Therapeutic drug for myotonic dystrophy type 1

Abstract

To provide a pharmaceutical composition or a method that is effective for treating myotonic dystrophy type 1 (DM1).SOLUTION: Provided is a therapeutic drug or a method for DM1 that utilizes a modified PPR protein.SELECTED DRAWING: Figure 2

Description

[Technical field]

[0001] The present invention relates to a pharmaceutical composition or method for treating myotonic dystrophy type 1. [Background technology]

[0002] Myotonic dystrophy type I (DM1) is the most common muscle disease in adults. DM1 is an autosomal dominant multisystem disorder that affects skeletal and smooth muscles as well as the eyes, heart, endocrine system, and central nervous system, and its symptoms are diverse, including muscle atrophy, muscle weakness, myotonia, cataracts, insulin resistance, hypogonadism, cardiac conduction disorders, anterior baldness, and intellectual disability. DM1 is caused by an abnormal expansion of the CTG repeat sequence in the 3'UTR (3' untranslated region) of the myotonin protein kinase (DMPK) gene. A specific splicing regulator binds to the transcript (mRNA) with the abnormally expanded CUG repeat sequence, resulting in a lack of splicing regulators required for normal splicing, causing splicing abnormalities.

[0003] Currently, development of drugs for treating DM1 is being advanced using various approaches, such as small molecular weight compounds and nucleic acid drugs (e.g., Non-Patent Documents 1 and 2). However, at this stage, there is no fundamental cure, and treatment for DM1 remains limited to symptomatic treatment. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Nakamori et al. Ann Clin Transl Neurol. (2015) [Non-Patent Document 2] Overby et al. Drug Discov. Today (2018) Summary of the Invention [Problem to be solved by the invention]

[0005] An objective of the present invention is to provide a pharmaceutical composition or method effective for treating myotonic dystrophy type 1 (DM1). [Means for solving the problem]

[0006] Pentatricopeptide repeat (PPR) proteins are proteins that contain repeated PPR motifs consisting of approximately 35 amino acids in length, and each PPR motif is known to bind specifically or selectively to one base. In recent years, the amino acids that function when the PPR motif exerts its RNA binding properties have been identified, and the relationship between the structure of the PPR motif and the target base has been clarified, leading to the development of RNA editing / modification technologies using PPR proteins (e.g., WO2013 / 058404).

[0007] As a result of searching for novel compounds or substances that can treat DM1, the present inventors discovered that DM1 can be treated by utilizing modified PPR proteins.

[0008] The present invention is based on the above findings and may have the following features.

[0009] [1]: A pharmaceutical composition for treating myotonic dystrophy type 1, comprising: The pharmaceutical composition comprises a nucleic acid encoding a protein that specifically binds to a CUG repeat sequence, The protein that specifically binds to the CUG repeat sequence contains at least six pentatricopeptide repeat (PPR) motifs consisting of a 30-38 amino acid long polypeptide represented by formula 1, [ka] (In formula 1: Helix A is a 12 amino acid long portion capable of forming an α-helical structure and is represented by formula 2: [ka] In formula 2, A1~A 12 each independently represents an amino acid; X is absent or a moiety consisting of 1 to 9 amino acids in length; Helix B is a portion that can form an α-helical structure and is 11 to 13 amino acids long; L is a moiety represented by formula 3 that is 2 to 7 amino acids in length; [ka] In formula 3, each amino acid is numbered from the C-terminus as "i"(-1), "ii"(-2), etc. However, L iii ~L vii may not exist.) A1, A4, and L in each of the PPR motifs ii A combination of three amino acids, or A4, L ii The combination of these two amino acids is selected such that each of the PPR motifs binds to C, U or G, thereby configuring the protein to specifically bind to the CUG repeat sequence. Pharmaceutical compositions.

[0010] [2]: The pharmaceutical composition according to [1], wherein the protein that specifically binds to the CUG repeat sequence contains 9 to 30 of the PPR motifs. Pharmaceutical compositions.

[0011] [3]: The pharmaceutical composition according to [2], wherein the protein that specifically binds to the CUG repeat sequence contains 12 to 24 of the PPR motifs. Pharmaceutical compositions.

[0012] [4]: The pharmaceutical composition according to any one of [1] to [3], wherein A1, A4, and L in each of the PPR motifs are ii The combination of three amino acids is: When the target base of the PPR motif is A (adenine), A1, A4, and L iiThe combination of three amino acids is (A1, A4, L ii ), in the order of (valine, threonine, asparagine), (phenylalanine, serine, asparagine), (phenylalanine, threonine, asparagine), (isoleucine, asparagine, aspartic acid), or (threonine, threonine, asparagine); When the target base of the PPR motif is G (guanine), A1, A4, and L ii The combination of three amino acids is (A1, A4, L ii ), in the order of (glutamic acid, glycine, aspartic acid), (valine, threonine, aspartic acid), (lysine, threonine, aspartic acid), or (leucine, threonine, aspartic acid); When the target base of the PPR motif is U (uracil), A1, A4, and L ii The combination of three amino acids is (A1, A4, L ii ), in the order of (valine, asparagine, aspartic acid), (isoleucine, asparagine, asparagine), (isoleucine, asparagine, aspartic acid), (isoleucine, methionine, aspartic acid), (phenylalanine, proline, aspartic acid), or (tyrosine, proline, aspartic acid); or When the target base of the PPR motif is C (cytosine), A1, A4, and L ii The combination of three amino acids is (A1, A4, L ii ), in the order of (valine, asparagine, asparagine), (isoleucine, asparagine, asparagine), (valine, asparagine, serine), or (isoleucine, methionine, aspartic acid); Pharmaceutical compositions.

[0013] [5]: The pharmaceutical composition according to any one of [1] to [3], ii The combination of two amino acids is: When the target base of the PPR motif is A (adenine), A4 and Lii The combination of the two amino acids is (A4, L ii ), in that order: (threonine, asparagine), (serine, asparagine), or (glycine, asparagine); When the target base of the PPR motif is G (guanine), A4 and L ii The combination of the two amino acids is (A4, L ii ) in that order, (threonine, aspartic acid) or (glycine, aspartic acid); When the base targeted by the PPR motif is U (uracil), A4 and L ii The combination of the two amino acids is (A4, L ii ), in the order of (asparagine, aspartic acid), (proline, aspartic acid), (methionine, aspartic acid), or (valine, threonine); When the target base of the PPR motif is C (cytosine), A4 and L ii The combination of the two amino acids is (A4, L ii ), in that order: (asparagine, asparagine), (asparagine, serine), or (leucine, aspartic acid), Pharmaceutical compositions.

[0014] [6]: The pharmaceutical composition according to any one of [1] to [5], A nucleic acid encoding a protein that specifically binds to the CUG repeat sequence is incorporated into an expression vector. Pharmaceutical compositions.

[0015] [7]: The pharmaceutical composition according to any one of [1] to [5], A nucleic acid encoding a protein that specifically binds to the CUG repeat sequence is incorporated into a viral vector. Pharmaceutical compositions.

[0016] [8]: The pharmaceutical composition according to [7], The viral vector is a viral vector having tropism for muscle tissue. Pharmaceutical compositions.

[0017] [9]: The pharmaceutical composition according to [8], The viral vector is an adeno-associated viral (AAV) vector, an adenoviral vector, a retroviral vector, a lentiviral vector, or a herpes simplex viral vector. Pharmaceutical compositions.

[0018]

[10] : The pharmaceutical composition according to [9], The viral vector is an AAV vector. Pharmaceutical compositions.

[0019]

[11] : The pharmaceutical composition according to

[10] , The AAV vector is an AAV1 vector, an AAV2 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or an AAV12 vector. Pharmaceutical compositions.

[0020]

[12] : An expression vector comprising a nucleic acid encoding a protein that specifically binds to the CUG repeat sequence defined in [1].

[0021]

[13] : A cell comprising the expression vector described in

[12] .

[0022]

[14] : A protein that specifically binds to the CUG repeat sequence, produced by the cells described in

[13] .

[0023]

[15] : A viral expression vector comprising a nucleic acid encoding a protein that specifically binds to the CUG repeat sequence defined in [1].

[0024]

[16] : A cell comprising the viral expression vector described in

[15] .

[0025]

[17] : A viral vector produced from the cell described in

[16] .

[0026]

[18] : Use of a nucleic acid encoding a protein that specifically binds to the CUG repeat sequence defined in [1] in the manufacture of a medicament for the treatment of myotonic dystrophy type 1.

[0027]

[19] : A method for treating myotonic dystrophy type 1, comprising: The method comprises administering to a subject a therapeutically effective amount of the pharmaceutical composition according to [1]. method.

[0028] It should be noted that the scope of the present invention also includes inventions that combine one or more of the above features in any desired manner. Effect of the Invention

[0029] The present invention may treat or alleviate the symptoms of myotonic dystrophy type 1 (DM1). [Brief description of the drawings]

[0030] [Figure 1] FIG. 1 shows that the PPR protein of the present invention specifically bound to the CUG repeat sequence. [Diagram 2] FIG. 2 shows that the PPR protein of the present invention suppressed the formation of RNA-foci in DM1 model cells. [Diagram 3] FIG. 3 shows that the PPR protein of the present invention improved splicing abnormalities in DM1 model cells. [Figure 4] FIG. 4 shows that the PPR protein of the present invention improved muscle differentiation efficiency in DM1 model animals. [Diagram 5] FIG. 5 shows that the PPR protein of the present invention suppressed the formation of RNA-foci in DM1 model animals. [Figure 6]FIG. 6 shows that the PPR protein of the present invention improved splicing abnormalities in DM1 model animals. [Figure 7] FIG. 7 shows that the PPR protein of the present invention improved myotonia in DM1 model animals. [Figure 8] FIG. 8 shows the relationship between the improving effect of abnormal splicing and the improving effect of myotonia according to the present invention. [Figure 9] Figure 9 shows that AAV9-CUG-PPR1 dose-dependently suppressed the formation of RNA-foci in DM1 model animals. In the figure, "Ctrl" indicates the PBS-administered group, "LD" indicates the low-dose AAV9-CUG-PPR1-administered group, "MD" indicates the medium-dose AAV9-CUG-PPR1-administered group, and "HD" indicates the high-dose AAV9-CUG-PPR1-administered group. The vertical axis indicates the rate of RNA-foci positive cells. [Figure 10] Figure 10 shows that AAV9-CUG-PPR1 improved splicing abnormalities in a dose-dependent manner in DM1 model animals. The left figure shows the results of the abnormal splicing detection system for Clcn1, and the right figure shows the results of the abnormal splicing detection system for Atp2a1. In the figure, "Ctrl" indicates the PBS administration group, "LD" indicates the low dose administration group for AAV9-CUG-PPR1, "MD" indicates the medium dose administration group for AAV9-CUG-PPR1, and "HD" indicates the high dose administration group for AAV9-CUG-PPR1. The vertical axis indicates the content (%) of normal splicing isoforms in each case. [Figure 11] Figure 11 shows that AAV9-CUG-PPR1 improved myotonia in a dose-dependent manner in DM1 model animals. The vertical axis indicates myotonia score, with the frequency of myotonic discharge decreasing in the order of scores 3, 2, 1, and 0. The frequency and severity of myotonic discharges are correlated. In the figure, "Ctrl" indicates the PBS-administered group, "LD" indicates the low-dose AAV9-CUG-PPR1-administered group, "MD" indicates the medium-dose AAV9-CUG-PPR1-administered group, and "HD" indicates the high-dose AAV9-CUG-PPR1-administered group. [Figure 12]Figure 12 shows the relationship between the dose of AAV9-CUG-PPR1 administered and the amount of PPR mRNA expression. GAPDH was used as an internal standard. Each individual point indicates the amount of PPR mRNA expression in the thigh muscle of each mouse. The vertical axis is displayed in Log format. In the figure, "Ctrl" indicates the PBS-administered group, "LD" indicates the low-dose AAV9-CUG-PPR1-administered group, "MD" indicates the medium-dose AAV9-CUG-PPR1-administered group, and "HD" indicates the high-dose AAV9-CUG-PPR1-administered group. [Figure 13] Figure 13 shows that AAV9-CUG-PPR1 suppressed the formation of RNA-foci in a time-dependent manner in DM1 model animals. In the figure, "Ctrl" indicates the PBS administration group. "2w", "4w", "8w", and "16w" indicate the test periods after AAV9-CUG-PPR1 administration, respectively. The vertical axis indicates the rate of RNA-foci positive cells. [Figure 14] Figure 14 shows that AAV9-CUG-PPR1 improved splicing abnormalities in a time-dependent manner in DM1 model animals. The left panel shows the results of the Clcn1 abnormal splicing detection system, and the right panel shows the results of the Atp2a1 abnormal splicing detection system. In the figure, "Ctrl" indicates the PBS administration group. "2w," "4w," "8w," and "16w" respectively indicate the test periods after AAV9-CUG-PPR1 administration. The vertical axis indicates the content of normal splicing isoforms. [Figure 15] Figure 15 shows that AAV9-CUG-PPR1 improved myotonia in a time-dependent manner in DM1 model animals. The vertical axis indicates myotonia score, with the frequency of myotonic discharge decreasing in the order of scores 3, 2, 1, and 0. The frequency and severity of myotonic discharges are correlated. In the figure, "Ctrl" indicates the PBS administration group. "2w", "4w", "8w", and "16w" indicate the test periods after AAV9-CUG-PPR1 administration, respectively. [Figure 16]Figure 16 shows that splicing abnormalities are comprehensively normalized after administration of AAV9-CUG-PPR1. Figure 16a shows how splicing events (left) with a change in PSI (Percent spliced ​​in) of 0.2 or more between WT and PBS-administered HSA-LR mice changed in PPR-administered HSA-LR mice (right). Figure 16b shows changes in DM1-related splicing events identified in Tanner et al. (2021). Black circles indicate signals from normal mice, blue squares indicate signals from PBS-administered drug-effect mice, and red triangles indicate signals from PPR-administered drug-effect mice. Figure 16c shows the results of gene ontology analysis for the genes at each point in Figure a. P-value indicates the P value of each gene ontology term. In PPR-administered HSA-LR mice, the number of genes in three stages with exon skipping improvement rates of more than 50%, 20 to 50%, and less than 20% is shown. [Figure 17] Figure 17 shows the PPR mRNA expression level in each organ of mice administered AAV9-CUG-PPR1. The vertical axis shows the relative expression level in Log format when the expression level of mice administered 1 x 1013 vg / kg is set to 1. GAPDH mRNA expression level is used as the internal standard. The horizontal axis shows the AAV9-CUG-PPR1 administration dose (vg / kg mouse body weight). The values ​​for each individual mouse are plotted as circles, and the medians are connected by a line. [Figure 18] Figure 18 shows the persistence of mRNA expression in each organ of mice administered AAV9-CUG-PPR1. The vertical axis shows the relative expression level when the expression level of one mouse 2 weeks after AAV administration (Day 14) is set to 1. GAPDH mRNA expression level is used as the internal standard. On the horizontal axis, "Ctrl" indicates the PBS group, and "14", "28", "56", "112", and "183" indicate the number of days after administration. The values ​​for each individual mouse are plotted as circles, and the average values ​​are connected with a line. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] [PPR motifs and PPR proteins] In the present disclosure, the term "PPR motif" refers to a polypeptide consisting of 30 to 38 amino acids, with an amino acid sequence in which the E value obtained for PF01535 in Pfam and PS51375 in Prosite is equal to or less than a predetermined value (preferably E-03) when the amino acid sequence is analyzed using a protein domain search program on the Web, unless otherwise specified. The position number of the amino acid constituting the PPR motif defined in the present disclosure is almost synonymous with PF01535, but corresponds to the number obtained by subtracting 2 from the position of the amino acid in PS51375 (e.g., from No. 1 of the present invention to No. 3 in PS51375). However, when referring to the amino acid at No. "ii" (-2), it refers to the second amino acid from the end (C-terminal side) of the amino acid constituting the PPR motif, or the amino acid two amino acids N-terminal to the No. 1 amino acid of the next PPR motif, i.e., the -2 amino acid. When the next PPR motif is not clearly identified, the amino acid two amino acids before the first amino acid of the next helix structure is designated as "ii".

[0032] The conserved amino acid sequence of the PPR motif is not highly conserved at the amino acid level, but the two α-helices in the secondary structure are well conserved. A typical PPR motif consists of 35 amino acids, but its length varies from 30 to 38 amino acids.

[0033] The basic structure of the PPR motif is known to be represented by formula 1.

[0034] [ka] (In the formula: Helix A is a 12 amino acid long portion capable of forming an α-helical structure and is represented by formula 2:

[0035] [ka] In formula 2, A1~A 12 each independently represents an amino acid; X is absent or a moiety consisting of 1 to 9 amino acids in length; Helix B is a portion that can form an α-helical structure and is 11 to 13 amino acids long; L is a moiety represented by formula 3 that is 2 to 7 amino acids in length;

[0036] [ka] In formula 3, each amino acid is numbered from the C-terminus as "i"(-1), "ii"(-2), etc. However, L iii ~L vii may not exist.

[0037] In this disclosure, the term "PPR protein" refers to a PPR protein having one or more, preferably two or more, of the above-mentioned PPR motifs, unless otherwise specified. In this disclosure, the term "protein" refers to a substance consisting of a polypeptide (a chain of multiple amino acids bonded by peptide bonds) in general, unless otherwise specified, and includes those consisting of relatively low molecular weight polypeptides. In the present invention, the term "amino acid" may refer to a normal amino acid molecule, as well as to an amino acid residue constituting a peptide chain. It will be clear to one of ordinary skill in the art from the context which is being referred to.

[0038] In the present disclosure, the term "selective" or "specific" with respect to the binding of a PPR motif to an RNA base means that the binding activity to one of the RNA bases is higher than the binding activity to the other bases, unless otherwise specified. This selectivity or specificity can be confirmed by a person skilled in the art by designing an experiment based on a known method, or can be calculated by a person skilled in the art.

[0039] In this disclosure, unless otherwise specified, the term "RNA base" refers to the base of a ribonucleotide constituting RNA, specifically, any of adenine (A), guanine (G), cytosine (C), or uracil (U). Note that although PPR proteins may have selectivity for bases in RNA, they do not bind to nucleic acid monomers.

[0040] PPR proteins are abundant in plants, with 500 proteins and approximately 5,000 motifs found in Arabidopsis thaliana. Many land plants, such as rice, poplar, and Selaginella, also have PPR motifs and PPR proteins with diverse amino acid sequences. In the present invention, PPR motifs and PPR proteins present in nature may be used, or PPR motifs and PPR proteins designed based on the method disclosed in WO2013 / 058404, for example, may be used. Specifically, a desired PPR motif and PPR protein can be designed based on the following information disclosed in WO2013 / 058404.

[0041] (I) Information on the positions of amino acids important for selective binding The combination of three amino acids at positions 1, 4, and “ii” (-2) of the PPR motif (A1, A4, L ii ), or a combination of two amino acids at positions 4, “ii”(−2) (A4, L ii ) are important for selective binding to RNA bases, and the combination of these determines which RNA base will bind.

[0042] The present invention relates to A1, A4, and L disclosed in WO2013 / 058404. ii and / or A4, and L ii The knowledge of the combination of the two amino acids can be utilized.

[0043] (II)A 1 、A 4 , and information on the correspondence between the three amino acid combinations of Lii and RNA bases (3-1) A1, A4, and L iiWhen the combination of these three amino acids is, in order, valine, asparagine, and aspartic acid, the PPR motif has selective RNA base binding ability, binding strongly to U, then to C, and then to A or G. (3-2) A1, A4, and L ii When the three amino acid combinations are, in order, valine, threonine, and asparagine, the PPR motif has selective RNA base-binding ability, binding strongly to A, then to G, then to C, but not to U. (3-3) A1, A4, and L ii When the combination of these three amino acids is, in order, valine, asparagine, asparagine, the PPR motif has selective RNA base binding ability, binding strongly to C, then to A or U, but not to G. (3-4) A1, A4, and L ii When the combination of these three amino acids is, in order, glutamic acid, glycine, and aspartic acid, the PPR motif has selective RNA base-binding ability, binding strongly to G but not to A, U, or C. (3-5) A1, A4, and L ii When the combination of these three amino acids is, in order, isoleucine, asparagine, asparagine, the PPR motif has selective RNA base-binding ability, binding strongly to C, then to U, then to A, but not to G. (3-6) A1, A4, and L ii When the combination of these three amino acids is, in order, valine, threonine, and aspartic acid, the PPR motif has selective RNA base-binding ability, binding strongly to G, then to U, but not to A or C. (3-7) A1, A4, and L ii When the combination of these three amino acids is, in order, lysine, threonine, and aspartic acid, the PPR motif has selective RNA base-binding ability, binding strongly to G, then to A, but not to U or C. (3-8) A1, A4, and Lii When the combination of these three amino acids is, in order, phenylalanine, serine, and asparagine, the PPR motif has selective RNA base-binding ability, binding strongly to A, then to C, and then to G and U. (3-9) A1, A4, and L ii When the combination of these three amino acids is, in order, valine, asparagine, and serine, the PPR motif has selective RNA base-binding ability, binding strongly to C, then to U, but not to A or G. (3-10) A1, A4, and L ii When the combination of these three amino acids is, in order, phenylalanine, threonine, and asparagine, the PPR motif has selective RNA base binding ability, binding strongly to A but not to G, U, or C. (3-11) A1, A4, and L ii When the combination of these three amino acids is, in order, isoleucine, asparagine, and aspartic acid, the PPR motif has selective RNA base-binding ability, binding strongly to U, then to A, but not to G or C. (3-12) A1, A4, and L ii When the combination of these three amino acids is, in order, threonine, threonine, and asparagine, the PPR motif has selective RNA base binding ability, binding strongly to A but not to G, U, or C. (3-13) A1, A4, and L ii When the combination of these three amino acids is, in order, isoleucine, methionine, and aspartic acid, the PPR motif has selective RNA base-binding ability, binding strongly to U, then to C, but not to A or G. (3-14) A1, A4, and L ii When the three amino acid combinations are, in order, phenylalanine, proline, and aspartic acid, the motif is called PPR, and has selective RNA base-binding ability, binding strongly to U, followed by C, but not A or G. (3-15) A1, A4, and L ii When the combination of these three amino acids is, in that order, tyrosine, proline, and aspartic acid, the PPR motif has selective RNA base-binding ability, binding strongly to U but not to A, G, or C. (3-16) A1, A4, and L ii When the combination of these three amino acids is, in order, leucine, threonine, and aspartic acid, the PPR motif has selective RNA base binding ability, binding strongly to G but not to A, U, or C.

[0044] (II)A 4 , and L ii Information on the correspondence between the combination of two amino acids and the RNA bases (2-1) A4, L ii However, in the case of asparagine and aspartic acid, respectively, the PPR motif has selective RNA base binding ability, binding strongly to U, then C, and then A and G. (2-2) A4, L ii However, in the case of asparagine, the PPR motif has selective RNA base binding ability, binding strongly to C, then U, and then A and G. (2-3) A4, L ii However, in the case of threonine and asparagine, respectively, the PPR motif has selective RNA base binding ability, binding strongly to A, followed by weaker binding to G, U and C. (2-4) A4, L ii However, in the case of threonine and aspartic acid, respectively, the PPR motif has selective RNA base binding ability, binding strongly to G, followed by weaker binding to A, U and C. (2-5) A4, L ii However, in the case of serine and asparagine, respectively, the PPR motif has selective RNA base binding ability, binding strongly to A, followed by binding to G, U and C. (2-6) A4, L iiHowever, in the case of glycine and aspartic acid, respectively, the PPR motif has selective RNA base binding ability, binding strongly to G, then U, then A, but not to C. (2-7) A4, L ii However, in the case of asparagine and serine, respectively, the PPR motif has selective RNA base binding ability, binding strongly to C, then U, and then A and G. (2-8) A4, L ii However, in the case of proline and aspartic acid, respectively, the PPR motif has selective RNA base binding ability, binding strongly to U, followed by G, C and C, but not A. (2-9) A4, L ii However, in the case of glycine and asparagine, respectively, the PPR motif has selective RNA base binding ability, binding strongly to A, then to G, but not to C or U. (2-10) A4, L ii However, in the case of methionine and aspartic acid, respectively, the PPR motif has selective RNA base binding ability, binding strongly to U, followed by weaker binding to A, G, and C. (2-11) A4, L ii However, in the case of leucine and aspartic acid, respectively, the PPR motif has selective RNA base binding ability, binding strongly to C, then to U, but not to A or G. (2-12) A4, L ii However, in the case of valine and threonine, respectively, the PPR motif has selective RNA base binding ability, binding strongly to U, then to A, but not to G or C.

[0045] The above rule applies to the PPR motif (A1, A4, L ii ) or (A4, L iiThis means that the combination of amino acids in the above sequence can statistically significantly increase the possibility that the PPR motif binds to the target base, and does not mean that a PPR motif (or PPR protein) that binds to the target base (or base sequence) with 100% probability can be produced by the above rules. However, a person skilled in the art can obtain a PPR motif (or PPR protein) that binds to the target base (or base sequence) with a high probability by producing several to several tens of candidate PPR proteins based on the above rules. Note that the selection of a desired PPR protein through the production and confirmation of candidate PPR proteins can be performed by a person skilled in the art within the scope of normal trial and error, and does not impose an excessive burden on the person skilled in the art.

[0046] [Utilization of PPR motifs and PPR proteins] One PPR motif can recognize a specific base of RNA. According to the present invention, by appropriately selecting amino acids at specific positions, PPR motifs selective for A, U, G, and C can be selected or designed. Furthermore, a protein containing an appropriate sequence of such PPR motifs can specifically or selectively recognize the corresponding base sequence. Furthermore, based on the above-mentioned findings, a PPR motif capable of selectively binding to a desired RNA base, and a protein having a plurality of PPR motifs capable of sequence-specifically binding to a desired RNA can be designed. In designing, the portion other than the amino acid at the important position in the PPR motif may be referred to the sequence information of the natural PPR motif. Alternatively, the natural PPR motif may be used as a whole, and only the amino acid at the important position may be replaced to design. The number of repetitions of the PPR motif can be appropriately determined depending on the target sequence, and can be, for example, 2 or more, and can be 2 to 30.

[0047] [PPR protein that specifically binds to CUG repeat sequences] The present invention relates to a PPR protein that specifically binds to mRNA containing an abnormally expanded CUG repeat sequence that causes DM1. Based on the above-mentioned theory, the PPR protein according to the present invention can be prepared by linking multiple sets of [PPR motif that binds to C, PPR motif that binds to U, and PPR motif that binds to G]. The first PPR motif of the PPR protein according to the present invention does not necessarily have to be a PPR motif that binds to C, and as long as the PPR protein as a whole specifically binds to a CUG repeat sequence, the first PPR motif may be a PPR motif that binds to U or a PPR motif that binds to G. Furthermore, it goes without saying that as long as the PPR protein according to the present invention as a whole is configured to specifically bind to a CUG repeat sequence, the number of PPR motifs contained in the PPR protein does not have to be a multiple of three.

[0048] A non-limiting example of a C-binding PPR motif that may be used in the present invention is a PPR motif having the following sequence:

[0049] JPEG2024069430000008.jpg29166

[0050] In the present invention, A1, A4, L ii amino acid at position A4, L ii A PPR motif having sequence homology (or sequence identity) of 80% or more (preferably, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more) with the above sequence and having binding ability to C may be used, provided that the amino acids at the positions are conserved.

[0051] In the present invention, A1, A4, L ii amino acid at position A4, L iiA PPR motif having a substitution, addition, and / or deletion of up to 7 bases (i.e., 1, 2, 3, 4, 5, 6, or 7 bases) with respect to the above sequence and having binding ability to C may be used, provided that the amino acids at the positions are conserved. The amino acid substitution may be, for example, a conservative substitution of an amino acid known in the art.

[0052] A non-limiting example of a U-binding PPR motif that may be used in the present invention is a PPR motif having the following sequence:

[0053] JPEG2024069430000009.jpg15166

[0054] In the present invention, A1, A4, L ii amino acid at position A4, L ii A PPR motif having sequence homology (or sequence identity) of 80% or more (preferably, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more) with the above sequence and having binding ability to U may be used, provided that the amino acids at the positions are conserved.

[0055] In the present invention, A1, A4, L ii amino acid at position A4, L ii A PPR motif having a substitution, addition, and / or deletion of up to 7 bases (i.e., 1, 2, 3, 4, 5, 6, or 7 bases) with respect to the above sequence and having binding ability to U may be used, provided that the amino acids at the positions are conserved. The amino acid substitution may be, for example, a conservative substitution of an amino acid known in the art.

[0056] A non-limiting example of a G-binding PPR motif that may be used in the present invention is a PPR motif having the following sequence:

[0057] JPEG2024069430000010.jpg27166

[0058] In the present invention, A1, A4, L ii amino acid at position A4, L ii A PPR motif having sequence homology (or sequence identity) of 80% or more (preferably, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more) with the above sequence and having binding ability to G, provided that the amino acids at the positions are conserved, may be used.

[0059] In the present invention, A1, A4, L ii amino acid at position A4, L ii A PPR motif having a substitution, addition, and / or deletion of up to 7 bases (i.e., 1, 2, 3, 4, 5, 6, or 7 bases) with respect to the above sequence and having binding ability to G may be used, provided that the amino acids at the positions are conserved. The amino acid substitution may be, for example, a conservative substitution of an amino acid known in the art.

[0060] In the present invention, when the term "identity" is used with respect to a base sequence (sometimes called a nucleotide sequence) or an amino acid sequence, it means the percentage of the number of matching bases or amino acids shared between the two sequences when the two sequences are aligned in an optimal manner, unless otherwise specified. In other words, it can be calculated as follows: identity = (number of matching positions / total number of positions) x 100, and can be calculated using an algorithm that is distributed for a fee or free of charge. In addition, such an algorithm is incorporated in, for example, the NBLAST and XBLAST programs described in Altschul et al., J. Mol. Biol. 215 (1990) 403-410. More specifically, searches and analyses regarding the identity of base sequences or amino acid sequences can be performed using algorithms or programs (e.g., BLASTN, BLASTP, BLASTX, ClustalW) well known to those skilled in the art. When using a program, parameters can be appropriately set by those skilled in the art, and the default parameters of each program may be used. Specific techniques for these analysis methods are also well known to those skilled in the art.

[0061] Conservative substitution of an amino acid may be, for example, substitution with an amino acid having similar properties. Amino acids having similar properties refer to amino acids having similar physical properties such as hydropathy, charge, pKa, solubility, etc., such as the following: Hydrophobic amino acids; alanine, valine, glycine, isoleucine, leucine, phenylalanine, proline, tryptophan, tyrosine; Non-hydrophobic amino acids; arginine, asparagine, aspartic acid, glutamic acid, glutamine, lysine, serine, threonine, cysteine, histidine; Hydrophilic amino acids; arginine, asparagine, aspartic acid, glutamic acid, glutamine, lysine, serine, threonine; · Acidic amino acids: aspartic acid, glutamic acid; · Basic amino acids: lysine, arginine, histidine; Neutral amino acids: alanine, asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine; · Sulfur-containing amino acids: methionine, cysteine; Aromatic ring-containing amino acids: tyrosine, tryptophan, phenylalanine.

[0062] [Treatment of DM1 according to the present invention] The effect of the present invention is exerted by the binding of the PPR protein of the present invention to mRNA containing an abnormally expanded CUG repeat sequence in the cells of a subject. The means of delivering the PPR protein into the cells of a subject is not limited, and a nucleic acid encoding the PPR protein of the present invention may be delivered into the cells of a subject to express the PPR protein of the present invention in the cells of a subject, or the PPR protein of the present invention itself may be delivered into the cells of a subject. The means of delivering proteins or nucleic acids is not limited, and various means known in the art can be used. Non-limiting examples of the means of delivering nucleic acids or proteins into the cells of a subject that can be used in the present invention include liposomes, lipid nanoparticles (LNPs), polymer micelles, emulsions, polymer microcapsules, antibody-nucleic acid complexes, antibody-drug complexes, viruses, and the like.

[0063] Non-limiting examples of viral vectors that may be used in the present invention include adeno-associated viral (AAV) vectors, adenoviral vectors, retroviral vectors, lentiviral vectors, and herpes simplex viral vectors. Those skilled in the art can select an appropriate vector depending on the tropism to cells or tissues, the need for nucleic acid integration into the host genome, etc.

[0064] AAV vectors are particularly suitable for use in the present invention because they have the ability to infect both dividing and quiescent cells and can transfer genetic material to a wide variety of cell types. Twelve serotypes of AAV (AAV1 to AAV12) have been reported to date, and all of the known serotypes can infect various types of tissue cells. The serotype of the AAV vector that may be used in the present invention is not limited, and may be, for example, an AAV1 vector, an AAV2 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or an AAV12 vector, which are known to have tropism for muscle tissue (skeletal muscle, cardiac muscle, and / or smooth muscle).

[0065] Treatment of DM1 using the present invention may be in an in vivo form in which the present invention is directly applied to the living body of a subject suffering from DM1, or in an ex vivo form in which the present invention is used to treat cells or tissues outside the body and then introduced into the living body of a subject.

[0066] There are no limitations on the method for producing an expression vector containing a nucleic acid encoding the PPR protein of the present invention, and it can be produced by a person skilled in the art using standard methods (e.g., using a commercially available protein expression vector production kit, using a commercially available virus expression vector production kit, entrusting the production to a manufacturer, etc.).

[0067] There are no limitations on the method for producing the PPR protein of the present invention, but for example, the desired PPR protein can be obtained by selectively extracting and / or purifying the PPR protein by conventional methods from cells (e.g., animal cells, plant cells, Escherichia coli, yeast, etc.) containing an expression vector (e.g., a plasmid, transposon, virus, etc.) that encodes a PPR protein designed by the method described herein.

[0068] The terms used in this specification, unless otherwise defined, are used to describe particular embodiments and are not intended to limit the invention.

[0069] Furthermore, the term "comprise" as used in this specification intends that the described items (components, steps, elements, numbers, etc.) are present, unless the context clearly indicates otherwise, and does not exclude the presence of other items (components, steps, elements, numbers, etc.).

[0070] Unless otherwise defined, all terms used herein (including technical and scientific terms) have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. Terms used herein should be interpreted as having a meaning consistent with the meaning in the present specification and related technical fields, and should not be interpreted in an idealized or overly formal sense, unless otherwise defined.

[0071] In the following, the present invention will be described in more detail with reference to examples. However, the present invention can be embodied in various forms and should not be construed as being limited to the examples set forth herein. EXAMPLES

[0072] [Example 1: Preparation of PPR protein that binds to CUG repeat RNA sequence and analysis of binding to RNA]

[0073] To generate a PPR protein that binds to the CUG repeat RNA sequence (hereafter abbreviated as CUG-PPR), and to analyze its binding, we generated a recombinant protein and performed an RNA binding experiment.

[0074] <Experimental Materials and Methods> (1) Preparation of PPR expression plasmid vector A gene fused with luciferase, PPR protein, and 3x hexahistidine tag in this order was cloned into the multiple cloning site of the E. coli expression plasmid vector pET-22b. Expression of the fusion gene is controlled by the T7 promoter. Cloning of the gene of the correct size was confirmed by PCR, and the gene sequence was confirmed by sequencing (SEQ ID NOs: 11 to 14). These were named Luc-CUG-PPR1, Luc-CUG-PPR2, Luc-CUG-PPR3, and Luc-CUG-PPR4 and used in the following tests.

[0075] [Table 1] JPEG2024069430000012.jpg210166

[0076] The detailed sequences of the PPR motifs contained in the PPR proteins in Table 1 above are shown below. Each PPR protein contains 18 PPR motifs. [Table 2] [Table 3] [Table 4] [Table 5]

[0077] (2) Preparation of PPR proteins The expression plasmid vector constructed above was introduced into Escherichia coli Rosetta (DE3) strain. This Escherichia coli was cultured in 2 mL of LB medium containing 100 μg / μL ampicillin at 37°C for 12 hours. OD 600 When the pH reached 0.5 to 0.8, the culture was transferred to a 15°C incubator and left to stand for 30 minutes. Then, 100μL (final concentration 0.1mM IPTG) was added and cultured at 15°C for 16 hours. Centrifugation was performed at 5,000×g, 4°C, for 10 minutes to collect the E. coli pellet, and 1.5mL of lysis buffer (20mM Tris-HCl, pH 8.0, 150mM NaCl, 0.5% NP-40, 1mM MgCl2, 2mg / ml lysozyme, 1mM PMSF, 2μl of DNase) was added and frozen at -80°C for 20 minutes. The cells were frozen and crushed with shaking at 25°C for 30 minutes. Then, centrifugation was performed at 3700rpm, 4°C, for 15 minutes to collect the supernatant (E. coli lysate) containing soluble PPR protein, which was used in the following experiments.

[0078] (3) Binding test of PPR protein to RNA The binding test between PPR protein and RNA was carried out using a method for binding experiments between PPR protein and biotinylated RNA on a streptavidin plate. CUGCUGCUGCUGCUGCUGCUGAUGCA (SEQ ID NO: 15)), and a non-target 30-base RNA containing CAGx6 (GACAUGC CAGCAGCAGCAGCAGCAG RNA probes modified with biotin at the 5' end were synthesized for GACUG (SEQ ID NO: 16) (requested from Greiner). 2.5 pmol of biotinylated RNA probe was added to a streptavidin-coated plate (Cat No. 15502, Thermo Fisher) and reacted for 30 minutes at room temperature. The plate was washed with probe washing buffer (20 mM Tris-HCl (pH 7.6), 150 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, 0.1% BSA). For background measurement, wells were also prepared to which dissolution buffer was added without biotinylated RNA (referred to as "-Probe"). Thereafter, blocking buffer (20 mM Tris-HCl (pH 7.6), 150 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, 1% BSA) was added, and the plate surface was blocked at room temperature for 30 minutes. 8 100μL of E. coli lysate containing luciferase-fused PPR protein with LU / μL luminescence was added to the wells, and the binding reaction was carried out at room temperature for 30 minutes. The wells were washed five times with 200μL of washing buffer (20mM Tris-HCl (pH7.6), 150mM NaCl, 5mM MgCl2, 0.5% NP-40, 1mM DTT), and 40μL of luciferase substrate (Promega, E151A) diluted 2500-fold with the washing buffer was added to the wells and reacted for 5 minutes, after which the luminescence was measured with a plate reader (PerkinElmer, Cat No.5103-35).

[0079] <Result> The results are shown in Figure 1. All of Luc-CUG-PPR1, Luc-CUG-PPR2, Luc-CUG-PPR3, and Luc-CUG-PPR4 had binding affinity to the CUG probe, but not to the CAG probe. In other words, all of the PPR proteins had high binding specificity to the CUG repeat sequence.

[0080] [Example 2: Effect of PPR on RNA aggregate formation in DM1 model cells] We treated DM1 model cells with PPR proteins and measured the number of RNA aggregates by FISH (fluorescent in situ hybridization).

[0081] <Experimental Materials and Methods> (1) DM1 model cells As a DM1 cell model, we used C2C12 cells that had been introduced with a DMPK gene region containing 800CTG repeats (C2C12-DMPK800R, Nucleic Acids Research, 2014, 42(10), 6591-6602). C2C12-DMPK800 was prepared as follows. A plasmid (pLC16) containing a sequence in which 800CTG was inserted into the 3' untranslated region of the DMPK gene and a plasmid expressing PhiC31 integrase were both transfected into mouse myoblast cell line C2C12 using Nucleofector (trade name, Lonza), and then a stable expression strain was selected using a selective medium supplemented with puromycin. Next, a plasmid expressing Cre recombinase was transfected into the stable expression strain, and a clone in which transcription of mRNA with 800 CUG repeats was induced was selected using a selective medium supplemented with hygromycin.

[0082] (2) Preparation of PPR protein expression plasmid vector for cell transfection The fusion genes of the green fluorescent protein mCLover3 gene, the PPR protein gene, the 3x nuclear localization signal, and the 3x FLAG epitope tag were cloned into the mammalian expression plasmid vector in this order. The expression of the fusion gene is controlled by the CMV promoter and the SV40 poly-A signal. The cloning of the gene of the correct size was confirmed by PCR, and the sequence of the gene was confirmed by sequencing. In addition, a fusion gene not containing the PPR protein gene, i.e., the green fluorescent protein mCLover3 gene, the 3x nuclear localization signal, and the 3x FLAG epitope tag fusion gene, was also prepared by the same method as a control. The following fusion genes were named mCLo-CUG-PPR1, mCLo-CUG-PPR2, mCLo-CUG-PPR3, mCLo-CUG-PPR4, and mCLo-empty in this order and used in the following tests. The sequences of the PPR proteins (PPR1 to PPR4) encoded in each expression plasmid vector are the same as the sequences of each PPR protein listed in Table 1.

[0083] [Table 6] JPEG2024069430000018.jpg220166JPEG2024069430000019.jpg83166

[0084] (3) Counting the number of RNA aggregates formed DM1 model cells were cultured under 37°C, 5% CO2 conditions using DMEM medium containing 10% FBS and penicillin / streptomycin. 200ng of the plasmid DNA constructed above, 0.6μL Fugene®-HD (Promega, E2311), and 200μL Opti-MEM were mixed and added to the wells in total. After 72 hours of culture under 37°C, 5% CO2 environment, the cells were fixed with 3% paraformaldehyde for 15 minutes at room temperature. After fixation, the cells were washed twice with PBS and then permeabilized with PBS containing 0.5% TritonX-100 for 5 minutes. Next, the cells were prehybridized for 10 minutes with 2×SSC buffer containing 30% formamide. Then, the hybridization was performed for 1 hour at 37°C in 2xSSC buffer containing 30% formamide, 2μg / mL BSA, 66μg / mL yeast tRNA, 2mM vanadyl complex, and 1ng / μL Texas Red CAG probe. After posthybridization for 30 minutes at 42°C in 2xSSC buffer containing 30% formamide, the cells were washed once with 1xSSC buffer and then twice with PBS. After fixation with Vectashield with DAPI (Vector Laboratories), the number of RNA aggregates in the nuclei was counted under a fluorescent microscope (Keyence PZ-9000).

[0085] <Result> The results are shown in Figure 2. As is clear from Figure 2, in the untreated DM1 model cells, the rate of RNA aggregate-positive cells exceeded 40%, but in the four experimental groups to which the PPR protein was applied, the rate of RNA aggregate-positive cells was significantly reduced.

[0086] [Example 3: Effect of PPR proteins on splicing abnormalities in DM1 model cells] We applied PPR protein to DM1 model cells to examine whether splicing abnormality in exon 22 of the Atp2a1 gene could be improved.

[0087] <Experimental Materials and Methods> (1) DM1 model cells The same DM1 model cells (C2C12-DMPK800R) as in Example 2 were used.

[0088] (2) PPR proteins The same expression plasmid vector as in Example 2 was used.

[0089] (3) Quantification of splicing products The PPR protein expression plasmid vector was transfected into DM1 model cells in the same manner as in Example 2, and after 72 hours, total RNA was extracted using RNeasy Mini Plus Kit (trade name, Qiagen). As a control, DM1 model cells not transfected with the PPR protein expression plasmid vector were used, and total RNA was extracted in the same manner. Then, cDNA was prepared using SuperScript III First Strand Synthesis System (Invitrogen). After treating the cDNA with RNaseH, RT-PCR was performed using the following Atp2a1 exon 22 RT primer. The RT-PCR products were electrophoresed on a 2% agarose gel and stained with GelRed, and then normal and abnormal PCR products were quantified using an image analyzer (ChemiDoc Touch imaging system, BioRad). Atp2a1 exon 22 RT primer Fw: GCTCATGGTCCTCAAGATCTCAC (SEQ ID NO: 22) Rv: GGGTCAGTGCCTCAGCTTTG (SEQ ID NO: 23)

[0090] <Result> The results are shown in Figure 3. The lower panel shows the results of electrophoresis of the RT-PCR products, and the upper panel is a graph showing the proportion of normal RT-PCR products. In the group not treated with PPR protein, the proportion of abnormal products was higher than the normal types. By applying PPR protein, the proportion of normal products in DM1 model cells was significantly increased, demonstrating that splicing abnormalities were improved.

[0091] [Example 4: Effect of PPR protein on muscle differentiation abnormality in DM1 model cells] The researchers applied PPR proteins to DM1 model cells to examine whether they improved the efficiency of muscle differentiation of DM1 model cells.

[0092] <Experimental Materials and Methods> (1) DM1 model cells The same DM1 model cells (C2C12-DMPK800R) as in Example 2 were used.

[0093] (2) PPR proteins The same expression plasmid vector for the PPR protein as in Example 2 was used.

[0094] (3) Quantification of muscle differentiation efficiency The PPR protein expression plasmid vector was transfected into the DM1 model cells in the same manner as in Example 2. The differentiation medium was replaced the next day, and 72 hours after transfection, nuclear staining with DAPI and antibody staining with anti-MyHC antibody were performed. First, antibody-stained cells with two or more nuclei in the cells were determined to be myotube cells, and the total number of nuclei in the myotube cells confirmed in the observation field was counted (hereinafter, value A). Next, the total number of nuclei in the entire field, including not only the myotube cells mentioned above but also undifferentiated cells, was counted (hereinafter, value B). The fusion index represents the percentage obtained by dividing value A by value B, and indicates muscle differentiation efficiency.

[0095] <Result> The results are shown in Figure 4. In the empty vector administration group (indicated as "no" in the figure), the fusion index was about 3. On the other hand, in the PPR administration groups, the fusion index was about 5 to 15 in all cases, indicating a significant improvement in muscle differentiation efficiency.

[0096] [Example 5: Effect of PPR on DM1 model mice] AAV6 carrying the CUG-PPR gene was administered once into the tibialis anterior muscle of DM1 model mice, and the effects on myotonia in the tibialis anterior muscle, the effects on splicing abnormalities of the Atp2a1 gene and skeletal muscle chloride channel (Clcn1) gene, and the number of RNA aggregates formed were examined.

[0097] <Experimental Materials and Methods> (1) Animals used HSA as a DM1 model mouse LR Mice (provided by Dr. Charles Thornton (University of Rochester) and bred at the experimental animal facility of Osaka University) were used. LR The mice were transgenic animals that had a 220-repeat CTG repeat sequence integrated into the genome of the hACTA gene (a human gene constitutively expressed in muscle cells) in the 3' untranslated region, and the symptoms of DM1 appeared when mRNA with an expanded CUG sequence was expressed in muscle cells (Science, 2000, 289 (5485), 1769-73). Wild-type mice (FVB / NJcl mice, purchased from CLEA Japan) were used as controls. 14-week-old male and female mice were used in the experiment.

[0098] (2) PPR proteins (AAV vector production) A gene fused with green fluorescent protein mCLover3, PPR protein, 3x nuclear localization signal, and 3x FLAG epitope tag was inserted in that order into the multiple cloning site of an AAV vector (AAVpro™ Helper Free System (AAV6), Takara, 6651 component). The expression size of the constructed gene was confirmed by PCR, and the inserted sequence was confirmed by sequencing. Expression of the fusion gene is controlled by the CMV promoter and the human growth hormone polyA signal.

[0099] (Preparation of AAV vectors) The AAV vector constructed in the previous section was transformed into pRC6 vector and phelper vector (both are components of AAVpro™ Helper Free System (AAV6), Takara, 6651). 20 μg of each was diluted to 2.5 × 10 8 The gene was introduced into the AAVpro™ HEK293T cell line (Takara, 632273). AAV-producing cells were obtained 3 days after transfection. AAV was purified using the AAVpro™ Purification Kit Maxi (all serotype) (Takara, 6666). Titer measurements were performed using the AAVpro titration kit for real time PCR ver.2 (Takara, 6233), yielding a titer of 5 × 10 11 The solution was diluted with D-PBS to 1000 mg / mL and used as the administration solution. These were named AAV6-mCLo-CUG-PPR1, AAV6-mCLo-CUG-PPR2, and AAV6-mCLo-empty, respectively, and used in the following tests. The sequences of the PPR proteins (PPR1, PPR2) encoded by each AAV vector are identical to the sequences of the PPR proteins listed in Table 1.

[0100] (3) Group assignment and administration schedule Four groups were established: AAV6-mCLo-CUG-PPR1-administered DM1 group, AAV6-mCLo-CUG-PPR2-administered DM1 group, AAV6-mCLo-empty-administered DM1 group, and PBS-administered DM1 group (n = 5 in each group (left and right limbs of 3 males and 2 females were used). The dose of AAV was 1 × 10 10 The PBS-treated DM1 group received a single dose of the same volume of PBS.

[0101] (4) Counting the number of RNA aggregates formed 56 days after the final administration, tibialis anterior muscles were harvested from mice and sectioned. After washing twice with PBS, they were permeabilized with 0.5% TritonX-100 in PBS for 5 min. Then, they were prehybridized with 30% formamide in 2xSSC buffer for 10 min. Then, they were hybridized with 30% formamide, 2μg / mL BSA, 66μg / mL yeast tRNA, 2mM vanadyl complex, and 1ng / μL Texas Red CAG probe in 2xSSC buffer at 37℃ for 1 h. After posthybridization with 30% formamide in 2xSSC buffer at 42℃ for 30 min, they were washed once with 1xSSC buffer and then twice with PBS. After fixation with Vectashield with DAPI (trade name, Vector Laboratories), the number of RNA aggregates in the nuclei was counted using a fluorescence microscope (Keyence PZ-9000).

[0102] (5) Quantification of splicing products 56 days after the final administration, tibialis anterior muscles were collected from the mice. Total RNA was extracted using TRI Reagent (trade name, MRC), and cDNA was prepared using SuperScript III First Strand Synthesis System (Invitrogen). After treating the cDNA with RNaseH, RT-PCR was performed using the same Atp2a1 exon22 RT primer as in Example 2 and the following Clcn1 exon 7a RT primer. The RT-PCR products were electrophoresed on a 2% agarose gel and stained with GelRed, after which normal and abnormal PCR products were quantified using an image analyzer (ChemiDoc Touch imaging system, BioRad), and the proportion of normal PCR products in the RT-PCR products was calculated. t-test was used for statistical analysis. Clcn1 exon 7a RT primer Fw: TGAAGGAATACCTCACACTCAAGG (SEQ ID NO: 24) Rv: CACGGAACACAAAGGCACTG (SEQ ID NO: 25)

[0103] (6) Measurement of myotonia 56 days after the final administration, the electrical myotonia phenomenon in the mouse tibialis anterior muscle was analyzed by needle electromyography under anesthesia. Specifically, the frequency of electrical myotonia occurrence when a needle electrode was inserted into the mouse tibialis anterior muscle 20 times was evaluated into the following four stages. Severity 0: No electrical myotonia is observed. Severity 1: Electrical myotonia is present in less than 50% of patients. Severity 2: Electrical myotonia is observed in more than 50% but less than 90% of patients. Severity 3: Electrical stiffness is observed in more than 90% of cases.

[0104] <Result> The results of RNA foci analysis are shown in Figure 5. The RNA foci positive cell rate was approximately 30% in the PBS and AAV6-mCLo-empty groups. On the other hand, a significant decrease in the RNA foci positive rate was observed in the AAV6-mCLo-CUG-PPR1 and AAV6-mCLo-CUG-PPR2 groups.

[0105] The results of the evaluation of splicing abnormalities are shown in Figure 6. For Atp2a1, the proportion of normal type was approximately 60% in the PBS-administered DM1 group and the AAV6-mCLo-Empty-administered MyoD group. The proportion of normal RT-PCR products significantly increased in the AAV6-mCLo-CUG-PPR1-administered DM1 group and the AAV6-mCLo-CUG-PPR2-administered DM1 group, demonstrating that the splicing abnormality of the Atp2a1 gene was improved by administration of PPR proteins. Similarly, it was found that the splicing abnormality of Clcn1 gene was improved by administration of PPR.

[0106] The analysis results of myotonia are shown in Figure 7. Myotonia was detected in 5 out of 5 mice in the PBS-administered group and the AAV6-mCLo-empty-administered group, with severity level 2. In both the AAV6-mCLo-CUG-PPR1-administered and AAV6-mCLo-CUG-PPR2-administered DM1-administered groups, 2 out of 5 mice showed severity level 1, and the remaining 3 mice showed severity level 2. Furthermore, the 2 mice that improved were from the experimental group that showed a high effect of improving Clcn1 splicing abnormalities (Figure 8).

[0107] The above results demonstrate that the present invention improves splicing abnormalities due to abnormal expansion of CTG repeat sequences, thereby improving myotonic symptoms in DM1.

[0108] [Example 6: Dose-dependency test of drug efficacy using DM1 model mice] To evaluate the dose-dependence of the drug's efficacy using DM1 model mice, DM1 model mice were injected with 3 × 10 AAV9 carrying the CUG-PPR gene. 13 ,1×10 14 ,3×10 14 Each compound was administered once into the tail vein at a dose of vg / kg, and the effects on myotonia in thigh muscles, on splicing abnormalities in the Atp2a1 gene and skeletal muscle chloride channel (Clcn1) gene, and on the number of RNA aggregates formed were examined.

[0109] <Experimental Materials and Methods> (1) Animals used HSA as a DM1 model mouse LR Mice (provided by Dr. Charles Thornton (University of Rochester) and bred at the experimental animal facility of Osaka University) were used. LRThe mice were transgenic animals that had a 220-repeat CTG repeat integrated into the 3' untranslated region of the hACTA gene (a human gene constitutively expressed in muscle cells), and the symptoms of DM1 appeared when mRNA with an expanded CUG sequence was expressed in muscle cells (Science, 2000, 289 (5485), 1769-73). Wild-type mice (FVB / NJcl mice, purchased from CLEA Japan) were used as controls. 14-week-old male and female mice were used in the experiment.

[0110] (2) PPR proteins (AAV vector production) A gene fused with the PPR protein and 3x nuclear localization signal was inserted into the multiple cloning site of the pAAV-CMV vector (AAVpro™ Helper Free System, Takara, 6651 component). The expression size of the constructed gene was confirmed by PCR, and the inserted sequence was confirmed by sequencing. Expression of the fusion gene is controlled by the CMV promoter and the human growth hormone polyA signal.

[0111] (Preparation of AAV vectors) The AAV vector constructed in the previous section was outsourced to SignaGen Laboratories (hereinafter referred to as SG). Packaging was performed by co-transfecting the Rep / Cap plasmid and Helper plasmid owned by SG, as well as the AAV vector sent from our company, into the packaging cell line. The cell lysate containing the packaged AAV was purified by density gradient centrifugation and the titer was measured. The obtained AAV was 1.16 × 10 14 The concentration was 1000 mg / ml and the volume was 5 ml. This was used as AAV9-CUG-PPR1 in the subsequent experiments. The sequence of the PPR protein (PPR1) encoded by each AAV vector is identical to the sequence of the PPR protein listed in Table 1.

[0112] (3) Group assignment and administration schedule Four groups were established: a low dose AAV9-CUG-PPR1 administration group (hereafter abbreviated as "Low dose: LD"), a medium dose AAV9-CUG-PPR1 administration group (hereafter abbreviated as "Middle dose: MD"), a high dose AAV9-CUG-PPR1 administration group (hereafter abbreviated as "High dose: HD"), and a PBS administration group (hereafter abbreviated as "PBS"). Each group had n=5 mice (3 males and 2 females). The AAV administration dose was LD of 3×10 13 vg / kg, MD is 1×10 14 vg / kg, HD is 3 × 10 14 The mice were administered a single dose of PBS in the tail vein at a dose of 100 mg / kg.

[0113] (4) Counting the number of RNA aggregates formed Twenty-eight days after the final administration, thigh muscles were harvested from the mice and sectioned. After washing twice with PBS, they were permeabilized with 0.5% TritonX-100 in PBS for 5 min. Next, they were prehybridized with 30% formamide in 2xSSC buffer for 10 min. Then, they were hybridized with 30% formamide, 2μg / mL BSA, 66μg / mL yeast tRNA, 2mM vanadyl complex, and 1ng / μL Texas Red CAG probe in 2xSSC buffer at 37℃ for 1 h. After posthybridization with 30% formamide in 2xSSC buffer at 42℃ for 30 min, they were washed once with 1xSSC buffer and then twice with PBS. After fixation with Vectashield with DAPI (trade name, Vector Laboratories), the number of RNA aggregates in the nuclei was counted using a fluorescence microscope (Keyence PZ-9000).

[0114] (5) Quantification of splicing products Twenty-eight days after the final administration, thigh muscles were collected from the mice. Total RNA was extracted using TRI Reagent™ (MRC), and cDNA was prepared using SuperScript III First Strand Synthesis System (Invitrogen). After treating the cDNA with RNaseH, RT-PCR was performed using the same Atp2a1 exon22 RT primer as in Example 2 and the following Clcn1 exon 7a RT primer. The RT-PCR products were electrophoresed on a 2% agarose gel and stained with GelRed, after which normal and abnormal PCR products were quantified using an image analyzer (ChemiDoc Touch Imaging System, BioRad), and the proportion of normal PCR products in the RT-PCR products was calculated. t-test was used for statistical analysis.

[0115] Clcn1 exon 7a RT primer Fw: TGAAGGAATACCTCACACTCAAGG (SEQ ID NO: 24) Rv: CACGGAACACAAAGGCACTG (SEQ ID NO: 25)

[0116] (6) Measurement of myotonia 28 days after the final administration, the electrical myotonia phenomenon in the thigh muscles of the mice was analyzed by needle electromyography under anesthesia. Specifically, the frequency of electrical myotonia occurrence when a needle electrode was inserted into the thigh muscles of the mice 20 times was evaluated into the following four stages. Severity 0: No electrical myotonia is observed. Severity 1: Electrical myotonia is present in less than 50% of patients. Severity 2: Electrical myotonia is observed in more than 50% but less than 90% of patients. Severity 3: Electrical stiffness is observed in more than 90% of cases.

[0117] (7) Measurement of PPR mRNA expression in AAV-injected mouse tissues The excised thigh muscle organ pieces were soaked in 800μL of TRIzol Reagent. Two beads (TOMY, SUB-30) were added, and the organs were disrupted using a bead-type cell disrupter Micro Smash (TOMY, MS-100R). After centrifugation at 15,000g at 4℃ for 5 minutes, 600μL of the supernatant was collected, 160μL of chloroform solution was added, and the mixture was mixed by inversion at room temperature for 5 minutes. The organs were then centrifuged at 15,000g at 4℃ for 5 minutes to separate the aqueous and organic phases. 300μL of the aqueous phase was collected and subjected to a nucleic acid purification device, Maxwell RSC Instrument, to obtain purified total-RNA. The concentration and purity of the RNA were measured by absorbance measurement using a NanoDrop 8000. To confirm the degree of degradation of the obtained RNA, electrophoresis was performed using 20-250ng / μL of total RNA using LabChip GX Touch HT (PerkinElmer, CLS137031J), and it was confirmed that degradation had not progressed from the band intensity ratio of 28S and 18S rRNA. cDNA synthesis was performed by reverse transcription reaction of 20-100ng / μL of the obtained RNA according to the product instructions for SuperScript III Reverse Transcriptase (Thermo Fisher Scientific (Life Technologies), 18080085). The amount of PPR mRNA and GAPDH mRNA was amplified and quantitatively analyzed using a real-time PCR system Aria MX (Agilent) after mixing the prepared cDNA, Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent, 600882) and the primers listed below according to the manual.

[0118] PPR quantitative PCR primers Fw:GATGAGGCTTTGGAACTGTTTG (SEQ ID NO: 26) Rv:TCTCTGGCTCTGCCGGCCTTGC (SEQ ID NO:27)

[0119] GAPDH quantitative PCR primers Fw:ATCATCCCTGCCTCTACTGG (SEQ ID NO:28) Rv:CTGCTTCACCACCTTCTTGA (SEQ ID NO:29)

[0120] <Result> The results of the RNA-foci analysis are shown in Figure 9. RNA-FISH was performed using the obtained thigh muscle organ sections to verify the effect of AAV9-CUG-PPR1 in suppressing RNA-foci formation. The results showed that the AAV9-CUG-PPR1 administration group had a dose-dependent suppression of RNA-foci formation. The rate of RNA-foci positive cells was 39% in the PBS administration group, 18% in the low dose AAV9-CUG-PPR1 group, 23% in the medium dose AAV9-CUG-PPR1 group, and 17% in the high dose AAV9-CUG-PPR1 group.

[0121] The results of the evaluation of splicing abnormalities are shown in Figure 10. Total RNA was collected from the collected organs, and reverse transcription PCR was performed to evaluate abnormal splicing of the Clcn1 and Atp2a1 genes. The abnormal splicing phenomenon of Clcn1 is a Cl channel known to be the direct cause of myotonic discharge. Atp2a1 is a Ca transporter also related to myotonic discharge and is known as a sensitive marker gene. As a result of splicing analysis, in the Clcn1 detection system, the PBS administration group showed 58% normal splicing, while the AAV9-CUG-PPR1 low dose group showed 72%, the AAV9-CUG-PPR1 medium dose group showed 78%, and the AAV9-CUG-PPR1 high dose group showed 82%, confirming a dose-dependent improvement in splicing. In the Atp2a1 detection system, the PBS-administered group showed 25% normal splicing, while the low-dose AAV9-CUG-PPR1 group showed 56%, the medium-dose AAV9-CUG-PPR1 group showed 60%, and the high-dose AAV9-CUG-PPR1 group showed 64%, indicating a dose-dependent improvement in splicing.

[0122] The reduction and improvement effect of myotonic discharge by PPR was displayed as a 4-level score based on the number of myotonic discharges. That is, a score of 0 means 0 out of 20, a score of 1 means 1 to 9 out of 20, a score of 2 means 10 to 19 out of 20, and a score of 3 means 20 out of 20. As a result of myotonic discharge analysis using thigh muscles, the PBS administration group showed a score of 3, 1 / 5 cases showed a score of 3 and 4 / 5 cases showed a score of 2 in the AAV9-CUG-PPR1 low dose group, 4 / 5 cases showed a score of 2 and 1 / 5 cases showed a score of 1 in the medium dose group, and 3 / 5 cases showed a score of 2 and 2 / 5 cases showed a score of 1 in the low dose group (Figure 11).

[0123] To investigate the pharmacokinetics, total RNA was extracted from the thigh muscle of the analyzed organ, and quantitative PCR of PPR mRNA was performed. RT-qPCR confirmed dose-dependent PPR mRNA expression (Figure 12). The expression level of PPR mRNA in each group was calculated using GAPDH as an internal standard and the relative value when the signal level of the individual with the lowest signal in the AAV9-CUG-PPR1 low dose administration group was set to 1. The median values ​​of each group were 0.2 for the PBS administration group, 0.7 for the low dose administration group, 1.8 for the medium dose administration group, and 2.6 for the high dose administration group, confirming dose-dependent PPR expression (Figure 12).

[0124] These results demonstrated that AAV9-CUG-PPR1 dose-dependently suppressed tetanic discharge, inhibited the formation of RNA foci, and improved abnormal splicing.

[0125] [Example 7: Time course change in drug efficacy in DM1 model mice] To evaluate the time course of drug efficacy using DM1 model mice, AAV9 carrying the CUG-PPR gene was administered once into the tail vein of DM1 model mice, and the effects on myotonia in thigh muscles, the effects on splicing abnormalities of the Atp2a1 gene and skeletal muscle chloride channel (Clcn1) gene, and the number of RNA aggregates formed were examined at each time point.

[0126] <Experimental Materials and Methods> (1) Animals used HSA as a DM1 model mouse LR Mice (provided by Dr. Charles Thornton (University of Rochester) and bred at the experimental animal facility of Osaka University) were used. LR The mice were transgenic animals that had a 220-repeat CTG repeat integrated into the 3' untranslated region of the hACTA gene (a human gene constitutively expressed in muscle cells), and the symptoms of DM1 appeared when mRNA with an expanded CUG sequence was expressed in muscle cells (Science, 2000, 289 (5485), 1769-73). Wild-type mice (FVB / NJcl mice, purchased from CLEA Japan) were used as controls. Male and female mice aged 12 weeks were used in the experiment.

[0127] (2) PPR proteins (AAV vector production) A gene fused with the PPR protein and a 3x nuclear localization signal was inserted in that order into the multiple cloning site of the pAAV-CMV vector (AAVpro™ Helper Free System, Takara, 6651 component). The expression size of the constructed gene was confirmed by PCR, and the inserted sequence was confirmed by sequencing. Expression of the fusion gene is controlled by the CMV promoter and the human growth hormone polyA signal.

[0128] (Preparation of AAV vectors) We outsourced the production of the AAV vector constructed in the previous section to SignaGen Laboratories (hereafter referred to as SG). Packaging was performed by co-transfecting the Rep / Cap plasmid and Helper plasmid owned by SG, as well as the AAV vector sent from our company, into the packaging cell line. The cell lysate containing the packaged AAV was purified by density gradient centrifugation and the titer was measured. The obtained AAV was 1.16 × 10 14The concentration was 1000 mg / ml and the volume was 5 ml. This was used as AAV9-CUG-PPR1 in the subsequent experiments. The sequence of the PPR protein (PPR1) encoded by each AAV vector is identical to the sequence of the PPR protein listed in Table 1.

[0129] (3) Group assignment and administration schedule Four groups were established: 14 days (2w), 28 days (4w), 56 days (8w), and 112 days (16w) after AAV9-CUG-PPR1 administration. Each group consisted of 5 mice (2 males, 3 females). The dose of AAV was 3 × 10 14 The antibody was administered in a single dose into the tail vein at a dose of 100 mg / kg.

[0130] (4) Counting the number of RNA aggregates formed At 14, 28, 56, or 112 days after the final injection, thigh muscles were harvested from the mice and sectioned. After washing twice with PBS, they were permeabilized with 0.5% TritonX-100 in PBS for 5 min. Next, they were prehybridized with 30% formamide in 2xSSC buffer for 10 min. Then, they were hybridized with 30% formamide, 2μg / mL BSA, 66μg / mL yeast tRNA, 2mM vanadyl complex, and 1ng / μL Texas Red CAG probe in 2xSSC buffer at 37℃ for 1 h. After posthybridization with 30% formamide in 2xSSC buffer at 42℃ for 30 min, they were washed once with 1xSSC buffer and then twice with PBS. After fixation with Vectashield with DAPI (trade name, Vector Laboratories), the number of RNA aggregates in the nuclei was counted using a fluorescence microscope (Keyence PZ-9000).

[0131] (5) Quantification of splicing products Thigh muscles were collected from mice 14, 28, 56, or 112 days after the final administration. Total RNA was extracted using TRI Reagent™ (MRC), and cDNA was prepared using SuperScript III First Strand Synthesis System (Invitrogen). After treating the cDNA with RNaseH, RT-PCR was performed using the same Atp2a1 exon22 RT primer as in Example 2 and the following Clcn1 exon 7a RT primer. The RT-PCR products were electrophoresed on a 2% agarose gel and stained with GelRed, after which normal and abnormal PCR products were quantified using an image analyzer (ChemiDoc Touch imaging system, BioRad), and the proportion of normal PCR products in the RT-PCR products was calculated. Statistical analysis was performed using t-test.

[0132] Clcn1 exon 7a RT primer Fw: TGAAGGAATACCTCACACTCAAGG (SEQ ID NO: 24) Rv: CACGGAACACAAAGGCACTG (SEQ ID NO: 25)

[0133] (6) Measurement of myotonia Immediately before necropsy, the electrical myotonia phenomenon in the thigh muscles of mice under anesthesia was analyzed by needle electromyography. Specifically, the frequency of electrical myotonia occurrence when needle electrodes were inserted into the thigh muscles of mice 20 times was evaluated into the following four stages. Severity 0: No electrical myotonia is observed. Severity 1: Electrical myotonia is present in less than 50% of patients. Severity 2: Electrical myotonia is observed in more than 50% but less than 90% of patients. Severity 3: Electrical stiffness is observed in more than 90% of cases.

[0134] <Result> The results of the RNA-foci analysis are shown in FIG. 13. The obtained thigh muscle organ sections were used to perform the RNA-FISH method, and the RNA-foci formation suppression effect of AAV9-CUG-PPR1 was verified. As a result, the RNA-foci formation suppression effect was confirmed in a dose-dependent manner in the AAV9-CUG-PPR1 administration group. The value of the PBS administration group used in the dose-dependency test in Example 6 was used as a control. The RNA-foci positive cell rate in the control group was 39%, in the group on the 14th day after AAV9-CUG-PPR1 administration, 36%, in the group on the 28th day after administration, 19% in the group on the 56th day after administration, and 18% in the group on the 112th day after administration, was confirmed to have a formation suppression effect (FIG. 13).

[0135] The results of the evaluation of splicing abnormalities are shown in FIG. 14. Total RNA was collected from the collected organs, and reverse transcription PCR was performed to evaluate abnormal splicing of the Clcn1 gene and the Atp2a1 gene. The abnormal splicing phenomenon of Clcn1 is a Cl channel known to be the direct cause of the myotonic discharge phenomenon. Atp2a1 is also known as a sensitive marker gene for a Ca transporter related to myotonic discharge. As a result of the splicing analysis, in the Clcn1 detection system, the PBS administration group shown in Example 6 showed 58% normal splicing, while the experimental group on the 14th day after AAV9-CUG-PPR1 administration showed 62%, on the 28th day after AAV9-CUG-PPR1 administration showed 76%, on the 56th day after AAV9-CUG-PPR1 administration showed 79%, and on the 112th day after AAV9-CUG-PPR1 administration, 80% splicing improvement was confirmed. In the Atp2a1 detection system, the PBS-administered group shown in Example 6 showed 25% normal splicing, while the experimental group showed 30% on the 14th day after AAV9-CUG-PPR1 administration, 63% on the 28th day after AAV9-CUG-PPR1 administration, 76% on the 56th day after AAV9-CUG-PPR1 administration, and 75% improvement in splicing was confirmed on the 112th day after AAV9-CUG-PPR1 administration (Figure 14).

[0136] The reduction and improvement effect of myotonic discharge by PPR was displayed as a 4-level score based on the number of myotonic discharges. That is, score 0 means 0 out of 20, score 1 means 1 to 9 out of 20, score 2 means 10 to 19 out of 20, and score 3 means 20 out of 20 myotonic discharges. As a result of myotonic discharge analysis using thigh muscles, the PBS administration group shown in Example 6 showed a score of 3, 4 / 5 cases in the experimental group on the 14th day after AAV9-CUG-PPR1 administration showed a score of 3 and 1 / 5 cases showed a score of 2, 5 / 5 cases in the experimental group on the 28th day after AAV9-CUG-PPR1 administration showed a score of 2, 3 / 5 cases in the experimental group on the 56th day after AAV9-CUG-PPR1 administration showed a score of 2 and 2 / 5 cases showed a score of 1, and 3 / 5 cases in the experimental group on the 112th day after administration showed a score of 2 and 2 / 5 cases showed a score of 1 (FIG. 15).

[0137] To investigate the pharmacokinetics, total RNA was extracted from the thigh muscle, and quantitative PCR was performed on PPR mRNA. RT-qPCR confirmed sustained expression of PPR even 112 days after administration (data not shown).

[0138] These results demonstrated that the efficacy of AAV9-CUG-PPR1-injected mice was improved up to 14, 28, and 56 days after administration, and that the efficacy was sustained even on the 112th day after administration.

[0139] [Example 8: Comprehensive improvement of DM1-associated splicing abnormalities by administration of AAV9-CUG-PPR1] <Experimental Materials and Methods> (1) Organs analyzed HSALR mice (14 weeks old) were inoculated with 3 × 10 AAV9-CUG-PPR1. 14 A single dose of 1000 mg / kg was administered into the tail vein, and the thigh muscle tissue pieces excised 8 weeks after administration (Day 56) were used as the PPR treatment group. The thigh muscles excised after a single administration of the same volume of PBS were used as the PPR untreated group. Thigh muscle tissue pieces from wild-type FVB / NJcl mice with the same genetic background were used as the wild-type group.

[0140] (2) Analysis of aberrant splicing events Total-RNA was extracted from the thigh muscles of the PPR-treated group, the PPR-untreated group, and the wild-type group according to the total RNA extraction method described in Example 6, and the required amount was sent to GENEZWIZ for RNA sequencing (Illumina Hiseq 2 × 150 bp sequencing). Ribosomal RNA in the total RNA was removed by Poly A selection method for the sent RNA. RNA was reverse transcribed to synthesize cDNA and prepare an adapter-attached library. Sequencing was performed, and adapter trimming was performed on the obtained read information using Trimmomatic (v0.33) 59. For the read sequence after trimming, alignment processing was performed with STAR (v2.7.9a) using GRCm39 (obtained from Ensemble) to the reference genome. Splicing events were identified using rMATS (v3.2.5) based on the STAR-aligned file (.bam). To identify altered splicing events, we compared the wild-type group with the PPR-untreated group (HSALR mice administered PBS), and used the "p-adjusted-value" and "InclLevelDifference" as indicators to determine whether there was any alteration, and only candidates defined as altered were extracted. Altered splicing events were cut off at a threshold of FDR (False Discovery Rate)-adjusted P value < 0.05 and used for comparison tests between groups. Percent spliced ​​in index (PSI) was defined as the ratio of the amount of spliced-in transcripts to the total number of reads for the target gene. Gene ontology analysis was performed using Metascape (https: / / metascape.org / gp / index.html# / main / step1).

[0141] <Result> Total RNA was extracted from thigh muscles excised from wild-type mice (14 weeks old) described in the previous section (hereafter referred to as the wild-type group), thigh muscles excised 8 weeks after PBS was administered to HSALR mice (hereafter referred to as the PPR-untreated group), and thigh muscles excised 8 weeks (Day 56) after AAV9-CUG-PPR1 was administered (hereafter referred to as the PPR-treated group), and comprehensive analysis of expressed RNA was performed using next-generation sequencing technology.

[0142] After mapping the obtained read sequences, the number of reads in adjacent exon sequences was compared, and the percent spliced ​​in index (PSI) was calculated to calculate the inclusion level of each exon of each gene. Among the PSIs between the wild type and the PBS-treated group, those with a difference of 0.2 or more were defined as splicing events that were abnormal in HSALR mice (n=455, Fig. 16a, left). Comparing the PSI of the same splicing event 8 weeks after AAV9-CUG-PPR1 administration with that in the WT (Fig. 16a, right), it was found that the PSI was generally restored.

[0143] Improvement was also observed for splicing events reported to occur as splicing abnormalities in HSA-LR other than Atp2a1 and Clcn1 in the following literature (Figure 16b). Reference: Matthew K Tanner et al. Nucleic Acids Research, Volume 49, Issue 4(2021)

[0144] Gene ontology analysis of the genes with abnormal splicing revealed that they were terms related to muscle function and muscle differentiation. Analysis of the number of genes with improvement in each gene ontology revealed that approximately 40% of the genes were strongly improved (greater than 50%), and including those with improvement (greater than 20%), the total was 90% (Figure 16c).

[0145] These results indicate that administration of AAV9-CUG-PPR1 improves various splicing abnormalities.

[0146] [Example 9: Analysis of PPR mRNA expression levels in each organ of normal mice treated with AAV9-CUG-PPR1]

[0147] <Experimental Materials and Methods> (1) Organs analyzed AAV9-CUG-PPR1 (administration dose: 1 × 10 13 vg / kg, 3×10 13 vg / kg, or 3 × 10 14 Four organ fragments (heart, thigh muscle, gastrocnemius muscle, and tibialis anterior muscle) isolated from normal mice were used for this study.

[0148] (2) Administration schedule and timing of necropsy Eight-week-old female normal mice were used. The dose was 1 × 10 13 vg / kg, 3×10 13 vg / kg, or 3 × 10 14 The drug was administered into the tail vein at a dose of 10 μL / g, and the observation period was 28 days after administration. The heart, thigh muscle, gastrocnemius muscle, and tibialis anterior muscle were removed from each mouse and PPR mRNA was analyzed.

[0149] (3) Measurement of PPR mRNA expression levels in AAV-injected mouse tissues Total-RNA was extracted from the excised organ pieces, cDNA was synthesized, and quantitative PCR was performed. First, 50 mg (± 5 mg) pieces of the organ pieces obtained in the previous section were wetted with 800 μL of TRIzol Reagent. Two crushing beads (TOMY, SUB-30) were added, and the organs were crushed using a bead-type cell crusher Micro Smash (TOMY Seiko, MS-100R), and centrifuged at 4 °C and 15,000 g for 5 minutes. 600 μL of the obtained supernatant was collected, and 160 μL of chloroform solution was added and mixed by inversion at room temperature for 5 minutes. Then, it was centrifuged at 4 °C and 15,000 g for 5 minutes to separate the aqueous and organic phases. 300 μL of the aqueous phase was collected and subjected to a nucleic acid purification device Maxwell RSC Instrument to obtain a purified product of total-RNA. The concentration and purity of the RNA were measured by absorbance measurement using NanoDrop 8000. To confirm the degree of degradation of the obtained RNA, electrophoresis was performed using 20 to 250 ng / μL of total RNA on a LabChip GX Touch HT (PerkinElmer, CLS137031J), and the band intensity ratio of 28S and 18S rRNA confirmed that degradation had not progressed.

[0150] For cDNA synthesis, 20 to 100 ng / μL of the obtained RNA was subjected to reverse transcription reaction according to the product instructions for SuperScript III Reverse Transcriptase (Thermo Fisher Scientific (Life Technologies), 18080085).

[0151] Quantitative PCR was performed using the real-time PCR system Aria MX (Agilent) according to the general manual for Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent, 600882).

[0152] PPR quantitative PCR primers Fw:GATGAGGCTTTGGAACTGTTTG (SEQ ID NO: 26) Rv:TCTCTGGCTCTGCCGGCCTTGC (SEQ ID NO:27)

[0153] GAPDH quantitative PCR primers Fw:ATCATCCCTGCCTCTACTGG (SEQ ID NO:28) Rv:CTGCTTCACCACCTTCTTGA (SEQ ID NO:29)

[0154] <Result> The results of quantitative PCR are shown in Figure 17. As a result of quantitative PCR, a dose-dependent increase in the PPR expression level was confirmed in each tissue, and the maximum dose of 3 × 10 14 The highest expression level was observed in the vg / kg administration group.

[0155] These results demonstrate that AAV9-CUG-PPR1 can be delivered and expressed throughout the body, suggesting that this is effective against DM1, a multi-organ disease that affects not only skeletal and smooth muscles but also the heart.

[0156] [Example 10: Analysis of sustained expression of PPR mRNA in each organ of normal mice administered AAV9-CUG-PPR1]

[0157] <Experimental Materials and Methods> (1) Organs analyzed AAV9-CUG-PPR1 (administration dose: 1 × 10 14 Four organ fragments (heart, thigh muscle, gastrocnemius muscle, and tibialis anterior muscle) isolated from normal mice were used for this study.

[0158] (2) Administration schedule and timing of necropsy Eight-week-old male normal mice were used. The dose was 1 × 10 14 The drug was administered into the tail vein at a dose of 10 μL / g, and the observation periods were 14, 28, 56, 112, and 182 days after administration. The heart, thigh muscle, gastrocnemius muscle, and tibialis anterior muscle were removed from each mouse and PPR mRNA was analyzed.

[0159] (3) Measurement of PPR mRNA expression levels in AAV-injected mouse tissues Total-RNA was extracted from the excised organ pieces, cDNA was synthesized, and quantitative PCR was performed. First, 50 mg (± 5 mg) pieces of the organ pieces obtained in the previous section were wetted with 800 μL of TRIzol Reagent, two crushing beads (TOMY, SUB-30) were added, and the organs were crushed using a bead-type cell crusher Micro Smash (TOMY Seiko, MS-100R). After centrifugation at 4 °C and 15,000 g for 5 minutes, 600 μL of the obtained supernatant was collected, 160 μL of chloroform solution was added, and the mixture was mixed by inversion at room temperature for 5 minutes. After that, the mixture was centrifuged at 4 °C and 15,000 g for 5 minutes to separate the aqueous and organic phases. 300 μL of the aqueous phase was collected and subjected to a nucleic acid purification device Maxwell RSC Instrument to obtain a purified product of total-RNA. The concentration and purity of the RNA were measured by absorbance measurement using a NanoDrop 8000. To confirm the degree of degradation of the obtained RNA, electrophoresis was performed using 20-250ng / μL of total RNA using LabChip GX Touch HT (PerkinElmer, CLS137031J), and the band intensity ratio of 28S and 18S rRNA confirmed that degradation had not progressed. cDNA synthesis was performed by reverse transcription reaction of 20-100ng / μL of the obtained RNA according to the product instructions for SuperScript III Reverse Transcriptase (Thermo Fisher Scientific (Life Technologies), 18080085). Quantitative PCR was performed using the real-time PCR system Aria MX (Agilent) according to the general manual for Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent, 600882).

[0160] PPR quantitative PCR primers Fw:GATGAGGCTTTGGAACTGTTTG (SEQ ID NO: 26) Rv:TCTCTGGCTCTGCCGGCCTTGC (SEQ ID NO:27)

[0161] GAPDH quantitative PCR primers Fw:ATCATCCCTGCCTCTACTGG (SEQ ID NO:28) Rv:CTGCTTCACCACCTTCTTGA (SEQ ID NO:29)

[0162] <Result> The results of quantitative PCR are shown in Figure 18. As a result of quantitative PCR, sustained expression was confirmed even 183 days after administration, and a time-dependent increase in expression was also confirmed. A previous paper has shown that expression can be sustained for a long period (6 months or more) when AAV9 is administered into the tail vein, and the results of this experiment are consistent with this finding.

[0163] From the above, it is suggested that the present invention can achieve the desired effect over a long period of time with fewer administrations to a subject.

Claims

1. A pharmaceutical composition for treating a disease caused by abnormal expansion of a CTG repeat sequence in the 3' untranslated region (3'UTR) of a myotonin protein kinase (DMPK) gene, comprising: The pharmaceutical composition comprises a nucleic acid encoding a protein that specifically binds to a CUG repeat sequence, The protein that specifically binds to the CUG repeat sequence contains at least six pentatricopeptide repeat (PPR) motifs consisting of a 30-38 amino acid long polypeptide represented by formula 1, 【Chemistry 1】 (In formula 1: Helix A is a 12 amino acid long portion capable of forming an α-helical structure and is represented by formula 2: 【Chemistry 2】 In formula 2, A １ ~A １２ each independently represents an amino acid; X is absent or is a moiety consisting of 1 to 9 amino acids in length; Helix B is a portion capable of forming an α-helical structure and consisting of 11 to 13 amino acids in length; L is a moiety of formula 3 that is 2 to 7 amino acids in length; 【Chemistry 3】 In formula 3, each amino acid is numbered from the C-terminus as "i" (-1), "ii" (-2), etc. However, L ｉｉｉ ~L ｖｉｉ may not exist.) A in each of the above PPR motifs １ , A ４ , and L ｉｉ or a combination of three amino acids ４ , L ｉｉ are selected such that each PPR motif binds to C, U or G, thereby configuring the protein to specifically bind to the CUG repeat sequence; The combination of the three amino acids A 1 , A 4 , and L ii in each of the PPR motifs is: When the target base of the PPR motif is G (guanine), the combination of the three amino acids A 1 , A 4 , and L ii is, in the order of (A 1 , A 4 , L ii ), (glutamic acid, glycine, aspartic acid), (valine, threonine, aspartic acid), (lysine, threonine, aspartic acid), or (leucine, threonine, aspartic acid); When the target base of the PPR motif is U (uracil), the combination of the three amino acids A 1 , A 4 , and L ii is, in the order of (A 1 , A 4 , L ii ), (valine, asparagine, aspartic acid), (isoleucine, asparagine, asparagine), (isoleucine, asparagine, aspartic acid), (isoleucine, methionine, aspartic acid), (phenylalanine, proline, aspartic acid), or (tyrosine, proline, aspartic acid); or When the target base of the PPR motif is C (cytosine), the combination of the three amino acids A 1 , A 4 , and L ii is, in the order of (A 1 , A 4 , L ii ), (valine, asparagine, asparagine), (isoleucine, asparagine, asparagine), (valine, asparagine, serine), or (isoleucine, methionine, aspartic acid). and / or The combination of the two amino acids A 4 and L ii in each of the PPR motifs is: When the target base of the PPR motif is G (guanine), the combination of the two amino acids A 4 and L ii is (threonine, aspartic acid) or (glycine, aspartic acid) in the order of (A 4 , L ii ); When the target base of the PPR motif is U (uracil), the combination of the two amino acids A 4 and L ii is (asparagine, aspartic acid), (proline, aspartic acid), (methionine, aspartic acid), or (valine, threonine) in the order of (A 4 , L ii ); When the target base of the PPR motif is C (cytosine), the combination of the two amino acids A 4 and L ii is (asparagine, asparagine), (asparagine, serine), or (leucine, aspartic acid) in the order of (A 4 , L ii ). Pharmaceutical compositions.

2. The pharmaceutical composition according to claim 1, It is used to inhibit the formation of RNA aggregates in the nucleus caused by abnormal expansion of the CTG repeat sequence in the 3'UTR of the DMPK gene. It is used to improve splicing abnormality caused by abnormal expansion of the CTG repeat sequence in the 3'UTR of the DMPK gene, or It is used to improve myotonia symptoms caused by abnormal expansion of the CTG repeat sequence in the 3'UTR of the DMPK gene. Pharmaceutical compositions.

3. The pharmaceutical composition according to claim 1, wherein the protein that specifically binds to the CUG repeat sequence contains 9 to 30 of the PPR motifs. Pharmaceutical compositions.

4. The pharmaceutical composition according to claim 3, wherein the protein that specifically binds to the CUG repeat sequence contains 12 to 24 of the PPR motifs. Pharmaceutical compositions.

5. 2. The pharmaceutical composition of claim 1, A nucleic acid encoding a protein that specifically binds to the CUG repeat sequence is incorporated into an expression vector. Pharmaceutical compositions.

6. 2. The pharmaceutical composition of claim 1, A nucleic acid encoding a protein that specifically binds to the CUG repeat sequence is incorporated into a viral vector. Pharmaceutical compositions.

7. 7. The pharmaceutical composition according to claim 6, The viral vector is a viral vector having tropism for muscle tissue. Pharmaceutical compositions.

8. 8. The pharmaceutical composition according to claim 7, The viral vector is an adeno-associated viral (AAV) vector, an adenoviral vector, a retroviral vector, a lentiviral vector, or a herpes simplex viral vector. Pharmaceutical compositions.

9. 9. The pharmaceutical composition according to claim 8, The viral vector is an AAV vector. Pharmaceutical compositions.

10. 10. The pharmaceutical composition according to claim 9, The AAV vector is an AAV1 vector, an AAV2 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or an AAV12 vector. Pharmaceutical compositions.

11. Use of a nucleic acid encoding a protein that specifically binds to the CUG repeat sequence defined in claim 1 in the manufacture of a pharmaceutical for the treatment of a disease caused by abnormal elongation of a CTG repeat sequence in the 3' untranslated region (3'UTR) of the myotonin protein kinase (DMPK) gene.

Images