Methods for determining contamination possibility by type ii cytolethal distending toxin-producing bacteria

Abstract

To provide efficient detection of bacteria producing type II cytolethal distending toxin.SOLUTION: Disclosed is a method for determining contamination possibility by Escherichia albertii, a type II cytolethal distending toxin-producing bacterium, which comprises a step of contacting a subject sample or DNA extracted from the sample with a primer set so as to amplify a target gene fragment in the sample, where the preferred primer set comprises a primer having a base sequence represented by one of SEQ ID Nos: 48-58 and a primer having a base sequence represented by one of SEQ ID Nos: 59-67.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to a method for determining the possibility of contamination with type II cytolethal toxin-producing bacteria. [Background technology]

[0002] In recent years, Escherichia albertii has been attracting attention as one of the bacteria that cause food poisoning. This bacterium (hereinafter sometimes referred to as "Escherichia albertii") is likely to cause intestinal bleeding, similar to Escherichia coli O157, and it is necessary to strictly distinguish between the two, since it not only has very similar biochemical properties to E. coli, but also has common pathogenic factors such as the eae gene that codes for intimin, which is involved in adhesion to the intestinal mucosa, and the cdt gene, which is involved in the cytolethal distending toxin (CDT).

[0003] As a method for distinguishing between the two, Patent Document 1 discloses a medium containing a sugar that is not decomposed by Lactobacillus albertii and a pH indicator. By culturing using this medium, it is possible to detect E. albertii from bacteria of the genus Escherichia. However, since Shigella and Bacillus Providencia also form similar colonies in this medium, it is necessary to specifically detect E. albertii.

[0004] It is known that there are many bacteria that produce CDT other than E. coli and P. albertii. However, it has been revealed that, among the five types of cdt (cdtI to V) genes that are said to be produced by E. coli, the cdt-I gene, cdt-III gene, cdt-IV gene, and cdt-V gene have low homology to the cdt gene possessed by P. albertii, and high homology to the cdt-II gene possessed by a specific strain of E. coli (Non-Patent Document 1). Based on this knowledge, Non-Patent Document 1 reveals that a PCR method (Eacdt PCR method) and a nested PCR method (Nested Eacdt PCR method) that can detect the cdt-II gene possessed by P. albertii were developed for the cdt gene of Providencia alcalifaciens (P. alcalifaciens) in addition to the cdt-III gene and cdt-V gene. Furthermore, Non-Patent Document 2 discloses a primer consisting of the base sequence shown in SEQ ID NO:69 and a primer consisting of the base sequence shown in SEQ ID NO:70, which were used in the Eacdt PCR method.

[0005] However, the former Eacdt PCR method has an insufficient lower limit of detection, and the latter nested PCR method requires two-step amplification, so new primers are needed that can distinguish and detect the cdt-II gene from the other four types of cdt genes in a single amplification step. Furthermore, since it is expected that the cdt-II gene also has mutations such as single nucleotide polymorphisms, a method that can detect as many cdt-II genes as possible is desired. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Patent Publication No. 2019-024418 [Non-patent literature]

[0007] [Non-Patent Document 1] Noritomo Yasuda, Development and application of a detection method for Escherichia albertii discovered by re-identification of E. coli carrying the type II cytolethal distending toxin gene, Internet,<URL:https: / / www.osakafu-u.ac.jp / osakafu-content / uploads / sites / 428 / k1798.pdf> [Non-Patent Document 2] Atsushi Hinenoya et al., Diagnostic Microbiology and Infection Disease 95(2019) 119-124 Summary of the Invention [Problem to be solved by the invention]

[0008] The present invention has been made in consideration of the above-mentioned background art, and aims to provide PCR primers that can specifically detect type II cytolethal toxin-producing bacteria by PCR that enables detection through a single amplification step rather than nested PCR. [Means for solving the problem]

[0009] The present invention is a method for determining the possibility of contamination by type II cytolethal toxin-producing bacteria, which includes a step of contacting a sample to be determined or DNA extracted from the sample to amplify a target gene fragment in the sample, and uses a specific primer set in the step of amplifying the target gene fragment. Effect of the Invention

[0010] According to the present invention, the type II cytolethal distending toxin (type II CDT) gene (cdt-II gene) can be specifically detected from various CDT-producing bacteria, and the possibility of contamination with the CDT-producing bacteria can be rapidly determined. [Brief description of the drawings]

[0011] [Figure 1] FIG. 1 is an explanatory diagram showing the sites where primers bind to the cdt-II gene and the amplified region. [Diagram 2] FIG. 2 is an explanatory diagram showing a part of the base sequence of the cdt-II gene and the sites where the primers bind. [Diagram 3] Figure 3 shows electrophoretic images of the amplified products using various primer sets. Lane 1 shows P. albertii, lane 2 shows Providencia rustigani, lane 3 shows E. coli, lane 4 shows distilled water as a control, and lanes M1 and M2 show the markers. [Figure 4] FIG. 4 is an image showing representative examples of melting curves obtained using various primer sets. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The method of the present invention is a method for determining the possibility of contamination with type II cytolethal toxin-producing bacteria, which includes a step of contacting a sample to be determined or DNA extracted from the sample to amplify a target gene fragment in the sample, and uses a specific primer set in the step of amplifying the target gene fragment.

[0013] The type II cytolethal distending toxin gene (cdt-II gene) is known. According to Non-Patent Document 1, the cdt-II gene is possessed by CTEC-II (type II cytolethal distending toxin-producing E. coli), which is a type of E. coli. However, CTEC-II is highly likely to be Lactobacillus albertii, and when cdt-II is detected, it can be assumed that there has been contamination with Lactobacillus albertii.

[0014] In the present invention, contamination with type II CDT-producing bacteria means not only the presence of bacteria carrying the cdt-II gene in a sample, whether live or dead, but also the presence of the target gene in a sample due to contamination by bacteria carrying the cdt-II gene or contamination by foreign matter containing the target gene, and the possibility of contamination means that it is presumed that the sample has been contaminated by the bacteria for some reason. Therefore, even if contamination is determined by the method of the present invention, it cannot necessarily be concluded that live bacteria were present, and confirmation of bacterial contamination by another method is required.

[0015] The method according to the present invention includes a step of contacting a sample to be evaluated or DNA extracted from the sample to amplify a target gene fragment in the sample. This step is a method known as PCR (Polymerase Chain Reaction). In this step, the following primer set is used in the present invention.

[0016] The primer set used preferably has a base sequence capable of binding complementarily to the cdt-II gene. The term "complementarily binding" is used in the sense that it is usually used by those skilled in the art who perform PCR, and means that the bases of each primer can bind to the cdt-II gene, but the primers in the present invention may not bind completely complementarily, and may amplify a partial region of the cdt-II gene even if 1 to 3 bases are inserted, deleted, or substituted. The cdt-II gene is a gene that produces type II CDT, and there are various polymorphisms in the cdt-II gene that differ by one base. The primer set in the present invention binds complementarily to the cdt-II gene having the consensus sequence (SEQ ID NO: 71) shown in FIG. 2, but can also amplify a partial region of the cdt-II gene having a base sequence different from the consensus sequence. The base sequence shown in SEQ ID NO: 71 indicates 641 bases from the 1300th base to the 1940th base counting from the 5' end of the consensus sequence (sense strand) of the cdt-II gene.

[0017] The primer set according to the present invention includes one forward primer selected from the group consisting of primer group 6F consisting of primers having the nucleotide sequence shown in SEQ ID NO: 1 and each having 20 to 24 bases, primer group 7F consisting of primers having the nucleotide sequence shown in SEQ ID NO: 3 and each having 17 to 21 bases, primer group 8F consisting of primers having the nucleotide sequence shown in SEQ ID NO: 5 and each having 17 to 22 bases, and a primer (1845F) having the nucleotide sequence shown in SEQ ID NO: 68 (TAATGATTCGAACGCCAAAC), primer group 6R consisting of primers having the nucleotide sequence shown in SEQ ID NO: 2 and each having 16 to 20 bases, primer group 7R consisting of primers having the nucleotide sequence shown in SEQ ID NO: 4 and each having 17 to 21 bases, and No. 6 and one reverse primer selected from the primer (IchiR) having the nucleotide sequence (CTATTTCCCATCCAATAGTCT) shown in SEQ ID NO: 70, wherein the combinations of the forward primer and the reverse primer are primer group 6F and primer group 6R, primer group 6F and primer group 7R, primer group 6F and primer group 8R, primer group 7F and primer group 7R, primer group 7F and primer group 8R, primer group 8F and primer group 7R, primer group 8F and primer group 8R, primer group 6F and primer IchiR, and primer 1845F and primer group 7R.

[0018] More specifically, the forward primer may be selected from primers having the nucleotide sequences shown in SEQ ID NOs: 7 to 15 in the primer group 6F, from primers having the nucleotide sequences shown in SEQ ID NOs: 27 to 36 in the primer group 7F, and from primers having the nucleotide sequences shown in SEQ ID NOs: 48 to 58 in the primer group 8F. The reverse primer may be selected from primers having the nucleotide sequences shown in SEQ ID NOs: 17 to 22, 24, and 25 in the primer group 6R, from primers having the nucleotide sequences shown in SEQ ID NOs: 38 to 46 in the primer group 7R, and from primers having the nucleotide sequences shown in SEQ ID NOs: 59 to 67 in the primer group 8R.

[0019] In the present invention, the forward primer and reverse primer are used in the sense that they are commonly used by those skilled in the art, where the forward primer means a primer designed to bind to the antisense strand of the cdt-II gene, and the reverse primer means a primer designed to bind to the sense strand of the cdt-II gene.

[0020] The binding position of each primer in the cdt-II gene is shown in Figures 1 and 2. The numbers shown in Figure 1 indicate the base position from the 5' end of the cdt-II gene. Furthermore, 6F, 7F, 8F, 6R, 7R, and 8R shown in Figures 1 and 2 respectively indicate the binding positions of representative primers in each of the primer groups 6F, 7F, 8F, 6R, 7R, and 8R, namely, primer (6F) consisting of the base sequence (TCAGATAGATGAATTAGGAAAAG) described in SEQ ID NO: 7, primer (7F) consisting of the base sequence (TGTGAAAACACCTGAAGAAG) described in SEQ ID NO: 27, primer (8F) consisting of the base sequence (GAGAGACTATTGGATGGGAAA) described in SEQ ID NO: 48, primer (6R) consisting of the base sequence (TTCTTCAGGTGTTTTCACA) described in SEQ ID NO: 17, primer (7R) consisting of the base sequence (CGTCATTTTTAGCAGGTTCC) described in SEQ ID NO: 38, and primer (8R) consisting of the base sequence (TGGTCTGTGTTTGGCGTTCG) described in SEQ ID NO: 59.

[0021] In the present invention, the combination of the forward primer and the reverse primer may be any combination as described above, but is preferably a combination of primer group 7F and primer group 7R, or a combination of primer group 8F and primer group 8R, and desirably a combination of primer group 8F and primer group 8R.

[0022] The target sample is not limited to a sample in which bacteria (either live or dead) carrying the cdt-II gene may be present, but may be any sample in which the cdt-II gene may be present, such as vomit, feces, food, etc., from various animals, including humans, cows, pigs, dogs, and cats. For amplification, these samples may be used directly as samples, but preferably, template DNA (template DNA) for amplification extracted from these samples is used. Extraction and preparation of template DNA are not particularly limited, and can be obtained by conventional methods.

[0023] The concentration of the primers used and the amount of the template used are not limited and can be adjusted as appropriate. In the present invention, in addition to the primers (primer set), buffers and DNA polymerases that are commonly used in PCR are also used for amplification. These buffers and DNA polymerases are not limited and the concentrations used can be appropriately determined by those skilled in the art.

[0024] Examples of buffers include TRIS, TRICINE, BIS-TRICINE, HEPES, MOPS, TES, TAPS, PIPES, and CAPS. In addition, the PCR reaction solution contains about 1.0 to 5 mM Mg. 2+ It is preferable to carry out the reaction in the presence of KCl, and the reaction can also be carried out in the presence of KCl.

[0025] As the DNA polymerase, a publicly known polymerase, preferably derived from a thermostable bacterium, can be used, and examples of commercially available polymerases (hereinafter, each is a trade name) include Taq DNA polymerase and Tth DNA polymerase belonging to family A (PolI type), and KOD DNA polymerase, Pfu DNA polymerase, Pwo DNA polymerase, Ultima DNA polymerase, and PrimeSTAR DNA polymerase belonging to family B (α type). The thermostable DNA polymerase is not limited to an extract, and may be a recombinant one, or may be a mutant having an amino acid sequence in which one to several amino acids are deleted, substituted, added, or inserted in the amino acid sequence of a natural polymerase. One or more types of DNA polymerase are used.

[0026] The amplification conditions in the amplification step (such as amplification temperature, amplification cycle, and holding time) can be set based on the common knowledge of those skilled in the art who perform PCR. As an example, the conditions described in the Examples are shown.

[0027] The possibility of contamination is judged by the presence or absence of an amplified product amplified in the amplification step and its amount. Methods for judging the presence or absence or amount of an amplified product include the electrophoresis method in which the amplified product in the reaction solution after the amplification step is electrophoresed, the cycling probe method or the probe method (5' nuclease method) using a fluorescent substance, and the intercalator method. All of these judgment methods are publicly known. Any of the judgment methods can be used to judge the possibility of contamination, but the intercalator method, which can be used as a relatively simple method for real-time PCR, is preferred.

[0028] The intercalator used in the intercalator method is not particularly limited as long as it is a fluorescent substance that emits fluorescence by being inserted between double-stranded DNA and is quenched by dissociation of the double-stranded DNA. For example, commercially available intercalators (hereinafter, the respective names are trade names) include, for example, Ethidium bromide, cyanine dyes (e.g., TOTO, YOYO, BOBO, POPO), SYBR Green I, SYBR Green ER, SYBR Green Gold, SYBR DX, PicoGreen, LCGreen, EvaGreen, SYTOX Green, ResoLight, Acridine orange, CyQUANT GR, SYTO 9, SYTO 10, SYTO 13, SYTO 14, SYTO 82, FUN-1, etc., but are not particularly limited. Of course, as long as the method can determine the presence or absence of an amplification product, it does not have to be the exemplified method. In addition, the intercalator method performs melting curve analysis, and the conditions for melting curve analysis can also be set based on the common sense of a person skilled in the art who performs melting curve analysis. A commercially available real-time PCR device is used for PCR amplification and melting curve analysis, and the conditions for melting curve analysis can be set according to the operation manual of the real-time PCR device used.

[0029] The measurement kit in the present invention is a measurement kit for determining the possibility of contamination by the cdt-II gene, and includes at least one pair of the primer set. This measurement kit is used to amplify the cdt-II gene present in a target sample and examine the possibility of contamination by a bacterium carrying the cdt-II gene, and may include a buffer, a DNA polymerase, a cycling probe for detecting the amplified product, an intercalator, and the like in addition to the primer set.

[0030] The present invention will now be described in further detail with reference to the following examples. However, it goes without saying that the present invention is not limited to the following examples. EXAMPLES

[0031] The base sequences of the cdt-II gene (consensus sequence: majority sequence) were obtained by analyzing the base sequences of the cdt-II gene for 38 strains shown in Table 1 that were identified as E. albertii strains of known origin. The 38 E. albertii strains for which the consensus sequence was determined include the type strain (ATCC), E. albertii (Albert19982), but the other 37 strains do not all have the same base sequence as the type strain, and single nucleotide polymorphisms were found throughout the cdt-II gene, including the region of the base sequence shown in Figure 1 (1300th to 1940th bases that were found to be relatively highly conserved). Based on the consensus sequence of this cdt-II gene, the base sequences of the cdt-I gene (NT3363-cdtI), cdt-III gene (PII4-cdtIII), cdt-IV gene (P159-cdtIV), and cdt-V gene (P336-cdtV), as well as the base sequences of the cdt gene (JHI-Prcdt) of Providencia rustigianii (JHI strain), which is considered to have a relatively high homology to the cdt-II gene of P. albati, and the cdt gene (AH31-Pacdt) of P. alcalifaciens (AH31 strain), primer sets Set1 to Set8 shown in Table 2 were created and real-time PCR was performed.For each set in the sample name (Sample Name) in Table 2, the start position of the forward side (upper row) and the number of bases of the primer and the start position of the reverse side (lower row) and the number of bases of the primer are shown. For example, the forward primer of Set 6 is a primer (6F) having a base sequence shown in SEQ ID NO: 7 consisting of 23 bases starting from the 1672nd base, the reverse primer is a primer (6R) having a base sequence shown in SEQ ID NO: 17 consisting of 19 bases starting from the 1816th base, the forward primer of Set 7 is a primer (7F) having a base sequence shown in SEQ ID NO: 27 consisting of 20 bases starting from the 1798th base, the reverse primer is a primer (7R) having a base sequence shown in SEQ ID NO: 38 consisting of 20 bases starting from the 1915th base, the forward primer of Set 8 is a primer (8F) having a base sequence shown in SEQ ID NO: 48 consisting of 21 bases starting from the 1770th base, and the reverse primer is a primer (8R) having a base sequence shown in SEQ ID NO: 59 consisting of 20 bases starting from the 1872th base. As a result, it was determined that the primer sets Set 1 to Set 5 did not show sufficient separation in the Tm values ​​(the temperature at which 50% of double-stranded DNA is judged to dissociate into single-stranded DNA: ℃) in melting curve analysis, and that it was not possible to detect M. albertii strains separately from other bacterial species from the electrophoretic images of the amplified products (not shown).

[0032] [Table 1]

[0033] [Table 2]

[0034] Next, the primer sets Set 6 to Set 8 were used to examine specificity, that is, whether they could be detected in distinction from other bacterial species. The target bacterial species were 67 strains in total, including 39 strains of E. albertii and 28 strains of 26 species other than E. albertii, as shown in Table 3.

[0035] Template DNA was prepared from bacteria according to standard methods, and a reaction solution was prepared by adding water to 1 μL of template DNA solution, 10 μL of DNA polymerase solution (Go Taq qPCR Master Mix: product name of Promega Corp.), 7 μL each of forward primer solution (10 μM) and reverse primer solution (10 μM) to a total volume of 20 μL.

[0036] The solution was amplified under the conditions shown in Table 4, and then a melting curve analysis was performed (hereinafter, real-time PCR was performed under the same conditions). As a result, regardless of which primer set was used, Tm values ​​were observed for all of the Bacillus albertii strains, and the cdt-II gene was amplified. On the other hand, no Tm values ​​were observed for the other 28 strains, and it was confirmed that only the cdt-II gene possessed by Bacillus albertii could be detected. [Table 3]

[0037] [Table 4]

[0038] Next, a comparison was made between real-time PCR using the primer set of Set8 and the Eacdt method (real-time PCR using the primer set of IchiF and IchiR) in Non-Patent Document 1. Raccoons, which are often infected with Burkholderia alberti, were used as subjects. After swabbing the rectum of the raccoon to collect a sample, the sample was suspended in PBS and then diluted 10 times with TSB. After centrifugation, the precipitate was decomposed with sodium hydroxide solution and neutralized with acid to prepare template DNA. The results are shown in Table 5. As a result, the positive detection rate was improved from 67% in the Eacdt method to 77%. The primer set of IchiF and IchiR in Non-Patent Document 1 was designed from a highly conserved region in the cdt-II gene possessed by E. coli, which was classified as CTEC-II (cdt-II gene-carrying E. coli).

[0039] [Table 5] EXAMPLES

[0040] The modified primers shown in Tables 6 to 8 were prepared based on the primer sets of Sets 6 to 8, and detection of E. albertii AKT5 was attempted. Table 6 shows the modified primers based on the primers of Set 6 (1672F: 6F in Figure 1 and 1816R: 6R in Figure 1), Table 7 shows the modified primers based on the primers of Set 7 (1798F: 7F in Figure 1 and 1915R: 7R in Figure 1), and Table 8 shows the modified primers based on the primers of Set 8 (1770F: 8F in Figure 1 and 1872R: 8R in Figure 1). The upper row of each table shows the forward primer, and the lower row of each table shows the reverse primer. In each table, real-time PCR was performed using a primer set that combines the modified forward primer with the unmodified reverse primer, and real-time PCR was performed using a primer set that combines the modified reverse primer with the unmodified forward primer. The numbers in parentheses in the tables indicate the Tm values.

[0041] [Table 6]

[0042] [Table 7]

[0043] [Table 8] EXAMPLES

[0044] Since each primer set of Set 6 to Set 8 amplifies a region of about 250 bp at most, the forward primers and reverse primers in these sets were combined with each other to form Set A to Set I (see FIG. 3), and detection of E. albertii (Eacdt), P. rustigainii (Prcdt), and E. coli (CTEC-III) was attempted. Here, as forward and reverse primers, a primer (6F) consisting of the nucleotide sequence of SEQ ID NO: 7, a primer (7F) consisting of the nucleotide sequence of SEQ ID NO: 27, a primer (8F) consisting of the nucleotide sequence of SEQ ID NO: 48, a primer (1845F) consisting of the nucleotide sequence of SEQ ID NO: 68, a primer (6R) consisting of the nucleotide sequence of SEQ ID NO: 17, a primer (7R) consisting of the nucleotide sequence of SEQ ID NO: 38, a primer (8R) having the nucleotide sequence of SEQ ID NO: 59, and a primer (IchiR) consisting of the nucleotide sequence of SEQ ID NO: 70 were used. It should be noted that detection was not attempted for the combination of primer (8F) and primer (6R) and the combination of primer (7F) and primer (6R) because the amplified region was narrow, etc. The results are shown in Figures 3 and 4. In addition, we attempted to detect E. albertii (Eacdt) in the feces of raccoons for Sets A, B, D, and I, which showed particularly good detection. The results are shown in Table 9. The strain names (Strain ID) in Table 9 indicate the strain names detected in the rectum of raccoons captured in the wild.

[0045] [Table 9]

Claims

1. A method for determining the possibility of contamination with Escherichia alberti, comprising: a step of contacting a sample to be determined or DNA extracted from the sample with the sample to amplify a target gene fragment in the sample; A method using the following primer set in the step of amplifying the target gene fragment: A primer consisting of the base sequence shown in SEQ ID NO: 48; A primer consisting of the base sequence shown in SEQ ID NO:59; A primer set consisting of

2. A method for determining the possibility of contamination with Escherichia alberti, comprising: a step of contacting a sample to be determined or DNA extracted from the sample with the sample to amplify a target gene fragment in the sample; A method using the following primer set in the step of amplifying the target gene fragment: A primer consisting of the base sequence shown in SEQ ID NO: 48; A primer selected from a group of primers consisting of the base sequences represented by SEQ ID NOs: 59 to 67; A primer set consisting of

3. A method for determining the possibility of contamination with Escherichia alberti, comprising: a step of contacting a sample to be determined or DNA extracted from the sample with the sample to amplify a target gene fragment in the sample; A method using the following primer set in the step of amplifying the target gene fragment: A primer selected from a group of primers consisting of the base sequences represented by SEQ ID NOs: 48 to 58; A primer consisting of the base sequence shown in SEQ ID NO:59; A primer set consisting of

4. A primer set for amplifying a partial region of a type II cytolethal distending toxin gene of Escherichia alberti, comprising: A primer consisting of the base sequence shown in SEQ ID NO: 48; A primer consisting of the base sequence shown in SEQ ID NO:59; A primer set consisting of:

5. A primer set for amplifying a partial region of a type II cytolethal distending toxin gene of Escherichia alberti, comprising: A primer consisting of the base sequence shown in SEQ ID NO: 48; A primer selected from a group of primers consisting of the base sequences represented by SEQ ID NOs: 59 to 67; A primer set consisting of:

6. A primer set for amplifying a partial region of a type II cytolethal distending toxin gene of Escherichia alberti, comprising: A primer selected from a group of primers consisting of the base sequences represented by SEQ ID NOs: 48 to 58; A primer consisting of the base sequence shown in SEQ ID NO:59; A primer set consisting of:

7. A measurement kit for determining the possibility of contamination by Escherichia alberti, comprising: A measuring kit comprising the primer set according to any one of claims 4 to 6.

Images