Method for producing 2,4-pyridinedicarboxylic acid

Abstract

To provide a method for producing 2,4-pyridinedicarboxylic acid using biomass resources.SOLUTION: A method for producing a 2,4-pyridinedicarboxylic acid represented by formula (2) is provided, including a step of bringing 3-amino-4-hydroxybenzoic acid represented by formula (1) into contact with protocatechuate 4,5-dioxygenase or microbes producing the same, wherein the protocatechuate 4,5-dioxygenase is a polypeptide complex exhibiting protocatechuate 4,5-dioxygenase activity, represented by a complex composed of a polypeptide with a specific amino acid sequence. R1 and R2 may be the same or different and represent H, a hydroxy group, a halogen atom, a C1-4 alkyl group, a C1-4 alkoxy group, an amino group or a carboxy group.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for producing 2,4-pyridinedicarboxylic acids using biomass resources. [Background technology]

[0002] 2,4-Pyridinedicarboxylic acid (2,4-PDCA) is an analog of 2-oxoglutaric acid, and it has been reported that it antagonizes 2-oxoglutaric acid and inhibits the action of 2-oxoglutarate-dependent dioxygenase (Non-Patent Document 1). It has also been reported that 2,4-PDCA antagonizes ascorbic acid and inhibits the action of 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, suppressing ethylene production in cut carnation flowers (Non-Patent Document 2), and further that treating cut carnation flowers with 2,4-PDCA can extend their viewing period, and that 2,4-PDCA can be used as a quality-preserving agent for carnation flowers (Non-Patent Document 3).

[0003] In addition, it has been reported that ester derivatives of 2,4-PDCA have the effect of inducing or stimulating the growth of human keratin fibers, such as hair or eyelashes, and are useful for inhibiting hair loss and increasing density (Patent Document 1). 2,4-PDCA is also used as an intermediate in the production of pharmaceuticals such as inhibitors of proline and lysine hydroxylase.

[0004] Chemically, 2,4-PDCA is produced from isonicotinic acid and 2,4-lutidine as raw materials. However, potential problems are that the raw materials are expensive and derived from petrochemical resources. On the other hand, as a method for producing pyridine carboxylic acids using an enzymatic reaction, a method is known in which the corresponding catechols are used as precursors, which are cleaved by dioxygenase using the precursors as substrates, and then an ammonium salt is added (Non-Patent Document 4). However, when catechols are used as precursors, the aldehyde-type intermediates generated by the action of dioxygenase are less stable and difficult to accumulate, and impurity amine compounds react with the intermediates in the same way as ammonium salts, resulting in reduced yields. For these reasons, a method has been developed in which aminophenols, rather than catechols, are used as precursors (see the following formula). When aminophenols are used as precursors, the intermediates generated by the action of dioxygenase rapidly form a pyridine ring through an intramolecular reaction, making it unnecessary to accumulate the intermediates and being less susceptible to the effects of impurities, which is expected to improve yields. (Non-Patent Document 5)

[0005] [ka]

[0006] In the production method of 2,4-PDCA, no dioxygenase is known that uses as a substrate an aminophenol (3-amino-4-hydroxybenzoic acid) corresponding to the raw material protocatechuic acid. The only method that has been reported to date is to allow protocatechuic acid to act on protocatechuic acid 4,5-dioxygenase and then allow ammonium chloride to act on the resulting intermediate, that is, to culture a Rhodococcus jostii strain expressing protocatechuic acid 4,5-dioxygenase in a medium containing 1 g / L NH4Cl (Non-Patent Document 6). [Prior art documents] [Patent documents]

[0007] [Patent Document 1] European Patent No. 1,352,629 [Non-patent literature]

[0008] [Non-Patent Document 1] KI Kivirikko and J. Myllyharju, Matrix Biol. 1998. 16:357-368. [Non-Patent Document 2] F. Vlad, et al., Physiol. Plant. 2010. 140:199-207. [Non-Patent Document 3] S. Satoh, et al., J. Japan. Soc. Hort. Sci. 2014. 83:72-80. [Non-Patent Document 4] Y. Asano, et al., Biosci. Biotech. Biochem. 1994. 58:2054-2056. [Non-Patent Document 5] Z. He and JC Spain, J. Ind. Microbiol. Biotechnol. 2000. 25:25-28. [Non-Patent Document 6] Z. Mycroft, et al., Green Chem. 2015. 17:4974-4979. Summary of the Invention [Problem to be solved by the invention]

[0009] The present invention relates to a method for producing 2,4-pyridinedicarboxylic acid using biomass resources. [Means for solving the problem]

[0010] The present inventors have discovered that a specific protocatechuate-4,5-dioxygenase exhibits catalytic activity toward 3-amino-4-hydroxybenzoic acid (3,4-AHBA) and that 2,4-pyridinedicarboxylic acid can be efficiently produced from 3,4-AHBA by using the enzyme or a microorganism that produces the enzyme.

[0011] The present invention relates to the following. The following general formula (1):

[0012] [ka]

[0013] [In the formula, R 1 and R 2 may be the same or different and represent a hydrogen atom, a hydroxyl group, a halogen atom, an alkyl group having 1 to 4 carbon atoms, an alkoxy group having 1 to 4 carbon atoms, an amino group, or a carboxy group.

[0014] The present invention relates to a method for producing a 3-amino-4-hydroxybenzoic acid represented by the following general formula (2):

[0015] [ka]

[0016] [In the formula, R 1 and R 2 indicates the same as above.

[0017] The present invention relates to a method for producing 2,4-pyridinedicarboxylic acids represented by the following formula (A) or (B): (A) a complex consisting of a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 and a polypeptide having the amino acid sequence shown in SEQ ID NO: 4; (B) a complex comprising a polypeptide having an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2 and functioning as an α-subunit of protocatechuate-4,5-dioxygenase, and a polypeptide having an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4 and functioning as a β-subunit of protocatechuate-4,5-dioxygenase; The method of claim 1, wherein the polypeptide complex has protocatechuate 4,5-dioxygenase activity and is represented by the formula: Effect of the Invention

[0018] According to the method of the present invention, 2,4-pyridinedicarboxylic acids can be efficiently produced using biomass resources without the need for the addition of ammonium chloride from outside. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] In the present invention, the identity of an amino acid sequence or a nucleotide sequence is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing an analysis using the search homology program of the genetic information processing software GENETYX Ver. 12 with the unit size to compare (ktup) set to 2.

[0020] In the present invention, "at least 90% identity" with respect to amino acid sequences and nucleotide sequences means identity of 90% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, still more preferably 98% or more, and even more preferably 99% or more.

[0021] In the present invention, "an amino acid sequence in which one or several amino acids are deleted, substituted, added, or inserted" refers to an amino acid sequence in which 1 to 14, preferably 1 to 10, more preferably 1 to 8, more preferably 1 to 5, and even more preferably 1 to 3 amino acids are deleted, substituted, added, or inserted. In addition, "a nucleotide sequence in which one or several nucleotides are deleted, substituted, added, or inserted" refers to a nucleotide sequence in which 1 to 42, preferably 1 to 30, more preferably 1 to 24, more preferably 1 to 15, and even more preferably 1 to 9 nucleotides are deleted, substituted, added, or inserted. In the present invention, "addition" of an amino acid or nucleotide includes addition of an amino acid or nucleotide to one end and both ends of a sequence. Introduction of such mutations, such as deletion, substitution, insertion, and addition, can be carried out by introducing a mutation into the target nucleotide sequence, for example, by site-specific mutagenesis.

[0022] In the present invention, "upstream" and "downstream" of a gene refer to the upstream and downstream of the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is present on the 3' side of the promoter in the DNA sense strand, and "upstream" of a gene means the 5' region of the gene in the DNA sense strand.

[0023] In the present invention, the "operable linkage" between a control region such as a promoter and a gene means that the gene and the control region are linked so that the gene can be expressed under the control of the control region. The procedure for "operably linking" a gene and a control region is well known to those skilled in the art.

[0024] In the present invention, a "foreign gene" refers to an exogenous gene introduced into a cell from outside. A foreign gene may be derived from the same organism as the cell into which it is introduced, or from a different organism (i.e., a heterologous gene).

[0025] The method for producing 2,4-pyridinedicarboxylic acids of the present invention comprises reacting a compound represented by the following general formula (1):

[0026] [ka]

[0027] [In the formula, R 1 and R 2 may be the same or different and represent a hydrogen atom, a hydroxyl group, a halogen atom, an alkyl group having 1 to 4 carbon atoms, an alkoxy group having 1 to 4 carbon atoms, an amino group, or a carboxy group.

[0028] The present invention relates to a method for producing a 3-amino-4-hydroxybenzoic acid represented by the following general formula (2):

[0029] [ka]

[0030] [In the formula, R 1 and R 2 indicates the same as above.

[0031] The method for producing 2,4-pyridinedicarboxylic acids represented by the following formula (A) or (B) is used as protocatechuate 4,5-dioxygenase: (A) a complex consisting of a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 and a polypeptide having the amino acid sequence shown in SEQ ID NO: 4; (B) a complex comprising a polypeptide having an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2 and functioning as an α-subunit of protocatechuate-4,5-dioxygenase, and a polypeptide having an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4 and functioning as a β-subunit of protocatechuate-4,5-dioxygenase; The polypeptide complex having protocatechuate 4,5-dioxygenase activity represented by the formula:

[0032] In formula (1) or (2), R 1 , R 2 Examples of the halogen atom represented by the formula (I) include a fluorine atom, a chlorine atom, a bromine atom and an iodine atom, and are preferably a fluorine atom, a chlorine atom and a bromine atom, and more preferably a fluorine atom. Preferred examples of the alkyl group having 1 to 4 carbon atoms include a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, an isobutyl group, and a tert-butyl group, and more preferred are a methyl group and an ethyl group. Preferred examples of the alkoxy group having 1 to 4 carbon atoms include a methoxy group, an ethoxy group, a propoxy group, and a butoxy group, and a methoxy group is more preferred.

[0033] R 1 , R 2 are each more preferably a hydrogen atom, a hydroxyl group, a methoxy group, a fluorine atom or a methyl group, and R 1 and R 2 More preferably, both are hydrogen atoms.

[0034] The 3-amino-4-hydroxybenzoic acids used as the raw material can be produced from biomass resources, for example, by fermentation production using a recombinant Corynebacterium glutamicum strain expressing the griH gene and griI gene derived from Streptomyces griseus (H. Kawaguchi, et al., Bioresour. Technol. 2015. 198:410-417.).

[0035] Protocatechuate 4,5-dioxygenase (EC1.13.11.8) is an enzyme that catalyzes the reaction of oxidatively cleaving protocatechuate with oxygen to produce 4-carboxy-2-hydroxymuconic acid semialdehyde. In the present invention, the protocatechuate 4,5-dioxygenase that comes into contact with the above-mentioned 3-amino-4-hydroxybenzoic acids includes a polypeptide complex having protocatechuate 4,5-dioxygenase activity shown in the following (A) or (B) (referred to as the "polypeptide of the present invention"). (A) a complex consisting of a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 and a polypeptide having the amino acid sequence shown in SEQ ID NO: 4; (B) A complex comprising a polypeptide having an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 and functioning as an alpha subunit of protocatechuate 4,5-dioxygenase, and a polypeptide having an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 4 and functioning as a beta subunit of protocatechuate 4,5-dioxygenase.

[0036] Here, (A) the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 refers to the α subunit (PmdA) of protocatechuate 4,5-dioxygenase (PmdAB) derived from Comamonas testosteroni, and the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4 refers to the β subunit (PmdB) of protocatechuate 4,5-dioxygenase (PmdAB) derived from Comamonas testosteroni. Comamonas testosteroni-derived protocatechuate 4,5-dioxygenase PmdAB is composed of two subunits, an α subunit (PmdA) and a β subunit (PmdB). The active center is located in the β subunit and has an active center structure in which iron is coordinated to glutamic acid residues and multiple histidine residues.

[0037] In the polypeptide (B), the identity with the amino acid sequence shown in SEQ ID NO: 2 or 4 is preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and still more preferably 99% or more. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2 or 4 include amino acid sequences in which one or several amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 2 or 4.

[0038] Examples of methods for introducing mutations such as deletion, substitution, addition, or insertion of amino acids into the amino acid sequence of the above-mentioned polypeptide include methods for introducing mutations such as deletion, substitution, addition, or insertion of nucleotides into the nucleotide sequence encoding the amino acid sequence. Examples of methods for introducing mutations into nucleotide sequences include mutagenesis using chemical mutagens such as ethyl methanesulfonate, N-methyl-N-nitrosoguanidine, and nitrous acid, or physical mutagens such as ultraviolet light, X-rays, gamma rays, and ion beams, site-directed mutagenesis, and the method described in Dieffenbach et al. (Cold Spring Harbar Laboratory Press, New York, 581-621, 1995). Examples of methods for site-specific mutagenesis include a method using splicing overlap extension (SOE) PCR (Horton et al., Gene 77, 61-68, 1989), the ODA method (Hashimoto-Gotoh et al., Gene, 152, 271-276, 1995), and the Kunkel method (Kunkel, TA, Proc. Natl. Acad. Sci. USA, 1985, 82, 488). Alternatively, the Site-Directed Mutagenesis System Mutan-SuperExpress Km Kit (Takara Bio Inc.), Transformer TM Commercially available site-directed mutagenesis kits such as Site-Directed Mutagenesis Kit (Clonetech) and KOD-Plus-Mutagenesis Kit (Toyobo) can also be used.

[0039] The protocatechuate-4,5-dioxygenase activity can be determined by contacting the polypeptide of the present invention with a substrate (protocatechuate) and measuring the amount of 4-carboxy-2-hydroxymuconic acid semialdehyde produced thereby. The 2,4-pyridinedicarboxylic acid-producing activity of the polypeptide of the present invention can be evaluated by contacting 3-amino-4-hydroxybenzoic acid with the polypeptide of the present invention or a microorganism producing the polypeptide of the present invention and measuring the amount of 2,4-pyridinedicarboxylic acid produced, as shown in the Examples described below.

[0040] The polypeptide of the present invention can be produced by culturing a recombinant microorganism into which a gene encoding a polypeptide complex having protocatechuate 4,5-dioxygenase activity shown in (A) or (B) has been introduced. The gene encoding the polypeptide complex having protocatechuate 4,5-dioxygenase activity represented by (A) or (B) preferably includes the following polynucleotide (a) or (b):

[0041] (a) a polynucleotide encoding a polypeptide complex having protocatechuate 4,5-dioxygenase activity, the polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 3; (b) A polynucleotide encoding a polypeptide complex having protocatechuate 4,5-dioxygenase activity, the polynucleotide comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:1 and encoding a polypeptide that functions as an alpha subunit of protocatechuate 4,5-dioxygenase, and a polynucleotide comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO:3 and encoding a polypeptide that functions as a beta subunit of protocatechuate 4,5-dioxygenase. Here, (a) the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1 refers to the gene (pmdA) encoding the alpha subunit (PmdA) of protocatechuate 4,5-dioxygenase (PmdAB) derived from Comamonas testosteroni, and the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3 refers to the gene (pmdB) encoding the beta subunit (PmdB) of protocatechuate 4,5-dioxygenase (PmdAB) derived from Comamonas testosteroni.

[0042] Examples of nucleotide sequences having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3 include nucleotide sequences in which one or several nucleotides are deleted, substituted, added, or inserted relative to the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3. Methods for introducing mutations such as deletion, substitution, addition, or insertion of nucleotides into a nucleotide sequence are as described above. The polynucleotide may be in the form of a single strand or a double strand, or may be DNA or RNA. The DNA may be artificial DNA such as cDNA or chemically synthesized DNA. The polynucleotide may contain a nucleotide sequence of an untranslated region (UTR) in addition to an open reading frame (ORF). The polynucleotide may be codon-optimized according to the species of the transformant used to produce the polypeptide of the present invention. Information on codons used by various organisms is available from the Codon Usage Database ([www.kazusa.or.jp / codon / ]).

[0043] Means for introducing such a polynucleotide (a) or (b) into a microorganism include, for example, introducing a vector or a DNA fragment containing each polynucleotide into a host microorganism (parent strain). Here, the vector containing each polynucleotide is an expression vector, preferably an expression vector capable of introducing the polynucleotide into a host microorganism and expressing it in the host. The vector preferably contains the polynucleotide and a control region operably linked thereto. The vector may be an extrachromosomal vector capable of autonomously replicating and replicating, such as a plasmid, or may be a vector that is integrated into a chromosome. Here, "operably linked" means that a gene and a regulatory region are linked in such a way that the gene can be expressed under the control of the regulatory region. The procedure for "operably linking" a gene and a regulatory region is well known to those skilled in the art.

[0044] Specific examples of vectors include pBluescript II SK(-) (Stratagene), pUC vectors such as pUC18 / 19 and pUC118 / 119 (Takara Bio), pET vectors (Takara Bio), pGEX vectors (GE Healthcare), pCold vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Mckenzie, T. et al., 1986, Plasmid 15(2):93-103), pBR322 (Takara Bio), pRS403 (Stratagene), pMW218 / 219 (Nippon Gene), pRI vectors such as pRI909 / 910 (Takara Bio), pBI vectors (Clontech), IN3 vectors (Implanta Innovations), pPTR1 / 2 (Takara Bio), pDJB2 (DJBallance et al., 2011). al., Gene, 36, 321-331, 1985), pAB4-1 (van Hartingsveldt W et al., Mol Gen Genet, 206, 71-75, 1987), pLeu4 (MIGRoncero et al., Gene, 84, 335-343, 1989), pPyr225 (CDSkory et al., Mol Genet Genomics, 268, 397-406, 2002), pFG1 (Gruber, F. et al., Curr Genet, 18, 447-451, 1990), and the like.

[0045] The polynucleotide of the present invention may be constructed as a DNA fragment containing the polynucleotide. Examples of the DNA fragment include a PCR-amplified DNA fragment and a restriction enzyme-cleaved DNA fragment. Preferably, the DNA fragment may be an expression cassette containing the polynucleotide and a control region operably linked thereto.

[0046] The control region contained in the vector or DNA fragment is a sequence for expressing a polynucleotide encoding the polypeptide of the present invention in a host cell into which the vector or DNA fragment has been introduced, and examples of such control regions include expression regulatory regions such as promoters and terminators, origins of replication, and secretion signal regions. The type of control region can be appropriately selected depending on the type of host microorganism into which the vector or DNA fragment is introduced. If necessary, the vector or DNA fragment may further have a selection marker such as an antibiotic resistance gene or an amino acid synthesis-related gene (e.g., resistance genes for drugs such as ampicillin, neomycin, kanamycin, and chloramphenicol).

[0047] The polynucleotide of the present invention can be linked to the above-mentioned control region or marker gene sequence by the above-mentioned SOE-PCR method or the like. The procedure for introducing a gene sequence into a vector is well known in the art. The types of expression control regions such as promoters and terminators, replication origins, and secretion signal regions are not particularly limited, and promoters and secretion signal sequences that are commonly used can be appropriately selected and used depending on the host to be introduced.

[0048] Suitable examples of the regulatory region include strong regulatory regions that can enhance expression compared to the wild type, such as known high expression promoters such as the T7 promoter, lac promoter, tac promoter, and trp promoter, but are not particularly limited to these.

[0049] The target polynucleotide and the control region contained in the vector or DNA fragment may be introduced into the nucleus of the host, or may be introduced into the host genome. Alternatively, the target polynucleotide contained in the vector or DNA fragment may be directly introduced into the host genome and operably linked to a high expression promoter on the genome. A method for introducing a polynucleotide into a genome includes homologous recombination.

[0050] To introduce a vector or DNA fragment into the above-mentioned host cells, a common transformation method such as electroporation, transformation, transfection, conjugation, protoplast, particle gun, or Agrobacterium can be used.

[0051] A recombinant microorganism into which a vector or DNA fragment of interest has been introduced can be selected using a selection marker. For example, when the selection marker is an antibiotic resistance gene, transformed cells into which a vector or DNA fragment of interest has been introduced can be selected by culturing the cells in a medium containing the antibiotic. For example, when the selection marker is an amino acid synthesis-related gene, the gene is introduced into a microbial strain that requires the amino acid, and then the microbial strain into which the vector or DNA fragment of interest has been introduced can be selected based on the presence or absence of the amino acid requirement. Alternatively, the introduction of the vector or DNA fragment of interest can be confirmed by examining the DNA sequence of the recombinant strain by PCR or the like.

[0052] By the above procedure, a recombinant microorganism can be prepared in which the polynucleotide of the present invention is introduced into a host microbial strain, and the recombinant microorganism has the ability to produce the protocatechuate-4,5-dioxygenase of the present invention.

[0053] The microorganism used as the host (parent strain) may be any of fungi, yeast, actinomycetes, Escherichia coli, Bacillus subtilis, etc., but is preferably Escherichia coli, yeast, or actinomycetes. As the actinomycetes, a group of microorganisms defined as coryneform bacteria (Bergey's Manual of Determinative Bacteriology, Vol. 8, 599 (1974)) is preferred, and specific examples thereof include bacteria of the genus Corynebacterium, Brevibacterium, Arthrobacter, Mycobacterium, Rhodococcus, Streptomyces, and Micrococcus. Among these, preferred are bacteria of the genus Corynebacterium (e.g., Corynebacterium glutamicum, Corynebacterium efficiens, Corynebacterium ammoniagenes, Corynebacterium halotolerance, Corynebacterium alkanolyticum, Corynebacterium crenatum, Corynebacterium crudilactis, Corynebacterium callunae, etc.), and more preferred is Corynebacterium glutamicum.

[0054] The above-mentioned recombinant microorganism can be cultured in any medium containing a carbon source, a nitrogen source, inorganic salts, etc., to produce and accumulate the polypeptide of the present invention in the culture, and the polypeptide can be obtained by collecting the polypeptide from the culture.

[0055] In the present invention, 2,4-pyridinedicarboxylic acids are produced by contacting 3-amino-4-hydroxybenzoic acids with the polypeptide of the present invention or the above-mentioned microorganism producing the polypeptide. Here, when the polypeptide of the present invention is used, the polypeptide may be one obtained by drying a polypeptide-containing aqueous liquid containing medium components and the like in which a microorganism that produces the polypeptide is cultured, or one that does not contain these and is essentially composed of the polypeptide itself. For example, the polypeptide may be one immobilized from a polypeptide-containing aqueous liquid produced by culturing the above-mentioned recombinant microorganism and then removing the bacterial cells, or one obtained by powdering the polypeptide-containing aqueous liquid. Examples of immobilized polypeptides include those in which the polypeptide is immobilized on a carrier such as silica, celite, diatomaceous earth, perlite, polyvinyl alcohol, anion exchange resin, phenol adsorption resin, hydrophobic carrier, cation exchange resin, chelating resin, etc. Examples of powdered polypeptides include those obtained by drying and powdering a polypeptide-containing aqueous liquid by a method such as spray drying, freeze drying, or drying after solvent precipitation.

[0056] The contact conditions between the polypeptide of the present invention and 3-amino-4-hydroxybenzoic acids are not particularly limited, but the contact can usually be performed at 20°C to 50°C for 5 minutes to 72 hours, preferably 1 hour to 60 hours, and more preferably 1 hour to 24 hours, with stirring or shaking as necessary.

[0057] When a microorganism is used, contact with a 3-amino-4-hydroxybenzoic acid or a derivative thereof can be achieved by culturing the above-mentioned recombinant microorganism in a medium supplemented with a 3-amino-4-hydroxybenzoic acid or a derivative thereof. The medium for culturing the recombinant microorganism may be either a natural medium or a synthetic medium, as long as it contains a carbon source, a nitrogen source, inorganic salts, etc., and can efficiently culture the recombinant microorganism. Examples of the carbon source that can be used include sugars such as glucose, polyols such as glycerin, alcohols such as ethanol, and organic acids such as pyruvic acid, succinic acid, and citric acid. Examples of the nitrogen source that can be used include peptone, meat extract, yeast extract, casein hydrolysate, alkaline extract of soybean meal, alkylamines such as methylamine, and ammonia or a salt thereof. In addition, salts such as phosphates, carbonates, sulfates, magnesium, calcium, potassium, iron, manganese, and zinc, specific amino acids, specific vitamins, and antifoaming agents may also be used as necessary.

[0058] The culture can usually be performed at 10° C. to 40° C. for 6 to 72 hours, preferably 9 to 60 hours, and more preferably 12 to 48 hours, with stirring or shaking as necessary. During the culture, antibiotics such as ampicillin and kanamycin may be added to the medium as necessary.

[0059] The method for recovering and purifying 2,4-pyridinedicarboxylic acids from the reaction system is not particularly limited, and can be carried out by combining well-known methods such as ion exchange resin method, precipitation method, crystallization method, recrystallization method, concentration method, and others. For example, in the case of production using a recombinant microorganism, 2,4-pyridinedicarboxylic acids can be obtained by removing the bacterial cells by centrifugation or the like, removing ionic substances with cation and anion exchange resins, and concentrating the mixture. The 2,4-pyridinedicarboxylic acids accumulated in the culture may be used as they are without isolation.

[0060] In relation to the above-described embodiment, the present invention further discloses the following aspects. <1> 1) The following general formula (1):

[0061] [ka] [In the formula, R 1 and R 2 may be the same or different and represent a hydrogen atom, a hydroxyl group, a halogen atom, an alkyl group having 1 to 4 carbon atoms, an alkoxy group having 1 to 4 carbon atoms, an amino group, or a carboxy group. The present invention relates to a method for producing a 3-amino-4-hydroxybenzoic acid represented by the following general formula (2):

[0062] [ka] [In the formula, R 1 and R 2 indicates the same as above. The present invention relates to a method for producing 2,4-pyridinedicarboxylic acids represented by the following formula (A) or (B): (A) a complex consisting of a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 and a polypeptide having the amino acid sequence shown in SEQ ID NO: 4; (B) a complex consisting of an amino acid sequence having an identity of 90% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and still more preferably 99% or more to the amino acid sequence shown in SEQ ID NO: 2, and a polypeptide that functions as an α-subunit of protocatechuate-4,5-dioxygenase, and an amino acid sequence having an identity of 90% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and still more preferably 99% or more to the amino acid sequence shown in SEQ ID NO: 4, and a polypeptide that functions as a β-subunit of protocatechuate-4,5-dioxygenase; The method of claim 1, wherein the polypeptide complex has protocatechuate 4,5-dioxygenase activity and is represented by the formula: <2> The protocatechuate 4,5-dioxygenase or a microorganism producing the same is a recombinant microorganism into which a gene encoding a polypeptide complex having protocatechuate 4,5-dioxygenase activity represented by (A) or (B) above has been introduced, and the gene is one of the following (a) or (b): (a) a polynucleotide encoding a polypeptide complex having protocatechuate 4,5-dioxygenase activity, the polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 3; (b) a polynucleotide encoding a polypeptide complex having protocatechuate 4,5-dioxygenase activity, the polynucleotide comprising a nucleotide sequence having 90% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and still more preferably 99% or more identity to the nucleotide sequence shown in SEQ ID NO: 1, and encoding a polypeptide that functions as an α-subunit of protocatechuate 4,5-dioxygenase; and a polynucleotide comprising a nucleotide sequence having 90% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and still more preferably 99% or more identity to the nucleotide sequence shown in SEQ ID NO: 3, and encoding a polypeptide that functions as a β-subunit of protocatechuate 4,5-dioxygenase. is a polynucleotide of <1> How to. <3> The microorganism is Escherichia coli, yeast or coryneform bacteria; <1> or <2> How to. <4> recovering 2,4-pyridinedicarboxylic acids; <1> ~ <3> Either way. <5> In general formulas (1) and (2), R 1 and R 2 each represents a hydrogen atom, a hydroxyl group, a methoxy group, a fluorine atom, or a methyl group; <1> ~ <4> Either way. <6> In general formulas (1) and (2), R 1 and R 2are both hydrogen atoms, <1> ~ <4> Either way. EXAMPLES

[0063] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.

[0064] Example 1 Production of 2,4-pyridinedicarboxylic acid (1) Construction of a plasmid containing the gene encoding protocatechuate-4,5-dioxygenase In the following examples, PCR was performed using KOD One PCR Master Mix (Toyobo). After treating the PCR product with DpnI (Takara Bio), the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The In-Fusion HD Cloning Kit (Takara Bio) was used for ligating DNA fragments. The ligated DNA fragments were used to transform ECOS Competent E. coli JM109 strain (Nippon Gene), and the cell liquid was spread on LBAmp agar medium (Difco LB Broth Lennox 20 g / L, ampicillin sodium 50 μg / mL, agar 1.5%) and left to stand overnight at 37 ° C. The obtained colonies were inoculated into 750 μL of TBAmp liquid medium (Difco Terrific Broth 47.6 g / L, ampicillin sodium 50 μg / mL) and cultured overnight at 37 ° C. Plasmids were prepared from the resulting cells using NucleoSpin Plasmid EasyPure (Takara Bio), and DNA sequence analysis of the resulting plasmids was performed by the Sanger method (Eurofins Genomics).

[0065] A DNA fragment was amplified by PCR using primers pmdA-ins-F (SEQ ID NO: 6: GAAGGAGATATACATATGGCTCTCGAGAAGCCGTA) and pmdB-ins-R (SEQ ID NO: 7: GTGGTGGTGGTGGTGTTACTGGTTCTCGAGGATCA) with DNA artificially synthesized so that the genes (pmdA and pmdB, SEQ ID NO: 1 and 3) encoding protocatechuate-4,5-dioxygenase derived from Comamonas testosteroni were linked via a linking sequence (SEQ ID NO: 5: AGGAGGGTTTAAATTT) as a template. The PCR product was ligated to a DNA fragment amplified by PCR using primers pET-vec-F (SEQ ID NO: 8: CACCACCACCACCACCACTGAGATC) and pET-vec-R (SEQ ID NO: 9: ATGTATATCTCCTTCTTAAAGTTAAACAAAATTAT) with the pET21a vector as a template to obtain the plasmid pET21a-pmdAB.

[0066] (2) Production of 2,4-pyridinedicarboxylic acid The plasmid pET21a-pmdAB obtained above was used to transform ECOS competent cells BL21(DE3) (Nippon Gene), the resulting transformed cell solution was applied to LBAmp agar medium, and then left to stand overnight at 37°C, and the resulting colonies were used as test strains. Similarly, colonies obtained by transforming the pET21a vector were used as control strains. Each of the obtained strains was inoculated into 7 mL of OXTBAmp medium (per 1 L: Overnight Express TB medium (Merck) 60 g, glycerin 10 mL, ampicillin sodium 50 mg) and cultured at 30°C for 24 hours. The cells were collected by centrifugation, washed with 0.1 M potassium phosphate buffer (pH 7.4), and then suspended in 1 mL of 3-amino-4-hydroxybenzoic acid in 1 M Tris-HCl (pH 8.0) solution (20 mM), and shaken at 30°C for 16 hours in a 96-well deep well plate. After shaking, 30 μL of the supernatant was mixed with 270 μL of 0.1% phosphoric acid solution, and insoluble matter was removed using an AcroPrep 96 filter plate (0.2 μm, WWPTFE membrane, Nippon Pole) and subjected to high performance liquid chromatography (HPLC). The HPLC device used was Chromaster (Hitachi High-Tech Science). The analytical column used was an L-column ODS (4.6 mm ID x 150 mm, Chemicals Evaluation and Research Institute), and gradient elution was performed with 0.1 M potassium dihydrogen phosphate in 0.1% phosphoric acid solution as eluent A and 70% methanol as eluent B at a flow rate of 1.0 mL / min and a column temperature of 40°C. 3-Amino-4-hydroxybenzoic acid and 2,4-pyridinedicarboxylic acid were detected using a UV detector (detection wavelength 280 nm) and quantified using concentration calibration curves.

[0067] (3) Results As shown in Table 1, when the control strain was used, 3-amino-4-hydroxybenzoic acid was detected but 2,4-pyridinedicarboxylic acid was not detected, whereas when the test strain was used, 2,4-pyridinedicarboxylic acid was detected but 3-amino-4-hydroxybenzoic acid was not detected. In addition, the molar yield of the amount of 2,4-pyridinedicarboxylic acid (molecular weight: 167.12) detected in the test strain was calculated based on the amount of 3-amino-4-hydroxybenzoic acid (molecular weight: 153.14) detected in the control strain, which was 1.0, indicating that 2,4-pyridinedicarboxylic acid can be efficiently produced from 3-amino-4-hydroxybenzoic acid by the action of protocatechuate-4,5-dioxygenase.

[0068] [Table 1]

Claims

1. 1) The following general formula (1): 【Chemistry 1】 [In the formula, R １ and R ２ may be the same or different and represent a hydrogen atom, a hydroxy group, a halogen atom, an alkyl group having 1 to 4 carbon atoms, an alkoxy group having 1 to 4 carbon atoms, an amino group, or a carboxy group. The present invention relates to a method for producing a 3-amino-4-hydroxybenzoic acid represented by the following general formula (2): 【Chemistry 2】 [In the formula, R １ and R ２ indicates the same as above.] The method for producing 2,4-pyridinedicarboxylic acids represented by the following formula (A) or (B): (A) a complex consisting of a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 and a polypeptide having the amino acid sequence shown in SEQ ID NO: 4; (B) a complex comprising a polypeptide having an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2 and functioning as an α-subunit of protocatechuate 4,5-dioxygenase, and a polypeptide having an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4 and functioning as a β-subunit of protocatechuate 4,5-dioxygenase; The method of claim 1, wherein the polypeptide complex has protocatechuate 4,5-dioxygenase activity and is represented by the formula:

2. 2. The method according to claim 1, wherein the microorganism is Escherichia coli, yeast or coryneform bacteria.

3. The method according to claim 1 or 2, further comprising a step of recovering the 2,4-pyridinedicarboxylic acids.

4. In general formulas (1) and (2), R １ and R ２ The method according to claim 1 or 2, wherein each of is a hydrogen atom, a hydroxy group, a methoxy group, a fluorine atom, or a methyl group.

5. In general formulas (1) and (2), R １ and R ２ The method according to claim 1 or 2, wherein both are hydrogen atoms.

Images