Metabolite sensor and enzymatic activity screening method

Abstract

To provide a novel metabolite sensor, and a novel enzymatic activity screening method.SOLUTION: A novel metabolite sensor is completed by a "multi-input multi-output gene switch production method" developed by the inventors, and furthermore, a novel enzymatic activity screening method is constructed, completing this invention.SELECTED DRAWING: None

Description

[Technical field]

[0001] (Current status of biosensors) The ability to measure the intracellular concentration of any substance, such as a metabolite or an environmental monitoring substance, in real time would greatly contribute to the development of life sciences. However, it is difficult to adjust the performance (sensitivity) of a metabolite sensor.

[0002] (Metabolite Sensor) Although there is a high demand for metabolic sensors, it is extremely difficult to create sensors on demand for specific metabolites. Living organisms (cells) themselves have sensors for physiologically important metabolites (ATP, pyruvate, some amino acids, etc.). If these natural sensors could be improved, it would be possible to monitor these metabolites. However, creating sensors for new metabolic substances required extremely time-consuming technology.

[0003] (prior art) The present inventors have already disclosed a "multiple-input / multiple-output gene switch and its manufacturing method (Patent Document 1)" which is different from the conventional sensor manufacturing method. However, Patent Document 1 does not disclose the metabolic sensor and the enzyme activity screening method of the present invention. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] WO2019 / 182156 publication Summary of the Invention [Problem to be solved by the invention]

[0005] The object of the present invention is to provide a novel metabolic sensor and a novel method for screening enzyme activity. [Means for solving the problem]

[0006] The inventors have completed a novel metabolic sensor using the "method for manufacturing a multi-input / multi-output gene switch" that they developed, and have further developed a novel enzyme activity screening method, thereby completing the present invention.

[0007] That is, the present invention is as follows. 1. A CODM mutant identified by any one of the following amino acid sequences or genes (1) to (7): (1) The amino acid sequence shown in SEQ ID NO: 51 has amino acid substitutions at positions 121 and 346, (2) The amino acid sequence represented by SEQ ID NO: 51 has the amino acid substitutions Q121L and R346H, (3) In the amino acid sequence shown in SEQ ID NO: 51, the amino acid sequence has an amino acid substitution of Q121L or R346H, and has substantially the same devine and / or codeine detection activity as that of (2) above. (4) The amino acid sequence shown in SEQ ID NO: 51 has amino acid substitutions of Q121L and R346H, and further has 1 to 20 amino acid substitutions, deletions, insertions and / or additions at positions other than 121 and 346, and has substantially the same devine and / or codeine detection activity as the above (2). (5) In the amino acid sequence shown in SEQ ID NO: 51, the amino acid sequence has amino acid substitutions of Q121L and R346H, has a homology of 90% or more with the amino acid sequence shown in SEQ ID NO: 51, and has a devine and / or codeine detection activity substantially equivalent to that of (2) above. (6) A gene encoding a polypeptide in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same devine and / or codeine detection activity as (2) above; and (7) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having substantially the same devine and / or codeine detection activity as (2) above. 2. The CODM mutant according to the preceding item 1, which is used for detecting devine and / or codeine. 3. A LuxR mutant identified by any one of the following amino acid sequences or genes (1) to (11): (1) The amino acid sequence shown in SEQ ID NO: 11 has amino acid substitutions of N86K and C245W, and further has amino acid substitutions at positions 33 and 57. (2) The amino acid sequence shown in SEQ ID NO: 11 has amino acid substitutions of N86K and C245W and further has amino acid substitutions of T33A and S57T. (3) In the amino acid sequence shown in SEQ ID NO: 11, the antibody has three or four amino acid substitutions selected from N86K, C245W, T33A, and S57T, and has a transcription enhancing activity or AHL detection sensitivity substantially equivalent to that of the antibody shown in (2) above. (4) The amino acid sequence shown in SEQ ID NO: 11 has the amino acid substitutions N86K, C245W, T33A, and S57T, and further has 1 to 20 amino acid substitutions, deletions, insertions, and / or additions at positions other than 86, 245, 33, and 57, and has a transcription enhancing activity or AHL detection sensitivity substantially equivalent to that of (2) above. (5) In the amino acid sequence shown in SEQ ID NO: 11, the amino acid substitutions are N86K, C245W, T33A, and S57T, and the amino acid sequence has 90% or more homology with the amino acid sequence shown in SEQ ID NO: 11, and has a transcription enhancing activity or AHL detection sensitivity substantially equivalent to that of (2) above. (6) A gene encoding a polypeptide in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has a transcription enhancing activity or AHL detection sensitivity substantially equivalent to that of (2) above. (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above and having substantially the same transcription enhancing activity or AHL detection sensitivity as (2) above. (8) A gene consisting of DNA having the nucleotide sequence set forth in SEQ ID NO: 77. (9) A gene that hybridizes under stringent conditions with DNA having a base sequence complementary to the base sequence set forth in SEQ ID NO: 77, and encodes a polypeptide having substantially the same transcription enhancing activity or AHL detection sensitivity as that of (2) above. (10) A gene consisting of DNA in which 1 to 50 nucleotides of the nucleotide sequence set forth in SEQ ID NO: 77 have been substituted, deleted, inserted and / or added; and (11) A gene consisting of DNA having a homology of 90% or more to the DNA consisting of the nucleotide sequence set forth in SEQ ID NO:77. 4. The LuxR mutant described in the preceding item 3, which is characterized in that the LuxR mutant has higher transcription-enhancing activity or AHL detection sensitivity compared to wild-type LuxR. 5. A LuxR mutant identified by any one of the following amino acid sequences or genes (1) to (11): (1) In the amino acid sequence shown in SEQ ID NO: 11, the amino acid sequence has amino acid substitutions of N86K, C245W, T33A, and S57T, and further has amino acid substitutions at positions 42, 93, 99, and 100. (2) The amino acid sequence shown in SEQ ID NO: 11 has amino acid substitutions of N86K, C245W, T33A, and S57T, and further has amino acid substitutions of L42S, N93K, N99D, and N100S. (3) In the amino acid sequence shown in SEQ ID NO: 11, the antibody has 5, 6, 7, or 8 amino acid substitutions selected from N86K, C245W, T33A, S57T, and L42S, N93K, N99D, and N100S, and has a transcription enhancing activity substantially equivalent to that of the antibody shown in (2) above. (4) In the amino acid sequence shown in SEQ ID NO: 11, the amino acid substitutions are 86K, C245W, T33A, S57T, and L42S, N93K, N99D, and N100S, and further, 1 to 20 amino acids are substituted, deleted, inserted, and / or added at positions other than 86, 245, 33, 57, 42, 93, 99, and 100, and the transcription enhancing activity is substantially equivalent to that of the above (2). (5) In the amino acid sequence shown in SEQ ID NO:11, the amino acid substitutions are 86K, C245W, T33A, S57T, and L42S, N93K, N99D, and N100S, and the amino acid sequence has a homology of 90% or more with the amino acid sequence shown in SEQ ID NO:11, and has a transcription-enhancing activity substantially equivalent to that of (2) above. (6) A gene encoding a polypeptide in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has a transcription enhancing activity substantially equivalent to that of (2) above. (7) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having substantially the same transcription enhancing activity as (2) above. (8) A gene consisting of DNA having the nucleotide sequence set forth in SEQ ID NO: 78. (9) A gene that hybridizes under stringent conditions with DNA having a base sequence complementary to the DNA having the base sequence set forth in SEQ ID NO: 78 and encodes a polypeptide having substantially the same transcription enhancing activity as that of the above (2). (10) A gene consisting of DNA in which 1 to 50 nucleotides of the nucleotide sequence set forth in SEQ ID NO: 78 have been substituted, deleted, inserted and / or added; and (11) A gene consisting of DNA having a homology of 90% or more to the DNA consisting of the nucleotide sequence set forth in SEQ ID NO:78. 6. The LuxR mutant described in the preceding item 5, which has transcription-enhancing activity under conditions in which AHL is not added. 7. A COR mutant identified by any one of the following amino acid sequences or genes (1) to (7): (1) The amino acid sequence shown in SEQ ID NO: 50 has amino acid substitutions at positions 11 and 276, (2) having the amino acid substitutions S11G and F276Y in the amino acid sequence represented by SEQ ID NO: 50; (3) The amino acid sequence shown in SEQ ID NO: 50 has an amino acid substitution of S11G or F276Y, and has reticulin detection activity substantially equivalent to that of (2) above. (4) The amino acid sequence shown in SEQ ID NO: 50 has amino acid substitutions of S11G and F276Y, and further has 1 to 20 amino acids substituted, deleted, inserted and / or added at positions other than positions 11 and 276, and has reticulin detection activity substantially equivalent to that of (2) above. (5) In the amino acid sequence shown in SEQ ID NO: 50, the amino acid sequence has amino acid substitutions of S11G and F276Y, has a homology of 90% or more with the amino acid sequence shown in SEQ ID NO: 50, and has reticulin detection activity substantially equivalent to that of (2) above. (6) A gene encoding a polypeptide in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same reticulin detection activity as (2) above; and (7) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having reticulin-detecting activity substantially equivalent to that of (2) above. 8. The COR mutant described in the preceding item 7, which is for detecting reticulin. 9. An IDI mutant identified by any one of the following amino acid sequences or genes (1) to (7): (1) The amino acid sequence shown in SEQ ID NO: 76 has an amino acid substitution at any one of the following positions: 〇19 〇28, 19 〇66, 82, 28, 19 〇85, 82, 28, 19 (2) The amino acid sequence shown in SEQ ID NO: 76 has any one of the following amino acid substitutions: 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P (3) In the amino acid sequence shown in SEQ ID NO: 76, the antibody has 2, 3, 4 or 5 amino acid substitutions selected from R85C, V66A, G82C, D28H and L19P, and has mevalonic acid detection activity substantially equivalent to that of the antibody shown in (2) above. (4) The amino acid sequence shown in SEQ ID NO: 76 has any one of the following amino acid substitutions, and further has 1 to 20 amino acids substituted, deleted, inserted and / or added at positions other than 85, 66, 82, 28 and 19, and has mevalonic acid detection activity substantially equivalent to that of (2) above. 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P (5) In the amino acid sequence shown in SEQ ID NO: 76, the amino acid sequence has any one of the following amino acid substitutions, has 90% or more homology with the amino acid sequence shown in SEQ ID NO: 76, and has mevalonic acid detection activity substantially equivalent to that of (2) above: 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P (6) A gene encoding a polypeptide in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same mevalonate detection activity as (2) above; and (7) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having substantially the same mevalonate-detecting activity as (2) above. 10. The IDI mutant according to item 9 above, which is used for detecting dimethyl diphosphate (DMAOH) or isopentenyl diphosphate (IOH). 11. A DXR mutant identified by any one of the following amino acid sequences or genes (1) to (7): (1) The amino acid sequence shown in SEQ ID NO: 75 has an amino acid substitution at any one of the following positions: 〇111, 297 〇120, 144, 283, 295 〇362 〇58, 118, 279 〇15, 254, 362 〇279 〇362 (2) The amino acid sequence shown in SEQ ID NO: 75 has any one of the following amino acid substitutions: 〇L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (3) In the amino acid sequence shown in SEQ ID NO: 75, it has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 amino acid substitutions selected from C15R, D58H, L111F, I120T, K118R, A144E, P279T, L297P, T283S, K295R, S362T and S254T, and has a DOXP detection activity substantially equivalent to that of (2) above. (4) The amino acid sequence shown in SEQ ID NO: 75 has any one of the following amino acid substitutions, and further has 1 to 20 amino acids substituted, deleted, inserted and / or added at positions other than 15, 58, 111, 120, 118, 144, 279, 297, 283, 295, 362 and 254, and has DOXP detection activity substantially equivalent to that of (2) above. 〇L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (5) In the amino acid sequence shown in SEQ ID NO: 75, the amino acid sequence has any one of the following amino acid substitutions, has 90% or more homology with the amino acid sequence shown in SEQ ID NO: 75, and has DOXP detection activity substantially equivalent to that of (2) above: 〇L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (6) A gene encoding a polypeptide in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same DOXP detection activity as (2) above; and (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above and having substantially the same DOXP detection activity as (2) above. 12. The DXR mutant according to the preceding item 11, which is used for detecting DOXP. 13. A method for screening an enzyme activity comprising the steps of: (1) introducing into a cell or adding to a cell-free protein synthesis system a nucleic acid library of fusion mutants of enzyme E and actuator A obtained by introducing mutations, insertions, and / or deletions into a gene construct carrying a gene sequence encoding all or a part of enzyme E and a gene sequence encoding actuator A, and a reporter expression vector carrying a gene sequence encoding promoter P controlled by actuator A and a gene sequence encoding reporter R functionally linked to said promoter P; (2) adding metabolite M to the cell or cell-free protein synthesis system of (1); and (3) A step of selecting an enzyme E mutant using the expression level of a reporter R under the control of the actuator A as an index. 14. The method for screening enzyme activity according to the preceding item 13, further comprising a step of identifying the mutation site of the enzyme E mutant selected in (3) above. 15. A method for screening enzyme activity described in the preceding paragraph 13 or 14, which includes a step of determining that the enzyme E mutant has higher enzymatic activity or substrate affinity than the wild-type enzyme E if the M concentration-dependent change in reporter R of the enzyme E mutant is higher than the M concentration-dependent change in reporter R of the wild-type enzyme E in (3). 16. The screening method according to any one of the preceding items 13 to 15, wherein the actuator A is a LuxR mutant according to any one of claims 3 to 6. 17. A method for determining the structure of an enzyme E mutant having higher enzymatic activity or substrate affinity than a wild-type enzyme E, comprising the steps of: (1) introducing into a cell or adding to a cell-free protein synthesis system a nucleic acid library of fusion mutants of enzyme E and actuator A obtained by introducing mutations, insertions, and / or deletions into a gene construct carrying a gene sequence encoding all or a part of enzyme E and a gene sequence encoding actuator A, and a reporter expression vector carrying a gene sequence encoding promoter P controlled by actuator A and a gene sequence encoding reporter R functionally linked to said promoter P; (2) adding metabolite M to the cell or cell-free protein synthesis system of (1); (3) selecting an enzyme E mutant using the expression level of reporter R under the control of actuator A as an index; (4) in the step (3), when the concentration-dependent change in the reporter R of the enzyme E mutant is higher than the concentration-dependent change in the reporter R of the wild-type enzyme E, determining that the enzyme E mutant has a higher enzymatic activity than the wild-type enzyme E; (5) A step of identifying the mutation site of the enzyme E mutant determined to have high enzymatic activity in (4) above. 18. A method for producing an enzyme E mutant based on the sequence of the enzyme E mutant identified in the preceding paragraph 17(5). 19. A method for using the enzyme E mutant obtained by the method according to the preceding paragraph 18. Effect of the Invention

[0008] The present invention can provide a novel metabolic sensor and a novel method for screening enzyme activity. [Brief description of the drawings]

[0009] [Figure 1]Overview of the construction of a plasmid in which a target gene (sensor element E: enzyme) is fused with LuxR. [Diagram 2] Overview of the plasmid structure of pHRA-TetR-LuxRv2. [Diagram 3] Functional distribution of TetR-LuxR mutants with and without aTc (100 ng / mL) in the absence of AHL. Mutants indicated by arrows were recovered. Blue indicates library, black indicates parent TetR-Lv2, and white indicates negative control LacZ. Dotted line corresponds to an on / off ratio (slope) of 1. [Figure 4] Amino acid mutation sites of LuxR mutants. [Diagram 5] Confirmation of the function of LuxRv3 (Experimental procedure to obtain T-curve). The experiment was carried out in steps (1) to (7). Regarding the compound numbers, (1) is aTc (anhydro-tetracycline) and (2) is AHL (N-(β-ketocaproyl)-DL-homoserine lactone). [Figure 6] Dose-response curves of TetR-LuxR to aTc (a) and AHL (b). Light blue indicates TetR-Lv1, blue indicates TetR-Lv2, dark blue indicates TetR-Lv3, and gray indicates LacZa (negative control). Each plot is the average of three experiments performed in parallel, and the error bars indicate the standard deviation. The curves for TetR-LuxRs were obtained by fitting each plot to the Hill equation. [Figure 7] Prediction of stability changes in LuxR mutants. Using the LuxR structure created using MODELLER as a template, the changes in stability upon mutation were calculated using FoldX. [Figure 8] Overview of the morphine biosynthetic pathway. [Figure 9] Overview of the reporter plasmid (Plux-GFP-hsvTK / aph). [Figure 10] Schematic of the workflow for constructing the prototype sensor plasmids. [Figure 11] Overview of the CODM-LuxR sensor plasmid. [Figure 12] Results of evaluation of the Lux promoter enhancing activity of various enzymes-LuxR. [Figure 13] Evaluation results of codeine responsiveness of various enzymes - LuxR. [Figure 14] Evaluation results of morphine responsiveness of various enzymes-LuxR. [Figure 15] Evaluation results of reticuline responsiveness of various enzymes-LuxR. [Figure 16] Schematic of the workflow for library construction of COR-LuxRv3. [Figure 17] Reticuline response results of the COR-LuxR library (pink: fluorescence distribution in the presence of 100 μM reticuline, blue: fluorescence distribution in its absence). [Figure 18] Reticuline response results of COR-LuxRv3 mutants obtained from the library (experiments were performed without AHL addition. Each data point is the average of N=3 experiments, and error bars indicate the standard deviation.) [Figure 19] Mutation sites of COR-LuxRv3 mutants (mut5 / mut6). [Figure 20] Workflow for obtaining CODM-LuxRv3 mutants. [Figure 21] Results of confirmation of specificity of CODM-LuxRv3 mutants. [Figure 22] Mutation sites found in CODM-LuxRv3 mutants. [Diagram 23] Summary of the TrpR-LuxR plasmid. [Figure 24] Summary of the TyrR-LuxR plasmid. [Diagram 25] Tryptophan and tyrosine sensors. (A) Reaction overview, (B) Tryptophan response of TrpR-LuxR, and (C) TyrR-LuxR response of tyrosine. [Figure 26] Summary of the TyrB-LuxR plasmid. [Figure 27]A tyrosine sensor using an enzyme as a molecular recognition element. (A) The ligand used, (B) Tryptophan response of TrpR-LuxR. As a control, a TrpB-LuxR-free sample (in which a plasmid expressing lacZa was introduced instead) was used. Grey: Fluorescence intensity distribution per cell in the absence of tyrosine, Blue: Fluorescence intensity distribution analysis in a medium containing tyrosine (500 μM). [Figure 28] Summary of the IDI-LuxRv3 plasmid. [Figure 29] Summary of the DXR-LuxRv3 plasmid. [Diagram 30] Summary of the BFP-MEVbottom plasmid. [Diagram 31] Summary of DXS plasmids. [Diagram 32] Construction of a metabolite sensor by tandem fusion of an enzyme and LuxR. In the cell population data, gray indicates the distribution when cultured under conditions where no substrate was supplied, and blue indicates the distribution when cultured under conditions where a compound for supplying substrate was added. The photographs of the culture medium were taken after centrifugation of 200 μL of the culture medium after the end of the culture to remove the medium, and the culture medium was then resuspended in the same volume of physiological saline. Low indicates the state when cultured under conditions where no substrate was supplied, and High indicates the state when cultured under conditions where substrate was supplied. The compounds added to the medium were (7) isopentenyl pyrophosphate, (8) dimethylallyl pyrophosphate, (9) mevalonic acid, and (10) 1-deoxy-D-xylulose 5-phosphate (DOXP). [Diagram 33] Confirmation of the effect of the V162I mutation introduced into LuxRv3 on the sensor function. Dark lines indicate IDI-Lv3V162I, blue indicates G1P2D4, light blue indicates IDI-Lv3, and white indicates the sensor in cells expressing IDI. Each plot is the average of three experiments performed in parallel, and the error bars indicate the standard deviation. [Diagram 34]Dose-response curves of IDI-Lv3 G2P3D9 and G1P2D4 mutants to mevalonate. Blue indicates G2P3D9, gray indicates G1P2D4, and white indicates IDI-expressing cells. Each plot is the average of three parallel experiments, and error bars indicate the standard deviation. [Diagram 35] Dose-response curves of IDI-LuxRv3 mutants (generation 3) to mevalonate. Blue indicates mutants (a, G3P1D3; b, G3P1F4), grey indicates G2P3D9, and white indicates IDI-expressing cells. Each plot is the average of three experiments performed in parallel, and error bars indicate the standard deviation. [Diagram 36] Transcriptional activity of first-generation mutants of DXR-Lv3. Each bar represents the average of four parallel experiments, and the error bars indicate the standard deviation. [Figure 37] Confirmation of the transcriptional enhancing activity of the second generation mutant of DXR-Lv3. Each bar is the average value of one experiment performed in parallel. For comparison, the data of the first generation mutant and the negative control are the values ​​of three experiments performed in parallel, and the error bars indicate the standard deviation. [Figure 38] Confirmation of the ON / OFF ability of the second generation mutant of DXR-Lv3. Each bar is the value of three experiments performed in parallel, and the error bars indicate the standard deviation. [Figure 39] Conceptual diagram showing how the substrate recognition properties of an enzyme can be confirmed non-destructively, in real time, and with high throughput. From top to middle: By fusing an enzyme with LuxR and appropriately destabilizing it, the LuxR output value in the absence of enzyme substrate can be reduced, enabling it to function as a metabolite (metabolic product) sensor. From middle to bottom: By searching for mutants with high output values ​​under substrate addition conditions, mutants that bind strongly to the substrate (low Km) can be obtained. [Diagram 40]Comparison of the change in transcriptional activity of the DXR-Lv3 mutant and the amount of lycopene synthesis of the DXR mutant. The horizontal axis is the value obtained by subtracting the average fluorescence intensity per cell density shown under the DXSE370A mutant overexpression condition from the average fluorescence intensity per cell density shown under the DXS overexpression condition. The vertical axis is the amount of lycopene synthesis in cells expressing the DXR mutants uncoupled from LuxRv3. Blue indicates the mutants, black indicates the parent DXR-Lv3 or DXR, and white indicates the negative control LacZa expressing cells. The three plots indicated by the arrows are mutants with 10% or more increased lycopene synthesis compared to the wild type. Each experiment was performed three times in parallel, and the average values ​​were plotted. The error bars on the vertical axis indicate the standard deviation. [Diagram 41] Summary of the "Manufacturing method for multi-input, multi-output gene switches." A protein that folds depending on a target molecule is systematically produced by introducing random mutations to "just be destabilize it." The cellular function of the protein fused with this "addiction module" reflects the cellular concentration of the target molecule. This method does not require the design of complex molecular dynamics such as allosteric effects. Step-1: Prepare two "binding motifs" for different biomolecules, and fuse them in-frame at the genetic level to create one protein. Step-2: Introduce random mutations throughout the gene for this fusion protein. Functional selection is performed on the "just be" destabilized protein that cannot maintain a stable structure without interaction with each target molecule. Step-3: Constantly express the obtained mutant fusion protein in cells. Since it can exist in cells only when the target molecule is present, a fluorescent signal corresponding to the concentration of the target molecule can be obtained. [Diagram 42] 1 is an outline of a method for producing a metabolite sensor of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] The present invention relates to a "metabolite sensor" and a "method for screening enzyme activity."

[0011] (Method of making a metabolite sensor) The metabolite sensor of the present invention is produced based on the "production method of a multi-input / multi-output type gene switch" developed by the present inventors. The method can be described in Patent Document 1, but the outline will be described below.

[0012] If the intracellular concentration of any metabolite could be measured in real time, it would greatly contribute to the development of cell engineering, fermentation production, and breeding technology. Traditionally, biosensors have been constructed based on two main operating principles. One is the "gene induction type" sensor. In this type, a reporter such as a fluorescent protein is placed downstream of the transcription control mechanism that turns on / off the target compound as an inducer. Transcription factors that respond to various molecules exist in nature, but the sensor motifs for the majority of metabolites are unknown. The inventors focused on the phenomenon that occurs whenever a molecule such as a sensor or receptor binds to a target molecule, that is, "stabilization." They proposed a sensor method that "reads out" this stabilization phenomenon with a unified standard, and completed a technology that can create any sensor at ultra-high speed (see Figure 41). Using the principle of this method (measurement of stabilization), tens of thousands of known enzymes can be used as molecular recognition elements in sensors, regardless of the type of reaction they perform.

[0013] (Outline of the method for producing the metabolite sensor of the present invention) An outline of the method for producing the metabolite sensor of the present invention is shown in FIG. A sensor element S for a metabolite M is prepared. [Step 1] Search for an enzyme that uses metabolite M as a substrate in a database, etc., and synthesize the gene for the enzyme. If necessary, the catalytically active group of the enzyme may be removed. [Step 2] The transcription factor (in this example, a mutant of LuxR) whose stability has been reduced by amino acid mutation is fused in-frame at the gene level. In some cases, the transcription factor already acts as a sensor at this stage. [Step 3] The stability of the entire fusion protein is adjusted downward by random mutations. Specifically, random mutations can be introduced into the genes of the entire fusion protein by error-prone PCR, or several destabilizing mutations derived by calculation can be introduced. [Step 4] Select those that exhibit LuxR function (expression of a reporter gene downstream of Plux) in the presence of the substrate, and from among them, select those that lose LuxR function in the absence of the substrate.

[0014] (Ligands and metabolites) In the present invention, "ligand L" refers to a substance, e.g., a compound, that changes the function of a gene switch by binding to a transcription factor, thereby inducing direct or indirect regulation of expression of a gene or multiple genes. A "ligand" can also be referred to as a "compound that activates a gene switch." Activating substances vary depending on the gene switch. The metabolite M of the present invention is a substrate for the enzyme E that is the material of the sensor element E, or a substance that becomes a substrate for E by a metabolic enzyme in a cell.

[0015] (Actuator) The "actuator A" in the present invention is selected from a transcription factor, an enzyme, an antibody, a histone, a chaperone, or a ribosome, and is preferably a transcription factor, and in this embodiment, LuxR was used. However, it is not limited to LuxR, and for example, AraC, XylR, TetR, ArsR, LacI, etc. can be used.

[0016] (sensor element) The "sensor element E" in the present invention means an element in a metabolite sensor that detects a metabolite M. Specifically, it is a mutant derived from a conventional enzyme obtained by a method for producing a metabolite sensor.

[0017] (Promoter) In the present invention, the term "promoter P" refers to a nucleic acid sequence having promoter activity controlled by a transcription factor (actuator A). The promoter refers to a nucleic acid sequence located 5' upstream of the translation initiation of a gene encoding the reporter R gene or an active portion thereof, and controls the transcription of the reporter R. The promoter is appropriately selected and used depending on the species of the host cell used. When bacteria are used as a host, the promoter is not particularly limited as long as it can be expressed in host cells such as E. coli, and any promoter may be used. For example, promoters derived from E. coli or phages such as λPR promoter, PL promoter, trp promoter, and lac promoter can be exemplified. Artificially designed and modified promoters such as tac promoter may be used. When yeast is used as a host, the promoter is not particularly limited as long as it can be expressed in yeast, and any promoter may be used. For example, gal1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, and AOX1 promoter can be exemplified. When an animal cell is used as a host, it is preferable that the recombinant vector is autonomously replicable in the cell and is composed of a promoter, an RNA splice site, a gene of interest, a polyadenylation site, and a transcription termination sequence. In addition, a replication origin may be included as desired. As the promoter, an SRα promoter, an SV40 promoter, an LTR promoter, a CMV promoter, or the like can be used, and further, an early gene promoter of a cytomegalovirus, or the like may also be used.

[0018] (Combination of ligand L, transcription factor T (actuator A) and promoter P) Examples of combinations of a ligand L, a transcription factor T responsive to the ligand L, and a promoter P controlled by the transcription factor T include the following. Activator-type promoter Arabinose, AraC, PBAD (arabinose operon) Transcription does not occur unless the activator protein binds to the operator DNA. When arabinose is present in the environment, the conformation of the arabinose activator changes. The conformationally changed arabinose activator binds to the operator. This allows RNA polymerase to transcribe the operon, and the reporter R gene downstream of the PBAD is expressed. AHL, LuxR, Plux When AHL is present in the environment, it binds to the transcription factor LuxR. The AHL-LUxR complex then activates the pluX promoter, resulting in the expression of the downstream reporter gene R. Xylose, XylR, Pxyl - Repressor-type promoter aTc, TetR, Ptet Arsenic, ArsR, Pars IPTG, LacI, Plac In this example, the above-mentioned "AHL, LuxR, Plux" were used.

[0019] (Library of nucleic acids of fusion mutants) The "library of nucleic acids of fusion mutants" in the present invention is a fusion mutant of a transcription factor T or an actuator A and an enzyme E having multiple types of mutations obtained by introducing mutations known per se (e.g., random mutations, site-specific mutations using stability prediction software such as Fold-X) into a gene construct (including an expression vector) carrying a gene sequence encoding a transcription factor T or an actuator A that responds to a ligand L and a gene sequence encoding an enzyme E that responds to a metabolite M. The method for fusing the transcription factor T and the enzyme E is not particularly limited, and may include tandem in-frame fusion, or fusion in which the gene for E is inserted into the loop portion of T (or fusion in which the gene for T is inserted into the loop portion of E). In addition, a preferred example of the mutation of the present invention is destabilization of a protein (fusion mutant). First, protein stability refers to the stability of the folded state, that is, the free energy change (ΔGfold) that occurs when the polypeptide chain that constitutes the protein forms a functional structure (folds). And "destabilization" means reducing the free energy change (ΔGfold) associated with the folding energy, and ultimately canceling it. For example, when a certain amino acid substitution reduces the stability of a functional structure (fold), the amino acid substitution is a "mutation that brings about destabilization (destabilizing mutation)". More specifically, if a suitable destabilization can be induced by the mutation, the folded state of the fusion mutant can be maintained (i.e., ΔGfold<0) only when a substrate for the enzyme E or a metabolite M that can be converted thereto is present.

[0020] (Reporter) The "reporter R" in the present invention is not particularly limited as long as it serves as an index for selecting a fusion mutant, and examples thereof include fluorescent proteins (GFP), chromoproteins (amilCP), luciferase, thymidine kinase (see JP 2013-17473 A), alkyladenine DNA glycosidase (see International Publication WO2012 / 060407), pigment biosynthetic gene operons (see JP 2014-223038 A), and the like. Specifically, when fluorescent proteins or chromoproteins are used, fusion mutants are selected based on the color change of the culture medium when metabolite M is added or not added to the medium. When thymidine kinase, alkyladenine DNA glycosylase, various drug transporters, drug resistance markers, toxin-antitoxin pairs, etc. are used, fusion mutants are selected using cell viability and proliferation as indicators. Furthermore, the reporter R is not particularly limited as long as it is functionally linked to each promoter P, but the type of reporter R can be changed for each promoter P. For example, combinations such as promoter P1-reporter R1, promoter P2-reporter R2, and promoter P3-reporter R3 can be exemplified.

[0021] (Reporter expression vector) The "reporter expression vector" of the present invention carries a gene sequence encoding a promoter P controlled by a transcription factor T, and a gene sequence encoding a reporter R functionally linked to the promoter P sequence. Note that there may be multiple types of reporter R, and one or multiple reporters R may be present downstream of each promoter.

[0022] An expression vector is a DNA that carries an exogenous gene to a host cell, in other words, a vector DNA that can express a target gene in a host cell. The vector DNA is not particularly limited as long as it can be replicated in the host, and is appropriately selected depending on the type of the host and the purpose of use. The vector DNA may be a vector DNA obtained by extracting naturally occurring DNA, or a vector DNA in which a part of DNA other than the part necessary for replication is missing. Representative examples of vector DNA include vector DNA derived from plasmids, bacteriophages, and viruses. Examples of plasmid DNA include plasmids derived from Escherichia coli, plasmids derived from Bacillus subtilis, and plasmids derived from yeast. Examples of bacteriophage DNA include λ phages. Examples of vector DNA derived from viruses include vectors derived from animal viruses such as retroviruses, vaccinia viruses, adenoviruses, papovaviruses, SV40, fowlpox viruses, and pseudorabies viruses, or vectors derived from insect viruses such as baculoviruses. Other examples of vector DNA include vector DNA derived from transposons, insertion elements, and yeast chromosomal elements. Alternatively, vector DNAs prepared by combining these elements, for example, vector DNAs (cosmids, phagemids, etc.) prepared by combining genetic elements of plasmids and bacteriophages, can be exemplified. It is necessary to incorporate a target gene into the vector DNA so that the target gene is expressed, and at least the target gene and a regulatory DNA element, for example, a promoter, are its constituent elements. In addition to these elements, if desired, a gene sequence carrying information on replication and control can be combined and incorporated into the vector DNA by a method known per se. Examples of such gene sequences include cis elements such as ribosome binding sequences, terminators, signal sequences, and enhancers, splicing signals, and selection markers (selectors: dihydrofolate reductase gene, ampicillin resistance gene, neomycin resistance gene, kanamycin resistance gene, etc.). One or more gene sequences selected from these can be incorporated into the vector DNA. The method of incorporating a target gene into a vector DNA can be a known genetic engineering technique. For example, a method is used in which the target gene is treated with an appropriate restriction enzyme to cleave it at a specific site, then mixed with a similarly treated vector DNA, and recombined with a ligase. Alternatively, a desired vector DNA can be obtained by ligating an appropriate linker to the target gene and inserting it into the multicloning site of a vector suitable for the purpose. The method for introducing an expression vector into a host cell is not particularly limited as long as it is a method capable of introducing a vector DNA into the host cell and expressing a target gene in the host cell, and any known method appropriately selected depending on the species of the host cell may be used, such as electroporation, calcium phosphate method, and lipofection.

[0023] (Cells or cell-free protein synthesis systems) The "cell or cell-free protein synthesis system" in the present invention is not particularly limited as long as it is an environment in which the transcription factor T(N), promoter P, and reporter RX can express proteins. For example, the cell may be either a prokaryotic cell or an isolated eukaryotic cell, but prokaryotic cells with a short cell cycle and a fast proliferation rate are preferred. Cells with such properties are useful for a rapid production method of a gene switch. For example, the cell-free protein synthesis system can be a known cell-free protein synthesis system (wheat, E. coli, etc.) that contains components essential for protein synthesis. The "step of adding ligand L and / or metabolite M to cells or a cell-free protein synthesis system" means that the addition of ligand L and / or metabolite M to cells or a cell-free protein synthesis system may be performed before, after, or substantially simultaneously with the addition of the library of nucleic acids of fusion mutants and / or the expression vector for a reporter to the cells.

[0024] (Select sensor element S) In the present invention, the expression level of reporter R is used as an index to select a fusion mutant having the desired sensor function. The gene sequence and / or amino acid sequence of the selected fusion product are analyzed by a method known per se, thereby obtaining information (base sequence, amino acid sequence) on the multi-input / multi-output gene switch or transcription factor. Furthermore, based on this information, a multi-input / multi-output gene switch or transcription factor can be easily obtained by using a protein synthesis system known per se.

[0025] (Linker) In the present invention, a linker L is preferably introduced between the sensor element E and the actuator A. The sequence of the linker L can be a sequence known per se.

[0026] (tag) In the present invention, a tag T known per se may be introduced into the sensor element S. The tag may be a binding label when the sensor element is purified using a column or the like.

[0027] (Configuration of Metabolic Sensor) The metabolite sensors obtained in this example are exemplified below, but mutants and derivatives that maintain the characteristics and properties described below are included within the scope of the present invention. The sensor element S, actuator A, and metabolite M (detection target) are as follows. (1) SalAT, LuxRv2 (or LuxRv3), codeine (2) THS, LuxRv2 (or LuxRv3), codeine (3) T6ODM, LuxRv2 (or LuxRv3), codeine (4) CODM, LuxRv2 (or LuxRv3), codeine (5) SalR, LuxRv2 (or LuxRv3), morphine (6) COR, LuxRv2 (or LuxRv3), morphine (7) T6ODM, LuxRv2 (or LuxRv3), lectin (8) COR, LuxRv2 (or LuxRv3), lectin (9) COR{mut5(S11G, F276Y)} mutant, LuxRv3, lectilin (10) COR{mut5(S11G, F276Y)} mutant, LuxRv3((K16R)) mutant, lectin (11) CODM (Q121L, R346H) mutant, LuxRv3, devine and / or codeine (12) TrpR, LuxRv3, tryptophan (13) TyrR, LuxRv3, tryptophan (14) TyrB, LuxRv3, tyrosine (15) IDI, LuxRLv3, mevalonic acid, and its metabolites dimethylallyl diphosphate (DMAOH) and isopentenyl diphosphate (IOH) (16) IDI-LuxRLv3(V162I) mutant, mevalonate, DMAOH / IOH (17) IDI (mutated to L19P) mutant-LuxRv3 (V162I) mutant {G1P2D4}, mevalonic acid, DMAOH / IOH (18) IDI (mutated to D28H, L19P) mutant-LuxRv3 (V162I) mutant {G2P3D9}, mevalonic acid, DMAOH / IOH (19) IDI (mutated to V66A, G82C, D28H, L19P) mutant-LuxRv3 (V162I) mutant {G3P1D3}, mevalonic acid, DMAOH / IOH (20) IDI (mutated to R85C, G82C, D28H, L19P) mutant-LuxRv3 (V162I) mutant {G3P1F4}, mevalonic acid, DMAOH / IOH (21) DXR (mutated to L111F and L297P), LuxRv3{G1P1A2}, and DOXP (22) DXR (mutated I120T, A144E, T283S, K295R) mutant, LuxRv3{G1P1B3}, DOXP (23)DXR(S362T mutated) mutant, LuxRv3{G1P1E2}, DOXP (24)DXR (mutated to D58H, K118R, and P279T) mutant, LuxRv3{G1P1F2}, DOXP (25)DXR (mutated to C15R, S254T, S362T) mutant, LuxRv3{G2P1F4}, DOXP (26)DXR(mutated to P279T) mutant, LuxRv3{G2P1C11}, DOXP (27)DXR(S362T mutated) mutant, LuxRv3{G2P1D7}, DOXP

[0028] (LuxR mutant, which is actuator A of the present invention) In this example, we created a superior LuxR mutant compared to conventional LuxR and LuxRv1 (LuxR (with N86K and C245W mutations: Kimura et al., J. Gen. Appl. Microbiol., 62, 240-247 (2016)) developed by the inventors.

[0029] (LuxRv2) LuxRv2 is capable of detecting AHLs with higher sensitivity than LuxRv1. The amino acid structure of LuxRv2 can be identified below. (1) In the amino acid sequence shown in SEQ ID NO: 11, it has amino acid substitutions of N86K and C245W, and further has amino acid substitutions at positions 33 and 57. (2) In the amino acid sequence shown in SEQ ID NO: 11, it has the amino acid substitutions N86K and C245W, and further has the amino acid substitutions T33A and S57T. (3) In the amino acid sequence shown in SEQ ID NO: 11, it has three or four amino acid substitutions selected from N86K, C245W, T33A and S57T, and has an AHL detection sensitivity substantially equivalent to that of (2) above. (4) In the amino acid sequence shown in SEQ ID NO:11, the amino acid substitutions are N86K, C245W, T33A, and S57T, and further, 1 to 20 amino acids are substituted, deleted, inserted, and / or added at positions other than 86, 245, 33, and 57, and the AHL detection sensitivity is substantially equivalent to that of (2) above. (5) In the amino acid sequence shown in SEQ ID NO:11, the amino acid substitutions are N86K, C245W, T33A and S57T, the amino acid sequence has a homology of 90% or more with the amino acid sequence described in SEQ ID NO:11, and the AHL detection sensitivity is substantially equivalent to that of (2) above. The base sequence structure of LuxRv2 can be identified as follows: (6) A gene encoding a polypeptide in which 1 to 20 amino acids have been substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same AHL detection sensitivity as (2) above. (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above and having substantially the same AHL detection sensitivity as (2) above. (8) A gene consisting of DNA having the nucleotide sequence set forth in SEQ ID NO: 77. (9) A gene encoding a polypeptide that hybridizes under stringent conditions with DNA having a base sequence complementary to the base sequence set forth in SEQ ID NO: 77 and has AHL detection sensitivity substantially equivalent to that of (2) above. (10) A gene consisting of DNA having the nucleotide sequence set forth in SEQ ID NO: 77, in which 1 to 50 nucleotides have been substituted, deleted, inserted and / or added. (11) A gene consisting of DNA having a homology of 90% or more to the DNA consisting of the nucleotide sequence set forth in SEQ ID NO:77.

[0030] (LuxRv3) LuxRv3 exhibits transcription-enhancing activity even without the addition of ligand L such as AHL. The amino acid structure of LuxRv3 can be identified below. (1) In the amino acid sequence shown in SEQ ID NO: 11, it has amino acid substitutions of N86K, C245W, T33A, and S57T, and further has amino acid substitutions at positions 42, 93, 99, and 100. (2) In the amino acid sequence shown in SEQ ID NO: 11, it has the amino acid substitutions N86K, C245W, T33A, and S57T, and further has the amino acid substitutions L42S, N93K, N99D, and N100S. (3) In the amino acid sequence shown in SEQ ID NO:11, it has 5, 6, 7 or 8 amino acid substitutions selected from N86K, C245W, T33A, S57T, and L42S, N93K, N99D and N100S, and has a transcription-enhancing activity substantially equivalent to that of (2) above. (4) In the amino acid sequence shown in SEQ ID NO: 11, the following amino acid substitutions are present: 86K, C245W, T33A, S57T, and L42S, N93K, N99D, and N100S, and further, 1 to 20 amino acids are substituted, deleted, inserted, and / or added at positions other than 86, 245, 33, 57, 42, 93, 99, and 100, and the transcription-enhancing activity is substantially equivalent to that of (2) above. (5) In the amino acid sequence shown in SEQ ID NO:11, it has the amino acid substitutions 86K, C245W, T33A, S57T, and L42S, N93K, N99D and N100S, has a homology of 90% or more with the amino acid sequence described in SEQ ID NO:11, and has a transcription-enhancing activity substantially equivalent to that of (2) above. The base sequence structure of LuxRv3 can be identified as follows: (6) A gene encoding a polypeptide in which 1 to 20 amino acids have been substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same transcription-enhancing activity as (2) above. (7) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having substantially the same transcription enhancing activity as (2) above. (8) A gene consisting of DNA having the nucleotide sequence set forth in SEQ ID NO: 78. (9) A gene that hybridizes under stringent conditions with DNA having a base sequence complementary to the DNA having the base sequence set forth in SEQ ID NO: 78, and encodes a polypeptide having transcription-enhancing activity substantially equivalent to that of (2) above. (10) A gene consisting of DNA having the nucleotide sequence set forth in SEQ ID NO: 78, in which 1 to 50 nucleotides have been substituted, deleted, inserted and / or added. (11) A gene consisting of DNA having a homology of 90% or more to the DNA consisting of the nucleotide sequence set forth in SEQ ID NO:78.

[0031] (Morphinan alkaloid sensor) According to this example, a sensor was obtained that included a sensor element S and an actuator A to be used in the following morphinan alkaloid sensor.

[0032] (Codeine detection sensor) SalAT-LuxRv2 (or LuxRv3) THS-LuxRv2 (or LuxRv3) T6ODM-LuxRv2 (or LuxRv3) CODM-LuxRv2 (or LuxRv3)

[0033] (Morphine detection sensor) SalR-LuxRv2 (or LuxRv3) COR-LuxRv2 (or LuxRv3) In addition, a linker sequence L may be inserted between each enzyme and LuxRv3 (or LuxRv2), and a tag sequence T may be inserted after the start codon of each enzyme.

[0034] (Reticulin detection sensor) T6ODM-LuxRv2 (or LuxRv3) COR -LuxRv2 (or LuxRv3) COR{mut5(S11G, F276Y)} mutant-LuxRv3 COR{mut5(S11G, F276Y)} mutant-LuxRv3{mutated to (K16R)} mutant In addition, a linker sequence L may be inserted between each enzyme and LuxRv3 (or LuxRv2), and a tag sequence T may be inserted after the start codon of each enzyme. The amino acid structure of the COR mutant (mut5) can be identified as follows. (1) The amino acid sequence shown in SEQ ID NO:50 has amino acid substitutions at positions 11 and 276. (2) The amino acid sequence shown in SEQ ID NO:50 has the amino acid substitutions S11G and F276Y. (3) It has an amino acid substitution of S11G or F276Y in the amino acid sequence shown in SEQ ID NO:50, and has reticulin detection activity substantially equivalent to that of (2) above. (4) In the amino acid sequence shown in SEQ ID NO:50, it has amino acid substitutions of S11G and F276Y, and further has substitutions, deletions, insertions and / or additions of 1 to 20 amino acids at positions other than positions 11 and 276, and has reticulin detection activity substantially equivalent to that of (2) above. (5) In the amino acid sequence shown in SEQ ID NO:50, it has amino acid substitutions of S11G and F276Y, has a homology of 90% or more with the amino acid sequence set forth in SEQ ID NO:50, and has reticulin detection activity substantially equivalent to that of (2) above. The base sequence structure of the COR mutant (mut5) can be identified as follows. (6) A gene encoding a polypeptide in which 1 to 20 amino acids have been substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has reticulin detection activity substantially equivalent to that of (2) above. (7) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having reticulin-detecting activity substantially equivalent to that of (2) above.

[0035] (Divine and / or Codeine Detection Sensor) CODM (mutated to Q121L, R346H) mutant-LuxRv3 In addition, a linker sequence L may be inserted between the CODM mutant and LuxRv3, and a tag sequence T may be inserted after the start codon of each enzyme. The amino acid structures of the CODM mutants can be identified below. (1) The amino acid sequence shown in SEQ ID NO:51 has amino acid substitutions at positions 121 and 346. (2) The amino acid sequence shown in SEQ ID NO:51 has the amino acid substitutions Q121L and R346H. (3) It has an amino acid substitution of Q121L or R346H in the amino acid sequence shown in SEQ ID NO:51, and has substantially the same devine and / or codeine detection activity as (2) above. (4) In the amino acid sequence shown in SEQ ID NO:51, it has amino acid substitutions of Q121L and R346H, and further has substitutions, deletions, insertions and / or additions of 1 to 20 amino acids at positions other than 121 and 346, and has devine and / or codeine detection activity substantially equivalent to that of (2) above. (5) In the amino acid sequence shown in SEQ ID NO:51, it has the amino acid substitutions Q121L and R346H, has a homology of 90% or more with the amino acid sequence described in SEQ ID NO:51, and has devine and / or codeine detection activity substantially equivalent to that of (2) above. The nucleotide sequence of the CODM mutant can be identified below. (6) A gene encoding a polypeptide in which 1 to 20 amino acids have been substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same devine and / or codeine detection activity as (2) above. (7) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having substantially the same devine and / or codeine detection activity as (2) above.

[0036] (Tryptophan and / or Tyrosine Sensors) According to this example, a sensor including a sensor element S and an actuator A used in a tryptophan and / or tyrosine sensor was obtained. TrpR-LuxRv3 The sensor is a tryptophan sensor capable of detecting an increase in tryptophan concentration. TyrR-LuxRv3 TyrB-LuxRv3 The sensor is a tyrosine sensor capable of detecting an increase in tyrosine concentration. A linker sequence L may be inserted between TrpR, TyrR or TyrB and LuxRv3, and a tag sequence T may be inserted after the initiation codon of TrpR, TyrR or TyrB.

[0037] (Isoprenoid precursor sensor) According to this example, a sensor was obtained that included a sensor element S and an actuator A used in the following isoprenoid precursor sensor.

[0038] (Mevalonic acid sensor) IDI-LuxRLv3 IDI-LuxRLv3(V162I) mutant IDI (mutated to L19P) mutant-LuxRv3 (V162I) mutant {G1P2D4} IDI (mutated to D28H, L19P) mutant-LuxRv3 (V162I) mutant {G2P3D9} IDI (mutated to V66A, G82C, D28H, L19P) mutant-LuxRv3 (V162I) mutant {G3P1D3} IDI (mutated to R85C, G82C, D28H, L19P) mutant-LuxRv3 (V162I) mutant {G3P1F4} The amino acid structures of the IDI variants are identified below. In addition, a linker sequence L may be inserted between IDI or the IDI mutant and LuxRLv3 or LuxRv3(V162I) mutant, and a tag sequence T may be inserted after the start codon of IDI or the IDI mutant. The structure of the IDI variant is specified by the amino acid sequence below. (1) The amino acid sequence shown in SEQ ID NO: 76 has an amino acid substitution at any one of the following positions: 〇19 〇28, 19 〇66, 82, 28, 19 〇85, 82, 28, 19 (2) The amino acid sequence shown in SEQ ID NO: 76 has any one of the following amino acid substitutions: 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P (3) In the amino acid sequence shown in SEQ ID NO: 76, it has 2, 3, 4 or 5 amino acid substitutions selected from R85C, V66A, G82C, D28H and L19P, and has mevalonic acid detection activity substantially equivalent to that of (2) above. (4) In the amino acid sequence shown in SEQ ID NO: 76, it has any one of the following amino acid substitutions, and further has 1 to 20 amino acids substituted, deleted, inserted and / or added at positions other than 85, 66, 82, 28 and 19, and has mevalonic acid detection activity substantially equivalent to that of (2) above. 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P (5) In the amino acid sequence shown in SEQ ID NO: 76, it has an amino acid substitution represented by any one of the following, has a homology of 90% or more with the amino acid sequence described in SEQ ID NO: 76, and has mevalonate detection activity substantially equivalent to that of (2) above. 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P The nucleotide sequence structure of the IDI variant can be identified below. (6) A gene encoding a polypeptide in which 1 to 20 amino acids have been substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same mevalonate detection activity as (2) above. (7) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having substantially the same mevalonate-detecting activity as (2) above.

[0039] (DOXP sensor) DXR (mutated to L111F, L297P) mutant - LuxRv3{G1P1A2} DXR (mutated I120T, A144E, T283S, K295R) mutant - LuxRv3{G1P1B3} DXR (mutated to S362T) mutant - LuxRv3{G1P1E2} DXR (mutated D58H, K118R, P279T) mutant - LuxRv3{G1P1F2} DXR (mutated C15R, S254T, S362T) mutant - LuxRv3{G2P1F4} DXR (mutated to P279T) mutant - LuxRv3{G2P1C11} DXR (mutated to S362T) mutant - LuxRv3{G2P1D7} In addition, a linker sequence L may be inserted between the DXR mutant and LuxRLv3, and a tag sequence T may be inserted after the start codon of the DXR mutant. The structure of the DXR mutant is specified by the following amino acid sequence: (1) The amino acid sequence shown in SEQ ID NO: 75 has an amino acid substitution at any one of the following positions: 〇111, 297 〇120, 144, 283, 295 〇362 〇58, 118, 279 〇15, 254, 362 〇279 〇362 (2) The amino acid sequence shown in SEQ ID NO: 75 has any one of the following amino acid substitutions: 〇L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (3) In the amino acid sequence shown in SEQ ID NO: 75, it has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 amino acid substitutions selected from C15R, D58H, L111F, I120T, K118R, A144E, P279T, L297P, T283S, K295R, S362T and S254T, and has DOXP detection activity substantially equivalent to that of (2) above. (4) In the amino acid sequence shown in SEQ ID NO: 75, it has any one of the amino acid substitutions shown below, and further has 1 to 20 amino acids substituted, deleted, inserted and / or added at positions other than 15, 58, 111, 120, 118, 144, 279, 297, 283, 295, 362 and 254, and has DOXP detection activity substantially equivalent to that of (2) above. 〇L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (5) In the amino acid sequence shown in SEQ ID NO: 75, it has an amino acid substitution represented by any one of the following, has a homology of 90% or more with the amino acid sequence described in SEQ ID NO: 75, and has DOXP detection activity substantially equivalent to that of (2) above. 〇L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T The nucleotide sequence of the DXR mutant can be identified as follows: (6) A gene encoding a polypeptide in which 1 to 20 amino acids have been substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same DOXP detection activity as (2) above. (7) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having substantially the same DOXP detection activity as (2) above.

[0040] (Method of screening for enzyme activity) The method for screening enzyme activity of the present invention makes it possible to obtain an enzyme mutant having superior enzyme activity compared to a wild-type enzyme without screening for actual enzyme activity. The method includes the following steps: (1) A process of introducing into a cell or adding to a cell-free protein synthesis system a nucleic acid library of fusion mutants of enzyme E and actuator A obtained by introducing mutations into a gene construct carrying a gene sequence encoding all or a part of enzyme E using metabolite M or its metabolic product as a substrate and a gene sequence encoding actuator A responsive to ligand L, and a reporter expression vector carrying a gene sequence encoding promoter P controlled by actuator A and a gene sequence encoding reporter R functionally linked to said promoter sequence P1. (2) adding metabolite M to the cell or cell-free protein synthesis system of (1); (3) A step of selecting a fusion mutant of enzyme E and actuator A using the expression level of the reporter as an indicator. In addition, in the selection process, if the reporter expression level of the fusion mutant of enzyme E and actuator A in the presence of metabolite M or under conditions of high concentration of metabolite M is higher than the reporter expression level of the fusion mutant of wild-type enzyme E and actuator A, it can be determined that the enzyme E mutant has higher enzymatic activity (especially affinity and substrate selectivity) than the wild-type enzyme E. In addition, it is preferable that the actuator A uses LuxRv1, LuxRv2 or LuxRv3, but is not particularly limited thereto.

[0041] The present invention will be described below with reference to examples, but the present invention is not limited to these examples in any way. EXAMPLES

[0042] (Construction of LuxR mutant as actuator A) When the sensor element, enzyme E, is fused to the actuator A, LuxR, the stabilization of the enzyme by binding to the substrate increases the effective concentration of the sensor protein within the cell, which in turn increases the cellular function of LuxR, thereby enhancing the expression of the reporter gene (such as GFP) downstream of the promoter (Plux), which is the promoter P. Although it is possible to destabilize the enzyme later by genetic mutation, it is expected that a certain degree of sensor behavior will be observed by simply fusing the enzyme with LuxR, by setting the stability in the unbound state as low as possible. In addition, for practical purposes, it is desirable for LuxR to function without the addition of the ligand AHL, and it is also undesirable for metabolites to bind to the AHL-binding cavity of LuxR. We have created a LuxR mutant that acts as a so-called "super activator," which is an actuator A that can enhance transcription without binding to AHL.

[0043] (Expression system) To search for a mutant that behaves as a super activator in the fused state and is moderately unstable, we created a plasmid in which the repressive transcription factor TetR, which responds to aTc (anhydrotetracycline), was fused with LuxR (Fig. 1). In constructing this plasmid, the following modifications were made to the base sequence. (1) Insertion of restriction enzyme recognition sequences: To facilitate cloning by genetically fusing the enzyme with LuxR (with N86K and C245W mutations: Kimura et al., J.Gen. Appl. Microbiol., 62, 240-247 (2016), LuxRv1) and to facilitate the creation of a random mutation library, sequences recognized by separate restriction enzymes were inserted into the N-terminus of the enzyme, between the enzyme and LuxR, and on the C-terminus of LuxR. (2) Insertion of histidine hexamer: Translation initiation efficiency is affected by the higher-order structure of mRNA, which consists of about 35 bases from the transcription start point in the ORF. In order to omit the RBS design and make it possible to develop various metabolite sensors, a base sequence (18 bases) encoding a histidine hexamer was inserted between the start codon and the enzyme ORF. Since a total of 27 bases, including the start codon (3 bases) and the restriction enzyme recognition sequence (6 bases), are common to all motifs, the translation initiation efficiency is roughly similar for all motifs. By locating a histidine hexamer downstream of the RBS, it is believed that the translation initiation efficiency will not change significantly even if the gene of interest sequence is changed. Unique restriction enzyme recognition sequences, BamHI, SpeI, and HindIII recognition sequences, were inserted upstream of the gene of interest, between the gene of interest and luxR, and downstream of luxR, respectively, allowing easy removal of any desired region by restriction enzyme treatment. More specifically, TS (threonine and serine) derived from the recognition sequence of the restriction enzyme SpeI, which is the linker L, was inserted between the enzyme and LuxR. In addition, a histogram (tag T) and a polypeptide HHHHHHGS derived from the recognition sequence of the restriction enzyme BamHI were added between the start codon and the enzyme on the N-terminus side of the enzyme. This sequence design is also used in the following examples.

[0044] (Preparation of TetR-LuxR) With reference to the expression construct shown in FIG. 1, the tetracycline-responsive transcription factor TetR derived from E. coli was fused with the known LuxRv1 mutant (WO2019182156). In detail, in order to amplify the tetR gene while rewriting the sequence recognized by the restriction enzyme HindIII contained in the tetR gene from the genomic DNA of the E. coli strain XL10G, the upstream side of the HindIII site (primer sequence 1 (sequence number 1) / sequence 2 (sequence number 2)) and the downstream side (primer sequence 3 (sequence number 3) / sequence 4 (sequence number 4)) were PCR-amplified. Furthermore, in order to provide a restriction enzyme recognition sequence to the upstream side of the tetR gene, the PCR product on the upstream side was further PCR-amplified (primer sequence 5 (sequence number 5) / sequence 2 (sequence number 2)). These were treated with the restriction enzymes ApaI, BsaI, and SpeI. Meanwhile, the LuxR mutant (WO2019182156) amplified by PCR using primer sequence 6 (SEQ ID NO: 6) and sequence 7 (SEQ ID NO: 7) was treated with restriction enzymes SpeI and HindIII. These three fragments were inserted into the pHRA vector treated with ApaI and HindIII to obtain pHRA-TetR-LuxRv2 (SEQ ID NO: 77) (FIG. 2, reference: SEQ ID NO: 8).

[0045] (LuxR Evolution) To obtain a LuxR mutant whose transcription-enhancing activity is enhanced by aTc binding, the following manipulations were carried out. Construction of TetR-[LuxRv2]: Using TetR-LuxRv1 as a template, a library was created by introducing random mutations only into the luxR gene under the following conditions. Template: 5 ng of PCR-amplified fragment using primer sequence 8 (sequence number 9) / sequence 9 (sequence number 10) Reaction volume 50 μL PCR Buffer NEB 10x Thermo Pol Reaction Buffer dNTP concentration 0.2 mM each, Mg concentration 0.2 mM, Mn concentration 50 μM NEB Taq DNA Polymerase, 5 units Final yield 5000 ng, amplification 1000-fold. The resulting DNA was gel extracted, further purified, and ligated into a vector. Vector: 100 ng, insert: 72 ng, reaction volume 10 μL, Reaction time: 16 hours, reaction temperature: 16℃, NEB T4 DNA Ligase, 400 units The obtained ligation solution was desalted and electroporated into E. coli strain BW25113. 3 mL of SOC was added to 60 μL of competent cells and curation cultured at 37°C for 1 h. 1 μL (1 / 3000) was plated on an agar plate. The remaining 2999 μL was diluted with 40 mL of LB and cultured overnight (12 h) at 37°C with shaking. 2 mL of the obtained bacterial cell suspension was mini-prepped. Thus, the TetR-[LuxRv2] library (in which random mutations were introduced only into the [LuxRv1] portion) was obtained (library size: 2.3 × 10 5 ). Selection 1: From the TetR-[LuxRv2] library, we isolated mutants that showed higher transcriptional activity in the presence of anhydrotetracycline (aTc), a ligand of TetR, without adding AHL. Specifically, the above plasmid library was transformed into E. coli strain BW25113 together with a reporter plasmid (Plux-sfGFP-hsvTK / aph, see WO2019182156), and the resulting mixture was cultured at 37°C for 1 h in LB medium supplemented with aTc (100 ng / mL), and then cultured for 3 hours with the addition of 0-120 μg / mL kanamycin (positive selection). In the reporter plasmid, hsvTK / aph is located under Plux together with GFP, so mutants with high expression levels of this aph (kanamycin resistance gene) were preferentially grown and concentrated. Functional selection 1: The library after selection 1 above was inoculated onto solid medium containing 100 ng / mL aTc (and no AHL), and the enrichment efficiency by selection was compared from the ratio of the number of fluorescent colonies to the total number of colonies (Table 1).

[0046] [Table 1] Mutants enriched in the first round of positive selection of the TetR-[LuxRv2] library. a) Number of colonies formed on solid medium containing 100 ng / mL aTc after selection. b) Number of colonies that showed fluorescence among the colonies formed. The number in parentheses indicates the percentage of colonies that showed fluorescence among all colonies.

[0047] The library that had not been selected did not contain any colonies that showed fluorescence in aTc-containing medium. In other words, even in the presence of the TetR ligand (aTc), there were almost no colonies that showed LuxR function in the absence of AHL. However, in the batches that had been selected by adding kanamycin, colonies that showed high fluorescence were found.

[0048] (Function Selection 2) Since the results were less than 10%, we further enriched the desired mutants. The enriched library was recovered and cultured again in the presence of kanamycin (120 μg / mL) to enrich for clones that enhanced Plux even in the absence of AHL. This time, 71% of the clones showed fluorescence on aTC plates. After two rounds of positive selection, the percentage of colonies that showed fluorescence on solid medium containing aTc was sufficiently increased, and the cell mixture was harvested, and the plasmid was then isolated.

[0049] (5) Functional distribution analysis: E. coli strain BW25113, which had previously been introduced with a reporter plasmid, was transformed with the above-obtained plasmid (mixture) solution and inoculated onto solid medium. 44 colonies were randomly selected from each transformant group and cultured in medium containing 100 ng / mL aTc or LB medium without aTc. After culturing for 12 h at 37°C, the fluorescence intensity per cell density was examined (Figure 3). As shown in Figure 3, most of the enriched mutants were plotted to the right of the parent (black dots) in both X and Y values. In other words, those that showed clear fluorescence even in the absence of AHL were enriched. However, most of the mutants did not show a significant difference in output value with aTc (On value, Y-axis) and without aTc (Off value, X-axis). A plasmid (arrow in Figure 3) that is a mutant with excellent aTc dependency was recovered as LuxRv3 (sequence number 78).

[0050] (6) Genotype: The genotype of LuxRv3 obtained in this example was examined (see FIG. 4). Compared with LuxRv1 and LuxRv2, LuxRv3 had additional amino acid mutations of L42S-N93K-N99D-N100S. LuxR N86K-C245W (LuxRv1: a mutation of LuxR (SEQ ID NO: 11)) is highly leaky even in the absence of AHL, meaning that it acts as a super activator by itself. LuxR N86K-C245W-T33A-S57T (LuxRv2) exhibits high transcription-enhancing activity even when fused with multiple transcription factors.

[0051] (Checking LuxRv3 functionality) To confirm the function of LuxRv3, the dose-response of TetR-Lv3 to aTc and AHL was evaluated (see Figure 5). In detail, E. coli strain BW25113, which had been introduced with Plux-sfGFP-HSVtk-aph (see WO2019182156), was transformed with various TetR-LuxR expression plasmids. Three isolated colonies were randomly selected and the fluorescence intensity per cell density was examined when they were cultured in liquid culture medium containing various concentrations of aTc or AHL (Figure 6). The experiment was also performed in the same way using a plasmid encoding the α peptide of LacZ instead of LuxR.

[0052] (LuxRv3 functionality verification results) TetR-LuxRv1 and TetR-LuxRv2 did not show a significant response to aTc in the absence of AHL (Fig. 6a), but showed higher fluorescence intensity with increasing AHL concentration (Fig. 6b). LuxRv1 has been reported as a superactivator type that can output even in the absence of AHL, but its transcriptional activity was only enhanced when high concentrations of AHL were added. It is believed that this characteristic of LuxRv1 was lost by its fusion with TetR. TetR-LuxRv2 showed little output in the absence of AHL, but showed much higher fluorescence intensity than LuxRv1 when 10 μM AHL was added. It is believed that the two amino acid mutations (T33A, S57T) introduced into LuxRv2 increased fusion tolerance and allowed it to show high transcription-enhancing activity upon AHL binding. TetR-LuxRv3 showed transcriptional enhancement activity without the addition of either ligand. In other words, it restored the properties of a "superactivator" that were lost by the fusion of TetR. On the other hand, the transcriptional enhancement activity increased 2.4-fold with the addition of 100 ng / mL aTc and 2.2-fold with the addition of 10 μM AHL. Since the transcriptional enhancement activity can be enhanced not only by AHL but also by aTc binding, the stability was reduced to such an extent that the fluctuation in the effective concentration of the sensor protein was easily reflected in the transcriptional enhancement level. All four amino acid mutations added to LuxRv3 were located near the AHL binding site, which is a LuxR ligand. This may have reduced the affinity for AHL. The inflection point (AHL response sensitivity) was 3190 nM, 10-fold higher than that of the parent (TetR-LuxRv2) (317 nM). In addition, the signal intensity by the addition of AHL also stopped increasing at a low level.

[0053] (Check for changes in stability) The stability change due to the four amino acid mutations newly added to LuxRv3 was calculated using FoldX 13. The introduction of these mutations was predicted to destabilize LuxRv3 by 3.4 kcal / mol compared to LuxRv2 (Figure 7). LuxRv3 is considered to have improved fusion tolerance and to be in a moderately unstable state compared to LuxRv1 and LuxRv2. Therefore, when creating a metabolite sensor, it is considered that a certain degree of on / off can be observed simply by fusing the enzyme. Therefore, it was confirmed that LuxRv3 is an actuator A that exhibits transcription-enhancing activity without the addition of ligand L such as AHL. EXAMPLES

[0054] (Preparation of morphinan alkaloid sensor) Morphinan-type alkaloids, which are secondary metabolites, contain compounds that can be used to make valuable pharmaceuticals, such as painkillers (morphine) and cough suppressants (codeine). These have extremely complex chemical structures, making their chemical synthesis difficult. For this reason, they are supplied by extracting components from plants. In addition, among the intermediates, such as thebaine, there are valuable alkaloids that can be converted into various physiologically active substances through chemical modification, but these are hardly found in extracts from opium poppies and other plants. Many of the morphine biosynthetic pathways (Figure 8) are difficult to express heterologously, and many efforts in enzyme engineering and metabolic engineering are required. Analysis of intermediates is limited to low-throughput methods such as HPLC, making library-based breeding difficult, and despite great efforts, an efficient biosynthetic pathway has not yet been established.

[0055] In general, it is difficult to detect intermediates in the biosynthetic pathway of secondary metabolites (natural products). In addition to their structural complexity and instability, the absence of receptors for their rare structures makes it more difficult to develop detection systems using biosensors for them than for ATP and key metabolites in central metabolic pathways (for which natural receptors are known in nature). However, even if secondary metabolic intermediates do not have their own receptors, there are enzymes that use them as substrates because they are metabolites. These enzymes specifically bind to the metabolic intermediates prior to their catalytic action. If these biosynthetic enzymes can be used as sensor elements (receptors), the biosynthetic intermediates become specific recognition targets for them. The receptor proteins that make up the sensors undergo conformational changes upon binding to a target, and the mechanism by which this conformational change is read out is in place. Some enzymes undergo significant conformational changes upon substrate binding, but many do not undergo any conformational change at all, or even if they do, it is difficult to read out the change. This has made it difficult to develop sensors for morphinan alkaloids and the like. In this example, we have created multiple sensors for biosynthetic intermediates by using a format that "reads out" not a conformational change but a "stabilization" change that is necessarily caused by substrate binding. In particular, to develop sensors for morphinan alkaloids and their biosynthetic intermediates, we carried out the following work. (1) Fusion of morphinan alkaloid biosynthetic enzymes with the transcription factor protein LuxR (2) Evolutionary engineering of the resulting fusion protein (random mutation and functional selection) We constructed sensors for the intermediates of morphine biosynthesis (reticuline, thebaine, and codeine) obtained through the above work.

[0056] (Construction of a prototype sensor) -1 As the sensor unit, a plasmid encoding Plux-GFP (see FIG. 9) was used in accordance with a previous report (WO2019182156). sfGFP was expressed from this plasmid by the action of the activator-type transcription factor LuxR, and the cells began to show fluorescence. -2 Eleven morphine biosynthetic enzymes (Table 2) were selected. -3 Two types of LuxR mutants (v2 and v3) were fused in-frame at the gene level to generate plasmids expressing 22 types of "enzyme-LuxR fusions." One of these, the CODM-LuxR (v3) expression plasmid, is shown in Figure 11. The above fabrication procedure is shown in FIG.

[0057] By PCR, restriction enzyme BamHI and SpeI sites were added to each of the "enzyme side" fragments (sequences 3 to 13) shown in Table 2. The primer sets used here are shown in Table 2. -2 The obtained DNA fragment was treated with restriction enzymes BamHI and SpeI and column purified (inserts). The idi portion of -3 pHRA-idi-LuxR (WO2019182156) was excised using restriction enzymes BamHI and SpeI and purified using a column (vector). -4 The insert / vector prepared in (-2) and (-3) above were mixed and ligated with T4 DNA Ligase. The resulting ligation product was transformed into E. coli strain XL10-Gold (Kan R ), colonies were formed, and the plasmids were then cloned and recovered from the colonies. -5 In all cases, sequence analysis confirmed that there were no mutations.

[0058] [Table 2] The constructed morphinan biosynthetic enzyme-LuxR fusion protein. *1: Of STORR (total length 901 amino acids), the 33-580 aa portion was used, from which the N-terminal portion (1-32 aa) encoding CYP80Y2 was removed. *2: Of SalS (full length 505 amino acids), the 91-1515 aa portion was used, with the N-terminal portion (1-90 aa) removed.

[0059] [Table 3] Primers used for fusion with LuxR.

[0060] (Sensor function evaluation) The functions of each of the sensors prepared above were examined: (1) responsiveness to AHL (acyl homoserine lactone), (2) responsiveness to morphine / codeine, and (3) responsiveness to reticuline.

[0061] (AHL responsiveness (transfer curve)) First, it was necessary to confirm that the LuxR reporter (Plux-enhancing function) was not lost by fusion with the biosynthetic enzyme. The expression plasmids of each enzyme-LuxR fusion gene were introduced into E. coli strain BW25113 together with Plux-sfGFP (see WO2019182156). Each transformant was cultured overnight (12 hours) with shaking in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) (preculture). From this preculture, fresh 0.5 mL medium (0-10 μM AHL) was inoculated in a 96 deep well plate so that the preculture was diluted 100-fold, and cultured at 37°C for 12 hours with shaking. The obtained bacterial solution was measured for OD595 and fluorescence (Ex: 485 nm / Em: 535 nm filter configuration) using a plate reader (FilterMax F5, Molecular Devices) (Figure 12). LuxR retained LuxP-enhancing activity when fused to any enzyme other than MorA. In other words, GFP fluorescence increased as the concentration of AHL added to the medium increased. However, the shape of the response curve was unique for each. In many motifs, LuxRv2 was more AHL-dependent and more sensitive to the response than LuxRv3. The LuxRv3 series was superior in that it had GFP fluorescence even in the absence of AHL (visible LuxR function) although its response sensitivity to AHL was about one order of magnitude lower than that of LuxRv2.

[0062] (Codeine-morphine sensor verification) Each transformant was cultured overnight (12 hours) with shaking in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) (preculture). This preculture was inoculated into 0.5 mL of fresh medium (containing 0-1 mM morphine or codeine) in a 96 deep well plate so that it was diluted 100-fold, and cultured with shaking at 37°C for 12 hours. The AHL concentration added to the medium was fixed at 1 μM or 0 (Ver-3) and 0.1 μM (Ver-2). The OD595 and fluorescence (Ex: 485 nm / Em: 535 nm filter configuration) of the obtained bacterial solution were measured using a plate reader (FilterMax F5, Molecular Devices) (FIGS. 13 and 14). Regarding the codeine response in Figure 13, it was confirmed that the four LuxR fusions, SalAT, THS, T6ODM, and CODM, responded to the codeine. That is, it was confirmed that SalAT-LuxRv2 (or LuxRv3), THS-LuxRv2 (or LuxRv3), T6ODM-LuxRv2 (or LuxRv3), and CODM-LuxRv2 (or LuxRv3) were codeine sensors. Regarding the morphine response in Figure 14, it was confirmed that the LuxR fusions of SalAT, CODM, SalR and COR responded. That is, it was confirmed that SalR-LuxRv2 (or LuxRv3) and COR-LuxRv2 (or LuxRv3) are morphine sensors. In addition, a TS sequence is inserted between each enzyme and LuxRv3 (or LuxRv2), and a HHHHHHGS sequence is inserted after the start codon of each enzyme.

[0063] (Checking the reticulin sensor) The response to S-reticuline, an important intermediate in morphine biosynthesis, was examined. Each transformant was cultured overnight (12 hours) with shaking in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) (preculture). A 100-fold dilution of this preculture was inoculated into 0.5 mL of fresh medium (0 to 50 μM (S)-reticuline) in a 96 deep well plate and cultured at 37°C for 12 hours with shaking. The OD595 and fluorescence (Ex: 485 nm / Em: 535 nm filter configuration) of the obtained bacterial solution were measured using a plate reader (FilterMax F5, Molecular Devices) (FIG. 15). It was confirmed that the LuxR fusion of T6ODM and COR responded to the reticuline response in Figure 15. That is, it was confirmed that T6ODM-LuxRv2 (or LuxRv3) and COR-LuxRv2 (or LuxRv3) are reticuline sensors. In addition, a TS sequence is inserted between each enzyme and LuxRv3 (or LuxRv2), and a HHHHHHGS sequence is inserted after the start codon of each enzyme.

[0064] (Evolutionary Engineering of Reticulin Sensors) Random mutations were introduced into COR-LuxRv3 (COR: an enzyme that reduces codeinone to codeine [UniPlot: Q9SQ68]), which showed good (S)-retuiculine responsiveness, to create a library and obtain mutants with better reticuline sensor properties. The library was prepared as follows based on the description in FIG. The vector portion was amplified by fidelity PCR using KOD plus with -1 pHRA-PN25-his-optCOR-LuxRv3 as a template. The reaction conditions were as follows: Amount of template plasmid: 5 ng / reaction volume 50 μL PCR Buffer TOYOBO 10xKOD plus Buffer dNTP concentration 2mM each, Mg concentration 25mM KOD plus Polymerase, 1 unit Primer set (vector side) 5'-TTTTACTAGTGAAAACATAAATGCCGACGACACA-3' (SEQ ID NO:53) 5'-TTTTGGATCCGTGGTGATGGTGATG-3'' (SEQ ID NO:54) Primer set (insert side) 5'-TTTTGGTCTCtCCAGGCATCAAATAAAACGAAAGG-3' (SEQ ID NO:55) 5'-CACCAGCGTTTCTGGGTGAG-3' (SEQ ID NO:56) Thermal cycle: 94℃ (2min) → {94℃(15sec) / 52℃(30sec) / 68℃ (3.5min)}x25 → 68℃ (4min) Both PCR products were digested with DpnI and then purified by gel extraction. -2 Using the PCR fragment (COR-LuxR, 2271 base pairs) obtained in "-1" above as a template, the gene of the COR-LuxRv3 portion was amplified by epPCR. The reaction conditions were as follows: Amount of template plasmid: 5 ng / reaction volume 50 μL PCR Buffer NEB 10x Thermo Pol Reaction Buffer dNTP concentration: 2 mM each, Mg concentration: 25 mM, Mn concentration: 10 and 50 μM NEB Taq DNA Polymerase, 1.25 units Final yield 5000 ng, amplification 1000-fold. Primer: 5'-TTTTGGTCTCtCCAGGCATCAAATAAAACGAAAGG-3' (SEQ ID NO:57) 5'-CACCAGCGTTTCTGGGTGAG-3' (SEQ ID NO:58) -3 The purified PCR products were digested with BamHI-HF, HindIII-HF, and rSAP for the vector and with BamHI-HF and HindIII-HF for the insert at 37°C for 3 hours and heat inactivated at 80°C for 30 minutes, then purified. These were ligated under the following conditions. Vector: 100 ng, insert: 217 ng, reaction volume 10 μL, Reaction time: 16 hours, reaction temperature: 16℃, NEB T4 DNA Ligase, 200 units -4 The resulting ligation product was used to transform E. coli BW25113, and the transformation solution was inoculated into 60 mL of LB liquid medium and cultured in a 300 mL baffled Erlenmeyer flask at 37°C for 12 hours to recover a plasmid library. The library sizes were as follows: [COR-LuxRv3] 10: 2.8×10 4 [COR-LuxRv3] 50: 5.4×10 4 -5 The movement of the populations in the constructed library was confirmed under conditions with and without the addition of 100 μM (S)-reticuline (Figure 17). The E. coli strain BW25113 carrying the reporter gene (pPlux-sfgfp) was designated [COR-LuxR]. 10 , [COR-LuxR] 50 The transformants were transformed with and inoculated into LB solid medium to form colonies. In addition, 10 mL of LB liquid medium was placed in a centrifuge tube, and 1 / 100 of the transformation solution was inoculated therein and cultured at 37°C overnight (pre-culture). 1 / 100 of the pre-culture solution was inoculated into 500 μL of LB liquid medium and cultured at 37°C for 12 hours, after which the distribution of fluorescence intensity after ON-selection at each (S)-reticuline concentration was measured by FCM (FCS: Trig log3 320V, SSC: Trig log3 230V, B1: Trig log5 490V, Trigger 2.00). Before randomization, there appears to be a slight response to reticuline. This "difference" was amplified by library (randomization). The fluorescence distribution in the On state is slightly decreased, but in the Off state it is significantly shifted to the low signal side. This change indicates that many (or all) of the mutants bind to S-reticuline with significant strength, and the introduction of random mutations widely redistributes the stability of the fusion proteins in the absence of reticuline downward.

[0065] (Obtaining a rectilin sensor through evolutionary engineering) The E. coli strain BW25113 carrying the reporter gene (pPlux-sfgfp) was designated [COR-LuxR]. 10 , [COR-LuxR] 50 The transformants were transformed with and inoculated into LB solid medium containing 100 μM (S)-reticuline to form colonies. 91 colonies that showed high fluorescence output were selected and cultured in 500 μL of LB liquid medium at 37°C for 12 hours with shaking to obtain a preculture solution. The preculture solution was transferred to LB medium (96 deep well plate, 500 μL) containing or not containing reticulin (100 μM) at 5 μL each, and the distribution of fluorescence intensity was measured. Six clones that were judged to have significantly higher fluorescence value per cell in the medium containing reticulin than in the medium not containing reticulin were selected, and the plasmids were recovered. When these were retransformed, two of them (mut-5 and mut6) reproduced the difference in fluorescence intensity due to the presence or absence of reticulin (Figure 18). Although leakage expression was observed in the absence of reticulin, a clear reticulin response was confirmed. Furthermore, sequence analysis of the two mutants revealed that mut5 had two amino acid mutations (S11G, F276Y) in the enzyme, and mut6 had two amino acid mutations (S11G, F276Y) in the enzyme and one (K16R) in LuxRv3 (Figure 19). Based on the above, it was confirmed that mut5(S11G, F276Y)-LuxRv3 and mut6(S11G, F276Y)-LuxRv3(K16R) are reticuline sensors. In addition, a TS sequence is inserted between mut5 or mut6 and LuxRv3, and a HHHHHHGS sequence is inserted after the start codon of mut5 or mut6.

[0066] (Creating a devine-codeine sensor by evolutionary engineering) CODM-LuxRv3, which showed good codeine responsiveness, is an enzyme that also uses thebaine, a key substance in morphine synthesis, as a substrate. We attempted to obtain mutants with better responsiveness from the random mutation library of CODM-LuxRv3.

[0067] 10 or 50 μM Mn 2+ By using EP-PCR with 3 The resulting PCR products were ligated with a vector and replicated in E. coli strain BW25113 to recover a plasmid library.

[0068] According to the workflow in Figure 20, E. coli strain BW25113 carrying a reporter plasmid (pPlux-sfgfp) was transformed with the CODM-LuxR library. The pCODM-LuxR library was inoculated onto LB solid medium containing various concentrations of codeine to form colonies. From the colonies that formed, shining colonies were picked and pre-cultured in 500 μL of LB (Amp / Cm) liquid medium at 37°C for 12 hours. The pre-culture solution was inoculated at 1 / 100 volume into LB liquid medium containing 0 / 100 μM codeine and cultured at 37°C for 12 hours. The main culture solution was diluted 10-fold with saline, and the cell density (OD595) and green fluorescence intensity (Ex: 485 nm / Em: 535 nm) were measured using FilterMax F5.

[0069] (Mutant specificity analysis) Three transformant colonies were randomly selected and cultured in 500 μL of LB liquid medium at 37°C for 12 hours with shaking (preculture). The preculture was inoculated into LB liquid medium at 1 / 100 volume and cultured in liquid medium containing various concentrations of thebaine, codeine, (S)-reticuline, and morphine without AHL addition for 12 hours with shaking at 37°C (main culture). The main culture was diluted 10-fold with saline and the cell density (OD ) was measured using a FilterMax F5. 595 ) and green fluorescence intensity (Ex: 485 nm / Em: 535 nm) were measured. From the results of Figures 21 and 22, it was confirmed that the CODM(Q121L and R346H)-LuxRv3 mutant, in which two amino acid mutations (Q121L and R346H) were introduced into the CODM enzyme, serves as a devine-codeine sensor. In addition, a TS sequence is inserted between CODM (Q121L and R346H) and LuxRv3, and a HHHHHHGS sequence is inserted after the start codon of CODM (Q121L and R346H). EXAMPLES

[0070] (Construction of tryptophan and tyrosine sensors) Many microorganisms possess transcription factors that respond to tryptophan and tyrosine, enabling precise and dynamic regulation of the aromatic amino acid biosynthetic pathway. For example, E. coli possesses repressors called TyrR and TrpR, which have long been used in gene expression systems that use amino acids as inducers. Both TyrR and TrpR are so-called "corepressor-type" transcriptional regulatory proteins. In other words, they have a mechanism that increases the affinity for TyrO and TrpO (respective binding sites) by binding to the ligands tyrosine and tryptophan. Therefore, the addition of tryptophan or tyrosine to the medium suppresses gene expression downstream of TyrP and TrpP, rather than inducing it (ON-OFF type response). For this reason, in order to use these as an induction system for gene expression, a method has been developed in which antagonists of TrpR and TyrR (such as indole acetic acid) are added to the medium. On the other hand, in the method reported by the present inventors (see WO2019182156), a sensor was prepared that senses stability due to ligand binding. In other words, it was possible to make an OFF→ON response to molecules that bind with sufficient stability (affinity) without an agonist or antagonist. In this example, a sensor that responds OFF→ON type by tryptophan, tyrosine, etc. was prepared by the following method.

[0071] (TrpR-LuxR) The gene for TrpR from Escherichia coli (EG11029: 108 amino acids, total 333 bases: SEQ ID NO: 59) was PCR-amplified from the genomic DNA of E. coli strain MG1655 (SEQ ID NO: 60, 61). This was treated with restriction enzymes BamHI and SpeI, and ligated with the tetR portion of pHRA-TetR-LuxR (also treated with BamHI and SpeI) to obtain pHRA-TrpR-LuxR (Figure 23: SEQ ID NO: 62). In this construct, TrpR-LuxR (full length 367 amino acids) was expressed under the control of the N25 promoter (RBS score 0.01). 4 is 9537, setting). SEQ ID NO: 60: TTTTGGATCCGCCCAACAATCACCCTATTCAG SEQ ID NO: 61: TTTTACTAGTATCGCTTTTCAGCAACACCTCTTC TyrR-LuxR: The gene for TyrR (EG11042: 513 amino acids, total 1548-bases: SEQ ID NO: 63) derived from Escherichia coli was PCR amplified from the genomic DNA of E. coli strain MG1655 (SEQ ID NO: 64, 65). This was treated with restriction enzymes BamHI and SpeI, and ligated with the TetR portion of pHRA-TetR-LuxR (also treated with BamHI and SpeI) to obtain pHRA-TyrR-LuxR (Figure 24, SEQ ID NO: 66). In this construct, TyrR-LuxR (full length 772 amino acids) was expressed under the control of the N25 promoter (RBS score was set to 13670). SEQ ID NO: 64: TTTTGGATCCCGTCTGGAAGTCTTTTGTGAAG SEQ ID NO: 65: TTTTACTAGTCTCTTCGTTCTTCTTCTGACTC

[0072] (Functional analysis (transfer curve)) TrpR-LuxRv3 and TyrR-LuxRv3 were introduced into E. coli strain BW25113 together with Plux-GFP (WO2019182156). The transformants were each cultured overnight (12 hours) with shaking in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) (preculture). The preculture was diluted 100-fold into 0.5 mL of fresh medium (0-10 mL) in a 96 deep well plate. 3 The bacteria were inoculated into a 100-μM L-tryptophan or L-tyrosine-containing culture medium and cultured for 12 hours with shaking at 37° C. The OD595 and fluorescence (485 nm / 535 nm filter configuration) of the resulting bacterial solution were measured using a plate reader (FilterMax F5, Molecular Devices) (FIG. 25). As shown in Figure 25, both the tyrosine sensor and the tryptophan sensor emitted higher fluorescent signals as the concentration of tryptophan added to the medium increased, indicating that an OFF→ON type sensor could be developed. The EC50 values ​​of the sensors were 61 μM (TyrR-LuxR) and 32 μM (TrpR-LuxR), respectively, which roughly reflected the reported Kd values ​​(24-330 μM (TyrR) and 16 μM (TrpR)). From the above, it was confirmed that TrpR-LuxRv3 and TyrR-LuxR v3 are tryptophan sensors capable of detecting increases in tryptophan concentration, unlike conventional sensors. In addition, a TS sequence is inserted between TrpR or TyrR and LuxRv3, and a HHHHHHGS sequence is inserted after the start codon of TrpR or TyrR.

[0073] (Creation of a tyrosine sensor using TyrB) The biosensor of this example is a method that reads out stabilization by ligands (small molecule binding), and has the advantage that enzymes can also be used as molecular recognition elements. Therefore, we created a tyrosine sensor in which TyrB (2.6.1.57: an enzyme that transfers the amino group of tyrosine to ketoglutarate), which is involved in tyrosine biosynthesis, is bound to LuxR.

[0074] (TyrB-LuxR) The gene for TyrB (EG11040: 397 amino acids, total 1200-bases: SEQ ID NO: 67) derived from Escherichia coli was PCR amplified from the genomic DNA of E. coli strain MG1655 (SEQ ID NO: 68, 69). This was treated with restriction enzymes BamHI and SpeI, and ligated with the TetR portion of pHRA-TetR-LuxR (also treated with BamHI and SpeI) to obtain pHRA-TyrB-LuxR (SEQ ID NO: 70, FIG. 26). In this construct, TyrB-LuxR (full length 656 amino acids) was expressed under the control of the N25 promoter (RBS score was set to 10916). SEQ ID NO: 68: TAAAGGATCCTTTCAAAAAGTTGACGCCTACGC SEQ ID NO: 69: TTTTACTAGTCATCACCGCAGCAAACGCC

[0075] (Functional analysis (flow cytometer analysis)) This sensor (TyrB-LuxRv3) was introduced into E. coli strain BW25113 together with Plux-GFP (see WO2019182156). The transformants were each cultured overnight (12 hours) with shaking in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) (preculture). From this preculture, cells were inoculated into 0.5 mL of fresh medium (containing 0 / 500 μM L-tyrosine) in a 96 deep well plate so that they were diluted 100-fold, and cultured with shaking at 37°C for 12 hours, and analyzed by flow cytometer (FSC, 320 V (trigger, 2.00); SSC, 230 V (secondary trigger, 2.00); B1, 400 V) (Figure 27). As shown in Figure 27, both the tyrosine sensor and the tryptophan sensor emitted higher fluorescent signals as the concentration of tyrosine added to the medium increased, indicating that an Off→ON type sensor could be developed. The EC50 value of the sensor was 115 μM, which roughly reflected the reported Kd value (42-625 μM). From the above, it was confirmed that TyrB-LuxRv3 is a tyrosine sensor capable of detecting increases in tyrosine concentration, unlike conventional techniques. In addition, a TS sequence is inserted between TyrB and LuxRv3, and a HHHHHHGS sequence is inserted after the start codon of TyrB. EXAMPLES

[0076] (Preparation of isoprenoid precursor sensor) IPP and DMAPP are the final biosynthetic products of the metabolic pathway called the MEP pathway in E. coli and the MEV pathway in yeast, and are used as building blocks for synthesizing isoprenoids as well as for membrane synthesis. In this example, in order to detect IDI, DMAPP, and DOXP, the product of DXS, which is said to be the rate-limiting enzyme of the E. coli MEP pathway, we created a sensor in which enzymes (IDI, DXR) that use IDI and DMAPP as substrates were fused with LuxR.

[0077] (Preparation of IDI-LuxR) IDI (isopentenyl-diphosphate isomerase: SEQ ID NO: 76) is known to reversibly isomerize IPP, isopentenyl pyrophosphate, and DMAPP, dimethylallyl pyrophosphate (8). A plasmid was constructed that genetically fuses IDI with the LuxRv3 mutant and stably expresses it (Figure 28, SEQ ID NO: 71). (DXR-LuxR Production) DXR (1-deoxy-D-xylulose 5-phosphate reductoisomerase, ispC) is the second enzyme in the MEP pathway, synthesizing MEP (2-methyl-D-erythritol 4-phosphate) from DOXP (1-deoxy-D-xylulose 5-phosphate) using NADPH as a coenzyme. A plasmid was constructed that genetically fuses DXR with the LuxRv3 mutant and steadily expresses it (Figure 29, SEQ ID NO: 72). (Construction of substrate (IPP) supplying plasmid) It has been found that the expression of the yeast endogenous genes mk, pmk, and pmd in E. coli increases the intracellular IPP accumulation level when MVA and mevalonate are added to the medium. Therefore, we constructed a plasmid that stably expresses the mk, pmk, and pmd genes and the blue fluorescent protein mTagBFP as an internal standard for the expression level (Figure 29, SEQ ID NO: 73). (Preparation of substrate (DOXP) supplying plasmid) Since the amount of isoprenoid synthesis increases when DXS (1-deoxy-D-xylulose-5-phosphate synthase), which is responsible for the first step of the MEP pathway, is overexpressed in E. coli, we hypothesized that the amount of DOXP, which is a substrate for DXR, could be significantly increased in the cells by additional expression of DXS. To increase the amount of DOXP in the cells, we constructed a plasmid (Figure 30, SEQ ID NO: 74) that constantly expresses the dxs gene.

[0078] (IDI-LuxR, DXR-LuxR substrate level response) To detect changes in the concentrations of these metabolites in E. coli, the two vectors prepared above were introduced into E. coli together with the Plux-sfGFP plasmid, and the fluorescence intensity was examined using a flow cytometer when the intracellular concentration of the target metabolites was changed (Figure 32). As shown in Figure 32, IDI-LuxRv3 contained cells that showed a slightly higher fluorescence when mevalonate was added, but the fluorescence intensity of the entire culture was weak, and sensor behavior was not observed. Similarly, DXR-LuxRv3 did not exhibit sensor behavior even when the amount of DOXP was increased by additional expression of DXS.

[0079] (IDI-LuxR Evolutionary Engineering (First Generation)) To improve the performance of the IPP / DMAPP sensor, we performed evolutionary engineering of idi-luxRv3. In detail, we created a library in which random mutations were introduced throughout the gene (see Table 4 below).

[0080] [Table 4] A library created using evolutionary engineering of IDI-Lv3.

[0081] We isolated mutants that responded to IPP from the library. Specifically, the E. coli strain BW25113, which already had a reporter plasmid and an IPP supplying plasmid, was transformed with the plasmid library and inoculated onto a solid medium containing 480 μM mevalonic acid to form colonies. After 12 hours of culture at 37oC, no colonies showed significant fluorescence, so we further cultured the colonies at 4oC for 12 hours and then screened them. At this time, 1,500 out of 3,000 colonies showed fluorescence, and 45 of them showed stronger fluorescence than the parent colony. These 45 colonies and 135 of the 1,500 glowing colonies were randomly selected (a total of 180 clones), and the fluorescence intensity was evaluated when they were cultured in medium containing or not containing 480 μM mevalonate. Among the mutants screened, one mutant (G1P2D4) showed high fluorescence upon addition of high concentrations of mevalonate. The ratio of fluorescence intensity when cultured in medium containing 4800 μM mevalonate to that without it was 2.8-fold for IDI-Lv3, whereas it was 9.5-fold for G1P2D4. Analysis of the DNA sequence of this mutant revealed that an L19P mutation was introduced into the IDI region and a V162I mutation was introduced into the LuxR region (see Table 5 below). The G1P2D4-LuxRv3(V162I) mutant was confirmed to function as a mevalonate sensor. In addition, a TS sequence is inserted between G1P2D4 and LuxRv3(V162I), and a HHHHHHGS sequence is inserted after the start codon of G1P2D4. Furthermore, to examine the effect of the mutations introduced into the G1P2D4 mutant, IDI-LuxRv3V162I was prepared by introducing the V162I mutation into the LuxR domain of IDI-LuxRv3.

[0082] [Table 5] Genotypes of mutants obtained through evolutionary engineering of IDI-Lv3 (first generation). a) Nucleotide and amino acid mutations introduced into LuxR were renumbered after LuxR. b) All mutants retain the nine mutations introduced into the LuxR side of the parent IDI-LuxRv3 (A97G(T33A), T125C(L42S), T169A(S57T), C258A(N86K), T279A(N93K), A295G(N99D), A299G(N100S), T624C(G208G), and C735G(C245W)) in addition to the new mutations listed above.

[0083] The dose-response of IDI-LuxRLv3, IDI-LuxRLv3V162I, and IDI-LuxRLv3{G1P2D4} to mevalonate was examined in parallel, and the results are shown in Figure 33. By adding the V162I mutation to IDI-Lv3, the overall transcriptional activity was increased, and the maximum output was improved, but the stringency was decreased. The G1P2D4 mutant in which the L19P mutation was introduced into the IDI domain of IDI-Lv3V162I had improved stringency while maintaining the same maximum output as IDI-Lv3V162I. This confirmed that IDI-LuxRLv3, IDI-LuxRLv3V162I, and IDI-LuxRLv3{G1P2D4} function as mevalonate sensors. In addition, a TS sequence is inserted between IDI and each LuxR, and a HHHHHHGS sequence is inserted after the start codon of IDI. These results suggest that the V162I mutation in LuxR enhances fusion tolerance, and the L19P mutation in IDI moderately reduces the stability of the sensor protein.

[0084] (IDI-LuxR Evolutionary Engineering (2nd Generation)) To create an IPP / DMAPP sensor with a higher dynamic range than the first generation, we created a second generation library by introducing random mutations only into the IDI region using IDI-LuxR G1P2D4 as a parent. To make it easier to search for mutants with high sensitivity, we cultured them under conditions with 480 μM mevalonate and performed positive screening by adding kanamycin at various concentrations. The clone strains were cultured for 3 hours under conditions with a kanamycin concentration of 30 μg / mL and concentrated. They were then inoculated onto solid medium without mevalonate, and the functional distribution of 88 of 600 dark colonies out of 700 was evaluated. As a result of the screening, one interesting mutant was obtained (see Table 6 below). The G2P3D9 mutant had a similar maximum output to the parent G1P2D4, but the dynamic range was improved by increasing the stringency (Figure 34). This confirmed that IDI-LuxRLv3{G2P3D9} functions as a mevalonate sensor. A TS sequence is inserted between IDI and each LuxR, and a HHHHHHGS sequence is inserted after the start codon of IDI. In addition, this mutant contained the D28H mutation in the IDI region, which improved the stringency of the sensor, suggesting that D28H reduces the structural stability of the sensor protein without impairing its binding to IPP / DMAPP.

[0085] [Table 6] Genotypes of mutants obtained by evolutionary engineering of IDI-Lv3 (second generation). a) In addition to the new mutations listed above, the mutant retains the nine mutations that were introduced into the LuxR side of LuxRv3: A97G (T33A), T125C (L42S), T169A (S57T), C258A (N86K), T279A (N93K), A295G (N99D), A299G (N100S), T624C (G208G), and C735G (C245W).

[0086] (IDI-LuxR Evolutionary Engineering (3rd Generation)) To create an IPP / DMAPP sensor with a higher dynamic range than the second generation, we created a third generation library by introducing random mutations only into the IDI region using IDI-LuxR G2P3D9 as a parent. To make it easier to search for mutants with high sensitivity, we cultured them under conditions containing 4800 μM mevalonate and performed positive screening by adding kanamycin at various concentrations. The clone strains were cultured for 6 hours under conditions containing 60 μg / mL kanamycin and concentrated. They were then inoculated onto solid medium without mevalonate, and the functional distribution of 80 randomly selected colonies out of 2000 dark colonies was evaluated. As a result of screening, two interesting mutants were obtained. The G3P1D3 mutant (see Table 7 below) had a similar maximum output to the parent G2P3D9, but the stringency was increased, improving the dynamic range (Figure 35a). On the other hand, the G3P1F4 mutant (see Table 7 below) had a higher maximum output than the parent G2P3D9, and the stringency was increased, expanding the dynamic range (Figure 35b). In addition, this mutant showed a high Hill coefficient (5.9 for the mutant compared to 3.7 for the parent), which corresponds to the shift in the mevalonate concentration at which it begins to respond. These results confirmed that IDI-LuxRv3{G3P1F4} and IDI-LuxRv3{G3P1D3} function as mevalonate sensors. Note that a TS sequence is inserted between IDI and each LuxR, and a HHHHHHGS sequence is inserted after the start codon of IDI.

[0087] [Table 7] Genotypes of mutants obtained by evolutionary engineering of IDI-Lv3 (third generation). a) In addition to the new mutations listed above, the mutant retains the nine mutations that were introduced into the LuxR side of LuxRv3: A97G (T33A), T125C (L42S), T169A (S57T), C258A (N86K), T279A (N93K), A295G (N99D), A299G (N100S), T624C (G208G), and C735G (C245W).

[0088] (DXR-LuxR evolutionary engineering) As is clear from the results in Figure 32, the sensor performance of DXR-LuxRv3 is extremely low, which suggests low fusion tolerance and low stability. Therefore, in the process of improving the sensor performance of DXR-LuxRv3, we performed evolutionary engineering of two generations of mutants that increase the enzyme activity.

[0089] (Library (first generation) creation) A [dxr]-luxRv3 library was created in which random mutations were introduced only into the dxr gene (see Table 8 below).

[0090] [Table 8] A library created through evolutionary engineering of DXR-Lv3.

[0091] (1st generation) The BW25113 strain was prepared by introducing a reporter plasmid (Plux-GFP-hsvTK / aph) and a substrate feeder plasmid (pDXS, FIG. 31), and was transformed with the [DXR]lib-LuxRv3 library plasmid prepared above. Mutants with improved substrate binding should give a higher signal than the parent in the presence of the substrate. Therefore, we induced the expression of DXS and performed kanamycin selection (positive selection) under those conditions. The enriched mutant population was then plated on agar medium to select mutants that formed colonies with high GFP fluorescence (positive screening). Among the approximately 1,650 colonies, 32 clones were found that showed a higher output than the parent. These were cultured in liquid culture in 96-deep wells and the fluorescence intensity was quantified. Furthermore, sequence analysis was performed to obtain four unique mutants. (Function evaluation (sensor function)) The transcriptional activity of cells expressing these mutants was more than four times higher than that of the parent (Figure 36). In other words, we were able to obtain a sensor that responds to DOXP, a product of DXS (Table 9). That is, DXR{G1P1A2}-LuxRv3, DXR{G1P1B3}-LuxRv3, DXR{G1P1E2}-LuxRv3 and DXR{G1P1F2}-LuxRv3 were confirmed to be sensors that respond to DOXP. Note that a TS sequence is inserted between each DXR and LuxRv3, and a HHHHHHGS sequence is inserted after the start codon of each DXR. The isolated DXR-Lv3 mutant populations all had many amino acid mutations (Table 9). Although it is unclear how these contributed to the improvement of sensor performance, this indicates that there are many amino acid substitutions and their combinations that increase the output when DXS is overexpressed.

[0092] [Table 9] Mutations introduced into the DXR-Lv3 mutant.

[0093] (2nd generation) A plasmid mixture consisting of equal concentrations of the four mutants isolated in the first generation was used as a template to create a second generation library in which random mutations were introduced only into the DXR region (see Table 8). (Function Selection) The BW25113 strain was prepared by introducing a reporter plasmid (Plux-GFP-hsvTK / aph) and a substrate feeder plasmid (pDXS), and was transformed with the [DXR]lib-LuxRv3 library plasmid prepared above. In order to enrich for mutants showing high fluorescence intensity, expression of DXS was induced and kanamycin selection (positive selection) was performed, after which the enriched mutant population was plated on agar medium to select mutants that formed colonies with high GFP fluorescence (positive screening). The enriched mutant population was then plated on agar medium to select various colonies with GFP fluorescence (Figure 37). (Function evaluation (sensor function)) Among the colonies, it was confirmed that the mutant with the highest fluorescence intensity ratio with / without dxs was G2P1C11, which was 2.5-fold (Figure 38). These results confirmed that G2P1C11 is a sensor that responds to DOXP. Furthermore, we confirmed that G2P1F4 and G2P1D7 are also sensors that respond to DOXP.

[0094] [Table 10] Mutations introduced into second-generation DXR-Lv3 mutants. EXAMPLES

[0095] (Method of screening for enzyme activity) In the above examples, it was shown with multiple sensor elements E (enzymes) that a sensor can be created simply by binding the enzyme E to LuxR, which is the actuator A, and down-regulating its stability. If an enzyme can be used as a molecular recognition element of a sensor by binding it to LuxR, it will be possible to construct sensors for most metabolites and metabolic intermediates on a metabolic map. On the other hand, the output characteristics of a sensor that uses an enzyme as the sensor element E accurately reflect the enzyme's substrate binding characteristics (and, strictly speaking, the characteristics in the subsequent activation and product release). In other words, using an enzyme as a sensor component is equivalent to "visualizing" the behavior of the enzyme through the sensor output. In other words, the substrate binding event of the enzyme is detected by the degree of sensor output. By measuring this detection, it becomes possible to (1) screen for compounds that can be substrates for the enzyme from within a compound library, (2) estimate the Km (an index of substrate affinity) for the enzyme substrate, and (3) screen for enzyme activity that acts on a certain metabolite. In particular, if the substrate supply is set constant (metabolite concentrations can be approximated to a steady state because homeostasis is highly effective in cells), the substrate binding properties of the enzyme can be evaluated by evaluating the sensor performance as an element. In other words, regardless of the type of reaction, the activity of any enzyme can be improved by fusing it to LuxR (see Figure 39).

[0096] Usually, screening for enzyme activity requires some method to visualize only the enzyme reaction expressed in the cell in a way that distinguishes it from the thousands of enzyme reactions occurring in the cell. With the exception of dyes, in many enzyme reactions, both the substrate and the product are invisible, so it is necessary to develop a new chemical or enzymatic system that selectively visualizes the accumulation of the product or the reduction of the substrate, or to develop a method to couple it to the growth rate of the host cell. As shown in this example, if the substrate binding event of an enzyme can be converted into the activity of a transcription factor, the substrate recognition ability of the enzyme reaction can be colorimetrically visualized by GFP fluorescence, luciferase chemiluminescence, LacZ dye synthesis, etc., even without a method to track the enzyme reaction itself. Furthermore, by placing a gene for assimilation or an antibiotic resistance gene under the control promoter of the fused transcription factor, it is possible to couple the substrate recognition ability to the growth rate of the host. In other words, it becomes possible to screen the activity of any enzyme reaction in the cell without any method to directly detect the reduction of the substrate or the production of the product.

[0097] (2nd Screening) The products obtained in the second screening were boil-prepped to recover the plasmids, and the reporter plasmid was then transformed into a DXS expression strain (BW25113 with pDXS introduced) and an inactive DXS mutant expression strain (BW25113 with pDXSdead introduced). These DXS-LuxRv3 mutants were scored along two axes. [1] Sensor signal increase ratio (1) The reporter plasmid (Plux-GFP-hsvTK / aph) was introduced into the BW25113 strain carrying the reporter plasmid together with the substrate feeder plasmid (pDXS) or the control plasmid (pDXSdead), and the fluorescence output was measured with or without DXS overexpression. [2] Cell activity in a single frame The LuxR domain was excised from each of the DXS-LuxRv3 mutants to create constructs expressing only the DXR mutants. These were then co-transfected into E. coli BW25113 with plasmid 1 expressing the lycopene synthesis pathway (CrtE, CrtB, and CrtI), and the amount of lycopene accumulated in the resulting transformants was measured. FIG. 40 shows a plot of the signal gain obtained by expression of dxs in the sensor on the X-axis and the enzyme activity (amount of accumulated lycopene) on the Y-axis.

[0098] As is clear from the results in Figure 40, when the performance as a sensor element in the state fused with LuxRLv3 (fluorescence intensity ratio at dxs + / -) was compared with the enzyme performance (amount of lycopene synthesis) shown in the state of a single frame in which LuxRLv3 was excised, it was possible to obtain three mutants (G2P1C11, G2P1D7, G2P1F4) that showed lycopene synthesis amount 10% or higher than the wild type out of eight mutants that were judged to have significantly improved sensor ON / OFF performance (ON / OFF ratio > 1.5 times) compared with the parent. In particular, G2P1C11 showed a 20% increase in production. As a result, the method of this example enabled the acquisition of mutants with high enzyme activity by screening using the detection sensitivity of the sensor element as an index. Furthermore, the DXR portion of these mutants was sequenced, and the introduced mutations are shown in the table below.

[0099] [Table 11] a) Mean ratio of fluorescence per OD of mutants to that of wild type. b) Mean ratio of lycopene production in mutants to that in wild type.

[0100] In the enzyme activity screening method of this embodiment, (1) sensor element E and actuator A were fused, and (2) the performance as a sensor (sensor detection sensitivity) was screened, thereby enabling the production of an enzyme with excellent enzyme activity without screening the actual enzyme activity (product formation or substrate consumption).

Claims

1. A polypeptide having a detection activity for a morphinan alkaloid, the morphinan alkaloid being devine, codeine or reticuline, the polypeptide having any one of the following amino acid sequences (1) to (10): (1) The amino acid sequence represented by SEQ ID NO:51 has amino acid substitutions at positions 121 and 346, (2) The amino acid sequence represented by SEQ ID NO:51 has the amino acid substitutions Q121L and R346H. (3) The amino acid sequence represented by SEQ ID NO: 51 has an amino acid substitution of Q121L or R346H, and has substantially the same devine and / or codeine detection activity as that of (2) above. (4) The amino acid sequence shown in SEQ ID NO:51 has amino acid substitutions of Q121L and R346H, and further has 1 to 20 amino acid substitutions, deletions, insertions and / or additions at positions other than positions 121 and 346, and has substantially the same devine and / or codeine detection activity as that of (2) above. (5) In the amino acid sequence shown in SEQ ID NO:51, the amino acid sequence has amino acid substitutions of Q121L and R346H, has a homology of 90% or more with the amino acid sequence shown in SEQ ID NO:51, and has a devine and / or codeine detection activity substantially equivalent to that of (2) above. (6) The amino acid sequence represented by SEQ ID NO: 50 has amino acid substitutions at positions 11 and 276. (7) The amino acid sequence represented by SEQ ID NO: 50 has amino acid substitutions of S11G and F276Y. (8) The amino acid sequence shown in SEQ ID NO: 50 has an amino acid substitution of S11G or F276Y, and has reticulin detection activity substantially equivalent to that of (7) above. (9) The amino acid sequence shown in SEQ ID NO:50 has amino acid substitutions of S11G and F276Y, and further has 1 to 20 amino acid substitutions, deletions, insertions and / or additions at positions other than positions 11 and 276, and has reticulin detection activity substantially equivalent to that of (2) above. (10) In the amino acid sequence shown in SEQ ID NO:50, it has the amino acid substitutions S11G and F276Y, has a homology of 90% or more with the amino acid sequence described in SEQ ID NO:50, and has reticulin detection activity substantially equivalent to that of (7) above.

2. The polypeptide of claim 1, wherein the morphinan alkaloid is devine or codeine, and is a codeine 3-O-demethylase (CODM) mutant having any one of the following amino acid sequences (1) to (5): (1) The amino acid sequence represented by SEQ ID NO:51 has amino acid substitutions at positions 121 and 346, (2) The amino acid sequence represented by SEQ ID NO:51 has the amino acid substitutions Q121L and R346H. (3) The amino acid sequence represented by SEQ ID NO: 51 has an amino acid substitution of Q121L or R346H, and has substantially the same devine and / or codeine detection activity as that of (2) above. (4) The amino acid sequence shown in SEQ ID NO:51 has amino acid substitutions of Q121L and R346H, and further has 1 to 20 amino acid substitutions, deletions, insertions and / or additions at positions other than positions 121 and 346, and has substantially the same devine and / or codeine detection activity as that of (2) above. (5) In the amino acid sequence shown in SEQ ID NO:51, it has the amino acid substitutions Q121L and R346H, has a homology of 90% or more with the amino acid sequence described in SEQ ID NO:51, and has a devine and / or codeine detection activity substantially equivalent to that of (2) above.

3. A gene encoding the CODM mutant polypeptide of claim 2, which is any one of the following genes (A) or (B): (A) a gene encoding a polypeptide in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above and which has substantially the same devine and / or codeine detection activity as (2) above; (B) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (2) above and having substantially equivalent devine and / or codeine detection activity as (2) above.

4. The polypeptide of claim 1, wherein the morphinan alkaloid is reticuline and is a codeinone reductase (COR) mutant having any one of the following amino acid sequences (6) to (10): (6) The amino acid sequence represented by SEQ ID NO: 50 has amino acid substitutions at positions 11 and 276. (7) The amino acid sequence represented by SEQ ID NO: 50 has amino acid substitutions of S11G and F276Y. (8) The amino acid sequence shown in SEQ ID NO: 50 has an amino acid substitution of S11G or F276Y, and has reticulin detection activity substantially equivalent to that of (7) above. (9) The amino acid sequence shown in SEQ ID NO:50 has amino acid substitutions of S11G and F276Y, and further has 1 to 20 amino acid substitutions, deletions, insertions and / or additions at positions other than positions 11 and 276, and has reticulin detection activity substantially equivalent to that of (7) above. (10) In the amino acid sequence shown in SEQ ID NO:50, it has the amino acid substitutions S11G and F276Y, has a homology of 90% or more with the amino acid sequence described in SEQ ID NO:50, and has reticulin detection activity substantially equivalent to that of (7) above.

5. A gene encoding the COR mutant polypeptide of claim 4, which is any one of the following genes (C) or (D): (C) a gene encoding a polypeptide in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (7) above and which has substantially the same reticulin detection activity as (7) above; (D) A gene encoding a polypeptide having 90% or more homology with the amino acid sequence of (7) above and having reticulin-detecting activity substantially equivalent to that of (7) above.

6. A morphinan alkaloid sensor which is a fusion protein of a sensor element S and an actuator A, wherein the sensor element S is selected from the group consisting of salutaridinol 7-O-acetyltransferase (SalAT), thebaine synthase (THS), thebaine 6-O-demethylase (T6ODM), codeine 3-O-demethylase (CODM), salutaridine reductase (SalR), codeinone reductase (COR), a COR {mut5 (S11G, F276Y)} mutant, and a CODM (Q121L, R346H) mutant, and the actuator A is a LuxR mutant having any one of the amino acid sequences (1) to (10) below: (1) The amino acid sequence represented by SEQ ID NO: 11 has amino acid substitutions of N86K and C245W and further has amino acid substitutions at positions 33 and 57. (2) The amino acid sequence represented by SEQ ID NO: 11 has amino acid substitutions of N86K and C245W and further has amino acid substitutions of T33A and S57T. (3) In the amino acid sequence shown in SEQ ID NO: 11, the gene has three or four amino acid substitutions selected from N86K, C245W, T33A, and S57T, and has a transcription enhancing activity or acyl homoserine lactone (AHL) detection sensitivity substantially equivalent to that of the gene shown in (2) above. (4) The amino acid sequence shown in SEQ ID NO: 11 has the amino acid substitutions N86K, C245W, T33A and S57T, and further has 1 to 20 amino acid substitutions, deletions, insertions and / or additions at positions other than 86, 245, 33 and 57, and has a transcription enhancing activity or AHL detection sensitivity substantially equivalent to that of (2) above. (5) In the amino acid sequence shown in SEQ ID NO: 11, the amino acid substitutions are N86K, C245W, T33A, and S57T, and the amino acid sequence has 90% or more homology with the amino acid sequence described in SEQ ID NO: 11, and has a transcription enhancing activity or AHL detection sensitivity substantially equivalent to that of (2) above. (6) In the amino acid sequence represented by SEQ ID NO: 11, the amino acid sequence has amino acid substitutions of N86K, C245W, T33A, and S57T, and further has amino acid substitutions at positions 42, 93, 99, and 100. (7) The amino acid sequence represented by SEQ ID NO: 11 has amino acid substitutions of N86K, C245W, T33A, and S57T, and further has amino acid substitutions of L42S, N93K, N99D, and N100S. (8) In the amino acid sequence shown in SEQ ID NO: 11, the amino acid sequence has 5, 6, 7, or 8 amino acid substitutions selected from N86K, C245W, T33A, S57T, and L42S, N93K, N99D, and N100S, and has a transcription enhancing activity substantially equivalent to that of (7) above. (9) In the amino acid sequence shown in SEQ ID NO: 11, the amino acid substitutions are N86K, C245W, T33A, S57T, and L42S, N93K, N99D, and N100S, and further, 1 to 20 amino acids are substituted, deleted, inserted, and / or added at positions other than 86, 245, 33, 57, 42, 93, 99, and 100, and the transcription enhancing activity is substantially equivalent to that of (7) above. (10) In the amino acid sequence shown in SEQ ID NO:11, it has the amino acid substitutions N86K, C245W, T33A, S57T, and L42S, N93K, N99D, and N100S, and has a homology of 90% or more with the amino acid sequence described in SEQ ID NO:11, and has a transcriptional enhancement activity substantially equivalent to that of (7) above.

7. 7. The morphinan alkaloid sensor of claim 6, which is a devine codeine sensor, wherein the sensor element S is selected from the group consisting of SalAT, THS, T6ODM, CODM, and a CODM(Q121L, R346H) mutant.

8. The morphinan alkaloid sensor of claim 6, wherein the sensor element S is selected from the group consisting of SalR and COR.

9. The morphinan alkaloid sensor of claim 6, which is a reticuline sensor, wherein the sensor element S is selected from the group consisting of T6ODM, COR and COR{mut5(S11G,F276Y)} mutant.

10. The morphinan alkaloid sensor according to any one of claims 6 to 9, wherein the sensor element S and the actuator A are fused together via a linker L.

Images