Transgenic non human animal in which proteasome function is attenuated

Abstract

To provide a transgenic non-human animal by which evaluation of the activity and function of proteasome can be analyzed at an individual level.SOLUTION: There is provided a transgenic non-human animal which comprises: a variant PSDM 12 protein which has a specific amino acid sequence to which, on a region of a C-terminal side of a PSDM 12 protein being a sub unit of 26S proteasome, substitution, deficiency and / or addition of an amino acid residue is performed, in which a function of systemic proteasome is attenuated.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a transgenic non-human animal in which the function of the proteasome is attenuated. [Background technology]

[0002] The proteasome selectively degrades and removes ubiquitinated proteins, and thus plays an essential role in maintaining intracellular protein homeostasis, as well as controlling various cellular functions such as gene expression, stress response, and signal transduction. Therefore, it is believed that failure of the proteasome causes various pathologies, such as cancer, neurodegenerative diseases, and autoimmune diseases. However, because the proteasome is essential for the survival of all cells, conventional analytical methods such as conditional knockout mice are not very useful, and research on the proteasome at the individual level has lagged far behind. Therefore, many points remain unclear about the molecular mechanism by which a decrease in proteasome function causes disease. In addition, although the development of inhibitors targeting the ubiquitin-proteasome pathway has been actively pursued, the problem is that there is no model to evaluate the drug efficacy at the individual level. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Glickman, MH & Ciechanover, A. The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev82, 373-428 (2002). [Non-Patent Document 2] Arima, K. et al.Proteasome assembly defect due to a proteasome subunit beta type 8 (PSMB8) mutation causes the autoinflammatory disorder, Nakajo-Nishimura syndrome. Proc Natl Acad Sci USA 108, 14914-14919 (2011). [Non-Patent Document 3] Kitamura, A. et al. A mutation in the immunoproteasome subunit PSMB8 causes autoinflammation and lipodystrophy in humans. J Clin Invest121, 4150-4160 (2011). Summary of the Invention [Problem to be solved by the invention]

[0004] Under these circumstances, there has been a need for the development of transgenic non-human animals that can analyze the function and activity of the proteasome at the individual level, such as animal models for proteasome-related diseases (proteasomopathy) and animal models for evaluating the efficacy of proteasome activators, and that can contribute to the development of drugs targeting the ubiquitin-proteasome system. [Means for solving the problem]

[0005] The present invention has been made in consideration of the above-mentioned circumstances, and provides, for example, a transgenic non-human animal, a screening method for a therapeutic or preventive agent for a proteostasis abnormality or a disease, symptom, or pathology caused by the abnormality, and a pharmaceutical composition for the treatment or prevention thereof, as shown below. (1) Transgenic non-human animals in which proteasome function is attenuated. (2) The transgenic non-human animal according to (1) above, wherein the attenuation of the function is attenuation of systemic proteasome function. (3) The transgenic non-human animal according to (1) or (2) above, wherein the proteasome with reduced function has a proteasome activity reduced by 10 to 50%. (4) The transgenic non-human animal according to any one of (1) to (3) above, wherein the proteasome with reduced function has a mutation introduced into PSDM12 protein, which is a subunit of the 26S proteasome.

[0006] (5) The transgenic non-human animal according to (4) above, wherein the mutation is a substitution, deletion and / or addition of amino acid residues in the C-terminal region of the amino acid sequence of PSDM12 protein. (6) The transgenic non-human animal according to (4) or (5) above, wherein the mutated PSDM12 protein is a protein selected from the group consisting of (a), (b) and (c) below: (a) a protein comprising the amino acid sequence shown in SEQ ID NO: 4, 6 or 8. (b) A protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4, 6 or 8, and having reduced proteasome function. (c) A protein comprising an amino acid sequence having 80% or more identity to the amino acid sequence shown in SEQ ID NO: 4, 6 or 8 and having attenuated proteasome function. (7) The transgenic non-human animal according to any one of (1) to (6) above, into which a gene mutation has been introduced so as to express the proteasome whose function is attenuated. (8) The transgenic non-human animal according to (7) above, wherein the genetic mutation is a mutation introduced into a gene encoding the PSDM12 protein, a subunit of the 26S proteasome.

[0007] (9) The transgenic non-human animal according to any one of (1) to (8) above, wherein the non-human animal is a rodent. (10) The transgenic non-human animal according to (9) above, wherein the rodent is a mouse. (11) The transgenic non-human animal according to any one of (1) to (10) above, which is a model animal having a proteostasis disorder. (12) The transgenic non-human animal according to (11) above, wherein the model animal is a model animal for a disease, symptom, or pathology caused by a proteostasis disorder.

[0008] (13) The transgenic non-human animal according to (12) above, wherein the disease, symptom or pathology caused by abnormal proteostasis is at least one selected from the group consisting of growth retardation, renal dysfunction, decreased liver function, diaphragmatic hernia and cerebellar abnormality. (14) A method for screening for a therapeutic or preventive agent for a proteostasis disorder, comprising the steps of administering a candidate substance to the transgenic non-human animal described in (11) above, and evaluating the proteostasis disorder in the non-human animal after administration of the candidate substance. (15) A method for screening for a therapeutic or preventive agent for a disease, symptom, or pathology caused by a proteostasis disorder, comprising the steps of administering a candidate substance to the transgenic non-human animal described in (12) above, and evaluating the disease, symptom, or pathology caused by a proteostasis disorder in the non-human animal after administration of the candidate substance. (16) The screening method according to (15) above, wherein the disease, symptom or pathological condition caused by abnormal proteostasis is at least one selected from the group consisting of growth retardation, renal dysfunction, decreased liver function, diaphragmatic hernia and cerebellar abnormality.

[0009] (17) A pharmaceutical composition for treating or preventing a proteostasis disorder, comprising a therapeutic or prophylactic agent obtained by the screening method according to (14) above. (18) A pharmaceutical composition for treating or preventing a disease, symptom, or pathology caused by abnormal proteostasis, comprising a therapeutic or prophylactic agent obtained by the screening method according to (15) or (16) above. (19) A method for treating or preventing a proteostasis disorder, comprising administering the pharmaceutical composition according to (17) above to a patient having or at risk of having a proteostasis disorder. (20) A method for treating or preventing a disease, symptom, or pathology caused by abnormal proteostasis, comprising administering the pharmaceutical composition according to (18) above to a patient suffering from or at risk of suffering from a disease, symptom, or pathology caused by abnormal proteostasis. Effect of the Invention

[0010] According to the present invention, it is possible to provide a transgenic non-human animal in which the function of the proteasome is attenuated, preferably the systemic proteasome function is attenuated, a model animal having a proteostasis abnormality using the non-human animal, or a model animal for a disease, symptom, or pathology caused by the abnormality, as well as a screening method for a therapeutic or preventive agent for a proteostasis abnormality or a disease, symptom, or pathology caused by the abnormality, and a pharmaceutical composition for the treatment or prevention thereof. [Brief description of the drawings]

[0011] [Figure 1] This is a diagram showing the three-dimensional structure of the proteasome. The 26S proteasome is composed of a catalytic subunit (CP: core particle: 20S proteasome) and a catalytic subunit (RP: regulatory particle: 19S complex). The RP is further classified into a lid and a base. The assembly of two 19S complexes is called the 30S proteasome. [Diagram 2]Figure 1 shows the results of analysis of the generated proteasome mutant mice. (A) gRNA and Cas9 protein were injected into fertilized eggs targeting the last exon (exon11) of Psmd12, and cells were collected from the tails of the resulting F0 mice. The cells were then primary cultured, and the expression of mutant PSMD12 protein was analyzed by Western blot. The black arrow indicates normal PSMD12 protein, and the red arrow indicates mutant PSMD12 protein. (B) Genomic sequence of Psmd12 heterozygous mutant mice. The results of analysis of the genomic sequence near the mutation in wild-type (WT) mice and three strains of Psmd12 mutant mice (#17, #53, #36) that were successfully established as lines. (C) Amino acid sequence of Psmd12 heterozygous mutant mice. The amino acid sequence near the mutation in WT mice and three strains of Psmd12 mutant mice (#17, #53, #36) that were successfully established as lines are shown. WT and homologous amino acids are highlighted in blue. [Diagram 3] Figure 1 shows the results of measuring proteasome activity in proteasome mutant mice. (A) Cell extracts were prepared from MEFs (Mouse Embryonic Fibroblasts) derived from wild-type (WT) or Psmd12 heterozygous mutant mice, and separated by Native-PAGE. The chymotrypsin-like activity of 20S, 26S, and 30S proteasomes in the gel was evaluated using Suc-LLVY-AMC, a peptide-based fluorescent substrate for proteasomes. (B) Brain and liver extracts were extracted from WT mice and Psmd12 mutant mouse #17, and proteasome activity was evaluated in the same manner as above (A). [Figure 4] Figure 1 shows the results of measurements of the growth status of proteasome mutant mice. (A) Growth curve from 1 to 12 weeks after birth. Wild-type (WT) mice and three lines of Psmd12 mutant mice (#17, #53, #36) that had been successfully established were weighed from 1 to 12 weeks after birth (mean ± SD, test method: Welch's t-test, *P<0.05, **P<0.01). (B) Photographs of tissues in WT mice and Psmd12 mutant mouse #17 at 4 weeks. [Diagram 5] This figure shows the results of histological analysis of proteasome mutant mice. Cerebellar slices from wild-type (WT) mice and Psmd12 mutant mice #17 were stained with HE staining and morphology was observed. The scale bar represents 300 μm at 4x magnification (x4) and 50 μm at 40x magnification (x40). As indicated by the arrow, loss of Purkinje cells was observed in Psmd12 mutant mice #17. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The present invention will be described in detail below. The scope of the present invention is not limited to these descriptions, and other than the following examples, the present invention can be appropriately modified and implemented without departing from the spirit of the present invention. All publications cited in this specification, such as prior art documents, publications, patent publications, and other patent documents, are incorporated herein by reference.

[0013] 1. Overview of the Invention The ubiquitin-proteasome system (UPS) is a major intracellular protein degradation system that selectively degrades ubiquitinated proteins. The proteasome is a proteolytic enzyme complex consisting of 33 different subunits, and has a structure in which one or two 20S proteasomes (CP: core particle) and 19S complexes (RP: regulatory particle) with protease activity are associated (see Figure 1).

[0014] Proteasomes are responsible for approximately 70% of intracellular protein degradation, and play an essential role in controlling all cellular functions, such as cell cycle progression, transcriptional control, signal transduction, immune response, and protein homeostasis, through the degradation of ubiquitinated substrates (see Non-Patent Document 1, cited above). When proteasome function is disrupted due to aging or stress, normal protein degradation is no longer possible, leading to the accumulation of abnormal proteins and disturbance of signal transduction, which is thought to lead to various diseases such as neurodegenerative diseases, autoimmune diseases, and cancer. Therefore, accurate understanding of the UPS control mechanism is expected to lead to an understanding of the onset of diseases caused by the breakdown of UPS function. However, since proteasomes are essential for cell survival, analysis of knockout mice, etc. is not very effective, and pathophysiological analysis at the individual level is lagging behind in terms of how proteasome function is controlled and how impaired proteasome function causes diseases.

[0015] Incidentally, it has been reported that missense mutations in the β5i (PSMB8) gene, one of the constituent subunits of the immune proteasome, a subtype of the 20S proteasome, cause Nakajo-Nishimura syndrome (designated intractable disease 268), a hereditary autoimmune disease endemic to Japan (see non-patent documents 2 and 3 listed above).

[0016] In recent years, pharmaceutical companies have been actively developing drugs that target the UPS. In particular, it is known that enhanced proteasome activity in cancer cells aids cell proliferation and survival, and UPS control molecules have become targets for anticancer drug development. However, until now, there have been no animal models with reduced proteasome function to evaluate the efficacy of these UPS control molecules, and the development of an animal model for analyzing proteasome function and activity at the individual level has been awaited.

[0017] Under these circumstances, the present inventors have developed transgenic non-human animals with reduced proteasome function, which enable evaluation and analysis of proteasome function and activity at the individual level.

[0018] 2. Transgenic Non-human Animals As described above, the transgenic non-human animal of the present invention (hereinafter sometimes referred to as "non-human animal of the present invention") is a non-human animal in which the function of the proteasome is attenuated, preferably a non-human animal in which the systemic proteasome function is attenuated. The systemic proteasome refers to the proteasome present throughout the entire body of the non-human animal, and can also be said to refer to substantially all of the proteasomes expressed in the body of the non-human animal.

[0019] In the non-human animal of the present invention, the proteasome with reduced function may be one whose activity is reduced compared to that of the wild-type proteasome, and is not particularly limited, but for example, proteasome activity is preferably reduced by 10 to 50%, and the activity may be reduced by 20 to 50%, 30 to 50%, 40 to 50%, 10 to 40%, 10 to 30%, or 10 to 20%. Reduction in proteasome activity can be confirmed, for example, in proteasomes expressed in organs or tissues such as the brain (preferably the cerebellum, cerebral cortex, and hippocampus), liver, kidney, testis, spleen, cardiac muscle, and skeletal muscle.

[0020] Preferred examples of proteasome activity include activity measured by measuring the peptidase activity of the proteasome using the fluorescent peptide substrate suc-LLVY-AMC. Other preferred examples of proteasome activity include activity measured using the degradation of polyubiquitinated proteins as an indicator, and activity measured by histological analysis of the formation of ubiquitin-positive aggregates.

[0021] In the non-human animal of the present invention, the proteasome with reduced function includes, but is not limited to, a proteasome in which a mutation has been introduced into any one or more subunit proteins constituting the standard 26S proteasome. The mutation is preferably, but is not limited to, a mutation in which an amino acid residue has been substituted, deleted, and / or added in the amino acid sequence of the subunit. The number of amino acid residues to be substituted, deleted, and / or added is, but is not limited to, for example, 1 to 20, 1 to 15, 1 to 10, or 1 to 5.

[0022] In addition, as a specific embodiment, the proteasome with the attenuated function is preferably, but not limited to, a proteasome with a mutation introduced into a subunit constituting the 19S complex among the catalytic subunit (CP: core particle; "20S proteasome") and the regulatory subunit (RP: regulatory particle; "19S complex") constituting the standard 26S proteasome, and more specifically, for example, a proteasome with a mutation introduced into the PSDM12 protein (Rpn5 protein), which is one of the subunits constituting the lid portion of the 19S complex. The PSDM12 protein is a conserved subunit of the proteasome and is considered to be required for the correct assembly and activity of the proteasome. In addition, since mutations in the PSDM12 protein or its gene are not lethal, the present inventors have focused on the fact that mutations in the PSDM12 protein cause a mild functional decrease in the proteasome, that is, can generate a proteasome with attenuated function.

[0023] The mutation in the PSDM12 protein is preferably, but not limited to, a mutation in which an amino acid residue is substituted, deleted, and / or added in the C-terminal region of the amino acid sequence of the PSDM12 protein. The substitution, deletion, and / or addition is preferably, but not limited to, for example, the first 20 amino acid residues counting from the C-terminus of the amino acid sequence of the wild-type PSDM12 protein, and may be, but not limited to, the first 30, the first 40, the first 50, or the first 60 amino acid residues. The number of amino acid residues substituted, deleted, and / or added is, but is not limited to, for example, 1 to 20, 1 to 15, 1 to 10, or 1 to 5.

[0024] In the non-human animals of the present invention, specific examples of the PSDM12 protein into which the mutation has been introduced include the following proteins (a) to (c):

[0025] (a) a protein comprising the amino acid sequence shown in SEQ ID NO: 4, 6 or 8. (b) A protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4, 6 or 8, and having reduced proteasome function. (c) A protein comprising an amino acid sequence having 80% or more identity to the amino acid sequence shown in SEQ ID NO: 4, 6 or 8 and having attenuated proteasome function.

[0026] The amino acid sequence of wild-type PSDM12 protein is shown in SEQ ID NO: 2. The amino acid sequence (456 amino acids) of SEQ ID NO: 2 is registered under the heading "NP It is registered under the accession number "080170".

[0027] The amino acid sequences shown in SEQ ID NOs: 4, 6, and 8 above are the amino acid sequences of mutant PSDM12 proteins that can be expressed in mice clone #17, mice clone #53, and mice clone #36, respectively, as shown in the Examples described below.

[0028] The above-mentioned clone #17 mouse can be produced, for example, from a fertilized egg of a mouse with the accession number NITE AP-03543, but is not limited thereto. The fertilized egg with the accession number NITE AP-03543 is called "PSMD12p.Leu438Gly" and was deposited on October 7, 2021 at the National Institute of Technology and Evaluation, Biotechnology Center, Patent Microorganism Deposit Center (NPMD) (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818).

[0029] The above-mentioned clone #53 mouse can be produced, for example, from a fertilized egg of a mouse with the accession number NITE AP-03545, but is not limited thereto. The fertilized egg with the accession number NITE AP-03545 is called "PSMD12p.Ser437Phefs3" and was deposited on October 7, 2021 at the National Institute of Technology and Evaluation, Biotechnology Center, Patent Microorganism Deposit Center (NPMD) (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818).

[0030] The above-mentioned clone #36 mouse can be produced, for example, from a fertilized egg of a mouse with the accession number NITE AP-03544, but is not limited thereto. The fertilized egg with the accession number NITE AP-03544 is called "PSMD12p.Ser437Leufs9" and was deposited on October 7, 2021 at the National Institute of Technology and Evaluation, Biotechnology Center, Patent Microorganism Deposit Center (NPMD) (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818).

[0031] The amino acid sequence of sequence number 4 (438 amino acids) is missing 18 amino acids on the C-terminus compared to the amino acid sequence of the wild-type PSDM12 protein, and the 438th amino acid is mutated from the wild-type amino acid.

[0032] The amino acid sequence of sequence number 6 (439 amino acids) is missing 17 amino acids on the C-terminus compared to the amino acid sequence of the wild-type PSDM12 protein, and the amino acids 437 to 439 are mutated from the wild-type amino acids.

[0033] The amino acid sequence of SEQ ID NO:8 (445 amino acids) is missing 11 amino acids on the C-terminus compared to the amino acid sequence of wild-type PSDM12 protein, and the amino acids 437 to 440 and 442 to 445 are mutated from the wild-type amino acids.

[0034] In the protein (b) above, the "amino acid sequence in which one or several amino acids are deleted, substituted or added" is, for example, an amino acid sequence in which about 1 to 10 amino acids, preferably 1 to several, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 amino acid, are deleted, substituted or added. The introduction of such mutations, such as deletion, substitution or addition, can be performed using a mutation introduction kit that utilizes site-directed mutagenesis, for example, GeneTailor TM This can be carried out using the Site-Directed Mutagenesis System (Invitrogen), the TaKaRa Site-Directed Mutagenesis System (Prime STAR (registered trademark) Mutagenesis Basal kit, Mutan (registered trademark)-Super Express Km, etc.: manufactured by Takara Bio Inc.), etc. Furthermore, whether the above-mentioned deletion, substitution, or addition mutation has been introduced can be confirmed using various amino acid sequencing methods, and structural analysis methods such as X-ray and NMR.

[0035] The "identity" in the protein of (c) above is more preferably 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0036] In the above proteins (b) and (c), "having attenuated proteasome function" means, as mentioned above, that the activity is reduced compared to that of the wild-type proteasome, and the above explanation can be applied to specific examples of the activity.

[0037] As described above, the non-human animal of the present invention is a non-human animal with attenuated proteasome function, and more specifically, it is preferable that a genetic mutation has been introduced so as to express a proteasome with attenuated function. In detail, the genetic mutation is not limited to, but may be, for example, a mutation introduced into a gene encoding a protein of any one or more subunits constituting the standard 26S proteasome.

[0038] In a specific embodiment, the genetic mutation is preferably a mutation introduced into a gene that encodes a protein of a subunit that constitutes the 19S complex, one of the catalytic subunits (CP: core particle; "20S proteasome") and regulatory subunits (RP: regulatory particle; "19S complex") that constitute the standard 26S proteasome. More specifically, it is preferable that the genetic mutation is a mutation introduced into a gene that encodes the PSDM12 protein (Rpn5 protein), which is one of the constituent subunits of the lid portion of the 19S complex.

[0039] In the non-human animal of the present invention, the method of introducing the above-mentioned gene mutation is not limited, and known gene recombination techniques, gene mutation introduction techniques, etc. can be adopted. For example, DNA used as a mutant gene can be prepared according to the site-specific mutagenesis method described in, for example, Molecular Cloning, A Laboratory Manual 4th ed., Cold Spring Harbor Laboratory Press (1989), Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997), etc. Specifically, it can be prepared using a mutation introduction kit utilizing site-specific mutagenesis by known methods such as the Kunkel method or the Gapped duplex method. Examples of such kits include, for example, QuickChange TM Site-Directed Mutagenesis Kit (Stratagene), GeneTailor TM Preferred examples include the Site-Directed Mutagenesis System (Invitrogen), the TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc.: Takara Bio Inc.). PCR can also be performed under appropriate conditions using a PCR primer designed to introduce a missense mutation so as to obtain DNA encoding a desired mutant protein, and a DNA containing a base sequence encoding a wild-type protein as a template. Alternatively, a non-human animal having a desired gene mutation can be produced using the CRISPR / Cas9 method.

[0040] In the non-human animals of the present invention, specific preferred examples of the gene encoding the PSDM12 protein into which the mutation has been introduced include genes comprising DNAs represented by (a) to (c) below:

[0041] (a) DNA consisting of the base sequence shown in SEQ ID NO: 3, 5 or 7. (b) A DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to the DNA having the base sequence shown in SEQ ID NO: 3, 5 or 7 (i.e., the DNA of (a) above), and that encodes a protein having attenuated proteasome function. (c) A DNA having 80% or more identity to the DNA consisting of the base sequence shown in SEQ ID NO: 3, 5 or 7 (i.e., the DNA of (a) above) and encoding a protein having attenuated proteasome function.

[0042] The gene encoding the wild-type PSDM12 protein is a gene containing DNA consisting of the nucleotide sequence shown in SEQ ID NO: 1. The nucleotide sequence of SEQ ID NO: 1 is registered under the title “NM It is registered under the accession number "025894".

[0043] The nucleotide sequences shown in SEQ ID NOs: 3, 5, and 7 above are nucleotide sequences encoding mutant PSDM12 proteins that can be expressed in mice of clone #17, mice of clone #53, and mice of clone #36, respectively, as shown in the Examples described below.

[0044] The above-mentioned mice clones #17, #53, and #36 can be produced, for example and not limited thereto, from fertilized eggs of mice with accession numbers NITE AP-03543, NITE AP-03545, and NITE AP-03544, respectively. These fertilized eggs were all deposited as described above.

[0045] The base sequence of SEQ ID NO:3 (1317 bases) encodes the amino acid sequence of SEQ ID NO:4 described above, and more specifically, is a deletion of two bases in the base sequence encoding the wild-type PSDM12 protein (specifically, the two bases (ct) at positions 1361 and 1362 in the numbering of the base sequence of SEQ ID NO:1).The sequence (taa) corresponding to the stop codon in the base sequence of SEQ ID NO:3 corresponds to bases 1366 to 1368 in the numbering of the base sequence of SEQ ID NO:1.

[0046] The base sequence of SEQ ID NO:5 (1320 bases) encodes the amino acid sequence of SEQ ID NO:6 described above, and more specifically, is a base sequence encoding the wild-type PSDM12 protein to which one base (t) has been added (specifically, between bases 1358 and 1359 in the numbering of the base sequence of SEQ ID NO:1).The sequence (taa) corresponding to the stop codon in the base sequence of SEQ ID NO:5 corresponds to bases 1366 to 1368 in the numbering of the base sequence of SEQ ID NO:1.

[0047] The base sequence of SEQ ID NO:7 (1338 bases) encodes the amino acid sequence of SEQ ID NO:8 described above, and more specifically, is a sequence in which one base (specifically, the 1358th base (t) in the numbering of the base sequence of SEQ ID NO:1) is deleted from the base sequence encoding the wild-type PSDM12 protein. The sequence (tag) corresponding to the stop codon in the base sequence of SEQ ID NO:7 corresponds to bases 1386 to 1388 in the numbering of the base sequence of SEQ ID NO:1.

[0048] Here, the DNA of (b) above can be obtained from a cDNA library or a genome library by carrying out a known hybridization method such as colony hybridization, plaque hybridization, or Southern blotting using the DNA of (a) above or a DNA having a base sequence complementary thereto, or a fragment thereof, as a probe. The library used is not limited and may be one prepared by a known method or a commercially available cDNA library or genome library.

[0049] For detailed procedures of the hybridization method, reference can be made to Molecular Cloning, A Laboratory Manual 4th ed., Cold Spring Harbor Laboratory Press (1989), etc. "Stringent conditions" in carrying out the hybridization method refer to conditions for washing after hybridization, in which the buffer salt concentration is 15 to 330 mM and the temperature is 25 to 65°C, preferably 15 to 150 mM, and the temperature is 45 to 55°C. Specific examples include conditions such as 80 mM and 50°C. Furthermore, in addition to such conditions such as salt concentration and temperature, various conditions such as probe concentration, probe length, and reaction time can also be taken into consideration to appropriately set conditions for obtaining the above (b) DNA.

[0050] The "identity" in the DNA of (c) above is more preferably 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. In the DNA of (b) and (c) above, "having attenuated proteasome function" means, as mentioned above, that the activity is reduced compared to that of the wild-type proteasome, and the above explanation can be applied to specific examples of the activity.

[0051] Non-human animals that can be used in the present invention include, but are not limited to, mammals other than humans, such as mice, rats, guinea pigs, rabbits, pigs, weasels, dogs, cats, monkeys, sheep, cows, and horses, of which rodents (rodents) such as mice, rats, and guinea pigs are preferred, and mice are more preferred.

[0052] The non-human animal of the present invention exhibits an aspect in which the function of the proteasome is attenuated, and therefore the non-human animal of the present invention can be used, for example, as a model animal having a proteostasis disorder, and more specifically, can be used as a model animal for a disease, symptom, or pathology caused by a proteostasis disorder.

[0053] In this case, the proteostasis abnormality can generally be exemplified by a state in which abnormal proteins accumulate due to a breakdown in protein homeostasis, etc. Furthermore, the disease, symptom, or pathology caused by the proteostasis abnormality is not limited, but can be exemplified by growth retardation, renal dysfunction, diaphragmatic hernia, cerebellar abnormality, neurodegenerative disease, intractable cancer, chronic inflammatory disease, arteriosclerosis, diabetes, aging, etc.

[0054] 3. Screening Method As described above, the non-human animal of the present invention can be used as a model animal having a proteostasis abnormality, more specifically, as a model animal for a disease, symptom, or pathology caused by a proteostasis abnormality, and is therefore useful in developing therapeutic agents for the abnormality, disease, symptom, or pathology, etc. Thus, the present invention can provide a screening method for a therapeutic or preventive agent for a proteostasis abnormality or a disease, symptom, or pathology caused by a proteostasis abnormality using the above-mentioned model animal, as well as a therapeutic or preventive agent for a proteostasis abnormality or a disease, symptom, or pathology caused by a proteostasis abnormality obtained by the method. Here, the above-mentioned explanation can be applied to specific examples of a proteostasis abnormality and a disease, symptom, or pathology caused by a proteostasis abnormality.

[0055] In the present invention, the method for screening for a therapeutic or prophylactic agent for proteostasis abnormality or a disease, symptom, or pathology caused by proteostasis abnormality comprises the following steps (a) and (b):

[0056] (a) administering a candidate substance to a non-human animal (model animal) of the present invention (administration step); (b) evaluating the proteostasis abnormality of the non-human animal (model animal) after administration of a candidate substance, or evaluating a disease, symptom, or pathology caused by the proteostasis abnormality (evaluation step).

[0057] In the administration step, examples of candidate substances to be administered to the model animal as a subject animal or to a control animal used as necessary include, but are not limited to, various substances such as naturally occurring or artificially synthesized various peptides, proteins (including enzymes and antibodies), nucleic acids (polynucleotides (DNA, RNA), oligonucleotides (siRNA, etc.), peptide nucleic acids (PNA), etc.), and low-molecular-weight, medium-molecular-weight or high-molecular-weight organic compounds.

[0058] The administration of the candidate substance can be performed orally or parenterally, and is not limited thereto, and in either case, known administration methods and conditions, etc. can be adopted. The dosage can also be appropriately determined taking into consideration the type and condition of the subject animal, the type of the candidate substance, etc.

[0059] In the above evaluation step, "evaluating proteostasis abnormalities" or "evaluating a disease, symptom, or pathology caused by proteostasis abnormalities" means analyzing the phenotype associated with proteostasis abnormalities in a non-human animal after administration of a candidate substance, or the phenotype associated with a disease, symptom, or pathology caused by proteostasis abnormalities, and means either comparing and examining the above phenotype of a non-human animal before and after administration of a candidate substance, or comparing and examining the above phenotype of a test animal administered with a candidate substance and a control animal not administered with the candidate substance.

[0060] In the above-mentioned phenotype analysis, if it can be evaluated that administration of a candidate substance significantly improves proteostasis abnormalities or diseases, symptoms, or pathologies caused thereby, or significantly suppresses the occurrence or progression of proteostasis abnormalities or diseases, symptoms, or pathologies caused thereby, the candidate substance can be selected as a therapeutic or preventive agent for proteostasis abnormalities or diseases, symptoms, or pathologies caused thereby.

[0061] The "control animal" is not limited as long as it is suitable for use as a comparison control with the test animal, and may be a non-transgenic non-human animal of the same litter or a wild-type animal that is not a transgenic animal. A transgenic non-human animal to which a candidate substance is not administered may also be used as a control animal. A wild-type non-human animal of the same litter or species as the non-human animal of the present invention is preferred as a control animal in that accurate comparative experiments can be performed. In addition, it is preferable to use animals of the same sex and age as the test animal and the control animal, and it is also preferable that the rearing conditions are similar. The screening method of the present invention may include any other steps as necessary.

[0062] 4. Pharmaceutical Compositions The present invention can also provide a pharmaceutical composition for treating or preventing a proteostasis abnormality, or a pharmaceutical composition for treating or preventing a disease, symptom, or pathology caused by a proteostasis abnormality. The pharmaceutical composition preferably contains a therapeutic or preventive agent obtained by the above-mentioned screening method of the present invention. The above-mentioned explanations can be applied to specific examples of proteostasis abnormalities and diseases, symptoms, or pathologies caused by the abnormalities.

[0063] The substance obtained by the screening method of the present invention as a therapeutic or preventive drug, which is an active ingredient of the pharmaceutical composition, is not limited to the substance itself, and for example, a derivative of the substance can be used as a substitute or in combination. The derivative is not particularly limited as long as it has a chemical structure derived from the original protein, compound, etc. and is considered to be a derivative based on the technical common sense of a person skilled in the art. The derivative includes, for example, those that undergo metabolism such as oxidation, reduction, hydrolysis, or conjugation in the living body, as well as those that are generated as an active ingredient by metabolism such as oxidation, reduction, or hydrolysis in the living body (so-called prodrugs).

[0064] As an active ingredient of the pharmaceutical composition of the present invention, a pharmacologically acceptable salt thereof can be used together with the above-mentioned substance, derivative or prodrug obtained by the screening method of the present invention, or in place of the substance, derivative or prodrug. Preferred examples of pharmacologically acceptable salts include, but are not limited to, hydrohalides (e.g., hydrochlorides, hydrobromides, hydroiodides, etc.), inorganic acid salts (e.g., sulfates, nitrates, perchlorates, phosphates, carbonates, bicarbonates, etc.), organic carboxylates (e.g., acetates, trifluoroacetates, maleates, tartrates, fumarates, citrates, etc.), organic sulfonates (e.g., methanesulfonates, trifluoromethanesulfonates, ethanesulfonates, benzenesulfonates, toluenesulfonates, camphorsulfonates, etc.), amino acid salts (e.g., aspartates, glutamates, etc.), quaternary amine salts, alkali metal salts (e.g., sodium salts, potassium salts, etc.), and alkaline earth metal salts (e.g., magnesium salts, calcium salts, etc.).

[0065] The active ingredient of the pharmaceutical composition of the present invention may include all isomers that may arise due to the structure of the compound (e.g., geometric isomers, optical isomers based on asymmetric carbons, rotational isomers, stereoisomers, tautomers, etc.) and mixtures of two or more of these isomers, and may be any of the S-, R-, or RS-isomers, without being limited thereto. Furthermore, the active ingredient of the pharmaceutical composition of the present invention may also exist in the form of a hydrate or solvate depending on the type. Examples of the solvate include, but are not limited to, a solvate with ethanol.

[0066] In the pharmaceutical composition of the present invention, the content of the above-mentioned active ingredient is not limited and can be appropriately set, and can be within the range of, for example, 0.01 to 99% by weight, 0.01 to 30% by weight, 0.05 to 20% by weight, or 0.1 to 10% by weight relative to the total pharmaceutical composition. When the content of the active ingredient is within the above range, the pharmaceutical composition of the present invention can exhibit a therapeutic or preventive effect against proteostasis abnormalities and diseases, symptoms, or pathologies caused by the abnormalities.

[0067] The pharmaceutical composition of the present invention can be administered to a target human or non-human mammal (e.g., mouse, rat, guinea pig, weasel, rabbit, sheep, pig, cow, cat, dog, monkey, etc.) by various administration routes, specifically, orally or parenterally (e.g., intravenous injection (intravenous injection), intramuscular injection, intraperitoneal injection, subcutaneous injection, rectal administration, transdermal administration), and can be formulated into an appropriate dosage form using a pharma- ceutically acceptable carrier by a method commonly used depending on the administration route and used.

[0068] As for dosage forms, for oral preparations, for example, tablets, powders, fine granules, granules, coated tablets, capsules, internal liquids, suspensions, emulsions, syrups, and troches can be mentioned, and for parenteral preparations, for example, injections (including drops), inhalants, ointments, nasal drops, and liposomes can be mentioned. When the therapeutic agent and pharmaceutical composition of the present invention are used as the various oral preparations described above, they can also be used as supplements (e.g., functional foods) in some cases.

[0069] Carriers that can be used in formulating these preparations include, for example, commonly used excipients, binders, disintegrants, lubricants, colorants, and flavoring agents, as well as stabilizers, emulsifiers, absorption enhancers, surfactants, pH adjusters, preservatives, antioxidants, bulking agents, wetting agents, surface activators, dispersants, buffers, preservatives, solubilizing agents, and soothing agents, as necessary. Known ingredients that can be used as raw materials for pharmaceutical preparations can be mixed to form the preparations in a conventional manner.

[0070] Examples of non-toxic substances that can be used as the component include animal and vegetable oils such as soybean oil, beef tallow, and synthetic glycerides; hydrocarbons such as liquid paraffin, squalane, and solid paraffin; ester oils such as octyldodecyl myristate and isopropyl myristate; higher alcohols such as cetostearyl alcohol and behenyl alcohol; silicone resins; silicone oils; surfactants such as polyoxyethylene fatty acid esters, sorbitan fatty acid esters, glycerin fatty acid esters, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene hydrogenated castor oil, and polyoxyethylene-polyoxypropylene block copolymers. water-soluble polymers such as hydroxyethyl cellulose, polyacrylic acid, carboxyvinyl polymer, polyethylene glycol, polyvinylpyrrolidone, and methyl cellulose; lower alcohols such as ethanol and isopropanol; polyhydric alcohols (polyols) such as glycerin, propylene glycol, dipropylene glycol, sorbitol, and polyethylene glycol; sugars such as glucose and sucrose; inorganic powders such as silicic anhydride, magnesium aluminum silicate, and aluminum silicate; inorganic salts such as sodium chloride and sodium phosphate; and purified water, all of which may be salts or hydrates thereof.

[0071] Preferred examples of excipients include lactose, fructose, corn starch, sucrose, glucose, mannitol, sorbitol, crystalline cellulose, and silicon dioxide. Preferred examples of binders include polyvinyl alcohol, polyvinyl ether, methylcellulose, ethylcellulose, gum arabic, tragacanth, gelatin, shellac, hydroxypropylmethylcellulose, hydroxypropylcellulose, polyvinylpyrrolidone, polypropylene glycol-polyoxyethylene block polymer, and meglumine. Preferred examples of disintegrants include starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, sodium bicarbonate, calcium citrate, dextrin, pectin, and carboxymethylcellulose calcium. Preferred examples of lubricants include magnesium stearate, talc, polyethylene glycol, silica, and hardened vegetable oil. Preferred examples of colorants include those permitted to be added to pharmaceuticals. Preferred examples of flavoring agents include cocoa powder, peppermint, aromatic powder, peppermint oil, borneol, and cinnamon powder. Each of these may be a salt or a hydrate thereof.

[0072] In addition, a pH adjuster is used when the composition is formulated as an injection. The pH adjuster is not particularly limited as long as it is, for example, medicamentarily, pharmacologically (pharmaceutical) or physiologically acceptable, and specifically includes alkali metal hydroxides such as sodium carbonate, potassium carbonate, sodium ethoxide, potassium butoxide, sodium hydroxide, and potassium hydroxide, alkali metal hydrides such as sodium hydride and potassium hydride, carbonates of alkali metals or alkaline earth metals, and alkali metal alkoxides. The pH adjuster to be blended may be used alone or in any combination of two or more. When the composition is formulated as an injection, the pH can be appropriately adjusted to an appropriate pH using a pH adjuster. In the present invention, the pH is preferably 3 to 6, more preferably 3 to 5, even more preferably 3 to 4.5, and particularly preferably 3.5 to 4.5.

[0073] In addition, when the composition is formulated as an injection, it may contain cyclodextrins. The cyclodextrins are not particularly limited as long as they are medicamentally, pharmacologically (pharmaceutical) or physiologically acceptable. Examples of such cyclodextrins include unmodified cyclodextrin and modified cyclodextrin. Examples of unmodified cyclodextrins include α-cyclodextrin, β-cyclodextrin, γ-cyclodextrin, etc. Further, examples of modified cyclodextrins include alkylated cyclodextrins (e.g., dimethyl-α-cyclodextrin, dimethyl-β-cyclodextrin, dimethyl-γ-cyclodextrin, etc.), hydroxyalkylated cyclodextrins (e.g., hydroxypropyl-α-cyclodextrin, hydroxypropyl-β-cyclodextrin, hydroxypropyl-γ-cyclodextrin, etc.), sulfoalkyl ether cyclodextrins (e.g., sulfobutyl ether-α-cyclodextrin, sulfobutyl ether-β-cyclodextrin, sulfobutyl ether-γ-cyclodextrin), branched cyclodextrins (e.g., maltosyl-α-cyclodextrin, maltosyl-β-cyclodextrin, maltosyl-γ-cyclodextrin, etc.), and the like.

[0074] Cyclodextrins may be used alone or in any combination of two or more. The cyclodextrins to be blended are preferably hydroxypropyl-β-cyclodextrin or sulfobutylether-β-cyclodextrin, and more preferably sulfobutylether-β-cyclodextrin.

[0075] The content of cyclodextrins is not particularly limited and is appropriately set depending on the type, the purpose of the injection, the method of use, etc. The content of cyclodextrins is, for example, preferably 5 to 50% by weight, more preferably 10 to 40% by weight, and even more preferably 10 to 30% by weight, based on the total amount of the injection.

[0076] The dosage of the pharmaceutical composition of the present invention can generally be appropriately set within a wide range, taking into consideration the mixing ratio of the active ingredient in the formulation, as well as the age, body weight, type and progress of the disease of the subject (patient), the administration route, the number of administrations (per day), the administration period, etc. The pharmaceutical composition of the present invention will be specifically described below when used as a parenteral or oral preparation.

[0077] When used as a parenteral agent, the form is generally not limited, but in the case of various injections, for example, it can be provided in the form of a unit dose ampoule or a multi-dose container, or in the form of a freeze-dried powder that is redissolved in a dissolving solution when used. In addition to the above-mentioned active ingredients, the parenteral agent can contain various known excipients and additives depending on the form, to the extent that the effects of the above-mentioned active ingredients are not impaired. For example, in the case of various injections, water, glycerol, propylene glycol, aliphatic polyalcohols such as polyethylene glycol, etc. can be mentioned.

[0078] The dosage (per day) of a parenteral agent is not limited, but for example, in the case of various injectables, the amount of the above-mentioned active ingredient, etc., can generally be 0.01 to 1000 mg, 0.05 to 500 mg, or 0.1 to 50 mg per kg of body weight of the target (subject, patient, etc.), or it can also be 0.5 to 20 mg or 1 to 10 mg.

[0079] When used as an oral preparation, the form is generally not limited, and may be any of the above-mentioned dosage forms, or may be a dried product that is redissolved when used. In addition to the above-mentioned active ingredients, the oral preparation may contain various known excipients and additives according to the various forms, to the extent that the effects of the above-mentioned active ingredients are not impaired. For example, binders (syrup, gum arabic, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone, etc.), fillers (lactose, sugar, corn starch, potato starch, calcium phosphate, sorbitol, glycine, etc.), lubricants (magnesium stearate, talc, polyethylene glycol, silica, etc.), disintegrants (various starches, etc.), and wetting agents (sodium lauryl sulfate, etc.).

[0080] The dosage (per day) of the oral preparation can generally be 0.05 to 5000 mg, 0.1 to 1000 mg, or 0.1 to 100 mg of the above-mentioned active ingredient, etc., per kg of body weight of the subject (subject, patient, etc.), or it can also be 0.5 to 50 mg or 1 to 10 mg. The blending ratio of the active ingredient in the oral preparation is not limited and can be appropriately set in consideration of the number of times of administration per day, etc.

[0081] The present invention also includes: (i) a method for treating or preventing a proteostasis abnormality or a disease, symptom or pathology caused by the abnormality, comprising using the pharmaceutical composition of the present invention, specifically, for example, administering an effective amount of the pharmaceutical composition of the present invention to a subject (a patient suffering from or at risk of suffering from a proteostasis abnormality or a disease, symptom or pathology caused by the abnormality, or a non-human mammal such as a mouse, rat, guinea pig, rabbit, sheep, pig, cow, weasel, cat, dog, monkey, etc.); (ii) use of the pharmaceutical composition of the present invention for producing a medicament for treating or preventing a proteostasis abnormality or a disease, symptom or pathology caused by the abnormality; and (iii) use of the pharmaceutical composition of the present invention for treating or preventing a proteostasis abnormality or a disease, symptom or pathology caused by the abnormality.

[0082] Furthermore, in the present invention, the treatment of proteostasis abnormalities and diseases, symptoms, or pathologies caused by such abnormalities specifically includes, for example, inhibition of progression, improvement of prognosis, and / or prevention of recurrence of the treatment of such abnormalities and diseases, symptoms, or pathologies caused by such abnormalities.

[0083] 5. Kit In treating or preventing a proteostasis abnormality or a disease, symptom, or pathology caused by said abnormality, a kit containing the pharmaceutical composition of the present invention described above can be used. The form of the active ingredient in the pharmaceutical composition in the kit is not limited, but may be provided in a dissolved state, for example, taking into consideration stability (storage stability) and ease of use. The kit may contain other components as appropriate in addition to the pharmaceutical composition of the present invention.

[0084] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these. EXAMPLES

[0085] [method] Generation of Psmd12 mutant mice (mice with reduced proteasome function) In order to generate mice with reduced proteasome function, the present inventors investigated various subunits that constitute the 26S proteasome and whose mutations are not lethal and that are suitable for reducing the function of the proteasome. As a result, they focused on the PSMD12 (Rpn5) protein and attempted to generate transgenic mice expressing mutant PSMD12 proteins (Psmd12 mutant mice). Specifically, they decided to use the CRISPR / Cas9 method to attempt to generate mice lacking the C-terminal region of the PSMD12 protein. Specifically, guide RNA (gRNA) targeting the last exon (Exon11) of the Psmd12 gene and Cas9 protein were injected into fertilized eggs of C57BL / 6JJcl mice (CLEA Japan). The gRNA was appropriately designed with the following base sequence (SEQ ID NO: 9) in Exon11 of the Psmd12 gene as the target sequence.

[0086] ACTGAACTCGCTGATGTCTC (SEQ ID NO: 9)

[0087] Next, the introduction of the mutation into the Psmd12 gene in the obtained F0 mice was confirmed by genome sequencing. In addition, to confirm the expression of mutant PSMD12 protein, cells taken from the tails of the F0 generation of the obtained various Psmd12 mutant mice (proteasome mutant mice) were primary cultured and Western blot analysis was performed. The base sequences of the gRNAs used in the above CRISPR / Cas9 are shown in Table 1.

[0088] Measurement of proteasome activity in mice with reduced proteasome function Proteasome activity was measured in MEFs (Mouse Embryonic Fibroblasts) and mouse tissues. MEFs were prepared from E12.5 embryos using the Primary Mouse Embryonic Fibroblast Isolation Kit (Thermo #88279) according to the attached protocol. 1×10 6Wild-type (WT) or proteasome heterozygous mutant mouse MEFs were washed twice with PBS and harvested using trypsin. The harvested cells were further washed twice with PBS and lysed with 50 μl of lysis buffer (50 mM Tris-HCl pH 7.5, 10% glycerol, 100 mM NaCl, 4 mM ATP, 1 mM DTT, 10 mM MgCl2, 1×Protease Inhibitor Cocktail (PIC) EDTA free (Roche)) + 0.2% NP40. After standing on ice for 30 minutes, the cells were centrifuged at 15,000 rpm and 4°C for 10 minutes, and the supernatant was collected. For mouse tissues, the brains and livers of 10-week-old WT and proteasome mutant mice were collected in 10 ml freeze-shredding tubes (Yasui Kikai) and the tissues were completely frozen in liquid nitrogen. A 10 ml metal cone for crushing tube (Yasui Kikai) was added to the tube, and the tissue was freeze-shattered at 2,700 rpm for 10 seconds using a multi-beads shocker (Yasui Kikai). 70 μl of lysis buffer (50 mM Tris-HCl pH 7.5, 10% glycerol, 100 mM NaCl, 4 mM ATP, 1 mM DTT, 10 mM MgCl2, 1×Protease Inhibitor Cocktail (PIC) EDTA free (Roche)) was added per 10 mg of tissue weight, and the tissue was suspended and subjected to ultrasonic disruption. After ultrasonic disruption, the tissue was centrifuged at 15,000 rpm and 4°C for 10 minutes, and the supernatant was collected. The obtained supernatant was filtered through a 0.45 μm filter (Millipore) (5,000 rpm, 4°C, 1 minute). The protein concentration of the obtained tissue extract was calculated using Pierce 660 nm Protein Assay Reagent (Thermo Fisher Scientific) (bovine serum albumin (BSA, Thermo Fisher Scientific) was used as the standard protein).The tissue extract was adjusted to 5μg / 3μl with lysis buffer, and 1μl of 4× loading dye (0.1μg / μl xylene cyanol, 10% glycerol) was added, followed by electrophoresis on NuPAGE 3-8% Tris acetate gel (Thermo Fisher Scientific) (150V, 240min, 4℃). TBE buffer (90mM Tris, 80mM borate, 0.1mM EDTA, 0.5mM ATP, 2mM MgCl2, 0.5mM DTT) was used as the electrophoresis buffer. The gel after Native-PAGE was preincubated at 37℃ for 30min. To evaluate the chymotrypsin-like protease activity of the 26S and 30S proteasomes, 4 ml of Buffer A (50 mM Tris-HCl pH 7.5, 10 % glycerol, 100 mM NaCl) containing 100 μM Succinyl-Leu-Leu-Val-Tyr-7-Amide-4-Methyl-Coumarin (Suc-LLVY-AMC, Peptide Institute), 1 mM ATP, 10 mM MgCl2, and 1 mM DTT was added to the gel and incubated for 30 min at 37°C. After incubation, the fluorescence of AMC due to hydrolysis of Suc-LLVY-AMC (excitation 345 nm, emission = 445 nm) was visualized using a LAS 4000 (GE Healthcare) (settings: DAPI mode, for standard DNA staining).

[0089] Growth analysis of mice with reduced proteasome function Growth of wild-type (WT) and proteasome mutant mice was monitored by measuring their body weight immediately after birth or weekly from 1 to 12 weeks after birth. Tissues were also collected from 4-week-old mice and the weights of each tissue were measured.

[0090] Histological analysis Tissues from 10-week-old WT and proteasome mutant mice were collected, immersed in a paraformaldehyde (PFA) solution (4% in 0.1 M PBS), and fixed at 4°C for several days. After fixation, the tissues were washed with 0.1 M PBS and dehydrated using 70% Drysol, 80% Drysol, 90% Drysol, 95% Drysol, and 100% Drysol series (Kanto Chemical) for 30 minutes to 1 hour each. After dehydration, degreasing with xylene (MERCK) was performed three times for 1 hour each. The degreased samples were infiltrated with paraffin (Fuji Film Wako) to prepare paraffin blocks. The obtained paraffin blocks were sliced ​​to 5 μm using a microtome (Leica Biosystems RM2245), attached to anti-peeling coated slide glass (Matsunami Glass), and dried overnight on a hot plate at 37°C. The dried samples were stored at 4°C. Paraffin sections were deparaffinized using xylene, then rehydrated using 100%, 90%, 70%, and 50% Drysol N series (Kanto Chemical) and purified water. After rehydration, they were stained with Mayer's hematoxylin (Fujifilm Wako) and eosin (Sakura Finetech), dehydrated and cleared using 100% Drysol N and xylene, and then mounted with Mount Quick (Daido Sangyo).

[0091] [result] Establishment of mice with reduced proteasome function We injected gRNA and Cas9 protein targeting the last exon (Exon11) of the Psmd12 gene into mouse fertilized eggs and performed mutation introduction using the CRISPR / Cas9 method, and obtained several lines of Psmd12 mutant mice with indel mutations (Figure 2A). We performed genome sequencing on three of the lines (clones #17, #53, and #36) that were successfully established, and found that clone #17 had a two-base deletion at c.1312-13 (CT), clone #53 had a one-base insertion at c.1310 (T), and clone #36 had a one-base deletion at c.1309 (T) in the Psmd12 gene (Figure 2B). In this way, we succeeded in generating three lines of heterozygous Psmd12 mutant mice with different mutation sites (strain names: #17:p.Leu438Gly*, #53:p.Ser437Phefs*3, #36:p.Ser437Leufs*9). Hereafter, #17 heterozygous mutant mice will be referred to as "#17 mice", #53 heterozygous mutant mice as "#53 mice", and #36 heterozygous mutant mice as "#36 mice". When proteasome heterozygous mutant mice were crossed with each other, homozygous mice could not be obtained from the two strains, #17 and #53. This suggests that homozygous mutant mice from #17 and #53 are embryonic lethal. On the other hand, homozygous mutant mice were obtained from #36 mice, which have the smallest degree of PSMD12 C-terminal deletion. These results suggest that the degree of PSMD12 C-terminal deletion affects proteasome function differently.

[0092] Examination of proteasome activity To determine whether the introduction of Psmd12 heterozygous mutations actually affects proteasome activity, we analyzed proteasome activity by in-gel peptidase assay using mouse embryonic fibroblasts (MEFs) derived from WT and Psmd12 mutant mice. As a result, it was revealed that 26S proteasome activity, especially the activity of the 30S proteasome with RP associated with both ends of the CP, was significantly attenuated in MEFs derived from #17 and #53 mice (Fig. 3A). Furthermore, when proteasome activity was measured using extracts from the liver and brain of 10-week-old WT and #17 mice by the same method as above, it was revealed that the activity of the 26S proteasome in the brain and liver of #17 mice was approximately 30% lower than that of WT mice, and approximately 20% lower than that of WT mice (Fig. 3). These results demonstrate that PSMD12 heterozygous mutations reduce proteasome function.

[0093] Effects of Psmd12 mutation on growth To examine the effect of Psmd12 mutation on growth, body weight was measured from 1 week to 12 weeks after birth. As a result, it was revealed that the growth of both males and females of #17 and #53 mice was delayed compared to WT mice (Figure 4A). In particular, #17 mice, which have the largest degree of C-terminal deletion of PSMD12, were particularly small among the three strains, and major organs such as the liver, kidneys, and testes were also small (Figure 4B). On the other hand, it was confirmed that #30 homozygous mutant mice tended to have growth retardation and movement disorders compared to WT mice. From the above results, it was revealed that the proteasome mutant mice generated in this example caused growth disorders.

[0094] Histological analysis of proteasome mutant mice To analyze in detail the effects of proteasome dysfunction on each tissue, we performed histological analysis. Paraffin sections were prepared from brain tissues of 10-week-old WT and #17 mice, stained with hematoxylin-eosin (HE), and examined under a microscope for morphology. As a result, no obvious abnormalities were observed in the cerebral cortex or hippocampus, but a significant loss of cerebellar Purkinje cells was confirmed in #17 mice (Figure 5). This suggests that proteasome dysfunction causes cerebellar dysfunction.

[0095] [Consideration] Since proteasomes exist in all cells and are essential for the survival of an individual, conventional analysis methods using conditional knockout mice have been unable to answer essential questions such as "Does the requirement for proteasomes differ depending on the tissue? And when and where is proteasome activity required?" In this example, we attempted to generate mice with systemic attenuation of proteasome function, and succeeded in establishing three strains of Psmd12 mutant mice (Psmd12 heterozygous mutant mice) with mutations in the Psmd12 gene, one of the subunits constituting the 19S complex. These mutant mice each had a different degree of mutation, and in particular, the #17 mouse, which had the largest deletion of the C-terminus of PSMD12, showed a remarkable phenotype. Thus, it was suggested that the effect on proteasome function differs depending on the degree of PSMD12 mutation. In addition, the results of chemical and histological analysis of the mice with reduced proteasome function produced in this example suggested that the effects of reduced proteasome function on individuals are not uniform, and that proteasome requirements differ depending on the tissue and location.

[0096] The phenotype of the systemically proteasome-deficient mice produced in this example corresponds well to the multifaceted symptoms seen in patients with PSMD12-mutated developmental disorders. Therefore, the systemically proteasome-deficient mice produced in this study are considered to be useful as model mice for proteasome-related diseases (proteasomopathy). Furthermore, the systemically proteasome-deficient mice produced in this example are not only useful as model mice for proteasome diseases (proteostasis abnormalities and diseases, symptoms, or pathologies caused by said abnormalities), but are also considered to be excellent animal models that can be used in UPS drug discovery, allowing in vivo evaluation of proteasome regulators for the treatment or prevention of said proteasome diseases. [Sequence List Free Text]

[0097] SEQ ID NO:3: Recombinant DNA SEQ ID NO: 4: Recombinant protein SEQ ID NO: 5: Recombinant DNA SEQ ID NO: 6: Recombinant protein SEQ ID NO: 7: Recombinant DNA SEQ ID NO: 8: Recombinant protein

Claims

1. A transgenic non-human animal in which proteasome function is attenuated.

2. The transgenic non-human animal according to claim 1 , wherein the attenuation of the function is attenuation of systemic proteasome function.

3. 3. The transgenic non-human animal according to claim 1, wherein the proteasome with reduced function has a proteasome activity reduced by 10 to 50%.

4. The transgenic non-human animal according to any one of claims 1 to 3, wherein the proteasome with reduced function has a mutation introduced into PSDM12 protein, which is a subunit of the 26S proteasome.

5. The transgenic non-human animal of claim 4 , wherein the mutation is a substitution, deletion and / or addition of amino acid residues in the C-terminal region of the amino acid sequence of PSDM12 protein.

6. The transgenic non-human animal according to claim 4 or 5, wherein the PSDM12 protein into which the mutation has been introduced is the following protein (a), (b) or (c): (a) a protein comprising the amino acid sequence shown in SEQ ID NO: 4, 6 or 8. (b) A protein comprising an amino acid sequence in which one or more amino acids have been deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4, 6 or 8 and having reduced proteasome function. (c) A protein comprising an amino acid sequence having 80% or more identity to the amino acid sequence shown in SEQ ID NO: 4, 6 or 8 and having attenuated proteasome function.

7. The transgenic non-human animal according to any one of claims 1 to 6, wherein a gene mutation has been introduced so as to express the proteasome with attenuated function.

8. The transgenic non-human animal according to claim 7 , wherein the genetic mutation is a mutation introduced into a gene encoding the PSDM12 protein, a subunit of the 26S proteasome.

9. The transgenic non-human animal according to any one of claims 1 to 8, wherein the non-human animal is a rodent.

10. The transgenic non-human animal of claim 9 , wherein the rodent is a mouse.

11. The transgenic non-human animal according to any one of claims 1 to 10, which is a model animal having a proteostasis disorder.

12. The transgenic non-human animal according to claim 11 , wherein the model animal is a model animal for a disease, symptom or pathological condition caused by a proteostasis disorder.

13. The transgenic non-human animal according to claim 12, wherein the disease, symptom or pathological condition caused by abnormal proteostasis is at least one selected from the group consisting of growth retardation, renal dysfunction, decreased liver function, diaphragmatic hernia and cerebellar abnormality.

14. A method for screening for a therapeutic or preventive agent for a proteostasis disorder, comprising the steps of administering a candidate substance to the transgenic non-human animal according to claim 11, and evaluating the proteostasis disorder of the non-human animal after administration of the candidate substance.

15. A method for screening for therapeutic or preventive agents for diseases, symptoms or pathological conditions caused by abnormal proteostasis, comprising the steps of administering a candidate substance to the transgenic non-human animal described in claim 12, and evaluating the disease, symptoms or pathological conditions caused by abnormal proteostasis in the non-human animal after administration of the candidate substance.

16. The screening method according to claim 15, wherein the disease, symptom or pathology caused by abnormal proteostasis is at least one selected from the group consisting of growth retardation, renal dysfunction, decreased liver function, diaphragmatic hernia and cerebellar abnormality.

17. A pharmaceutical composition for treating or preventing a proteostasis disorder, comprising a therapeutic or prophylactic agent obtained by the screening method according to claim 14.

18. A pharmaceutical composition for treating or preventing a disease, symptom or pathology caused by abnormal proteostasis, comprising a therapeutic or prophylactic agent obtained by the screening method according to claim 15 or 16.

19. A method for treating or preventing a proteostasis disorder, comprising administering the pharmaceutical composition according to claim 17 to a patient having or at risk of having a proteostasis disorder.

20. A method for treating or preventing a disease, symptom or condition caused by abnormal proteostasis, comprising administering the pharmaceutical composition described in claim 18 to a patient suffering from or at risk of suffering from a disease, symptom or condition caused by abnormal proteostasis.

Images