Frizzled receptor antibodies and uses thereof

Abstract

To provide antibodies that bind to Frizzled receptor, in particular, antibodies that bind to Frizzled receptor 4 cysteine-rich domain, and methods of use thereof.SOLUTION: Provided herein is an isolated antibody or an immunoconjugate thereof that specifically binds to Frizzled receptor (FZD)4 cysteine-rich domain, where the antibody comprises light chain variable region and heavy chain variable region, where the heavy chain variable region comprises complementarity determining region CDR-H1, CDR-H2 and CDR-H3 and the light chain variable region comprises complementarity determining region CDR-L1, CDR-L2 and CDR-L3, each having an amino acid sequence comprising or consisting of a sequence selected from a group of specific sequences.SELECTED DRAWING: Figure 5

Description

[Technical field]

[0001] Field The present disclosure relates to antibodies that bind to frizzled receptors, in particular, antibodies that bind to the frizzled receptor 4 cysteine-rich domain, and uses thereof.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the priority dates of U.S. Provisional Application No. 62 / 885,781, filed August 12, 2019, and U.S. Provisional Application No. 62 / 886,292, filed August 13, 2019, the entire contents of which are incorporated herein by reference. [Background technology]

[0003] background Frizzled receptors (FZDs) are an important class of seven-transmembrane receptors involved in many important biological processes such as development, cell proliferation, survival, migration, and stem cell maintenance. In adult animals, signaling pathways are activated when Wnt ligands interact with the Frizzled family of seven-transmembrane receptors, controlling the renewal and cell differentiation of stem and progenitor cells during embryonic development and tissue homeostasis. Aberrant expression and signaling of these receptors and their ligands (Wnts) have been linked to numerous cancers, including colon, lung, breast, and ovarian cancers. In many cases, multiple Wnt ligands and / or frizzled receptors are upregulated, resulting in aberrant signaling that promotes tumorigenesis. Thus, inhibition of multiple frizzled receptors may be necessary to achieve even better anticancer effects. In addition, frizzled receptors are also involved in cancer stem cells, a small population of cancer cells that are believed to be responsible for drug resistance, tumor recurrence, and metastasis. Thus, inhibition of FZD receptors, including FZD4 (either one or more receptors), may be an effective method to target cancer stem cells and treat various types of cancer.

[0004] Wnt signaling leads to the activation of canonical and non-canonical signaling pathways. The non-canonical pathway activates signaling molecules that do not involve the nucleus or transcription, but rather activate cytoplasmic signals that regulate the cytoskeleton and calcium levels. This pathway primarily plays a role in regulating cell polarity or migration.

[0005] The classical pathway primarily controls transcriptional activity by regulating the cytoplasmic levels of β-catenin. In the unstimulated state, β-catenin associates with a degradation complex composed of Axin, APC, CD1, and GSKβ, which leads to phosphorylation, ubiquitination, and proteasomal degradation of β-catenin. Wnt signaling is active when Wnt binds to the frizzled (FDZ) seven-transmembrane receptor and the co-receptor low density lipoprotein receptor-related protein (either LRP5 or LRP6). This signaling destabilizes the complex, in part, by attracting disheveled (Dsh / Dvl) to the plasma membrane, leading to the accumulation of β-catenin, which translocates to the nucleus and activates TCF / LEF-mediated transcription.

[0006] Several human cancers are caused by mutations within the cytoplasmic components of the WNT pathway, leading to ligand-independent activation of Wnt target genes. For example, inactivating APC mutations and activating β-catenin mutations are the major underlying causes in human colorectal cancer. Because this pathway is activated downstream of cell surface receptors, developing targeted therapies against the Wnt pathway has proven challenging. However, in recent years, cancers have been identified that cause mutations in RNF43 (colon, endometrial, pancreatic, gastric, ovarian, and hepatic cancers) and its homolog ZNRF3 (adrenocortical carcinoma and osteosarcoma), negative regulators of Wnt signaling, implying ligand-dependent tumor growth. Indeed, RNF43 and ZNRF3 are Wnt target genes that encode transmembrane E3 ubiquitin ligases that target Frizzled receptors, and loss-of-function mutations in them can lead to high expression of FZDs, rendering tumor cells sensitive to inhibition of Wnt-dependent signaling. Summary of the Invention

[0007] overview The following summary is intended to introduce the reader to various aspects of the disclosure, but is not intended to define or limit any of the invention.

[0008] In one aspect, the disclosure provides an antibody that specifically binds to each cysteine-rich domain (CRD) of one or more human Frizzled receptors selected from FZD 1, 2, 4, 5, 7, 8, and 9, comprising a light chain variable region and / or a heavy chain variable region, wherein the heavy chain variable region comprises complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, and the amino acid sequences of the CDRs comprise or consist of a sequence selected from the sequences in Table 1a or Table 3a. In one embodiment, the CDRs comprise (a) the complete set of sequences or (b) the set of light chain sequences or (c) the set of heavy chain sequences selected from the antibodies identified in Table 1a or Table 3a.

[0009] In another embodiment, the CDRs comprise or consist of the following sequences: CDR-H1 is ISYYYM (SEQ ID NO: 1), IYSYYM (SEQ ID NO: 2), LSYYYM (SEQ ID NO: 3), IYYYSI (SEQ ID NO: 4), LYSYYM (SEQ ID NO: 5), LSSYSM (SEQ ID NO: 6), ISYYYI (SEQ ID NO: 7), LSYSSM (SEQ ID NO: 8), IYYYYM (SEQ ID NO: 9), LYYYSI (SEQ ID NO: 10), ISSYYI (SEQ ID NO: 11), FSSSSI (SEQ ID NO: 12), LSYYSI (SEQ ID NO: 13), LYSYYI (SEQ ID NO: 14), LSSYYM (SEQ ID NO: 15), LSYYYI (SEQ ID NO: 16), ISSYYM (SEQ ID NO: 17), LSYYSM (SEQ ID NO: 18), LYSYSI (SEQ ID NO: 19), LYYYYI (SEQ ID NO: 20), IYSYYI (SEQ ID NO: 21), ISYSYI (SEQ ID NO: 22), and ISYYSM (SEQ ID NO: 23); CDR-H2 is SIYSYYGYTY (SEQ ID NO: 24), SIYSSSSSTY (SEQ ID NO: 25), SIYPSSSYTY (SEQ ID NO: 26), SIYSSSSYTS (SEQ ID NO: 27), YISSYSGSTY (SEQ ID NO: 28), and SIYSSYGYTY (SEQ ID NO: 29), YISSYYGYTY (SEQ ID NO: 30), SIYPSSSSTY (SEQ ID NO: 31), SIYSSSGYTY (SEQ ID NO: 32), YISSYSGSTS (SEQ ID NO: 33), SISSYYGSTY (SEQ ID NO: 34), SIYSYYGSTY (SEQ ID NO: 35), SIYPYSGYTY (SEQ ID NO: 36), YISPYYGYTS (SEQ ID NO: 37), SISSSSGYTY (SEQ ID NO: 38), SIYSYSSSTY (SEQ ID NO: 39), SISPSSSYTY (SEQ ID NO: 39). 40) YISPYYGYTY (SEQ ID NO: 41), SISPYSSSTY (SEQ ID NO: 42), SIYSSYGSTY (SEQ ID NO: 43), SIYSSSSYTY (SEQ ID NO: 44), SIYPSSGYTY (SEQ ID NO: 45), SIYPYSGSTY (SEQ ID NO: 45). 46. ​​SIYPSYGSTY (SEQ ID NO: 47), YISSYSSYTY (SEQ ID NO: 48), SIYSYYSSTY (SEQ ID NO: 49), YISSSYGYTS (SEQ ID NO: 50). 52) SIYPYYSYTY (SEQ ID NO: 53), SISPYYGYTS (SEQ ID NO: 54), SISPSYSSTY (SEQ ID NO: 55), SISSSYSSTY (SEQ ID NO: 56), SIYPYSGSTS (SEQ ID NO: 57), SISSYYSSTS (SEQ ID NO: 57) 58) and SIYSYSGYTY (SEQ ID NO: 59).CDR-H3は、SSFSWAM (SEQ ID NO: 60)、SSFYWAL (SEQ ID NO: 61)、SWFGWGI (SEQ ID NO: 62)、YWFSYGYASYPAF (SEQ ID NO: 63)、HPWYGM (SEQ ID NO: 64) 65)、PAPGHWGF (SEQ ID NO: 66)、SSFFWAM (SEQ ID NO: 67)、SAFYWAM (SEQ ID NO: 68)、HFFAM (SEQ ID NO: 69)、SWWAWAF (SEQ ID NO: 70)、SAFGWF (SEQ ID NO: 70) (SEQ ID NO: 72)、PYYWSGGF (SEQ ID NO: 73)、HPSSSWFSFGAL (SEQ ID NO: 74)、SAFYWAF (SEQ ID NO: 75)、SSYAWAM (SEQ ID NO: 76)、SSFYWAI (SEQ ID NO: 77) 78)、PAVWVGL (SEQ ID NO: 79)、SWVFWAL (SEQ ID NO: 80)、SWVYWGM (SEQ ID NO: 81)、SWVYWAL (SEQ ID NO: 82)、NOSSYAWAI (SEQ ID NO: 83) 84)、HGASFGSGAPAF (SEQ ID NO: 85)、SCFFWAM (SEQ ID NO: 86)、WAFFGL (SEQ ID NO: 87)、SSFYFAM (SEQ ID NO: 88)、SAFSWAI (SEQ ID NO: 89)、SGFY IDW NO: 90)、PSVGYAAF (SEQ ID NO: 91)、SWVGWGL (SEQ ID NO: 92)、SSVGYVAM (SEQ ID NO: 93)、SWVYWAF (SEQ ID NO: 94)、YYYYSSSVYFWYAAL (SEQ ID NO: 95). 96)、SWVYWAI (SEQ ID NO: 97)、SWVGWGI (SEQ ID NO: 98)、SSVYWAL (SEQ ID NO:99), WGGWGSGGYFYAAL (SEQ ID NO: 100), FWYPGM (SEQ ID NO: 101), and SSFAWAF (SEQ ID NO: 102); CDR-L1 is SVSSA (SEQ ID NO: 103), CDR-L2 is SASSLYS (SEQ ID NO: 104), CDR-L3は、HPWSGGYLI (SEQ ID NO: 105), PVGYWGVPI (SEQ ID NO: 106), VSGGAHALI (SEQ ID NO: 107), VSSAYPI (SEQ ID NO: 108), FWGVPI (SEQ ID NO: 109), SYYHYAALI (SEQ ID NO: 110), WYYAPI (SEQ ID NO: 111), SHSYSLI (SEQ ID NO: 112), SGYGPF (SEQ ID NO: 113), SWSSPI (SEQ ID NO: 114), HYSVYASLI (SEQ ID NO: 115), and PHPPSLI (SEQ ID NO: 115). 116, VAYSHVGLI (SEQ ID NO: 117), GYGAPI (SEQ ID NO: 118), SWYSLI (SEQ ID NO: 119), PGYLF (SEQ ID NO: 120), VWFGLI (SEQ ID NO: 121), VYYGSPLF (SEQ ID NO: 120). 122, HAHSPLI (SEQ ID NO: 123), SSAYYPF (SEQ ID NO: 124), GHASPI (SEQ ID NO: 125), SSGGWSLI (SEQ ID NO: 126), VAWSSFLI (SEQ ID NO: 127), SVAAASLI (SEQ ID NO: 126). 128) SGWWGVSLI (SEQ ID NO: 129), SYAAYLF (SEQ ID NO: 130), HGSLF (SEQ ID NO: 131), YAGVSNLF (SEQ ID NO: 132), GWPYSALF (SEQ ID NO: 133), SGYYPSLF (SEQ ID NO: 132). 134)、SYHSGSGLI (SEQ ID NO: 135), HGYSASLI (SEQ ID NO: 136), APGWALF (SEQ ID NO: 137), GHSSPI (SEQ ID NO: 138), GWPSLF (SEQ ID NO: 139), VPGYPVPI (SEQ ID NO: 138). 140) HYYSHLI (SEQ ID NO: 141), GPASSLI (SEQ ID NO: 142), SVGSSYYLI (SEQ ID NO: 142).143), YYGPWVLI (SEQ ID NO: 144), AASWGYPF (SEQ ID NO: 145), HWSYPI (SEQ ID NO: 146), and GGWGPF (SEQ ID NO: 147).

[0010] In yet another embodiment, the CDRs comprise or consist of the following sequences: CDR-H1 is ISYYYM (SEQ ID NO: 1), IYSYYM (SEQ ID NO: 2), LSYYYM (SEQ ID NO: 3), IYYYSI (SEQ ID NO: 4), LYSYYM (SEQ ID NO: 5), LSSYSM (SEQ ID NO: 6), ISYYYI (SEQ ID NO: 7), LSYSSM (SEQ ID NO: 8), IYYYYM (SEQ ID NO: 9), LYYYSI (SEQ ID NO: 10), ISSYYI (SEQ ID NO: 11), FSSSSI (SEQ ID NO: 12), LSYYSI (SEQ ID NO: 13), LYSYYI (SEQ ID NO: 14), LSSYYM (SEQ ID NO: 15), LSYYYI (SEQ ID NO: 16), ISSYYM (SEQ ID NO: 17), LSYYSM (SEQ ID NO: 18), LYSYSI (SEQ ID NO: 19), LYYYYI (SEQ ID NO: 20), IYSYYI (SEQ ID NO: 21), ISYSYI (SEQ ID NO: 22), and ISYYSM (SEQ ID NO: 23); CDR-H2 is SIYSYYGYTY (SEQ ID NO: 24), SIYSSSSSTY (SEQ ID NO: 25), SIYPSSSYTY (SEQ ID NO: 26), SIYSSSSYTS (SEQ ID NO: 27), YISSYSGSTY (SEQ ID NO: 28), and SIYSSYGYTY (SEQ ID NO: 29), YISSYYGYTY (SEQ ID NO: 30), SIYPSSSSTY (SEQ ID NO: 31), SIYSSSGYTY (SEQ ID NO: 32), YISSYSGSTS (SEQ ID NO: 33), SISSYYGSTY (SEQ ID NO: 34), SIYSYYGSTY (SEQ ID NO: 35), SIYPYSGYTY (SEQ ID NO: 36), YISPYYGYTS (SEQ ID NO: 37), SISSSSGYTY (SEQ ID NO: 38), SIYSYSSSTY (SEQ ID NO: 39), SISPSSSYTY (SEQ ID NO: 39). 40) YISPYYGYTY (SEQ ID NO: 41), SISPYSSSTY (SEQ ID NO: 42), SIYSSYGSTY (SEQ ID NO: 43), SIYSSSSYTY (SEQ ID NO: 44), SIYPSSGYTY (SEQ ID NO: 45), SIYPYSGSTY (SEQ ID NO: 45). 46. ​​SIYPSYGSTY (SEQ ID NO: 47), YISSYSSYTY (SEQ ID NO: 48), SIYSYYSSTY (SEQ ID NO: 49), YISSSYGYTS (SEQ ID NO: 50). 52) SIYPYYSYTY (SEQ ID NO: 53), SISPYYGYTS (SEQ ID NO: 54), SISPSYSSTY (SEQ ID NO: 55), SISSSYSSTY (SEQ ID NO: 56), SIYPYSGSTS (SEQ ID NO: 57), SISSYYSSTS (SEQ ID NO: 57) 58) and SIYSYSGYTY (SEQ ID NO: 59).CDR-H3は、SSFSWAM (SEQ ID NO: 60)、SSFYWAL (SEQ ID NO: 61)、SWFGWGI (SEQ ID NO: 62)、YWFSYGYASYPAF (SEQ ID NO: 63)、HPWYGM (SEQ ID NO: 64) 65)、PAPGHWGF (SEQ ID NO: 66)、SSFFWAM (SEQ ID NO: 67)、SAFYWAM (SEQ ID NO: 68)、HFFAM (SEQ ID NO: 69)、SWWAWAF (SEQ ID NO: 70)、SAFGWF (SEQ ID NO: 70) (SEQ ID NO: 72)、PYYWSGGF (SEQ ID NO: 73)、HPSSSWFSFGAL (SEQ ID NO: 74)、SAFYWAF (SEQ ID NO: 75)、SSYAWAM (SEQ ID NO: 76)、SSFYWAI (SEQ ID NO: 77) 78)、PAVWVGL (SEQ ID NO: 79)、SWVFWAL (SEQ ID NO: 80)、SWVYWGM (SEQ ID NO: 81)、SWVYWAL (SEQ ID NO: 82)、NOSSYAWAI (SEQ ID NO: 83) 84)、HGASFGSGAPAF (SEQ ID NO: 85)、SCFFWAM (SEQ ID NO: 86)、WAFFGL (SEQ ID NO: 87)、SSFYFAM (SEQ ID NO: 88)、SAFSWAI (SEQ ID NO: 89)、SGFY IDW NO: 90)、PSVGYAAF (SEQ ID NO: 91)、SWVGWGL (SEQ ID NO: 92)、SSVGYVAM (SEQ ID NO: 93)、SWVYWAF (SEQ ID NO: 94)、YYYYSSSVYFWYAAL (SEQ ID NO: 95). 96)、SWVYWAI (SEQ ID NO: 97)、SWVGWGI (SEQ ID NO: 98)、SSVYWAL (SEQ ID NO:99), WGGWGSGGYFYAAL (SEQ ID NO: 100), FWYPGM (SEQ ID NO: 101), and SSFAWAF (SEQ ID NO: 102); CDR-L1 is SVSSA (SEQ ID NO: 103), CDR-L2 is SASSLYS (SEQ ID NO: 104), CDR-L3は、HPWSGGYLI (SEQ ID NO: 105), PVGYWGVPI (SEQ ID NO: 106), VSGGAHALI (SEQ ID NO: 107), VSSAYPI (SEQ ID NO: 108), FWGVPI (SEQ ID NO: 109), SYYHYAALI (SEQ ID NO: 110), WYYAPI (SEQ ID NO: 111), SHSYSLI (SEQ ID NO: 112), SGYGPF (SEQ ID NO: 113), SWSSPI (SEQ ID NO: 114), HYSVYASLI (SEQ ID NO: 115), and PHPPSLI (SEQ ID NO: 115). 116, VAYSHVGLI (SEQ ID NO: 117), GYGAPI (SEQ ID NO: 118), SWYSLI (SEQ ID NO: 119), PGYLF (SEQ ID NO: 120), VWFGLI (SEQ ID NO: 121), VYYGSPLF (SEQ ID NO: 120). 122, HAHSPLI (SEQ ID NO: 123), SSAYYPF (SEQ ID NO: 124), GHASPI (SEQ ID NO: 125), SSGGWSLI (SEQ ID NO: 126), VAWSSFLI (SEQ ID NO: 127), SVAAASLI (SEQ ID NO: 126). 128) SGWWGVSLI (SEQ ID NO: 129), SYAAYLF (SEQ ID NO: 130), HGSLF (SEQ ID NO: 131), YAGVSNLF (SEQ ID NO: 132), GWPYSALF (SEQ ID NO: 133), SGYYPSLF (SEQ ID NO: 132). 134)、SYHSGSGLI (SEQ ID NO: 135), HGYSASLI (SEQ ID NO: 136), APGWALF (SEQ ID NO: 137), GHSSPI (SEQ ID NO: 138), GWPSLF (SEQ ID NO: 139), VPGYPVPI (SEQ ID NO: 138). 140) HYYSHLI (SEQ ID NO: 141), GPASSLI (SEQ ID NO: 142), SVGSSYYLI (SEQ ID NO: 142).143), YYGPWVLI (SEQ ID NO: 144), AASWGYPF (SEQ ID NO: 145), HWSYPI (SEQ ID NO: 146), and GGWGPF (SEQ ID NO: 147).

[0011] In a further aspect, the present disclosure provides a method for producing a method for treating a cancer cell comprising: (i) a heavy chain amino acid sequence set forth in Table 2; (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to a heavy chain amino acid sequence set forth in Table 2, wherein the CDR sequences are a set of CDR sequences set forth in Table 1a or Table 3a; or (iii) A conservatively substituted amino acid sequence according to (i), wherein the CDR sequence is a set of CDR sequences as set forth in Table 1a or Table 3a. The antibody described above comprises a heavy chain variable region comprising:

[0012] In a further aspect, the present disclosure provides a method for producing a method for treating a cancer cell comprising: (i) a light chain amino acid sequence as set forth in Table 2; (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to a light chain amino acid sequence set forth in Table 2, wherein the CDR sequences are a set of CDR sequences set forth in Table 1a or Table 3a; or (iii) A conservatively substituted amino acid sequence according to (i), wherein the CDR sequence is a set of CDR sequences as set forth in Table 1a or Table 3a. The antibody further comprises a light chain variable region comprising:

[0013] In a further aspect, the present disclosure provides an antibody that specifically binds to FZD4. In a further aspect, the antibody CDR sequence that specifically binds to FZD4 is a set of CDR sequences of an antibody selected from antibodies 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, 5077-5080, or 5081.

[0014] In a further aspect, the disclosure provides an antibody that specifically binds to FZD4 and at least one other receptor selected from FZD1, 2, 5, 7, 8, and 9. In yet a further aspect, the CDR sequence is a set of CDR sequences of an antibody selected from antibodies 5014, 5016, 5018-5023, 5025, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076. In yet a further aspect, the antibody preferentially binds to Frizzled 4 (FZD4) compared to another FZD receptor. In still further embodiments, the CDR sequences are the set of CDR sequences of an antibody selected from antibodies 5028, 5029, 5031, 5034, 5035, 6497, 6498, 5039, 5045, 5048, 5054, 5056, 5057, 5067, 5073, 5074, 5075. In still further embodiments, the antibody has a binding affinity as measured by surface plasmon resonance of about 0.2 nM to about 15.3 nM.

[0015] In yet a further aspect, the CDR sequences are the set of CDR sequences of an antibody selected from antibodies 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, 5077-5080, or 5081.

[0016] In still further embodiments, the antibody is monoclonal, humanized, single chain, antibody fragment, multivalent, bispecific, comprises a non-native glycosylation pattern, comprises a cysteine ​​substitution or addition, or blocks Wnt binding to FZD. In still further embodiments, the antibody fragment is selected from the group consisting of fragments selected from Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and multimers thereof. In still further embodiments, the multivalent antibody is bivalent, trivalent, or tetravalent. In still further embodiments, the cysteine ​​substitution is in the constant region or framework region. In still further embodiments, the bispecific antibody further binds to LRP 5 and / or 6. In still further embodiments, the antibody comprises a non-native glycosylation pattern. In still further embodiments, the cysteine ​​substitution is in the constant region or framework region. In still further embodiments, the antibody described herein blocks Wnt binding to FZD.

[0017] In another aspect, the present disclosure provides an immunoconjugate comprising an antibody described herein and a detectable label or a cytotoxic agent. In one embodiment, the cytotoxic agent is selected from maytansinoids, auristatins, dolastatins, tubulysins, cryptophycins, pyrrolobenzodiazepine (PBD) dimers, indolinobenzodiazepine dimers, α-amanitins, trichothenes, SN-38, duocarmycins, CC1065, calicheamincins, enediyne antibiotics, taxanes, doxorubicin derivatives, anthracyclines, and stereoisomers, azanofides, isosteres, analogs, or derivatives thereof.

[0018] In another aspect, the present disclosure provides a nucleic acid encoding an antibody described herein. In one embodiment, one or more of the CDR sequences encoded by the nucleic acid are set forth in Table 1b, Table 1c, Table 3b, and Table 3c.

[0019] In another embodiment, the antibody encoded by the nucleic acid comprises: (i) a heavy chain nucleic acid sequence as set forth in Table 2; (ii) a nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to a light chain nucleic acid sequence set forth in Table 2, wherein the CDR sequences are a set of CDR sequences set forth in Table 1a or Table 3a; or (iii) A codon-degenerate nucleic acid sequence according to (i), wherein the CDR sequence is a set of CDR sequences as set forth in Table 1a or Table 3a. The light chain variable region is encoded by a nucleic acid comprising:

[0020] In another embodiment, the antibody encoded by the nucleic acid comprises: (i) a light chain nucleic acid sequence as set forth in Table 2; (ii) a nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to a light chain nucleic acid sequence set forth in Table 2, wherein the CDR sequences are a set of CDR sequences set forth in Table 1a or Table 3a; or (iii) A codon-degenerate nucleic acid sequence according to (i), wherein the CDR sequences are a set of CDR sequences as set forth in Table 1a or Table 3a. The light chain variable region is encoded by a nucleic acid comprising:

[0021] In yet another aspect, the disclosure provides vectors comprising an expression control sequence operably linked to a nucleic acid encoding an antibody described herein.

[0022] In yet a further aspect, the disclosure provides a host cell comprising a recombinant nucleic acid molecule comprising an expression control sequence operably linked to a nucleic acid encoding an antibody described herein. In one aspect, the host cell is a Chinese Hamster Ovary (CHO) cell.

[0023] In yet a further aspect, the disclosure provides a method for producing an anti-FZD antibody comprising culturing a host cell described herein.

[0024] In yet a further aspect, the present disclosure provides a composition comprising one or more antibodies, immunoconjugates, nucleic acids, vectors, or host cells described herein, optionally together with a suitable diluent. In one embodiment, the composition comprises one or more antibodies or immunoconjugates, and optionally, the composition is a pharmaceutical composition.

[0025] In still a further aspect, the present disclosure provides kits comprising one or more antibodies, immunoconjugates, nucleic acids, vectors, or host cells described herein.

[0026] In yet a further aspect, the present disclosure provides a method for detecting FZD expression, comprising contacting a sample comprising one or more cells with one or more antibodies or immunoconjugates described herein under conditions that permit the formation of antibody:cell complexes, and detecting the presence of any antibody complexes. In one embodiment, the detection method is by immunofluorescence. In another embodiment, the detection method is by flow cytometry. In yet another embodiment, the method is for detecting FZD4 expression, and the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081.

[0027] In yet a further aspect, the present disclosure provides a method of inhibiting Wnt ligand binding to a FZD receptor, interfering with a Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting activation of disheveled, promoting the preservation of a β-catenin degradation complex, promoting accumulation of β-catenin, or inhibiting cell proliferation, the method comprising contacting a cell expressing a FZD receptor with an antibody or immunoconjugate described herein. In another aspect, the present disclosure provides an antibody or immunoconjugate described herein for use in inhibiting Wnt ligand binding to a FZD receptor, interfering with a Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting activation of disheveled, promoting the preservation of a β-catenin degradation complex, promoting accumulation of β-catenin, or inhibiting cell proliferation. In a further aspect, the present disclosure provides the use of the antibody or immunoconjugate described herein for inhibiting Wnt ligand binding to FZD receptor, interfering with Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting activation of disheveled, promoting the preservation of β-catenin degradation complex, promoting accumulation of β-catenin, or inhibiting cell proliferation.In yet a further aspect, the present disclosure provides the use of the antibody or immunoconjugate described herein in the manufacture of a medicament for inhibiting Wnt ligand binding to FZD receptor, interfering with Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting activation of disheveled, promoting the preservation of β-catenin degradation complex, promoting accumulation of β-catenin, or inhibiting cell proliferation.In one embodiment, the Wnt ligand is Wnt3a.In another embodiment, the antibody or immunoconjugate is selected from the group consisting of (a) 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081 or (b) 5014, 5016, 5018-5 The set of CDR sequences corresponding to antibodies selected from: 023, 5025, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073 to 5076.

[0028] In yet a further aspect, the present disclosure provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition comprising the antibody or immunoconjugate described herein. In another aspect, the present disclosure provides a use of the antibody or immunoconjugate described herein for treating cancer. In yet another aspect, the present disclosure provides an antibody or immunoconjugate described herein for use in treating cancer. In yet another aspect, the present disclosure provides a use of the antibody or immunoconjugate described herein in the manufacture of a medicament for treating cancer. In one aspect, the cancer is selected from acute myeloid leukemia, neuroblastoma, liver cancer, lung cancer, endometrial cancer, salivary adenoid cystic carcinoma cancer, colorectal cancer, prostate cancer, glioblastoma, bladder cancer, cervical cancer, pancreatic cancer, colon cancer, breast cancer, esophageal cancer, glioma, gastric cancer, astrocytoma, and osteosarcoma. In another embodiment, the method or use comprises an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt3a-induced signaling in at least one assay, optionally wherein the antibody or immunoconjugate is an antibody or immunoconjugate described herein. In yet another embodiment, the antibody or immunoconjugate of the method or use is selected from the group consisting of (a) 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081, or (b) 5014, 5016, In yet a further embodiment, the antibody or immunoconjugate comprises the set of CDR sequences corresponding to an antibody selected from 5019 and 5020.In yet a further aspect, the cancer treated by the method or use comprises one or more cancer cells comprising a mutation in the RNF43 gene, and the antibody or immunoconjugate comprises a set of CDR sequences corresponding to antibody 5020.

[0029] Other features and advantages of the present disclosure will become apparent from the following detailed description, but it should be understood that the detailed description and specific examples, while illustrating embodiments, are given by way of illustration only, and that the claims should not be limited by the embodiments set forth in the examples, but rather should be accorded the broadest interpretation consistent with the description as a whole.

[0030] An embodiment of the present disclosure will now be described with reference to the drawings. [Brief description of the drawings]

[0031] [Figure 1] Figure 1 is a graph showing the binding of phage clones to FZD4-CRD-Fc and Fc. Single colonies were used to inoculate 96-well culture plates and overnight phage supernatants were diluted 1:2 in 0.05% Tween20 / 0.5% BSA / PBS (dilution buffer) and tested for binding by ELISA. Phages were detected using anti-M13-HRP secondary antibody (1:5000 in dilution buffer) and plates were developed with TMB substrate and acid stopper. Absorbance was read at 450 nm for FZD4-Fc-coated and control Fc-coated wells as indicated. [Diagram 2]Figure 2 is a graph showing competitive ELISA binding of anti-FZD4 Fabs. ELISA was performed to estimate the affinity of the FZD4 Fab panel. 384-well ELISA plates were coated with 2 μg / ml FZD4 CRD-Fc (R&D systems) in PBS overnight at 4°C. Plates were blocked with 0.5% BSA / PBS for 1 h at room temperature and then washed three times with 0.05% Tween20 / PBS. Fabs at a final concentration of 0.5 μg / ml were pre-incubated in non-binding 96-well ELISA plates with solutions of FZD4 CRD-Fc at the indicated concentrations (in 0.05% Tween20 / 0.5% BSA / PBS) for 1 h at room temperature. The Fab-antigen mixture was transferred to the 384-well plate and incubated at room temperature for 20 min. Plates were washed six times and bound Fab was detected with anti-FLAG-HRP secondary antibody (Sigma) at 1:5000 in 0.05% Tween20 / 0.5% BSA / PBS. Secondary antibody was incubated for 45 minutes at room temperature, plates were washed and then developed with TMB substrate with acid stopper. Absorbance was read at 450 nm. % binding was calculated by dividing the absorbance of Fab wells with competing soluble FZD4 CRD-Fc by the absorbance of Fab wells without competing soluble FZD4 CRD-Fc and multiplying by 100. [Figure 3-1] Figure 3 is a series of immunofluorescence staining photographs showing binding of anti-FZD4 Fab to FZD expressed on CHO cells. Fabs from FZD4 selections were tested for reactivity by immunofluorescence staining (IF) of CHO overexpression lines stably expressing the FZD4 CRD region as a GPI-linked domain with a myc tag. Fabs were detected using an anti-F(ab')2-FITC secondary antibody (Jackson Immuno). FITC staining is indicated by the white area. [Figure 3-2] See description of Figure 3-1. [Figure 4-1]Figure 4 is a series of immunofluorescence staining photographs showing binding of anti-FZD4 Fab to CHO cells. Fabs from FZD4 selection were tested for reactivity by immunofluorescence staining (IF) of a control CHO cell line stably transfected with a GPI linker and myc tag. Fabs were detected using an anti-F(ab')2-FITC secondary antibody (Jackson Immuno). FITC staining is indicated by the white area. [Figure 4-2] See description of Figure 4-1. [Diagram 5] FIG. 5 is a table showing binding of Fabs to FZDs as determined by IF staining. [Figure 6] FIG. 6 is a series of immunofluorescence staining photographs showing the binding of Fab5019 and Fab5020 that bind FZD in multiple human pancreatic cancer cell lines. [Figure 7-1] 7 is a series of graphs showing binding of Fab5019 and Fab5020 to pancreatic cell lines by flow cytometry. Numbers indicate fold increase in MFI compared to secondary Ab control. [Figure 7-2] See description of Figure 7-1. [Figure 8A] 8A-D are a series of graphs showing binding of anti-FZD4 Fab to FZD. [Figure 8B] 8A-D are a series of graphs showing binding of anti-FZD4 Fab to FZD. [Figure 8C] 8A-D are a series of graphs showing binding of anti-FZD4 Fab to FZD. [Figure 8D] 8A-D are a series of graphs showing binding of anti-FZD4 Fab to FZD. [Figure 9A] 9A-B are tables showing binding of anti-FZD4 Fab to FZD as determined by IF. CHO myc GPI cell line. 200 nM Fab. -= no binding; += very weak binder; ++= weak binder; +++= good binder; ++++= very good binder. [Figure 9B] See legend to Figure 9A [Figure 10]FIG. 10 is a table showing the binding affinities of anti-FZD4 Fabs to FZD4 as determined by SPR. [Figure 11] FIG. 11 is a graph showing binding of anti-FZD4 Fab to pancreatic cancer cells as measured by flow cytometry. [Figure 12]Figure 12A-B is a series of graphs showing inhibition of WNT5A binding by anti-FZD4 Fab. (A) Wnt5a (R&D systems) was biotinylated using a commercial kit (Thermo 21329 EZ-link NHS-PEG4-Biotin) and excess biotin was removed by buffer exchange using a 3000 MWCO Amicon filter. FZD4-CRD-Fc or control Fc protein (R&D systems) was diluted to the indicated concentrations in 1% BSA / 0.05% Tween20 / PBS (dilution buffer) and incubated with a constant amount of biotinylated Wnt5a for 1 h at room temperature in a BSA-blocked 96-well TC-treated plate. Control wells were also included in which only buffer was added instead of biotinylated wnt5a. Biotinylated Wnt5a was added at a final concentration of 150 ng / ul. Samples were transferred to pre-blocked streptavidin-coated plates (R&D systems) and allowed to capture for 1 h at room temperature. Wells were washed 4 times with 0.05% Tween20 / PBS, then anti-Fc-HRP (1:5000 in dilution buffer, Jackson Immuno) was added to the wells for 45 minutes at room temperature. Wells were washed 4 times and developed with TMB reagent with acid stopper. Absorbance was read at 450 nm. (B) FZD4-CRD-Fc was diluted to the concentrations previously determined in (A) to obtain an ELISA signal within the linear range and incubated with the desired Fab or buffer control for 1 hour at room temperature in a 96-well TC plate pre-blocked with 1% BSA. Control wells containing Fc protein were also included as above. Biotinylated wnt5a was added to the wells and the plate was incubated for an additional hour. Control wells were also included where only buffer was added instead of biotinylated wnt5a. Biotinylated Wnt5a was added to a final concentration of 150 ng / ul. Fab proteins were at a final concentration of 400 nM, except for Fab 6494 at 180 nM, Fab 6406 at 135 nM, and Fab 6500 at 159 nM. Negative control Fabs specific for different protein antigens were included, as well as a control for the effect from the neutralized elution buffer in which the Fab proteins were stored (Fab buffer control). Percent binding was calculated. [Figure 13]FIG. 13 is a table showing the effect of Fabs on β-catenin promoted transcription (TOPFLASH assay). [Figure 14A] 14A-H are a series of graphs depicting the effect of anti-FZD4 Fab on cancer cell proliferation. [Figure 14B] 14A-H are a series of graphs depicting the effect of anti-FZD4 Fab on cancer cell proliferation. [Figure 14C] 14A-H are a series of graphs depicting the effect of anti-FZD4 Fab on cancer cell proliferation. [Figure 14D] 14A-H are a series of graphs depicting the effect of anti-FZD4 Fab on cancer cell proliferation. [Figure 14E] 14A-H are a series of graphs depicting the effect of anti-FZD4 Fab on cancer cell proliferation. [Figure 14F] 14A-H are a series of graphs depicting the effect of anti-FZD4 Fab on cancer cell proliferation. [Figure 14G] 14A-H are a series of graphs depicting the effect of anti-FZD4 Fab on cancer cell proliferation. [Figure 14H] 14A-H are a series of graphs depicting the effect of anti-FZD4 Fab on cancer cell proliferation. [Figure 15] FIG. 15 is a table showing the effect of anti-FZD4 Fabs on pancreatic cancer cell proliferation as determined by SRB sulforhodamine B) assay, where "na" means not tested. [Figure 16] Figure 16 is a summary table of anti-FZD4 Fabs, where na means not tested. Antiproliferative activity appears to be related to binding to FZD 1, 2, 4, 5, 7, 8, 9, and inhibition of wnt3a activity. The most potent inhibitors shown in this assay are 5014, 5019-5023, and 6495. [Figure 17]Figure 17 is a graph showing that anti-FZD4 antibody inhibits the expression of Axin2, a Wnt pathway regulatory gene, in human pancreatic adenocarcinoma cell line (HPAF II). Gene expression (RT-qPCR) upon treatment with 200 nM Fab / IgG was normalized to β-actin. [Figure 18A] Figures 18A-B are a series of graphs showing the proliferation inhibition of IgG 5019 and IgG 5020. (A) shows that IgG 5019 and IgG 5020 inhibit proliferation of pancreatic cancer cells using an Alamar Blue proliferation assay, 200 nM Fab / IgG, and (B) shows that IgG 5020 inhibits cell proliferation in a dose-dependent manner. [Figure 18B-1] See legend to Figure 18A. [Figure 18B-2] See legend to Figure 18A. [Figure 19] FIG. 19 is a series of colony photographs showing that IgG 5020 inhibits colony formation. [Figure 20] FIG. 20 is a series of immunofluorescence staining photographs showing binding of Fab 5019 and Fab 5020 to FZD in PDAC patient-derived xenograft (PDX) cell lines (GP2A and GP14A). [Figure 21] FIG. 21 is a graph showing the effect of Fab 5019, Fab 5020 and IgG 5020 on proliferation of PDAC PDX cell lines in an Alamar Blue proliferation assay, 200 nM Fab / IgG. [Figure 22] FIG. 22 shows a diagram of the Wnt canonical signaling pathway. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] Detailed Description of the Disclosure I. Definition Unless otherwise defined, scientific and technical terms used in connection with this disclosure shall have the meanings commonly understood by those skilled in the art. Furthermore, unless otherwise required by context, singular terms shall include plural, and plural terms shall include singular. For example, the term "cell" includes a single cell, as well as a plurality of cells, or a population of cells. In general, the nomenclature utilized in connection with cell and tissue culture, molecular biology, and protein and oligonucleotide or polynucleotide chemistry and hybridization described herein, as well as the techniques thereof, are well known and commonly used in the art (see, for example, Green and Sambrook, 2012).

[0033] As used herein, the term "polypeptide" refers to a molecule having a sequence of natural and / or non-natural amino acids linked via peptide bonds. The term "peptide" refers to a short polypeptide, typically 30 amino acids long or less. The amino acid sequence of a polypeptide is referred to as its "primary structure". The term "protein" refers to a polypeptide having secondary, tertiary, and / or quaternary structure, e.g., a structure stabilized by hydrogen bonds, a relationship between the secondary structure and a structure formed from multiple proteins. Proteins may be further modified by other binding moieties, e.g., carbohydrates (glycoproteins), lipids (lipoproteins), phosphate groups (phosphoproteins), etc.

[0034] As used herein, an amino acid sequence "consists" of only the amino acids in that sequence.

[0035] As used herein, a first amino acid sequence "consists essentially of" a second amino acid sequence if the first amino acid sequence (1) comprises the second amino acid sequence and (2) is no more than 1, 2, or 3 amino acids longer than the second amino acid sequence.

[0036] As used herein, when a second amino acid sequence comprises a first amino acid sequence, the first amino acid sequence is a "fragment" of the second amino acid sequence. In certain embodiments, a first amino acid sequence that is a fragment of a second amino acid sequence may have 1 or less, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, or 10 or less amino acids fewer than the second amino acid sequence.

[0037] As used herein, the "functional equivalent" of a reference amino acid sequence is a sequence that is not identical to the reference sequence, but contains minor changes, such as, for example, the insertion, deletion, or substitution of one or several amino acids. A functionally equivalent sequence retains the function (e.g., immunogenicity) of the reference sequence to which it is equivalent. When a functionally equivalent amino acid sequence contains one or more amino acid substitutions to a reference sequence, these are generally conservative amino acid substitutions.

[0038] As used herein, a "conservative amino acid substitution" refers to one amino acid residue that is replaced by another without losing the desired properties of the protein. Suitable conservative amino acid substitutions can be made by substituting amino acids with similar hydrophobicity, polarity, and R chain length for each other. See, for example, Watson, et al., "Molecular Biology of the Gene," 4th Edition, 1987, The Benjamin / Cummings Pub. Co., Menlo Park, CA, p. 224. Examples of conservative amino acid substitutions include (note that some categories are not mutually exclusive):

[0039] TIFF2024153733000002.tif50133

[0040] As used herein, the term "substantially identical" refers to identity between a first amino acid sequence that includes a sufficient or a minimum number of amino acid residues that are (i) identical to aligned amino acid residues in the second amino acid sequence or (ii) conservative substitutions of aligned amino acid residues in the second amino acid sequence, such that the first and second amino acid sequences have a common structural domain and / or a common functional activity and / or a common immunogenicity. For example, amino acid sequences that include a common structural or antigenic domain that have at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity are said to be sufficiently or substantially identical. In the context of nucleotide sequences, the term "substantially identical" is used herein to refer to a first nucleic acid sequence that contains a sufficient or a minimum number of nucleotides that are identical to aligned nucleotides in a second nucleic acid sequence such that the first and second nucleotide sequences encode a polypeptide having a common functional activity, or encode a common structural polypeptide domain or a common functional polypeptide activity, or encode a polypeptide having the same immunogenic properties.

[0041] As used herein, the terms "antigen", "immunogen" and "antibody target" refer to a molecule, compound or complex that can be recognized by antibody, i.e., can be bound by antibody.The term can refer to any molecule that can be recognized by antibody, such as a polypeptide, a polynucleotide, a carbohydrate, a lipid, a chemical moiety, or a combination thereof (such as a phosphorylated polypeptide or a glycosylated polypeptide).Those skilled in the art will understand that the term does not indicate that a molecule is immunogenic in all circumstances, but simply indicates that it can be targeted by antibody.

[0042] As used herein, the term "epitope" refers to the localized site on an antigen that is recognized and bound by an antibody.Epitope can comprise a few amino acids, or a portion of a few amino acids, for example, 5 or 6 or more, for example, 20 or more amino acids, or a portion of these amino acids.In some cases, epitopes comprise non-protein components, for example, from carbohydrates, nucleic acids, or lipids.In some cases, epitopes are three-dimensional parts.Thus, for example, when the target is a protein, epitopes can be composed of consecutive amino acids, or amino acids from different parts of the protein that are brought into close proximity by folding of the protein (for example, discontinuous epitopes).

[0043] As used herein, the term "antibody" refers to an immunoglobulin that recognizes and specifically binds to one or more target antigens, such as proteins, polypeptides, peptides, carbohydrates, polynucleotides, lipids, or combinations thereof. This binding occurs through at least one antigen recognition site in the variable region of the immunoglobulin, to one or more epitopes on the antigen. The variable region is of utmost importance for binding specificity and affinity. As used herein, the term "antibody" encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments, single-chain Fv (scFv) variants, multispecific antibodies, chimeric antibodies, humanized antibodies, human antibodies, hybrid antibodies, fusion proteins, and any other immunoglobulin molecule that contains an antigen recognition site, so long as the antibody exhibits the desired biological activity. Antibodies can be of (i) any of the five major classes of immunoglobulins based on the identity of their heavy chain constant domains-α (IgA), δ (IgD), ε (IgE), γ (IgG), and μ (IgM), or (ii) their subclasses (isotypes) (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2). The light chains can be either λ or κ. Antibodies can be naked or conjugated to other molecules, e.g., toxins, drugs, radioisotopes, chemotherapeutic agents, etc.

[0044] In one embodiment, an "intact antibody" comprises a tetramer composed of two identical pairs of polypeptide chains, each pair having one "light" chain (about 25 kD) and one "heavy" chain (about 50-70 kD). The heavy and light chains are linked via covalent and non-covalent bonds (e.g., disulfide bonds) that vary in number and amount among the various immunoglobulin classes. In one embodiment, each chain comprises a variable region and a constant region. The antigen recognition site of the variable region is composed of a hypervariable region or complementarity determining region (CDR) and a framework region. The framework region typically does not contact the antigen, but provides structural support for the CDRs. The constant region interacts with other immune cells of the body. Between the constant region and the variable region (only IgG, IgD, IgA, not IgM or IgE), in the middle between the two heavy chains, there is a hinge region that provides flexibility to link antigen binding.

[0045] Below is a non-exhaustive list of different antibody forms that all retain antigen-binding activity: (1) Whole immunoglobulin (also called an "intact" antibody) (two light chains and two heavy chains, e.g., a tetramer). (2) An immunoglobulin polypeptide (light or heavy chain). (3) Antibody fragments, such as Fv (monovalent or bivalent variable region fragments), are fragments of a variable region (e.g., V L and / or V H ), Fab(V L C L V H C H ), F(ab')2, Fv(V L V H ), scFv (single chain Fv) (V linked by a linker, e.g., a peptide linker L and V H (a polypeptide comprising a CH3 domain), (scFv)2, sc(Fv)2, bispecific sc(Fv)2, bispecific (scFv)2, minibodies (sc(Fv)2 fused to a CH3 domain), and triabodies are trivalent sc(Fv)3 or trispecific sc(Fv)3. (4) Multivalent antibodies (antibodies that contain binding regions that bind two different epitopes or proteins, e.g., "scorpion" antibodies. (5) Fusion proteins, which contain the binding portion of an immunoglobulin fused to another amino acid sequence (such as a fluorescent protein).

[0046] As used herein, the term "antibody fragment" refers to a portion or part of an antibody or antibody chain that contains fewer amino acid residues than an intact or complete antibody or antibody chain and binds to an antigen or competes with the intact antibody. Fragments can be obtained by chemical or enzymatic treatment of an intact or complete antibody or antibody chain. Fragments can also be obtained by recombinant means. For example, F(ab')2 fragments can be generated by treating an antibody with pepsin. The resulting F(ab')2 fragments can be treated to reduce disulfide bridges to generate Fab' fragments. Papain digestion can result in the formation of Fab fragments. Fab, Fab' and F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments, and other fragments can also be constructed by recombinant expression techniques.

[0047] Although various antibody fragments have been defined in terms of the products of digestion of intact antibodies, those skilled in the art will understand that such fragments may also be synthesized chemically de novo or constructed and expressed using recombinant DNA methodologies.

[0048] A single chain Fv (scFv) is a VFv that is linked by a linker, e.g., a peptide linker. L and V HscFvs refer to polypeptides comprising: scFvs can also be used to form tandem (or bivalent) scFvs or diabodies. The generation and properties of tandem scFvs and diabodies are described, for example, in Asano et al. (2011) J Biol. Chem. 286: 1812; Kenanova et al. (2010) Prot Eng Design Sel 23: 789; Asano et al. (2008) Prot Eng Design Sel 21: 597.

[0049] Antibody fragments further include Fd antibodies (the portion of the heavy chain contained in the Fab fragment) and single domain antibodies. Single domain antibodies (sdAbs) are variable domains of either the heavy or light chain that are produced by recombinant methods.

[0050] The phrase "set of CDR sequences" as used herein refers to the three heavy chain CDRs and / or three light chain CDRs of a particular antibody described herein. A "light chain" CDR sequence set refers to the light chain CDR sequences. A "heavy chain" CDR sequence set refers to the heavy chain CDR sequences. A "complete" CDR sequence set refers to both the heavy chain CDR sequences and the light chain CDR sequences. For example, for antibody 5017, the complete CDR sequence set includes or consists of SVSSA (CDR L1) (SEQ ID NO: 103), SASSLYS (CDR L2) (SEQ ID NO: 104), AAYHWPPLF (CDR L3) (SEQ ID NO: 148), LYYTDM (CDR H1) (SEQ ID NO: 149), SISLFFGYVS (CDR H2) (SEQ ID NO: 150), and YLAM (CDR H3) (SEQ ID NO: 151), as shown in Table 1a. The CDR sequence for each CDR can, for example, include, consist essentially of, or consist of the CDRs of Table 1a or 3a. The CDRs are predicted based on IMGT sequence alignments.

[0051] As used herein, the term "monoclonal antibody" refers to a clonal preparation or composition of antibodies having a single binding specificity and affinity for a given epitope on an antigen (a "monoclonal antibody composition"). A "polyclonal antibody" refers to a preparation or composition of antibodies raised against a single antigen but with differing binding specificities and affinities (a "polyclonal antibody composition").

[0052] As used herein, the term "chimeric antibody" refers to an antibody having amino acid sequences derived from two or more species. In one embodiment, the variable regions of both the light and heavy chains correspond to the variable regions of an antibody derived from one species of mammal (e.g., mouse, rat, rabbit, etc.) with the desired specificity, affinity, and capacity, while the constant regions are homologous to sequences derived from another species (typically in the subject being treated, e.g., human) to avoid eliciting an immune response.

[0053] As used herein, the term "humanized antibody" refers to a chimeric antibody in which CDRs derived from the VH and VL regions of a non-human antibody with desired specificity, affinity, and capacity are grafted onto human framework sequences. In one embodiment, framework residues of the humanized antibody are modified to improve and optimize the specificity, affinity, and capacity of the antibody. Humanization, i.e., replacement of non-human CDR sequences with the corresponding sequences of a human antibody, can be carried out according to the methods described, for example, in U.S. Pat. Nos. 5,545,806, 5,569,825, 5,633,425, 5,661,016, Riechmann et al., Nature 332: 323-327(1988); Marks et al., Bio / Technology 10: 779-783(1992); Morrison, Nature 368: 812-13(1994); Fishwild et al., Nature Biotechnology 14: 845-51(1996).

[0054] As used herein, the term "human antibody" refers to an antibody produced by a human or an antibody having a corresponding amino acid sequence produced by any technique known in the art.

[0055] As used herein, the term "hybrid antibody" refers to an antibody in which a pair of heavy and light chains from antibodies with different antigenic determinant regions are assembled together such that the resulting tetramer can recognize and bind two different epitopes or two different antigens. Hybrid antibodies can be bispecific (binding to two different antigens or epitopes) or multispecific (binding to more than one different antigen or epitope).

[0056] As used herein, an antibody is "monospecific" if all of its antigen-binding sites bind to the same epitope.

[0057] As used herein, an antibody is "bispecific" if it has at least two different antigen-binding sites that each bind to a different epitope or antigen.

[0058] As used herein, an antibody is "multivalent" if it has multiple antigen-binding sites. For example, a tetravalent antibody has four antigen-binding sites.

[0059] Specificity of binding can be defined in terms of the comparative dissociation constant (Kd) of the antibody (or other targeting moiety) for the target, compared to the dissociation constants for the antibody and other materials in the environment, or generally unrelated molecules. d represents a relatively low affinity interaction, K d Conversely, a relatively small (relatively low) K d represents a relatively high affinity interaction or relatively tight binding, K d By way of example only, the K of an antibody that specifically binds to a target is dcan be femtomolar, picomolar, nanomolar or micromolar and is the K of the antibody binding to unrelated material d The binding affinity can be in the micromolar range (kD=10 -4 ~10 -6 ), nanomolar range (kD=10 -7 M~10 -9 M), picomolar range (kD = 10 -10 M~10 -12 M), or in the femtomolar range (kD = 10 -13 M~10 -15 M).

[0060] As used herein, an antibody is -4 An agent "binds" to or "recognizes" an antigen or epitope if it binds to the antigen or epitope with a Kd of less than M (i.e., in the micromolar range). The term "binds" in reference to a cell type (e.g., an antibody that binds to cancer cells) typically indicates that the agent binds to the majority of cells in a pure population of those cells. For example, an antibody that binds to a given cell type typically binds to at least 2 / 3 (e.g., 67, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) of the cells in the population of cells shown. In some cases, binding to a polypeptide can be assayed by comparing the binding of the antibody to cells that display the polypeptide with the binding (or lack thereof) of the antibody to cells that do not express the polypeptide. Those skilled in the art will recognize that some variation occurs depending on the method and / or threshold value that determines binding. The affinity of an antibody for a target can be determined according to methods known in the art, for example, as reviewed in Ernst et al. Determination of Equilibrium Dissociation Constants, Therapeutic Monoclonal Antibodies (Wiley & Sons ed. 2009).

[0061] As used herein, the term "relatively greater affinity" refers to the ability of antibody X to bind to target Y more strongly than to target Z (K on ) and / or the dissociation constant (K off ) is small, in this context, antibody X has a greater affinity for target Y than Z. Similarly, the term "relatively low affinity" herein refers to the degree of antibody binding where antibody X binds to target Y with a weaker and / or larger dissociation constant than target Z, in this context, antibody X has a lesser affinity for target Y than Z. The affinity of binding between an antibody and its target antigen is determined by the following formula: 1 / K D Equal to K A where K D k on / k off is equal to k on and k off The value of can be measured using surface plasmon resonance technology, for example, using the Molecular Affinity Screening System (MASS-1) (Sierra Sensors GmbH, Hamburg, Germany). Antagonists or blocking antibodies are antibodies that partially or completely block or neutralize the biological activity associated with the target antigen, compared to the activity under similar physiological conditions in the absence of the antibody. Antagonists can be competitive, non-competitive, or irreversible. Competitive antagonists are substances that bind to the natural ligand or receptor at the same site as the natural ligand-receptor interaction, or bind allosterically in a manner that induces a change that prevents normal binding. Non-competitive antagonists bind at a site different from the natural ligand-receptor interaction, but reduce the KD or signal resulting from the interaction. Irreversible inhibitors cause covalent modifications to the receptor, preventing any subsequent binding.

[0062] As used herein, the term "avidity" refers to the overall stability of the binding complex between antibody and target antigen.It is defined by three factors: (i) the inherent affinity of antibody to antigen, (2) the binding valency of antibody, and (3) the geometric arrangement of interacting components.Affinity is the strength of the interaction between antibody and a single target, whereas avidity is the cumulative strength of multiple affinities.In one aspect, the antibody disclosed herein is bivalent.

[0063] As used herein, an antibody "preferentially binds" a first antigen compared to a second antigen if it binds the first antigen with greater affinity than the second antigen. Preferential binding can be at least any of 2-fold, 5-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 500-fold, or 1000-fold greater affinity. Thus, for example, an antibody preferentially binds a first FZD protein compared to a second FZD protein if it binds the first FZD protein with greater affinity than it binds the second FZD protein.

[0064] As used herein, an antibody is defined as a concentration of 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12 An antibody "specifically binds" or is "specific" for a target antigen, or for a target group of antigens, if it binds to the target antigen, or each member of the target group of antigens, with at least some affinity of M, e.g., with an affinity that is at least twice its affinity for a non-target antigen being compared. Typically, specific binding is characterized by binding to an antigen with sufficient affinity that the antibody is useful as a diagnostic agent for detecting the antigen or epitope and / or as a therapeutic agent in targeting the antigen or epitope.

[0065] When an antibody specifically binds to a target group of proteins (e.g., some or all members of the Frizzled protein family), the binding affinity of the antibody to the weakest binding target group member is greater than the binding affinity of the antibody to a non-target antigen. In one embodiment, an antibody that specifically binds to each of the cysteine-rich domains (CRDs) of one or more human Frizzled (FZD) receptors selected from FZD 1, 2, 4, 5, 7, 8, 9 more generally refers to an antibody that specifically binds to the selected member of this group compared to non-selected group members or other antigens. Thus, for example, an antibody that specifically binds to the cysteine-rich domains of the target group consisting of FZD1, FZD2, FZD4, FZD5, and FZD7 specifically binds to these proteins and does not specifically bind to FZD3, FZD8, FZD9, and FZD10.

[0066] As used herein, an antibody "blocks" or "antagonizes" the binding of a ligand to a receptor if it competitively reduces or prevents any interaction between the ligand and the receptor. In one embodiment, the measured reduction level can be at least 5%, 10%, 25%, 50%, 80%, 90%, 95%, 97.5%, 99%, 99.5%, 99.9% of control (e.g., untreated) cells. For example, an antibody that antagonizes or blocks the binding of a Wnt ligand to a FZD receptor competitively reduces or prevents the interaction of a Wnt protein with the FZD receptor. This attenuates or blocks downstream signaling events associated with Wnt signaling. This includes, for example, the activation of disheveled, dissolution of β-catenin degradation complex, reduction of cytosolic levels of β-catenin, and / or reduction of the activity of TCF / LEF-mediated transcription.

[0067] The term "capture" with respect to an antibody target (e.g., an antigen, an analyte, an immune complex) typically indicates that the antibody binds to a majority of the antibody target in a pure population (assuming the appropriate molar ratio). For example, an antibody that binds to a given antibody target typically binds at least 2 / 3 of the antibody target in solution (e.g., at least any of 67, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%). Those skilled in the art will recognize that some variation occurs depending on the method and / or threshold value for determining binding.

[0068] The term "conjugate" refers to a first molecule, e.g., an antibody, that is chemically linked to a moiety, such as a detectable label, or a biologically active moiety, such as a drug, a toxin, or a chemotherapeutic or cytotoxic agent (an "immunoconjugate"). Thus, the present disclosure contemplates antibodies that are conjugated to one or more moieties. Furthermore, an antibody can be a "conjugated antibody" or an "unconjugated antibody" (i.e., not conjugated to a moiety).

[0069] As used herein, the term "antibody-drug conjugate" or ("ADC") refers to an antibody conjugated with a drug. Typically, the conjugation involves covalent attachment via a linker.

[0070] As used herein, the term "labeled" molecule (e.g., a nucleic acid, protein, or antibody) refers to a molecule that is attached to a detectable label, either covalently via a linker or chemical bond, or non-covalently via ionic, van der Waals, electrostatic, or hydrogen bonds, such that the presence of the molecule can be detected by detecting the presence of the detectable label attached to the molecule.

[0071] As used herein, the term "detectable label" refers to a composition that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. Examples of detectable labels are described herein, and examples of detectable labels include, but are not limited to, colorimetric labels, fluorescent labels, chemiluminescent labels, enzyme labels, and radioactive labels. For the purposes of this disclosure, detectable labels can also be moieties that do not generate a signal themselves (e.g., biotin) but bind to a second moiety that can generate a signal (e.g., labeled avidin).

[0072] The term "crosslinked" with respect to an antibody refers to the attachment of the antibody to a solid or semi-solid matrix (e.g., sepharose, beads, microtiter plate), or to another protein or antibody. For example, antibodies can be multimerized to create antibody complexes with multiple (more than two) antigen binding sites. Antibodies can be multimerized by expressing them as high valency isotypes (e.g., IgA or IgM, which typically form complexes of two or five antibodies, respectively). Multimerization of antibodies can also be performed by using crosslinkers that contain reactive groups (e.g., carbodiimides, NHS esters, etc.) that can link proteins. Methods and compositions for crosslinking antibodies to matrices are described, for example, in the catalogs and websites of Abcam and New England Biolab (available at abcam.com and neb.com). Crosslinker compounds with various reactive groups are described, for example, in the catalogs and websites of Thermo Fisher Scientific (available at piercenet.com).

[0073] As used herein, the term "immunoassay" refers to a method of detecting an analyte by detecting binding between the analyte and an antibody that recognizes the analyte.

[0074] As used herein, the term "expression construct" refers to a polynucleotide that contains an expression control sequence operably linked to a heterologous nucleotide sequence to be expressed (i.e., a sequence to which the expression control sequence is not normally linked in nature). As used herein, the term "expression vector" refers to a polynucleotide that contains an expression construct and a sequence sufficient for replication in a host cell or insertion into a host chromosome. Plasmids and viruses are examples of expression vectors. As used herein, the term "expression control sequence" refers to a nucleotide sequence that regulates the transcription and / or translation of a nucleotide sequence operably linked to it. Expression control sequences include promoters, enhancers, repressors (transcriptional regulatory sequences), and ribosome binding sites (translational regulatory sequences).

[0075] The term "vector" as used herein includes any intermediate vehicle for a nucleic acid molecule that allows the nucleic acid molecule to be introduced into, for example, a prokaryotic and / or eukaryotic cell and / or integrated into a genome, including a plasmid, a phagemid, a bacteriophage, or a viral vector, such as a retrovirus-based vector, an adeno-associated viral vector, etc. As used herein, the term "plasmid" generally refers to a construct of extrachromosomal genetic material, usually a circular DNA double strand, that can replicate independently of chromosomal DNA.

[0076] As used herein, a nucleotide sequence is "operably linked" to an expression control sequence if the expression control sequence functions in a cell to control the transcription of the nucleotide sequence, including promoting transcription of the nucleotide sequence through interaction between a polymerase and a promoter.

[0077] As used herein, a "host cell" refers to a recombinant cell that contains an expression construct.

[0078] As used herein, the term "biological sample" refers to a sample containing cells (e.g., tumor cells) or biological molecules derived from cells. Biological samples can be obtained from a subject, e.g., a patient, from an animal, such as an animal model, or from cultured cells, e.g., cell lines or cells removed from a patient and grown in culture for observation. Biological samples can include tissues and / or fluids. Biological samples can be obtained from any biological source, including, but not limited to, blood, blood fractions (e.g., serum or plasma), cerebrospinal fluid (CSF), lymph, tears, saliva, sputum, buccal swabs, breast milk, urine, or feces. Biological samples can be biopsies, e.g., tissue biopsies, e.g., needle biopsies, fine needle biopsies, surgical biopsies, and the like. Samples can include tissue samples with lesions or suspected lesions, but biological samples can also be derived from another site, e.g., a site of suspected metastasis, lymph nodes, or blood. Biological samples can be a portion of a sample taken from a subject. Examples of tissue samples include brain tissue samples or neural tissue samples. Methods for obtaining such biological samples are known in the art, including but not limited to standard blood collection procedures.

[0079] As used herein, the term "diagnosis" refers to the relative probability that a subject has a disorder such as cancer.Similarly, the term "prognosis" refers to the relative probability that a particular future outcome may occur to a subject.For example, in the context of the present disclosure, prognosis can refer to the likelihood that an individual will develop cancer, the likelihood that an individual will have a recurrence, the likelihood that cancer will metastasize, the likelihood that cancer will be cured, or the likely severity of disease (e.g., severity of symptoms, rate of functional decline, survival rate, etc.).The term is not intended to be absolute, as will be understood by those skilled in the art of medical diagnosis.

[0080] As used herein, the terms "therapy", "treatment", "therapeutic intervention" and "amelioration" refer to any activity that results in a reduction in the severity of symptoms. In the case of cancer, treatment can refer to, for example, reducing tumor size, the number of cancer cells, growth rate, metastatic activity, reducing cell death of non-cancerous cells, reducing nausea and other side effects of chemotherapy or radiotherapy, and the like. The terms "treat" and "prevent" are not intended to be absolute terms. Treatment and prevention can refer to any delay in onset, amelioration of symptoms, improving patient survival, increasing survival time or survival rate, and the like. Treatment and prevention can be complete (undetectable levels of neoplastic cells) or partial, such that fewer neoplastic cells are found in the patient than would have occurred without the intervention. The effect of treatment can be compared to an individual not receiving treatment, or a pool of individuals, or the same patient at different times before or during treatment. In some aspects, the severity of the disease is reduced by at least 10%, for example, compared to the individual before administration or to a control individual not receiving treatment. In some aspects, the severity of the disease is reduced by at least 25%, at least 50%, at least 75%, at least 80%, or at least 90%, or in some cases, is no longer detectable using standard diagnostic techniques.

[0081] As used herein, the terms "effective amount", "effective dose" and "therapeutically effective amount" refer to an amount of an agent, such as an antibody or immunoconjugate, sufficient to produce a desired response, such as reducing or eliminating the signs or symptoms of a disease state or ameliorating a disorder. In some examples, an "effective amount" is an amount effective to treat (including prevent) one or more symptoms and / or underlying causes of any of the disorders or diseases and / or prevent the progression of the disease. For example, for a given parameter, a therapeutically effective amount shows an increase or decrease in therapeutic efficacy by at least any of 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. The therapeutic efficacy can also be expressed as a "fold" increase or decrease. For example, a therapeutically effective amount can have at least any of 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more efficacy over a control.

[0082] As used herein, the term "pharmaceutical composition" refers to a composition comprising a pharmaceutical compound (eg, a drug) and a pharma- ceutically acceptable carrier.

[0083] As used herein, the term "pharmaceutical acceptable" refers to a carrier that is compatible with other components of a pharmaceutical composition and can be safely administered to a subject.The term is used synonymously with "physiologically acceptable" and "pharmacologically acceptable".Pharmaceutical compositions and the techniques for their preparation and use are known to those skilled in the art in light of this disclosure. For detailed listings of suitable pharmacological compositions and techniques for their administration, reference may be made to documents such as Remington's Pharmaceutical Sciences, 17th ed. 1985; Brunton et al., "Goodman and Gilman's The Pharmacological Basis of Therapeutics," McGraw-Hill, 2005; University of the Sciences in Philadelphia(eds.), "Remington: The Science and Practice of Pharmacy," Lippincott Williams&Wilkins, 2005; and University of the Sciences in Philadelphia(eds.), "Remington: The Principles of Pharmacy Practice," Lippincott Williams&Wilkins, 2008.

[0084] Pharmaceutically acceptable carriers are generally sterile, at least for human use.Pharmaceutical compositions generally contain agents for buffering and preservation during storage, and may contain buffers and carriers for appropriate delivery depending on the route of administration.Examples of pharmaceutical acceptable carriers include, but are not limited to, normal (0.9%) saline, phosphate buffered saline (PBS), Hanks' balanced salt solution (HBSS), and multiple electrolyte solutions, such as PlasmaLyte ATM (Baxter).

[0085] Acceptable carriers, excipients, and / or stabilizers are nontoxic to recipients at the dosages and concentrations employed and include, but are not limited to, buffers, e.g., phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid, glutathione, cysteine, methionine, and citric acid; preservatives, such as ethanol, benzyl alcohol, phenol, m-cresol, p-chloro-m-cresol, methyl or propyl paraben, benzalkonium chloride, or combinations thereof; amino acids, e.g., arginine, glycine, ornithine, lysine, histidine, glutamic acid, aspartic acid, isoleucine, leucine, alanine, phenylalan ... laminine, tyrosine, tryptophan, methionine, serine, proline, and combinations thereof; monosaccharides, disaccharides, and other carbohydrates; low molecular weight (less than about 10 residues) polypeptides; proteins, such as gelatin or serum albumin; chelating agents, such as EDTA; sugars, such as trehalose, sucrose, lactose, glucose, mannose, maltose, galactose, fructose, sorbose, raffinose, glucosamine, N-methylglucosamine, galactosamine, and neuraminic acid; and / or non-ionic surfactants, such as Tween, Pluronics, Triton-X, or polyethylene glycol (PEG).

[0086] The terms "dose" and "dosage" are used interchangeably herein. Dose refers to the amount of active ingredient given to an individual at each administration. In the present invention, dose can refer to the concentration of an antibody or related component, the amount of, for example, a therapeutic agent, or the amount of a radioactive label administered. Dosage varies depending on several factors, including frequency of administration, size and tolerance of the individual, severity of the condition, risk of side effects, route of administration, and imaging modality of detectable label (if present). Those skilled in the art will recognize that dosage may be altered depending on the above factors or based on the progress of treatment. The term "dosage form" refers to the specific format of a pharmaceutical product and depends on the route of administration. For example, the dosage form can be a liquid, for example, saline for injection.

[0087] As used herein, the term "subject" refers to an individual animal. As used herein, the term "patient" refers to a subject under the care or supervision of a medical provider, such as a doctor or nurse. Subjects include mammals, such as humans and non-human primates, such as monkeys, as well as dogs, cats, horses, cows, rabbits, rats, mice, goats, pigs, and other mammalian species. Subjects may also include birds. A patient may be an individual who is seeking treatment, monitoring, adjustment or modification of an existing treatment regimen, and the like. The term "cancer subject" refers to an individual who has been diagnosed with cancer. Cancer patients may include individuals who are not undergoing treatment, individuals who are currently undergoing treatment, individuals who have undergone surgery, and individuals who have discontinued treatment.

[0088] In the context of cancer treatment, a subject in need of treatment can refer to an individual who has cancer or a precancerous condition, an individual who has previously had cancer and is at risk of recurrence, an individual suspected of having cancer, or an individual who is undergoing standard treatment for cancer, such as radiation therapy or chemotherapy.

[0089] Terms such as "cancer," "tumor," and "transformed" include precancerous, neoplastic, transformed, and cancerous cells and can refer to solid or nonsolid tumors (see, e.g., Edge et al. AJCC Cancer Staging Manual (7th ed. 2009); Cibas and Ducatman Cytology: Diagnostic principles and clinical correlates (3rd ed. 2009)). Cancer includes both benign and malignant neoplasms (abnormal growth). "Transformation" refers to spontaneous or induced phenotypic changes, such as cellular immortalization, morphological changes, abnormal cell proliferation, contact inhibition, and loss of fixation, and / or malignant tumors (see Freshney, Culture of Animal Cells a Manual of Basic Technique (3rd ed. 1994)). Transformation can result from infection with a transforming virus and integration of new genomic DNA, or uptake of exogenous DNA, but can also occur spontaneously or following exposure to carcinogens.

[0090] The term "cancer" can refer to any cancer, including, but not limited to, leukemia, carcinoma, sarcoma, adenocarcinoma, lymphoma, solid cancer, lymphatic cancer, etc. Examples of various types of cancer include, but are not limited to, lung cancer (e.g., non-small cell lung cancer, or NSCLC), breast cancer, prostate cancer, colorectal cancer, bladder cancer, ovarian cancer, leukemia, liver cancer (i.e., hepatocellular carcinoma), renal cancer (i.e., renal cell carcinoma), thyroid cancer, pancreatic cancer, uterine cancer, cervical cancer, testicular cancer, esophageal cancer, stomach (gastric) cancer, kidney cancer, cancer of the central nervous system, skin cancer, glioblastoma, and melanoma.

[0091] As used herein, a chemical entity, such as a polypeptide, is "substantially pure" if it is the predominant chemical entity of that type (e.g., a polypeptide) in a composition. This includes chemical entities that make up more than 50%, more than 80%, more than 90%, more than 95%, more than 98%, more than 99%, more than 99.5%, more than 99.9%, or more than 99.99% of the chemical entities of that type in a composition.

[0092] The phrase "isolated antibody" refers to an antibody that is produced in vivo or in vitro, removed from the source that produced the antibody, e.g., an animal, a hybridoma or other cell line (a recombinant insect cell that produces an antibody, a yeast cell, or a bacterial cell).

[0093] "Substantially pure" or "isolated" means that the object species is the predominant species present (i.e., more abundant, on a molar basis, than any other individual macromolecular species in the composition) and that a substantially purified fraction is a composition in which the object species constitutes at least about 50% (on a molar basis) of the total macromolecular species present. Generally, a substantially pure composition means that about 80%-90% or more of the macromolecular species present in the composition is the purified species of interest. When a composition consists essentially of a single macromolecular species, the object species is purified to essential homogeneity (contaminating species cannot be detected in the composition by conventional detection methods). Solvent species, small molecules (<500 Daltons), stabilizers (e.g., BSA), and elemental ion species are not considered macromolecular species for purposes of this definition.

[0094] The term "sequence identity" as used herein refers to the percentage of sequence identity between two polypeptide sequences or two nucleic acid sequences. To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced into the sequence of the first amino acid sequence or nucleic acid sequence for optimal alignment with the second amino acid sequence or nucleic acid sequence). The amino acid residues or nucleotides at the corresponding amino acid or nucleotide positions are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical overlapping positions / total number of positions x 100%). In one embodiment, the two sequences are the same length. Determining the percent identity between two sequences can also be achieved using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm used to compare two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87: 2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90: 5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol. 215: 403. For example, BLAST nucleotide searches can be performed using the NBLAST nucleotide program parameters set to score=100 and word length=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the present application. For example, BLAST protein searches can be performed using the XBLAST program parameters set to score-50 and word length=3 to obtain amino acid sequences homologous to the protein molecules described herein.To obtain gapped alignments for comparison purposes, Gapped BLAST, as described in Altschul et al., 1997, Nucleic Acids Res. 25: 3389-3402, can be used. Alternatively, PSI-BLAST can be used to perform an iterative search that detects distant relationships between molecules (ibid.). When using the BLAST, Gapped BLAST and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used (see, e.g., the NCBI website). Another preferred, non-limiting example of a mathematical algorithm used for comparing sequences is the algorithm of Myers and Miller, 1988, CABIOS 4: 11-17. Such an algorithm is incorporated in the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program to compare amino acid sequences, a PAM120 weighted residue table, a gap length penalty of 12 and a gap penalty of 4 can be used. The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.

[0095] For antibodies, the percentage sequence identity can be determined when the antibody sequences are maximally aligned by IMGT. After alignment, when a region of a subject antibody (e.g., the entire mature variable region of a heavy or light chain) is compared with the same region of a reference antibody, the percentage sequence identity between the subject and reference antibody regions is the number of positions occupied by the same amino acid in both the subject and reference antibody regions divided by the total number of aligned positions in the two regions, multiplied by 100, and converted to a percentage.

[0096] Percent amino acid sequence identity can also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25: 3389-3402(1997)). The NCBI-BLAST2 sequence comparison program is available from the National Institutes of Health, Bethesda, Md. NCBI-BLAST2 uses several search parameters, all of which are set to default values, including, for example, unmask=yes, strand=all, expected occurrences=10, minimum low complexity length=15 / 5, multipass e-value=0.01, multipass constant=25, final gapped alignment dropoff=25, and scoring matrix=BLOSUM62.

[0097] In the context of using NCBI-BLAST2 for amino acid sequence comparison, the % amino acid sequence identity of a given amino acid sequence A to, with, or relative to a given amino acid sequence B (alternatively, it can be stated that a given amino acid sequence A has or contains a particular % amino acid sequence identity to, with, or relative to a given amino acid sequence B) is calculated as follows: 100 x fraction X / Y where X is the number of amino acid residues scored as identical matches by the sequence alignment program NCBI-BLAST2 in the alignment of A with B in the program, and Y is the total number of amino acid residues in B. It is understood that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B is not equal to the % amino acid sequence identity of B to A. The term "nucleic acid sequence" as used herein refers to a sequence of nucleoside or nucleotide monomers consisting of naturally occurring bases, sugars and intersugar (backbone) linkages, including cDNA. The term also includes modified or substituted sequences that include non-naturally occurring monomers or portions thereof. The nucleic acid sequences of the present application may be deoxyribonucleic acid sequences (DNA) or ribonucleic acid sequences (RNA) and may include naturally occurring bases including adenine, guanine, cytosine, thymidine, and uracil. The sequences may also include modified bases. Examples of such modified bases include aza and deaza adenine, guanine, cytosine, thymidine, and uracil, as well as xanthine and hypoxanthine. It is understood that polynucleotides containing non-transcribeable nucleotide bases can be useful, for example, as probes in hybridization assays. Nucleic acids can be either double-stranded or single-stranded, and represent sense or antisense strands. Furthermore, the term "nucleic acid" includes complementary nucleic acid sequences, and codon-optimized codon equivalents or synonymous codon equivalents.

[0098] As used herein, the term "isolated nucleic acid" refers to a nucleic acid that is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. An isolated nucleic acid is also substantially free of sequences that naturally flank the nucleic acid from which it is derived (i.e., sequences located at the 5' and 3' ends of the nucleic acid).

[0099] "At least moderately stringent hybridization conditions" means that conditions are selected that promote selective hybridization between two complementary nucleic acid molecules in solution. Hybridization can occur to all or part of the nucleic acid sequence molecule. The hybridizing portion is typically at least 15 (e.g., 20, 25, 30, 40, or 50) nucleotides in length. Those skilled in the art will recognize that the stability of a nucleic acid duplex or hybrid is determined by Tm (Tm=81.5°C-16.6(Log10[Na+])+0.41(%(G+C)-600 / l), or a similar formula), which is a function of sodium ion concentration and temperature in a sodium-containing buffer. Thus, the parameters of the washing conditions that determine hybrid stability are sodium ion concentration and temperature. To identify molecules similar but not identical to known nucleic acid molecules, it can be assumed that 1% mismatch results in a drop in Tm of about 1°C, for example, if a nucleic acid molecule with >95% identity is sought, the final wash temperature is reduced by about 5°C. Based on these considerations, a person skilled in the art will be able to easily select appropriate hybridization conditions. In a preferred embodiment, stringent hybridization conditions are selected. As an example, the following conditions may be used to achieve stringent hybridization: hybridization with 5x sodium chloride / sodium citrate (SSC) / 5x Denhardt's solution / 1.0% SDS at Tm-5°C based on the above formula, followed by washing with 0.2x SSC / 0.1% SDS at 60°C. Moderately stringent hybridization conditions include a washing step with 3x SSC at 42°C. However, it is understood that equivalent stringency can be achieved using alternative buffers, salts, and temperatures.Additional guidance regarding hybridization conditions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY, 2002, and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2001.

[0100] The term "treat" or "treatment" as used herein and well understood in the art, refers to an approach to obtain beneficial or desired results, including clinical results. Beneficial or desired clinical results may include, without limitation, alleviation or amelioration of one or more symptoms or pathology, whether detectable or undetectable, attenuation of the extent of disease, stabilization (i.e., not worsening) of disease, prevention of disease spread, prolongation or delay of disease progression, improvement or alleviation of disease state, reduction of disease recurrence, and remission (whether partial or total). "Treat" or "treatment" may also mean prolonging survival compared to expected survival in the absence of treatment. "Treat" or "treatment" as used herein also includes prophylactic treatment. For example, a subject with cancer may be treated to prevent progression, and may be treated with an antibody, immunoconjugate, nucleic acid, or composition described herein to prevent progression.

[0101] As used herein, the term "administration" means providing or giving to a subject an effective amount of an agent, such as a composition comprising an antibody, by an effective route, such as an intratumoral or intravenous route.

[0102] As used herein, the term "diluent" refers to a pharma- ceutically acceptable carrier that does not inhibit the physiological activity or properties of the active compound, such as the antibody or immunoconjugate that is administered, does not stimulate the subject, and does not neutralize the biological activity and properties of the administered compound.Diluent includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservative salts, preservatives, binders, excipients, disintegrants, lubricants, and similar materials, and combinations thereof, as known to those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, which is incorporated herein by reference).Except where any conventional carrier is incompatible with the active ingredient, its use in pharmaceutical compositions is contemplated.

[0103] A composition or method that "comprising" or "including" one or more recited elements may include other elements not specifically recited. For example, a composition that "comprises" or "includes" an antibody may contain the antibody alone or in combination with other components.

[0104] For purposes of understanding the scope of the present disclosure, the term "consisting of" and its derivatives as used herein are intended to be closed terminology specifying the presence of stated features, elements, components, groups, integers, and / or steps and excluding the presence of other unrecited features, elements, components, groups, integers, and / or steps.

[0105] The recitation of numerical ranges by endpoints herein includes all numbers and fractions subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to be understood that all such numbers and fractions are presumed to be modified by the term "about." Additionally, the singular forms of the articles "a," "an," and "the" are to be understood to include plural references unless the context clearly dictates otherwise. For example, the term "antibody" or "at least one antibody" can include a plurality of antibodies, including mixtures thereof.

[0106] The terms "Frizzled" and "FZD" refer to any gene or protein member of the Frizzled family, depending on the context. Frizzled proteins are involved in the activation of Dishevelled proteins in the cytosol. Frizzled refers to any of Frizzled-1, Frizzled-2, Frizzled-3, Frizzled-4, Frizzled-5, Frizzled-6, Frizzled-7, Frizzled-8, Frizzled-9, and Frizzled-10. Frizzled 4 ("FZD4") (also referred to as CD344, EVR1, FEVR, FZD4S, Fz-4, Fz4, FzE4, GPCR, hFz4, and frizzled class receptor 4) is a member of the frizzled gene family of proteins. This gene has ENTREZ Gene ID: 8322. This protein has NCBI Reference Sequence: NP_036325.2.

[0107] "Lipoprotein receptor-related proteins", "low density lipoprotein receptor-related proteins" (HGNC), or "pro-low density lipoprotein receptor-related proteins" (UniProt), abbreviated "LRPs", are a group of genes and proteins. They include LRP1, LRP1B, LRP2 (megalin), LRP3, LRP4, LRP5, LRP6, LRP8 (apolipoprotein e receptor), LRP10, LRP11, and LRP12. LRP5 and LRP6 are part of the LRP5 / LRP6 / Frizzled coreceptor group involved in the canonical Wnt pathway. LRP5 is also known as LRP5, BMND1, EVR1, EVR4, HBM, LR3, LRP-5, LRP7, OPPG, OPS, OPTA1, VBCH2, and LDL receptor-related protein 5. The LRP5 gene has ENTREZ gene ID: 4041 and the protein has NCBI reference sequence: NP_002326. The LRP6 gene has ENTREZ gene ID: 4040 and the protein has NCBI reference sequence: NP_002327. LRP6 is also known as ADCAD2, STHAG7.

[0108] II. Disorders associated with dysregulated FRZ signaling Wnt binding to FZD destabilizes β-catenin binding complex, causing β-catenin degradation.As a result, the level of intracellular β-catenin increases.Therefore, the present specification provides a method for blocking Wnt binding to frizzled protein, particularly FZD4, as well as other members of frizzled family, such as FZD1, FZD2, FZD4, FZD5, FZD7, FZD8 and FZD9.

[0109] "FZD-associated disorder" (e.g., "FZD4-associated disorder" or "FZD5-associated disorder") refers to a condition or disease that correlates with dysregulation of the particular FZD receptor referenced. Dysregulation refers to abnormal signaling that increases normal β-catenin-mediated transcriptional changes or any other intracellular signaling pathways defined by these receptors.

[0110] Various Frizzled receptors are associated with various cancers. More specifically, FZD1 is associated with neuroblastoma. FZD2 is associated with liver cancer, lung cancer, endometrial cancer, and salivary adenoid cystic carcinoma. FZD3 is associated with colorectal cancer. FZD4 is associated with acute myeloid leukemia, prostate cancer, glioblastoma, bladder cancer, and cervical cancer. FZD5 is associated with pancreatic cancer, colon cancer, and prostate cancer. FZD6 is associated with colorectal cancer and breast cancer. FZD7 is associated with esophageal cancer, glioma, breast cancer, gastric cancer, and colorectal cancer. FZD8 is associated with prostate cancer, breast cancer, and lung cancer. FZD9 is associated with astrocytoma and osteosarcoma. FZD10 is associated with colorectal cancer and synovial sarcoma.

[0111] III. Anti-FZD4 antibody A. Antibodies The present specification describes antibodies against Frizzled receptors (FZDs), including antibodies that bind to multiple FZDs and other antibodies that preferentially bind to FZD4.These antibodies bind to Frizzled receptors, block ligand WNT binding, and regulate frizzled receptor signaling.These antibodies also show that their anti-proliferative effects have therapeutic potential for treating cancer and other diseases in which frizzled receptors are dysregulated.

[0112] Thus, one aspect of the disclosure includes an isolated antibody that specifically binds to a Frizzled receptor (FZD) cysteine-rich domain (CRD), comprising a light chain variable region and a heavy chain variable region, wherein the heavy chain variable region comprises complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, and the amino acid sequences of the CDRs comprise, consist essentially of, or consist of a sequence selected from the sequences of Table 1a or Table 3a.

[0113] In one embodiment, the antibody comprises a set of CDR sequences selected from the set of CDR sequences in Table 1a, ie, the set of CDR sequences of clones 5016-5037 and 6498-6500.

[0114] Table 1a. CDR amino acid sequences of FZD4 antibodies TIFF2024153733000003.tif168170

[0115] Table 1b. CDR nucleic acid sequences of FZD4 antibodies TIFF2024153733000004.tif202170

[0116] Table 1c. CDR nucleic acid sequences of FZD4 antibodies TIFF2024153733000005.tif189170

[0117] Heavy and light chain variable regions are also described herein. Table 2 provides exemplary variable domain sequences of Fab heavy and Fab light chains from clone 5017. Antibodies comprising a sequence of Table 2 or a sequence substantially identical thereto, wherein the CDRs are the set of CDR sequences identified in Table 1a or Table 3a, are also contemplated. In another embodiment, the antibody comprises a heavy chain variable region comprising: (i) a heavy chain amino acid sequence as set forth in Table 2, (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the heavy chain amino acid sequence as set forth in Table 2, wherein the CDR sequences are the set of CDR sequences as set forth in Table 1a or Table 3a, or (iii) a conservatively substituted amino acid sequence of (i), wherein the CDR sequences are the set of CDR sequences as set forth in Table 1a or Table 3a.

[0118] In another embodiment, the antibody comprises a light chain variable region comprising: (i) a light chain amino acid sequence set forth in Table 2; (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a light chain amino acid sequence set forth in Table 2, wherein the CDR sequence is a set of CDR sequences set forth in Table 1a or Table 3a; or (iii) a conservatively substituted amino acid sequence of (i), wherein the CDR sequence is a set of CDR sequences set forth in Table 1a or Table 3a.

[0119] Table 2: Example of full-length sequence of FZD4 antibody 5017 TIFF2024153733000006.tif185150 The underlines identify the CDR sequences. Bold type identifies CDR variations from the library (antibody clone ID 5017 shown as an example here). Italics represent constant domain sequences.

[0120] In another embodiment, the antibody comprises a set of CDR sequences selected from the set of CDR sequences in Table 3a, ie, the set of CDR sequences of clones 5038-5081.

[0121] Table 3a - CDR amino acid sequences of FZD4 antibody. Table 3a sets forth, in order of appearance, the CDR L1 sequence ("SVSSA") as SEQ ID NO: 103, the CDR L2 sequence ("SASSLYS") as SEQ ID NO: 104, the CDR L3 sequences as SEQ ID NOs: 105-136, 134, and 137-147, the CDR H1 sequences as SEQ ID NOs: 1-3, 1, 4-6, 1, 7-8, 1, 9, 3, 10-11, 5, 3, 5, 3, 12-14, 3, 15, 7, 7, 16, 2, 17-18, 17, 1, 19, 3, 19, 7, 17, 20-21, 1, 1, 22-23, and 3, and the CDR H2 sequences as SEQ ID NOs: 24-36, 28, 37, 32, 38-40, 24, 41-43, 43-46, 35, 47-49, 42, 50-56, 51, 42, and 57-59, and CDR H3 sequences as SEQ ID NOs: 60-74, 68, and 75-102. Table 3a: CDR amino acid sequences of FZD4 antibodies TIFF2024153733000007.tif154137

[0122] Table 3b - CDR light chain nucleic acid sequences of FZD4 antibodies. Table 3b discloses the CDR L1 sequence ("TCCGTGTCCAGCGCT") as SEQ ID NO: 219, the CDR L2 sequence ("TCGGCATCCAGCCTCTACTCT") as SEQ ID NO: 220, and the CDR L3 sequences as SEQ ID NOs: 304-334, 332, and 335-345, all in order of appearance. Table 3b. CDR nucleic acid sequences of FZD4 antibodies TIFF2024153733000008.tif207138

[0123] In some embodiments, the variable domain sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% similar outside the CDR regions, and the CDR sequence set is 100% identical to the amino acid sequences shown in Table 1a or Table 3a.

[0124] Table 3c - CDR heavy chain nucleic acid sequences of FZD4 antibodies. Table 3c lists the CDR H1 sequences as SEQ ID NOs: 346-357, 261, 350, 358, 354, 359-361, 346, 362-364, 364-365, 260, 366-378, 373, 363, and 379-381, and the CDR H2 sequences as SEQ ID NOs: and CDR H3 sequences are disclosed as SEQ ID NOs: 385-399, 393, and 400-427. Table 3c. CDR nucleic acid sequences of FZD4 antibodies TIFF2024153733000009.tif171139TIFF2024153733000010.tif80138

[0125] In another embodiment, a competitive antibody is also provided that competes for binding with the antibody comprising the CDR sequence set described herein.For example, in one embodiment, the competitive antibody reduces the binding of the antibody comprising the CDR sequence set to FZD4 CDR by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%.

[0126] Some of the described antibodies can bind to multiple FZDs. Thus, in some embodiments, the antibody specifically binds to FZD4 and further specifically binds to one or more of FZDs 1, 2, 5, 7, 8, and 9. For example, the antibody can be an antibody whose CDR sequence is a set of antibodies selected from antibodies 5016, 5018-5023, 5025, 6495, 6496, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076.

[0127] Some of the described antibodies preferentially bind to FZD4. In one embodiment, the antibody is an antibody that preferentially binds to Frizzled 4 (FZD4) compared to any of FZD1, 2, 5, 7, 8, 9, or 10. In one embodiment, the antibody preferentially binds to FZD4 compared to FZD1, FZD5, FZD7, and FZD9. In one aspect, the antibody comprises a set of CDR sequences of antibody 6497. In another embodiment, the antibody preferentially binds to FZD4 compared to FZD1 and FZD7. In one aspect, the antibody comprises a set of CDR sequences of an antibody selected from 5028, 5035, 5039, 5073. In yet another embodiment, the antibody preferentially binds to FZD4 compared to FZD9. In one aspect, the antibody comprises a set of CDR sequences of antibody 5029. In yet another embodiment, the antibody binds preferentially to FZD4 compared to FZD1, FZD2, and FZD7. In one aspect, the antibody comprises a set of CDR sequences of an antibody selected from 5031, 6498, 5054, or 5075. In yet another embodiment, the antibody binds preferentially to FZD4 compared to FZD1, FZD2, FZD5, and FZD7. In one aspect, the antibody comprises a set of CDR sequences of antibody 5034. In yet another embodiment, the antibody binds preferentially to FZD4 compared to FZD1. In one aspect, the antibody comprises a set of CDR sequences of antibody 5045 or 5048. In yet another embodiment, the antibody binds preferentially to FZD4 compared to FZD1, FZD7, and FZD9. In one aspect, the antibody comprises a set of CDR sequences of antibody 5056. In yet another embodiment, the antibody preferentially binds to FZD4 relative to FZD9 and FZD10. In one aspect, the antibody comprises a set of CDR sequences from antibody 5057. In yet another embodiment, the antibody preferentially binds to FZD4 relative to FZD1 and FZD2. In one aspect, the antibody comprises a set of CDR sequences from antibody 5067.

[0128] Certain antibodies, for example those having the CDR sets from antibodies 5018, 5019, 5022, 6494, and 5025, preferentially bind other FZD proteins relative to FZD4. (See, for example, FIG. 5.)

[0129] In another embodiment, the antibody comprises a CDR sequence that is the set of CDR sequences of an antibody selected from antibodies 5022, 5031, 6497, 6498, and 6500.

[0130] As shown herein, the antibodies described herein have high affinity for FZD4. For example, in one embodiment, the antibodies have a binding affinity of about 0.2 nM to about 15.3 nM as measured by surface plasmon resonance.

[0131] The antibody may be a humanized or chimeric antibody as described herein.

[0132] In some embodiments, the antibody is a single chain antibody, which can be obtained, for example, by fusing together the heavy and light chains or portions thereof.

[0133] In some embodiments, the antibody is an antibody binding fragment selected from a Fab, a Fab', a F(ab')2, a scFv, a dsFv, a ds-scFv, a dimer, a nanobody, a minibody, a diabody, and multimers thereof.

[0134] In some other embodiments, the antibody is a binding fragment, Fab. In some embodiments, binding fragments are preferred.

[0135] In other embodiments, it may be preferable to have multivalent antibodies, or antibodies that include Ig portions.

[0136] As shown in the Examples, the Fab fragments of the present disclosure can be combined with an immunoglobulin (Ig) constant region, such as an IgG. In one embodiment, the IgG is an IgG1, IgG2, IgG3, or IgG4.

[0137] B. Detectably Labeled Antibody Detectable labels can include peptide sequences (such as myc tags, HA tags, V5 tags, or NE tags) that can be attached or introduced to the antibodies described herein and generate a directly or indirectly detectable signal, fluorescent proteins or luminescent proteins (e.g., green fluorescent protein or luciferase). For example, the label can be a radio-opaque positron-emitting radionuclide (e.g., for use in PET imaging), or a radioisotope, e.g., 3 H, 13 N, 14 C. 18 F, 32 P, 35 S, 123 I, 125 I, 131 It may be I; a fluorescent (fluorophore) or chemiluminescent (chromophore) compound, such as fluorescein isothiocyanate, rhodamine, or luciferin; an enzyme, such as alkaline phosphatase, β-galactosidase, or horseradish peroxidase; an imaging agent; or a metal ion.

[0138] C. Antibody-Drug Conjugates Further aspects include immunoconjugates comprising an antibody described herein and a detectable label or a cytotoxic agent.

[0139] A chemotherapeutic (anti-cancer) agent can be any agent that can reduce cancer growth, disrupt cancer cell replication, directly or indirectly kill cancer cells, reduce metastasis, reduce tumor blood supply, and the like. Thus, chemotherapeutic agents include cytotoxic agents. Cytotoxic agents include, but are not limited to, saporin, taxanes, vinca alkaloids, anthracyclines, and platinum-based agents. Classes of chemotherapeutic agents include, but are not limited to, alkylating agents, antimetabolites (e.g., methotrexate), plant alkaloids (e.g., vincristine), and antitumor antibiotics, e.g., anthracyclines (e.g., doxorubicin), as well as miscellaneous drugs not classified into a specific class, e.g., hydroxyurea. Platinum-based drugs, exemplified by cisplatin and oxaliplatin, are a major class of chemotherapeutic agents. These drugs bind to DNA and disrupt replication. Taxanes, exemplified by taxol, are another major class of chemotherapeutic agents. These compounds act by disrupting the formation of the cytoskeleton and mitotic spindle to inhibit cell division, thereby preventing the proliferation of rapidly dividing cancer cells. Other chemotherapeutic agents include hormone therapy. Chemotherapeutic agents also include agents that inhibit the assembly or polymerization of tubulin, such as maytansine, mertansine, and auristatin. Chemotherapeutic agents also include DNA damaging agents, such as calicheamicin.

[0140] Chemotherapeutic agents may include maytansinoids, auristatins, dolastatins, tubulysins, cryptophycins, pyrrolobenzodiazepine (PBD) dimers, indolinobenzodiazepine dimers, α-amanitins, trichothenes, SN-38, duocarmycins, CC1065, calicheamicins, enediyne antibiotics, taxanes, doxorubicin derivatives, anthracyclines, and their stereoisomers, azanofides, isosteres, analogs, or derivatives.

[0141] IV. Nucleic acids Further aspects include the nucleic acid molecules or polynucleotides, recombinant nucleic acid molecules, expression constructs and vectors described herein.

[0142] A. Nucleic acid molecules Further aspects include the nucleic acid molecules set forth in Tables 1b, 1c, 3b, and 3c, and polynucleotides that hybridize to one of the above sequences, e.g., under stringent hybridization conditions. The CDR and variable domain nucleic acid sequences can be used, for example, to prepare expression constructs.

[0143] B. Expression Constructs and Vectors The nucleic acid molecule can be incorporated in a known manner into a suitable expression construct or expression vector that ensures the expression of the protein. The expression construct can include an expression control sequence, such as a promoter, operably linked to the polynucleotide that includes the nucleotide sequence encoding the antibody of the present disclosure. Possible expression vectors include, but are not limited to, cosmids, plasmids, or modified viruses (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses). The vector should be compatible with the host cell used. The expression vector is "suitable for transformation of a host cell", which means that the expression vector contains a nucleic acid molecule that encodes an epitope or peptide corresponding to an antibody described herein.

[0144] In one embodiment, the vector is suitable for expressing single chain antibody, for example by gene therapy.In one embodiment, the vector comprises an IRES, allowing expression of light chain variable region and heavy chain variable region.Such vector can be used to deliver antibody in vivo.

[0145] Suitable regulatory sequences can be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes.

[0146] Examples of such regulatory sequences include transcription promoters and enhancers or RNA polymerase binding sequences, ribosome binding sequences including translation initiation signals. Furthermore, depending on the host cell selected and the vector used, other sequences such as replication origins, additional DNA restriction sites, enhancers, and sequences that confer inducibility of transcription may be incorporated into the expression vector.

[0147] In one embodiment, the regulatory sequence directs or increases expression in neural tissue and / or cells.

[0148] The vector can be any vector, including vectors suitable for producing the antibodies described herein.

[0149] In one embodiment, the vector is a viral vector.

[0150] The recombinant expression vectors can also contain a marker gene to facilitate selection of host cells that have been transformed, infected or transfected with the vector to express the antibodies or epitopic peptides described herein.

[0151] Recombinant expression vectors may also include expression cassettes encoding fusion moieties (i.e., "fusion proteins") that result in increased expression or stability of the recombinant peptide, increased solubility of the recombinant peptide, and may include, for example, tags and labels described herein to aid in the purification of the target recombinant peptide by acting as ligands in affinity purification. Additionally, proteolytic cleavage sites can be added to the target recombinant protein to separate the recombinant protein from the fusion moiety after purification of the fusion protein. Exemplary fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ), which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the recombinant protein.

[0152] Systems for transferring genes both in vitro and in vivo include vectors based on viruses, most notably Herpes Simplex Virus, adenoviruses, adeno-associated viruses (AAV), and retroviruses, including lentiviruses. Alternative approaches for gene delivery include the use of naked plasmid DNA, and liposome-DNA complexes.

[0153] In one aspect, the disclosure includes a method for making an antibody described herein comprising synthesizing a nucleic acid molecule comprising an antibody framework and a set of CDR sequences described herein.

[0154] V. Recombinant Cells A further aspect is a recombinant host cell expressing the antibodies described herein.

[0155] The antibodies described herein can be made by recombinant expression of nucleic acid encoding the antibody sequences.

[0156] The antibodies disclosed herein can be produced by culturing cells engineered to express nucleic acid constructs encoding immunoglobulin polypeptides.

[0157] Recombinant host cells can be generated using any cell suitable for the production of a polypeptide, e.g., for the production of an antibody. For example, to introduce a nucleic acid (e.g., a vector) into a cell, the cell may be transfected, transformed, or infected, depending on the vector used.

[0158] Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. For example, the proteins described herein can be expressed in bacterial cells, such as E. coli, insect cells (using baculovirus), yeast cells, or mammalian cells.

[0159] In one aspect, the cell is a eukaryotic cell selected from a yeast, plant, worm, insect, avian, fish, reptile, and mammalian cell.

[0160] In another embodiment, the mammalian cell is a CHO cell, a myeloma cell, a spleen cell, or a hybridoma cell.

[0161] Suitable yeast and fungal host cells for expressing antibodies include, but are not limited to, Saccharomyces cerevisiae, Schizosaccharomyces pombe, various species of the genera Pichia or Kluyveromyces, and Aspergillus. Examples of vectors for expression in the yeast S. cerevisiae include pYepSec1, pMFa, pJRY88, and pYES2 (Invitrogen Corporation, San Diego, CA). Protocols for transformation of yeast and fungi are well known to those skilled in the art.

[0162] Mammalian cells that may be suitable include, among others, COS cells (e.g., ATCC No. CRL 1650 or 1651), BHK cells (e.g., ATCC No. CRL 6281), CHO cells (ATCC No. CCL 61), HeLa cells (e.g., ATCC No. CCL 2), 293 cells (ATCC No. 1573), and NS-1 cells. Suitable expression vectors for directing expression in mammalian cells generally include a promoter (e.g., derived from viral material such as polyoma, adenovirus 2, cytomegalovirus, and simian virus 40), as well as other transcriptional and translational control sequences. Examples of mammalian expression vectors include pCDM8 and pMT2PC.

[0163] VI. Pharmaceutical Compositions A further aspect is a composition comprising an antibody, immunoconjugate, nucleic acid molecule, vector, or recombinant cell described herein, optionally together with a suitable diluent, e.g., a pharma- ceutically acceptable carrier.

[0164] The composition can include, for example, one or more antibodies or immunoconjugates.

[0165] Suitable diluents for polypeptides, including antibodies and / or cells, include, but are not limited to, saline, pH buffers, and glycerol solutions, or other solutions suitable for freezing the polypeptides and / or cells.

[0166] Suitable diluents for nucleic acids include, but are not limited to, water, saline, and ethanol.

[0167] In one aspect, the composition is a pharmaceutical composition comprising any of the antibodies, nucleic acids or vectors disclosed herein, and optionally a pharma- ceutically acceptable vehicle, such as a diluent or carrier.

[0168] The compositions described herein can be prepared by methods known per se for preparing pharma- ceutically acceptable compositions that can be administered to a subject such that an effective amount of an active substance is combined in admixture with a pharma- ceutically acceptable vehicle.

[0169] Pharmaceutical compositions include, but are not limited to, lyophilized powders, or aqueous or non-aqueous sterile injection solutions or suspensions, which may further contain antioxidants, buffers, bacteriostatic agents, and solutes that render the composition substantially compatible with the tissue or blood of the intended recipient. Other components that may be present in such compositions include, for example, water, surfactants (such as Tween), alcohols, polyols, glycerin, and vegetable oils. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, tablets, or concentrated solutions or suspensions. Compositions may be supplied, for example, but are not limited to, as lyophilized powders that are reconstituted with sterile water or saline before administration to a patient.

[0170] The pharmaceutical composition may include a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers include essentially chemically inert and non-toxic compositions that do not interfere with the effect of the biological activity of the pharmaceutical composition. Examples of suitable pharmaceutical carriers include, but are not limited to, water, saline, glycerol solution, ethanol, N-(1(2,3-dioleyloxy)propyl)N,N,N-trimethylammonium chloride (DOTMA), dioleylphosphotidyl-ethanolamine (DOPE) and liposomes. Such compositions should contain a therapeutically effective amount of the compound together with a suitable amount of carrier so as to provide a form for direct administration to a patient.

[0171] The compositions may be in the form of pharma- ceutically acceptable salts, including, but not limited to, those formed with free amino groups, such as those derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, and the like, and those formed with free carboxyl groups, such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxide, isopropylamine, triethylamine, 2-ethylaminoethanol, and the like.

[0172] In one aspect, the composition comprises an antibody described herein. In another aspect, the composition comprises an antibody described herein and a diluent. In one aspect, the composition is a sterile composition.

[0173] Further aspects include antibody complexes comprising an antibody described herein bound to a FZD protein, e.g., FZD4. The complexes may be in solution or, optionally, contained within a tissue in vitro.

[0174] Methods of making and using the reagents described herein are also provided.

[0175] VI. Methods of Administration and Use The anti-FZD antibody of the present invention can effectively deliver therapeutic compositions to cells that undergo Wnt signaling in vivo.In some embodiments, the method of treatment or method of use comprises administering to an individual an effective amount of a therapeutic anti-FZD conjugate, for example, an anti-FZD antibody attached to a therapeutic agent, or using the same.In some embodiments, the individual is diagnosed with cancer.In some embodiments, the individual is undergoing or has undergone cancer therapy, for example, surgery, radiation therapy, or chemotherapy.In some embodiments, the individual is diagnosed, but the cancer is in remission.

[0176] In some embodiments, the anti-FZD conjugate comprises a liposome. In some embodiments, the method further comprises monitoring the individual for cancer progression. In some embodiments, the dose of the anti-LRP conjugate for each administration is determined based on the progress of the individual's treatment, for example, when the individual does not respond adequately to treatment and a higher dose of chemotherapy is administered.

[0177] In some embodiments, the invention can include an antibody or antibody targeting composition and a physiologically (i.e., pharma- ceutically) acceptable carrier. The term "carrier" refers to a typically inert substance used as a diluent or vehicle for a diagnostic or therapeutic agent. The term also encompasses typically inert substances that impart cohesiveness to the composition. A physiologically acceptable carrier can be a liquid, such as saline, phosphate buffer, normal buffered saline (135-150 mM NaCl), water, buffered water, 0.4% saline, 0.3% glycine, glycoproteins (e.g., albumin, lipoproteins, globulins, etc.) to enhance stability, and the like. Because physiologically acceptable carriers are determined in part by the particular composition being administered and by the particular method used to administer the composition, there are a wide variety of suitable formulations of the pharmaceutical compositions of the invention (see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989).

[0178] The composition of the present invention may be sterilized by conventional well-known sterilization techniques or produced under sterile conditions. Aqueous solutions may be packaged for use or filtered under aseptic conditions and lyophilized, and the lyophilized preparations are combined with sterile aqueous solutions before administration. The composition may contain pharma- ceutically acceptable auxiliary substances necessary to approximate physiological conditions, such as pH adjusting agents and buffers, isotonicity adjusting agents, wetting agents, etc., such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate. Sugars for stabilizing the composition may also be included, such as stabilizers for lyophilized antibody compositions.

[0179] The dosage form can be prepared for mucosal administration (e.g., nasal, sublingual, vaginal, buccal or rectal), parenteral administration (e.g., subcutaneous, intravenous, intramuscular or intraarterial injection, either bolus or infusion), oral administration, or transdermal administration to a patient. Examples of dosage forms include, but are not limited to, liquid dispersions; suppositories; ointments; poultices (compresses); pastes; powders; dressings; creams; bandages; solutions; patches; aerosols (e.g., nasal sprays or inhalers); gels; liquid dosage forms suitable for oral or mucosal administration to a patient, including suspensions (e.g., aqueous or non-aqueous liquid suspensions, oil-in-water or water-in-oil liquid emulsions), solutions, and elixirs; liquid dosage forms suitable for parenteral administration to a patient; and sterile solids (e.g., crystalline or amorphous solids) that can be reconstituted to provide liquid dosage forms suitable for parenteral administration to a patient.

[0180] Injectable (e.g., intravenous) compositions can include a solution of the antibody or antibody targeting composition suspended in an acceptable carrier, such as an aqueous carrier. For example, any of a variety of aqueous carriers, such as water, buffered water, 0.4% saline, 0.9% isotonic saline, 0.3% glycine, 5% dextrose, and the like, can be used, and may include glycoproteins, such as albumin, lipoproteins, globulins, and the like, to enhance stability. Normal buffered saline (135-150 mM NaCl) is often used. The composition can contain pharma- ceutically acceptable auxiliary substances to approximate physiological conditions, such as pH adjusting and buffering agents, isotonicity adjusting agents, wetting agents, such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, and the like. In some embodiments, the antibody targeting composition can be formulated into a kit for intravenous administration.

[0181] Formulations suitable for parenteral administration, such as by intraarticular (intra-articular), intravenous, intramuscular, intratumoral, intradermal, intraperitoneal, and subcutaneous routes, include aqueous and non-aqueous isotonic sterile injection solutions that may contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, as well as aqueous and non-aqueous sterile suspensions that may contain suspending agents, solubilizers, thickeners, stabilizers, and preservatives. Injection solutions and suspensions may also be prepared from sterile powders, granules, and tablets. In the practice of the present invention, the compositions may be administered, for example, by intravenous infusion, topically, intraperitoneally, intravesically, or intrathecally. Parenteral and intravenous administration are the preferred methods of administration. Formulations of targeting compositions may be provided in unit-dose or multi-dose sealed containers, such as ampoules and vials.

[0182] The selected targeted delivery composition, alone or in combination with other suitable components, can be made into an aerosol formulation ("nebulizer") to be administered via inhalation. The aerosol formulation can be placed into a pressurized acceptable propellant, such as dichlorodifluoromethane, propane, and nitrogen.

[0183] Pharmaceutical preparations can be packaged or prepared in unit dosage form.In such form, the preparation is divided into unit dosages containing appropriate amounts of active ingredients, for example, according to the dose of therapeutic agent or the concentration of antibody.The unit dosage form can be a packaged preparation, and the package contains a discrete amount of the preparation.The composition can also contain other compatible therapeutic agents if desired.

[0184] The antibody (or antibody targeting composition) can be administered or may be for use by injection or infusion via any suitable route, including, but not limited to, intravenous, subcutaneous, intramuscular, or intraperitoneal routes. An example of administration of a pharmaceutical composition includes storing the antibody at 10 mg / ml in sterile isotonic aqueous saline for injection at 4° C. and diluting it in either 100 ml or 200 ml of 0.9% sodium chloride for injection prior to administration to the patient. The antibody is administered by intravenous infusion over 1 hour at a dose of 0.2-10 mg / kg. In other embodiments, the antibody is administered by intravenous infusion over a period of 15 minutes to 2 hours. In still other embodiments, the administration procedure is by subcutaneous bolus injection.

[0185] The dose of the antibody is selected to provide an effective treatment to the patient and ranges from less than 0.1 mg / kg body weight to about 25 mg / kg body weight or from 1 mg to 2 g per patient. In some cases, the dose ranges from 1 to 100 mg / kg or from about 50 mg to about 8000 mg per patient. Depending on the pharmacokinetics of the antibody (e.g., half-life of the antibody in circulation) and the pharmacodynamic response (e.g., duration of therapeutic effect of the antibody), the dose may be repeated at an appropriate frequency, which may range from once a day to once every three months. In some embodiments, the antibody administration with an in vivo half-life of about 7 days to about 25 days is repeated once a week to once every three months.

[0186] Administration or use can be periodic.Dose can be administered, for example, once every 1, 3, 5, 7, 10, 14, 21, or 28 days, or once every longer period (for example, once every 2, 3, 4, or 6 months), depending on the route of administration.In some cases, administration is more frequent, such as twice or three times a day.As will be appreciated by those skilled in the art, patient can be monitored to adjust dosage and frequency of administration according to the progress of treatment and any adverse side effects.

[0187] Thus, in some embodiments, further doses are dependent on the patient's progress, e.g., the patient is monitored between doses. For example, after an initial dose or series of doses, the patient can be monitored for tumor growth rate, recurrence (e.g., in the case of post-operative patients), or general disease-related symptoms such as weakness, pain, nausea, etc.

[0188] In therapeutic use to treat cancer, the antibody targeting composition (e.g., including therapeutic and / or diagnostic agents) may be administered at an initial dosage of about 0.001 mg / kg to about 1000 mg / kg daily, which may be adjusted over time. A daily dose range of about 0.01 mg / kg to about 500 mg / kg, or about 0.1 mg / kg to about 200 mg / kg, or about 1 mg / kg to about 100 mg / kg, or about 10 mg / kg to about 50 mg / kg may be used. Dosages vary depending on the requirements of the patient, the severity of the condition being treated, and the targeting composition being used. For example, dosages may be empirically determined in a particular patient, taking into account the type and stage of cancer diagnosed. In the context of the present invention, the dose administered to a patient should be sufficient to affect a beneficial therapeutic response to the patient over time. The size of the dose will also be determined by the existence, nature, and extent of any adverse side effects associated with the administration of a particular targeting composition to a particular patient, as will be recognized by those of skill in the art.

[0189] VIII. Kits Another aspect is a kit or package that includes any of the antibodies, immunoconjugates, nucleic acid molecules, vectors, recombinant cells, and / or compositions contained herein.Antibodies, immunoconjugates, nucleic acid molecules, vectors, recombinant cells, and / or compositions can be contained in vials, such as sterile vials or other housings.As used herein, the term "kit" refers to a collection of items that are intended to be used together.The kit can optionally include a reference agent and / or instructions for its use.The kit can further include a transport container that is adapted to hold a container, such as a vial, that contains the compositions disclosed herein.

[0190] IX. Methods of Using Antibodies The antibodies described herein can be used in a number of in vitro and in vivo methods.

[0191] A. Methods for detecting FZD expression As demonstrated herein, antibodies can be used to detect FZD expression.

[0192] Thus, in one aspect, the present disclosure provides a method for detecting FZD expression, comprising contacting a sample comprising one or more cells with one or more antibodies or immunoconjugates described herein under conditions that allow the formation of an antibody:FZD complex, and detecting the presence of any antibody complex.Typically, the antibody is part of an immunoconjugate that comprises an antibody bound to a detectable label.

[0193] The sample can include live cells or cell extracts. Antibody:FZD complexes can be detected by immunoassays, such as immunofluorescence, flow cytometry, Western blot, ELISA, SPR, and immunoprecipitation followed by SDS-PAGE immunocytochemistry. In some embodiments, detection is by immunofluorescence. In some embodiments, detection is by flow cytometry.

[0194] As shown herein, some of the identified antibodies preferentially recognize FZD4. Thus, in embodiments in which the method is for detecting FZD4 expression, the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081.

[0195] B. Methods for Inhibiting WNT Binding to FZD The antibody disclosed herein inhibits Wnt binding to Frizzled receptors, particularly FZD4.Without wishing to be limited by theory, inhibiting Wnt binding to FZD protein affects signal transduction that FZD plays a role in initiating.For example, antibodies that bind to FZD receptors inhibit FZD promotion of β-catenin phosphorylation.Unphosphorylated β-catenin avoids degradation in cells and accumulates.Accumulation of β-catenin is associated with malignant tumors.

[0196] It may be desirable to reduce or inhibit the Wnt ligand signal transduction via FZD.Therefore, another aspect is the method of inhibiting the Wnt ligand binding to FZD or the Wnt-induced transcriptional activity, comprising contacting one or more cells that express one or more FZD polypeptides with an effective amount of the antibody or immunoconjugate described herein.

[0197] In one embodiment, the antibody or immunoconjugate comprises a set of CDR sequences (complete light or heavy chain) corresponding to an antibody selected from the clones described herein, e.g., 5014, 5017-5023, 5027-5031, 5034, 5036, 5037, 6496, 6498, 6499 and 6500, 5035, 6495, and 5025.

[0198] In one embodiment, the antibody or immunoconjugate comprises a set of CDR sequences (complete light or heavy chain) corresponding to an antibody selected from a clone described herein, e.g., 5014, 5018-5023, 5025, 5036, 5037, 6495, 5027-5031, and 6497-6499.

[0199] The contacting can be effected in vivo, for example, by administering an antibody or immunoconjugate to a subject. Such inhibition can be desirable, particularly when wnt signaling is dysregulated, such as in cancer cells.

[0200] C. Methods of Treating Cancer The method for treating cancer comprises administering to a subject in need thereof a pharmaceutical composition comprising an antibody of the present disclosure that binds to FZD.The subject in need thereof may be a subject, such as a human, suffering from cancer or at risk of cancer, such as recurrence of cancer.

[0201] Without wishing to be limited by theory, such therapies may work by inhibiting activation of the canonical Wnt pathway, for example, by inhibiting Wnt binding to FZD, by inhibiting Wnt-induced transcriptional activity, by inhibiting activation of disheveled, by inhibiting inhibition of the β-catenin degradation complex, and by promoting accumulation of β-catenin.

[0202] In another aspect, the present disclosure includes a method for treating cancer, comprising administering to a subject in need thereof an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt-induced signaling in at least one assay. The present disclosure also includes an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt-induced signaling in at least one assay for use in treating cancer. The present disclosure provides the use of an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt-induced signaling in at least one assay for use in treating cancer. The present disclosure also provides for the use of an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt-induced signaling in at least one assay in the manufacture of a medicament for treating cancer.

[0203] In one embodiment, the antibody or immunoconjugate, e.g., an antibody-drug conjugate, is comprised in a pharmaceutical composition.

[0204] In one embodiment, the cancer is selected from colon cancer, lung cancer, breast cancer, ovarian cancer, endometrial cancer, pancreatic cancer, gastric cancer, liver cancer, adrenal cortical cancer, and osteoblastoma cancer, and optionally, the cancer is pancreatic cancer. In one embodiment, the antibody or immunoconjugate comprises a set of CDR sequences (complete light or heavy chain) corresponding to an antibody selected from 5014, 5017-5023, 5025, 5035-5037, 6495, and 6500.

[0205] As provided herein, the antibodies can also inhibit cancer cell proliferation, and thus methods for inhibiting cancer cell proliferation are also provided, comprising contacting one or more cancer cells expressing FZD with an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt3a-induced signaling in at least one assay.

[0206] In one embodiment, the antibody or immunoconjugate is an antibody or immunoconjugate described herein, e.g., an antibody or immunoconjugate that comprises a set of CDR sequences (complete light or heavy chain) corresponding to an antibody selected from 5014, 5017-5023, 5025, 5035-5037, 6495, and 6500.

[0207] In one embodiment, the antibody comprises a set of CDR sequences (complete light or heavy chain) corresponding to an antibody selected from the variable region sequences described herein, 5014, 5017-5023, 5025, 5035-5037, 6495, and 6500.

[0208] In one aspect, the cancer is selected from acute myeloid leukemia, prostate cancer, glioblastoma, bladder cancer, and cervical cancer.

[0209] In another embodiment, the cancer cells are selected from colon cancer, lung cancer, breast cancer, ovarian cancer, endometrial cancer, pancreatic cancer, gastric cancer, liver cancer, adrenal cortical cancer, and osteoblastoma cancer cells.

[0210] In another embodiment, the cancer cell is a pancreatic cancer cell. In one embodiment, the antibody or immunoconjugate comprises a set of CDR sequences (complete light or heavy chain) corresponding to an antibody selected from 5019 and 5020.

[0211] Antibody 5020 has also been demonstrated to be effective in treating RNF43 mutant cancers. Thus, in one embodiment, the cancer cells are known or determined to contain a mutation in the RNF43 gene, and the antibody or immunoconjugate used comprises a set of CDRs corresponding to antibody 5020.

[0212] In one embodiment, the method includes determining that a subject's cancer is associated with dysregulated Wnt signaling, optionally determining the specific Wnt protein that is dysregulated, optionally determining the member of the FZD protein family that is targeted, and administering an anti-FZD antibody to the subject to block binding of one or more selected Wnts to one or more selected FZD receptors.

[0213] The above disclosure generally describes the present disclosure. A more complete understanding can be obtained by reference to the following specific examples. These examples are provided for illustrative purposes only and are not intended to limit the scope of the present application. Changes in form and substitution of equivalents are contemplated as the circumstances suggest or render expedient. Although specific terms have been used herein, such terms are intended in a descriptive sense and not for purposes of limitation. EXAMPLES

[0214] X. Working Example Example 1 Antibody selection and functional testing of FZD4 FAB Antibody Selection: To identify FZD4 binders, two selection procedures were performed.

[0215] 1. Selections were performed using a library designed based on previous FZD7-derived binders. Antibodies have been previously identified from selections using FZD7 CRD-Fc as the antigen. These antibodies bind to FZD1, 2, 5, 7, 8, and 9, exhibit antagonistic activity against the Wnt pathway, and inhibit pancreatic cancer cell proliferation and tumor growth. The library was used to identify antibodies that bind to FZD4 and would have wnt antagonistic and antitumor activity.

[0216] (a) Design and preparation of Fab phage display libraries. A Fab phage display library was designed and prepared using an IPTG-inducible display vector encoding a Fab recognizing MBP. The Fab template was identical to library F, containing a FLAG-tagged light chain, with dimerization domains L1, L2, L3 mutated to the parental Fab sequence H1, H2, and H3 soft randomized to allow 50% bias towards wild-type amino acids and 50% bias towards any other amino acid (using a 70:10:10:10 nucleotide mix). All six CDR regions were mutated in a single Kunkel mutagenesis reaction. A second generation library was constructed based on a panel of Fab antagonists. An IPTG-inducible display vector encoding a Fab specific for maltose binding protein was used as library template. Using light chain oligos, a site-directed Kunkel mutagenesis reaction was performed to mutate CDRs L1, L2, and L3 to the parental Fab sequence, and CDRs H1, H2, and H3 were soft randomized (50% wild-type and 50% any other amino acid). The purified mutagenesis reaction was electroporated into SR320 cells preinfected with M13 K07. The library was rescued overnight in a 500 ml culture, double precipitated with PEG / NaCl, and resuspended in PBS with 50% glycerol for storage at -20°C.

[0217] (b) Selection and generation of Fab against FZD4 Second generation libraries were pooled (equal to cfu) and screened for four rounds against recombinant FZD4 cysteine ​​rich domain (CRD) fused to an Fc tag (R&D systems). Input and output phage titers were calculated for carbenecillin (carb) resistant library phage and kanamycin (kan) resistant helper phage. Maxisorb plates were coated overnight at 4° with 5 μg / ml of FZD4-CRD-Fc or Fc protein in PBS and the indicated number of wells and blocked with 0.5% BSA. Coated wells were washed four times with PBS / 0.5% Tween20 (wash buffer) and library phage (PEG precipitated and resuspended in 0.5% BSA / 0.05% Tween20 / PBS) were first incubated in the Fc protein wells for 1 h at room temperature. Unbound phages were transferred to blocked FZD4-CRD-Fc plates and incubated for 1 hour at room temperature. Wells were washed as indicated and then eluted with 100 mM HCl. Eluted phages were amplified using standard protocols in the laboratory for subsequent rounds of selection. Input and output titers of library phages (carb resistant) and helper phages (kan resistant) are shown. DNA from a site-directed kunkel mutagenesis reaction designed to add a His6-amber stop ("His6" disclosed as SEQ ID NO:428) between the phage gene III and Fab CH1 regions of the output phage pools from FZD4 selection was transformed into Omnimax cells and plated for single colonies. Single colonies were used to inoculate 96-well culture boxes and overnight phage supernatants were diluted 1:2 in 0.05% Tween20 / 0.5% BSA / PBS (dilution buffer) to test ELISA binding. Phages were detected using anti-M13-HRP secondary antibody (1:5000 in dilution buffer) and plates were developed with TMB substrate and acid stopper.Absorbance at 450 nm was read for FZD4-Fc and control Fc coated wells as indicated. Heavy and light chains were sequenced to determine the CDR sequences of individual Fabs. CH1-geneIII junctions were sequenced to determine successful incorporation of His-tags and amber stop codons for Fab expression. Phage binders were cloned into bacterial expression vectors and purified as Fab proteins for characterization.

[0218] (c) Characterization of anti-FZD4 binders. The CDR sequences of the antibodies described herein are shown in Table 1. First, the phage binders were tested in an ELISA assay to confirm their binding to antigen. As shown in FIG. 1, all phage clones bind to FZD4 CRD-Fc, but not to Fc protein alone, suggesting that these phage binders bind to FZD4 CRD, not to Fc. Second, the purified Fabs were tested in a competitive ELISA assay in the presence of increasing amounts of non-immobilized antigen to estimate their binding affinity (FIG. 2). In the presence of 50 nM of competing free antigen (FZD4 CRD), the binding of all Fabs was reduced by more than 50%. In the presence of 10 nM of competing antigen (FZD4 CRD), the binding of five Fabs (5022, 5031, 6497, 6498, and 6500) was reduced by more than 50%, suggesting that these five Fabs may have higher binding affinity than the rest. Note that no binding was observed for Fabs 5025 and 6494 in this assay. The reason for this is unclear, but is likely due to physical interference. Next, the Fabs were tested for binding to FZD4 expressed on the cell surface by immunofluorescence staining. A membrane staining pattern was observed for both FZD4 Fabs in CHO cells stably expressing FZD4 (Figure 3), but not in CHO cells (Figure 4). IF staining was used to determine whether these Fabs bind to other FZDs. Binding was tested using 10 CHO cell lines stably expressing individual FZDs on their surface. As shown in Figure 5, the Fabs exhibited a range of binding profiles. Fabs 5017, 5027, 5030, and 6499 bound only to FZD4-expressing CHO cells, whereas the other Fabs (5014, 5018-5023, 5025, 6495, 6496) bind to multiple FZDs, including FZD1, 2, 4, 5, 7, 8, and 9. However, the assay did not show that the Fabs bind to FZD 3, 6, or 10. Next, we used Fabs 5019 and 5020 as examples to test their binding to cancer cells by both immunofluorescence staining and flow cytometry. As shown in Figure 6, both Fabs showed clear membrane-localized staining in the five pancreatic cell lines tested.As shown in FIG. 7, binding of these Fabs to these cancer cell lines was confirmed by flow cytometry.

[0219] 2. Selection with a naive Fab library (library F). (a) Recombinant FZD4-CRD-Fc was used for selection of Fabs that bind to FZD4. Specifically, a Fab phage library (library F) was pre-filtered from non-specific binders with unrelated proteins. To enrich for binders that bind to FZD4-CRD-Fc, several rounds of selection were performed on the pre-filtered Fab library. Clonal phages resulting from the selection were screened by ELISA for binders that specifically bind to FZD4-CRD-Fc but not to Fc. 44 Fabs with unique CDR sequences were identified (see Table 3 for sequences).

[0220] (b) Characterization of anti-FZD4 Fab The anti-FZD4 phage binder clones were then cloned into a bacterial expression vector, and 42 Fabs were expressed and purified for subsequent characterization. Multiple methods were used to determine the binding selectivity for FZDs. First, the purified Fabs were tested in an ELISA assay to confirm binding to the recombinant antigen (FZD4-CRD-Fc) and to other FZDs (FZD1, 2, 5, 6, 7, 8, 9, and 10). As shown in Figure 8, all Fabs bound to FZD4-CRD-Fc (the antigen used for selection), but little binding to Fc or the unrelated protein BSA was observed. Furthermore, these Fabs were shown to bind to other FZDs to various degrees (Figure 8). For example, in addition to binding to FZD4-CRD-Fc, small amounts of binding to FZD2 CRD-Fc and FZD8 CRD-Fc were detected for the Fabs (Figure 8A). Fab 5076 binds to FZD1, 2, 5, 7, and 8 in addition to FZD4 (Figure 8D). We then determined the binding of anti-FZD4 Fabs to various FZDs by immunofluorescence staining of FZD-expressing CHO cells. The results are summarized in Figure 9. The majority of Fabs, including Fabs 5038, 5040–5044, 5046, 5047, 5049–5053, 5055, 5058–5064, 5066, 5068–5072, and 5077–5081), were shown to bind only FZD4 in this assay, while others bind to two or more FZDs. Furthermore, we used surface plasmon resonance (SPR) to determine the binding affinity of anti-FZD4 Fabs to FZD4 CRD-Fc. As shown in Figure 10. FZD4-derived Fabs show high affinity for FZD4 ranging from 0.2 nM to 15.3 nM. To examine whether these Fabs bind to FZDs expressed on pancreatic cancer cells, we tested their binding using flow cytometry. As summarized in Figure 11, most Fabs were able to bind to HPAFII and PATU8988. A small amount of binding was seen for Fabs 5049, 5064, and 5072 (PATU8988 cells).

[0221] Functional testing of FZD4 Fab: To characterize the anti-FZD4 Fab, several assays were performed.

[0222] 1. Effect of anti-FZD4 Fab on Wnt ligand binding to FZD4-CRD. To optimize the assay conditions, increasing concentrations of FZD4-CRD-Fc or Fc were mixed with biotinylated Wnt5A, and the complexes were captured by streptavidin-coated plates. The binding of FZD4-CRD-Fc or Fc was detected by anti-Fc-HRP (Figure 12A). To test the blocking activity of anti-FZD4 Fab, the concentration of FZD4-CRD-Fc that gave an ELISA signal within the linear range was selected. FZD4-CRD-Fc was mixed with biotinylated Wnt5A in the presence of various Fabs as indicated, and the bound FZD4-CRD-Fc was detected by anti-Fc-HRP as in Figure 12A. As shown in FIG. 12B, greater than 80% inhibition of binding was observed for Fabs 5014, 5017-5023, 5027-5031, 5034, 5036, 5037, 6496, 6498, 6499, and 6500, greater than 60% inhibition of binding was observed for Fabs 5035 and 6495, approximately 30% inhibition was observed for Fab 5025, and no inhibition was seen for Fabs 6494 and 6497.

[0223] 2. Effect of anti-FZD4 Fab on β-catenin-promoted transcription. To investigate whether anti-FZD4 Fabs affect β-catenin-dependent signaling, Fabs were tested for their effect on Wnt3a-induced transcriptional activity in a TOPFLASH assay. As shown in Figure 13, potent inhibitory activity (>80%) was observed with Fabs 5014, 5018-5023, 5025, 5036, 5037, and 6495. Lesser inhibition (10-35%) was observed with Fabs 5027-5031, 6497-6499. No inhibition was observed with Fabs 5017, 5034, and 5035.

[0224] 3. Effect on cancer cell proliferation. To test whether anti-FZD4 Fabs affect cancer cell proliferation, pancreatic cancer cells (HPAFII and PATU8988) were treated with 2 and 10 μg / ml of Fab and cell proliferation was measured (see Figure 14A-H). The data are summarized in Figure 15. Fabs that were dose-dependently anti-proliferative include Fabs 5018-5021, 5023, 5036, and 6495. Fabs 5022 and 6500 were only tested at a single dose level (2 μg / ml) and were inhibitory against both cell lines tested. In the assay, several Fabs (5017, 5025, 5035, and 5037) were shown to be inhibitory against the HPAFII cell line. Based on the data summarized in Figure 16, the anti-proliferative activity of anti-FZD4 Fabs appears to be related to the following observations: their binding to FZDs 1, 2, 4, 5, 7, 8, and 9, and their ability to inhibit Wnt3a-induced transcriptional activity. The most potent anti-proliferative Fabs include 5014, 5019-5023, and 6495 (Figure 16).

[0225] 4. Effect on expression of the Wnt regulatory gene Axin2. To further characterize anti-FZD4 antibody, some Fabs were converted to IgG. IgG 5020 and Fab 5019 and 5020 were tested in gene expression assay, and the mRNA level of Axin2 gene was measured by RT qPCR. As shown in Figure 17, IgG 5020, Fab 5019 and 5020 all reduced the Axin2 mRNA level of HPAFII cells after antibody treatment, suggesting that these antibodies inhibit Wnt pathway.

[0226] 5. Effect of anti-FZD4 IgG on cancer cell proliferation. IgG was also tested for its effect on the proliferation of four pancreatic cancer cell lines HPAFII, CAPAN2, AsPC11, and PATU8988. All of these cell lines are known to have damaging mutations in the RNF43 gene. As shown in Figure 18A using the Alamar Blue assay, the proliferation of these pancreatic cells was inhibited by IgG 5019 and 5020 along with their corresponding Fabs. Furthermore, IgG5020 was shown to inhibit the proliferation of cancer cells in a dose-dependent manner (Figure 18B). Interestingly, several pancreatic cancer cell lines (BxPC3 and PANC 1) that do not have damaging mutations in the RNF43 gene were also tested but were not sensitive to IgG5020, suggesting that sensitivity to the FZD4 antibody IgG 5020 may depend on mutations in the RNF43 gene. RNF43 and ZNRF3 are Wnt target genes that encode transmembrane E3 ubiquitin ligases that target Frizzled receptors, and loss-of-function mutations of these genes can lead to high expression of FZDs and sensitize tumor cells to inhibition of Wnt-dependent signaling. To examine whether FZD4 antibodies also affect colony formation, IgG5020 was tested using five pancreatic cancer cell lines (Figure 19). Consistent with the results of Figure 18, IgG5020 inhibits colony formation by cell lines with RNF43 mutations (HPAFII, AsPC1, and PATU8988), but not cell lines without RNF43 mutations (BxPC3 and PANC 1).

[0227] 6. Anti-FZD4 Fab binds to tumor-derived cells from pancreatic cancer patients and affects their proliferation. Next, Fab 5019 and 5020 were tested for binding to pancreatic cancer patient tumor-derived cells (PDX) by immunofluorescence staining. As shown in Figure 20, both Fabs on PDX cell lines GP2A and GP14A and pancreatic cell line CAPAN2 clearly showed membrane staining patterns. Furthermore, these antibodies were tested in cell proliferation assays (Figure 21). Both Fab and IgG 5020 were able to inhibit the proliferation of PDX cell lines GP2A and GP14A, PDX cell lines with mutations in the RNF43 gene, consistent with the observations in Figures 18 and 19.

[0228] In vivo efficacy studies are underway to demonstrate the anti-tumor activity of these disclosed anti-FZD antibodies.

[0229] XI. Illustrative Embodiments 1. 1. An antibody that specifically binds to each cysteine-rich domain (CRD) of one or more human Frizzled receptors selected from FZD 1, 2, 4, 5, 7, 8, and 9, comprising a light chain variable region and / or a heavy chain variable region, The heavy chain variable region comprises the complementarity determining regions CDR-H1, CDR-H2 and CDR-H3, and the light chain variable region comprises the complementarity determining regions CDR-L1, CDR-L2 and CDR-L3, and the amino acid sequences of said CDRs comprise or consist of a sequence selected from the sequences of Table 1a or Table 3a; antibody. 2. The amino acid sequence of the CDR comprises or consists of a sequence selected from the sequences set out below: CDR-H1 is LYYTDM (SEQ ID NO: 149), IYFSSI (SEQ ID NO: 158), IGSSSSI (SEQ ID NO: 159), VNSSSI (SEQ ID NO: 160), IHFSSI (SEQ ID NO: 161), IYSASI (SEQ ID NO: 162), IHSSSI (SEQ ID NO: 157), IYFSSI (SEQ ID NO: 158), IYSSSI (SEQ ID NO: 163), LSYSFF (SEQ ID NO: 164), LSFYFL (SEQ ID NO: 165), LSSYYM (SEQ ID NO: 15), SSFYFM (SEQ ID NO: 166), LSYYYM (SEQ ID NO: 3), IASYFT (SEQ ID NO: 168), FSSSSI (SEQ ID NO: 12), LSYYFM (SEQ ID NO: 169), IYYYPM (SEQ ID NO: 170), FSAYNI (SEQ ID NO: 171), IYYFGM (SEQ ID NO: 172), IHSSSI (SEQ ID NO: 157), and ISYHYM (SEQ ID NO: 429); CDR-H2 is SISLFFGYVS (SEQ ID NO: 150), SNYPSFGSNS (SEQ ID NO: 174), SIYSAFASTS (SEQ ID NO: 175), AFYSSFGATS (SEQ ID NO: 176), AYYSAFASSS (SEQ ID NO: 177), CSYPSFGSTS (SEQ ID NO: 178), SRYPSFGSTS (SEQ ID NO: 179), AIYSSFSANS (SEQ ID NO: 180), SNYPAFGSTS (SEQ ID NO: 181), SIYSAFLSTT (SEQ ID NO: 182), SIYPSSGYTY (SEQ ID NO: 45), SIYPYSGYTY (SEQ ID NO: 36), SIYPFHASTY (SEQ ID NO: 183), TVYPYLDYTY (SEQ ID NO: 184), SIYPYSRNTF (SEQ ID NO: 185), SIYPFSGYST (SEQ ID NO: 186), SIYPYYAYTY (SEQ ID NO: 187), SIYLSFGYGY (SEQ ID NO: 188), CCNSAYRYGP (SEQ ID NO: 189), SIYPYAGNTY (SEQ ID NO: 190), SFYSYYSFTY (SEQ ID NO: 191), SLYTSYGYTY (SEQ ID NO: 192), YIYPFNGYSY (SEQ ID NO: 193), YIYPSYDYTY (SEQ ID NO: 194), YISPPYGFTY (SEQ ID NO: 195), ATYSSFGSIT (SEQ ID NO: 173), and SIYPNLGYTY (SEQ ID NO: 430), CDR-H3 is YHPFFGYAL (SEQ ID NO: 196), YLAM (SEQ ID NO: 151), YHFPFAYSL (SEQ ID NO: 197), YHFPFGFAL (SEQ ID NO: 198), YHFPFGHAL (SEQ ID NO: 199), YHYPFGHAL (SEQ ID NO: 200), YHYPFGHAL (SEQ ID NO: 200), YHYPFGTAL (SEQ ID NO: 201), YHYPFGYAL (SEQ ID NO: 202), YHYPFGYAM (SEQ ID NO: 203), YHYPHGHAL (SEQ ID NO: 204), PAPFSYHVL (SEQ ID NO: 205), AAPGSYHPM (SEQ ID NO: 206), AAPYFYGVM (SEQ ID NO: 207), AFPGSYHPM (SEQ ID NO: 208), AYPFSYHFM (SEQ ID NO: 209), PSAFSYHPM (SEQ ID NO: 210), PVAGAYHPM (SEQ ID NO: 211), SSLGFYNGM (SEQ ID NO: 212), TVRGSKKPYFSGWAM (SEQ ID NO: 213), TYPGYYYIL (SEQ ID NO: 214), SGVGGDHAL (SEQ ID NO: 215), VWYVVQ (SEQ ID NO: 216), GYFYTWGGM (SEQ ID NO: 217), GYFYTWGGM (SEQ ID NO: 217), GYYYSWGGM (SEQ ID NO: 218), YHHPFGYAL (SEQ ID NO: 196), and AYPFSYHYM (SEQ ID NO: 431); CDR-L1 is SVSSA (SEQ ID NO: 103), and / or the CDR-L2 is SASSLYS (SEQ ID NO: 104); and / or CDR-L3 is selected from the group consisting of AAYHWPPLF (SEQ ID NO: 148), GVYLF (SEQ ID NO: 152), SSYSLI (SEQ ID NO: 153), WAYGPF (SEQ ID NO: 154), YYHPI (SEQ ID NO: 155), and YYSLF (SEQ ID NO: 156); The antibody of embodiment 1. 3. the amino acid sequences of said CDRs comprise or consist of sequences selected as described below, CDR-H1 is ISYYYM (SEQ ID NO: 1), IYSYYM (SEQ ID NO: 2), LSYYYM (SEQ ID NO: 3), IYYYSI (SEQ ID NO: 4), LYSYYM (SEQ ID NO: 5), LSSYSM (SEQ ID NO: 6), ISYYYI (SEQ ID NO: 7), LSYSSM (SEQ ID NO: 8), IYYYYM (SEQ ID NO: 9), LYYYSI (SEQ ID NO: 10), ISSYYI (SEQ ID NO: 11), FSSSSI (SEQ ID NO: 12), LSYYSI (SEQ ID NO: 13), LYSYYI (SEQ ID NO: 14), LSSYYM (SEQ ID NO: 15), LSYYYI (SEQ ID NO: 16), ISSYYM (SEQ ID NO: 17), LSYYSM (SEQ ID NO: 18), LYSYSI (SEQ ID NO: 19), LYYYYI (SEQ ID NO: 20), IYSYYI (SEQ ID NO: 21), ISYSYI (SEQ ID NO: 22), and ISYYSM (SEQ ID NO: 23); CDR-H2, SIYSYYGYTY (SEQ ID NO: 24), SIYSSSSSTY (SEQ ID NO: 25), SIYPSSSYTY (SEQ ID NO: 26), SIYSSSSYTS (SEQ ID NO: 27), YISSYSGSTY (SEQ ID NO: 28), SIYSSYGYTY (SEQ ID NO: 29), YISSYYGYTY (SEQ ID NO: 30), SIYPSSSSTY (SEQ ID NO: 31), SIYSSSGYTY (SEQ ID NO: 32), YISSYSGSTS (SEQ ID NO: 33), SISSYYGSTY (SEQ ID NO: 34), SIYSYYGSTY (SEQ ID NO: 35), SIYPYSGYTY (SEQ ID NO: 36), YISPYYGYTS (SEQ ID NO: 37), SISSSSGYTY (SEQ ID NO: 38), SIYSYSSSTY (SEQ ID NO: 39), SISPSSSYTY (SEQ ID NO: 39). 40) YISPYYGYTY (SEQ ID NO: 41), SISPYSSSTY (SEQ ID NO: 42), SIYSSYGSTY (SEQ ID NO: 43), SIYSSSSYTY (SEQ ID NO: 44), SIYPSSGYTY (SEQ ID NO: 45), SIYPYSGSTY (SEQ ID NO: 45). 46. ​​SIYPSYGSTY (SEQ ID NO: 47), YISSYSSYTY (SEQ ID NO: 48), SIYSYYSSTY (SEQ ID NO: 49), YISSSYGYTS (SEQ ID NO: 50). 52) SIYPYYSYTY (SEQ ID NO: 53), SISPYYGYTS (SEQ ID NO: 54), SISPSYSSTY (SEQ ID NO: 55), SISSSYSSTY (SEQ ID NO: 56), SIYPYSGSTS (SEQ ID NO: 57), SISSYYSSTS (SEQ ID NO: 57) 58) and SIYSYSGYTY (SEQ ID NO: 59).CDR-H3、SSFSWAM (SEQ ID NO: 60)、SSFYWAL (SEQ ID NO: 61)、SWFGWGI (SEQ ID NO: 62)、YWFSYGYASYPAF (SEQ ID NO: 63)、HPWYGM (SEQ ID NO: 64) 65)、PAPGHWGF (SEQ ID NO: 66)、SSFFWAM (SEQ ID NO: 67)、SAFYWAM (SEQ ID NO: 68)、HFFAM (SEQ ID NO: 69)、SWWAWAF (SEQ ID NO: 70)、SAFGWF (SEQ ID NO: 70) (SEQ ID NO: 72)、PYYWSGGF (SEQ ID NO: 73)、HPSSSWFSFGAL (SEQ ID NO: 74)、SAFYWAF (SEQ ID NO: 75)、SSYAWAM (SEQ ID NO: 76)、SSFYWAI (SEQ ID NO: 77) 78)、PAVWVGL (SEQ ID NO: 79)、SWVFWAL (SEQ ID NO: 80)、SWVYWGM (SEQ ID NO: 81)、SWVYWAL (SEQ ID NO: 82)、NOSSYAWAI (SEQ ID NO: 83) 84)、HGASFGSGAPAF (SEQ ID NO: 85)、SCFFWAM (SEQ ID NO: 86)、WAFFGL (SEQ ID NO: 87)、SSFYFAM (SEQ ID NO: 88)、SAFSWAI (SEQ ID NO: 89)、SGFY IDW NO: 90)、PSVGYAAF (SEQ ID NO: 91)、SWVGWGL (SEQ ID NO: 92)、SSVGYVAM (SEQ ID NO: 93)、SWVYWAF (SEQ ID NO: 94)、YYYYSSSVYFWYAAL (SEQ ID NO: 95). 96)、SWVYWAI (SEQ ID NO: 97)、SWVGWGI (SEQ ID NO: 98)、SSVYWAL (SEQ ID NO:99), WGGWGSGGYFYAAL (SEQ ID NO: 100), FWYPGM (SEQ ID NO: 101), and SSFAWAF (SEQ ID NO: 102); CDR-L1 is SVSSA (SEQ ID NO: 103), and / or the CDR-L2 is SASSLYS (SEQ ID NO: 104); and / or CDR-L3, HPWSGGYLI (SEQ ID NO: 105), PVGYWGVPI (SEQ ID NO: 106), VSGGAHALI (SEQ ID NO: 107), VSSAYPI (SEQ ID NO: 108), FWGVPI (SEQ ID NO: 109), SYYHYAALI (SEQ ID NO: 110), WYYAPI (SEQ ID NO: 111), SHSYSLI (SEQ ID NO: 112), SGYGPF (SEQ ID NO: 113), SWSSPI (SEQ ID NO: 114), HYSVYASLI (SEQ ID NO: 115), and PHPPSLI (SEQ ID NO: 115). 116, VAYSHVGLI (SEQ ID NO: 117), GYGAPI (SEQ ID NO: 118), SWYSLI (SEQ ID NO: 119), PGYLF (SEQ ID NO: 120), VWFGLI (SEQ ID NO: 121), VYYGSPLF (SEQ ID NO: 120). 122, HAHSPLI (SEQ ID NO: 123), SSAYYPF (SEQ ID NO: 124), GHASPI (SEQ ID NO: 125), SSGGWSLI (SEQ ID NO: 126), VAWSSFLI (SEQ ID NO: 127), SVAAASLI (SEQ ID NO: 126). 128) SGWWGVSLI (SEQ ID NO: 129), SYAAYLF (SEQ ID NO: 130), HGSLF (SEQ ID NO: 131), YAGVSNLF (SEQ ID NO: 132), GWPYSALF (SEQ ID NO: 133), SGYYPSLF (SEQ ID NO: 132). 134)、SYHSGSGLI (SEQ ID NO: 135), HGYSASLI (SEQ ID NO: 136), APGWALF (SEQ ID NO: 137), GHSSPI (SEQ ID NO: 138), GWPSLF (SEQ ID NO: 139), VPGYPVPI (SEQ ID NO: 138). 140) HYYSHLI (SEQ ID NO: 141), GPASSLI (SEQ ID NO: 142), SVGSSYYLI (SEQ ID NO: 142).143), YYGPWVLI (SEQ ID NO: 144), AASWGYPF (SEQ ID NO: 145), HWSYPI (SEQ ID NO: 146), and GGWGPF (SEQ ID NO: 147); The antibody of embodiment 1. 4. (i) a heavy chain amino acid sequence set forth in Table 2; (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity to a heavy chain amino acid sequence set forth in Table 2, wherein the CDR sequences are a set of CDR sequences set forth in Table 1a or Table 3a; or (iii) A conservatively substituted amino acid sequence according to (i), wherein the CDR sequence is a set of CDR sequences as set forth in Table 1a or Table 3a. The antibody of embodiment 2 or 3, comprising a heavy chain variable region comprising: 5. (i) a light chain amino acid sequence as set forth in Table 2; (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity to a light chain amino acid sequence set forth in Table 2, wherein the CDR sequences are a set of CDR sequences set forth in Table 1a or Table 3a; or (iii) A conservatively substituted amino acid sequence according to (i), wherein the CDR sequence is a set of CDR sequences as set forth in Table 1a or Table 3a. 5. The antibody according to any one of aspects 2 to 4, comprising a light chain variable region comprising: 6. The antibody of any of embodiments 1 to 5, wherein the CDR sequences are the complete set of CDR sequences selected from the antibodies identified in Table 1a or Table 3a. 7. The antibody of any of embodiments 1 to 5, wherein the CDR sequences comprise a set of light chain CDR sequences or a set of heavy chain CDR sequences selected from the antibodies identified in Table 1a or Table 3a. 8. The antibody of any one of embodiments 1 to 7, which specifically binds to FZD4. 9. The antibody of embodiment 8, wherein the CDR sequences are the set of CDR sequences of an antibody selected from antibodies 5017, 5027, 5030, 6499, 5038, 5040 to 5044, 5046, 5047, 5049 to 5053, 5055, 5058 to 5064, 5066, 5068 to 5072, 5077 to 5080, or 5081. 10. The antibody according to any one of embodiments 1 to 7, which specifically binds to FZD4 and at least one other FZD receptor selected from FZD1, FZD2, FZD5, FZD7, FZD8, and FZD9. 11. The antibody of embodiment 9, wherein the CDR sequences are the set of CDR sequences of an antibody selected from antibodies 5014, 5016, 5018 to 5023, 5025, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073 to 5076. 12. 12. The antibody of any one of embodiments 1 to 11, which preferentially binds to Frizzled 4 (FZD4) compared to FZD1, 2, 5, 7, 8, or 9. 13. The antibody of any of embodiments 1 to 11, which preferentially binds to FZD4 over other FZD receptors. 14. 14. The antibody of embodiment 13, comprising a CDR sequence which is the set of CDR sequences of an antibody selected from antibodies 5028, 5029, 5031, 5034, 5035, 6497, 6498, 5039, 5045, 5048, 5054, 5056, 5057, 5067, 5073, 5074, 5075. 15. 14. The antibody according to any one of embodiments 1 to 13, having a binding affinity as measured by surface plasmon resonance of between about 0.2 nM and about 15.3 nM. 16. 16. The antibody according to any one of embodiments 1 to 15, which is a monoclonal antibody. 17. 17. The antibody according to any one of embodiments 1 to 16, which is a humanized antibody. 18. The antibody according to any one of embodiments 1 to 17, which is a single chain antibody. 19. 19. The antibody of any one of embodiments 1 to 18, which is an antibody-binding fragment selected from a Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and multimers thereof. 20. The antibody according to any one of embodiments 1 to 18, which is a multivalent antibody that is a bivalent, trivalent, or tetravalent antibody. twenty one. 19. The antibody according to any one of embodiments 1 to 18, which is a bispecific antibody that additionally binds to LPR 5 / 6. twenty two. 19. The antibody according to any one of embodiments 1 to 18, comprising a non-native glycosylation pattern. twenty three. 19. The antibody according to any one of embodiments 1 to 18, comprising a cysteine ​​substitution or addition in the constant or framework region. twenty four. 19. The antibody according to any one of embodiments 1 to 18, which blocks binding of Wnt to FZD. twenty five. 22. An immunoconjugate comprising the antibody according to any one of embodiments 1 to 21 and a detectable label or a cytotoxic agent. 26. 26. The immunoconjugate of embodiment 25, comprising a cytotoxic agent selected from a maytansinoid, an auristatin, a dolastatin, a tubulysin, a cryptophycin, a pyrrolobenzodiazepine (PBD) dimer, an indolinobenzodiazepine dimer, an α-amanitin, a trichothene, SN-38, a duocarmycin, CC1065, a calicheamicin, an enediyne antibiotic, a taxane, a doxorubicin derivative, an anthracycline, and stereoisomers, azanofides, isosteres, analogs, or derivatives thereof. 27. A nucleic acid molecule encoding the antibody of any one of embodiments 1 to 21. 28. 28. The nucleic acid molecule of embodiment 27, wherein one or more of the CDR sequences are encoded by a nucleic acid of Table 1b, Table 1c, Table 3b, or Table 3c. 29. The antibody, (i) a heavy chain nucleic acid sequence as set forth in Table 2; (ii) a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to a heavy chain nucleic acid sequence set forth in Table 2, wherein the CDR sequences are a set of CDR sequences set forth in Table 1a or Table 3a; or (iii) A codon-degenerate nucleic acid sequence according to (i), wherein the CDR sequences are a set of CDR sequences as set forth in Table 1a or Table 3a. 28. The nucleic acid molecule of embodiment 27, comprising a heavy chain variable region encoded by a nucleic acid comprising: 30. The antibody, (i) a light chain nucleic acid sequence as set forth in Table 2; (ii) a nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity to a light chain nucleic acid sequence set forth in Table 2, wherein the CDR sequences are a set of CDR sequences set forth in Table 1a or Table 3a; or (iii) A codon-degenerate nucleic acid sequence according to (i), wherein the CDR sequences are a set of CDR sequences as set forth in Table 1a or Table 3a. 28. The nucleic acid molecule of embodiment 27, comprising a light chain variable region encoded by a nucleic acid comprising: 31. A vector comprising an expression control sequence operably linked to the nucleic acid of any one of aspects 27 to 30. 32. A host cell comprising a recombinant nucleic acid molecule comprising an expression control sequence operably linked to the nucleic acid of any one of aspects 27 to 30. 33. 33. The host cell of embodiment 32, which is a Chinese hamster ovary (CHO) cell. 34. A host cell comprising the vector of embodiment 31. 35. A method for producing an anti-FZD antibody, comprising the step of culturing a host cell according to any one of embodiments 32 to 34. 36. A composition comprising any one or more of the antibodies of embodiments 1 to 24, the immunoconjugates of embodiments 25 to 26, the nucleic acid molecule of embodiment 27 to 30, the vector of embodiment 31, or the host cell of embodiment 34 to 34, optionally together with a suitable diluent. 37. The composition of embodiment 3636, which comprises one or more antibodies or immunoconjugates, and is optionally a pharmaceutical composition. 38. A kit comprising the antibody or antibodies of any one of embodiments 1 to 24, the immunoconjugate of embodiment 25 to 26, the nucleic acid molecule of embodiment 27 to 30, the vector of embodiment 31, or the host cell of embodiment 34 to 34. 39. A method for detecting FZD expression, comprising contacting a sample containing one or more cells with one or more antibodies or immunoconjugates of any one of embodiments 1 to 26 under conditions that allow the formation of antibody:cell complexes, and detecting the presence of any antibody complexes. 40. The method of embodiment 39, wherein detecting is by immunofluorescence. 41. The method of embodiment 39, wherein detecting is by flow cytometry. 42. 42. The method of any one of embodiments 39 to 41, wherein the method is for detecting FZD4 expression and the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081. 43. 1. A method for inhibiting Wnt ligand binding to a FZD receptor, interfering with a Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting activation of disheveled, promoting preservation of a β-catenin degradation complex, promoting accumulation of β-catenin, or inhibiting proliferation of a cell, comprising: A method comprising the step of contacting a cell expressing a FZD receptor with the antibody or immunoconjugate of any one of embodiments 1 to 26. 44. The method of embodiment 43, wherein the Wnt ligand is Wnt3a. 45. The antibody or immunoconjugate is selected from the group consisting of (a) 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081, or (b) 5014, 5016, 5018-5023, 502 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076. 46. A method of treating cancer in a subject in need thereof, comprising the step of administering to the subject an effective amount of a pharmaceutical composition comprising the antibody or immunoconjugate according to any one of embodiments 1 to 26. 47. The method of embodiment 46, wherein the cancer is selected from colon, lung, breast, ovarian, endometrial, pancreatic, gastric, liver, adrenal cortical cancer, and osteoblastoma cancer cells. 48. The method of embodiment 46, wherein the cancer is selected from acute myeloid leukemia, neuroblastoma, liver cancer, lung cancer, endometrial cancer, salivary adenoid cystic carcinoma, colorectal cancer, prostate cancer, glioblastoma, bladder cancer, cervical cancer, pancreatic cancer, colon cancer, breast cancer, esophageal cancer, glioma, gastric cancer, astrocytoma, and osteosarcoma. 49. The method of embodiment 46, wherein the antibody or immunoconjugate specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt3a-induced signaling in at least one assay, and optionally the antibody or immunoconjugate is the antibody or immunoconjugate of any one of embodiments 1 to 26. 50. The antibody or immunoconjugate is selected from the group consisting of (a) 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081, or (b) 5014, 5016, 5018-5023, 502 5, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076. 51. The method of embodiment 46, wherein the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5019 and 5020. 52. 52. The method of embodiment 51, wherein the cancer treated by said method comprises one or more cancer cells comprising a mutation in the RNF43 gene, and wherein the antibody or immunoconjugate comprises a set of CDR sequences corresponding to antibody 5020.

[0230] As used herein, the following meanings apply unless otherwise indicated: The word "may" is used in an permissive sense (i.e., meaning having the possibility) rather than a mandatory sense (i.e., meaning must). The words "include," "including," and "includes," etc., mean including without limitation. The singular forms "a," "an," and "the" include plural referents. Thus, for example, a reference to "an element" includes a combination of two or more elements, notwithstanding the use of other terms and phrases for one or more elements, such as "one or more." The phrase "at least one" includes "one or more," "one or a plurality," and "a plurality." The term "or" is non-exclusive, unless otherwise indicated, i.e., encompasses both "and" and "or." The term "any" between a modifier and a series means that the modifier modifies every member of the series. Thus, for example, the phrase "at least any of one, two, or three" means "at least one, at least two, or at least three." The term "consisting essentially of" refers to the inclusion of the recited elements and other elements that do not materially affect the basic and novel characteristics of the claimed combination.

[0231] Terms of degree used herein, such as "about," "substantially," and "approximately," refer to a reasonable amount of deviation of the modified term so that the end result is not significantly altered. These terms of degree should be interpreted as including a deviation of at least ±5% of the modified term, if this deviation does not negate the meaning of the word it modifies.

[0232] Moreover, it is intended that the definitions and aspects described in a particular section are applicable to other aspects described herein where they are suitable, as understood by those skilled in the art. For example, in the following sections, various aspects of the present invention are defined in more detail. Each aspect so defined can be combined with any other aspect or aspects, unless expressly indicated otherwise. In particular, any feature indicated as being preferred or advantageous can be combined with any other feature or features indicated as being preferred or advantageous.

[0233] It should be understood that the description and drawings are not intended to limit the invention to the particular forms disclosed; on the contrary, the intent is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention as defined by the appended claims. Further modifications and alternative embodiments of various aspects of the invention will be apparent to those skilled in the art in view of this description. Thus, this description and drawings should be interpreted as illustrative only and are for the purpose of teaching those skilled in the art the general manner of carrying out the invention. It should be understood that the forms of the invention shown and described herein should be interpreted as examples of embodiments. Elements and materials may be substituted for those illustrated and described herein, parts and processes may be reversed or omitted, and certain features of the invention may be utilized independently, as would be apparent to any person skilled in the art after having the benefit of this description of the invention. Changes may be made to the elements described herein without departing from the spirit and scope of the invention as set forth in the following claims. The headings used herein are for organizational purposes only and are not meant to be used to limit the scope of the description.

[0234] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0235] Array information SEQUENCE LISTING <110> ANTLERA THERAPEUTICS INC. <120> FRIZZLED RECEPTOR ANTIBODIES AND USES THEREOF <150> US 62 / 886,292 <151> 2019-08-13 <150> US 62 / 885,781 <151> 2019-08-12 <160> 431 <170> PatentIn version 3.5 <210> 1 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 1 Ile Ser Tyr Tyr Tyr Met 1 5 <210> 2 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2 Ile Tyr Ser Tyr Tyr Met 1 5 <210> 3 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 3 Leu Ser Tyr Tyr Tyr Met 1 5 <210> 4 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 4 Ile Tyr Tyr Tyr Ser Ile 1 5 <210> 5 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 5 Leu Tyr Ser Tyr Tyr Met 1 5 <210> 6 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 6 Leu Ser Ser Tyr Ser Met 1 5 <210> 7 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 7 Ile Ser Tyr Tyr Tyr Ile 1 5 <210> 8 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 8 Leu Ser Tyr Ser Ser Met 1 5 <210> 9 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 9 Ile Tyr Tyr Tyr Tyr Met 1 5 <210> 10 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 10 Leu Tyr Tyr Tyr Ser Ile 1 5 <210> 11 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 11 Ile Ser Ser Tyr Tyr Ile 1 5 <210> 12 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 12 Phe Ser Ser Ser Ser Ile 1 5 <210> 13 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 13 Leu Ser Tyr Tyr Ser Ile 1 5 <210> 14 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 14 Leu Tyr Ser Tyr Tyr Ile 1 5 <210> 15 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 15 Leu Ser Ser Tyr Tyr Met 1 5 <210> 16 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 16 Leu Ser Tyr Tyr Tyr Ile 1 5 <210> 17 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 17 Ile Ser Ser Tyr Tyr Met 1 5 <210> 18 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 18 Leu Ser Tyr Tyr Ser Met 1 5 <210> 19 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 19 Leu Tyr Ser Tyr Ser Ile 1 5 <210> 20 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 20 Leu Tyr Tyr Tyr Tyr Ile 1 5 <210> 21 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 21 Ile Tyr Ser Tyr Tyr Ile 1 5 <210> 22 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 22 Ile Ser Tyr Ser Tyr Ile 1 5 <210> 23 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 23 Ile Ser Tyr Tyr Ser Met 1 5 <210> 24 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 24 Ser Ile Tyr Ser Tyr Tyr Gly Tyr Thr Tyr 1 5 10 <210> 25 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 25 Ser Ile Tyr Ser Ser Ser Ser Ser Thr Tyr 1 5 10 <210> 26 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 26 Ser Ile Tyr Pro Ser Ser Ser Tyr Thr Tyr 1 5 10 <210> 27 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 27 Ser Ile Tyr Ser Ser Ser Ser Tyr Thr Ser 1 5 10 <210> 28 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 28 Tyr Ile Ser Ser Tyr Ser Gly Ser Thr Tyr 1 5 10 <210> 29 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 29 Ser Ile Tyr Ser Ser Tyr Gly Tyr Thr Tyr 1 5 10 <210> 30 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 30 Tyr Ile Ser Ser Tyr Tyr Gly Tyr Thr Tyr 1 5 10 <210> 31 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 31 Ser Ile Tyr Pro Ser Ser Ser Ser Thr Tyr 1 5 10 <210> 32 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 32 Ser Ile Tyr Ser Ser Ser Gly Tyr Thr Tyr 1 5 10 <210> 33 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 33 Tyr Ile Ser Ser Tyr Ser Gly Ser Thr Ser 1 5 10 <210> 34 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 34 Ser Ile Ser Ser Tyr Tyr Gly Ser Thr Tyr 1 5 10 <210> 35 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 35 Ser Ile Tyr Ser Tyr Tyr Gly Ser Thr Tyr 1 5 10 <210> 36 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 36 Ser Ile Tyr Pro Tyr Ser Gly Tyr Thr Tyr 1 5 10 <210> 37 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 37 Tyr Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser 1 5 10 <210> 38 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 38 Ser Ile Ser Ser Ser Ser Gly Tyr Thr Tyr 1 5 10 <210> 39 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 39 Ser Ile Tyr Ser Tyr Ser Ser Ser Thr Tyr 1 5 10 <210> 40 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 40 Ser Ile Ser Pro Ser Ser Ser Tyr Thr Tyr 1 5 10 <210> 41 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 41 Tyr Ile Ser Pro Tyr Tyr Gly Tyr Thr Tyr 1 5 10 <210> 42 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 42 Ser Ile Ser Pro Tyr Ser Ser Ser Thr Tyr 1 5 10 <210> 43 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 43 Ser Ile Tyr Ser Ser Tyr Gly Ser Thr Tyr 1 5 10 <210> 44 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 44 Ser Ile Tyr Ser Ser Ser Ser Tyr Thr Tyr 1 5 10 <210> 45 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 45 Ser Ile Tyr Pro Ser Ser Gly Tyr Thr Tyr 1 5 10 <210> 46 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 46 Ser Ile Tyr Pro Tyr Ser Gly Ser Thr Tyr 1 5 10 <210> 47 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 47 Ser Ile Tyr Pro Ser Tyr Gly Ser Thr Tyr 1 5 10 <210> 48 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 48 Tyr Ile Ser Ser Tyr Ser Ser Tyr Thr Tyr 1 5 10 <210> 49 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 49 Ser Ile Tyr Ser Tyr Tyr Ser Ser Thr Tyr 1 5 10 <210> 50 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 50 Tyr Ile Ser Ser Ser Tyr Gly Tyr Thr Ser 1 5 10 <210> 51 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 51 Ser Ile Ser Pro Tyr Ser Ser Tyr Thr Tyr 1 5 10 <210> 52 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 52 Tyr Ile Ser Pro Tyr Ser Gly Tyr Thr Ser 1 5 10 <210> 53 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 53 Ser Ile Tyr Pro Tyr Tyr Ser Tyr Thr Tyr 1 5 10 <210> 54 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 54 Ser Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser 1 5 10 <210> 55 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 55 Ser Ile Ser Pro Ser Tyr Ser Ser Thr Tyr 1 5 10 <210> 56 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 56 Ser Ile Ser Ser Ser Tyr Ser Ser Thr Tyr 1 5 10 <210> 57 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 57 Ser Ile Tyr Pro Tyr Ser Gly Ser Thr Ser 1 5 10 <210> 58 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 58 Ser Ile Ser Ser Tyr Tyr Ser Ser Thr Ser 1 5 10 <210> 59 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 59 Ser Ile Tyr Ser Tyr Ser Gly Tyr Thr Tyr 1 5 10 <210> 60 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 60 Ser Ser Phe Ser Trp Ala Met 1 5 <210> 61 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 61 Ser Ser Phe Tyr Trp Ala Leu 1 5 <210> 62 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 62 Ser Trp Phe Gly Trp Gly Ile 1 5 <210> 63 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 63 Tyr Trp Phe Ser Tyr Gly Tyr Ala Ser Tyr Pro Ala Phe 1 5 10 <210> 64 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 64 His Pro Trp Tyr Gly Met 1 5 <210> 65 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 65 Ser Ala Phe Tyr Trp Ala Leu 1 5 <210> 66 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 66 Pro Ala Pro Gly His Trp Gly Phe 1 5 <210> 67 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 67 Ser Ser Phe Phe Trp Ala Met 1 5 <210> 68 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 68 Ser Ala Phe Tyr Trp Ala Met 1 5 <210> 69 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 69 His Phe Phe Ala Met 1 5 <210> 70 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 70 Ser Trp Trp Ala Trp Ala Phe 1 5 <210> 71 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 71 Ser Ala Phe Gly Trp Ala Leu 1 5 <210> 72 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 72 Ser Ser Phe Phe Phe Ala Met 1 5 <210> 73 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 73 Pro Tyr Tyr Trp Ser Gly Gly Phe 1 5 <210> 74 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 74 His Pro Ser Ser Ser Trp Phe Ser Phe Gly Ala Leu 1 5 10 <210> 75 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 75 Ser Ala Phe Tyr Trp Ala Phe 1 5 <210> 76 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 76 Ser Ser Tyr Ala Trp Ala Met 1 5 <210> 77 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 77 Ser Ser Phe Tyr Trp Ala Ile 1 5 <210> 78 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 78 Ser Pro Trp Gly Ser Gly Trp Ala Gly Phe 1 5 10 <210> 79 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 79 Pro Ala Val Trp Val Gly Leu 1 5 <210> 80 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 80 Ser Trp Val Phe Trp Ala Leu 1 5 <210> 81 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 81 Ser Trp Val Tyr Trp Gly Met 1 5 <210> 82 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 82 Ser Trp Val Tyr Trp Ala Leu 1 5 <210> 83 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 83 Ser Ser Tyr Ala Trp Ala Ile 1 5 <210> 84 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 84 Ser Ser Phe Tyr Trp Ala Met 1 5 <210> 85 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 85 His Gly Ala Ser Phe Gly Ser Gly Ala Pro Ala Phe 1 5 10 <210> 86 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 86 Ser Cys Phe Phe Trp Ala Met 1 5 <210> 87 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 87 Trp Ala Phe Phe Gly Leu 1 5 <210> 88 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 88 Ser Ser Phe Tyr Phe Ala Met 1 5 <210> 89 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 89 Ser Ala Phe Ser Trp Ala Ile 1 5 <210> 90 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 90 Ser Gly Phe Tyr Trp Ala Leu 1 5 <210> 91 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 91 Pro Ser Val Gly Tyr Ala Ala Phe 1 5 <210> 92 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 92 Ser Trp Val Gly Trp Gly Leu 1 5 <210> 93 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 93 Ser Ser Val Gly Tyr Val Ala Met 1 5 <210> 94 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 94 Ser Trp Val Tyr Trp Ala Phe 1 5 <210> 95 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 95 Tyr Tyr Tyr Ser Ser Ser Val Tyr Phe Trp Tyr Ala Ala Leu 1 5 10 <210> 96 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 96 Ser Ser Phe Phe Trp Ala Ile 1 5 <210> 97 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 97 Ser Trp Val Tyr Trp Ala Ile 1 5 <210> 98 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 98 Ser Trp Val Gly Trp Gly Ile 1 5 <210> 99 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 99 Ser Ser Val Tyr Trp Ala Leu 1 5 <210> 100 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 100 Trp Gly Gly Trp Gly Ser Gly Gly Tyr Phe Tyr Ala Ala Leu 1 5 10 <210> 101 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 101 Phe Trp Tyr Pro Gly Met 1 5 <210> 102 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 102 Ser Ser Phe Ala Trp Ala Phe 1 5 <210> 103 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 103 Ser Val Ser Ser Ala 1 5 <210> 104 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 104 Ser Ala Ser Ser Leu Tyr Ser 1 5 <210> 105 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 105 His Pro Trp Ser Gly Gly Tyr Leu Ile 1 5 <210> 106 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 106 Pro Val Gly Tyr Trp Gly Val Pro Ile 1 5 <210> 107 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 107 Val Ser Gly Gly Ala His Ala Leu Ile 1 5 <210> 108 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 108 Val Ser Ser Ala Tyr Pro Ile 1 5 <210> 109 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 109 Phe Trp Gly Val Pro Ile 1 5 <210> 110 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 110 Ser Tyr Tyr His Tyr Ala Ala Leu Ile 1 5 <210> 111 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 111 Trp Tyr Tyr Ala Pro Ile 1 5 <210> 112 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 112 Ser His Ser Tyr Ser Leu Ile 1 5 <210> 113 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 113 Ser Gly Tyr Gly Pro Phe 1 5 <210> 114 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 114 Ser Trp Ser Ser Pro Ile 1 5 <210> 115 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 115 His Tyr Ser Val Tyr Ala Ser Leu Ile 1 5 <210> 116 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 116 Pro His Pro Pro Ser Leu Ile 1 5 <210> 117 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 117 Val Ala Tyr Ser His Val Gly Leu Ile 1 5 <210> 118 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 118 Gly Tyr Gly Ala Pro Ile 1 5 <210> 119 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 119 Ser Trp Tyr Ser Leu Ile 1 5 <210> 120 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 120 Pro Gly Tyr Leu Phe 1 5 <210> 121 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 121 Val Trp Phe Gly Leu Ile 1 5 <210> 122 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 122 Val Tyr Tyr Gly Ser Pro Leu Phe 1 5 <210> 123 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 123 His Ala His Ser Pro Leu Ile 1 5 <210> 124 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 124 Ser Ser Ala Tyr Tyr Pro Phe 1 5 <210> 125 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 125 Gly His Ala Ser Pro Ile 1 5 <210> 126 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 126 Ser Ser Gly Gly Trp Ser Leu Ile 1 5 <210> 127 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 127 Val Ala Trp Ser Ser Phe Leu Ile 1 5 <210> 128 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 128 Ser Val Ala Ala Ala Ser Leu Ile 1 5 <210> 129 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 129 Ser Gly Trp Trp Gly Val Ser Leu Ile 1 5 <210> 130 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 130 Ser Tyr Ala Ala Tyr Leu Phe 1 5 <210> 131 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 131 His Gly Ser Leu Phe 1 5 <210> 132 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 132 Tyr Ala Gly Val Ser Asn Leu Phe 1 5 <210> 133 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 133 Gly Trp Pro Tyr Ser Ala Leu Phe 1 5 <210> 134 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 134 Ser Gly Tyr Tyr Pro Ser Leu Phe 1 5 <210> 135 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 135 Ser Tyr His Ser Gly Ser Gly Leu Ile 1 5 <210> 136 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 136 His Gly Tyr Ser Ala Ser Leu Ile 1 5 <210> 137 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 137 Ala Pro Gly Trp Ala Leu Phe 1 5 <210> 138 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 138 Gly His Ser Ser Pro Ile 1 5 <210> 139 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 139 Gly Trp Pro Ser Leu Phe 1 5 <210> 140 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 140 Val Pro Gly Tyr Pro Val Pro Ile 1 5 <210> 141 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 141 His Tyr Tyr Ser His Leu Ile 1 5 <210> 142 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 142 Gly Pro Ala Ser Ser Leu Ile 1 5 <210> 143 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 143 Ser Val Gly Ser Ser Tyr Tyr Leu Ile 1 5 <210> 144 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 144 Tyr Tyr Gly Pro Trp Val Leu Ile 1 5 <210> 145 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 145 Ala Ala Ser Trp Gly Tyr Pro Phe 1 5 <210> 146 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 146 His Trp Ser Tyr Pro Ile 1 5 <210> 147 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 147 Gly Gly Trp Gly Pro Phe 1 5 <210> 148 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 148 Ala Ala Tyr His Trp Pro Pro Leu Phe 1 5 <210> 149 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 149 Leu Tyr Tyr Thr Asp Met 1 5 <210> 150 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 150 Ser Ile Ser Leu Phe Phe Gly Tyr Val Ser 1 5 10 <210> 151 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 151 Tyr Leu Ala Met 1 <210> 152 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 152 Gly Val Tyr Leu Phe 1 5 <210> 153 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 153 Ser Ser Tyr Ser Leu Ile 1 5 <210> 154 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 154 Trp Ala Tyr Gly Pro Phe 1 5 <210> 155 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 155 Tyr Tyr His Pro Ile 1 5 <210> 156 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 156 Tyr Tyr Ser Leu Phe 1 5 <210> 157 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 157 Ile His Ser Ser Ser Ile 1 5 <210> 158 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 158 Ile Tyr Phe Ser Ser Ile 1 5 <210> 159 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 159 Ile Gly Ser Ser Ser Ile 1 5 <210> 160 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 160 Val Asn Ser Ser Ser Ile 1 5 <210> 161 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 161 Ile His Phe Ser Ser Ile 1 5 <210> 162 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 162 Ile Tyr Ser Ala Ser Ile 1 5 <210> 163 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 163 Ile Tyr Ser Ser Ser Ile 1 5 <210> 164 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 164 Leu Ser Tyr Ser Phe Phe 1 5 <210> 165 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 165 Leu Ser Phe Tyr Phe Leu 1 5 <210> 166 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 166 Ser Ser Phe Tyr Phe Met 1 5 <210> 167 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 167 Leu Ser Phe Tyr Tyr Met 1 5 <210> 168 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 168 Ile Ala Ser Tyr Phe Thr 1 5 <210> 169 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 169 Leu Ser Tyr Tyr Phe Met 1 5 <210> 170 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 170 Ile Tyr Tyr Tyr Pro Met 1 5 <210> 171 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 171 Phe Ser Ala Tyr Asn Ile 1 5 <210> 172 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 172 Ile Tyr Tyr Phe Gly Met 1 5 <210> 173 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 173 Ala Thr Tyr Ser Ser Phe Gly Ser Ile Thr 1 5 10 <210> 174 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 174 Ser Asn Tyr Pro Ser Phe Gly Ser Asn Ser 1 5 10 <210> 175 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 175 Ser Ile Tyr Ser Ala Phe Ala Ser Thr Ser 1 5 10 <210> 176 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 176 Ala Phe Tyr Ser Ser Phe Gly Ala Thr Ser 1 5 10 <210> 177 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 177 Ala Tyr Tyr Ser Ala Phe Ala Ser Ser Ser 1 5 10 <210> 178 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 178 Cys Ser Tyr Pro Ser Phe Gly Ser Thr Ser 1 5 10 <210> 179 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 179 Ser Arg Tyr Pro Ser Phe Gly Ser Thr Ser 1 5 10 <210> 180 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 180 Ala Ile Tyr Ser Ser Phe Ser Ala Asn Ser 1 5 10 <210> 181 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 181 Ser Asn Tyr Pro Ala Phe Gly Ser Thr Ser 1 5 10 <210> 182 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 182 Ser Ile Tyr Ser Ala Phe Leu Ser Thr Thr 1 5 10 <210> 183 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 183 Ser Ile Tyr Pro Phe His Ala Ser Thr Tyr 1 5 10 <210> 184 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 184 Thr Val Tyr Pro Tyr Leu Asp Tyr Thr Tyr 1 5 10 <210> 185 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 185 Ser Ile Tyr Pro Tyr Ser Arg Asn Thr Phe 1 5 10 <210> 186 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 186 Ser Ile Tyr Pro Phe Ser Gly Tyr Ser Thr 1 5 10 <210> 187 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 187 Ser Ile Tyr Pro Tyr Tyr Ala Tyr Thr Tyr 1 5 10 <210> 188 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 188 Ser Ile Tyr Leu Ser Phe Gly Tyr Gly Tyr 1 5 10 <210> 189 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 189 Cys Cys Asn Ser Ala Tyr Arg Tyr Gly Pro 1 5 10 <210> 190 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 190 Ser Ile Tyr Pro Tyr Ala Gly Asn Thr Tyr 1 5 10 <210> 191 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 191 Ser Phe Tyr Ser Tyr Tyr Ser Phe Thr Tyr 1 5 10 <210> 192 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 192 Ser Leu Tyr Thr Ser Tyr Gly Tyr Thr Tyr 1 5 10 <210> 193 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 193 Tyr Ile Tyr Pro Phe Asn Gly Tyr Ser Tyr 1 5 10 <210> 194 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 194 Tyr Ile Tyr Pro Ser Tyr Asp Tyr Thr Tyr 1 5 10 <210> 195 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 195 Tyr Ile Ser Pro Pro Tyr Gly Phe Thr Tyr 1 5 10 <210> 196 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 196 Tyr His His Pro Phe Gly Tyr Ala Leu 1 5 <210> 197 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 197 Tyr His Phe Pro Phe Ala Tyr Ser Leu 1 5 <210> 198 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 198 Tyr His Phe Pro Phe Gly Phe Ala Leu 1 5 <210> 199 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 199 Tyr His Phe Pro Phe Gly His Ala Leu 1 5 <210> 200 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 200 Tyr His Tyr Pro Phe Gly His Ala Leu 1 5 <210> 201 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 201 Tyr His Tyr Pro Phe Gly Thr Ala Leu 1 5 <210> 202 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 202 Tyr His Tyr Pro Phe Gly Tyr Ala Leu 1 5 <210> 203 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 203 Tyr His Tyr Pro Phe Gly Tyr Ala Met 1 5 <210> 204 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 204 Tyr His Tyr Pro His Gly His Ala Leu 1 5 <210> 205 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 205 Pro Ala Pro Phe Ser Tyr His Val Leu 1 5 <210> 206 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 206 Ala Ala Pro Gly Ser Tyr His Pro Met 1 5 <210> 207 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 207 Ala Ala Pro Tyr Phe Tyr Gly Val Met 1 5 <210> 208 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 208 Ala Phe Pro Gly Ser Tyr His Pro Met 1 5 <210> 209 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 209 Ala Tyr Pro Phe Ser Tyr His Phe Met 1 5 <210> 210 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 210 Pro Ser Ala Phe Ser Tyr His Pro Met 1 5 <210> 211 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 211 Pro Val Ala Gly Ala Tyr His Pro Met 1 5 <210> 212 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 212 Ser Ser Leu Gly Phe Tyr Asn Gly Met 1 5 <210> 213 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 213 Thr Val Arg Gly Ser Lys Lys Pro Tyr Phe Ser Gly Trp Ala Met 1 5 10 15 <210> 214 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 214 Thr Tyr Pro Gly Tyr Tyr Tyr Ile Leu 1 5 <210> 215 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 215 Ser Gly Val Gly Gly Asp His Ala Leu 1 5 <210> 216 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 216 Val Trp Tyr Val Val Gln 1 5 <210> 217 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 217 Gly Tyr Phe Tyr Thr Trp Gly Gly Met 1 5 <210> 218 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 218 Gly Tyr Tyr Tyr Ser Trp Gly Gly Met 1 5 <210> 219 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 219 tccgtgtcca gcgct 15 <210> 220 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 220 tcggcatcca gcctctactc t 21 <210> 221 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 221 ggtgtttacc tgttc 15 <210> 222 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 222 gctgcttacc attggccgcc gctgttcacg 30 <210> 223 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 223 ggtgtttacc tgttcacg 18 <210> 224 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 224 tcttcttatt ctctgatcac g 21 <210> 225 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 225 tgggcttacg gtccgttcac g 21 <210> 226 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 226 tactaccatc cgatcacg 18 <210> 227 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 227 tactactctc tgttcacg 18 <210> 228 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 228 atccattctt cttctata 18 <210> 229 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 229 ctctattata ctgatatg 18 <210> 230 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 230 atctattttt cttctatc 18 <210> 231 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 231 atcggttctt cttctatc 18 <210> 232 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 232 gtcaattctt cttctatc 18 <210> 233 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 233 atccattttt cttctatc 18 <210> 234 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 234 atctattctg cttctatc 18 <210> 235 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 235 atccattctt cttctatc 18 <210> 236 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 236 atctattctt cttctatc 18 <210> 237 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 237 ctctcttatt cttttttc 18 <210> 238 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 238 ctctcttttt attttttg 18 <210> 239 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 239 ctttcttctt attatatg 18 <210> 240 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 240 tcctcttttt attttatg 18 <210> 241 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 241 ctctcttatt attatatg 18 <210> 242 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 242 ctcagttttt attatatg 18 <210> 243 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 243 atcgcttctt attttacg 18 <210> 244 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 244 ttttcttctt cttctata 18 <210> 245 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 245 ctctcttatt attttatg 18 <210> 246 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 246 atctattatt atcctatg 18 <210> 247 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 247 ttctctgctt ataatatc 18 <210> 248 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 248 atctattatt ttggtatg 18 <210> 249 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 249 gctacttatt cttcttttgg ctctattact 30 <210> 250 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 250 tctatttctc ttttttttgg ctatgtttct 30 <210> 251 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 251 tctaattatc cttcttttgg ctctaattct 30 <210> 252 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 252 tctatttatt ctgcttttgc ctctacttct 30 <210> 253 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 253 gctttttatt cttcttttgg cgctacttct 30 <210> 254 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 254 gcttattatt ctgcttttgc ctctagttct 30 <210> 255 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 255 tgtagttatc cttcttttgg ctctacttct 30 <210> 256 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 256 tctcgttatc cttcttttgg ctctacttct 30 <210> 257 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 257 gctatttatt cttcttttag cgctaattct 30 <210> 258 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 258 tctaattatc ctgcttttgg ctctacttct 30 <210> 259 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 259 tctatttatt ctgcttttct ctctactact 30 <210> 260 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 260 tctatttatc cttcttctgg ctatacttat 30 <210> 261 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 261 tctatttatc cttattctgg ctatacttat 30 <210> 262 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 262 tctatttatc cttttcatgc ctctacttat 30 <210> 263 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 263 actgtttatc cttatcttga ctatacttat 30 <210> 264 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 264 tctatttatc cttattctcg caatactttt 30 <210> 265 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 265 tctatttatc ctttttctgg ctattctact 30 <210> 266 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 266 tctatttatc cttattatgc ctatacttat 30 <210> 267 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 267 tctatttatc tttcttttgg ctatggttat 30 <210> 268 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 268 tgttgtaatt ctgcttatcg ctatggtcct 30 <210> 269 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 269 tctatttatc cttatgctgg caatacttat 30 <210> 270 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 270 tctttttatt cttattatag ctttacttat 30 <210> 271 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 271 tctctttata cttcttatgg ctatacttat 30 <210> 272 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 272 tatatttatc cttttaatgg ctatagttat 30 <210> 273 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 273 tatatttatc cttcttatga ctatacttat 30 <210> 274 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 274 tatatttctc ctccttatgg ctttacttat 30 <210> 275 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 275 taccatcacc cgttcggtta tgctttg 27 <210> 276 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 276 tacttggcta tg 12 <210> 277 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 277 taccatttcc cgttcgctta ttctttg 27 <210> 278 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 278 taccatttcc cgttcggttt tgctttg 27 <210> 279 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 279 taccatttcc cgttcggtca tgctctg 27 <210> 280 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 280 taccattacc cgttcggtca tgctttg 27 <210> 281 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 281 taccattacc cgttcggtca tgctctg 27 <210> 282 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 282 taccattacc cgttcggtac tgctttg 27 <210> 283 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 283 taccattacc cgttcggtta tgctttg 27 <210> 284 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 284 taccattacc cgttcggtta tgctatg 27 <210> 285 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 285 taccattacc cgcacggtca tgctttg 27 <210> 286 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (9)..(9) <223> a, c, t, g, unknown or other <400> 286 ccggctccnt tttcttacca tgttctg 27 <210> 287 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 287 gcggctccgg gttcttacca tcctatg 27 <210> 288 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 288 gcggctccct atttttacgg tgttatg 27 <210> 289 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 289 gcgtttccgg gttcttacca tcctatg 27 <210> 290 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 290 cgcgtatccg ttttcttacc attttatg 28 <210> 291 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 291 ccgtctgcgt tttcttacca tcctatg 27 <210> 292 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 292 ccggttgcgg gtgcttacca tcctatg 27 <210> 293 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 293 tcgtctctgg gtttttacaa tggtatg 27 <210> 294 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 294 actgttcgtg gatccaaaaa accgtacttc tctggttggg ctatg 45 <210> 295 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 295 acgtatccgg gttattacta tattctg 27 <210> 296 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 296 tctggtgtgg gtggtgatca cgctttg 27 <210> 297 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 297 gtttggtacg ttgttcag 18 <210> 298 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 298 ggttacttct acacttgggg tggtatg 27 <210> 299 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 299 ggttactact actcttgggg tggtatg 27 <210> 300 <211> 217 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 300 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Ser Ser Ala 20 25 30 Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ser Ala Ser Ser Leu Tyr Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Arg Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Ala Tyr His Trp Pro 85 90 95 Pro Leu Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 100 105 110 Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 115 120 125 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 130 135 140 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 145 150 155 160 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 165 170 175 Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His 180 185 190 Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val 195 200 205 Thr Lys Ser Phe Asn Arg Gly Glu Cys 210 215 <210> 301 <211> 659 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 301 gatatccaga tgacccagtc cccgagctcc ctgtccgcct ctgtgggcga tagggtcacc 60 atcacctgcc gtgccagtca gtccgtgtcc agcgctgtag cctggtatca agaaacca 120 ggaaaagctc cgaagcttct gatttactcg gcatccagcc tctactctac tctggagtcc 180 cttctcgctt ctctggtagc cgttccggga cggatttcac tctgaccatc agcagtctgc 240 agccggaaga cttcgcaact tattactgtc agcaagctgc ttaccattgg ccgccgctgt 300 tcacgacgtt cggacagggt accaaggtgg agatcaaacg tacggtggct gcaccatctg 360 tcttcatctt cccgccatct gatgagcagt tgaaatctgg aactgcctct gttgtgtgcc 420 tgctgaataa cttctatccc agagaggcca aagtacagtg gaaggtggat aacgccctcc 480 aatcgggtaa ctcccaggag agtgtcacag agcaggacag caaggacagc acctacagcc 540 tcagcagcac cctgacgctg agcaaagcag actacgagaa acaaaagtc tacgcctgcg 600 aagtcaccca tcagggcctg agctcgcccg tcaaaagag cttcaacagg ggagagtgt 659 <210> 302 <211> 445 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 302 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Leu Tyr Tyr Thr 20 25 30 Asp Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Ser Ile Ser Leu Phe Phe Gly Tyr Val Ser Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Tyr Leu Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr 100 105 110 Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro 115 120 125 Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val 130 135 140 Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala 145 150 155 160 Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly 165 170 175 Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly 180 185 190 Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys 195 200 205 Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys 210 215 220 Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu 225 230 235 240 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255 Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys 260 265 270 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285 Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu 290 295 300 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 305 310 315 320 Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 325 330 335 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350 Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360 365 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 370 375 380 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 385 390 395 400 Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln 405 410 415 Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 435 440 445 <210> 303 <211> 1335 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 303 gaggttcagc tggtggagtc tggcggtggc ctggtgcagc cagggggctc actccgtttg 60 tcctgtgcag cttctggctt caacctctat tatactgata tgcactgggt gcgtcaggcc 120 ccgggtaagg gcctggaatg ggttgcatct atttctcttt tttttggcta tgtttcttat 180 gccgatagcg tcaagggccg tttcactata agcgcagaca catccaaaaa cacagcctac 240 ctacaaatga acagcttaag agctgaggac actgccgtct attattgtgc tcgctacttg 300 gctatggact actggggtca aggaaccctg gtcaccgtct cctcggctag caccaagggc 360 ccatcggtct tccccctggc accctcctcc aagagcacct ctgggggcac agcggccctg 420 ggctgcctgg tcaaggacta cttccccgaa ccggtgacgg tgtcgtggaa ctcaggcgcc 480 ctgaccagcg gcgtgcacac cttcccggct gtcctacagt cctcaggact ctactccctc 540 agcagcgtgg tgaccgtgcc ctccagcagc ttgggcaccc agacctacat ctgcaacgtg 600 aatcacaagc ccagcaacc caaggtggac aagaaagttg agcccaaatc ttgtgacaaa actcacacat gcccaccgtg cccagcacct gaactcctgg ggggaccgtc agtcttcctc 720 ttccccccaa aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgtg gtggtggacg tgagccacga agaccctgag gtcaagttca actggtacgt ggacggcgtg 840 gaggtgcata atgccaagac aaagccgcgg gaggagcagt acaacagcac gtaccgtgtg gtcagcgtcc tcaccgtcct gcaccaggac tggctgaatg gcaaggagta caagtgcaag 960 gtctccaaca aagccctccc agcccccatc gagaaacca tctccaaagc caaagggcag ccccgagac cacaggtgta caccctgccc ccatcccggg aggagatgac caagaccag gtcagcctga cctgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtggggag agcaatgggc agccggagaa caactacag accacgcctc ccgtgctgga ctccgacggc tccttcttcc tctacagcaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtc ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacgcagaa gagcctctcc ctgtctccgg gtaaa 1335 <210> 304 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 304 catccgtggt ctggtggtta cctgatc 27 <210> 305 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 305 ccggttggtt actggggtgt tccgatc 27 <210> 306 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 306 gtttctggtg gtgctcatgc tctgatc 27 <210> 307 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 307 gtttcttctg cttacccgat c 21 <210> 308 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 308 ttctggggtg ttccgatc 18 <210> 309 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 309 tcttactacc attacgctgc tctgatc 27 <210> 310 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 310 tggtactacg ctccgatc 18 <210> 311 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 311 tctcattctt actctctgat c 21 <210> 312 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 312 tctggttacg gtccgttc 18 <210> 313 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 313 tcttggtctt ctccgatc 18 <210> 314 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 314 cattactctg tttacgcttc tctgatc 27 <210> 315 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 315 ccgcatccgc cgtctctgat c 21 <210> 316 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 316 gttgcctact ctcatgttgg tctgatc 27 <210> 317 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 317 ggttacggtg ctccgatc 18 <210> 318 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 318 tcttggtact ctctgatc 18 <210> 319 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 319 ccgggttacc tgttc 15 <210> 320 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 320 gtttggttcg gtctgatc 18 <210> 321 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 321 gtttactacg gttctccgct gttc 24 <210> 322 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 322 catgctcatt ctccgctgat c 21 <210> 323 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 323 tcttctgctt actacccgtt c 21 <210> 324 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 324 ggtcatgctt ctccgatc 18 <210> 325 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 325 tcttctggtg gttggtctct gatc 24 <210> 326 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 326 gttgcttggt cttctttcct gatc 24 <210> 327 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 327 tctgttgctg ctgcttctct gatc 24 <210> 328 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 328 tctggttggt ggggtgtttc tctgatc 27 <210> 329 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 329 tcttacgctg cttacctgtt c 21 <210> 330 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 330 catggttctc tgttc 15 <210> 331 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 331 ggttggccgt actctgctct gttc 24 <210> 332 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 332 tctggttact acccgtctct gttc 24 <210> 333 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 333 tcttaccatt ctggttctgg tctgatc 27 <210> 334 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 334 catggttact ctgcttctct gatc 24 <210> 335 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 335 gctccgggtt gggctctgtt c 21 <210> 336 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 336 ggtcattctt ctccgatc 18 <210> 337 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 337 ggttggccgt ctctgttc 18 <210> 338 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 338 gttccgggtt acccggttcc gatc 24 <210> 339 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 339 cattactact ctcatctgat c 21 <210> 340 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 340 ggtccggctt cttctctgat c 21 <210> 341 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 341 tctgttggtt cttcttacta cctgatc 27 <210> 342 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 342 tactacggtc cgtgggttct gatc 24 <210> 343 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 343 gctgcttctt ggggttaccc gttc 24 <210> 344 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 344 cattggtctt acccgatc 18 <210> 345 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 345 ggtggttggg gtccgttc 18 <210> 346 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 346 tctatttatt cttattatgg ctatacttat 30 <210> 347 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 347 tctatttatt cttcttctag ctctacttat 30 <210> 348 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 348 tctatttatc cttcttctag ctatacttat 30 <210> 349 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 349 tctatttatt cttcttctag ctatacttct 30 <210> 350 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 350 tatatttctt cttattctgg ctctacttat 30 <210> 351 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 351 ctctattctt attatatg 18 <210> 352 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 352 tatatttctt cttattatgg ctatacttat 30 <210> 353 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 353 tctatttatc cttcttctag ctctacttat 30 <210> 354 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 354 tctatttatt cttcttctgg ctatacttat 30 <210> 355 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 355 ctctcttatt cttctatg 18 <210> 356 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 356 tctatttctt cttattatgg ctctacttat 30 <210> 357 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 357 atctattatt attatatg 18 <210> 358 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 358 tatatttctc cttattatgg ctatacttct 30 <210> 359 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 359 tctatttctt cttcttctgg ctatacttat 30 <210> 360 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 360 tctatttatt cttattctag ctctacttat 30 <210> 361 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 361 tctatttctc cttcttctag ctatacttat 30 <210> 362 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 362 tatatttctc cttattatgg ctatacttat 30 <210> 363 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 363 tctatttctc cttattctag ctctacttat 30 <210> 364 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 364 tctatttatt cttcttatgg ctctacttat 30 <210> 365 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 365 tctatttatt cttcttctag ctatacttat 30 <210> 366 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 366 tctatttatc cttattctgg ctctacttat 30 <210> 367 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 367 tctatttatt cttattatgg ctctacttat 30 <210> 368 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 368 tctatttatc cttcttatgg ctctacttat 30 <210> 369 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 369 tatatttctt cttattctag ctatacttat 30 <210> 370 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 370 tctatttatt cttattatag ctctacttat 30 <210> 371 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 371 atctcttatt attatatg 18 <210> 372 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 372 tatatttctt cttcttatgg ctatacttct 30 <210> 373 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 373 tctatttctc cttattctag ctatacttat 30 <210> 374 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 374 ctctattctt attctatc 18 <210> 375 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 375 atctcttatt attatatc 18 <210> 376 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 376 tctatttctc cttattatgg ctatacttct 30 <210> 377 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (2)..(2) <223> a, c, t, g, unknown or other <400> 377 tntatttctc cttcttatag ctctacttat 30 <210> 378 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 378 tctatttctt cttcttatag ctctacttat 30 <210> 379 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 379 tctatttatc cttattctgg ctctacttct 30 <210> 380 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 380 tctatttctt cttattatag ctctacttct 30 <210> 381 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 381 tctatttatt cttattctgg ctatacttat 30 <210> 382 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 382 tctatttatt cttcttatgg ctatacttat 30 <210> 383 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 383 tatatttctt cttattctgg ctctacttct 30 <210> 384 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 384 tatatttctc cttattctgg ctatacttct 30 <210> 385 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 385 tcttctttct cttgggctat g 21 <210> 386 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 386 tcttctttct actgggcttt g 21 <210> 387 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 387 tcttggttcg gttggggtat t 21 <210> 388 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 388 tactggttct cttacggtta cgcttcttac ccggctttt 39 <210> 389 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 389 catccgtggt acggtatg 18 <210> 390 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 390 tctgctttct actgggcttt g 21 <210> 391 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 391 ccggctccgg gtcattgggg tttt 24 <210> 392 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 392 tcttctttct tctgggctat g 21 <210> 393 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 393 tctgctttct actgggctat g 21 <210> 394 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 394 catttcttcg ctatg 15 <210> 395 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 395 tcttggtggg cttgggcttt t 21 <210> 396 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 396 tctgctttcg gttgggcttt g 21 <210> 397 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 397 tcttctttct tcttcgctat g 21 <210> 398 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 398 ccgtactact ggtctggtgg tttt 24 <210> 399 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 399 catccgtctt cttcttggtt ctctttcggt gctttg 36 <210> 400 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 400 tctgctttct actgggcttt t 21 <210> 401 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 401 tcttcttacg cttgggctat g 21 <210> 402 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (11)..(11) <223> a, c, t, g, unknown or other <400> 402 tcttctttct nctgggctat t 21 <210> 403 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 403 tctccgtggg gttctggttg ggctggtttt 30 <210> 404 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 404 ccagctgttt gggttggttt g 21 <210> 405 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 405 tcttgggttt tctgggcttt g 21 <210> 406 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (16)..(16) <223> a, c, t, g, unknown or other <400> 406 tcttgggttt actggntatg 20 <210> 407 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 407 tcttgggttt actgggcttt g 21 <210> 408 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 408 tcttcttacg cttgggctat t 21 <210> 409 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 409 tcttctttct actgggctat g 21 <210> 410 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 410 catggtgctt ctttcggttc tggtgctccg gctttt 36 <210> 411 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 411 tcttgttttt tctgggctat g 21 <210> 412 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 412 tgggctttct tcggtttg 18 <210> 413 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 413 tcttctttct acttcgctat g 21 <210> 414 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 414 tctgctttct cttgggctat t 21 <210> 415 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 415 tctggtttct actgggcttt g 21 <210> 416 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 416 ccgtctgttg gttacgctgc tttt 24 <210> 417 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 417 tcttgggttg gttggggttt g 21 <210> 418 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 418 tcttctgttg gttacgttgc tatg 24 <210> 419 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 419 tcttgggttt actgggcttt t 21 <210> 420 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 420 tactactact cttcttctgt ttacttctgg tacgctgctt tg 42 <210> 421 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 421 tcttctttct tctgggctat t 21 <210> 422 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 422 tcttgggttt actgggctat t 21 <210> 423 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 423 tcttgggttg gttggggtat t 21 <210> 424 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 424 tcttctgttt actgggcttt g 21 <210> 425 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 425 tggggtggtt ggggttctgg tggttacttc tacgctgctt tg 42 <210> 426 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 426 ttctggtacc cgggtatg 18 <210> 427 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 427 tcttctttcg cttgggcttt t 21 <210> 428 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 428 His His His His His His 1 5 <210> 429 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 429 Ile Ser Tyr His Tyr Met 1 5 <210> 430 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 430 Ser Ile Tyr Pro Asn Leu Gly Tyr Thr Tyr 1 5 10 <210> 431 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 431 Ala Tyr Pro Phe Ser Tyr His Tyr Met 1 5

Claims

1. An antibody that specifically binds to each of a cysteine-rich domain (CRD) of one or more human Frizzled receptors selected from FZD 1, 2, 4, 5, 7, 8, and 9, comprising a light chain variable region and / or a heavy chain variable region, The antibody specifically binds to FZD4, The heavy chain variable region comprises complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises complementarity determining regions CDR-L1, CDR-L2, and CDR-L3; The antibody comprises a CDR-L1 comprising SEQ ID NO: 103, a CDR-L2 comprising SEQ ID NO: 104, and (a) CDR-H1 comprising SEQ ID NO: 6, CDR-H2 comprising SEQ ID NO: 30, CDR-H3 comprising SEQ ID NO: 66, and CDR-L3 comprising SEQ ID NO: 111; (b) CDR-H1 comprising SEQ ID NO: 149, CDR-H2 comprising SEQ ID NO: 150, CDR-H3 comprising SEQ ID NO: 151, and CDR-L3 comprising SEQ ID NO: 148; (c) CDR-H1 comprising SEQ ID NO: 158, CDR-H2 comprising SEQ ID NO: 181, CDR-H3 comprising SEQ ID NO: 203, and CDR-L3 comprising SEQ ID NO: 152; (d) CDR-H1 comprising SEQ ID NO: 164, CDR-H2 comprising SEQ ID NO: 45, CDR-H3 comprising SEQ ID NO: 205, and CDR-L3 comprising SEQ ID NO: 153; (e) CDR-H1 comprising SEQ ID NO: 165, CDR-H2 comprising SEQ ID NO: 36, CDR-H3 comprising SEQ ID NO: 206, and CDR-L3 comprising SEQ ID NO: 153; (f) CDR-H1 comprising SEQ ID NO: 15, CDR-H2 comprising SEQ ID NO: 183, CDR-H3 comprising SEQ ID NO: 207, and CDR-L3 comprising SEQ ID NO: 153; (g) CDR-H1 comprising SEQ ID NO: 166, CDR-H2 comprising SEQ ID NO: 184, CDR-H3 comprising SEQ ID NO: 208, and CDR-L3 comprising SEQ ID NO: 153; (h) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 185, CDR-H3 comprising SEQ ID NO: 209, and CDR-L3 comprising SEQ ID NO: 153; (i) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 186, CDR-H3 comprising SEQ ID NO: 210, and CDR-L3 comprising SEQ ID NO: 153; (j) CDR-H1 comprising SEQ ID NO: 167, CDR-H2 comprising SEQ ID NO: 187, CDR-H3 comprising SEQ ID NO: 211, and CDR-L3 comprising SEQ ID NO: 153; (k) CDR-H1 comprising SEQ ID NO: 168, CDR-H2 comprising SEQ ID NO: 188, CDR-H3 comprising SEQ ID NO: 212, and CDR-L3 comprising SEQ ID NO: 153; (l) CDR-H1 comprising SEQ ID NO: 12, CDR-H2 comprising SEQ ID NO: 189, CDR-H3 comprising SEQ ID NO: 213, and CDR-L3 comprising SEQ ID NO: 153; (m) CDR-H1 comprising SEQ ID NO: 169, CDR-H2 comprising SEQ ID NO: 190, CDR-H3 comprising SEQ ID NO: 214, and CDR-L3 comprising SEQ ID NO: 153; (n) CDR-H1 comprising SEQ ID NO: 170, CDR-H2 comprising SEQ ID NO: 191, CDR-H3 comprising SEQ ID NO: 215, and CDR-L3 comprising SEQ ID NO: 154; (o) CDR-H1 comprising SEQ ID NO: 171, CDR-H2 comprising SEQ ID NO: 192, CDR-H3 comprising SEQ ID NO: 216, and CDR-L3 comprising SEQ ID NO: 155; (p) CDR-H1 comprising SEQ ID NO: 172, CDR-H2 comprising SEQ ID NO: 195, CDR-H3 comprising SEQ ID NO: 218, and CDR-L3 comprising SEQ ID NO: 156; (q) CDR-H1 comprising SEQ ID NO: 1, CDR-H2 comprising SEQ ID NO: 24, CDR-H3 comprising SEQ ID NO: 60, and CDR-L3 comprising SEQ ID NO: 105; (r) CDR-H1 comprising SEQ ID NO: 2, CDR-H2 comprising SEQ ID NO: 25, CDR-H3 comprising SEQ ID NO: 61, and CDR-L3 comprising SEQ ID NO: 106; (s) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 26, CDR-H3 comprising SEQ ID NO: 62, and CDR-L3 comprising SEQ ID NO: 107; (t) CDR-H1 comprising SEQ ID NO: 1, CDR-H2 comprising SEQ ID NO: 27, CDR-H3 comprising SEQ ID NO: 63, and CDR-L3 comprising SEQ ID NO: 108; (u) CDR-H1 comprising SEQ ID NO: 4, CDR-H2 comprising SEQ ID NO: 28, CDR-H3 comprising SEQ ID NO: 64, and CDR-L3 comprising SEQ ID NO: 109; (v) CDR-H1 comprising SEQ ID NO: 5, CDR-H2 comprising SEQ ID NO: 29, CDR-H3 comprising SEQ ID NO: 65, and CDR-L3 comprising SEQ ID NO: 110; (w) CDR-H1 comprising SEQ ID NO: 1, CDR-H2 comprising SEQ ID NO: 31, CDR-H3 comprising SEQ ID NO: 67, and CDR-L3 comprising SEQ ID NO: 112; (x) CDR-H1 comprising SEQ ID NO: 7, CDR-H2 comprising SEQ ID NO: 32, CDR-H3 comprising SEQ ID NO: 68, and CDR-L3 comprising SEQ ID NO: 113; (y) CDR-H1 comprising SEQ ID NO: 8, CDR-H2 comprising SEQ ID NO: 33, CDR-H3 comprising SEQ ID NO: 69, and CDR-L3 comprising SEQ ID NO: 114; (z) CDR-H1 comprising SEQ ID NO: 1, CDR-H2 comprising SEQ ID NO: 34, CDR-H3 comprising SEQ ID NO: 70, and CDR-L3 comprising SEQ ID NO: 115; (aa) CDR-H1 comprising SEQ ID NO: 9, CDR-H2 comprising SEQ ID NO: 35, CDR-H3 comprising SEQ ID NO: 71, and CDR-L3 comprising SEQ ID NO: 116; (bb) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 36, CDR-H3 comprising SEQ ID NO: 72, and CDR-L3 comprising SEQ ID NO: 117; (cc) CDR-H1 comprising SEQ ID NO: 10, CDR-H2 comprising SEQ ID NO: 28, CDR-H3 comprising SEQ ID NO: 73, and CDR-L3 comprising SEQ ID NO: 118; (dd) CDR-H1 comprising SEQ ID NO: 11, CDR-H2 comprising SEQ ID NO: 37, CDR-H3 comprising SEQ ID NO: 74, and CDR-L3 comprising SEQ ID NO: 119; (ee) CDR-H1 comprising SEQ ID NO: 5, CDR-H2 comprising SEQ ID NO: 32, CDR-H3 comprising SEQ ID NO: 68, and CDR-L3 comprising SEQ ID NO: 120; (ff) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 38, CDR-H3 comprising SEQ ID NO: 75, and CDR-L3 comprising SEQ ID NO: 121; (gg) CDR-H1 comprising SEQ ID NO: 5, CDR-H2 comprising SEQ ID NO: 39, CDR-H3 comprising SEQ ID NO: 76, and CDR-L3 comprising SEQ ID NO: 122; (hh) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 40, CDR-H3 comprising SEQ ID NO: 77, and CDR-L3 comprising SEQ ID NO: 123; (ii) CDR-H1 comprising SEQ ID NO: 12, CDR-H2 comprising SEQ ID NO: 24, CDR-H3 comprising SEQ ID NO: 78, and CDR-L3 comprising SEQ ID NO: 124; (jj) CDR-H1 comprising SEQ ID NO: 13, CDR-H2 comprising SEQ ID NO: 41, CDR-H3 comprising SEQ ID NO: 79, and CDR-L3 comprising SEQ ID NO: 125; (kk) CDR-H1 comprising SEQ ID NO: 14, CDR-H2 comprising SEQ ID NO: 42, CDR-H3 comprising SEQ ID NO: 80, and CDR-L3 comprising SEQ ID NO: 126; (ll) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 43, CDR-H3 comprising SEQ ID NO: 81, and CDR-L3 comprising SEQ ID NO: 127; (mm) CDR-H1 comprising SEQ ID NO: 15, CDR-H2 comprising SEQ ID NO: 43, CDR-H3 comprising SEQ ID NO: 82, and CDR-L3 comprising SEQ ID NO: 128; (nn) CDR-H1 comprising SEQ ID NO: 7, CDR-H2 comprising SEQ ID NO: 44, CDR-H3 comprising SEQ ID NO: 83, and CDR-L3 comprising SEQ ID NO: 129; (oo) CDR-H1 comprising SEQ ID NO: 7, CDR-H2 comprising SEQ ID NO: 45, CDR-H3 comprising SEQ ID NO: 84, and CDR-L3 comprising SEQ ID NO: 130; (pp) CDR-H1 comprising SEQ ID NO: 16, CDR-H2 comprising SEQ ID NO: 46, CDR-H3 comprising SEQ ID NO: 85, and CDR-L3 comprising SEQ ID NO: 131; (qq) CDR-H1 comprising SEQ ID NO: 17, CDR-H2 comprising SEQ ID NO: 47, CDR-H3 comprising SEQ ID NO: 87, and CDR-L3 comprising SEQ ID NO: 133; (rr) CDR-H1 comprising SEQ ID NO: 18, CDR-H2 comprising SEQ ID NO: 48, CDR-H3 comprising SEQ ID NO: 88, and CDR-L3 comprising SEQ ID NO: 134; (ss) CDR-H1 comprising SEQ ID NO: 17, CDR-H2 comprising SEQ ID NO: 49, CDR-H3 comprising SEQ ID NO: 89, and CDR-L3 comprising SEQ ID NO: 135; (tt) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 42, CDR-H3 comprising SEQ ID NO: 90, and CDR-L3 comprising SEQ ID NO: 136; (uu) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 51, CDR-H3 comprising SEQ ID NO: 92, and CDR-L3 comprising SEQ ID NO: 137; (vv) CDR-H1 comprising SEQ ID NO: 19, CDR-H2 comprising SEQ ID NO: 52, CDR-H3 comprising SEQ ID NO: 93, and CDR-L3 comprising SEQ ID NO: 138; (ww) CDR-H1 comprising SEQ ID NO: 7, CDR-H2 comprising SEQ ID NO: 53, CDR-H3 comprising SEQ ID NO: 94, and CDR-L3 comprising SEQ ID NO: 139; (xx) CDR-H1 comprising SEQ ID NO: 17, CDR-H2 comprising SEQ ID NO: 54, CDR-H3 comprising SEQ ID NO: 95, and CDR-L3 comprising SEQ ID NO: 140; (yy) CDR-H1 comprising SEQ ID NO: 20, CDR-H2 comprising SEQ ID NO: 55, CDR-H3 comprising SEQ ID NO: 96, and CDR-L3 comprising SEQ ID NO: 141; (zz) CDR-H1 comprising SEQ ID NO: 21, CDR-H2 comprising SEQ ID NO: 56, CDR-H3 comprising SEQ ID NO: 97, and CDR-L3 comprising SEQ ID NO: 142; (aaa) CDR-H1 comprising SEQ ID NO: 1, CDR-H2 comprising SEQ ID NO: 51, CDR-H3 comprising SEQ ID NO: 98, and CDR-L3 comprising SEQ ID NO: 143; (bbb) CDR-H1 comprising SEQ ID NO: 1, CDR-H2 comprising SEQ ID NO: 42, CDR-H3 comprising SEQ ID NO: 99, and CDR-L3 comprising SEQ ID NO: 144; (ccc) CDR-H1 comprising SEQ ID NO: 22, CDR-H2 comprising SEQ ID NO: 57, CDR-H3 comprising SEQ ID NO: 100, and CDR-L3 comprising SEQ ID NO: 145; (ddd) CDR-H1 comprising SEQ ID NO: 23, CDR-H2 comprising SEQ ID NO: 58, CDR-H3 comprising SEQ ID NO: 101, and CDR-L3 comprising SEQ ID NO: 146; or (eee) CDR-H1 comprising SEQ ID NO: 3, CDR-H2 comprising SEQ ID NO: 59, CDR-H3 comprising SEQ ID NO: 102, and CDR-L3 comprising SEQ ID NO: 147; Including, The antibody. (i) a heavy chain amino acid sequence of SEQ ID NO: 302; (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the heavy chain amino acid sequence of SEQ ID NO: 302; or (iii) a conservatively substituted amino acid sequence of (i); The antibody of claim 1, comprising a heavy chain variable region comprising the CDRs of claim 1. (i) a light chain amino acid sequence of SEQ ID NO: 300; (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the light chain amino acid sequence of SEQ ID NO: 300; or (iii) a conservatively substituted amino acid sequence of (i); The antibody of claim 1 or 2, comprising a light chain variable region comprising the CDRs of claim 1.

4. An antibody described in any one of claims 1 to 3, wherein the CDR sequences are a set of CDR sequences of antibodies selected from antibodies (a), (b), (g), (j), (m), (q), (s) to (v), (x), (y), (aa) to (ee), (gg), (jj) to (qq), (ss) to (vv), and (aaa) to (eee) described in claim 1.

5. An antibody described in any one of claims 1 to 3, which specifically binds to FZD4 and at least one other FZD receptor selected from FZD1, FZD2, FZD5, FZD7, FZD8, and FZD9.

6. An antibody described in any one of claims 1 to 3, wherein the CDR sequences are a set of CDR sequences of antibodies selected from antibodies (h), (i), (k), (n), (o), (c) to (f), (l), (p), (r), (w), (z), (ff), (hh), (ii), (rr), and (ww) to (zz) described in claim 1.

7. An antibody described in any one of claims 1 to 6, which preferentially binds to Frizzled 4 (FZD4) compared to FZD1, 2, 5, 7, 8, or 9.

8. An antibody according to any one of claims 1 to 6, which preferentially binds to FZD4 over other FZD receptors.

9. The antibody described in claim 8, comprising a CDR sequence which is a set of CDR sequences of antibodies selected from antibodies (h), (i), (k), (n), (o), (f), (l), (r), (w), (z), (ff), (hh), (ii), (rr), (ww), (xx), and (yy) described in claim 1.

10. An antibody described in any one of claims 1 to 8, having a binding affinity as measured by surface plasmon resonance of about 0.2 nM to about 15.3 nM.

11. An antibody described in any one of claims 1 to 10, which is a monoclonal antibody.

12. An antibody described in any one of claims 1 to 11, which is a humanized antibody.

13. An antibody described in any one of claims 1 to 12, which is a single-chain antibody.

14. An antibody described in any one of claims 1 to 13, which is an antibody-binding fragment selected from Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and multimers thereof.

15. An antibody described in any one of claims 1 to 13, which is a multivalent antibody that is a bivalent, trivalent, or tetravalent antibody.

16. An antibody described in any one of claims 1 to 13, which is a bispecific antibody that further binds to LRP 5 and / or LRP 6.

17. An antibody described in any one of claims 1 to 13, comprising a non-native glycosylation pattern.

18. An antibody described in any one of claims 1 to 13, comprising a cysteine ​​substitution or addition in a constant region or framework region.

19. An antibody described in any one of claims 1 to 13, which blocks binding of Wnt to FZD.

20. An immunoconjugate comprising an antibody described in any one of claims 1 to 16 and a detectable label or a cytotoxic agent.

21. The immunoconjugate of claim 20, comprising a cytotoxic agent selected from maytansinoids, auristatins, dolastatins, tublysins, cryptophycins, pyrrolobenzodiazepine (PBD) dimers, indolinobenzodiazepine dimers, α-amanitins, trichothenes, SN-38, duocarmycins, CC1065, calicheamicins, enediyne antibiotics, taxanes, doxorubicin derivatives, anthracyclines, and their stereoisomers, azanofides, isosteres, analogs, or derivatives.

22. A nucleic acid molecule encoding an antibody described in any one of claims 1 to 16.

23. The nucleic acid molecule described in claim 22, wherein one or more of the CDR sequences are encoded by any one of the nucleic acids of SEQ ID NOs: 219-299 and 304-427.

24. The antibody comprising: (i) the heavy chain nucleic acid sequence of SEQ ID NO: 303; (ii) a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to the heavy chain nucleic acid sequence set forth in SEQ ID NO: 303; or (iii) the codon-degenerate nucleic acid sequence of (i); 23. The nucleic acid molecule of claim 22, comprising a heavy chain variable region encoded by a nucleic acid comprising the following:

25. The antibody comprising: (i) the light chain nucleic acid sequence of SEQ ID NO: 301; (ii) a nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the light chain nucleic acid sequence of SEQ ID NO: 301; or (iii) the codon-degenerate nucleic acid sequence of (i); 23. The nucleic acid molecule of claim 22, comprising a light chain variable region encoded by a nucleic acid comprising the following:

26. A vector comprising an expression control sequence operably linked to the nucleic acid of any one of claims 22 to 25.

27. A host cell comprising a recombinant nucleic acid molecule comprising an expression control sequence operably linked to the nucleic acid of any one of claims 22 to 25.

28. The host cell of claim 27, which is a Chinese hamster ovary (CHO) cell.

29. A host cell comprising the vector of claim 26.

30. A method for producing an anti-FZD antibody, comprising culturing a host cell according to any one of claims 27 to 29.

31. A composition comprising an antibody or antibodies according to any one or more of claims 1 to 19, an immunoconjugate according to any one of claims 20 to 21, a nucleic acid molecule according to any one of claims 22 to 25, a vector according to claim 26, or a host cell according to claims 27 to 29, optionally together with a suitable diluent.

32. The composition of claim 31, comprising one or more antibodies or immunoconjugates, and optionally being a pharmaceutical composition.

33. A kit comprising an antibody described in any one or more of claims 1 to 19, an immunoconjugate described in any one of claims 20 to 21, a nucleic acid molecule described in any one of claims 22 to 25, a vector described in claim 26, or a host cell described in claims 27 to 29.

34. A method for detecting FZD expression, comprising the steps of contacting a sample containing one or more cells with one or more antibodies or immunoconjugates described in any one of claims 1 to 21 under conditions allowing the formation of antibody:cell complexes, and detecting the presence of any antibody complexes.

35. The method of claim 34, wherein detection is by immunofluorescence.

36. The method of claim 34, wherein detection is by flow cytometry.

37. The method of any one of claims 34 to 36, wherein the method is for detecting FZD4 expression and the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from (a), (b), (g), (j), (m), (q), (s) to (v), (x), (y), (aa) to (ee), (gg), (jj) to (qq), (ss) to (vv), and (aaa) to (eee) as described in claim 1.

38. An in vitro method for inhibiting Wnt ligand binding to a FZD receptor, disrupting a Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting activation of disheveled, promoting preservation of the β-catenin degradation complex, promoting accumulation of β-catenin, or inhibiting cell proliferation, comprising: A method comprising the step of contacting a cell expressing a FZD receptor with the antibody or immunoconjugate of any one of claims 1 to 21.

39. The method of claim 38, wherein the Wnt ligand is Wnt3a.

40. The method of claim 38, wherein the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from (a) (a), (b), (g), (j), (m), (q), (s) to (v), (x), (y), (aa) to (ee), (gg), (jj) to (qq), (ss) to (vv), and (aaa) to (eee) of claim 1; or (b) (h), (i), (k), (n), (o), (c) to (f), (l), (p), (r), (w), (z), (ff), (hh), (ii), (rr), and (ww) to (zz) of claim 1.

41. A pharmaceutical composition for treating cancer in a subject in need thereof, comprising an effective amount of an antibody or immunoconjugate described in any one of claims 1 to 21.

42. The pharmaceutical composition of claim 41, wherein the cancer is selected from colon, lung, breast, ovarian, endometrial, pancreatic, gastric, liver, adrenal cortex cancer, and osteoblastoma cancer cells.

43. The pharmaceutical composition of claim 41, wherein the cancer is selected from acute myeloid leukemia, neuroblastoma, liver cancer, lung cancer, endometrial cancer, salivary adenoid cystic carcinoma, colorectal cancer, prostate cancer, glioblastoma, bladder cancer, cervical cancer, pancreatic cancer, colon cancer, breast cancer, esophageal cancer, glioma, gastric cancer, astrocytoma, and osteosarcoma.

44. The pharmaceutical composition of claim 41, wherein the antibody or immunoconjugate specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt3a-induced signaling in at least one assay, and optionally, the antibody or immunoconjugate is an antibody or immunoconjugate described in any one of claims 1 to 21.

45. The pharmaceutical composition of claim 41, wherein the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from: (a) a), (b), (g), (j), (m), (q), (s) to (v), (x), (y), (aa) to (ee), (gg), (jj) to (qq), (ss) to (vv), and (aaa) to (eee) of Claim 1; or (b) h), (i), (k), (n), (o), (c) to (f), (l), (p), (r), (w), (z), (ff), (hh), (ii), (rr), and (ww) to (zz) of Claim 1.

Images