Short-chain nucleic acid composite molecule, droplets composed of aggregated short-chain nucleic acid composite molecules, and methods for collection, transport, arrangement, or sensing of molecules, particles, or cells using the same

Abstract

To provide cost-effective short-chain nucleic acid composite molecules that enable molecular recognition at the micrometer scale and are suitable for control, capture, transport, or arrangement of molecules; droplets composed of aggregated short-chain nucleic acid composite molecules; and methods for collection, transport, arrangement, or sensing of molecules, particles, or cells using the same.SOLUTION: The present invention provides a short-chain nucleic acid composite molecule comprising two or more composite short chains, each comprising nucleic acids with different sequences, where at least one of the composite short chains comprises a stem site composed of the nucleic acid and a molecular recognition site, and the molecular recognition site has a structure capable of specifically binding to a specific molecule. Also provided are droplets composed of aggregated short-chain nucleic acid composite molecules; and methods for collection, transport, arrangement, or sensing of molecules, particles, or cells using the same.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to a short-chain nucleic acid complex molecule capable of selectively controlling the molecular structure and recognition of other molecules, a droplet formed by aggregation of the short-chain nucleic acid complex molecule using the same, and a method for controlling biomolecules using the same, i.e., a method for accumulating, transporting, arranging, sensing, etc. molecules, particles, or cells. [Background technology]

[0002] Nucleic acid molecules transmit genetic information through their base sequences and also have various physical and chemical properties. Taking advantage of these properties of nucleic acid molecules, technology is being developed to use them as molecules that play the role of functional materials. For example, nanometer-sized molecular robots have been constructed using nucleic acid molecule nanotechnology, and it is expected that they will be applied to new bio-nanodevices and micromachines.

[0003] For example, the technology of Patent Document 1 aims to provide an RNA nanomachine capable of controlling RNA structure and function by using an RNA-protein conjugate.

[0004] In Patent Document 2, the present inventors have also disclosed a method for producing a nucleic acid comprising the steps of: (a) preparing a nucleic acid sequence comprising: a first nucleic acid having a first end portion and a second end portion; and (b) preparing a nucleic acid sequence comprising: a first end portion and a second end portion; and a second end portion and a third end portion and a fourth ... m (sticky end) and the melting temperature T m The present invention discloses a short-chain nucleic acid, in which (stem) satisfies a specific relationship, a droplet formed by aggregation of the short-chain nucleic acid, and a method for accumulating, transporting, arranging, or sensing a molecule or particle using the same. This technology aims to provide low-cost short-chain nucleic acids that are micrometer-sized and can be used to control, capture, transport or place biomolecules, droplets formed by agglomerating short-chain nucleic acids, and a method for accumulating, transporting, placing or sensing molecules, particles or cells using the same. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] Republished WO2017 / 10568 [Patent Document 2] Patent Publication No. 2021-97603 Summary of the Invention [Problem to be solved by the invention]

[0006] Meanwhile, in vivo, macrophages have the function of recognizing, binding to, ingesting, and denaturing (eg, decomposing) specific molecules or molecular aggregates (particles), viruses, cells, etc.

[0007] The present inventors focused on the functions of macrophages in vivo. They then considered whether it would be possible to endow the molecules made of short-chain nucleic acids, which they had discovered, with a function to recognize specific molecules, thereby endowing them with some of the functions of macrophages. If it were possible to endow molecules made of short-chain nucleic acids with a function to selectively recognize specific molecules, this would contribute to the design and manufacture of structures having the functions of macrophages. This technology was thought to be useful as a technology for manufacturing so-called macrophage-like molecular robots endowed with selective functions. The technology of Patent Document 1 makes it possible to control the structure of RNA. In addition, the technology of Patent Document 2 makes it possible to control the structure of molecules made of short-chain nucleic acids and store, accumulate, transport, etc. other molecules and particles. By applying a technology for recognizing molecules to these technologies, we found the possibility of applying them to the manufacturing technology of macrophage-like molecular robots, and conducted further research.

[0008] The present invention has been made in consideration of the above-mentioned circumstances, and aims to provide an inexpensive short-chain nucleic acid complex molecule that is capable of recognizing molecules, cells, etc. on a micrometer scale and can be used to control, capture, transport or place molecules, and droplets formed by aggregating short-chain nucleic acid complex molecules, and a method for accumulating, transporting, placing or sensing molecules, particles or cells using the same. [Means for solving the problem]

[0009] In order to solve the above problems, the present invention has the following aspects. [1] A short-chain nucleic acid composite molecule having two or more composite short chains each containing a nucleic acid with a different sequence, At least one of the composite short chains comprises a stem portion made of the nucleic acid and a molecular recognition portion; At least one of the composite short strands comprises a stem portion made of the nucleic acid and a sticky end portion made of a nucleic acid; At least one of the composite short strands has a sequence in which at least a portion of the stem portion is complementary to at least a portion of the stem portion of another of the composite short strands; The molecular recognition site is a short-stranded nucleic acid complex molecule having a structure capable of specifically binding to a particular molecule. [2] The short-chain nucleic acid complex molecule according to [1], wherein the melting temperature Tm (sticky end) of the sticky end portion and the melting temperature Tm (stem) of the stem portion satisfy the following relationship (1): 0 < Tm(sticky end) < Tm(stem) < 100 [unit: °C] (1) [3] The short-chain nucleic acid complex molecule according to [1] or [2], wherein the molecular recognition site is made of a nucleic acid or a polypeptide. [4] The short-chain nucleic acid complex molecule according to any one of [1] to [3], wherein the molecular recognition site is an aptamer nucleic acid molecule or an antibody molecule. [5] The short-chain nucleic acid complex molecule according to any one of [1] to [4], wherein the specific molecule is a nucleic acid or a protein. [6] A short-chain nucleic acid composite molecule described in any one of [1] to [5], wherein the sticky end sites have sequences that enable mutual adhesion. [7] A short-stranded nucleic acid complex molecule according to any one of [1] to [6], wherein the nucleic acids bind to each other at complementary sequences in at least a portion of the stem region, thereby forming three or more binding units in the complex short strand. [8] Having two or more types of the bond units, The short-chain nucleic acid complex molecule according to [7], wherein one of the binding units and the other of the binding units have a sequence such that the sticky end site of the nucleic acid contained in one of the binding units cannot adhere to the sticky end site of the nucleic acid contained in the other of the binding units. [9] A short-chain nucleic acid complex molecule described in any one of [1] to [8], wherein the stem portion is longer than the sticky end portion.

[10] A droplet comprising the short-chain nucleic acid complex molecule according to any one of [1] to [9] and a solvent, the droplet being formed by aggregation of the short-chain nucleic acid complex molecule.

[11] A method for accumulating, transporting, locating or sensing molecules or particles, comprising a step of controlling the structure of droplets formed by aggregation of the short-chain nucleic acid complex molecules of

[10] .

[12] The method for accumulating, transporting, arranging or sensing a molecule or particle according to

[11] , wherein the droplets formed by the aggregation of the short-chain nucleic acid complex molecules are controlled by changing the temperature of the droplets formed by the aggregation of the short-chain nucleic acid complex molecules.

[13] The method for accumulating, transporting, arranging or sensing molecules or particles described in

[11] or

[12] , wherein the droplets formed by the aggregation of the short-chain nucleic acid complex molecules are controlled by adding an enzyme or a nucleic acid molecule to the droplets formed by the aggregation of the short-chain nucleic acid complex molecules.

[14] A method for accumulating, transporting, placing or sensing a molecule or particle described in any one of

[11] to

[13] , wherein the droplets formed by aggregation of the short-chain nucleic acid complex molecules are controlled by cleaving the nucleic acid or dissociating the double-stranded bond of the nucleic acid.

[15] A method for accumulating, transporting, placing or sensing molecules or particles described in any one of

[11] to

[14] , which comprises incorporating molecules or particles into droplets formed by aggregation of the short-chain nucleic acid complex molecules, and collecting, transporting or placing the molecules or particles.

[16] The method for accumulating, transporting, positioning or sensing molecules, particles or cells described in

[15] , wherein the molecules or particles are modified with a compound that has affinity for droplets formed by aggregation of the short-chain nucleic acid complex molecules.

[17] A method for accumulating, transporting, placing or sensing molecules or particles as described in claim

[16] , wherein the compound having affinity for droplets formed by aggregation of the short-chain nucleic acid complex molecules is a nucleic acid molecule.

[18] The method for accumulating, transporting, locating or sensing a molecule or particle described in

[15] , wherein the molecule or particle is a protein molecule, a nucleic acid molecule, or a particle or cell containing these. Effect of the Invention

[0010] According to the present invention, there is provided a short-chain nucleic acid complex molecule that is capable of recognizing molecules on a micrometer scale, can be used for controlling, collecting, transporting or placing molecules, and is inexpensive; a droplet formed by agglomeration of the short-chain nucleic acid complex molecule; and a method for accumulating, transporting, placing or sensing molecules or particles using the same. [Brief description of the drawings]

[0011] [Figure 1] FIG. 2 is a schematic diagram showing a binding unit (S motif) of the short-chain nucleic acid complex molecule of the present embodiment. [Diagram 2] FIG. 1 is a photograph showing the antigen-binding activity of a DNA hydrogel containing the short nucleic acid complex molecule of this example with human PTK7 protein. [Diagram 3] FIG. 1 is a photograph showing the cell binding activity of a DNA hydrogel containing the short-chain nucleic acid composite molecule of this example with CCRF-CEM cells. [Figure 4] FIG. 1 is a photograph showing the cell binding activity of a DNA hydrogel containing a short-chain nucleic acid composite molecule of this comparative example with CCRF-CEM cells. [Diagram 5] FIG. 1 is a photograph showing the cell binding activity of a DNA hydrogel containing the short-chain nucleic acid composite molecule of this example with 3T3 cells. [Figure 6]FIG. 1 is a photograph showing the effect of UV stimulation on a DNA hydrogel containing a short-chain nucleic acid complex molecule of this embodiment. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] Hereinafter, the short-chain nucleic acid complex molecule, the droplet formed by aggregation of the short-chain nucleic acid complex molecule, and the accumulation, transportation, arrangement, or sensing method of molecules, particles, or cells using the same according to the present invention will be described with reference to the following embodiments, although the present invention is not limited to the following embodiments.

[0013] (Short nucleic acid complex molecule) The short-stranded nucleic acid complex molecule of this embodiment is a short-stranded nucleic acid complex molecule comprising two or more composite short strands each containing a nucleic acid with a different sequence, wherein at least one of the composite short strands comprises a stem portion composed of the nucleic acid and a molecular recognition portion, at least one of the composite short strands comprises a stem portion composed of the nucleic acid and a sticky end portion composed of the nucleic acid, at least a portion of the stem portion of at least one of the composite short strands has a sequence complementary to at least a portion of the stem portion of another of the composite short strands, and the molecular recognition portion has a structure capable of specifically binding to a specific molecule.

[0014] That is, the short-stranded nucleic acid composite molecule of this embodiment comprises two or more composite short strands. The composite short strands comprise nucleic acids. The nucleic acids comprise stem portions that allow the nucleic acids to bind to each other with a certain degree of specificity. The composite short strands may also comprise sticky end portions that allow the nucleic acids to bind to each other with a certain degree of non-specificity. The composite short strands may also comprise molecular recognition portions.

[0015] The complex short chains are, for example, (A) A complex short chain having a stem portion made of nucleic acid and a molecular recognition portion. (B) A composite short chain having a stem portion made of nucleic acid and a sticky end portion. (C) A composite short chain having a stem portion made of a nucleic acid, a molecular recognition portion and a sticky end portion. However, the short-stranded nucleic acid composite molecule has at least one composite short strand having a molecular recognition site and at least one composite short strand having a sticky end site.

[0016] (Molecular recognition site) A molecular recognition site is a molecule having a structure capable of specifically binding to a specific molecule. A molecular recognition site broadly refers to a structure capable of specifically recognizing and specifically binding to a specific molecule, and broadly includes, for example, nucleic acids, polypeptides, sugars, fats, other organic compounds, other molecules, or complexes thereof. A specific molecule is also a molecule that can be recognized by a molecular recognition site, and can be selected from the above molecules. The specific molecule may be one type or a limited number of types. The molecular recognition site is preferably a nucleic acid or a polypeptide. Here, the term "polypeptide" includes a polymer of several amino acids to a polymer of many amino acids, so-called proteins.

[0017] In the composite short strand, the molecular recognition site may be bound to either end of the nucleic acid strand or may be bound to the middle of the nucleic acid strand via molecular modification, but is preferably bound to either end of the nucleic acid strand.

[0018] The molecular recognition site is preferably an aptamer nucleic acid molecule or an antibody molecule. An aptamer is a nucleic acid molecule capable of recognizing and binding to a specific protein, and an antibody molecule is a protein molecule capable of recognizing and binding to various molecules that serve as antigens.

[0019] The specific molecule recognized by the molecular recognition moiety is preferably a nucleic acid or a protein.

[0020] The size of the molecular recognition site is preferably a structure that has as small a molecular weight as possible and has high activity in recognizing and binding to a specific molecule, but as a guideline, the upper limit is preferably 1 to 3 times the molecular weight of the nucleic acid contained in the composite short chain. Aptamer nucleic acid molecules are particularly preferred because their length can be made 1 / 10 or less of the total length of the composite short strand, depending on the design of the stem portion.

[0021] (nucleic acid) The nucleic acid contained in the composite short chain may be DNA and RNA or chemically modified DNA and RNA, and may be appropriately combined for each base sequence. For example, the stem portion described below is particularly composed of DNA or chemically modified DNA and RNA, and is more stable than RNA.

[0022] Containing two or more types of nucleic acids with different sequences means, specifically, in this embodiment, that at least a portion of one of the nucleic acids has a sequence that is complementary to at least a portion of the sequence of another of the nucleic acids.

[0023] Furthermore, it is also preferred that the nucleic acids each have a sticky end portion and a stem portion, and that at least a portion of the stem portion of one of the nucleic acids has a sequence complementary to at least a portion of the stem portion of the other of the nucleic acids. The stem portion (the portion that becomes the trunk of the branch described below) is a sequence that allows nucleic acids to form a so-called nucleic acid double bond to form a binding unit described below. The sticky end portion (sticky end) is a sequence that allows binding units to adhere to each other. By further binding two or more types of binding units made of nucleic acids, a so-called mesh-like structure consisting of nucleic acid chains and spaces is formed. When this mesh-like structure is formed in a solvent described below, water molecules enter the spaces, and the structure can take the form of droplets formed by aggregation of short-chain nucleic acids described below, or a hydrogel.

[0024] The stem portion is preferably longer than the sticky end portion. When the stem portion is sufficiently longer than the sticky end portion, it is possible to stably form the binding unit described later. In addition, the stem portion is preferably 8 bases or more. If the length of the stem portion is less than 8 bases, it is not sufficient to form the binding unit described later. Specifically, it may be insufficient for the strength of binding, the recognition of the sequence, and the formation of the droplets or hydrogel described later. On the other hand, there is no upper limit to the length of the stem portion, but the longer it is, the more costly it is to synthesize. As a guideline, if the length is 30 to 40 bases, binding and sequence recognition can be performed sufficiently, and production can be performed at a relatively low cost.

[0025] The sticky end portions have sequences that can be mutually adhesive. Here, adhesion may be a nucleic acid double bond, other chemical bond, or bond by other interactions. In this embodiment, it particularly refers to nucleic acid double bond at least in part between the sticky end portions of the nucleic acid. The sequences that can be mutually bonded may be sequences that are at least partially complementary and can form nucleic acid double bonds, or may be sequences that can be bonded physically or chemically.

[0026] In this embodiment, the short-stranded nucleic acid composite molecule preferably comprises a binding unit to which the composite short strands are bound. The binding unit preferably comprises three or more composite short strands bound to each other by binding the composite short strands to each other at least in a complementary sequence of a part of the stem portion.

[0027] It is also preferred that the number of the composite short chains linked is 4 or more or 6 or more. Linking more than three composite short chains makes it possible to provide a binding unit having a plurality of recognition sites or sticky end sites, and thus allows for various designs of the binding unit structure and molecular recognition function.

[0028] Here, among the states where three or more nucleic acids are bonded, a state where six nucleic acids are bonded will be described with reference to FIG. 1. The bond unit 100 of this embodiment includes composite short chains V1 to V6, each of which is V-shaped when bonded, as shown in FIG. 1. A part of the composite short chain V1 and a part of the composite short chain V2, a part of the composite short chain V2 and a part of the composite short chain V3, a part of the composite short chain V3 and a part of the composite short chain V4, a part of the composite short chain V4 and a part of the composite short chain V5, a part of the composite short chain V5 and a part of the composite short chain V6, and a part of the composite short chain V6 and a part of the composite short chain V1 each have complementary nucleic acid sequences and are stem sites that can be bonded to each other. The complementary sequences are bonded to each other, and each sequence has a double-stranded nucleic acid structure, so that the composite short chains V1 to V6 form a bond unit (S motif, 6-branch structure) in which six composite short chains are bonded, as shown in FIG. 1.

[0029] In the example shown in the figure, each of the composite short chains V1 to V6 has a sticky end site with the same sequence on the 5'-end side. In the example shown in the figure, the sticky end site is composed of 8 bases, and the 4 bases from the 5'-end side and the 4 bases from the 3'-end side have complementary sequences, so that a part or the whole of this sequence is likely to stick to each other.

[0030] In the example shown in the figure, the composite short chains V3 and V6 each have a molecular recognition site at the 5' end that can recognize the same molecule. In the example shown in the figure, the molecular recognition site is an aptamer nucleic acid molecule. Depending on the design of each stem region, the V3 and V6 aptamer nucleic acid molecules can be arranged such that they are at both ends of the S motif. In the composite short chains V3 and V6, a nucleic acid sequence NS that is difficult or cannot adhere to the sticky end is provided between the stem and the molecular recognition site. In other words, in V3, it is provided so that when the stem sites of V2 and V3 are bound, it physically inhibits the binding of the sticky end site of V2 to other sequences, or makes it difficult for the molecular recognition site of V3 to bind to the sticky end site of V2. The same is also provided for the sticky end site of V5 in V6.

[0031] The short-chain nucleic acid of this embodiment may have a binding unit in which more than six nucleic acids are bound. For example, 3 to 8 short-chain nucleic acids (3 to 8 branched structure) may be bound. Furthermore, binding units having different numbers of bound nucleic acids may be mixed and used.

[0032] The short-chain nucleic acid of this embodiment has sequences in which the sticky end portion and the stem portion satisfy the following conditions: m (sticky end), the melting temperature of the stem part T m (stem) must satisfy the following relationship (1). 0 < T m (sticky end) < T m (stem) < 100 [unit: °C] (1)

[0033] Here, the melting temperature T m (sticky end), the melting temperature of the stem part T m (stem) can be calculated as follows:

number

number

[0034] The complex short-chain nucleic acid of this embodiment can be arbitrarily selected from sequences that satisfy the above formula (1). By satisfying the above formula (1), the melting temperature of the sticky end portion is lower than the melting temperature of the stem portion. Therefore, by adjusting the temperature below the boiling point of water (100°C) and even below the melting temperature of the stem portion, it is possible to adjust the state from a state in which the sticky end portions are completely dissociated from each other while the stem portions remain bonded (while maintaining the bond units described below) to a state in which they are partially bonded or almost completely bonded. Therefore, the state of the solution containing the bond units of the complex short-chain nucleic acid can be controlled to a dispersed phase, a droplet phase, or a gel phase, as described below.

[0035] (Droplets formed by aggregation of short nucleic acid complex molecules) Next, droplets formed by aggregation of short-chain nucleic acid complex molecules will be described. The droplets formed by aggregation of the short-chain nucleic acid complex molecules of this embodiment contain short-chain nucleic acid complex molecules and a solvent. The term "agglomerated short-chain nucleic acid complex molecules" refers to structures contained in the short-chain nucleic acid complex molecules, such as complex short chains or binding units, which are mutually bonded, as well as cases where the molecules are gathered together by intermolecular forces, etc.

[0036] The solvent is preferably water. The droplets of this embodiment are formed by the transition of the short-chain nucleic acid complex molecules from a state dissolved in water to various phases. As long as the solvent is mainly water (e.g., 90% by mass or more), it may contain other components. For example, it may contain a pH adjuster that increases or decreases the solubility of the nucleic acid.

[0037] A solution containing a short-chain nucleic acid complex molecule and a solvent, in this embodiment, an aqueous solution in which the short-chain nucleic acid complex molecule is dissolved in water, exceeds the liquid critical temperature in the dispersed phase, and at a temperature below the Tm (Stem) of the nucleic acid, the above-mentioned binding units are separated into almost individual binding units and are in a dispersed state in which they are uniformly dispersed in the solution. Therefore, there is only one liquid phase, which is the aqueous solution of the binding units. The liquid critical temperature is higher than the Tm (Sticky End) of the nucleic acid and lower than the Tm (Stem) of the nucleic acid.

[0038] On the other hand, at temperatures below the liquid critical temperature and above the gel critical temperature, some of the binding units are mutually bonded. In the liquid droplet phase at this temperature, multiple binding units are bonded or associated at the sticky end sites. In this state, molecular assemblies containing water molecules in the gaps between the nucleic acid molecules form droplets (droplets) consisting of the aggregation of short-chain nucleic acids. The solution has two phase-separated phases: a phase that is mainly a solution with a low concentration of nucleic acid molecules, and a phase where the nucleic acid molecules self-assemble into microstructures (droplets) with fluidity. The gel critical temperature is lower than the liquid critical temperature and the Tm (Stem) of the nucleic acid.

[0039] Inside each droplet, the bond units combine with each other to form a large mesh, with water molecules filling the mesh. The size of the droplets in this embodiment can be mainly micrometer size. The micrometer size is in the range of about 0.1 to 10000 μm, and is mainly expressed in units of μm, that is, 1 to 1000 μm. In particular, droplets of up to several tens of μm (about 1 to 100 μm) are suitable for controlling particles or molecules, which will be described later.

[0040] When the temperature is further lowered, the droplets formed by the aggregation of short-chain nucleic acid complex molecules will aggregate with each other, and the binding units of many more short-chain nucleic acid complex molecules will bind to each other to form larger droplets. However, at temperatures between 0°C and 100°C, the droplets and gel particles can move freely within the solution, and the aqueous solution as a whole remains in a fluid state.

[0041] Next, at temperatures below the gel critical temperature, even more bond units are bonded than in the droplet phase. In the gel phase at this temperature, many bond units are bonded to form even larger droplets. Many of the droplets cannot move within the solution, and the gel state as a whole does not flow. In particular, this gel consisting of nucleic acid and water is also called a hydrogel in this embodiment. The solution has two phases that are separated into a phase that is mainly a solution phase with a low concentration of nucleic acid molecules and a phase that is self-assembled into a microstructure (hydrogel) that has almost no fluidity.

[0042] In this way, the solution of the short-chain nucleic acid complex molecule and solvent of this embodiment can transition between a dispersed phase in a solution state, a droplet phase that is liquid and capable of flowing but contains droplets of a certain size, and a gel phase that does not flow, depending on the temperature.

[0043] (Methods for accumulating, transporting, locating, or sensing molecules, particles, or cells) Next, a method for accumulating, transporting, arranging, or sensing molecules, particles, or cells using the short-chain nucleic acid-composite molecule and droplets of this embodiment will be described. This method includes a step of controlling the structure of droplets formed by aggregation of the short-chain nucleic acid-composite molecule of this embodiment.

[0044] The step of controlling the structure of droplets formed by aggregation of short-chain nucleic acid complex molecules can be carried out, for example, by changing the temperature of the droplets. By changing the temperature of the droplets, the droplets change the structure of the binding units, and change into a dispersed phase, a droplet phase, and a gel phase. The short-chain nucleic acid complex molecules of this embodiment and droplets formed by aggregation of short-chain nucleic acid complex molecules can undergo these changes reversibly and repeatedly by changing the temperature. In addition, the size of the droplets can be controlled by temperature within the micrometer size range. Therefore, the short-chain nucleic acid complex molecules of this embodiment and droplets formed by aggregation of short-chain nucleic acid complex molecules can be used as functional materials whose structure can be controlled at the micrometer size.

[0045] The step of controlling the structure of droplets formed by aggregation of short-chain nucleic acid complex molecules can also be carried out, for example, by cleaving the nucleic acid. By cleaving the nucleic acid, the binding units are decomposed or the bonds between the binding units are decomposed, so that the droplets can be decomposed or made smaller. The nucleic acid can be cleaved by adding an enzyme, which will be described later. In addition, the step of controlling the structure of droplets formed by aggregation of short-chain nucleic acid complex molecules can also be carried out, for example, by dissociating the double-stranded bonds of the nucleic acid. By dissociating the double-stranded bonds of the nucleic acid, the binding units are decomposed, or the bonds between the binding units are decomposed, so that the droplets can be disassembled or made smaller. The step of dissociating the double-stranded bonds of the nucleic acid can be carried out by the above-mentioned temperature change or other changes in the association conditions of the nucleic acid, the addition of enzymes described below, the addition of other compounds such as other nucleic acids, and the like.

[0046] The step of controlling the structure of droplets formed by the aggregation of short-chain nucleic acid complex molecules can also be carried out, for example, by adding an enzyme to the droplet. Here, the enzyme includes protein enzymes and RNA enzymes (ribozymes). For example, an enzyme that catalyzes an interaction with a nucleic acid sequence, in particular a restriction enzyme that cleaves a specific nucleic acid sequence, can be used. The nucleic acid can be cleaved by the restriction enzyme, and the droplet can be controlled as described above.

[0047] For example, if a part of the nucleic acid structure is RNA, the RNA can be cut by RNAse enzyme, which can cut short nucleic acids and disperse the droplets. In other words, the droplet structure can be controlled by the position and amount of RNA contained in the nucleic acid, the addition conditions related to the activity of the RNAse enzyme, etc.

[0048] The step of controlling the structure of droplets formed by aggregation of short-chain nucleic acid complex molecules can also be carried out, for example, by adding a nucleic acid molecule to the droplet. Here, the nucleic acid molecule includes a sequence other than the above-mentioned enzyme. For example, a nucleic acid molecule can be used that can inhibit or separate the binding of nucleic acids in a binding unit, or inhibit or separate the mutual binding of binding units by competing with or substituting a nucleic acid sequence. For example, a nucleic acid having a sequence that inhibits or separates the binding of a stem portion or a sequence that inhibits or separates the binding of a sticky end portion can be used as such a molecule.

[0049] (Inclusion of molecules, particles or cells) In this embodiment, molecules, particles or cells are contained in droplets formed by aggregation of short-stranded nucleic acid complex molecules, and the droplets can be controlled to capture, transport, position or sense the molecules, particles or cells. Here, a molecule is a single molecule, and a particle is an aggregate of molecules, with no lower limit to size, and the upper limit is mainly up to the micrometer size described below (approximately 1 μm or more and less than 1 mm). Note that molecules and particles also include viruses. There is no particular upper or lower limit to the size of a cell, but no lower limit, and the upper limit is mainly up to the micrometer size described below.

[0050] In this embodiment, the short-chain nucleic acid composite molecule specifically recognizes a specific molecule that is specifically recognized by the molecular recognition site contained in the composite short chain. As a result, droplets (including fluid droplets and non-fluid / semi-fluid gels) formed by aggregation of the short-chain nucleic acid composite molecule have affinity for the specific molecule, and by controlling contact, the droplets can specifically incorporate the molecule or a particle containing it.

[0051] Here, the molecules, particles, or cells may be of any nature as long as they can be contained in the droplets. Since the droplets of this embodiment are of so-called micrometer size, the molecules, particles, or cells can be appropriately selected from organic or inorganic substances as long as they are also of micrometer size. Examples of organic substances include biomolecules such as proteins, nucleic acids, lipids, and carbohydrates, and examples of inorganic substances include inorganic particles such as metals. In addition, even molecules, particles, or cells with a diameter larger than that of the droplets can be controlled as long as they interfere with the droplets, for example, can be transported by multiple droplets.

[0052] It is also preferred that the molecule, particle or cell is a protein molecule, a nucleic acid molecule, or a particle comprising these.

[0053] It is also preferred that the molecule, particle or cell is modified with a compound having affinity for the droplets formed by the aggregation of the short-chain nucleic acid complex molecules. Having affinity for the droplets means having affinity for the solvent or nucleic acid molecules contained in the droplets, having affinity due to the molecular recognition site, i.e., being easily bound or associated, etc., and molecules having affinity for nucleic acid molecules are preferred because they are easy to design. By modifying the molecules, particles, or cells with a compound that has affinity for the droplets, the molecules, particles, or cells are easily included in the droplets. In addition to increasing the affinity, the affinity can be adjusted to a high or low level, allowing for more detailed control of the molecules, particles, or cells by controlling the droplets. For example, as described below, by increasing the affinity for a specific nucleic acid molecule and decreasing the affinity for another nucleic acid molecule, the molecules, particles, or cells can be controlled together with the droplets containing the specific nucleic acid molecule.

[0054] The compound having affinity for droplets formed by aggregation of short-chain nucleic acid complex molecules is preferably a protein or a nucleic acid. When the compound is a protein or a nucleic acid, the affinity for the nucleic acid molecule contained in the droplet can be adjusted by designing the nucleic acid sequence or selecting the molecular recognition site.

[0055] In addition, when the compound is a nucleic acid, it is also preferable that the compound has a structure capable of adhering to the sticky end site. For example, if the nucleic acid has the same sequence as the sticky end site, it can adhere to the sticky end site of the short-chain nucleic acid, so that it easily adheres to the conjugate and has high affinity.

[0056] The means for modifying the molecule, particle, or cell with a compound having affinity for the droplet can be a conventionally known method. For example, when the molecule or particle is a protein molecule or a particle composed of protein molecules and the compound to be modified is a nucleic acid, a conventional means for modifying a nucleic acid to a protein or amino acid can be used.

[0057] In this embodiment, a modified molecule, particle, or cell is modified with a compound that has affinity for the droplet, and the modified molecule is added to the droplet to form an inclusion body in which the inclusion target is included in the droplet. By using a process of controlling the structure of the droplet formed by the aggregation of the short-chain nucleic acid complex molecule described above, the inclusion body can be subjected to accumulation, transportation, arrangement, sensing, etc. of the molecule, particle, or cell. For example, the accumulation of the molecule, particle, or cell can be performed by including the molecule, particle, or cell in the droplet.

[0058] Furthermore, the structure of the droplets can be controlled by the above means to switch between a flowable state and a gel state that cannot flow, allowing the transport or placement of encapsulation bodies. Furthermore, the structure can be controlled by the above means to switch from a droplet to a dispersed state, so that when the droplets contained in the encapsulation bodies are put into a dispersed state, the molecules, particles, or cells contained in the encapsulation body are released. Therefore, the molecules, particles, or cells can be transported or placed at any position or timing.

[0059] Furthermore, by specifically adjusting the affinity between the molecule, particle, cell, or modified form thereof and the short-chain nucleic acid composite molecule, the molecule, particle, or cell can be distinguished. For example, among the modified forms, only those with high affinity to the short-chain nucleic acid are contained in the droplet, and those with low affinity are not contained in the droplet, so that the molecule, particle, or cell can be distinguished by the affinity of the modified form, and can be used for sensing.

[0060] (Effects of this embodiment) According to the short-chain nucleic acid complex molecule, the droplets formed by agglomeration of the short-chain nucleic acid complex molecule, and the accumulation, transport, arrangement or sensing method of molecules, particles or cells using the same, a highly functional material can be obtained that can recognize specific molecules and can control the structure of the micrometer size such as the droplets or a larger size such as a gel by easy means such as temperature change or addition of a compound. This can be used for the rigid control, collection, transport or arrangement of biomolecules such as the specific molecules. Since the compounds used are mainly nucleic acids, the design is easy and the cost of synthesis is low. Since biomolecules such as proteins and nucleic acids can be suitably controlled as molecules, particles or cells, and further, specific molecules can be recognized, it is suitable for application to the control, collection, transport and arrangement of biomolecules in the medical field, for example, in drug delivery systems. Since molecules and particles can be highly selectively controlled, it is also suitable for sensing and sorting.

[0061] In addition, the structure of droplets or gels formed by aggregation of short-chain nucleic acid complex molecules that recognize and incorporate specific molecules corresponds to a part of the function of a part of a cell or organelle to incorporate and digest molecules. Therefore, the technology of this embodiment may be applicable to reproduce the functions of cells and organelles and to artificially reproduce them, for example, when developing macrophage-like molecular robots. EXAMPLES

[0062] Examples will be given below, but the present invention is not limited to the Examples.

[0063] (Short nucleic acid complex molecule) As short-chain nucleic acid complex molecules, six types of V-shaped complex short chains corresponding to V1 to V6, each having an 8-base stem portion and a sequence having a molecular recognition portion or a sticky end portion, were designed so that they could form a binding unit with a 6-branch structure by the mutually complementary stem portions as shown in Figure 1. That is, a portion of the composite short chain V1 and a portion of the composite short chain V2, a portion of the composite short chain V2 and a portion of the composite short chain V3, a portion of the composite short chain V3 and a portion of the composite short chain V4, a portion of the composite short chain V4 and a portion of the composite short chain V5, a portion of the composite short chain V5 and a portion of the composite short chain V6, and a portion of the composite short chain V6 and a portion of the composite short chain V1 each have complementary nucleic acid sequences and were designed to bind to each other depending on the temperature conditions to form binding units of the S motif (6-branched structure).

[0064] Specifically, the short nucleic acid composite molecules of Examples 1 to 3 and Comparative Example 1 were prepared using the composite short chains having the sequences shown in SEQ ID NOs: 1 to 6 in the combinations shown in the table below.

[0065] SEQ ID NO: 1 (Six-1_8_Azo): GxCTCGAGCGCTGGACTAACGGAACGGTTAGTCAGGTATGCCAGCAC SEQ ID NO: 2 (Six-2_0): CTCAGAGAGGTGACAGCATTCCGTTCCGTTAGTCCAGC Sequence number 3 (Six-3_8_Apt_Azo-1x7-8): GxCTCGAGCCCATGGTCCCAAGTGATGTTTGCTGTCACCTCTCTGAGTTTTTTTTATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA SEQ ID NO: 4 (Six-4_8_Azo): GxCTCGAGCCGGCGCTGTAAATTTGCGTTCATCACTTGGGACCATGG SEQ ID NO: 5 (Six-5_8): GCTCGAGCCAGACGTCACTCTCCAACTTCGCAAATTTACAGCGCCG Sequence number 6 (Six-6_8_Apt_Azo-1x7-8): GxCTCGAGCGTGCTGGCATACCTGACTTTGTTGGAGAGTGACGTCTGTTTTTTTTTATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA

[0066] Each complementary stem portion was added to a test tube at a concentration of 5 μM together with a buffer solution (20 mM Tris-HCl, 350 mM NaCl, pH 8.0). The Tm (sticky end) and Tm (stem) of the nucleic acid portion of this complex short chain are as follows: 0°C < 9.3 °C (Tm(sticky end)) < 66°C (Tm(stem)) < 100 °C We had a relationship like that.

[0067] As the nucleic acid complex molecules, the following Examples 1 to 4 were prepared. Example 1: Nucleic acid composite molecule with azobenzene modification and aptamer nucleic acid molecule. Four of the composite short chains have azobenzene modification and two have aptamer nucleic acid molecules. The composition of the DNA hydrogel is shown in Table 1. Example 2: Nucleic acid complex molecules with azobenzene modification. Four of the short complex chains have azobenzene modification. The composition of the DNA hydrogel is shown in Table 2. Example 3: Nucleic acid complex molecule with aptamer nucleic acid molecule. Two of the complex short strands have aptamer nucleic acid molecules. The composition of the DNA hydrogel is shown in Table 3. Comparative Example 1: Unmodified nucleic acid complex molecule. The composition of the DNA hydrogel is shown in Table 4. The aptamer (molecular recognition site) is a nucleic acid sequence of PTK7 aptamer that recognizes the PTK7 protein (SEQ ID NO: 7: Sgc8, 5'-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3' Cited paper: Shangguan, D. et al. Aptamers evolved from live cells as effective molecular probes for The results are shown in Table 1. Cancer study. Proc. Natl. Acad. Sci. USA 103, 11838-11843 (2006). In addition, for fluorescent modifications of DNA hydrogels, Six-2_0_Cy3 (sequence number 8), in which a fluorescent molecule [Cy3] was added to the 5' side of Six-2_0_Cy3, and Six-5_0_Alexa405 (sequence number 9), in which a fluorescent molecule [Alexa405] was added to the 5' side of Six-5_0, were also used.

[0068] SEQ ID NO:8 (Six-2_0_Cy3): [Cy3]- CTCAGAGAGGTGACAGCATTCCGTTCCGTTAGTCCAGC SEQ ID NO: 9 (Six-5_0_Alexa405)]: [Alexa405]-CAGACGTCACTCTCCAACTTCGCAAATTTACAGCGCCG

[0069] [Table 1]

[0070] [Table 2]

[0071] [Table 3]

[0072] [Table 4]

[0073] In the table, Six-1 to Six-6 are complex short chains that compose the S motif (6-branch structure), and correspond to V1 to V6 in Figure 1. Cy3 and Alexa405 are labels for dyeing, Apt is an aptamer nucleic acid molecule, and azо-1×7-8 indicates modification with azobenzene.

[0074] (Cell binding activity) (Test Example 1) The target molecule of the aptamer Sgc8 is the human PTK7 protein (antigen). In this experiment, we analyzed the binding ability of the DNA hydrogel containing the aptamer Sgc8 to the target molecule PTK7. As a background key point, A. Human PTK7 protein is biotinylated. B. Biotin molecules have been shown to have strong binding ability to streptavidin (SA). C. Streptavidin (SA) is labeled with fluorescent Dylight549. Here, when the DNA hydrogel containing the aptamer Sgc8 binds to the target PTK7 molecule, it can be detected that the DNA hydrogel's own fluorescent Cy5 (shown in magenta, dark gray in the figure) comes into contact with or overlaps with the fluorescent Dylight549 (shown in green, light gray in the figure) of streptavidin (SA).

[0075] CCRF-CEM cells are cultured in a plastic flask-shaped container, Nunc(TM) EasyFlask(TM) 25cm 2 and cultured at 1.0 × 10 6 The cells were collected by centrifugation at 800 rpm for 5 minutes and suspended in 4 mL of PBS. 1 μL of each of the DNA hydrogels of Example 3 having the aptamer and Comparative Example 1 having no aptamer was incubated with 10 μL of the CCRF-CEM cell suspension at 37° C. 5 μL of the incubated cell-DNA hydrogel suspension was taken and suspended in 20 μL of PBS.

[0076] To investigate the antigen affinity binding ability of the DNA hydrogel with the aptamer Sgc8, 5 μM short DNA was annealed in the same buffer to synthesize the DNA hydrogel, which was then stained with fluorescent Cy5.

[0077] The DNA hydrogel with the aptamer Sgc8 was incubated for 1 hour at room temperature with biotinylated human PTK7 protein and Dylight549-labeled SA (streptavidin) at the defined concentrations listed in Table 5. The results were confirmed by a fluorescence microscope (FV1000, Olympus).

[0078] [Table 5]

[0079] Figure 2 shows the antigen binding activity of the DNA hydrogel containing the short nucleic acid complex molecule with the human PTK7 protein, as photographs of the state after the incubation, observed under a microscope. (a) shows staining with fluorescent Cy5 (dark gray in the figure), (b) shows staining with fluorescent Dylight549 (light gray in the figure), and (c) shows the merge of both stainings. The scale bar is 10 μm. The contact or overlapping of the positions of the DNA hydrogel with the aptamer Sgc8 labeled with fluorescent Cy5 and the fluorescent Dylight549 of streptavidin (SA) indicates that the DNA hydrogel with the aptamer Sgc8 is bound to the target PTK7 molecule. Furthermore, it was confirmed that the fluorescent Dylight549 does not only remain on the surface of the DNA hydrogel, but also penetrates into its interior.

[0080] (Test Example 2) CCRF-CEM cells are cultured in a plastic flask-shaped container, Nunc(TM) EasyFlask(TM) 25cm 2 and cultured at 1.1 × 10 6 The cells were collected by centrifugation at 800 rpm for 5 minutes and suspended in 4 mL of PBS. 5 μL of each of the DNA hydrogels of Example 3 having the aptamer and Comparative Example 1 having no aptamer was incubated with 5 μL of the CCRF-CEM cell suspension in 10 μL of PBS at 37°C. The cell-DNA hydrogel suspension was observed under an IX71 inverted fluorescence microscope (Olympus), and the results are shown in Figure 3.

[0081] 3(a) and (b) are photographs of the DNA hydrogel and CCRF-CEM cells incubated in Example 3. The scale bar in the figure is 20 μm. In the figure, the large, light-colored, amorphous masses are DNA hydrogels (stained magenta with Cy3, shown in solid gray in the figure), and the small, light-colored, hemispherical masses are CCRF-CEM cells (stained green with SA that labels PTK7 protein with Dylight549, shown in light gray in the figure). From these results, it can be seen that the DNA hydrogels including Example 1 and CCRF-CEM cells are in contact or overlap each other, and that the DNA hydrogels and cells are bound to each other.

[0082] 4(a) and (b) are similar photographs of the DNA hydrogel and CCRF-CEM cells incubated in Comparative Example 1. The DNA hydrogel and CCRF-CEM cells, including Comparative Example 1, are not in contact with each other or overlap each other, and the DNA hydrogel and the cells are not bonded to each other.

[0083] These results show that the DNA hydrogel using Example 1, in which the nucleic acid complex molecule has a PTK7 aptamer nucleic acid molecule, binds to CCRF-CEM cells, while the DNA hydrogel using Comparative Example 1, in which the nucleic acid complex molecule does not have a PTK7 aptamer nucleic acid molecule, does not bind to CCRF-CEM cells. PTK7 is a protein present on the cell surface, and it is believed that the PTK7 aptamer nucleic acid molecule binds to cells by recognizing the cell surface.

[0084] (Test Example 3) It is possible that the nucleic acid complex may react with other molecules on the cell surface than PTK7. Therefore, to examine the possibility that the nucleic acid complex reacts with other molecules than PTK7 and binds to cells, we also used 3T3 cells, which are known to not express PTK7. 3T3 cells (NIH3T3, mouse embryonic fibroblasts) were cultured in a 60 mm cell culture dish at a density of 2.7 × 10 5The concentration was adjusted to be 1 / mL. CCRF-CEM cells were 9.8 × 10 5 The number was adjusted to be / piece. These adjusted cells were mixed in equal amounts of 100 μL each to prepare a cell suspension. 40 μL of the Cy3-labeled DNA hydrogel solution of Example 3 was added to the cell suspension, and the mixture was incubated overnight in a cell incubator at 37° C. Then, the mixture was observed under an IX71 inverted fluorescent microscope (Olympus). The results are shown in FIG.

[0085] In Figure 5 (a) and (b), the large, irregular lumps in light color are the DNA hydrogel of Example 3 (stained magenta with Cy3), the small, hemispherical lumps in light color are CCRF-CEM cells (stained green), and the 3T3 cells in dark color are not stained but can be seen in the field of view. The scale bar in the figure is 20 μm. The results in the figure show that the DNA hydrogel including Example 3 and the CCRF-CEM cells are in contact or overlap, indicating that the DNA hydrogel and the cells are bound to each other. On the other hand, the DNA hydrogel and the 3T3 cells are not in contact and do not appear to overlap, suggesting that the 3T3 cells are not being taken up by the DNA hydrogel.

[0086] These results show that the DNA hydrogel using Example 1, in which the nucleic acid complex molecule has a PTK7 aptamer nucleic acid molecule, binds to CCRF-CEM cells in which PTK7 cells are expressed, but does not bind to 3T3 cells in which PTK7 cells are not expressed. Therefore, it is considered that the DNA hydrogel using Example 1, in which the nucleic acid complex molecule has a PTK7 aptamer nucleic acid molecule, has the ability to recognize the specific molecule PTK7, bind to cells that have it, and further incorporate it into the gel.

[0087] (Effect of UV stimulation by photoresponsive azobenzene) (Test Example 4) In addition to the PTK7 aptamer nucleic acid molecule, we introduced a photoresponsive azobenzene into the nucleic acid composite molecule and investigated whether the behavior of the DNA hydrogel could be manipulated by UV stimulation. The nucleic acid complex molecule of Example 1 was prepared, which has a PTK7 aptamer nucleic acid molecule and a complex short chain into which a photoresponsive azobenzene has been introduced. CCRF-CEM cells were prepared and photographed in the same manner as in Test Example 1.

[0088] Figure 6(a) shows, from the left, a merged image of Cy3 staining and CellTracker™ Green staining, an image of a DNA hydrogel stained with Cy3, and an image of CCRF-CEM cells stained with CellTracker™ Green. Figure 6(b) shows the merge diagram observed at various times (0 seconds, 20 seconds, 40 seconds, 60 seconds, 80 seconds, 120 seconds) after irradiating ultraviolet light (UV) on this DNA hydrogel and CCRF-CEM cells using a thermoplate (TPl-110RX, Tokai Hit) under conditions of heating at 37°C for 30 minutes. The behavior of the DNA hydrogel was observed while irradiating ultraviolet light (UV) stained with Alexa Fluor 405. In the figure, the shape of the DNA hydrogel gradually changes, and for example, it can be confirmed that the part indicated by the white circle in the figure is different at 0 seconds and 120 seconds.

[0089] These results show that when this DNA hydrogel was irradiated with ultraviolet light, it deformed in such a way that it enveloped the CCRF-CEM cells due to UV stimulation. In other words, it is believed that the reaction of the nucleic acid complex molecules with the photoresponsive azobenzene caused the DNA hydrogel to become more fluid, and at that time each of the nucleic acid complex molecules moved in a direction that would allow them to come into contact with the CCRF-CEM cells, causing the DNA hydrogel to behave as if it were enveloping the CCRF-CEM cells. These results indicate that the introduction of photoresponsive azobenzene allows the behavior of DNA hydrogels to be manipulated by UV stimulation, and that the behavior of DNA hydrogels may be further controlled artificially by introducing other structures, such as modifications, into the nucleic acid complex molecules. [Industrial Applicability]

[0090] The short-chain nucleic acid complex molecule of the present invention, droplets formed by aggregation of short-chain nucleic acid complex molecules, and methods for accumulating, transporting, placing, or sensing molecules, particles, or cells using the same provide short-chain nucleic acid complex molecules and droplets formed by aggregation of short-chain nucleic acid complex molecules that are capable of recognizing molecules on a micrometer scale and can be used for controlling, capturing, transporting, or placing molecules, and are inexpensive, and a method for accumulating, transporting, placing, or sensing molecules or particles using the same can be obtained.

Claims

1. A short-chain nucleic acid composite molecule having two or more composite short chains each containing a nucleic acid having a different sequence, At least one of the composite short chains comprises a stem portion made of the nucleic acid and a molecular recognition portion; At least one of the composite short strands comprises a stem portion made of the nucleic acid and a sticky end portion made of the nucleic acid; At least one of the composite short strands has a sequence in which at least a portion of the stem portion is complementary to at least a portion of the stem portion of another of the composite short strands; The molecular recognition site is a short-stranded nucleic acid complex molecule having a structure capable of specifically binding to a particular molecule.

2. The melting temperature T m (sticky end) and the melting temperature T m The short-chain nucleic acid complex molecule according to claim 1, wherein (stem) satisfies the following relationship (1): 0 < T m (sticky end) < T m (stem) < 100 [unit: °C] ... (1)

3. The short-chain nucleic acid composite molecule according to claim 1 or 2, wherein the molecular recognition site is made of a nucleic acid or a polypeptide.

4. The short-chain nucleic acid complex molecule according to claim 1 or 2, wherein the molecular recognition site is an aptamer nucleic acid molecule or an antibody molecule.

5. The short-chain nucleic acid complex molecule according to claim 1 , wherein the specific molecule is a nucleic acid or a protein.

6. The short-chain nucleic acid complex molecule according to claim 1 or 2, wherein the sticky end sites have sequences capable of sticking to each other.

7. The short-stranded nucleic acid complex molecule according to claim 1 or 2, wherein the nucleic acids are bound to each other at complementary sequences in at least a portion of the stem region, so that the complex short strand comprises three or more bound binding units.

8. The bond unit has two or more kinds, The short-stranded nucleic acid complex molecule of claim 7, wherein one of the binding units and the other of the binding units have a sequence such that the sticky end site of the nucleic acid contained in one of the binding units cannot adhere to the sticky end site of the nucleic acid contained in the other of the binding units.

9. The short-chain nucleic acid composite molecule according to claim 1 or 2, wherein the stem portion is longer than the sticky end portion.

10. A droplet formed by aggregation of the short-chain nucleic acid-complex molecule, comprising the short-chain nucleic acid-complex molecule according to claim 1 or 2 and a solvent.

11. A method for accumulating, transporting, locating or sensing molecules, particles or cells, comprising a step of controlling the structure of droplets formed by aggregation of the short-chain nucleic acid complex molecule of claim 10.

12. The method for accumulating, transporting, placing or sensing molecules, particles or cells described in claim 11, wherein the droplets formed by the aggregation of the short-chain nucleic acid complex molecules are controlled by changing the temperature of the droplets formed by the aggregation of the short-chain nucleic acid complex molecules.

13. The method for accumulating, transporting, placing or sensing molecules, particles or cells described in claim 11, wherein the droplets formed by the aggregation of the short-chain nucleic acid complex molecules are controlled by adding an enzyme or a nucleic acid molecule to the droplets formed by the aggregation of the short-chain nucleic acid complex molecules.

14. The method for accumulating, transporting, positioning or sensing molecules, particles or cells described in claim 11, wherein the droplets formed by aggregation of the short-chain nucleic acid complex molecules are controlled by cleaving the nucleic acid or dissociating a double-stranded bond of the nucleic acid.

15. The method for accumulating, transporting, placing or sensing molecules, particles or cells described in claim 11, wherein molecules, particles or cells are encapsulated in droplets formed by aggregation of the short-chain nucleic acid complex molecules, and the molecules, particles or cells are collected, transported or placed.

16. The method for accumulating, transporting, placing or sensing molecules, particles or cells described in claim 15, wherein the molecules, particles or cells are modified with a compound that has affinity for droplets formed by aggregation of the short-chain nucleic acid complex molecules.

17. The method for accumulating, transporting, locating or sensing molecules, particles or cells according to claim 16, wherein a nucleic acid molecule is used as the compound having an affinity for the droplets formed by the aggregation of the short-chain nucleic acid complex molecules.

18. The method for accumulating, transporting, locating or sensing a molecule, particle or cell according to claim 15 , wherein the molecule, particle or cell is a protein molecule, a nucleic acid molecule, or a particle or cell containing the same.

Images