Compositions and methods for increasing fetal hemoglobin and treating sickle cell disease

Abstract

To provide: methods of increasing levels of fetal hemoglobin (HbF) in cells; and methods for treating patients suffering from blood cell diseases, including those associated with reduced amounts of functional adult hemoglobin (HbA), such as sickle cell disease and β-thalassemia.SOLUTION: A method for increasing expression of a fetal hemoglobin (HbF) in a eukaryotic cell comprises contacting the cell with an inhibitor of a target protein or target protein complex that serves to regulate HbF expression. Optionally, the target protein is Cullin 3 (CUL3) or Speckle-type POZ protein (SPOP).SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS [1] This application is a joint venture with U.S. Provisional Application No. 62 / 769,700, filed November 20, 2018. This application claims the benefit of and priority to No. 96, the contents of which are incorporated herein by reference in their entirety.

[0002] SEQUENCE LISTING STATEMENT [2] The sequence listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference. The name of the text file containing the sequence listing is FULC_033_01WO_ST25.txt. The text file is 33 KB, was created on November 20, 2019, and has been submitted electronically via EFS-Web.

[0003] Field of Disclosure [3] The present disclosure relates to the detection of fetal hemoglobin (hemoglobin gamma (HBγ)) in erythroid cells. The present disclosure further relates to methods for treating patients suffering from diseases associated with blood cell disorders, such as sickle cell disease (SCD) or beta thalassemia, including those in which elevated expression of HbF protein can compensate for a mutated or defective hemoglobin beta (HBB) gene, a mutated or defective HBB protein, or altered HBB protein levels. [Background technology]

[0004] background [4] Hemoglobin is an important protein involved in the transport of oxygen throughout the body of vertebrates. Hemoglobin is found in red blood cells and consists of two α-subunits and two β-like subunits. The composition of hemoglobin is developmentally regulated and the human genome encodes multiple versions of these proteins, which are expressed during different developmental stages (Blobel et al, Exp Hematol 2015; Stamatoyannopoulos G, Exp Hematol 2005). In general, fetal hemoglobin (HbF) is composed of two subunits of hemoglobin gamma (HBγ) and two subunits of hemoglobin alpha (HBα), whereas adult hemoglobin (HbA) is composed of two subunits of hemoglobin beta (HBβ) and two subunits of HBα. Thus, the β-like subunits (HBγ) utilized during fetal development are switched to hemoglobin beta (HBβ) after birth.

[0005] [5] The developmental regulation of expression of β-like subunits has been the focus of intense research for decades. The five human β-like subunits are all located on chromosome 11, and their genomic locations correspond to their temporal expression patterns. A distal cluster of enhancer elements, called the locus control region (LCR), coordinates the expression pattern at the β-globin locus, where multiple transcription factors, including GATA1, GATA2, KLF1, KLF2, and MYB and TALI, bind to specific locations within the LCR at specific times during development. The five human β-like subunits are epsilon (HBE1; ε), gamma G (HBG2; γ), gamma A (HBG1; γ), delta (HBD; δ), and beta (HBB; β). The HBE1 gene is expressed during embryonic development, the HBG1 and HBG2 genes are expressed during fetal development, and the HBD and HBB genes are expressed in adults. The HBG1 and HBG2 genes encode identical proteins except for a single amino acid change at residue 136 (HBG1=gly; HBG2=ala). Red blood cell disorders such as sickle cell disease (SCD) and β-thalassemia are caused by alterations in the gene for the hemoglobin β (HBβ) subunit. is caused by.

[0006] [6] SCD affects millions of people worldwide and is the most common inherited blood disorder in the United States. SCD is an autosomal recessive genetic disease caused by a single homozygous mutation in both copies of the HBB gene (E6V), which results in a mutant hemoglobin protein called HbS (https: / / ghr.nlm.nih.gov / condition / sickle-cell-disease). Under deoxygenated conditions, the HbS protein The protein polymerizes, which results in abnormal red blood cell morphology that can lead to multiple pathological conditions, including vascular obstruction, pain crises, pulmonary hypertension, organ damage, and stroke.

[0007] [7] Beta thalassemia is caused by a mutation in the HBB gene, which reduces the amount of hemoglobin This leads to decreased production (https: / / ghr.nlm.nih.gov / condition / beta-thalassemia). Mutations in the HBB gene typically result in decreased production of adult beta globin protein, resulting in low levels of HbA, the adult hemoglobin. This results in a shortage of red blood cells and poor oxygen distribution throughout the body. Patients with beta thalassemia may feel weak, fatigued, and are at risk for developing abnormal blood clots. Thousands of infants are born with beta thalassemia each year, and symptoms are typically detected within the first two years of life.

[0008] [8] Upregulation of fetal hemoglobin is a result of the mutation HbS in SCD. Identification of factors that regulate the expression of fetal hemoglobin may be a useful target for the treatment of SCD and beta thalassemia, as they can compensate for the lack of HbA in the protein or beta thalassemia. Because beta-like globin expression is developmentally regulated, with a decrease in the fetal orthologue (γ) occurring shortly after birth and concomitant with an increase in the adult orthologue (β), it has been hypothesized that maintaining expression of the anti-sickling gamma orthologue may be therapeutically beneficial in both children and adults. Hemoglobin gamma (HBγ), the fetal orthologue of HBβ, can reverse disease-associated pathophysiology in these disorders by also forming a complex with the required hemoglobin α subunit (Paikari and Sheehan, Br J Haematol 2018;Lettre and Bauer, Lancet 2016). Expression of fetal hemoglobin protein can reverse the pathophysiology of SCD through inhibition of HbS polymerization and morphologically defective red blood cells. Functionally, upregulation of either the HBG1 or HBG2 genes can compensate for mutated or defective adult HBβ. Based on clinical and preclinical studies, upregulation of hemoglobin gamma (HBγ) has been shown to be associated with a number of therapeutic options, including compounds including palmolidomide and hydroxyurea, as well as the inhibition of EHMT1 / EHMT2 and This is a proposed mechanism for targets including LSD1 (Moutouh-de Parseval et al. J Clin Invest 2008;Letvin et al. NEJM 1984;Renneville et al. Blood 2015;Shi et al. Nature Med 2015). Summary of the Invention [Problem to be solved by the invention]

[0009] [9] Elevated expression of HbF protein indicates a mutated or defective hemoglobin beta (HBβ) Given the severity and lack of effective treatments for blood cell disorders such as sickle cell disease (SCD) and β-thalassemia, including those that can be genetically compensated for, there is a clear need for new methods of treating these disorders. The present disclosure meets this need by providing novel therapeutic agents and methods for increasing HbF for the treatment of these disorders. [Means for solving the problem]

[0010] Summary of the Invention

[10] This disclosure is based, in part, on the determination of fetal hemoglobin (Hb) in erythroid cells. The present disclosure is based on the identification of novel targets for inducing hematopoietic stem cell (HB) expression. The present disclosure further relates to a method for treating a patient suffering from a disease associated with a blood cell disorder, such as sickle cell disease (SCD) or beta thalassemia.

[0011]

[11] In one embodiment, the disclosure provides a method for increasing expression of fetal hemoglobin (HbF) in a cell, comprising contacting the cell with an inhibitor of a target protein or protein complex that functions to regulate HbF expression. In some embodiments, HbF comprises hemoglobin gamma and hemoglobin alpha. In some embodiments, hemoglobin gamma comprises hemoglobin gamma G1 (HBG1) and / or hemoglobin gamma G2 (HBG2). In certain embodiments, the target protein or protein complex regulates HbF expression through a molecular signaling pathway listed in Table 5. In certain embodiments, the molecular signaling pathway is selected from the group consisting of glucagon signaling pathway, carbon metabolism, oxytocin signaling, glycolysis, gluconeogenesis, endocrine resistance, gonadotropin releasing hormone (GnRH) signaling, oocyte meiosis, fatty acid degradation, and inflammatory mediator regulation of transient receptor potential (TRP) channels. In certain embodiments, the target protein is CUL3. In certain embodiments, the target protein is SPOP. In certain embodiments, the target protein is selected from those listed in Table 1, Table 2, Table 3, Table 4, Table 5, Table 6 or Table 7. In certain embodiments, the hit shows enriched expression in whole blood versus other tissues and cell types. In certain embodiments, the target protein (or hit) is expressed in late stage erythroid cells or is listed in Table 7. In some embodiments, the target protein is permanently or transiently associated with a multiprotein complex that regulates HbF expression. In some embodiments, the multiprotein complex is selected from those listed in Table 3 or Table 4, and the target is selected from those listed in Table 3 or Table 4. In certain embodiments, CUL3 is permanently or transiently associated with a multiprotein complex.In certain embodiments, the multiprotein complex is selected from D(4) dopamine receptor (DRD4)-Kelch-like protein 12 (KLH12)-CUL3, ubiquitin E3 ligase, coiled-coil domain-containing protein 22 (CCDC22)-COMM domain-containing protein 8 (COMMD8)-CUL3, or cullin-associated NEDD8 dissociating protein (CAND1)-CUL3-E3 ubiquitin protein ligase RBX1 (RBX). In certain embodiments, the SPOP is permanently or transiently associated with the multiprotein complex. In certain embodiments, the multiprotein complex is a ubiquitin E3 ligase complex. In certain embodiments, the inhibitor targets a nucleotide sequence encoding a target protein or protein complex, thereby inhibiting or preventing expression of the target protein or protein complex. In some embodiments, the nucleotide sequence encoding a target protein or protein complex is DNA or RNA. In certain embodiments, the nucleotide sequence comprises or consists of a nucleic acid encoding CUL3 and optionally encoding the amino acid sequence of SEQ ID NO: 108. In certain embodiments, the nucleotide sequence comprises or consists of a nucleic acid encoding SPOP and optionally encoding the amino acid sequence of SEQ ID NO: 109. In some embodiments, the inhibitor is selected from the group consisting of a small molecule, a nucleic acid, a polypeptide, and a nucleoprotein complex that binds to a target protein or a polynucleotide sequence encoding a target protein, such as a gene encoding a target protein or a rtiRNA. It should be understood that the inhibitor or target protein may inhibit a target protein by directly inhibiting the target protein, e.g., by binding to the target protein, or by inhibiting expression of the target protein, e.g., by binding to a polynucleotide encoding the target protein. In some embodiments, the nucleic acid is selected from DNA, RNA, shRNA, siRNA, microRNA, gRNA, and antisense oligonucleotides. In certain embodiments, the polypeptide is selected from a protein, a peptide, a protein mimetic, a peptidomimetic, an antibody or functional fragment thereof, and an antibody-drug conjugate or functional fragment thereof.In certain embodiments, the nucleoprotein complex comprises: a. a) a first sequence comprising a guide RNA (gRNA) that specifically binds to a target sequence, the target sequence comprising a regulator of HbF expression, and b) a second sequence encoding a CRISPR-Cas protein, the CRISPR-Cas protein comprising a DNA nuclease activity. In certain embodiments, the cell is a blood cell, e.g., a red blood cell. In certain embodiments, the contacting of the cell is performed in vitro, in vivo, ex vivo, or in situ.

[0012]

[12] In a related embodiment, the disclosure provides a pharmaceutical composition for increasing expression of fetal hemoglobin (HbF), comprising an inhibitor of a target protein or protein complex that functions to regulate HbF expression, and diluents, excipients and carriers, formulated for delivery to a patient in need thereof. In certain embodiments, the inhibitor is a small molecule, a nucleic acid, such as DNA, RNA, shRNA, siRNA, microRNA, gRNA or an antisense oligonucleotide, or a polypeptide, such as a protein, peptide, proteomimetic, peptidomimetic, antibody or functional fragment thereof, or antibody-drug conjugate or functional fragment thereof. In some embodiments, the small molecule inhibitor targets CUL3. In some embodiments, the CUL3 small molecule inhibitor is selected from MLN4924, suramin, or DI-591. In some embodiments, the polypeptide specifically binds to a regulator of HbF expression. In certain embodiments, the inhibitor is a ribonucleoprotein (RNP) complex comprising a) a first sequence comprising a guide RNA (gRNA) that specifically binds to a target sequence, the target sequence comprising a regulator of HbF expression, and b) a second sequence encoding a CRISPR-Cas protein, the CRISPR-Cas protein comprising a DNA nuclease activity. In certain embodiments, the gRNA binds to a gene encoding a regulator of HbF expression. In certain embodiments, the target sequence is listed in any of Tables 1, 3-4, or 6-7. In some embodiments, the gRNA comprises any one of the targets or sequences in Table 2 or a fragment thereof or an antisense sequence of the target sequence or a fragment thereof. In some embodiments, the target sequence is CUL3. In some embodiments, the target sequence is SPOP. In some embodiments, the gRNA comprises any one of the sequences disclosed in Table 2. In some embodiments, the gRNA binds to a gene encoding CUL3, and optionally comprises or consists of GAGCATCTCAAACACAACGA (SEQ ID NO: 94), CGAGATCAAGTTGTACGTTA (SEQ ID NO: 95), or TCATCTACGGCAAACTCTAT (SEQ ID NO: 96).In some embodiments, the gRNA binds to a gene encoding SPOP and optionally comprises or consists of TAACTTTAGCTTTTGCCGGG (SEQ ID NO: 91), CGGGCATATAGGTTTGTGCA (SEQ ID NO: 92), or GTTTGCGAGTAAACCCCAAA (SEQ ID NO: 93). In certain embodiments, the first sequence comprising the gRNA comprises a sequence encoding a promoter capable of expressing the gRNA in a eukaryotic cell. In some embodiments, the second sequence comprising the CRISPR-Cas protein comprises a sequence capable of expressing the CRISPR-Cas protein in a eukaryotic cell, e.g., a mammalian cell, e.g., a blood cell, e.g., an erythrocyte. In some embodiments, the composition is delivered via a vector, e.g., a viral vector such as AAV.

[0013]

[13] In another related embodiment, the disclosure provides a method of treating a disease or disorder associated with defective hemoglobin protein activity or expression, comprising providing to a subject in need thereof a composition disclosed herein. In some embodiments, the disease or disorder is a hematological disorder, such as sickle cell disease, beta thalassemia, beta thalassemia intermedia, beta thalassemia major, beta thalassemia minor, and Cooley anemia. In some embodiments, the hemoglobin protein is selected from hemoglobin-alpha and hemoglobin-beta. In certain embodiments, the defective hemoglobin protein activity or expression is a com- pound that is associated with a defective hemoglobin protein activity or expression. The defects result from mutations, substitutions, deletions, insertions, frameshifts, inversions or rearrangements to the nucleotide sequence encoding the hemoglobin protein. [Brief description of the drawings]

[0014] BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1]

[14] Schematic diagram detailing the CRISPR pooled screening sample collection process. Samples were collected after puromycin selection (1), before FAC sorting (2) and after sorting for HbF high cells (3). [Diagram 2]

[15] provides FACS sorting plots from a CRISPR screen with library #1. FACS plots are shown for HUDEP2 cells with control gGFP (dark grey) and CRISPR library #1 (light grey). The left panel plots the levels of HbF (X-axis) and β-actin (Y-axis) for each event, with line "L" indicating the HbF threshold for HbF-high cells. The right panel represents the same data in a one-dimensional plot showing HbF levels (X-axis) and events (Y-axis), with line "C" indicating the HbF threshold for HbF-high cells. Any cells above the HbF threshold were collected in the HbF-high population. [Diagram 3]

[16] provides FACS sorting plots from a CRISPR screen with library #2. FACS plots are shown for HUDEP2 cells with control sgGFP (dark grey) and CRISPR library #2 (light grey). The left panel plots the levels of HbF (X-axis) and β-actin (Y-axis) for each event, with line "L" indicating the HbF threshold for HbF-high cells. The right panel represents the same data in a one-dimensional plot showing HbF levels (X-axis) and events (Y-axis), with line "C" indicating the HbF threshold for HbF-high cells. Any cells above the HbF threshold were collected in the HbF-high population. [Figure 4A]

[17] Details a list of all bioinformatics analyses performed on the CRISPR screening data: genome alignment (left panel), hit quantification (middle panel) and hit prioritization (right panel). [Figure 4B]

[18] A series of plots showing the distribution of guide abundance in different samples across two different screening libraries (library #1, left; library #2, right). Arrows indicate peaks for the number of guides with a given abundance level at input, after selection, and after HbF+ve (HbF high positive selection population). [Figure 4C]

[19] Plot showing distribution of z-score difference across samples for library #1. Squares indicate hits that promote differentiation and triangles indicate hits that hinder differentiation. [Figure 5A]

[20] Heatmap showing all genes with two or more enriched gRNAs in the initial library #1 screening data. [Figure 5B]

[21] A plot detailing the overlap between library #1 and library #2. Triangles correspond to genes that were called hits in both screening libraries. [Figure 5C]

[22] An exemplary graph showing Z-score (y-axis) versus UBE2H locus (x-axis), showing that 4 out of 10 designed guide RNAs have a Z-score greater than 2.5. [Figure 6]

[23] A chart detailing the number of hits for each of the distinct biological complexes shown. Complex membership information was obtained from the CORUM database. [Figure 7A]

[24] Heatmap showing expression z-scores of CRISPR hits enriched in whole blood (32 out of 307 hits show highly enriched expression in whole blood versus other tissues and cell types, data source: GTEx). The 32 hits showing highly enriched expression in whole blood are listed in Table 7. [Figure 7B]

[25] Heatmap showing hits with "late erythroid" expression patterns (data source: DMAP). Hits with "late erythroid" expression patterns include CUL3, SAP130, PRPS1, NAP1L4, GCLC, CUL4A, GCDH, NEK1, HIRA, MST1, SPOP, GOLGA5, AUH, MAST3, CDKN1B, UBR2, MAP4K4, TAF10, HDGF, YWHAE, AMD1, EID1, HIF1AN, CDK8, DCK, FXR2, UQCRC1, TESK2, ADCK2, USP21, CAMK2D, FGFR1, PHC2, UBE2H, BPGM, SIRT2, S1RT3, NFYC, and CPT2. [Figure 7C]

[26] Hierarchical differentiation tree of UBE2H with an exemplary "late erythroid" expression pattern. [Figure 8A]

[27] A series of images showing HbF levels determined by HbF immunocytochemistry (ICC) using CRISPR Cas9-RNP-based loss of function. Cas9-RNP complexes were electroporated into proliferating CD34+ cells. Cells were then differentiated into erythroid lineage for 7 days and HbF levels were quantified using HbF ICC. Percent F cells (top row) and mean HbF intensity (bottom row) were quantified for the negative control, sgBCL11A, sgSPOP, and sgCUL3. [Figure 8B]

[28] is a series of graphs showing HbF levels determined by HbF ICC using shRNA-based loss of function. Percent F cells were quantified for individual shRNA constructs, negative control, shBCL11A, shSPOP, and shCUL3. [Figure 8C]

[28] is a series of graphs showing HbF levels determined by HbF ICC using shRNA-based loss of function. Mean HbF intensity was quantified for individual shRNA constructs, negative control, shBCL11A, shSPOP, and shCUL3. [Figure 8D]

[28] is a series of graphs showing HbF levels determined by HbF ICC using shRNA-based loss of function. Percent F cells were quantified for individual shRNA constructs, negative control, shBCL11A, shSPOP, and shCUL3. [Figure 8E]

[28] is a series of graphs showing HbF levels determined by HbF ICC using shRNA-based loss of function. Mean HbF intensity was quantified for individual shRNA constructs, negative control, shBCL11A, shSPOP, and shCUL3. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] Detailed Description of the Invention

[29] The present invention relates to targets, compositions and methods for increasing fetal hemoglobin (HbF) in erythroid cells, for example, by increasing expression of hemoglobin gamma (HBγ). This can be done through upregulation of hemoglobin gamma mRNA levels (e.g., HBG1 or HBG2) and / or upregulation of fetal hemoglobin protein (HBγ) levels resulting in elevated HbF. The targets, compositions or methods can be used alone or in combination with another agent that upregulates HbF or targets symptoms of SCD or β-thalassemia, including but not limited to vaso-occlusion and anemia.

[0016] Abbreviation

[30] As used in this specification and the appended claims, the singular form “a” or “an” is used interchangeably with “an” or “an” in the following description. ", "an" and "the" include plural references unless the content clearly dictates otherwise.

[0017]

[31] As used herein, the term "and / or" is used in this disclosure as either "and" or "or" unless otherwise indicated.

[0018]

[32] Throughout this specification, unless the context otherwise requires, the word "comprise" or variations such as "comprises" or "including" refer to any element or elements described. It will be understood that "inclusive" implies an integer, or an element or group of integers, but does not exclude any other element, integer, or group of elements or integers.

[0019]

[33] As used in this application, the terms "about" and "approximately" are used as equivalents. Any numbers used in this application, with or without about / approximately, are intended to encompass any normal variations recognized by one of ordinary skill in the relevant art. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% in either direction (greater or less) of the stated reference value, unless otherwise specified or clear from the context (except where such number exceeds 100% of the possible values).

[0020]

[34] "Administration," as used herein, refers to introducing an agent or composition into a subject or contacting an agent or composition with cells and / or tissues.

[0021] Methods and Compositions

[35] In one aspect, the disclosure provides a method for increasing the amount of fetal hemoglobin (HbF) in a cell. In certain embodiments, the method includes increasing the expression of one or more components of HbF in the cell. In certain embodiments, the component of HbF is hemoglobin gamma (HBγ), such as human hemoglobin subunit gamma-1 (HBG1) or human hemoglobin subunit gamma-2 (HBG2). In certain embodiments, the component of fetal hemoglobin is hemoglobin alpha (HBα), such as human hemoglobin subunit alpha-1 (HBA1) or human hemoglobin subunit alpha-2 (HBA2). In certain embodiments, the expression of both HBγ and HBα is increased.

[0022]

[36] In certain embodiments, the fetal hemoglobin comprises human hemoglobin subunit gamma-1 (HBG1), which is set forth in NCBI Reference Sequence: NP_000550.2 and has the protein sequence shown below: [ka]

[0023]

[37] In certain embodiments, the HBG1 protein is encoded by the polynucleotide sequence set forth in NCBI Reference Sequence: NM_000559.2 and shown below. [ka]

[0024]

[38] In certain embodiments, the fetal hemoglobin comprises human hemoglobin subunit gamma-2 (HBG2), which is set forth in NCBI Reference Sequence: NP_000175.1 and has the protein sequence shown below: [ka]

[0025]

[39] In certain embodiments, the HBG2 protein is encoded by a polynucleotide sequence set forth in NCBI Reference Sequence: NM_000184.2, NCBI Reference Sequence: NM_000184.3, or as set forth below. [ka]

[0026]

[40] In certain embodiments, the fetal hemoglobin comprises human hemoglobin subunit alpha-1 (HBA1), which is set forth in NCBI Reference Sequence: NP_000549.1 and has the protein sequence shown below: [ka]

[0027]

[41] In certain embodiments, the HBA1 protein is encoded by a polynucleotide sequence set forth in NCBI Reference Sequence: NM_000558.4, NCBI Reference Sequence: NM_000558.5, or as set forth below. [ka]

[0028]

[42] In certain embodiments, the fetal hemoglobin comprises human hemoglobin subunit alpha-2 (HBA2), which is set forth in NCBI Reference Sequence: NP_000508.1 and has the protein sequence shown below: [ka]

[0029]

[43] In certain embodiments, the HBA2 protein is encoded by a polynucleotide sequence set forth in NCBI Reference Sequence: NM_000517.4, NCBI Reference Sequence: NM_000517.6, or as set forth below. [ka]

[0030]

[44] In certain embodiments, the fetal hemoglobin comprises two HBG1 and / or HBG2 proteins and two HBA1 and / or HBA2 proteins.

[0031]

[45] The methods disclosed herein may be performed in vitro or in vivo.

[0032]

[46] The methods disclosed herein include contacting a cell with an inhibitor of a target gene, mRNA or protein (which may collectively be referred to as a "target") disclosed herein, where inhibition of the target results in an increase in the amount of fetal hemoglobin in the cell, e.g., erythroid or red blood cells. In certain embodiments, inhibition of the target results in an increase in the amount of HBG1 or HBG2 in the cell. In certain embodiments, an effective amount of the inhibitor is used to result in an increase in the level of Hbγ and / or HbF. In certain embodiments, the method includes contacting a tissue, organ or organism, e.g., a mammal, with the inhibitor. In certain embodiments, one or more inhibitors may be used, each targeting the same or different targets.

[0033]

[47] In certain embodiments, the target gene, mRNA or protein is cullin 3 (CUL3). CUL3 is a core component of multiple E3 ubiquitin ligase protein complexes that regulate the ubiquitination of target proteins leading to proteasomal degradation. In some embodiments, the CUL3-E3 ubiquitin ligase complex regulates multiple cellular processes responsible for protein trafficking, stress response, cell cycle regulation, signal transduction, protein quality control, transcription and DNA replication.

[0034]

[48] ​​In one aspect, the disclosure provides a method for increasing the amount of fetal hemoglobin (HbF) in a cell by inhibiting or modulating the expression of CUL3.

[0035]

[49] In certain embodiments, CUL3 comprises the following protein sequence: [ka]

[0036]

[50] In certain embodiments, the target gene, mRNA or protein is a speckle-type POZ protein (SPOP). In certain embodiments, SPOP is associated with multiple E3 ubiquitin ligase complexes.

[0037]

[51] In one aspect, the present disclosure provides a method for increasing the amount of fetal hemoglobin (HbF) in a cell by inhibiting or modulating expression of SPOP.

[0038]

[0023] In certain embodiments, the SPOP comprises the following protein sequence: [ka]

[0039]

[53] The term "inhibitor" can refer to any agent that inhibits the expression or activity of a target gene, mRNA, and / or protein in a cell, tissue, organ, or subject. The expression level or activity of a target mRNA and / or protein in a cell can be decreased through a variety of means, including, but not limited to, decreasing the total amount of the target protein or inhibiting one or more activities of the target protein. In various embodiments, an inhibitor can inhibit the expression of a target gene, target mRNA, or target protein, and / or an inhibitor can inhibit the biological activity of a target protein. In certain embodiments, the biological activity is kinase activity. For example, an inhibitor can competitively bind to the ATP binding site of a kinase and inhibit its kinase activity, or an inhibitor can allosterically block kinase activity. In certain embodiments, an inhibitor causes increased degradation of a target protein. In certain embodiments, an inhibitor inhibits any of the target genes or proteins identified in Table 1, Table 2, Table 6, Table 7, Table 8, or Table 9, or any component or subunit of any of the complexes identified in Table 3 or Table 4, or a pathway identified in Table 5. Methods for determining the expression level or activity of a target gene or polypeptide are known in the art and include, for example, RT-PCR and FACS.

[0040]

[54] In certain embodiments, the inhibitor directly inhibits the expression or activity of the target gene, mRNA or protein, e.g., the inhibitor may directly bind to the target gene, mRNA or protein. In some embodiments, the inhibitor indirectly inhibits the expression or activity of the target gene, mRNA or protein, e.g., the inhibitor may bind to and inhibit a protein that mediates the expression of the target gene, mRNA or protein (such as a transcription factor), or the inhibitor may bind to another protein involved in the activity of the target protein (such as another protein present in a complex with the target protein) and inhibit the expression of that activity.

[0041]

[55] In certain embodiments, the inhibitor inhibits SPOP or a protein complex with which SPOP is permanently or temporarily associated. In certain embodiments, the protein complex is an SPOP-associated E3 ubiquitin ligase complex. In certain embodiments, the complex includes core histone macro-H2A.1 (H2AFY), SPOP, and CUL3; DNA damage binding protein 1 (DDB1), DNA damage binding protein 2 (DDB2), cullin-4A (CUL4A), cullin-4B (CUL4B), and E3 ubiquitin protein ligase RBX1 (RBX); or polycomb complex protein BMI-1 (BMI1), SPOP, and CUL3; SPOP, death domain associated protein 6 (DAXX), and CUL3; core histone macro-H2A.1 (H2AFY), SPOP, and CUL3; or BMI1, SPOP, and CUL3. In certain embodiments, the inhibitor inhibits one or more components of any of these complexes. In some embodiments, the inhibitor inhibits the expression of SPOP, while in other embodiments, the inhibitor inhibits the activity of SPOP.

[0042]

[56] In certain embodiments, the inhibitor inhibits CUL3 or a protein complex with which CUL3 is permanently or transiently associated. In certain embodiments, the protein complex is a CUL3-associated E3 ubiquitin ligase complex. In certain embodiments, the CUL3-associated protein complex is D(4) dopamine receptor (DRD4)-Kelch-like protein 12 (KLH12)-CUL3. In certain embodiments, the CUL3-associated protein complex is a coiled-coil domain-containing protein 22 (CCDC22)-COMM domain-containing protein 8 (COMMD8)-CUL3 complex. In certain embodiments, the CUL3-associated protein complex is a cullin-associated NEDD8 dissociation protein (CAND1)-CUL3-E3 ubiquitin protein ligase RBX1 (RBX1). In some embodiments, the complex is comprised of SPOP, death domain associated protein 6 (DAXX) and CUL3; core histone macro-H2A.1 (H2AFY), SPOP and CUL3; DNA damage binding protein 1 (DDB1), DNA damage binding protein 1 (DDB2), cullin-4A (CUL4A), cullin-4B (CUL4B) and E3 ubiquitin-protein ligase RBX1 (RBX1); polycomb complex protein BMI-1 (BMI1), SPOP and CUL3; COP9 signalosome complex subunit 1 (CSN1), COP9 signalosome complex subunit 2 (CSN2), COP9 signalosome complex subunit 3 (CSN3), COP9 signalosome complex subunit 4 (CSN4), COP9 signalosome complex subunit 5 (CSN5), COP9 signalosome complex subunit 6 (CSN6), COP9 signalosome complex subunit 7 (CSN7), COP9 signalosome complex subunit 8 (CSN8), COP9 signalosome complex subunit 9 (CSN9), COP9 signalosome complex subunit 1 (CSN1), COP9 signalosome complex subunit 1 (CSN1), COP9 signalosome complex subunit 2 (CSN1), COP9 signalosome complex subunit 3 (CSN1), COP9 signalosome complex subunit 1 (CSN1), COP9 signalosome complex subunit 2 (CSN1), COP9 signalosome complex subunit 3 (CSN1), COP9 signalosome complex subunit 4 ...5 (CSN1), COP9 signalosome complex subunit 1 (CSN1), COP9 signalosome complex subunit 2 (CSN1), COP9 signalosome complex subunit 3 (C These include cytoplasmic complex subunit 8 (CSN8), hairy / enhancer of split associated with YRPW motif protein 1 (HRT1), S-phase kinase-related protein 1 (SKP1), S-phase kinase-related protein 2 (SKP2), cullin-1 (CUL1), cullin-2 (CUL2) and cullin-3; CUL3, Kelch-like protein 3 (KLHL3) and serine / threonine-protein kinase WNK4 (WNK4); CUL3, KLHL3 and serine / threonine-protein kinase WNK1 (WNK1); CUL3 and KLHL3. In certain embodiments, the inhibitor inhibits one or more components of any of these complexes. In some embodiments, the inhibitor inhibits expression of CUL3, while in other embodiments, the inhibitor inhibits activity of CUL3.

[0043]

[57] In one embodiment, a method for increasing the amount of fetal hemoglobin in a cell, tissue, organ, or subject includes contacting the cell, tissue, organ, or subject with an agent that results in a decrease in the amount of one or more target genes, mRNA, or proteins in the cell. In certain embodiments, the agent inhibits expression or activity of one or more target genes, mRNA, or polypeptides in the cell or tissue. In certain embodiments, the agent causes increased degradation of one or more target genes, mRNA, or polypeptides. In certain embodiments, the cell or tissue is contacted with an amount of the agent effective to decrease expression or activity of one or more target genes, mRNA, or polypeptides in the cell or tissue. In certain embodiments, the cell or tissue is contacted with an amount of the agent effective to decrease the amount of active target protein in the cell or tissue. In certain embodiments, the cell is a hematopoietic cell, e.g., a red blood cell. In certain embodiments, the cell is a terminally differentiated, e.g., a terminally differentiated red blood cell.

[0044]

[58] In certain embodiments of any of the methods disclosed herein, the cells contain one or more mutations associated with a blood cell disorder, e.g., SCD or β-thalassemia. In certain embodiments of any of the methods disclosed herein, the cells have a reduced amount of functionally active HbA compared to a control cell, e.g., a non-diseased cell. In certain embodiments, the cells are associated with a blood cell disorder, e.g., SCD or β-thalassemia. For example, the cells can be derived or obtained from cells or tissue from a subject diagnosed with a blood cell disorder. In certain embodiments, the method is performed on a subject diagnosed with a blood cell disorder, e.g., SCD or β-thalassemia. The methods disclosed herein can be performed in vitro or in vivo.

[0045]

[59] In a related aspect, the disclosure provides a method for treating or preventing a blood cell disease or disorder associated with reduced amounts of functionally active HbA (or total HbA) in a subject in need thereof. The method includes providing to the subject an agent that inhibits expression or activity of one or more target proteins in the subject or in a particular cell or tissue of the subject, and the treatment is performed on the subject or one or more cells or tissues of the subject, such as hematopoietic cells, e.g., erythrocytes. or a red blood cell, resulting in an increase in the amount of HbF. In certain embodiments, the agent is present in a pharmaceutical composition. In some embodiments, a subject is provided with one or more (e.g., two, three, or more) agents that inhibit the expression or activity of one or more target proteins in the subject or in a particular cell or tissue of the subject. In some embodiments, the two or more agents inhibit the same target or target complex disclosed herein, while in other embodiments, the two or more agents inhibit different targets or target complexes disclosed herein. In certain embodiments, the cells are terminally differentiated, e.g., terminally differentiated red blood cells. In some embodiments, the agent inhibits the expression or activity of one or more target proteins. In certain embodiments, the agent induces degradation of one or more target proteins. In certain embodiments, the agent inhibits the activity of one or more target proteins. In certain embodiments of any of the methods, the inhibitor reduces the expression of one or more target genes, mRNA, or proteins in a cell or tissue of the subject, e.g., a hematopoietic cell, e.g., a red blood cell. In certain embodiments, the inhibitor inhibits any of the target genes or proteins identified in Table 1, Table 2, Table 6, Table 7, Table 8 or Table 9, or any component or subunit of any of the complexes identified in Table 3 or Table 4, or a pathway identified in Table 5.

[0046]

[60] In certain embodiments of the methods of treatment disclosed herein, the hematological disease or disorder is selected from sickle cell disease, beta thalassemia, beta thalassemia trait or beta thalassemia minor, thalassemia intermedia, thalassemia major, or Cooley anemia.

[0047]

[61] In certain embodiments of any of the methods described herein, the pharmaceutical composition is provided to the subject parenterally.

[0048]

[62] The inhibitors and / or other agents and compositions (e.g., inhibitors) described herein may be formulated in any manner suitable for the desired route of administration (e.g., parenteral or oral administration). In some embodiments, contacting the agent or composition with a cell and / or tissue is the result of administering or providing the agent or composition to a subject. In some embodiments, the agent or composition (e.g., inhibitor) is administered at least 1, 2, 3, 4, 5, 10, 15, 20 or more times. In some embodiments of the combination therapy, administration of a first agent or composition follows administration of a second agent or composition, overlaps with administration of the second agent or composition, or is simultaneous with administration of the second agent or composition. The first and second agents or compositions may be the same or different. In some embodiments, the first and second agents or compositions are administered by the same actor and / or at the same geographic location. In some embodiments, the first and second agents or compositions are administered by different actors and / or at different geographic locations. In some embodiments, the agents described herein are administered as a single composition.

[0049]

[63] A variety of administration methods can be used in conjunction with the inhibitors according to the methods disclosed herein. For example, the inhibitors can be administered or co-administered topically, orally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, buccally, nasally, intraliposomally, by inhalation, intravaginally, intraocularly, via local delivery (e.g., by catheter or stent), subcutaneously, intraadiposely, intraarticularly, intrathecally, transmucosally, intrapulmonary or parenterally, including, for example, subcutaneously, intradermal, intramuscular, intravenous, intraarterially, intracardiacly, intrathecally, intraspinal, intravesical, subvesical, intraorbital, intraorbital, intraperitoneally, intratracheally, subcuticularly, intraarticular, subarachnoidally and intrasternal; by implantation of a depot or reservoir, for example, subcutaneously or intramuscularly.

[0050]

[64] "Subject" includes animals (e.g., mammals, pigs, fish, birds, insects, etc.). In some embodiments, the subject is a mammal, particularly a primate, particularly a human. In some embodiments, the subject is a livestock animal, such as cattle, sheep, goats, cows, pigs; poultry, such as chickens, ducks, geese, turkeys; and domesticated animals, such as dogs and cats. In some embodiments (e.g., particularly in the context of research), the subject is a rodent (e.g., mouse, rat, hamster), rabbit, primate, or pig, such as an inbred pig. The terms "subject" and "patient" are used interchangeably herein.

[0051]

[65] A “tissue” is a collection of similar cells of the same origin that together perform a specific function.

[0052]

[66] The methods disclosed herein can be practiced using any agent capable of inhibiting expression or activity of a target gene, mRNA or protein, such as an inhibitor of a gene, mRNA or protein, complex or pathway disclosed herein, e.g., in any of Tables 1-9.

[0053]

[67] In certain embodiments, the methods disclosed herein result in a decrease in the expression level or activity of a target gene, mRNA or protein in one or more cells or tissues (e.g., in a subject) compared to, for example, the expression level or activity in a control cell or tissue not contacted with an inhibitor, or a reference level. "Decrease" refers to, for example, at least a 5%, for example, at least a 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, or 100% decrease compared to the reference level. Decrease also refers to, for example, at least a 1-fold decrease, for example, a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000-fold or more decrease compared to the level in a reference or control cell or tissue.

[0054]

[68] In certain embodiments, the methods disclosed herein result in an increase in the amount of HbF or HBγ in one or more cells or tissues (e.g., in a subject), e.g., compared to the expression or activation level or reference level in a control cell or tissue not contacted with the inhibitor. In certain embodiments, the methods disclosed herein result in an increase in expression of hemoglobin gamma (e.g., HBG1 or HBG2) in one or more cells or tissues (e.g., in a subject), e.g., compared to the expression or activation level or reference level in a control cell or tissue not contacted with the inhibitor. An "increase" refers to an increase, for example, of at least 5%, such as at least 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99 or 100%, or at least a 2-fold, 3-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 500-fold or 1000-fold increase compared to a reference level or level in a control cell or tissue.

[0055]

[69] The methods described herein can be performed using any type of inhibitor that results in a reduction in the amount or level of a target gene, mRNA or protein in a cell or tissue, e.g., in a cell or tissue of a subject. In certain embodiments, the inhibitor causes, e.g., a reduction in active target protein, a reduction in total target protein, a reduction in target mRNA levels and / or a reduction in target protein activity in a cell or tissue contacted with the inhibitor. In certain embodiments, the reduction is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the level in a cell or tissue of the same type not contacted with the inhibitor or a reference level. Methods for measuring total protein or mRNA levels or activity in a cell are known in the art. In certain embodiments, an inhibitor inhibits or reduces the activity or expression of a target protein, e.g., mRNA and / or protein expression, hi certain embodiments, an inhibitor causes increased degradation of the target protein, resulting in less of the target protein in a cell or tissue.

[0056]

[70] Inhibitors that can be used to practice the disclosed methods include, but are not limited to, agents that inhibit, reduce, or decrease the expression or activity of a biomolecule, such as, but not limited to, a target gene, mRNA, or protein. In certain embodiments, an inhibitor can cause increased degradation of a biomolecule. In certain embodiments, an inhibitor can inhibit a biomolecule by competitive, uncompetitive, or non-competitive means. Exemplary inhibitors include, but are not limited to, nucleic acids, DNA, RNA, gRNA, shRNA, siRNA, modified mRNA (mRNA), microRNA (miRNA), proteins, protein mimetics, peptides, peptidomimetics, antibodies, small molecules, small organic molecules, inorganic molecules, chemicals, enzymes, analogs that mimic the binding sites of receptors or other proteins (e.g., involved in signal transduction), therapeutic agents, pharmaceutical compositions, drugs, and combinations thereof. In some embodiments, an inhibitor can be a nucleic acid molecule, including, but not limited to, siRNA, that reduces the amount of functional protein in a cell. Thus, a compound or agent that is said to be "capable of inhibiting" a particular target protein includes any type of inhibitor.

[0057]

[71] In certain embodiments, the inhibitor comprises a nucleic acid that binds to a target gene or mRNA. Thus, the nucleic acid inhibitor may comprise a sequence complementary to a target polynucleotide sequence or a region thereof or its antisense. In certain embodiments, the nucleic acid inhibitor comprises at least 8, at least 10, at least 12, at least 14, at least 16, at least 20, at least 24, or at least 30 nucleotide sequences corresponding to or complementary to the target polynucleotide sequence or its antisense.

[0058]

[72] In certain embodiments, the nucleic acid inhibitor is an RNA interference or antisense RNA agent, or a portion or mimic thereof, or a morpholino, that reduces expression of a target gene when administered to a cell. Typically, the nucleic acid inhibitor comprises at least a portion of a target nucleic acid molecule or its ortholog, or comprises at least a portion of a complementary strand of a target nucleic acid molecule. In some embodiments, expression of the target gene is reduced by at least about 10%, at least about 25%, at least about 50%, at least about 75%, or even 90-100%.

[0059]

[73] A "complementary" nucleic acid sequence is one that can hybridize with another nucleic acid sequence that is composed of complementary nucleotide base pairs. "Hybridizing" refers to pairing between complementary nucleotide bases to form a double-stranded molecule under appropriate stringency conditions (e.g., adenine (A) base pairs with thymine (T) in DNA, similarly, guanine (G) base pairs with cytosine (C)). (See, e.g., Wahl, GM and SL Berger (1987) Methods Enzymol. 152: 399; Kimmel, AR (1987) Methods Enzymol. 152:507).

[0060]

[74] "Antisense" refers to a nucleic acid sequence that is complementary to a nucleic acid sequence, regardless of length. In certain embodiments, antisense RNA refers to a single-stranded RNA molecule that can be introduced into an individual cell, tissue, or subject to result in a reduction in expression of a target gene by a mechanism that is independent of endogenous gene silencing pathways. Antisense nucleic acids can include modified backbones, such as phosphorothioates, phosphorodithioates, or others known in the art, or can include non-natural internucleoside linkages. Antisense nucleic acids can include, for example, locked nucleic acids (LNAs).

[0061]

[75] As used herein, "RNA interference" refers to the use of agents to reduce expression of a target gene by degradation of the target mRNA via endogenous gene silencing pathways (e.g., Dicer and RNA-induced silencing complex (RISC)). RNA interference can be achieved using a variety of agents, including shRNA and siRNA. "Short hairpin RNA" or "shRNA" refers to a double-stranded artificial RNA molecule with a hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). Expression of shRNA in cells is typically achieved by delivery of a plasmid or via a viral or bacterial vector. shRNAs are advantageous mediators of RNAi in that they have a relatively low rate of degradation and turnover. Small interfering RNAs (siRNAs) are a class of double-stranded RNA molecules, typically 20-25 base pairs in length, similar to miRNAs, that function within the RNA interference (RNAi) pathway. They disrupt the expression of specific genes with complementary nucleotide sequences by degrading mRNA after transcription and preventing translation. In certain embodiments, the siRNA is 18, 19, 20, 21, 22, 23 or 24 nucleotides long and has a 2-base overhang at its 3' end. The siRNA can be introduced into individual cells and / or culture systems, resulting in degradation of the target mRNA sequence. As used herein, "morpholino" refers to a modified nucleic acid oligomer in which a standard nucleobase is bound to a morpholine ring and linked via phosphorodiamidate linkage. Similar to siRNA and shRNA, morpholino binds to a complementary mRNA sequence. However, morpholino does not target a complementary mRNA sequence for degradation, but rather functions through steric inhibition of mRNA translation and alteration of mRNA splicing.

[0062]

[76] In certain embodiments, the nucleic acid inhibitor is a messenger RNA that can be introduced into a cell, where the nucleic acid inhibitor encodes a polypeptide inhibitor of a target disclosed herein. In certain embodiments, the mRNA is modified, for example, to increase its stability or reduce its immunogenicity, for example, by incorporation of one or more modified nucleosides. Suitable modifications are known in the art.

[0063]

[77] In certain embodiments, the inhibitor comprises an expression cassette encoding a polynucleotide or polypeptide inhibitor of a target disclosed herein. In certain embodiments, the expression cassette is present in a gene therapy vector, such as a viral gene therapy vector. A variety of gene therapy vectors, including viral gene therapy vectors, are known in the art, including, for example, AAV-based gene therapy vectors.

[0064]

[78] In some embodiments, the inhibitor is a polypeptide inhibitor. In certain embodiments, the polypeptide inhibitor binds to the target polypeptide and thus inhibits its activity, e.g., kinase activity. Examples of polypeptide inhibitors include any type of polypeptide (e.g., peptides and proteins), such as antibodies and fragments thereof.

[0065]

[79] An "antibody" is an immunoglobulin (Ig) molecule capable of specifically binding to a target, such as a carbohydrate, polynucleotide, lipid, or polypeptide, through at least one epitope recognition site located in the variable region of the immunoglobulin Ig molecule. As used herein, the term encompasses intact polyclonal or monoclonal antibodies, as well as fragments thereof, such as dAbs, Fab, Fab', F(ab')2, Fv, single chain (scFv), synthetic variants thereof, naturally occurring variants, fusion proteins comprising an antibody portion having an antigen-binding fragment of the required specificity, chimeric antibodies, nanobodies, and any other modified configuration of an immunoglobulin molecule that contains an antigen-binding site or fragment of the required specificity.

[0066]

[80] "Fragment" refers to a portion of a polypeptide or nucleic acid molecule, preferably at least 10%, 20%, 30%, 40% of the entire length of the reference nucleic acid molecule or polypeptide. , 50%, 60%, 70%, 80% or 90%. A fragment may comprise 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 nucleotides or amino acids. A "functional fragment" of an antibody is a fragment that maintains one or more activities of the antibody, e.g., a functional fragment binds to the same epitope and / or has the biological activity of the antibody. In certain embodiments, a functional fragment comprises the six CDRs present in the antibody.

[0067]

[81] In certain embodiments, the inhibitor induces degradation of a target polypeptide. For example, the inhibitor comprises a proteolysis inducer chimera (PROTAC) that induces selective intracellular proteolysis of a target protein. PROTACs comprise functional domains that may be covalently linked protein-binding molecules, one of which can bind to an E3 ubiquitin ligase and the other of which binds to a target protein intended for degradation. Once the E3 ligase is recruited to the target protein, ubiquitination and subsequent degradation of the target protein by the proteasome occurs. In certain embodiments, the inhibitor is a PROTAC that targets any of the targets disclosed herein.

[0068]

[82] In certain embodiments, the inhibitor is a small molecule inhibitor or a stereoisomer, enantiomer, diastereomer, isotopically enriched, prodrug, or pharma- ceutically acceptable salt thereof. In certain embodiments, the small molecule inhibitor of a target protein or protein complex that functions to regulate HbF expression targets SPOP. In certain embodiments, the small molecule inhibitor of a target protein or protein complex that functions to regulate HbF expression targets CUL3. In certain embodiments, the CUL3 inhibitor is MLN4924 (CAS number: 905579-51-3), suramin (CAS number: 145-63-1), or DI-591 (CAS number: 2245887-38-9).

[0069]

[83] In certain embodiments, the inhibitor comprises one or more components of a gene editing system. As used herein, the term "gene editing system" refers to a protein, a nucleic acid, or a combination thereof that can modify a target locus of an endogenous DNA sequence when introduced into a cell. Numerous gene editing systems suitable for use in the methods of the present invention are known in the art, including, but not limited to, zinc finger nuclease systems, TALEN systems, and CRISPR / Cas systems.

[0070]

[84] In some embodiments, the gene editing system used in the methods described herein is the CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated) nuclease system, which is an engineered nuclease system based on a bacterial system that can be used for mammalian genome engineering. In general, the system includes a CRISPR-associated endonuclease (e.g., Cas endonuclease) and a guide RNA (gRNA). The gRNA is composed of two parts: a crispr-RNA (crRNA) specific to a target genomic DNA sequence and a trans-activating RNA (tracrRNA) that facilitates binding of the endonuclease to DNA at the target insertion site. In some embodiments, the crRNA and tracrRNA can be present in the same RNA oligonucleotide, referred to as a single guide RNA (sgRNA). In some embodiments, the crRNA and tracrRNA can be present as separate RNA oligonucleotides. In such embodiments, the gRNA is composed of a crRNA oligonucleotide and a tracrRNA oligonucleotide that are associated to form a crRNA:tracrRNA duplex. As used herein, the term "guide RNA" or "gRNA" refers to the combination of tracrRNA and crRNA, present either as an sgRNA or as a crRNA:tracrRNA duplex.

[0071]

[85] In some embodiments, the CRISPR / Cas system comprises a Cas protein. In some embodiments, the crRNA and tracrRNA are combined as a double-stranded RNA molecule to form a gRNA. In some embodiments, the crRNA:tracrRNA duplex is formed in vitro prior to introduction into a cell. In some embodiments, the crRNA and tracrRNA are introduced into a cell as separate RNA molecules, and then the crRNA:tracrRNA duplex is formed within the cell. In some embodiments, polynucleotides encoding the crRNA and tracrRNA are provided. In such embodiments, polynucleotides encoding the crRNA and tracrRNA are introduced into a cell, and then the crRNA and tracrRNA molecules are transcribed within the cell. In some embodiments, the crRNA and tracrRNA are encoded by a single polynucleotide. In some embodiments, the crRNA and tracrRNA are encoded by separate polynucleotides.

[0072]

[86] In some embodiments, the Cas endonuclease is directed to the target insertion site by the sequence specificity of the crRNA portion of the gRNA, which may include a protospacer motif (PAM) sequence near the target insertion site. A variety of PAM sequences suitable for use with particular endonucleases (e.g., Cas9 endonuclease) are known in the art (see, e.g., Nat Methods. 2013 Nov; 10(11):1116-1121 and Sci Rep. 2014; 4: 5405).

[0073]

[87] The specificity of the gRNA for the target locus is mediated by the crRNA sequence, which comprises a sequence of about 20 nucleotides that is complementary to a DNA sequence at the target locus (e.g., complementary to a target DNA sequence). In some embodiments, the crRNA sequence used in the methods of the invention is at least 90% complementary to the DNA sequence of the target locus. In some embodiments, the crRNA sequence used in the methods of the invention is at least 95%, 96%, 97%, 98% or 99% complementary to the DNA sequence of the target locus. In some embodiments, the crRNA sequence used in the methods of the invention is 100% complementary to the DNA sequence of the target locus. In some embodiments, the crRNA sequences described herein are designed to minimize off-target binding using algorithms known in the art (e.g., Cas-OFF finder) to identify target sequences unique to a particular target locus or target gene.

[0074]

[88] In some embodiments, the endonuclease is a Cas protein or orthologue. In some embodiments, the endonuclease is a Cas9 protein. In some embodiments, the Cas9 protein is a Cas9 protein specific for Streptococcus pyogenes (e.g., SpCas9), Staphylococcus aureus (e.g., SaCas9), or Neisseria meningitide. In some embodiments, the Cas endonuclease is derived from Neisseria meningitides (NmeCas9). In some embodiments, the Cas endonuclease is a Cas9 protein or a Cas9 ortholog selected from the group consisting of SpCas9, SpCas9-HF1, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, and NmeCas9. In some embodiments, the endonuclease is selected from the group consisting of C2C1, C2C3, Cpf1 (also called Cas12a), Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1 , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3 and Csf4. In some embodiments, the Cas9 is a Cas9 nickase mutant. A Cas9 nickase mutant has one catalytically active domain and one The RuvC domain contains only one of the HNH and RuvC domains.

[0075]

[89] In certain aspects, the disclosure includes compositions, e.g., pharmaceutical compositions, comprising an inhibitor of a target disclosed herein, including any of the various classes of inhibitors described herein. The present invention encompasses pharmaceutical compositions comprising an inhibitor and a pharma- ceutically acceptable carrier, diluent or excipient. Any inert excipient commonly used as a carrier or diluent can be used in the compositions of the present invention, such as sugars, polyalcohols, soluble polymers, salts and lipids. Sugars and polyalcohols that can be used include, but are not limited to, lactose, sucrose, mannitol and sorbitol. Examples of soluble polymers that can be used are polyoxyethylene, poloxamer, polyvinylpyrrolidone and dextran. Useful salts include, but are not limited to, sodium chloride, magnesium chloride and calcium chloride. Lipids that can be used include, but are not limited to, fatty acids, glycerol fatty acid esters, glycolipids and phospholipids.

[0076]

[90] Additionally, pharmaceutical compositions may contain binders (e.g., acacia, corn starch, gelatin, carbomer, ethylcellulose, guar gum, hydroxypropyl cellulose, hydroxypropyl methylcellulose, povidone), disintegrants (e.g., corn starch, potato starch, alginic acid, silicon dioxide, croscarmellose sodium, crospovidone, guar gum, sodium starch glycolate, Primogel), buffers of various pH and ionic strength (e.g., Tris-HCL, acetate, phosphate), additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Plutonic F68, bile salts), protease inhibitors, surfactants (e.g., sodium lauryl sulfate), penetration enhancers, solubilizers (e.g., glycerol, polyethylene glycerol, cyclodextrin), fluidizing agents (e.g., colloidal silicon dioxide), antioxidants (e.g., ascorbic acid, sodium metabisulfite, butylated hydroxyanisole), stabilizers (e.g., hydroxypropylcellulose, hydroxypropylmethylcellulose), viscosity increasing agents (e.g., carbomer, colloidal silicon dioxide, ethylcellulose, guar gum), sweeteners (e.g., sucrose, aspartame, citric acid), flavoring agents (e.g., peppermint, methyl salicylate or orange flavor), preservatives. (e.g., thimerosal, benzyl alcohol, parabens), lubricants (e.g., stearic acid, magnesium stearate, polyethylene glycol, sodium lauryl sulfate), flow aids (e.g., colloidal silicon dioxide), plasticizers (e.g., diethyl phthalate, triethyl citrate), emulsifiers (e.g., carbomer, hydroxypropyl cellulose, sodium lauryl sulfate, methylcellulose, hydroxyethyl cellulose, sodium carboxymethyl cellulose), polymeric coatings (e.g., poloxamers or poloxamines), coating and film formers (e.g., ethyl cellulose, acrylates, polymethacrylates) and / or auxiliary agents.

[0077]

[91] In one embodiment, the pharmaceutical compositions are prepared with carriers that will protect the inhibitor from rapid elimination from the body, such as controlled release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparing such formulations will be apparent to those skilled in the art. Materials may also be commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions Pharmaceutically acceptable carriers can also be used, including liposomes targeted to infected cells using monoclonal antibodies against viral antigens. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0078]

[92] Additionally, the present invention provides pharmaceutical compositions comprising the inhibitor in any solid or liquid physical form. For example, the inhibitors may be in crystalline form, amorphous form and may have any particle size. The particles may be micronized or agglomerated, may be particulate granules, powders, oils, oily suspensions or any other form of solid or liquid physical form.

[0079]

[93] If the inhibitor exhibits insufficient solubility, methods for solubilizing the compound may be used. Such methods are known in the art and include ethanol, propylene glycol, polyethylene glycol (PEG) 300, PEG 400, DMA (10-30%), DMSO (10-20%), NMP (10-20%), surfactants such as polysorbate 80, polysorbate 20 (1-10%), cremophor EL, Cremophor RH40, Cremophor RH60 (5-10%), Pluronic F68 / Poloxamer 188 (20-50%), Solutol HS15 (20-50%), Vitamin E TPGS, and da-tocopheryl PEG 1000. These include, but are not limited to, pH adjustment and salt formation using co-solvents such as succinates (20-50%), complex formation such as HP β-CD and SBE β-CD (10-40%), as well as advanced approaches such as micelles, addition of polymers, nanoparticle suspensions, and liposome formation.

[0080]

[94] The inhibitors may also be administered or co-administered in sustained release dosage forms. The inhibitors may be in gaseous, liquid, semi-liquid or solid form formulated in a manner appropriate for the route of administration to be used. For oral administration, suitable solid oral formulations include tablets, capsules, pills, granules, pellets, sachets and effervescents, powders, and the like. Suitable liquid oral formulations include solutions, suspensions, dispersions, syrups, emulsions, oils, and the like. For parenteral administration, reconstitution of lyophilized powders is typically used.

[0081]

[95] The appropriate dose of the inhibitor for use in treating the diseases or disorders described herein can be determined by one of ordinary skill in the art. Generally, the therapeutic dose is identified through dose-ranging studies in humans based on preliminary evidence obtained from animal studies. The dose should be sufficient to provide the desired therapeutic benefit without causing undesirable side effects. The mode of administration, dosage form and suitable pharmaceutical excipients can also be fully used and adjusted by one of ordinary skill in the art. All variations and modifications are contemplated within the scope of this patent application.

[0082]

[96] In certain embodiments, the disclosure includes a unit dosage form of a pharmaceutical composition comprising an agent that inhibits the expression or activity of a target polypeptide (or causes a decrease in the level of a target protein) and a pharma- ceutically acceptable carrier, diluent or excipient, wherein the unit dosage form is effective to increase expression of hemoglobin gamma in one or more tissues in a subject to which the unit dosage form is administered.

[0083]

[97] In certain embodiments, the unit dosage form comprises an effective amount, effective concentration, and / or inhibitory concentration of an inhibitor for treating a blood cell disease or disorder, such as one associated with mutant or abnormal hemoglobin beta (including any of the diseases or disorders disclosed herein, such as SCD or beta thalassemia).

[0084]

[98] A "pharmaceutical composition" includes a composition of one or more inhibitors disclosed herein and one or more pharma- ceutically acceptable carriers, excipients, or diluents.

[0085]

[99] "Pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0086]

[0100] "Pharmaceutically acceptable carrier" means any agent that is acceptable for use in humans and / or veterinary medicine. The present invention includes, but is not limited to, any adjuvant, carrier, excipient, flow agent, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surfactant and / or emulsifier approved by the U.S. Food and Drug Administration as being capable of being used in the preparation of pharmaceutical compositions. Exemplary pharma- ceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; tragacanth; malt; gelatin; talc; cocoa butter, waxes, animal and vegetable fats, paraffin, silicones, bentonite, silicic acid, zinc oxide; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffers, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free distilled water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffers; and any other compatible substances used in pharmaceutical formulations. Except insofar as any conventional media and / or agent is incompatible with the agents of the present disclosure, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[0087]

[0101] As used herein, an "effective amount" refers to an amount that is sufficient to produce a particular effect, e.g., on a cell, tissue, organ or refers to the amount of an agent effective to achieve an increase in the level of fetal hemoglobin (or hemoglobin gamma) in a subject. In certain embodiments, the increase is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% compared to the amount before treatment or without treatment. In the context of therapeutic treatment of a subject, an effective amount can be, for example, an amount effective or sufficient to reduce one or more disease symptoms in a subject, for example, a subject with sickle cell disease.

[0088]

[0102] As used herein, "effective concentration" refers to the concentration of a compound needed to produce a particular physiological effect. Effective concentration refers to the minimum concentration (mass / volume) of an agent and / or composition required. As used herein, effective concentration typically refers to the concentration of an agent required to increase, activate and / or enhance a particular physiological effect.

[0089]

[0103] "Inhibitory concentration" "Inhibitory concentration" is the amount of a drug required to inhibit a particular physiological effect. Inhibitory concentration is the minimum concentration (mass / volume) of an agent that is capable of inhibiting a particular physiological effect. As used herein, inhibitory concentration typically refers to the concentration of an agent required to reduce, inhibit and / or suppress a particular physiological effect.

[0090]

[0104] In some embodiments, the agent or compound described herein is administered in an amount of about 1 mg. / kg to about 300 mg / kg. In another embodiment, the agent or compound described herein may be administered at a dose of about 1 mg / kg to about 20 mg / kg. For example, the agent or compound may be administered to a subject at a dose of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mg / kg or within any of these values, such as about 10 mg / kg to about 15 mg / kg, about 6 mg / kg to about 12 mg / kg, etc. In another embodiment, the agent or compound described herein is administered at a dose of ≦15 mg / kg. For example, the agent or compound may be administered at 15 mg / kg / day for 7 days for a total of 105 mg / kg / week. For example, the compound may be administered at 10 mg / kg twice a day for 7 days for a total of 140 mg / kg / week.

[0091]

[0105] In many embodiments, the dosages described herein are single doses, daily doses. The dosage may refer to a daily or weekly dose. In one embodiment, the agent or compound may be administered once a day. In another embodiment, the compound may be administered twice a day. In some embodiments, In some embodiments, the agent or compound may be administered three times per day. In some embodiments, the compound may be administered four times per day. In some embodiments, the agent or compound described herein may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times per week. In other embodiments, the compound is administered once every other week.

[0092]

[0106] In some embodiments, the agents or compounds described herein are administered orally. In some embodiments, an agent or compound described herein may be administered orally once daily at a dosage of ≦15 mg / kg.

[0093]

[0107] The actual dosage employed will depend on the requirements of the patient and the severity of the condition being treated. It may vary. Determination of the proper dosage regimen for a particular situation is within the skill of the art. For convenience, the total daily dosage may be divided and administered in portions during the day as required.

[0094]

[0108] Dosing regimens using the disclosed compounds may be tailored to suit the type, species, age, weight, and / or condition of the patient. The dosage will be selected according to a variety of factors, including the patient's gender, sex, and medical condition; the severity of the condition being treated; the route of administration; the renal or hepatic function of the patient; and the particular disclosed compound being used. A physician or veterinarian of ordinary skill in the art can readily determine and prescribe the effective amount of the drug required to prevent, combat, or halt the progress of the condition.

[0095]

[0109] The amount and frequency of administration of the compounds of the present invention and / or pharma- ceutically acceptable salts thereof may vary. The dosage will be adjusted according to the judgment of the attending clinician, taking into account such factors as the age, condition and size of the patient and the severity of the condition being treated. EXAMPLES

[0096] Example 1 Target Identification Methods

[0110] Factors that upregulate HbF protein in the erythroid lineage are shown in Figure 1 HbF was identified using a pooled CR1SPR screening approach as diagrammed in. HUDEP2 cells, a model erythroid precursor derived from CD34+ cells isolated from human umbilical cord blood, were used as a cellular model to study HbF reactivation since HBB / HBβ globin is the predominant β-like globin expressed.

[0097]

[0111] The CRISPR gRNA pool was delivered by lentivirus at an MOI of approximately 0.1. The lentiviral pool was introduced into growing HUDEP2 cells via ELISA. Depending on the library construction, this was either a one-vector system (vectors encoding both gRNA and Cas9) or a two-vector system (vectors encoding gRNA). In the case of the two-vector system, the lentiviral pool was delivered to HUDEP2 cells that constitutively express the Cas9 protein. One day after lentiviral transduction, cells were grown in HUDEP2 growth medium (StemSpan SFEM, StemCell Technologies; 50ng / ml SCF; 3IU / ml erythropoietin; luM dexamethasone; lug / ml doxycycline) containing 500ng / ml puromycin to select for cells that had received the CRISPR construct. Selection in growth medium + puromycin was performed for 2 days. The selected cells were then grown for an additional 7 days in growth medium and then transitioned to HUDEP2 differentiation medium (Iscove's modified Dulbecco's medium; 1% L-glutamine; 2% penicillin / streptomycin; 330ug / ml holohuman transferrin; 2IU / ml heparin; 10ug / ml recombinant human insulin; 3IU / ml erythropoietin; 100ng / ml SCF; 4% fetal bovine serum) for 10 days.

[0098]

[0112] Using HbF fluorescence-activated cell sorting (FAC) assay (Invitrogen, HFH01) To isolate cells with elevated HbF levels, we used HUDEP2 cells transduced with a negative control gRNA (sgGFP) as a gating threshold to select for HbF-high cells. Cells were also collected after 3 days of puromycin selection (post-selection sample) and before FAC sorting (FAC input sample) and used for downstream analysis to identify hits.

[0099]

[0113] Genomic DNA was extracted from HbF-enriched cells, post-selection samples, and FAC input samples. gRNAs were isolated from the human genome. gRNAs present in the genomic DNA were amplified using nested PCR amplification. A second round of PCR amplification was performed to incorporate Illumina sequencing adapters into the samples as well. Illumina sequencing was performed to quantify the gRNAs present in each sample. gRNAs were identified using conserved identifiers and subsequently mapped to the human reference genome to identify gRNA target genes, providing a relationship between the target genes and the genetic perturbations that led to HbF upregulation.

[0100]

[0114] The results of the screening are shown in Figure 2 (CRISPR Library #1) and Figure 3 (CRISPR Library #2). RISPR library #2). In each figure, the left panel plots the levels of HbF (X-axis) and β-actin (Y-axis) for each event, with line "L" indicating the HbF threshold for HbF high cells. The right panel represents the same data in a one-dimensional plot showing HbF levels (X-axis) and events (Y-axis), with line "C" indicating the HbF threshold for HbF high cells. Any cells above the HbF threshold were collected in the HbF high population. In both Figures 2 and 3, the darker shaded cells on the left side of each panel are HUDEP2 cells transduced with the control sgGFP, and the lighter shaded cells on the right side of each panel are HUDEP2 cells transduced with the CRISPR library.

[0101] Example 2 Computational methods to identify gRNAs that upregulate HBF

[0115] Illumina sequencing was used to identify post-selection samples, FAC input samples and HbF A library of gRNAs in high quality samples was sequenced. Each read was sequenced at 5' or 3'. ‘ Any of the regions were searched for conserved identifiers, and only reads containing the conserved identifier were retained. 20bp gRNA sequences between the conserved identifiers were extracted from the retained reads and mapped to the human genome (hg19). A single retained read with a given gRNA represented one count for that gRNA in each sample. Counts were converted to RPM (reads per million) to normalize for sequencing depth and allow comparison across different gRNA libraries. The RPM of a gRNA was calculated as follows:

number

[0102] Method 1: Z-score based approach in high HbF samples:

[0116] In this approach, gRNA in HbF samples rpm Based on the distribution of values More formally, we calculated the Z-score using the following formula:

number

[0103] In the above formula, gRNA HbF+ is the Z-score in the HbF+ sample, and gRNA rpm,Hbf+ is the abundance, and μHbf+, and σ Hbf+ indicates gRNA expression in HbF+ samples. rpm,Hbf+ Similarly, the mean and standard deviation of the input (gRNA input ) and after selection (gRNA post-selected ) and calculated the Z-score of the samples. gRNAs that had a negative effect on cell health or proliferation were identified by performing a gRNA dropout analysis. More formally, in this dropout analysis, |gRNA input -gRNA post-selected All guides with | ≥ 1 were removed. gRNA HbF+ All remaining gRNAs with >3 were considered enriched in HbF+ samples. Using this approach, a total of 174 hits containing at least one enriched gRNA were identified.

[0104] Method 2: Approach based on Z-score difference in HbF high and FAC input:

[0117] In this approach, we performed the same dropout analysis (as in Method 1). gRNA HbF+ -gRNA input All gRNAs with a β-gRNA index >2.5 were considered enriched in HbF+ samples. Using this approach, a total of 307 hits containing at least one enriched gRNA were identified. These are provided in Table 1.

[0105] [Table 1]

[0106] [Table 2]

[0107] [Table 3]

[0108] [Table 4]

[0109] [Table 5]

[0110] [Table 6]

[0111] [Table 7]

[0112] [Table 8]

[0113] Method 3: Approach based on fold change in HbF height and FACs input:

[0118] In this approach, the fold change in RPM values ​​is used to estimate dropouts and hits. The call was made. More formally,

number

number

[0114] Number of gRNA hits per gene:

[0119] In this approach, enriched gRNAs were identified using method 2. Genes with one enriched gRNA were considered as hits. Using this approach, 39 hits were identified. These are listed in Figure 5A. The list of hits and associated gRNAs is summarized in Table 2.

[0115] [Table 9]

[0116] [Table 10]

[0117] [Table 11]

[0118] Example 3 Bioinformatics analysis of target gene hits that upregulate HBF

[0120] Using multiple bioinformatic analyses, HbF protein levels were significantly We identified specific pathways, complexes and tissue-specific expression patterns enriched in the top targets that were differentially upregulated.

[0119] Protein Complex Analysis:

[0121] Identification of a multi-target protein complex that upregulates HbF To achieve this, we compared the top targets identified by the above method with existing protein complex annotations (CORUM protein complex annotation (Giurgiu M et al, Nucleic Acids Research)). This analysis identified several complexes with multiple targets. These complexes and the number of targets identified as components of each complex are shown in Figure 6. The overlap of complex annotations and targets identified using methods 2 and 3 are shown in Tables 3 and 4.

[0120] [Table 12]

[0121]

Table 13

[0122]

Table 14

[0123]

Table 15

[0124]

Table 16

[0125]

Table 17

[0126]

Table 18

[0127]

Table 19

[0128]

Table 20

[0129]

Table 21

[0130]

Table 22

[0131]

Table 23

[0132]

Table 24

[0133]

Table 25

[0134]

Table 26

[0135]

Table 27

[0136]

Table 28

[0137]

Table 29

[0138]

Table 30

[0139]

Table 31

[0140]

Table 32

[0141]

Table 33

[0142] Molecular pathway analysis: To identify top molecular pathways enriched in multiple targets, the top targets were overlapped with KEGG pathway maps using the clusterProfiler R package. The top pathways derived from the identified hits are shown in Table 5.

[0143] [Table 34]

[0144] [Table 35]

[0145] [Table 36]

[0146] [Table 37]

[0147] Consistency between two different CRISPR libraries: To obtain higher confidence in the identified targets, a different set of genes and An additional CRISPR library (library #2) with the corresponding gRNA was used. Only HbF+ and FACs input samples were sequenced in library #2. Hits in library #2 were identified using method 2 (cutoff changed to 1.0) without dropout filters. A total of 209 hits were identified using this approach (Figure 6B). Several common hits were identified in both libraries (Figure 5B and Table 6).

[0148] [Table 38]

[0149] Expression specificity of hits in blood tissues and erythroid lineages: Hits identified using method 2 were analyzed to determine their association with SCD in blood tissues. Genes with high blood-specific expression were prioritized based on their expression in the blood-specific subpopulations. This was done using GTEx gene expression data from 15,598 samples across 31 different tissues (The GTEx Consortium, Nature Genetics). A mean Z-score was calculated to identify genes with high blood-specific expression. The blood Z-score for a hit was calculated as follows:

number

[0150] In the above formula, Z g,blood is the average gene "g" in blood tissue. is the average Z score, and g i is the expression of gene "g" in sample "i", and μ g is the average expression of gene 'g' across all samples, and σ g is the standard deviation of gene 'g' across all samples. In total, Z > 1 g,blood Thirty-two hits were identified (Figure 7A and Table 7).

[0151] [Table 39]

[0152] [Table 40]

[0153] [Table 41]

[0154] Blood tissue is heterogeneous and has many different cell types, all of which are associated with SCD. To focus on the erythroid lineage, which is primarily affected in SCD, the hits were overlapped with lineage-specific modules identified by the DMAP project (Novershtem et al., Cell). Many hits were identified that were expressed in the precursor and late erythroid lineages (Table 8) (Figures 7B and 7C).

[0155] [Table 42]

[0156] [Table 43]

[0157] [Table 44]

[0158] Table 9 shows multiple targets identified herein for increasing expression of HbF. A list of the various components of the junctions and pathways is provided, any of which may be targeted according to any of the methods disclosed herein.

[0159] [Table 45]

[0160] [Table 46]

[0161] [Table 47]

[0162] Example 4 SPOP and CUL3 gene validation in primary CD34+ cells SPOP and CUL3 are regulators of fetal hemoglobin expression in HU They were identified using pooled CRISPR screening in the DEP2 model. To further investigate the role of SPOP and CUL3 in fetal hemoglobin regulation, primary CD34+ cells from healthy donors were used with CRISPR Cas9 and shRNA-mediated genetic perturbation approaches. The effects on HbF levels were studied in differentiated CD34+ cells using HbF immunocytochemistry (ICC) (Figure 8A).

[0163] HbF levels were measured using CRISPR Cas9-RNP-based loss of function , determined by HbF ICC. Cas9-RNP complexes were electroporated into proliferating CD34+ cells. Cells were then differentiated into the erythroid lineage for 7 days and HbF levels were quantified using HbF ICC. Non-targeting guide RNA was used as a negative control and guide RNA targeting BCL11A was used as a positive control in this experimental design. Genetic disruption of SPOP and CUL3 using either CRISPR-Cas9 or shRNA increased HbF levels, as measured by percent F cells or average HbF levels per cell within a population of differentiated erythroid cells. CRISPR via electroporation Using the Cas9-RNA method, the gRNAs used for SPOP were TAACTTTAGCTTTTGCCGGG (SEQ ID NO: 91), CGGGCATATAGGTTTGUGCA (SEQ ID NO: 92), GTTTGCGAGTAAACCCCAAA (SEQ ID NO: 93), and the gRNAs used for CUL3 were GAGCATCTCAAACACAACGA (SEQ ID NO: 94), CGAGATCAAGTTGTACGTTA (SEQ ID NO: 95), TCATCTACGGCAAACTCTAT (SEQ ID NO: 96). Cas9-gRNA complexes were generated independently and three complexes per target were pooled for cell assays. The shRNAs used for SPOP were: [ka] The shRNA used for CUL3 was [ka] HbF ICC allows quantification of the percent F cells and HbF intensity per cell. F cells are erythroid cells with detectable levels of HbF above a defined threshold, and percent F cells are defined as the percent of cells in the cell population that are defined as F cells. Percent F cells and mean HbF intensity cells were quantified for negative controls, sgBCL11A, sgSPOP, and sgCUL3. HbF levels determined by HbF ICC using shRNA-based loss of function. shRNA vectors were electroporated into proliferating CD34+ cells. Cells were then differentiated into the erythroid lineage for 7 days and HbF levels were quantified using ICC. Percent F cells (Figures 8B and 8D) and mean HbF intensity (Figures 8C and 8E) were quantified for individual shRNA constructs and for negative controls, shBCL11A, shSPOP, and shCUL3.

[0164] method cell culture Human mobilized peripheral blood primary CD34+ cells were cultured in IMDM, 100 ng / mL hS Cells were expanded from thawing by seeding 100,000 viable cells / mL into culture flasks containing CD34+ Phase 1 media composed of CF, 5ng / mL IL-3, 3IU / mL EPO, 250ug / mL transferrin, 2.5% normal human serum, 1% pen / strep, 10ng / mL heparin, and 10ug / mL insulin. On day 3 after thawing, cells were replenished by adding an additional 1X culture volume of CD34+ Phase 1 media. After 5 days of expansion, primary CD34+ cells were transfected with RNP complex.

[0165] Preparation of Cas9-gRNA RNP and nucleofection Resuspend the lyophilized crRNA and tracrRNA using TE buffer. crRNA and tracrRNA were added to annealing buffer and annealed in a thermocycler. Multiple sgrRNAs per gene were pooled in a microcentrifuge tube. Each sgRNA was mixed with TrueCut Cas9v2 and incubated for 10 minutes to generate RNP complexes. After counting, 144,000 CD34+ cells were added to a transfection cuvette and combined with transfection solution (P3, RNP complex, glycerol). Cells were transfected using an Amaxa Nucleofector and then transferred to a 12-well plate with 1 ml of pre-warmed Phase 1 medium.

[0166] In vitro differentiation The day after transfection, the cells were replenished with an additional 0.5 mL of Phase 1 medium. Five days after transfection, cells were differentiated towards erythroid lineage by complete media change to CD34+ Phase 2 media consisting of IMDM, 100ng / mL hSCF, 5ng / mL IL-3, 3IU / mL EPO, 250ug / mL transferrin, 2.5% normal human serum, 1% pen / strep, 10ng / mL heparin, 10ug / mL insulin. Two days after the change to Phase 2 media, cells were centrifuged and 1mL of Phase 2 media was replaced with fresh Phase 2 media. After an additional two days, cells were harvested for HbF analysis by ICC.

[0167] HbFICC Protocol To collect CD34+ cells, 40 uL from each well was transferred to a 384-well plate. The cells were transferred in duplicate to a plate and the plate was centrifuged. First, the plate was washed with 25 μL of PBS. Then, the plate was fixed with 25 μL of 4% paraformaldehyde for 10 minutes at room temperature. Then, the cells were washed three times with 25 μL of PBS. Next, the cells were fixed in IX PBS, 1% bovine serum albumin, 10% fetal bovine serum, 0.3 M glycine and 0.1% Cells were permeabilized and blocked in 25 μL of Perm / Block buffer composed of tween-20 for 1 h at room temperature. Cells were then washed three times with 25 μL of 0.1% tween in PBS. After washing, cells were incubated overnight at 4°C with 25 μL of HbF-488 primary antibody (ThermoFisher MHFHO1-4) diluted 1:40 in 0.1% tween and Hoescht diluted 1:2000 in 0.1% tween. The next day, cells were washed again 3 times with 25 μL of 0.1% tween in PBS and foil sealed for imaging on a ThermoFisher CellInsight CX7. did.

[0168] The plates were then scanned on a CX7 at 10x magnification and 100% IgG per well was counted. Nine images were acquired. The software algorithm then identified nuclei and calculated the total number of nuclei using the Hoechst stain on channel 1. After the nuclei were identified, the algorithm , the average nuclear intensity of HbF staining on channel 2 was calculated.

[0169] References An international effort to cure a global health problem: A report on the 19th Hemoglobin Switching Conference. Blobel GA, Bodine D, Brand M, Crispino J, de Bruijn MF, Nathan D, Papayannopoulou T, Porcher C, Strouboulis J, Zon L, Higgs DR, Stamatoyannopoulos G, Engel JD. Exp Hematol. 2015 Oct;43(10):821-37. doi: 10.1016 / j.exphem.2015.06.008. Epub 2015 Jul 2. Review. PMID:26143582 Control of globin gene expression during development and ervthroid differentiation· Stamatoyannopoulos G. Exp Hematol. 2005 Mar;33(3):259-71. Review. PMID: 15730849 Fetal haemoglobin induction in sickle cell disease. Paikari A, Sheehan VA. Br J Haematol. 2018 Jan; 180(2): 189-200. doi: 10.1111 / bjh.15021. Epub 2017 Nov 16. Review. PMID: 29143315 Fetal haemoglobin in sickle-cell disease: from genetic epidemiology to new therapeutic strategies. Lettre G, Bauer DE. Lancet. 2016 Jun 18;387(10037):2554-64. doi: 10.1016 / 80140-6736(15)01341-0. Review. PMID: 27353686 Locus control regions. Li Q, Peterson KR, Fang X, Stamatoyannopoulos G. Blood. 2002 Nov l;100(9):3077-86. Review. PMID: 12384402 Pomalidomide and lenalidomide regulate ervthropoiesis and fetal hemoglobin production in human CD34+ cells. Moutouh-de Parseval LA, Veihelle D, Glezer E, Jensen-Pergakes K, Ferguson GD, Corral LG, Morris CL, Muller G, Brady H, Chan K. J Clin Invest. 2008 Jan;118(l):248-58. PMID: 18064299 Augmentation of fetal-hemoglobin production in anemic monkeys bv hvdroxvurea. Letvin NL, Linch DC, Beardsley GP, McIntyre KW, Nathan DG. N Engl J Med. 1984 Apr 5;310(14):869-73. PMID: 619967 EHMT1 and EHMT2 inhibition induces fetal hemoglobin expression. Renneville A, Van Galen P, Canver MC, McConkey M, Krill-Burger JM, Dorfman DM, Holson EB, Bernstein BE, Oikin SH, Bauer DE, Ebert BL. Blood. 2015 Oct 15;126(16): 1930-9. doi: 10.1182 / blood-2015-06-649087. Epub 2015 Aug 28. PMID: 26320100 Lvsine-specific demethvlase 1 is a therapeutic target for fetal hemoglobin induction. Shi L, Cui S, Engel JD, Tanabe O. Nat Med. 2013 Mar;19(3):291-4. doi: 10.1038 / hm.3101. Epub 2013 Feb 17. PMID: 23416702 CORUM: the comprehensive resource of mammalian protein complexes-2009. Giurgiu M, Reinhaid J, Brauner B, Dunger-Kaltenbach I, Fobo G, Frishman G, Montrone C, Ruepp A Nucleic Acids Res. 2010 Jan;38(Database issue):D497-501. doi: 10.1093 / nar / gkp914. Epub 2009 Nov l. Pmid: 19884131 Densely interconnected transcriptional circuits control cell states in human hematopoiesis Novershtem N, Subramanian A, Lawton L.N, Raymond H. M, Haining N, McConkey M. E, Habib N, Yosef N, Chang C. Y, Shay T, Frampton C. M, Drake A. C. B, Leskov I, Nilsson B, Proffer F, Dombkowski D, Evans J. W, Liefeld R, Smutko J. S, Chen J, Friedman N, Young R. A, Golub T. R, Regev A, Ebert B. L. Cell. 2011 Jan 21;144(2):296-309. doi: 10.1016 / j.cell.2011.01.004. PMID: 21241896 The Genotype-Tissue Expression (GTEx) project The GTEx Consortium Nat Genet. 2013 Jun;45(6):580-5. doi: 10.1038 / ng.2653. PMID: 23715323

[0170] All publications and patent applications mentioned herein are hereby incorporated by reference in their entirety.

[0171] While the present invention has been described in conjunction with the specific embodiments outlined above, many alternatives, modifications and other variations thereof will be apparent to those skilled in the art. All such alternatives, modifications and variations are intended to be included within the spirit and scope of the present invention.

Claims

1. A method for increasing expression of fetal hemoglobin (HbF) in a cell, optionally a eukaryotic cell, comprising contacting the cell with an inhibitor of a target protein or target protein complex that functions to regulate HbF expression, optionally wherein the target protein is cullin 3 (CUL3) or speckle-type POZ protein (SPOP).

2. The method of claim 1 , wherein the target protein is CUL3.

3. The method of claim 1 , wherein the target protein is SPOP.

4. The method of any one of claims 1 to 3, wherein the HbF comprises hemoglobin gamma and hemoglobin alpha.

5. The method of claim 4 , wherein the hemoglobin gamma comprises hemoglobin gamma G1 (HBG1) and / or hemoglobin gamma G2 (HBG2).

6. The method of any one of claims 1 to 5, wherein the target protein or protein complex regulates HbF expression through a molecular signaling pathway listed in Table 5.

7. 7. The method of claim 6, wherein the molecular signaling pathway is selected from the group consisting of glucagon signaling pathway, carbon metabolism, oxytocin signaling, glycolysis, gluconeogenesis, endocrine resistance, gonadotropin releasing hormone (GnRH) signaling, oocyte meiosis, fatty acid degradation and inflammatory mediator regulation of transient receptor potential (TRP) channels.

8. The method of any one of claims 1 to 7, wherein the target protein is selected from those listed in Table 1 or Table 2.

9. The method of any one of claims 1 to 8, wherein the target protein is permanently or transiently associated with a multiprotein complex that regulates HbF expression.

10. 10. The method of claim 9, wherein the multiprotein complex is selected from those listed in Table 3 or Table 4.

11. The method of claim 9 or 10, wherein CUL3 is permanently or transiently associated with the multiprotein complex.

12. 12. The method of claim 11, wherein the multiprotein complex is selected from D(4) dopamine receptor (DRD4)-Kelch-like protein 12 (KLH12)-CUL3, a ubiquitin E3 ligase, coiled-coil domain-containing protein 22 (CCDC22)-COMM domain-containing protein 8 (COMMD8)-CUL3, or cullin-associated NEDD8 dissociating protein (CAND1)-CUL3-E3 ubiquitin protein ligase RBX1 (RBX).

13. The method of claim 9 or 10, wherein SPOP is permanently or transiently associated with the multiprotein complex.

14. The method of claim 13, wherein the multiprotein complex is a ubiquitin E3 ligase complex.

15. 15. The method of any one of claims 1 to 14, wherein the inhibitor targets or binds to a nucleotide sequence encoding the target protein or a protein in the protein complex, thereby inhibiting or preventing expression of the target protein or a protein in the protein complex.

16. 16. The method of claim 15, wherein the nucleotide sequence encoding the target protein or the protein in the protein complex is DNA.

17. 16. The method of claim 15, wherein the nucleotide sequence encoding the target protein or the protein in the protein complex is RNA.

18. 18. The method of claim 17, wherein the nucleotide sequence encodes CUL3 and optionally comprises or consists of a nucleic acid encoding the amino acid sequence of SEQ ID NO: 108 or an antisense sequence thereof.

19. 18. The method of claim 17, wherein the nucleotide sequence encodes SPOP and optionally comprises or consists of a nucleic acid encoding the amino acid sequence of SEQ ID NO: 109 or an antisense sequence thereof.

20. The method of any one of claims 1 to 19, wherein the inhibitor is selected from the group consisting of a small molecule, a nucleic acid, a polypeptide and a nucleoprotein complex.

21. 21. The method of claim 20, wherein the nucleic acid is selected from the group consisting of DNA, RNA, shRNA, siRNA, microRNA, gRNA and antisense oligonucleotides.

22. 21. The method of claim 20, wherein the polypeptide is selected from the group consisting of a protein, a peptide, a protein mimetic, a peptidomimetic, an antibody or a functional fragment thereof, and an antibody-drug conjugate or a functional fragment thereof.

23. The nucleoprotein complex comprises: a) a first sequence comprising a guide RNA (gRNA) that specifically binds to a target sequence, the target sequence comprising a regulator of HbF expression; and b) a second sequence encoding a CRISPR-Cas protein, the CRISPR-Cas protein comprising a DNA nuclease activity; 21. The method of claim 20, wherein the nucleic acid is a ribonucleoprotein complex (RNP) comprising:

24. The method of any one of claims 1 to 23, wherein the cells are blood cells.

25. 25. The method of claim 24, wherein the blood cells are red blood cells.

26. The method of any one of claims 1 to 25, wherein said contacting of the cell is performed in vitro, in vivo, ex vivo or in situ.

27. 1. A pharmaceutical composition for increasing expression of fetal hemoglobin (HbF) in a subject in need thereof, comprising: an inhibitor of a target protein or protein complex that functions to regulate HbF expression; Diluents, excipients and carriers and formulated for delivery to a subject in need thereof.

28. 28. The pharmaceutical composition of claim 27, wherein the inhibitor is a small molecule.

29. The pharmaceutical composition of claim 28, wherein the small molecule inhibitor targets CUL3.

30. 30. The pharmaceutical composition of claim 29, wherein the CUL3 small molecule inhibitor is selected from the group consisting of MLN4924, suramin and DI-591.

31. 28. The pharmaceutical composition of claim 27, wherein the inhibitor is a nucleic acid.

32. 32. The pharmaceutical composition of claim 31 , wherein the nucleic acid is selected from DNA, RNA, shRNA, siRNA, microRNA, gRNA and antisense oligonucleotides.

33. 28. The pharmaceutical composition of claim 27, wherein the inhibitor is a polypeptide.

34. 34. The pharmaceutical composition of claim 33, wherein the polypeptide is selected from a protein, a peptide, a protein mimetic, a peptidomimetic, an antibody or a functional fragment thereof, and an antibody-drug conjugate or a functional fragment thereof.

35. 35. The pharmaceutical composition of claim 33 or 34, wherein the polypeptide specifically binds to a regulator of HbF expression.

36. The inhibitor is a) a first sequence comprising a guide RNA (gRNA) that specifically binds to a target sequence, the target sequence comprising a regulator of HbF expression; and b) a second sequence encoding a CRISPR-Cas protein, the CRISPR-Cas protein comprising a DNA nuclease activity; 28. The pharmaceutical composition of claim 27, which is a ribonucleoprotein (RNP) complex comprising:

37. The pharmaceutical composition of claim 36, wherein the gRNA binds to a gene encoding a regulator of HbF expression.

38. 37. The pharmaceutical composition of claim 36, wherein the target sequence is listed in any one of Tables 1, 3-4, and 6-7.

39. 39. The pharmaceutical composition of claim 38, wherein the target sequence is CUL3.

40. 39. The pharmaceutical composition of claim 38, wherein the target sequence is SPOP.

41. 38. The pharmaceutical composition of claim 37, wherein the gRNA comprises any one of the sequences disclosed in Table 2 or a fragment thereof, or an antisense sequence of any of the above.

42. 42. The pharmaceutical composition of claim 41, wherein the gRNA binds to a gene encoding CUL3 and optionally comprises or consists of GAGCATCTCAAACACAACGA (SEQ ID NO: 94), CGAGATCAAGTTGTACGTAC (SEQ ID NO: 95) or TCATCTACGGCAAACTCTAT (SEQ ID NO: 96).

43. The gRNA binds to a gene encoding SPOP and optionally is selected from the group consisting of TAACTTTAGCTTTTGCCGGG (SEQ ID NO: 91), CGGGCATATAGGTTTTG 42. The pharmaceutical composition of claim 41 comprising or consisting of TGCA (SEQ ID NO: 92) or GTTTGCGAGTAAACCCCAAA (SEQ ID NO: 93).

44. 38. The pharmaceutical composition of claim 36 or 37, wherein the first sequence comprising the gRNA comprises a sequence encoding a promoter capable of expressing the gRNA in a eukaryotic cell.

45. 38. The pharmaceutical composition of claim 36 or 37, wherein the second sequence comprising the CRISPR-Cas protein comprises a sequence capable of expressing the CRISPR-Cas protein in a eukaryotic cell.

46. The method of any one of claims 1 to 26 or the pharmaceutical composition of claim 44 or 45, wherein the eukaryotic cell is a mammalian cell.

47. The method of any one of claims 1 to 26 or the pharmaceutical composition of any one of claims 44 to 46, wherein the eukaryotic cells are blood cells.

48. The method of any one of claims 1 to 26 or the pharmaceutical composition of any one of claims 44 to 46, wherein the eukaryotic cells are red blood cells.

49. The method of any one of claims 1 to 26, wherein the inhibitor is delivered via a vector.

50. 50. The method of claim 49, wherein the vector is a viral vector.

51. 51. The method of claim 50, wherein the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV).

52. 52. A method for treating a disease or disorder associated with defective hemoglobin protein activity or expression, comprising providing to a subject in need thereof a composition according to any one of claims 27 to 51.

53. 53. The method of claim 52, wherein the disease or disorder is a hematological disorder.

54. 54. The method of claim 53, wherein the blood disorder is selected from the group consisting of sickle cell disease, beta thalassemia, beta thalassemia intermedia, beta thalassemia major, beta thalassemia minor, and Cooley anemia.

55. 55. The method of any one of claims 52 to 54, wherein the hemoglobin protein is selected from hemoglobin-alpha and hemoglobin-beta.

56. 56. The method of any one of claims 52 to 55, wherein the defect in hemoglobin protein activity or expression results from a mutation, substitution, deletion, insertion, frameshift, inversion or rearrangement to the nucleotide sequence encoding the hemoglobin protein.

Images