaction was performed in a total of 5 μL containing 2.5 μL of 2 × GoTaq G2 Hot Start Green Master Mix (Promega), 0.3 μM of forward primer (SEQ ID NO: 3) with a universal sequence (SEQ ID NO: 5) added to the 5' end of the sequence of SEQ ID NO: 1, 0.5 μM of reverse primer (SEQ ID NO: 4) with a pig-tail sequence added to the 5' end of SEQ ID NO: 2, 0.2 μM of universal primer labeled with 6-FAM fluorescence, and about 2 ng of DNA. In the paper by Schuelke (2000), the M13 (-21) sequence was used as the universal sequence, but the modified 20-bp sequence was used as the universal sequence (5'-GCTACGGACTGACCTCGGAC-3' SEQ ID NO: 5). The pig-tail sequence (Brownstein et al., BioTechniques (1996) 20:1004-1010, 5'-GTTTCTT-3') added to the 5' end of the reverse primer is for stabilizing genotyping. PCR reaction was performed using the GeneAmp PCR System 9700 with the following program. 95°C for 2 min (initial denaturation). 40 cycles of 95°C for 30 seconds (denaturation), 55°C for 30 seconds (annealing), and 72°C for 45 seconds (extension). After incubation at 72°C for 5 minutes (final extension), hold at 4°C.

[0059] The resulting amplified products were analyzed by a DNA sequencer. Electrophoresis was performed using a 36 cm capillary, POP-7 polymer, internal standard (400 HD ROX), and a dedicated buffer (Genetic Analyzer Buffer with EDTA) according to the protocol of the Applied Biosystems 3130xl Genetic Analyzer. Genotypes were determined using GeneMapper software.

[0060] The relationship between the obtained DNA amplification products and the phenotype and genotype of peeling ability is shown in Table 2. Note that since a 20 bp universal sequence was added to the forward primer and a 7 bp pig-tail sequence was added to the reverse primer, the actual length of the genomic sequence in the amplification product is the length of the amplification product minus 27 bp.

[0061] [Table 2]

[0062] It was found that the 394 bp amplification product (actual genomic sequence length is 367 bp) obtained using the above primer set corresponds to the major gene p for peeling ability.

[0063] Other Japanese chestnut varieties were also analyzed in the same manner. Based on the presence or absence of amplification of the 394 bp amplification product, the relationship between the amplification product length type, genotype, and peeling ability is shown in Table 3 below. The amplification product length type is described as "394 homozygous" for varieties in which the 394 bp amplification product was confirmed in both of a pair of homologous chromosomes, "394 heterozygous" for varieties in which the 394 bp amplification product was confirmed in one of a pair of homologous chromosomes, and "394 not amplified" for varieties in which the 394 bp amplification product was not confirmed in either of a pair of homologous chromosomes.

[0064] [Table 3]

[0065] Thus, this novel marker made it possible to estimate the genotype of astringent peeling ability, and it was demonstrated that it is now possible to select Chestnut plants that are easily astringent peeling-prone with high accuracy.

[0066] [Example 2: New primer set (2)] A primer set for a new marker (CmSca06716) was designed and genotype analysis was performed. DNA from each variety of Japanese chestnut was extracted in the same manner as in the reference example. The reaction was carried out in a total volume of 5 μL, containing 2.5 μL of 2×GoTaq G2 Hot Start Green Master Mix (Promega), 0.4 μM of forward primer with a fluorescent dye attached to the 5' end of the sequence of SEQ ID NO: 1, 0.4 μM of reverse primer consisting of the sequence of SEQ ID NO: 2, and about 2 ng of DNA. PCR was carried out using the following program using a PCR system, GeneAmp PCR System 9700. 95°C for 2 min (initial denaturation). 40 cycles of 95°C for 30 seconds (denaturation), 55°C for 30 seconds (annealing), and 72°C for 45 seconds (extension). After incubation at 72°C for 5 minutes (final extension), hold at 4°C.

[0067] The obtained amplification products were analyzed by a DNA sequencer in the same manner as in Example 2, and the genotypes were determined using GeneMapper software.

[0068] The relationship between the obtained DNA amplification products and the phenotypes and genotypes was similar to that shown in Tables 2 and 3 in Example 2. Note that the length of the amplification products obtained using the primer set of this example was the length of the amplification products shown in Tables 2 and 3 minus 27 bp.

[0069] Thus, this novel marker made it possible to estimate the genotype of astringent peeling ability, and it was demonstrated that it is now possible to select Chestnut plants that are easily astringent peeling-prone with high accuracy.

Claims

1. A method for determining peeling ability in a Castanea plant, comprising: The method includes determining peeling ability based on the length of a DNA region in the DNA of a Chestnut plant that is amplified by PCR using a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO:

2.

2. The method according to claim 1, comprising determining that the chestnut plant is astringent and peel-prone when the length of the amplified DNA region is 366 to 368 bases in both of a pair of homologous chromosomes.

3. The method according to claim 2, comprising determining that the Chestnut plant is astringent and peel-prone when the length of the amplified DNA region is 367 bases in both of a pair of homologous chromosomes.

4. Determining peeling ability based on the length of the amplified DNA region in the DNA of a chestnut plant; amplifying DNA of a chestnut plant using a primer set for detecting the length of the amplified DNA region; and The method according to any one of claims 1 to 3, comprising a step of determining astringent peeling property based on the amplification length of the DNA amplification product.

5. The primer set is The method according to claim 4, comprising a primer consisting of a nucleotide sequence containing a base sequence having 90% or more sequence identity with SEQ ID NO:1, and a primer consisting of a nucleotide sequence containing a base sequence having 90% or more sequence identity with SEQ ID NO:

2.

6. A step of determining whether the astringent skin is peeled based on the amplification length of the DNA amplification product, The method according to claim 4, comprising determining that the chestnut plant is easily peeled when the amplified length of the DNA amplification product in both of a pair of homologous chromosomes is the same or differs by only one base length compared to that of a cultivar that is easily peeled.

7. A step of determining whether the astringent skin is peeled based on the amplification length of the DNA amplification product, The method according to claim 4, comprising determining that the chestnut plant is easily peeled when the amplification length of the DNA amplification product is identical in both of a pair of homologous chromosomes compared to a variety that is easily peeled.

8. A method for producing a chestnut plant, comprising determining astringent peeling property by the method according to any one of claims 1 to 3.

9. A method for producing a chestnut plant, comprising determining whether the plant has astringent skin peeling property by the method according to claim 4.

10. A primer set for determining the peeling ability of chestnut plants, for detecting the length of a DNA region amplified by PCR using a primer consisting of the base sequence of sequence number 1 and a primer consisting of the base sequence of sequence number 2.

11. The primer set according to claim 10, comprising a primer consisting of nucleotides having a base sequence having 90% or more sequence identity with SEQ ID NO: 1, and a primer consisting of nucleotides having a base sequence having 90% or more sequence identity with SEQ ID NO:

2.

12. A chestnut plant obtainable by the method according to claim 9.

13. A fruit or seed obtained from the Chestnut plant according to claim 12.

14. A method for producing a chestnut plant having an easily peelable astringent property, comprising the steps of: A step of crossbreeding an easily peelable chestnut plant with an easily peelable chestnut plant or a difficult to peel chestnut plant; A step of selecting a Chestnut plant determined to be easily peeled by the method according to any one of claims 1 to 3 from the progeny plants; The method includes:

15. A method for obtaining fruits or seeds from a Chestnut plant produced by the method of claim 14.