Compositions and methods for reducing HLA-A in cells

Abstract

For example, compositions and methods for reducing HLA-A protein expression in cells, including genetically modifying HLA-A for use in adoptive cell transfer therapy.

Description

[Technical Field]

[0001] This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 130,095, filed December 23, 2020, U.S. Provisional Application No. 63 / 250,996, filed September 30, 2021, U.S. Provisional Application No. 63 / 254,970, filed October 12, 2021, and U.S. Provisional Application No. 63 / 288,492, filed December 10, 2021, the disclosures of each of which are incorporated herein by reference in their entirety.

[0002] This application is filed with an electronic Sequence Listing. The Sequence Listing is provided as a file entitled "2021-12-20_01155-0036-00PCT_Seq_List_ST25.txt," created on December 20, 2021, and is 320,511 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0003] I. Introduction and Overview The ability to downregulate MHC class I is important for many in vivo and ex vivo applications, for example, when using allogeneic cells (derived from donors) for transplantation and / or for example, to generate cell populations in vitro that do not activate T cells. In particular, the transplantation of allogeneic cells into a subject is of great interest in the field of cell therapy. The use of allogeneic cells is limited by the problem of rejection by the recipient subject's immune cells, which recognize the transplanted cells as foreign and launch attacks. To avoid the problem of immune rejection, cell-based therapy focuses on an autologous approach, which uses the subject's own cells as the cell source for therapy, but this approach is time-consuming and expensive.

[0004] Typically, immune rejection of allogeneic cells results from mismatching of major histocompatibility complex (MHC) molecules between the donor and recipient. Within the human population, MHC molecules exist in various forms, including, for example, numerous genetic variants, or alleles, of any given MHC gene that encode different forms of MHC proteins. The primary classes of MHC molecules are referred to as MHC class I and MHC class II. MHC class I molecules (e.g., HLA-A, HLA-B, and HLA-C in humans) are expressed on all nucleated cells and present antigens to activate cytotoxic T cells (CD8+ T cells or CTLs). MHC class II molecules (e.g., HLA-DP, HLA-DQ, and HLA-DR in humans) are expressed only on certain cell types (e.g., B cells, dendritic cells, and macrophages) and present antigens to activate helper T cells (CD4+ T cells or Th cells), which in turn provide signals to B cells to produce antibodies.

[0005] Slight differences in MHC alleles between individuals, such as mismatches, can activate T cells in the recipient. During T cell development, an individual's T cell repertoire is tolerant to its own MHC molecules, but T cells that recognize another individual's MHC molecules can persist in the circulation and are called alloreactive T cells. Alloreactive T cells can be activated, for example, by the presence of another individual's cells expressing MHC molecules in the body, causing, for example, graft-versus-host disease and transplant rejection.

[0006] Although perfect matching of HLA types between donor and recipient is theoretically possible as a means of reducing transplant rejection, such an approach would be logistically and practically challenging to achieve perfect matching of, for example, 10 of 10 alleles (i.e., two alleles for each of HLA-A, HLA-B, HLA-C, HLA-DRB1, and HLA-DQB1) given the diversity of HLA alleles across the population.

[0007] For example, methods and compositions for reducing the susceptibility of allogeneic cells to rejection, including reducing the expression of MHC proteins in cells to avoid recipient T cell responses, are of interest.In fact, the ability to genetically modify allogeneic cells for transplantation into subjects has been hindered by the requirement for multiple gene editing to reduce all MHC protein expression while simultaneously avoiding other harmful recipient immune responses.For example, strategies to deplete MHC class I proteins can reduce the activation of CTLs, but cells that lack MHC class I on their surface are susceptible to lysis by natural killer (NK) cells of the immune system, because NK cell activation is regulated by MHC class I-specific inhibitory receptors.Therefore, it has proven difficult to safely reduce or eliminate the expression of MHC class I.

[0008] Gene editing strategies to deplete MHC class II molecules have also proven challenging, particularly in certain cell types, for reasons including low editing efficiency and poor cell viability, hindering their practical application as cell therapies.

[0009] Thus, there is a need for improved methods and compositions for modifying allogeneic cells to overcome the problems of recipient immune rejection and the technical difficulties associated with the multiple genetic modifications required to produce safer cells for transplantation.

[0010] The present disclosure provides engineered human cells with reduced or eliminated surface expression of HLA-A compared to unmodified cells, where the cells are homozygous for HLA-B and homozygous for HLA-C. Thus, the engineered human cells disclosed herein offer a "partial matching" approach to the problem of allogeneic cell transplantation and MHC class I compatibility. The use of cells homozygous for HLA-B and HLA-C reduces or eliminates HLA-A expression within the cells. Furthermore, the disclosed partial matching approach requires only one matching HLA-B allele (rather than two) and one HLA-C allele (rather than two), thereby limiting the number of donors required to provide therapy that covers the majority of recipients in a population. Surprisingly, the engineered human cells disclosed herein with reduced or eliminated surface expression of HLA-A compared to unmodified cells exhibit persistence and are protective against NK-mediated rejection, particularly compared to engineered cells with reduced or eliminated B2M expression. The present disclosure provides methods and compositions for generating such engineered human cells, which have reduced or eliminated surface expression of HLA-A compared to unmodified cells, and the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the present disclosure provides engineered human cells, as well as methods and compositions for generating engineered human cells, where the cells further have reduced expression of MHC class II proteins on the surface of the cells, e.g., the cells have a genetic modification in the CIITA gene. In some embodiments, the present disclosure provides further manipulation of the cells, including reducing or eliminating expression of endogenous T cell receptor proteins (e.g., TRAC, TRBC) and introducing exogenous nucleic acids, e.g., encoding polypeptides expressed on the cell surface or secreted by the cells. Thus, the present disclosure provides a flexible platform for genetically engineering human cells for a variety of desired adoptive cell therapy purposes.

[0011] Provided herein are engineered human cells comprising a genetic modification in the HLA-A gene that reduces or eliminates surface expression of HLA-A compared to unmodified cells, wherein the cells are homozygous for HLA-B and homozygous for HLA-C. Also provided are engineered human cells comprising a genetic modification in the HLA-A gene that reduces or eliminates surface expression of HLA-A compared to unmodified cells, wherein the genetic modification comprises at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619, wherein the cells are homozygous for HLA-B and homozygous for HLA-C.

[0012] Provided herein are engineered human cells that reduce or eliminate surface expression of HLA-A compared to unmodified cells and comprise genetic modifications in the HLA-A gene, the genetic modifications being chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29942884-29942884, and chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.

[0013] Provided herein are engineered human cells that reduce or eliminate surface expression of HLA-A compared to unmodified cells and comprise genetic modifications in the HLA-A gene, the genetic modifications being chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29942883-29942903, chr6:29942884-29942884, and chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.

[0014] Provided herein are methods for generating engineered human cells that reduce or eliminate surface expression of HLA-A protein compared to unmodified cells, wherein the cells are homozygous for HLA-B and homozygous for HLA-C, and the cells are subjected to a target site comprising (a) a target site comprising (i) a guide sequence selected from SEQ ID NOs: 1-211, or (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-211, or (iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-211, or (iv) a genomic region listed in Tables 2-5. or (v) a guide sequence that is complementary to at least 17, 18, 19, or 20 contiguous nucleotides of a genomic region listed in Tables 1-2 and 5, or a guide sequence that is complementary to at least 17, 18, 19, 20, 21, 22, 23, or 24 contiguous nucleotides of a genomic region listed in Table 4; or (vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v), and optionally (b) an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent.

[0015] Provided herein is a method for reducing surface expression of HLA-A protein in human cells compared to unmodified cells, comprising: (a) modifying the cells with a guide sequence that binds to a target site comprising (i) a guide sequence selected from SEQ ID NOs: 1-211; or (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-211; or (iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-211; or (iv) a guide sequence that binds to a target site comprising a genomic region listed in Tables 2-5; or (v) a guide sequence that binds to a target site comprising a genomic region listed in Tables 1-2 and 5. or a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (vi)(v), and optionally (b) a composition comprising: (a) an HLA-A guide RNA comprising a guide sequence that is complementary to at least 17, 18, 19, or 20 contiguous nucleotides of a genomic region listed in Table 4; or a guide sequence that is complementary to at least 17, 18, 19, 20, 21, 22, 23, or 24 contiguous nucleotides of a genomic region listed in Table 4; or (b) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); and optionally (b) an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent.

[0016] Provided herein are methods of administering engineered cells to a recipient subject in need thereof, the method comprising: (a) determining the recipient subject's HLA-B and HLA-C alleles; (b) selecting an engineered cell or cell population of any one of the preceding embodiments, or an engineered cell or cell population produced by the method of any one of the preceding embodiments, wherein the engineered cell comprises at least one of the same HLA-B or HLA-C alleles as the recipient subject; and (c) administering the selected engineered cell to the recipient subject.

[0017] Further embodiments are provided and described throughout the claims and drawings. [Brief explanation of the drawings]

[0018] [Figure 1] Figures 1A and 1B show the percentage of HLA-A2-negative activated T cells by flow cytometry. Figure 1A shows data for guides (G018997, G018998, G018999, G019000, G019008, G013006). Figure 1B shows data for guides (G018091, G018933, G018935, G018954, G018995, G018996). [Figure 2] Optionally, the resistance to NK cell-mediated killing of HLA-A knockout (HLA-B / C matched) versus B2M knockout T cells containing an exogenous HLA-E construct is shown as percent T cell lysis, comparing HLA-A knockout, HLA-A, CIITA double knockout, B2M knockout, B2M+HLA-E, and wild-type cells. [Figure 3A] Figure 3 shows the results of serial editing in CD8+ T cells. Figure 3A shows the percentage of HLA-A positive cells. [Figure 3B] Figure 3B shows the results of sequential editing in CD8+ T cells. Figure 3B shows the percentage of MHC class II positive cells. [Figure 3C] Figure 3C shows the results of sequential editing in CD8+ T cells. Figure 3C shows the percentage of WT1 TCR-positive CD3+, Vb8+ cells. [Figure 3D] Figure 3D shows the results of sequential editing in CD8+ T cells. Figure 3D shows the percentage of cells displaying mismatched TCRs. [Figure 3E] Figure 3D shows the results of sequential editing in CD8+ T cells. Figure 3E shows the percentage of CD3+, vb8- cells that express only the endogenous TCR. [Figure 3F] Figure 3F shows the results of sequential editing in CD8+ T cells. Figure 3F shows the percentage of CD3+, Vb8+ cells positive for WT1 TCR and negative for HLA-A and MHC class II. [Figure 4A] Figure 4 shows the results of serial editing in CD4+ T cells. Figure 4A shows the percentage of HLA-A positive cells. [Figure 4B]Figure 4B shows the results of sequential editing in CD4+ T cells. Figure 4B shows the percentage of MHC class II positive cells. [Figure 4C] Figure 4C shows the results of sequential editing in CD4+ T cells. Figure 4C shows the percentage of WT1 TCR-positive CD3+, Vb8+ cells. [Figure 4D] Figure 4D shows the results of sequential editing in CD4+ T cells. Figure 4D shows the percentage of cells displaying mismatched TCRs. [Figure 4E] Figure 4D shows the results of sequential editing in CD4+ T cells. Figure 4E shows the percentage of CD3+, vb8- cells that express only the endogenous TCR. [Figure 4F] Figure 4F shows the results of serial editing in CD4+ T cells. Figure 4F shows the percentage of CD3+, Vb8+ cells positive for WT1 TCR and negative for HLA-A and MHC class II. [Figure 5A] Shown is the percent of indels after sequential editing of T cells for CIITA in T cells (Figure 5A). [Figure 5B] Shown is the percent of indels after serial editing of T cells for HLA-A (Figure 5B) in T cells. [Figure 5C] Shown is the percentage of indels after serial editing of T cells of TRBC1 (Figure 5C) in T cells. [Figure 5D] Shown is the percentage of indels after serial editing of T cells of TRBC2 (Figure 5D) in T cells. [Figure 6A] Figure 6A shows luciferase expression from B2M, CIITA, HLA-A, or double (HLA-A, CIITA) knockout human T cells administered to mice inoculated with human natural killer cells. Figure 6B shows the luminance (photons / s / cm / sr) from luciferase-expressing T cells present at various time points after injection. [Figure 6B]Figure 6B shows luciferase expression from B2M, CIITA, HLA-A, or double (HLA-A, CIITA) knockout human T cells administered to mice inoculated with human natural killer cells. Figure 6B shows the luminance (photons / s / cm / sr) from luciferase-expressing T cells present in the various mouse groups on day 27. [Figure 7] Figures 7A-B show luciferase expression from B2M and AlloWT1 knockout human T cells administered to mice inoculated with human natural killer cells. Figure 7A shows the total flux (p / s) from luciferase-expressing T cells present at various time points after injection. Figure 7B shows the total flux (p / s) from luciferase-expressing T cells present in various mouse groups 31 days later. [Figure 8A] Shown are the normalized percent proliferation of host CD4 (FIG. 8A) or host CD8 (FIG. 8B) T cells induced by HLA class I+HLA class II double knockout or HLA-A and HLA class II double knockout engineered autologous or allogeneic T cells. [Figure 8B] Shown are the normalized percent proliferation of host CD4 (FIG. 8A) or host CD8 (FIG. 8B) T cells induced by HLA class I+HLA class II double knockout or HLA-A and HLA class II double knockout engineered autologous or allogeneic T cells. [Figure 9A] Panels showing percent CD8+ (Figure 9A) are shown. [Figure 9B] Panel shows endogenous TCR+ (Figure 9B). [Figure 9C] The panel shows WT1 TCR+ (Figure 9C). [Figure 9D] A panel of HLA-A2 knockout (Figure 9D) is shown. [Figure 9E] A panel of HLA-DRDPDQ knockout (Figure 9E) is shown. [Figure 9F] The panel shows %Allo WT1 (Figure 9F). [Figure 10] The total flux (p / s) from luciferase-expressing T cells present at various time points post-injection up to 18 days is shown. [Figure 11] Figures 11A-11B show the release of IFN-γ and IL-2 in the supernatants from killing assays containing co-cultures of engineered T cells from Allo-WT1, Auto-WT1, TCR KO, and wild-type (WT) groups with target tumor cells, respectively. [Figure 12A] Figure 12 shows the CIITA, HLA-A, TRAC, and TRBC editing and WT1 TCR insertion rates in CD8+ T cells under three conditions. The percentage of cells expressing the relevant cell surface proteins after sequential T cell manipulations is shown for CD8+ T cells in Figure 12A. [Figure 12B] Figure 12B shows the rates of CIITA, HLA-A, TRAC, and TRBC editing and WT1 TCR insertion in CD8+ T cells under three conditions. The percentage of T cells with all intended edits (WT1-TCR insertion combined with HLA-A and CIITA knockout) is shown. [Figure 13] Shown is the percent lysis of T cells targeted by NK cells at different effector:target (E:T) ratios treated with sgRNA and base editor and UGI mRNA. [Figure 14] The mean percentage of CD8+ T cells negative for the HLA-A surface receptor is shown after treatment with sgRNA in the form of a 100mer or 91mer targeting HLA-A. [Figure 15A] Shows HLA-A gene editing correlation to protein knockout in donors A to C, respectively. [Figure 15B] Shows HLA-A gene editing correlation to protein knockout in donors A to C, respectively. [Figure 15C] Shows HLA-A gene editing correlation to protein knockout in donors A to C, respectively. DETAILED DESCRIPTION OF THE INVENTION

[0019] The present disclosure provides engineered human cells, as well as methods and compositions for genetically modifying human cells to generate engineered human cells that are useful, for example, in adoptive cell transfer (ACT) therapy. The present disclosure provides engineered human cells that have reduced or eliminated surface expression of HLA-A compared to unmodified cells, and the cells are homozygous for HLA-B and homozygous for HLA-C. Thus, the engineered human cells disclosed herein offer a "partial matching" solution to the hurdles associated with allogeneic cell transplantation.

[0020] In some embodiments, the present disclosure provides engineered human cells having reduced or eliminated surface expression of HLA-A as a result of genetic modification in the HLA-A gene, wherein the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the present disclosure provides compositions and methods for reducing or eliminating expression of HLA-A protein compared to unmodified cells, as well as compositions and methods for reducing the susceptibility of cells to immune rejection. In some embodiments, engineered human cells having reduced or eliminated surface expression of HLA-A compared to unmodified cells are not susceptible to lysis by NK cells, a problem observed with other approaches that reduce or eliminate MHC class I protein expression. In some embodiments, the methods and compositions include genetically modifying HLA-A using a gene editing system to reduce or eliminate surface expression of HLA-A protein, and inserting into the cells by genetic modification an exogenous nucleic acid or other polypeptide (expressed on the cell surface or secreted) encoding a targeting receptor. The engineered cell compositions produced by the methods disclosed herein have desirable properties including, for example, reduced expression of HLA-A, reduced immunogenicity in vitro and in vivo, increased survival time, and increased genetic compatibility with larger recipients for transplantation.

[0021] The term "about" or "approximately" refers to an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, or on the degree of variation that does not materially affect the properties of the described subject matter or tolerance accepted in the art (e.g., within 10%, 5%, 2%, or 1%). Accordingly, unless otherwise indicated, the numerical parameters set forth in the following specification and appended claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0022] A.Definition Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings:

[0023] As used herein, the term "or combinations thereof" refers to all permutations and combinations of the terms listed before it. For example, "A, B, C, or combinations thereof" is intended to include at least one of A, B, C, AB, AC, BC, or ABC, and, where order is important in a particular context, also BA, CA, CB, ACB, CBA, BCA, BAC, or CAB. Following this example, combinations containing one or more repeats of an item or term, such as BB, AAA, AAB, BBC, CBBA, CABA, etc., are expressly included. Those skilled in the art will understand that there is typically no limit to the number of items or terms in any combination unless otherwise clear from the context.

[0024] As used herein, the term "kit" refers to a packaged set of one or more polynucleotides or compositions and one or more related materials, e.g., related components such as a delivery device (e.g., a syringe), solvent, solution, buffer, instructions, or desiccant.

[0025] "Allogeneic" cells, as used herein, refer to cells derived from a donor subject of the same species as the recipient subject, where the donor and recipient subjects have genetic differences, e.g., genes at one or more loci that are not identical. Thus, for example, the cells are allogeneic to the subject to whom the cells are administered. As used herein, cells removed or isolated from a donor that are not reintroduced into the original donor are considered allogeneic cells.

[0026] "Autologous" cells, as used herein, refer to cells derived from the same subject into which the material is later reintroduced. Thus, for example, if cells are removed from a subject and then reintroduced into the same subject, the cells are considered autologous.

[0027] "β2M" or "B2M," as used herein, refers to the nucleic acid or protein sequence of "β-2 microglobulin," the human gene having accession number NC_000015 (range 44711492..44718877), reference GRCh38.p13. The B2M protein associates with MHC class I molecules as a heterodimer on the surface of nucleated cells and is required for MHC class I protein expression.

[0028] "CIITA" or "CIITA" or "C2TA" as used herein refers to the nucleic acid or protein sequence of the "class II major histocompatibility complex transactivator," the human gene having accession number NC_000016.10 (range 10866208..10941562), reference GRCh38.p13. The nuclear CIITA protein acts as a positive regulator of MHC class II gene transcription and is required for MHC class II protein expression.

[0029] As used herein, "MHC" or "MHC molecule(s)" or "MHC protein" or "MHC complex(es)" refers to a major histocompatibility complex molecule(s), including, for example, MHC class I and MHC class II molecules. In humans, MHC molecules are referred to as "human leukocyte antigen" complexes or "HLA molecules" or "HLA proteins." The use of the terms "MHC" and "HLA" is not meant to be limiting, and as used herein, the term "MHC" can be used to refer to human MHC molecules, i.e., HLA molecules. Thus, the terms "MHC" and "HLA" are used interchangeably herein.

[0030] The term "HLA-A," as used herein in the context of an HLA-A protein, refers to an MHC class I protein molecule, which is a heterodimer consisting of a heavy chain (encoded by the HLA-A gene) and a light chain (i.e., beta-2 microglobulin). The term "HLA-A" or "HLA-A gene," as used herein in the context of a nucleic acid, refers to the gene encoding the heavy chain of the HLA-A protein molecule. The HLA-A gene is also referred to as "HLA class I histocompatibility, A alpha chain," and the human gene has the accession number NC_000006.12 (29942532..29945870). It is known that there are thousands of different genotypic versions of the HLA-A gene throughout the population (and individuals can receive two different alleles of the HLA-A gene). A public database of HLA-A alleles, including sequence information, can be accessed at IPD-IMGT / HLA: www.ebi.ac.uk / ipd / imgt / hla / . All alleles of HLA-A are encompassed by the terms "HLA-A" and "HLA-A gene."

[0031] "HLA-B," as used herein in the context of nucleic acids, refers to the gene encoding the heavy chain of the HLA-B protein molecule. HLA-B is also referred to as "HLA class I histocompatibility, B alpha chain," and the human gene has the accession number NC_000006.12 (31353875..31357179).

[0032] "HLA-C," as used herein in the context of nucleic acids, refers to the gene encoding the heavy chain of the HLA-C protein molecule. HLA-C is also referred to as "HLA class I histocompatibility, C alpha chain," and the human gene has the accession number NC_000006.12 (31268749..31272092).

[0033] As used herein, the term "within genomic coordinates" includes the boundaries of a given genomic coordinate range. For example, if chr6:29942854-chr6:29942913 is given, then coordinates chr6:29942854-chr6:29942913 are encompassed. Throughout this application, referenced genomic coordinates are based on the genome annotations in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium, available on the National Center for Biotechnology Information website. Tools and methods for converting genomic coordinates between one assembly and another are known in the art and can be used to convert the genomic coordinates provided herein to corresponding coordinates in another assembly of the human genome, including conversions to previous assemblies produced by the same organization or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversions of assemblies produced by different organizations or algorithms (e.g., from GRCh38 to NCBI33, produced by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, the NCBI Genome Remapping Service available at the National Center for Biotechnology Information website, UCSC LiftOver available at the UCSC Genome Brower website, and Assembly Converter available at the Ensembl.org website.

[0034] As used herein, the term "homozygous" refers to having two identical alleles of a particular gene.

[0035] As used herein, an HLA "allele" can refer to a named HLA-A, HLA-B, or HLA-C gene, and can be defined as the first four digits of the name following "HLA-A," "HLA-B," or "HLA-C" (or the first two digits set separated by a colon, e.g.,

number

[0036] "Matching" or "matched" refers to alleles shared between a donor and a recipient, e.g., identical alleles.

[0037] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds comprising nucleosides or nucleoside analogs (including traditional RNA, DNA, mixed RNA-DNA, and polymers of their analogs) having nitrogenous heterocyclic bases or base analogs linked together along the backbone. The nucleic acid "backbone" can be composed of various linkages, including one or more of sugar phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT Publication No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2' methoxy or 2' halide substitutions. The nitrogenous bases can be the traditional bases (A, G, C, T, U), their analogs (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine), derivatives of inosine, purine, or pyrimidine (e.g., N 4-methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with a substituent at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with a substituent at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 -alkyl-pyrimidines, U.S. Pat. No. 5,378,825 and PCT Publication No. WO 93 / 13121. For a general discussion, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., eds., 11th ed., 1992). Nucleic acids can contain one or more "abasic" residues, in which the backbone does not contain a nitrogenous base at one or more positions in the polymer (U.S. Pat. No. 5,585,481). Nucleic acids can contain only conventional RNA or DNA sugars, bases, and linkages, or can contain both conventional building blocks and substitutions (e.g., conventional bases with 2' methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs), which are analogs containing one or more LNA nucleotide monomers that have a bicyclic furanose unit locked to an RNA-mimetic sugar structure, enhancing hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties and can differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.

[0038] "Guide RNA," "gRNA," and simply "guide" are used interchangeably herein to refer, for example, to a guide that directs an RNA-guided DNA-binding agent to a target DNA, and can be a single guide RNA or a combination of crRNA and trRNA (also known as tracrRNA). Exemplary gRNAs include modified or unmodified forms of Class II Cas nuclease guide RNAs. The crRNA and trRNA can associate as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA strands (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to each type. The trRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or variations compared to the naturally occurring sequence.

[0039] As used herein, a "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct the guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA-binding agent. A "guide sequence" may also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence may be 20 base pairs in length, for example, in the case of Streptococcus pyogenes (i.e., Spy Cas9 (SpCas9)) and related Cas9 homologs / orthologs. Shorter or longer sequences, e.g., 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, can also be used as a guide. In some embodiments, the target sequence is, for example, within a gene or on a chromosome, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the guide sequence and target region may be 100% complementary or identical. In other embodiments, the guide sequence and target region may contain at least one mismatch. For example, the guide sequence and target sequence may contain one, two, three, or four mismatches, and the total length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and target region may contain one to four mismatches, and the guide sequence comprises at least 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and target region may contain one, two, three, or four mismatches, and the guide sequence comprises 20 nucleotides.

[0040] Because the nucleic acid substrate of an RNA-guided DNA binder is a double-stranded nucleic acid, the target sequence of the RNA-guided DNA binder includes both the plus and minus strands of genomic DNA (i.e., the given sequence and the reverse complement of the sequence). Thus, when a guide sequence is said to be "complementary to a target sequence," it should be understood that the guide sequence can direct the guide RNA to bind to the reverse complement of the target sequence. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a specific nucleotide of the target sequence (e.g., the target sequence without the PAM) except that T is replaced with U in the guide sequence.

[0041] As used herein, "RNA-guided DNA binding agent" refers to a polypeptide or polypeptide complex having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, where the DNA-binding activity is sequence-specific and dependent on the sequence of the RNA. Exemplary RNA-guided DNA binding agents include Cas cleavase / nickases and their inactivated forms ("dCas DNA binding agents"). As used herein, "Cas nucleases," also referred to as "Cas proteins," encompass Cas cleavase, Cas nickase, and dCas DNA binding agents. Cas cleavase / nickases and dCas DNA binding agents include the Csm or Cmr complex of type III CRISPR systems, Cas10, Csm1, or their Cmr2 subunits, the Cascade complex of type I CRISPR systems, their Cas3 subunits, and class 2 Cas nucleases. As used herein, a "class 2 Cas nuclease" is a single-chain polypeptide with RNA-guided DNA binding activity. Class 2 Cas nucleases include Class 2 Cas cleavase / nickases that further have RNA-guided DNA cleavase or nickase activity (e.g., H840A, D10A, or N863A variants), and Class 2 dCas DNA binders in which the cleavase / nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and modifications thereof. The Cpf1 protein, Zetsche et al., Cell, 163:1-13 (2015), is homologous to Cas9 and contains a RuvC-like nuclease domain. The Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Tables S1 and S3 of Zetsche.See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0042] As used herein, the term "editor" refers to an agent comprising a polypeptide capable of making modifications within a DNA sequence. In some embodiments, the editor is a cleavase, such as a Cas9 cleavase. In some embodiments, the editor is capable of deaminating bases within a DNA molecule. In some embodiments, the editor is capable of deaminating cytosine (C) in DNA. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to a cytidine deaminase. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to an APOBEC3A deaminase (A3A). In some embodiments, the editor comprises a Cas9 nickase fused to an APOBEC3A deaminase (A3A). In some embodiments, the editor is a fusion protein comprising a cytidine deaminase and an RNA-guided nickase fused to a UGI. In some embodiments, the editor lacks a UGI.

[0043] As used herein, "cytidine deaminase" means a polypeptide or complex of polypeptides capable of cytidine deaminase activity, which catalyzes the hydrolytic deamination of cytidine or deoxycytidine, typically to yield uridine or deoxyuridine. Cytidine deaminases include enzymes within the cytidine deaminase superfamily, particularly the APOBEC family of enzymes (APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups of enzymes), activation-induced cytidine deaminases (AID or AICDA), and CMP deaminases (see, e.g., Conticello et al., Mol. Biol. Evol. 22:367-77, 2005; Conticello, Genome Biol. 9:229, 2008; Muramatsu et al., J. Biol. Chem. 274:18470-6, 1999; Carrington et al., Cells 9:1690 (2020)).

[0044] As used herein, the term "APOBEC3" refers to an APOBEC3 protein, such as an APOBEC3 protein expressed by any of the seven genes (A3A-A3H) in the human APOBEC3 locus. APOBEC3s can have catalytic DNA or RNA editing activity. The amino acid sequence of APOBEC3A has been described (UniPROT Accession ID: p31941) and is included herein as SEQ ID NO: 40. In some embodiments, the APOBEC3 protein is a human APOBEC3 protein and / or a wild-type protein. Variants include sequences that differ from the wild-type APOBEC3 protein by one or more mutations (i.e., substitutions, deletions, insertions), e.g., proteins with one or more single-point substitutions. For example, truncated APOBEC3 sequences can be used, e.g., by deleting several N- or C-terminal amino acids, preferably 1 to 4 amino acids at the C-terminus of the sequence. As used herein, the term "variant" refers to allelic variants, splicing variants, and natural or artificial mutants that are homologous to the APOBEC3 reference sequence. The variants are "functional" in that they exhibit catalytic activity for DNA or RNA editing. In some embodiments, the APOBEC3 (e.g., human APOBEC3A) has a wild-type amino acid position 57 (numbered in the wild-type sequence). In some embodiments, the APOBEC3 (e.g., human APOBEC3A) has an asparagine at amino acid position 57 (numbered in the wild-type sequence).

[0045] As used herein, a "nickase" is an enzyme that creates a single-strand break (also known as a "nick") in double-stranded DNA, i.e., it cleaves one strand of the DNA double helix but not the other. As used herein, an "RNA-guided DNA nickase" refers to a polypeptide or complex of polypeptides having DNA nickase activity, where the DNA nickase activity is sequence-specific and dependent on the sequence of the RNA. Exemplary RNA-guided DNA nickases include Cas nickases. Cas nickases include the nickase forms of the Csm or Cmr complexes of type III CRISPR systems, Cas10, Csm1, or their Cmr2 subunits, the Cascade complex of type I CRISPR systems, its Cas3 subunit, and class 2 Cas nucleases. Class 2 Cas nickases include variants with RNA-guided DNA nickase activity in which only one of the two catalytic domains is inactivated. Class 2 Cas nickases include, for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and modifications thereof. The Cpf1 protein, Zetsche et al., Cell, 163:1-13 (2015), is homologous to Cas9 and contains a RuvC-like protein domain. Zetsche's Cpf1 sequences are incorporated by reference in their entirety. See, e.g., Tables S1 and S3 of Zetsche. "Cas9" encompasses S. pyogenes (Spy) Cas9, variants of Cas9 listed herein, and their equivalents.See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0046] As used herein, the term "fusion protein" refers to a hybrid polypeptide containing protein domains from at least two different proteins. One protein may be located at the amino-terminal (N-terminal) portion or the carboxy-terminal (C-terminal) portion of the fusion protein, thus forming an "amino-terminal fusion protein" or a "carboxy-terminal fusion protein," respectively. Any of the proteins provided herein can be produced by any method known in the art. For example, the proteins provided herein can be produced via recombinant protein expression and purification, which is particularly suitable for fusion proteins containing peptide linkers. Methods of recombinant protein expression and purification are well known and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012)), the entire contents of which are incorporated herein by reference.

[0047] The term "linker," as used herein, refers to a chemical group or molecule that connects two adjacent molecules or moieties. Typically, a linker is positioned between or adjacent to two groups, molecules, or other moieties and is connected to each via a covalent bond. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein), such as a 16-amino acid residue "XTEN" linker, or a variant thereof (see, e.g., the Examples, and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 900), SGSETPGTSESA (SEQ ID NO: 901), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 902).

[0048] As used herein, the term "uracil glycosylase inhibitor" or "UGI" refers to a protein that can inhibit the uracil-DNA glycosylase (UDG) base excision repair enzyme.

[0049] As used herein, the "open reading frame" or "ORF" of a gene refers to a sequence of codons that specifies the amino acid sequence of the protein encoded by the gene. An ORF begins with a start codon (e.g., ATG in DNA or AUG in RNA) and ends with a stop codon (e.g., TAA, TAG, or TGA in DNA, or UAA, UAG, or UGA in RNA).

[0050] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA that together with an RNA-guided DNA-binding agent, e.g., a Cas nuclease, e.g., a Cas cleavase, a Cas nickase, or a dCas DNA-binding agent (e.g., Cas9). In some embodiments, the guide RNA guides an RNA-guided DNA-binding agent, such as Cas9, to a target sequence, the guide RNA hybridizes to the target sequence, and an agent binds to the target sequence, where the agent is a cleavase or nickase and can perform cleavage or nicking after binding.

[0051] As used herein, a first sequence is considered to "comprise a sequence having at least X% identity to" a second sequence if alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence overall are matched by the first sequence. For example, the sequence AAGA contains a sequence having 100% identity to the sequence AAG because the alignment gives 100% identity in that there is a match at all three positions in the second sequence. Differences between RNA and DNA (generally, the exchange of thymidine for uridine, or vice versa), and the presence of nucleoside analogs such as modified uridines, do not contribute to differences in identity or complementarity between polynucleotides, as long as the related nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as their complement). Thus, for example, the sequence 5'-AXG (where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine) is considered 100% identical to AUG, in that both are perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand the selection of an appropriate algorithm and parameter settings for a given pair of sequences to be aligned. Generally, for sequences of similar length and predicted identity of greater than 50% for amino acids or 75% for nucleotides, the Needleman-Wunsch algorithm, using the default settings of the Needleman-Wunsch algorithm interface provided by EBI at the www.ebi.ac.uk web server, is generally appropriate.

[0052] "mRNA" is used herein to refer to a polynucleotide that contains an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and an aminoacylated tRNA). An mRNA can include a phosphate sugar backbone that includes ribose residues or analogs thereof (e.g., 2'-methoxyribose residues). In some embodiments, the sugars of the mRNA phosphate sugar backbone consist essentially of ribose residues, 2'-methoxyribose residues, or a combination thereof.

[0053] As used herein, "indel" refers to an insertion / deletion mutation consisting of a number of nucleotides that are either inserted or deleted within a target nucleic acid, for example, at the site of a double-strand break (DSB).

[0054] As used herein, "reduced or eliminated" expression of a protein on a cell refers to a partial or complete loss of expression of the protein relative to unmodified cells. In some embodiments, the surface expression of a protein on a cell is measured by flow cytometry and has "reduced or eliminated" surface expression compared to unmodified cells, as evidenced by a reduced fluorescent signal when stained with the same antibody against the protein. Cells that have "reduced or eliminated" surface expression of a protein by flow cytometry compared to unmodified cells can be referred to as "negative" for the expression of that protein, as evidenced by a fluorescent signal similar to that of cells stained with an isotype control antibody. "Reduced or eliminated" protein expression can be measured by other known techniques in the art, using appropriate controls known to those skilled in the art.

[0055] As used herein, "knockdown" refers to a reduction in the expression of a particular gene product (e.g., protein, mRNA, or both), for example, compared to the expression of an unedited target sequence. Protein knockdown can be measured by detecting the total cellular amount of protein from a sample, such as a tissue, fluid, or cell population of interest. It can also be measured by measuring a surrogate, marker, or activity of the protein. Methods for measuring mRNA knockdown are known and include analyzing mRNA isolated from a sample of interest. In some embodiments, "knockdown" can refer to some loss of expression of a particular gene product, for example, a reduction in the amount of transcribed mRNA, or a reduction in the amount of protein expressed by a cell or cell population (including in vivo populations such as those found in tissues).

[0056] As used herein, "knockout" refers to the loss of expression from a specific gene or the loss of a specific protein in a cell. Knockout can result in a reduction in expression below the detection level of an assay. Knockout can be measured by detecting the total cellular amount of protein in either a cell, tissue, or cell population.

[0057] As used herein, "target sequence" or "genomic target sequence" refers to a sequence of nucleic acid within a target gene that has complementarity to the guide sequence of a gRNA. The interaction between the target sequence and the guide sequence directs the RNA-guided DNA-binding agent to bind and potentially (depending on the activity of the agent) nick or cleave within the target sequence.

[0058] As used herein, "treatment" refers to any administration or application of a therapy for a disease or disorder in a subject, including inhibiting the disease, halting its progression, alleviating one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease, including the recurrence of symptoms.

[0059] Reference will now be made in detail to specific embodiments of the invention. Example embodiments of the invention are illustrated in the accompanying drawings. While the invention will be described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents that may be included within the invention as defined by the appended claims and the included embodiments.

[0060] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to particular compositions or process steps, as such may vary. It should be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "a conjugate" includes a plurality of conjugates, and a reference to, for example, "a cell" includes a plurality of cells.

[0061] Numerical ranges are inclusive of the numbers defining the range. Measured and measurable values ​​are understood to be approximate, taking into account significant orders of magnitude and the error associated with the measurements. Additionally, the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting. It should be understood that both the general description and the detailed description set forth above are exemplary and are for purposes of illustration only and not limitation of the teachings herein.

[0062] Unless otherwise stated herein, embodiments herein that recite various components as "comprising" are also assumed to "consist of" or "consist essentially of" the recited components. Embodiments herein that recite various components as "consisting of" are also assumed to "comprising" or "consisting essentially of" the recited components. Embodiments herein that recite various components as "consisting essentially of" are also assumed to "consist of" or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in its inclusive sense, i.e., equivalent to "and / or," unless the context clearly dictates otherwise.

[0063] The section headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference conflicts with any term defined herein or any other explicit content of this specification, the present specification shall control. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. To the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those skilled in the art.

[0064] B. Genetically modified cells 1. Engineered Human Cell Compositions The present disclosure provides engineered human cell compositions comprising genetic modifications in the HLA-A gene that reduce or eliminate surface expression of HLA-A compared to unmodified cells, wherein the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the engineered human cells are allogeneic cells. In some embodiments, engineered human cells with reduced HLA-A expression are useful for adoptive cell transfer therapy. In some embodiments, the engineered human cells comprise additional genetic modifications in the genome of the cells (e.g., reduction or elimination of MHC class II proteins, and / or reduction or elimination of endogenous T cell receptor (TCR) proteins, and / or introduction of exogenous nucleic acids for expression) to produce desirable cells for allogeneic transplantation purposes.

[0065] In some embodiments, the engineered human cells are an allogeneic cell therapy. In some embodiments, the engineered human cells are transferred to a recipient with the same HLA-B alleles as the engineered human cells. In some embodiments, the engineered human cells are transferred to a recipient with the same HLA-C alleles as the engineered human cells. In some embodiments, the engineered human cells are transferred to a recipient with the same HLA-B and HLA-C alleles as the engineered human cells. Thus, the engineered human cells disclosed herein provide a partial HLA match to the recipient, thereby reducing the risk of an adverse immune response.

[0066] In some embodiments, engineered human cells are provided that comprise a genetic modification in the HLA-A gene that reduces or eliminates surface expression of HLA-A compared to unmodified cells, and the cells are homozygous for HLA-B and homozygous for HLA-C.

[0067] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619, and wherein the cell is homozygous for HLA-B and homozygous for HLA-C.

[0068] In some embodiments, for each given range of genomic coordinates, the range may encompass + / - 10 nucleotides on either end of the specified coordinate. For example, given chr6:29942854-chr6:29942913, in some embodiments, a genomic target sequence or genetic modification may fall within chr6:29942844-chr6:29942923. In some embodiments, for each given range of genomic coordinates, the range may encompass + / - 5 nucleotides on either end of the range.

[0069] In some embodiments, a given range of genomic coordinates may include target sequences on both strands of DNA (i.e., the plus (+) strand and the minus (-) strand).

[0070] Genetic modification in HLA-A gene is further described herein.In some embodiments, the genetic modification in HLA-a gene comprises any one or more of the insertion, deletion, substitution or deamination of at least one nucleotide in the target sequence.

[0071] The engineered human cells described herein can comprise any HLA-A allele of the HLA-A gene.HLA genes are located on chromosome 6 in a genomic region known as the HLA superlocus, and several hundred HLA-A alleles have been reported in the art (see, for example, Shiina et al., Nature 54:15-39 (2009)).The sequences of HLA-A alleles are available in the art (see, for example, IPD-IMGT / HLA database https: / / www.ebi.ac.uk / ipd / imgt / hla / allele.html for searching the sequence of a specific HLA-A allele).

[0072] In some embodiments, the cells have reduced or eliminated expression of at least one HLA-A allele selected from HLA-A1, HLA-A2, HLA-A3, HLA-A11, and HLA-A24. In some embodiments, the cells have reduced or eliminated expression of HLA-A1. In some embodiments, the cells have reduced or eliminated expression of HLA-A2. In some embodiments, the cells have reduced or eliminated expression of HLA-A3. In some embodiments, the cells have reduced or eliminated expression of HLA-A11. In some embodiments, the cells have reduced or eliminated expression of HLA-A24.

[0073] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942864-chr6:29942903.

[0074] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-chr6:29943609.

[0075] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, and chr6:29942883-29942903.

[0076] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, and chr6:29943589-29943609.

[0077] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942876-29942897.

[0078] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-chr629943550.

[0079] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897.

[0080] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550.

[0081] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise genetic modifications in the HLA-A gene, wherein the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:299 and chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.

[0082] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942864-29942884.

[0083] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942868-29942888.

[0084] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942876-29942896.

[0085] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942877-29942897.

[0086] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942883-29942903.

[0087] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943126-29943146.

[0088] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-29943548.

[0089] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943529-29943549.

[0090] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943530-29943550.

[0091] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943537-29943557.

[0092] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943549-29943569.

[0093] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943589-29943609.

[0094] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29944026-29944046.

[0095] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and that comprise a genetic modification in the HLA-A gene, wherein the genetic modification comprises an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cells are homozygous for HLA-B. In some embodiments, the cells are homozygous for HLA-C. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0096] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise genetic modifications in the HLA-A gene, wherein the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29942883-29942903, chr6:29942884-29942884, In some embodiments, the cell comprises an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cell is homozygous for HLA-B. In some embodiments, the cell is homozygous for HLA-C. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0097] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise genetic modifications in the HLA-A gene, wherein the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-2 and chr6:29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046, wherein the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the cell is homozygous for HLA-B. In some embodiments, the cell is homozygous for HLA-C. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0098] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise genetic modifications in the HLA-A gene, wherein the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6 chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046, wherein the genetic modification comprises at least 5 consecutive nucleotides within the genomic coordinate. In some embodiments, the cell is homozygous for HLA-B. In some embodiments, the cell is homozygous for HLA-C. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0099] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise genetic modifications in the HLA-A gene, wherein the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943 chr6:29943589-29943609, and chr6:29944026-29944046, wherein the genetic modification comprises an indel, a CT substitution, or an AG substitution within a genomic coordinate selected from chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046, and wherein the genetic modification comprises at least 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 6 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 7 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 8 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 9 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the cell is homozygous for HLA-B. In some embodiments, the cell is homozygous for HLA-C. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0100] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, and comprise genetic modifications in the HLA-A gene, wherein the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:2994 and chr6:29943546, wherein the genetic modification comprises at least one CT substitution or at least one AG substitution within the genomic coordinates selected from chr6:3528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cell is homozygous for HLA-B. In some embodiments, the cell is homozygous for HLA-C. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0101] In some embodiments, HLA-A expression is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-2994 3146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr 6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:2994 4026-29944046, chr6:29934330-29934350, chr6:29943115-29943135, chr6:29943135-299 43155, chr6:29943140-29943160, chr6:29943590-29943610, chr6:29943824-29943844, ch

[0010] Provided are engineered human cells in which a gene editing system binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within a genomic coordinate selected from r6:29943858-29943878, chr6:29944478-29944498, and chr6:29944850-29944870. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.

[0102] In some embodiments, HLA-A expression is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549 , chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.

[0103] In some embodiments, the HLA-A expression is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943528-29943548, chr6:29943529-29943549 , chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, and chr6:29943589-29943609. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.

[0104] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence that comprises at least 5 contiguous nucleotides within a genomic coordinate selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, and chr6:29942883-29942903. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.

[0105] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence that comprises at least 5 contiguous nucleotides within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, and chr6:29943589-29943609. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.

[0106] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within a genomic coordinate selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.

[0107] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.

[0108] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr6:29945290-29945310, chr6:29945296-29945316, chr6:29945297-29945317, and chr6:29945300-29945320. Due to allelic polymorphism, in some embodiments, the target sequence may comprise 1, 2, or 3 mismatches from the genomic sequence of hg38. In some embodiments, the HLA-A genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate.

[0109] In some embodiments, HLA-A expression is chr6:29890117-29890137, chr6:29927058-29927078, chr6:29934330-29934350, chr6:29942541-29942561, chr6:29942542-29942562, chr6:29942543-29942563, chr6:29942543-29942563, chr6:29942550-29942570, chr6:29942864-29942884, chr6:29942868-29942 2888, chr6:29942876-29942896, chr6:29942876-29942896, chr6:29942 877-29942897, chr6:29942883-29942903, chr6:29943062-29943082, chr 6:29943063-29943083, chr6:29943092-29943112, chr6:29943115-29943 135, chr6:29943118-29943138, chr6:29943119-29943139, chr6:2994312 0-29943140, chr6:29943126-29943146, chr6:29943128-29943148, chr6 :29943129-29943149, chr6:29943134-29943154, chr6:29943134-299431 54, chr6:29943135-29943155, chr6:29943136-29943156, chr6:29943140 -29943160, chr6:29943142-29943162, chr6:29943143-29943163, chr6:2 9943188-29943208, chr6:29943528-29943548, chr6:29943529-2994354 9, chr6:29943530-29943550, chr6:29943536-29943556, chr6:29943537- 29943557, chr6:29943538-29943558, chr6:29943549-29943569, chr6:29 943556-29943576, chr6:29943589-29943609, chr6:29943590-29943610,chr6:29943590-29943610、chr6:29943599-29943619、chr6:29943600-29943620、chr6:29943601-29943621、chr6:29943602-29943622、chr6:29943603-29943623、chr6:29943774-29943794、chr6:29943779-29943799、chr6:29943780-29943800、chr6:29943822-29943842、chr6:29943824-299 43844, chr6:29943857-29943877, chr6:29943858-29943878, chr6:29943859-29943879, chr6:29943860-29943880, chr6:29944026-29944046, chr6:29944077-29944097, chr6:29944078-29944098, chr6:29944458-29944478, chr6:29944478-29944498, chr6:29944597-29944617, chr6:299446 42-29944662、chr6:29944643-29944663、chr6:29944772-29944792、chr6:29944782-29944802、chr6:29944850-29944870、chr6:29944907-29944927、chr6:29945024-29945044、chr6:29945097-29945117、chr6:29945104-29945124、chr6:29945105-29945125、chr6:29945116-29945136、chr6: 29945118-29945138, chr6:29945119-29945139, chr6:29945124-29945144, chr6:29945176-29945196, chr6:29945177-29945197, chr6:29945177-29945197, chr6:29945180-29945200, chr6:29945187-29945207, chr6:29945188-29945208, chr6:29945228-29945248, chr6:29945230-29945250,

[0010] Provided are engineered human cells in which a gene editing system binds to an HLA-A genomic target sequence that comprises at least 5 contiguous nucleotides within a genomic coordinate selected from chr6:29945231-29945251, chr6:29945232-29945252, chr6:29945308-29945328, chr6:29945361-29945381, chr6:29945362-29945382, and chr6:31382543-31382563. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binder such as S. pyogenes Cas9 or a base editor comprising S. pyogenes Cas9 nickase.

[0110] In some embodiments, HLA-A expression is chr6:29942815-29942835, chr6:29942816-29942836, chr6:29942817-29942837, chr6:29942817-29942837, chr6:29942828-29942848, chr6:29942837-29942857, chr6:29942885-29942905, chr6:29942895-29942915, chr6:29942896-299 42916, chr6:29942898-29942918, chr6:29942899-29942919, chr6:29942900-29942920, chr6:29942904-29942924, chr6:29942905 -29942925, chr6:29942912-29942932, chr6:29942913-29942933, chr6:29943490-29943510, chr6:29943497-29943517, chr6:29943 498-29943518, chr6:29943502-29943522, chr6:29943502-29943522, chr6:29943511-29943531, chr6:29943520-29943540, chr6:2 9943521-29943541, chr6:29943566-29943586, chr6:29943569-29943589, chr6:29943569-29943589, chr6:29943570-29943590, chr

[0010] In some embodiments, engineered human cells are provided in which the HLA-A genomic target sequence comprises at least 5 contiguous nucleotides within a genomic coordinate selected from chr6:29943573-29943593, chr6:29943578-29943598, chr6:29943585-29943605, chr6:29943589-29943609, chr6:29943568-29943588, and chr6:29942815-29942835. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent, such as S. pyogenes Cas9.

[0111] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr6:29942884-29942904, chr6:29943519-29943539, chr6:29942863-29942883. In some embodiments, the HLA-A genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binder, such as S. aureus Cas9.

[0112] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within a genomic coordinate selected from chr6:29943517-29943537 and chr6:29943523-29943543. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binder, such as CasX.

[0113] In some embodiments, HLA-A expression is chr6:29942845-29942869, chr6:29942852-29942876, chr6:29942865-29942889, chr6:29942891-29942915, chr6:29942895-29942919, chr6:29942903-29942927, chr6:29942904-29942928, chr6:2994351 8-29943542, chr6:29943525-29943549, chr6:29943535-29943559, chr6:29943538-29943562, chr6:29943539-299 43563, chr6:29943547-29943571, chr6:29943547-29943571, chr6:29943548-29943572, chr6:29943555-29943579 , chr6:29943556-29943580, chr6:29943557-29943581, chr6:29943558-29943582, chr6:29943559-29943583, chr6 :29943563-29943587, chr6:29943564-29943588, chr6:29943565-29943589, chr6:29943568-29943592, chr6:2994

[0003] Provided are engineered human cells in which a gene editing system binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr6:3571-29943595, chr6:29943572-29943596, chr6:29943595-29943619, chr6:29943596-29943620, and chr6:29943600-29943624. In some embodiments, the HLA-A genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent, such as Nme2 Cas9.

[0114] In some embodiments, HLA-A expression is chr6:29942885-29942905, chr6:29942895-29942915, chr6:29942896-29942916, chr6:29942898-29942918, chr6:29942899-29942919, chr6:2 9942900-29942920, chr6:29942904-29942924, chr6:29943511-29943531, chr6:299 43520-29943540, chr6:29943521-29943541, chr6:29943529-29943549, chr6:29943

[0013] Provided are engineered human cells in which HLA-A expression levels are reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence that includes at least five consecutive nucleotides within genomic coordinates selected from: chr6:29943568-29943588, chr6:29943569-29943589, chr6:29943569-29943589, chr6:29943570-29943590, chr6:29943573-29943593, chr6:29943578-29943598, chr6:29943585-29943605, and chr6:29943589-29943609. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA-binding agent, such as a base editor comprising a deaminase and S. pyogenes Cas9 nickase.

[0115] In some embodiments, HLA-A expression is chr6:29942469-29942489, chr6:29943058-29943078, chr6:29943063-29943083, chr6:29943080-29943100, chr6:29943187-29943207, chr6:29943192-29943212, chr6:29943197-29943217, chr6:29943812-29943832 , chr6:29944349-29944369, chr6:29944996-29945016, chr6:29945018-29945038, chr6:29945341-29945361, and chr6:29945526-29945546. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.

[0116] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within a genomic coordinate selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinate. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinate.

[0117] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within genomic coordinates chr6:29942876-29942897. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.

[0118] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr6:29943528-chr629943550. In some embodiments, the HLA-A genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the HLA-A genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.

[0119] In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29942864-29942884. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29942868-29942888. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29942876-29942896. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29942877-29942897. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29942883-29942903. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29943126-29943146. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29943528-29943548. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29943529-29943549.In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29943530-29943550. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29943537-29943557. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29943549-29943569. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29943589-29943609. In some embodiments, engineered human cells are provided in which HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29944026-29944046. In some embodiments, the HLA-A genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinates. In some embodiments, the HLA-A genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinates.

[0120] In some embodiments, the HLA-A genomic target sequence comprises at least 17, 19, 18, or 20 contiguous nucleotides within the genomic coordinates.

[0121] In some embodiments, the gene editing system comprises a transcription activator-like effector nuclease (TALEN). In some embodiments, the gene editing system comprises a zinc finger nuclease. In some embodiments, the gene editing system comprises a CRISPR / Cas system, such as a Class 2 system. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.

[0122] Exemplary RNA-guided DNA binding agents are shown in Table 1A below.

[0123] [Table 1]

[0124] In some embodiments, the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder comprises a Cas9 protein, hi some embodiments, the RNA-guided DNA binder is selected from one of S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g., Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpf1, Acidaminococcus sp. Cpf1, Lachnospiraceae bacterium Cpf1, a CT base editor, an AG base editor, Cas12a, Mad7 nuclease, ARCUS nuclease, and CasX. In some embodiments, the RNA-guided DNA binder comprises a polypeptide selected from one of S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g., Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpf1, Acidaminococcus sp. Cpf1, Lachnospiraceae bacterium Cpf1, a CT base editor, an AG base editor, Cas12a, and CasX.

[0125] In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is N. meningitidis Cas9, e.g., Nme2Cas9. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is S. thermophilus Cas9. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is S. aureus Cas9. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is Cpf1 from F. novicida. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is Cpf1 from Acidaminococcus sp. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is Cpf1 from Lachnospiraceae bacterium ND2006. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is a CT base editor. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is an AG base editor. In some embodiments, the base editor comprises a deaminase and an RNA-guided nickase. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase. In some embodiments, the RNA-guided nickase is SpyCas9 nickase. In some embodiments, the RNA-guided nickase comprises NmeCas9 nickase. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is Cas12a. In some embodiments, the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent is CasX.

[0126] In any of the above embodiments, the gene editing system comprises an RNA-guided DNA binding agent, or a nucleic acid encoding the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the RNA-guided DNA binding agent is a base editor. In some embodiments, the base editor comprises CT deaminase and an RNA-guided nickase, such as S. pyogenes Cas9 nickase. In some embodiments, the base editor comprises AG deaminase and an RNA-guided nickase, such as S. pyogenes Cas9 nickase.

[0127] In some embodiments, when the engineered cells are homozygous for HLA-B, the HLA-B alleles are selected from the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, The antibody is selected from any one of HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HLA-B*40:02.

[0128] In some embodiments, when the engineered cells are homozygous for HLA-C, the HLA-C alleles are selected from the following HLA-C alleles: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, The antibody is selected from any one of HLA-C*15:02, HLA-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:02.

[0129] In some embodiments, the HLA-B alleles are the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, HLA-B*51:01 , HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B Any one of *37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HLA-B*40:02 The HLA-C alleles are selected from the following: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA-C*15 ... *07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:02.

[0130] In some embodiments, the engineered cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the HLA-B and HLA-C alleles of the engineered human cells are the following HLA-B and HLA-C alleles: HLA-B*07:02 and HLA-C*07:02, HLA-B*08:01 and HLA-C*07:01, HLA-B*44:02 and HLA-C*05:01, HLA-B*35:01 and HLA-C*04:01, HLA-B*40:01 and HLA-C*03:04, HLA-B*57:01 and HLA-C*06:01. :02, HLA-B*14:02 and HLA-C*08:02, HLA-B*15:01 and HLA-C*03:03, HLA-B*13:02 and HLA-C*06:02, HLA-B*44:03 and HLA-C*16:01, HLA-B*38:01 and HLA-C*12:03, HLA-B*18:01 and HLA-C*07:01, HLA-B*44:03 and HLA-C*04:01, HLA-B*51:01 and HLA-C*15:02, HLA- B*49:01 and HLA-C*07:01, HLA-B*15:01 and HLA-C*03:04, HLA-B*18:01 and HLA-C*12:03, HLA-B*27:05 and HLA-C*02:02, HLA-B*35 :03 and HLA-C*04:01, HLA-B*18:01 and HLA-C*05:01, HLA-B*52:01 and HLA-C*12:02, HLA-B*51:01 and HLA-C*14:02, HLA-B*37:01 and and HLA-C*06:02, HLA-B*53:01 and HLA-C*04:01, HLA-B*55:01 and HLA-C*03:03, HLA-B*44:02 and HLA-C*07:04, HLA-B*44:03 and HLA-C*07:01, HLA-B*35:02 and HLA-C*04:01, HLA-B*15:01 and HLA-C*04:01, and HLA-B*40:02 and HLA-C*02:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*07:02 and HLA-C*07:02.In some embodiments, the HLA-B and HLA-C alleles are HLA-B*08:01 and HLA-C*07:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*05:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*35:01 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*40:01 and HLA-C*03:04. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*57:01 and HLA-C*06:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*14:02 and HLA-C*08:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*15:01 and HLA-C*03:03. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*13:02 and HLA-C*06:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:03 and HLA-C*16:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*38:01 and HLA-C*12:03. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*18:01 and HLA-C*07:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:03 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*51:01 and HLA-C*15:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*49:01 and HLA-C*07:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*15:01 and HLA-C*03:04. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*18:01 and HLA-C*12:03.In some embodiments, the HLA-B and HLA-C alleles are HLA-B*27:05 and HLA-C*02:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*35:03 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*18:01 and HLA-C*05:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*52:01 and HLA-C*12:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*51:01 and HLA-C*14:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*37:01 and HLA-C*06:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*53:01 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*55:01 and HLA-C*03:03. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*07:04. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:03 and HLA-C*07:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*35:02 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*15:01 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*40:02 and HLA-C*02:02.

[0131] The HLA-B and HLA-C allele combinations disclosed herein cumulatively cover approximately 88% of the population. The cumulative frequencies of HLA-B and HLA-C allele pairs are shown in Table 1B below.

[0132] [Table 2]

[0133] In some embodiments, engineered human cells that have reduced or eliminated surface expression of HLA-A, are homozygous for HLA-B, and are homozygous for HLA-C compared to unmodified cells, further reduce or eliminate surface expression of MHC class II proteins. In some embodiments, the engineered human cells have a genetic modification in a gene that reduces or eliminates surface expression of MHC class II. In some embodiments, the engineered human cells have a genetic modification in the CIITA gene. In some embodiments, the engineered human cells have a genetic modification in the HLA-DR gene. In some embodiments, the engineered human cells have a genetic modification in the HLA-DQ gene. In some embodiments, the engineered human cells have a genetic modification in the HLA-DP gene. In some embodiments, the engineered human cells have a genetic modification in the RFX gene. In some embodiments, the engineered human cells have a genetic modification in the CREB gene. In some embodiments, the engineered human cells have a genetic modification in the nuclear factor (NF)-gamma gene.

[0134] In some embodiments, engineered human cells that have reduced or eliminated surface expression of HLA-A compared to unmodified cells, are homozygous for HLA-B, and are homozygous for HLA-C, and further reduce or eliminate surface expression of TRAC protein. In some embodiments, engineered human cells that have reduced or eliminated surface expression of HLA-A compared to unmodified cells, are homozygous for HLA-B, and are homozygous for HLA-C, and further reduce or eliminate surface expression of TRBC protein.

[0135] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, comprising a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-chr6:29943609, and the engineered cells further comprise a genetic modification in a gene that reduces or eliminates surface expression of MHC class II. In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, comprising a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-chr6:29943609, and the engineered cells further comprise a genetic modification in the CIITA gene.

[0136] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, comprising a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-chr6:29943609, and the engineered cells further comprise a genetic modification in the TRAC gene. In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, comprising a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-chr6:29943609, and the engineered cells further comprise a genetic modification in the TRBC gene.

[0137] In some embodiments, engineered human cells are provided that reduce or eliminate surface expression of HLA-A compared to unmodified cells, the engineered human cells comprising a genetic modification in the HLA-A gene, wherein the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-chr6:29943609, and the engineered cells further comprise an exogenous nucleic acid. In some embodiments, the engineered cells comprise an exogenous nucleic acid encoding a targeting receptor that is expressed on the surface of the engineered cell. In some embodiments, the targeting receptor is a CAR or universal CAR. In some embodiments, the targeting receptor is a TCR. In some embodiments, the targeting receptor is a WT1 TCR. In some embodiments, the targeting receptor is a ligand for a receptor. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain) and a subunit of a TCR. In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeted receptor is a B cell receptor (BCR). In some embodiments, the engineered cell further comprises an exogenous nucleic acid encoding a polypeptide secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the secreted polypeptide is an antibody. In some embodiments, the secreted polypeptide is an enzyme. In some embodiments, the exogenous nucleic acid encodes an antibody that encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.

[0138] The engineered human cells can be any of the exemplary cell types disclosed herein. Furthermore, because MHC class I molecules are expressed on all nucleated cells, the engineered human cells can be any nucleated cell. In some embodiments, the engineered cells are immune cells. In some embodiments, the engineered cells are stem cells, such as hematopoietic stem cells (HSCs). In some embodiments, the engineered cells are induced pluripotent stem cells (iPSCs). In some embodiments, the engineered cells are mesenchymal stem cells (MSCs). In some embodiments, the engineered cells are neural stem cells (NSCs). In some embodiments, the engineered cells are limbal stem cells (LSCs). In some embodiments, the engineered cells are progenitor cells, e.g., endothelial progenitor cells or neural progenitor cells. In some embodiments, the engineered cells are tissue-specific primary cells. In some embodiments, the engineered cells are selected from chondrocytes, muscle cells, and keratinocytes. In some embodiments, the engineered cells are monocytes, macrophages, mast cells, dendritic cells, or granulocytes. In some embodiments, the engineered cells are monocytes. In some embodiments, the engineered cells are macrophages. In some embodiments, the engineered cells are mast cells. In some embodiments, the engineered cells are dendritic cells. In some embodiments, the engineered cells are granulocytes. In some embodiments, the engineered cells are lymphocytes. In some embodiments, the engineered cells are T cells. In some embodiments, the engineered cells are CD4+ T cells. In some embodiments, the engineered cells are CD8+ T cells. In some embodiments, the engineered cells are memory T cells. In some embodiments, the engineered cells are B cells. In some embodiments, the engineered cells are plasma B cells. In some embodiments, the engineered cells are memory B cells. In some embodiments, the engineered cells are macrophages.

[0139] In some embodiments, the present disclosure provides a pharmaceutical composition comprising any one of the engineered human cells disclosed herein. In some embodiments, the pharmaceutical composition comprises a population of any one of the engineered cells disclosed herein. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 65% HLA-A negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 70% HLA-A negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 80% HLA-A negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 90% HLA-A negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 91% HLA-A negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 92% HLA-A negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 93% HLA-A negative as measured by flow cytometry, hi some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 94% HLA-A negative as measured by flow cytometry.

[0140] In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 95% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 97% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 98% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 99% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 99.5% endogenous TCR protein negative as measured by flow cytometry.

[0141] In some embodiments, methods are provided for administering the engineered human cells or pharmaceutical compositions disclosed herein to a subject in need thereof. In some embodiments, methods are provided for administering the engineered human cells or pharmaceutical compositions disclosed herein to a subject as an ACT therapy. In some embodiments, methods are provided for administering the engineered human cells or pharmaceutical compositions disclosed herein to a subject as a treatment for cancer. In some embodiments, methods are provided for administering the engineered human cells or pharmaceutical compositions disclosed herein to a subject as a treatment for autoimmune disease. In some embodiments, methods are provided for administering the engineered human cells or pharmaceutical compositions disclosed herein to a subject as a treatment for infectious disease.

[0142] C. Methods and Compositions for Reducing or Eliminating Surface Expression of HLA-A The present disclosure provides methods and compositions for genetically modifying the HLA-A gene to reduce or eliminate surface expression of HLA-A protein compared to unmodified cells. The resulting genetically modified cells may also be referred to herein as engineered cells. In some embodiments, already genetically modified (or engineered) cells may be starting cells for further genetic modification using the methods or compositions provided herein. In some embodiments, the cells are allogeneic cells. In some embodiments, cells with reduced HLA-A expression are useful for adoptive cell transfer therapy. In some embodiments, editing of the HLA-A gene is combined with additional genetic modifications to produce desirable cells for allogeneic transplantation purposes.

[0143] In some embodiments, the method comprises reducing surface expression of an HLA-A protein in a human cell compared to an unmodified cell, and the method comprises: a) administering to a human cell a guide sequence selected from: i. SEQ ID NOs: 1-211; or ii. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from: 1-211; or iii. a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from: 1-211; or iv. a guide sequence that binds to a target site comprising a genomic region listed in Tables 2-5; or v. a guide sequence that binds to a target site comprising a genomic region listed in Tables 1-2 and 5. The method comprises contacting a cell with a composition comprising: an HLA-A guide RNA comprising a guide sequence that is complementary to at least 17, 18, 19, or 20 contiguous nucleotides of a genomic region, or a guide sequence that is complementary to at least 17, 18, 19, 20, 21, 22, 23, or 24 contiguous nucleotides of a genomic region listed in Table 4, or a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from vi.(v); and optionally b) an RNA-guided DNA binding agent or a nucleic acid encoding the RNA-guided DNA binding agent. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein. In some embodiments, the RNA-guided DNA binding agent is selected from one of S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g., Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpf1, Acidaminococcus sp. Cpf1, Lachnospiraceae bacterium Cpf1, a CT base editor, an AG base editor, Cas12a, and CasX.In some embodiments, the RNA-guided DNA binding agent comprises a polypeptide selected from one of S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g., Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpf1, Acidaminococcus sp. Cpf1, Lachnospiraceae bacterium Cpf1, a CT base editor, an AG base editor, Cas12a, and CasX. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is an S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase domain. In some embodiments, the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase. In some embodiments, the RNA-guided DNA binding agent is N. meningitidis Cas9, e.g., Nme2Cas9. In some embodiments, the RNA-guided DNA binding agent is S. thermophilus Cas9. In some embodiments, the RNA-guided DNA binding agent is S. aureus Cas9. In some embodiments, the RNA-guided DNA binding agent is Cpf1 from F. novicida. In some embodiments, the RNA-guided DNA binding agent is Cpf1 from Acidaminococcus sp.. In some embodiments, the RNA-guided DNA binding agent is Cpf1 from Lachnospiraceae bacterium ND2006. In some embodiments, the RNA-guided DNA binding agent is a CT base editor. In some embodiments, the RNA-guided DNA binding agent is an AG base editor. In some embodiments, the base editor comprises a deaminase and an RNA-guided nickase. In some embodiments, the RNA-guided DNA binding agent comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase.In some embodiments, the RNA-guided nickase is SpyCas9 nickase. In some embodiments, the RNA-guided nickase comprises NmeCas9 nickase. In some embodiments, the RNA-guided DNA binding agent is Cas12a. In some embodiments, the RNA-guided DNA binding agent is CasX. In some embodiments, expression of HLA-A protein on the surface of the cell (i.e., the engineered cell) is thereby reduced.

[0144] In some embodiments, the methods comprise generating engineered human cells that have reduced or eliminated surface expression of HLA-A protein compared to unmodified cells, wherein the cells are homozygous for HLA-B and homozygous for HLA-C and comprise a) a target site that binds to a target site comprising: i. a guide sequence selected from SEQ ID NOs: 1-211; or ii. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-211; or iii. a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-211; or iv. a genomic region listed in Tables 2-5. or v. a guide sequence that is complementary to at least 17, 18, 19, or 20 contiguous nucleotides of a genomic region listed in Tables 1-2 and 5, or a guide sequence that is complementary to at least 17, 18, 19, 20, 21, 22, 23, or 24 contiguous nucleotides of a genomic region listed in Table 4, or vi. (v) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v), and optionally b) an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder is Cas9. In some embodiments, the RNA-guided DNA binder is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is an S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase domain. In some embodiments, the RNA-guided DNA binding agent comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase. In some embodiments, the expression of HLA-A protein on the surface of the cell (i.e., the engineered cell) is thereby reduced.

[0145] In some embodiments, the method of reducing or eliminating expressed HLA-A protein on the surface of a cell comprises contacting the cell with any one or more of the HLA-A guide RNAs disclosed herein. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-211.

[0146] In some embodiments, compositions are provided comprising: a) an HLA-A guide RNA comprising: i. a guide sequence selected from SEQ ID NOs: 1-211; or ii. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-211; or iii. a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-211; or iv. a guide sequence that binds to a target site comprising a genomic region listed in Tables 2-5; or v. a guide sequence that is complementary to at least 17, 18, 19, or 20 contiguous nucleotides of a genomic region listed in Tables 1-2 and 5, or a guide sequence that is complementary to at least 17, 18, 19, 20, 21, 22, 23, or 24 contiguous nucleotides of a genomic region listed in Table 4; or vi. a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); and, optionally, b) an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder. In some embodiments, the composition further comprises an RNA-guided DNA binding agent or a nucleic acid encoding the RNA-guided DNA binding agent. In some embodiments, the composition comprises an RNA-guided DNA binding agent that is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase domain. In some embodiments, the RNA-guided DNA binding agent comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0147] In some embodiments, the composition further comprises a uracil glycosylase inhibitor (UGI). In some embodiments, the composition comprises an RNA-guided DNA binding agent, wherein the RNA-guided DNA binding agent generates a cytosine (C) to thymine (T) conversion with an HLA-A genomic target sequence. In some embodiments, the composition comprises an RNA-guided DNA binding agent, wherein the RNA-guided DNA binding agent generates an adenosine (A) to guanine (G) conversion with an HLA-A genomic target sequence.

[0148] In some embodiments, engineered human cells are provided that are produced by the methods described herein. In some embodiments, the engineered human cells produced by the methods and compositions described herein are allogeneic cells. In some embodiments, the methods produce compositions comprising engineered human cells that have reduced or eliminated HLA-A expression. In some embodiments, the engineered human cells produced by the methods disclosed herein elicit a reduced response from CD8+ T cells compared to unmodified cells, as measured in an in vitro cell culture assay containing CD8+ T cells.

[0149] In some embodiments, the compositions disclosed herein further comprise a pharmaceutically acceptable carrier. In some embodiments, cells produced by the compositions disclosed herein are provided, the cells comprising the pharmaceutically acceptable carrier. In some embodiments, compositions are provided, the cells comprising the cells disclosed herein.

[0150] 1.HLA-A guide RNA The methods and compositions provided herein disclose guide RNAs useful for reducing or eliminating expression of HLA-A proteins on the surface of human cells. In some embodiments, such guide RNAs direct an RNA-guided DNA binder to an HLA-A genomic target sequence and may be referred to herein as "HLA-A guide RNAs." In some embodiments, an HLA-A guide RNA directs an RNA-guided DNA binder to a human HLA-A genomic target sequence. In some embodiments, the HLA-A guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-211.

[0151] In some embodiments, a composition is provided comprising an HLA-A guide RNA as described herein and an RNA-guided DNA binder, or a nucleic acid encoding the RNA-guided DNA binder.

[0152] In some embodiments, compositions are provided that include an HLA-A single guide RNA (sgRNA) that includes a guide sequence selected from SEQ ID NOs: 1 to 211. In some embodiments, compositions are provided that include an HLA-A sgRNA described herein and an RNA-guided DNA binder, or a nucleic acid encoding the RNA-guided DNA binder.

[0153] In some embodiments, compositions are provided that include an HLA-A dual guide RNA (dgRNA) that includes a guide sequence selected from SEQ ID NOs: 1 to 211. In some embodiments, compositions are provided that include an HLA-a dgRNA described herein and an RNA-guided DNA binder, or a nucleic acid encoding an RNA-guided DNA binder.

[0154] In some embodiments, the HLA-A gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 1-211. Exemplary HLA-A guide sequences are shown below in Table 2 (SEQ ID NOs: 1-95, corresponding guide RNA sequences SEQ ID NOs: 249-343 and 344-438), Table 3 (SEQ ID NOs: 96-128, corresponding guide RNA sequences SEQ ID NOs: 439-471 and 472-504), Table 4 (SEQ ID NOs: 129-182), and Table 5 (SEQ ID NOs: 183-211, corresponding guide RNA sequences SEQ ID NOs: 505-532 and 533-560).

[0155] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8] [Table 3-9] [Table 3-10] [Table 3-11] [Table 3-12]

Table 3-13

Table 3-14

Table 3-15

Table 3-16

Table 3-17

Table 3-18

Table 3-19

Table 3-20

Table 3-21

Table 3-22

Table 3-23

Table 3-24

Table 3-25

Table 3-26

Table 3-27

Table 3-28

Table 3-29

Table 3-30

Table 3-31

Table 3-32

Table 3-33

Table 3-34

Table 3-35

Table 3-36

Table 3-37

Table 3-38

Table 3-39

Table 3-40

[0156]

Table 4-1

Table 4-2

Table 4-3

Table 4-4

Table 4-5

Table 4-6

Table 4-7

Table 4-8

Table 4-9

Table 4-10

Table 4-11

Table 4-12

Table 4-13

[0157]

Table 5-1

Table 5-2

Table 5-3

[0158]

Table 6-1

Table 6-2

Table 6-3

Table 6-4

Table 6-5

[0159] In some embodiments, the HLA-A gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 1-95. In some embodiments, the HLA-A gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 7, 13-18, 22, 26, 31, 33, 37-41, 43, 45, 47, 57, 59, 62, 66, and 87. In some embodiments, the HLA-A gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 13-18, 26, 37-39, 41, 43, 45, and 62. In some embodiments, the HLA-A gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 13-18. In some embodiments, the HLA-A gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 13-17. In some embodiments, the HLA-A gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 37-39, 41, 43, and 45. In some embodiments, the HLA-A gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 37-39.

[0160] In some embodiments, the gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 1-211. In some embodiments, the HLA-A guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-211. In some embodiments, the HLA-A guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-211. In some embodiments, the HLA-A guide RNA comprises a guide sequence that is at least 95% identical to a sequence selected from SEQ ID NOs: 1-211.

[0161] In some embodiments, the HLA-A guide RNA comprises a guide sequence comprising at least 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Tables 2-5. As used herein, at least 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate means, for example, at least 10 contiguous nucleotides within a genomic coordinate, where the genomic coordinate comprises 10 nucleotides in the 5' direction and 10 nucleotides in the 3' direction from the range listed in Tables 2-5. For example, the HLA-A guide RNA may comprise 10 contiguous nucleotides within genomic coordinates chr6:29942864-chr6:29942903 or chr6:29943528-chr6:29943609 (inclusive of the boundary nucleotides of these ranges). In some embodiments, the HLA-A guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Tables 1-2 and 5, or a guide sequence that is complementary to at least 17, 18, 19, 20, 21, 22, 23, or 24 contiguous nucleotides of a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 4. In some embodiments, the HLA-A guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from a sequence that is 17, 18, 19, or 20 contiguous nucleotides of a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Tables 1-2 and 5, or a guide sequence that is complementary to at least 17, 18, 19, 20, 21, 22, 23, or 24 contiguous nucleotides of a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 4.

[0162] In some embodiments, a guide RNA in Tables 2-5 comprises a guide sequence that includes at least 15 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Tables 2-5. In some embodiments, an HLA-A guide RNA comprises a guide sequence that includes at least 20 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Tables 2-5.

[0163] In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 1. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 2. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 3. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 4. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 5. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 6. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 7. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 8. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 9. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 10. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 11. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 12. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 13. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 14. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 15. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 16. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 17. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 18. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 19. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 20. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 21. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 22. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 23. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 24. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 25. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 26. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 27. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 28.In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 29. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 30. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 31. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 32. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 33. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 34. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 35. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 36. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 37. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 38. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 39. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 40. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 41. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 42. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 43. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 44. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 45. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 46. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 47. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 48. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 49. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 50. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 51. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 52. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 53. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 54. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 55. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 56.In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 57. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 58. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 59. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 60. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 61. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 62. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 63. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 64. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 65. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 66. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 67. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 68. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 69. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 70. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 71. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 72. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 73. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 74. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 75. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 76. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 77. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 78. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 79. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 80. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 81. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 82. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 83. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 84.In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 85. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 86. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 87. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 88. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 89. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 90. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 91. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 92. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 93. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 94. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 95. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 96. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 97. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 98. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 99. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 100. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 101. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 102. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 103. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 104. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 105. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 106. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 107. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 108. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 109. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 110. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 111. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 112.In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 113. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 114. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 115. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 116. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 117. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 118. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 119. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 120. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 121. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 122. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 123. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 124. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 125. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 126. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 127. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 128. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 129. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 130. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 131. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 132. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 133. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 134. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 135. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 136. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 137. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 138. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 139.In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 140. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 141. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 142. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 143. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 144. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 145. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 146. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 146. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 147. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 148. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 149. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 150. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 151. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 152. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 153. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 154. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 155. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 156. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 157. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 158. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 159. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 160. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 161. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 162. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 163. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 164. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 165. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 166. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 167. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 168. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 169. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 170. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 171. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 172. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 173.In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 174. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 175. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 176. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 177. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 178. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 179. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 180. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 181. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 182. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 183. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 184. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 185. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 186. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 187. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 188. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 189. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 190. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 191. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 192. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 193. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 194. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 195. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 196. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 197. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 198. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 199. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 200.In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 201. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 202. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 203. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 204. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 205. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 206. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 207. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 208. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 209. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 210. In some embodiments, the HLA-A guide RNA comprises SEQ ID NO: 211.

[0164] For example, additional embodiments of HLA-A guide RNAs are provided herein, including exemplary modifications to the guide RNA.

[0165] 2. Genetic modification of HLA-A In some embodiments, the methods and compositions disclosed herein genetically modify at least one nucleotide in an HLA-A gene in a cell, where the genetic modification includes a set of modifications resulting from contact with a gene editing system (e.g., a set of edits resulting from Cas9 and an HLA-A guide RNA, or a set of edits resulting from BC22 and an HLA-A guide RNA).

[0166] In some embodiments, the genetic modification comprises at least one nucleotide within a genomic coordinate selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619.

[0167] In some embodiments, the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942864-chr6:29942903.

[0168] In some embodiments, the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-chr6:29943609.

[0169] In some embodiments, the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, and chr6:29942883-29942903.

[0170] In some embodiments, the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, and chr6:29943589-29943609.

[0171] In some embodiments, the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29942876-29942897.

[0172] In some embodiments, the genetic modification comprises at least one nucleotide within genomic coordinates chr6:29943528-chr629943550.

[0173] In some embodiments, the genetic modification comprises at least one nucleotide within a genomic coordinate selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, and chr6:29942877-29942897.

[0174] In some embodiments, the genetic modification comprises at least one nucleotide within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, and chr6:29943530-29943550.

[0175] In some embodiments, the genetic modifications are located at genomic coordinates chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943 and at least one nucleotide within chr6:528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.

[0176] In some embodiments, the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-299435 48, containing an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.

[0177] In some embodiments, the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:2 9943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29 943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:2994 3589-29943609, and chr6:29944026-29944046, chr6:29934330-29934350, chr6:29943115-29943135, chr6:29943135-29943155, chr6:29943140-29943160, chr6:29943 and chr6:29944850-29944870.

[0178] In some embodiments, the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-299435 48, containing an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.

[0179] In some embodiments, the genetic modifications are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943528-299435 48, containing an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, and chr6:29943589-29943609.

[0180] In some embodiments, the genetic modification comprises an indel, a CT substitution, or an AG substitution within a genomic coordinate selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, and chr6:29942883-29942903.

[0181] In some embodiments, the genetic modification comprises an indel, a CT substitution, or an AG substitution within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, and chr6:29943589-29943609.

[0182] In some embodiments, the genetic modifications are chr6:29890117-29890137, chr6:29927058-29927078, chr6:29934330-29934350, chr6:29942541-29942561, chr6:29942542-29942562, chr6:29942543-29942563, chr6:29942543-29942563, chr6:29942550-29942570, chr6:29942864-29942884, chr6:29942868-299428 88, chr6:29942876-29942896, chr6:29942876-29942896, chr6:2994287 7-29942897, chr6:29942883-29942903, chr6:29943062-29943082, chr6: 29943063-29943083, chr6:29943092-29943112, chr6:29943115-299431 35, chr6:29943118-29943138, chr6:29943119-29943139, chr6:29943120 -29943140, chr6:29943126-29943146, chr6:29943128-29943148, chr6: 29943129-29943149, chr6:29943134-29943154, chr6:29943134-2994315 4, chr6:29943135-29943155, chr6:29943136-29943156, chr6:29943140 -29943160, chr6:29943142-29943162, chr6:29943143-29943163, chr6:2 9943188-29943208, chr6:29943528-29943548, chr6:29943529-2994354 9, chr6:29943530-29943550, chr6:29943536-29943556, chr6:29943537- 29943557, chr6:29943538-29943558, chr6:29943549-29943569, chr6:29 943556-29943576, chr6:29943589-29943609, chr6:29943590-29943610,chr6:29943590-29943610、chr6:29943599-29943619、chr6:29943600-29943620、chr6:29943601-29943621、chr6:29943602-29943622、chr6:29943603-29943623、chr6:29943774-29943794、chr6:29943779-29943799、chr6:29943780-29943800、chr6:29943822-29943842、chr6:29943824-299 43844, chr6:29943857-29943877, chr6:29943858-29943878, chr6:29943859-29943879, chr6:29943860-29943880, chr6:29944026-29944046, chr6:29944077-29944097, chr6:29944078-29944098, chr6:29944458-29944478, chr6:29944478-29944498, chr6:29944597-29944617, chr6:299446 42-29944662、chr6:29944643-29944663、chr6:29944772-29944792、chr6:29944782-29944802、chr6:29944850-29944870、chr6:29944907-29944927、chr6:29945024-29945044、chr6:29945097-29945117、chr6:29945104-29945124、chr6:29945105-29945125、chr6:29945116-29945136、chr6: 29945118-29945138, chr6:29945119-29945139, chr6:29945124-29945144, chr6:29945176-29945196, chr6:29945177-29945197, chr6:29945177-29945197, chr6:29945180-29945200, chr6:29945187-29945207, chr6:29945188-29945208, chr6:29945228-29945248, chr6:29945230-29945250,The present invention also includes an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:29945231-29945251, chr6:29945232-29945252, chr6:29945308-29945328, chr6:29945361-29945381, chr6:29945362-29945382, and chr6:31382543-31382563.

[0183] In some embodiments, the genetic modifications are chr6:29942815-29942835, chr6:29942816-29942836, chr6:29942817-29942837, chr6:29942817-29942837, chr6:29942828-29942848, chr6:29942837-29942857, chr6:29942885-29942905, chr6:29942895-29942915, chr6:2 9942896-29942916, chr6:29942898-29942918, chr6:29942899-29942919, chr6:29942900-29942920, chr6:29942904-2994 2924, chr6:29942905-29942925, chr6:29942912-29942932, chr6:29942913-29942933, chr6:29943490-29943510, chr6:299 43497-29943517, chr6:29943498-29943518, chr6:29943502-29943522, chr6:29943502-29943522, chr6:29943511-299435 31, chr6:29943520-29943540, chr6:29943521-29943541, chr6:29943566-29943586, chr6:29943569-29943589, chr6:29943 and chr6:29943568-29943588, and chr6:29942815-29942835.

[0184] In some embodiments, the genetic modification comprises an indel, a CT substitution, or an AG substitution within a genomic coordinate selected from chr6:29942884-29942904, chr6:29943519-29943539, chr6:29942863-29942883.

[0185] In some embodiments, the genetic modification comprises an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:29943517-29943537, and chr6:29943523-29943543.

[0186] In some embodiments, the genetic modifications are chr6:29942845-29942869, chr6:29942852-29942876, chr6:29942865-29942889, chr6:29942891-29942915, chr6:29942895-29942919, chr6:29942903-29942927, chr6:29942904-29942928, chr6:29943518-29943542, chr6:29943525-29943549, chr6:29943535-29943559, chr6:29943538-2994356 2, chr6:29943539-29943563, chr6:29943547-29943571, chr6:29943547-29943571, chr6:29943548-29943 572, chr6:29943555-29943579, chr6:29943556-29943580, chr6:29943557-29943581, chr6:29943558-299 43582, chr6:29943559-29943583, chr6:29943563-29943587, chr6:29943564-29943588, chr6:29943565-2 and containing an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:9943589, chr6:29943568-29943592, chr6:29943571-29943595, chr6:29943572-29943596, chr6:29943595-29943619, chr6:29943596-29943620, chr6:29943600-29943624.

[0187] In some embodiments, the genetic modifications are chr6:29942885-29942905, chr6:29942895-29942915, chr6:29942896-29942916, chr6:29942898-29942918, chr6:29942899-29942919, chr6:29942900-29942920, chr6:29942904-29942924, chr6:29943511-29943531, chr6:29943520-29943540, chr6:29943521-29943541, chr6:299 and chr6:29943573-29943593, chr6:29943578-29943598, chr6:29943585-29943605, and chr6:29943589-29943609.

[0188] In some embodiments, the genetic modifications are chr6:29942469-29942489, chr6:29943058-29943078, chr6:29943063-29943083, chr6:29943080-29943100, chr6:29943187-29943207, chr6:29943192-29943212, chr6:29943197-29943 217, containing an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:29943812-29943832, chr6:29944349-29944369, chr6:29944996-29945016, chr6:29945018-29945038, chr6:29945341-29945361, and chr6:29945526-29945546.

[0189] In some embodiments, the genetic modification comprises an indel, a CT substitution, or an AG substitution within genomic coordinates chr6:29942876-29942897.

[0190] In some embodiments, the genetic modification comprises an indel, a CT substitution, or an AG substitution within a genomic coordinate selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, and chr6:29942877-29942897.

[0191] In some embodiments, the genetic modification comprises an indel, a CT substitution, or an AG substitution within genomic coordinates chr6:29943528-chr629943550.

[0192] In some embodiments, the genetic modification comprises an indel, a CT substitution, or an AG substitution within genomic coordinates selected from chr6:29943528-29943548, chr6:29943529-29943549, and chr6:29943530-29943550.

[0193] In some embodiments, the modification to HLA-A comprises any one or more of an insertion, deletion, substitution, or deamination of at least one nucleotide in the target sequence. In some embodiments, the modification to HLA-A comprises an insertion of 1, 2, 3, 4, or 5 or more nucleotides in the target sequence. In some embodiments, the modification to HLA-A comprises a deletion of 1, 2, 3, 4, or 5 or more nucleotides in the target sequence. In other embodiments, the modification to HLA-A comprises an insertion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in the target sequence. In other embodiments, the modification to HLA-A comprises a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in the target sequence. In some embodiments, the modification to HLA-A comprises an indel, which is generally defined in the art as an insertion or deletion of less than 1000 base pairs (bp). In some embodiments, the modification to HLA-A comprises an indel that results in a frameshift mutation in the target sequence. In some embodiments, the modification to HLA-A comprises a substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in the target sequence. In some embodiments, the modification to HLA-A comprises one or more of an insertion, deletion, or substitution of nucleotides resulting from the incorporation of a template nucleic acid. In some embodiments, the modification to HLA-A comprises an insertion of a donor nucleic acid in the target sequence. In some embodiments, the modification to HLA-A is not transient.

[0194] 3. Efficacy of HLA-A guide RNA The effectiveness of the HLA-A guide RNA can be determined by techniques available in the art that evaluate the editing efficiency of the guide RNA and the expression of HLA-A protein on the surface of cells. In some embodiments, the reduction or elimination of HLA-A protein on the surface of cells can be determined by comparison with (or "relative to") unmodified cells. The engineered cells or cell population can also be compared with a population of unmodified cells.

[0195] An "unmodified cell" (or "unmodified cells") refers to a control cell (or cells) of the same type of cell in an experiment or test; the "unmodified" control cell has not been contacted with an HLA-A guide. Thus, an unmodified cell (or cells) can be a cell that has not been contacted with a guide RNA or a cell that has been contacted with a guide RNA that does not target HLA-A.

[0196] In some embodiments, the effectiveness of the HLA-A guide RNA is determined by measuring the level of HLA-A protein on the surface of cells. In some embodiments, the HLA-A protein level is measured by flow cytometry (e.g., using antibodies against HLA-A2 / HLA-A3). In some embodiments, the cell population is enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% HLA-A negative when measured by flow cytometry relative to an unmodified cell population. In some embodiments, the cell population is not enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% HLA-A negative when measured by flow cytometry relative to an unmodified cell population. In some embodiments, the cell population is at least 65% HLA-A negative when measured by flow cytometry relative to an unmodified cell population. In some embodiments, the cell population is at least 70% HLA-A negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 80% HLA-A negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 90% HLA-A negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 95% MHC I negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 100% HLA-A negative when measured by flow cytometry compared to an unmodified cell population.

[0197] In some embodiments, an effective HLA-A guide RNA may be determined by measuring immune cell responses in vitro or in vivo (e.g., CD8+ T cells) to the genetically modified target cells. For example, a reduced response from CD8+ T cells indicates an effective HLA-A guide RNA. CD8+ T cell responses may be assessed by assays measuring CD8+ T cell activation responses, e.g., CD8+ T cell proliferation, expression of activation markers, and / or cytokine production (IL-2, IFN-γ, TNF-α) (e.g., flow cytometry, ELISA). CD8+ T cell responses may be assessed in vitro or in vivo. In some embodiments, CD8+ T cell responses may be assessed by co-culturing genetically modified cells with CD8+ T cells in vitro. In some embodiments, CD8+ T cell activity may be assessed in an in vivo model, e.g., a rodent model. In an in vivo model, for example, genetically modified cells may be administered with CD8+ T cells, and survival of the genetically modified cells indicates their ability to evade CD8+ T cell lysis. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for 1, 2, 3, 4, 5, or 6 weeks or more. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for at least 1-6 weeks. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for at least 2-4 weeks. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for at least 4-6 weeks. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for more than 6 weeks.

[0198] The efficacy of the HLA-A guide RNA may also be assessed by the survival of cells after editing. In some embodiments, the cells survive for at least 1-6 weeks after editing. In some embodiments, the cells survive for at least 2 weeks after editing. In some embodiments, the cells survive for at least 3 weeks after editing. In some embodiments, the cells survive for at least 4 weeks after editing. In some embodiments, the cells survive for at least 5 weeks after editing. In some embodiments, the cells survive for at least 6 weeks after editing. In some embodiments, the cells survive for at least 1-12 weeks after editing. The viability of genetically modified cells may be measured using standard techniques, including, for example, measures of cell death, live / dead staining by flow cytometry, or cell proliferation.

[0199] In some embodiments, the engineered cells are assessed by the persistence of engineered human cells that have reduced or eliminated HLA-A expression, are homozygous for HLA-B, and are homozygous for HLA-C. As used herein, "persistence" refers to the ability of engineered cells to persist in in vitro and / or in vivo environments where reactive or responsive T cells and / or NK cells are present, e.g., the ability to persist in vivo after transplantation into a recipient. In some embodiments, the engineered human T cells are protective against NK-mediated rejection. In some embodiments, the ratio of engineered cells that are viable in vivo in the presence of NK cells to engineered cells that are viable in vivo in the absence of NK cells is at least 0.3:1 or greater at least 20 days, at least 30 days, at least 40 days, at least 50 days, at least 60 days, at least 70 days, at least 80 days, or at least 90 days after transplantation into a recipient, as demonstrated herein. In some embodiments, at least 90 days after transplantation into the recipient, the ratio of engineered cells that are viable in vivo in the absence of NK cells to engineered cells that are viable in vivo in the presence of NK cells is at least 0.4:1 or greater, 0.5:1 or greater, 0.6:1 or greater, 0.7:1 or greater, 0.8:1 or greater, or 0.9:1 or greater, as demonstrated herein. In some embodiments, the engineered human T cells are protective against CD8+ T cell-mediated rejection.

[0200] In some embodiments, engineered cells may be evaluated using a mixed lymphocyte reaction (MLR). (See, e.g., DeWolf et al., Transplantation 100:1639-1649 (2017)). In some embodiments, engineered human cells are mixed with labeled, non-edited (unengineered) responder T cells, and the MLR assay measures the proliferation of responder T cells activated by allorecognition (i.e., via mismatched HLA molecules on the surface of the engineered human cells).

[0201] D. Methods and Compositions for Reducing or Eliminating MHC Class II and Additional Modifications In some embodiments, the multiplex gene editing may be performed intracellularly. In some embodiments, the method comprises reducing or eliminating expression of an HLA-A protein on the surface of the cell, comprising genetically modifying the HLA-A gene, and comprising contacting the cell with an HLA-A guide RNA disclosed herein, optionally an RNA-guided DNA binder, or a composition comprising a nucleic acid encoding the RNA-guided DNA binder, wherein the method further comprises contacting the cell with one or more compositions selected from: (a) a guide RNA that directs the RNA-guided DNA binder to the CIITA gene, (b) a guide RNA that directs the RNA-guided DNA binder to a locus in the genome of the cell other than HLA-A or CIITA, and (c) a donor nucleic acid for insertion into the genome of the cell.

[0202] 1. MHC class II knockout In some embodiments, methods are provided for reducing or eliminating expression of HLA-A protein on the surface of cells by genetically modifying HLA-A as disclosed herein, and the methods and compositions further provide for reducing or eliminating expression of MHC class II protein on the surface of cells compared to unmodified cells. In some embodiments, MHC class II protein expression is reduced or eliminated by contacting the cells with a CIITA guide RNA. In some embodiments, the cells are allogeneic cells. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0203] In some embodiments, methods are provided for reducing MHC class II surface expression on engineered human cells. MHC class II expression is influenced by various proteins. (See, e.g., Crivello et al., Journal Immunology 202:1895-1903 (2019)). For example, the CIITA protein functions as a transcriptional activator (activating the MHC class II promoter) and is essential for MHC class II protein expression. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of a gene selected from CIITA, HLA-DR, HLA-DQ, HLA-DP, RFX5, RFXB / ANK, RFXAP, CREB, NF-YA, NF-YB, and NF-YC. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the CIITA gene. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the HLA-DR gene. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the HLA-DQ gene. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the HLA-DP gene. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the RFX5 gene. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the RFXB / ANK gene. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the RFXAP gene. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the CREB gene. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the NK-YA gene. In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the NK-YB gene.In some embodiments, MHC class II protein expression is reduced or eliminated by genetic modification of the NK-YC gene.

[0204] In some embodiments, methods are provided for generating engineered human cells that have reduced or eliminated expression of HLA-A protein compared to unmodified cells, wherein the cells are homozygous for HLA-B and homozygous for HLA-C, and further comprise reducing or eliminating surface expression of MHC class II protein in the cells compared to unmodified cells. In some embodiments, the method comprises contacting the cells with a CIITA guide RNA.

[0205] In some embodiments, the efficacy of a CIITA guide RNA is determined by measuring the level of CIITA protein in cells. The level of CIITA protein can be detected, for example, by cell lysate and Western blot using an anti-CIITA antibody. In some embodiments, the efficacy of a CIITA guide RNA is determined by measuring the level of CIITA protein in cell nuclei. In some embodiments, the efficacy of a CIITA guide RNA is determined by measuring the level of CIITA mRNA in cells. The level of CIITA mRNA can be detected, for example, by RT-PCR. In some embodiments, a decrease in the level of CIITA protein and / or CIITA mRNA in target cells compared to unmodified cells indicates an effective CIITA guide RNA.

[0206] In some embodiments, the effectiveness of a CIITA guide RNA is determined by measuring the reduction or elimination of MHC class II protein expression by target cells. The CIITA protein functions as a transactivator, activating the MHC class II promoter and is essential for the expression of MHC class II proteins. In some embodiments, MHC class II protein expression can be detected on the surface of target cells. In some embodiments, MHC class II protein expression is measured by flow cytometry. In some embodiments, antibodies against MHC class II proteins (e.g., anti-HLA-DR, -DQ, -DP) can be used to detect MHC class II protein expression, for example, by flow cytometry. In some embodiments, the reduction or elimination of MHC class II protein on the surface of a cell (or cell population) compared to an unmodified cell (or unmodified cell population) indicates an effective CIITA guide RNA. In some embodiments, a cell (or cell population) contacted with a particular CIITA guide RNA and an RNA-guided DNA binder that is negative for MHC class II protein by flow cytometry indicates an effective CIITA guide RNA.

[0207] In some embodiments, MHC class II protein expression is reduced or eliminated in a cell population using the methods and compositions disclosed herein. In some embodiments, the cell population is enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% MHC class II negative as measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is not enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% MHC class II negative as measured by flow cytometry compared to an unmodified cell population.

[0208] In some embodiments, the cell population is at least 65% MHC II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 70% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 80% MHC II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 90% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 91% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 92% MHC II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 93% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 94% MHC class II negative as measured by flow cytometry compared to an unmodified cell population.

[0209] In some embodiments, the cell population elicits a reduced response from immune cells (e.g., CD4+ T cells) in vitro or in vivo. CD4+ T cell responses can be assessed by assays measuring CD4+ T cell activation responses, e.g., CD4+ T cell proliferation, activation marker expression, and / or cytokine production (IL-2, IL-12, IFN-γ) (e.g., flow cytometry, ELISA). CD4+ T cell responses can be assessed in in vitro cell culture assays in which genetically modified cells are co-cultured with cells containing CD4+ T cells. For example, engineered cells can be co-cultured with, e.g., PBMCs, purified CD3+ T cells containing CD4+ T cells, purified CD4+ T cells, or a CD4+ T cell line. CD4+ T cell responses elicited from engineered cells can be compared to responses elicited from unmodified cells.

[0210] In some embodiments, engineered human cells are provided, wherein the cells reduce or eliminate expression of HLA-A and MHC class II proteins on the cell surface, the cells comprise a genetic modification in the HLA-A gene, the cells are homozygous for HLA-B and homozygous for HLA-C, and the cells comprise a modification in the CIITA gene. In some embodiments, the engineered cells elicit a reduced response from CD4+ T cells and a reduced response from CD8+ T cells.

[0211] 2. Exogenous Nucleic Acid Knock-in In some embodiments, the present disclosure provides methods and compositions for reducing or eliminating expression of HLA-A protein on the surface of cells by genetically modifying the HLA-A disclosed herein, wherein the methods and compositions further provide for expression of a protein encoded by an exogenous nucleic acid (e.g., an antibody, a chimeric antigen receptor (CAR), a T cell receptor (TCR), a cytokine or cytokine receptor, a chemokine or chemokine receptor, an enzyme, a fusion protein, or other type of cell surface-associated or soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a protein to be expressed on the cell surface. For example, in some embodiments, the exogenous nucleic acid encodes a targeting receptor to be expressed on the cell surface (as further described herein). In some embodiments, the genetically modified cells can function as a "cell factory" for expression of secreted polypeptides encoded by exogenous nucleic acids, including, for example, as a source for continuous production of polypeptides in vivo (as further described herein). In some embodiments, the cells are allogeneic cells. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0212] In some embodiments, the method comprises reducing expression of HLA-A protein on the surface of the cell, comprises genetically modifying the HLA-A gene, comprises contacting the cell with a composition comprising an HLA-A guide RNA disclosed herein, and the method further comprises contacting the cell with an exogenous nucleic acid.

[0213] In some embodiments, the methods involve reducing or eliminating expression of HLA-A protein on the surface of the cells and involve genetically modifying the cells with one or more compositions comprising an HLA-A guide RNA disclosed herein, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), and an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent.

[0214] In some embodiments, the methods involve reducing or eliminating expression of HLA-A and MHC class II proteins on the surface of the cells, and involve genetically modifying the cells with one or more compositions comprising an HLA-A guide RNA, a CIITA guide RNA, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder disclosed herein.

[0215] In some embodiments, the exogenous nucleic acid encodes a polypeptide expressed on the surface of a cell. In some embodiments, the exogenous nucleic acid encodes a soluble polypeptide. As used herein, a "soluble" polypeptide refers to a polypeptide that is secreted by a cell. In some embodiments, the soluble polypeptide is a therapeutic polypeptide. In some embodiments, the soluble polypeptide is an antibody. In some embodiments, the soluble polypeptide is an enzyme. In some embodiments, the soluble polypeptide is a cytokine. In some embodiments, the soluble polypeptide is a chemokine. In some embodiments, the soluble polypeptide is a fusion protein.

[0216] In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an antibody fragment (e.g., Fab, Fab2). In some embodiments, the exogenous nucleic acid encodes a full-length antibody. In some embodiments, the exogenous nucleic acid encodes a single-chain antibody (e.g., scFv). In some embodiments, the antibody is an IgG, IgM, IgD, IgA, or IgE. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgG1 antibody. In some embodiments, the antibody is an IgG4 antibody. In some embodiments, the heavy chain constant region contains mutations known to reduce effector function. In some embodiments, the heavy chain constant region contains mutations known to enhance effector function. In some embodiments, the antibody is a bispecific antibody. In some embodiments, the antibody is a single domain antibody (e.g., an antibody with only a VH domain).

[0217] In some embodiments, the exogenous nucleic acid encodes a neutralizing antibody. A neutralizing antibody neutralizes the activity of its target antigen. In some embodiments, the antibody is a neutralizing antibody against a viral antigen. In some embodiments, the antibody neutralizes the target viral antigen and blocks the virus's ability to infect cells. In some embodiments, a cell-based neutralization assay can be used to measure the neutralizing activity of an antibody. The specific cell and readout depend on the target antigen of the neutralizing antibody. The half-maximal effective concentration (EC 50 ) can be measured in a cell-based neutralization assay and has a lower EC 50 indicates more potent neutralizing antibodies.

[0218] In some embodiments, the exogenous nucleic acid encodes an antibody that binds to an antigen associated with a disease or disorder (see, eg, the diseases and disorders described in Section IV).

[0219] In some embodiments, the exogenous nucleic acid encodes a polypeptide (i.e., a cell surface binding protein) expressed on the surface of a cell. In some embodiments, the exogenous nucleic acid encodes a targeting receptor. A "targeting receptor" is a receptor present on the surface of a cell, e.g., a T cell, that allows the cell to bind to a target site, e.g., a specific cell or tissue within an organism. In some embodiments, the targeting receptor is a CAR. In some embodiments, the targeting receptor is a universal CAR (UniCAR). In some embodiments, the targeting receptor is a proliferation-inducing ligand (APRIL). In some embodiments, the targeting receptor is a TCR. In some embodiments, the targeting receptor is TRuC. In some embodiments, the targeting receptor is a B cell receptor (BCR) (e.g., expressed on B cells). In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a cytokine receptor.

[0220] In some embodiments, the targeting receptor comprises a chimeric antigen receptor (CAR), a T cell receptor (TCR), and a receptor for a cell surface molecule operably linked through at least a transmembrane domain within an internal signaling domain that can activate T cells upon binding of the extracellular receptor portion. In some embodiments, CAR refers to an extracellular antigen recognition domain, e.g., an scFv, VHH, or nanobody, operably linked to an intracellular signaling domain that activates T cells upon antigen binding. CARs are composed of four regions: an antigen recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T cell signaling domain. Such receptors are well known in the art (see, e.g., WO2020092057, WO2019191114, WO2019147805, and WO2018208837). Universal CARs (UniCARs) for recognizing various antigens (see, e.g., EP2990416A1) and reverse universal CARs (RevCARs), which facilitate immune cell binding to target cells via adapter molecules (see, e.g., WO2019238722), are also contemplated. CARs can target any antigen for which an antibody can be developed, and are typically directed to molecules displayed on the surface of the targeted cell or tissue. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain) and a subunit of a TCR (e.g., TRuC). (See Baeuerle et al. Nature Communications 2087 (2019)).

[0221] In some embodiments, the exogenous nucleic acid encodes a TCR. In some embodiments, the exogenous nucleic acid encodes a genetically modified TCR. In some embodiments, the exogenous nucleic acid encodes a genetically modified TCR with specificity for a polypeptide expressed by a cancer cell. In some embodiments, the exogenous nucleic acid encodes a targeting receptor specific for the Wilms tumor gene (WT1) antigen. In some embodiments, the exogenous nucleic acid encodes a WT1-specific TCR (see, e.g., WO2020 / 081613A1).

[0222] In some embodiments, the exogenous nucleic acid is inserted into the genome of the target cell. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by homologous recombination (HR). In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by blunt-end insertion. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by non-homologous end joining. In some embodiments, the exogenous nucleic acid is integrated into a safe harbor locus in the genome of the cell. In some embodiments, the exogenous nucleic acid is integrated into one of the TRAC locus, the B2M locus, the AAVS1 locus, and / or the CIITA locus. In some embodiments, the exogenous nucleic acid is provided to the cell in a lipid-nucleic acid assembly composition. In some embodiments, the lipid-nucleic acid assembly composition is a lipid nanoparticle (LNP).

[0223] In some embodiments, the methods produce compositions comprising engineered cells that reduce or eliminate HLA-A expression and that include an exogenous nucleic acid. In some embodiments, the methods produce compositions comprising engineered cells that reduce or eliminate HLA-A expression and that secrete and / or express a polypeptide encoded by an exogenous nucleic acid integrated into the genome of the cell. In some embodiments, the methods produce compositions comprising engineered cells that reduce or eliminate HLA-A protein expression and / or reduce or eliminate HLA-A levels in the cell nucleus, have reduced MHC class II protein expression, and secrete and / or express a polypeptide encoded by an exogenous nucleic acid integrated into the genome of the cell. In some embodiments, the engineered cells elicit a reduced response from CD4+ T cells and / or CD8+ T cells.

[0224] In some embodiments, allogeneic cells are provided, the cells having reduced or eliminated expression of MHC class II and HLA-A proteins on the cell surface, the cells comprising a modification in the HLA-A gene disclosed herein, the cells comprising a modification in the CIITA gene, and the cells further comprising an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).

[0225] In some embodiments, the present disclosure provides methods for reducing or eliminating expression of HLA-A protein on the surface of cells by genetically modifying HLA-A as disclosed herein, the method further providing for reducing expression of one or more additional target genes (e.g., TRAC, TRBC). In some embodiments, the additional genetic modifications provide further advantages for the use of genetically modified cells for adoptive cell transfer applications. In some embodiments, the cells are allogeneic cells. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0226] In some embodiments, the method comprises reducing or eliminating expression of HLA-A protein on the surface of a cell, and comprises genetically modifying the cell with one or more compositions comprising an HLA-A guide RNA disclosed herein, a CIITA guide RNA, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), a guide RNA that directs an RNA-guided DNA binder to a target sequence located in another gene, thereby reducing or eliminating expression of the other gene, and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder. In some embodiments, the additional target gene is TRAC. In some embodiments, the additional target gene is TRBC.

[0227] E. Exemplary Cell Types In some embodiments, the methods and compositions disclosed herein genetically modify human cells. In some embodiments, the cells are allogeneic cells. In some embodiments, genetically modified cells are referred to as engineered cells. Engineered cells refer to cells (or progeny of cells) that contain an engineered genetic modification, e.g., have been contacted with a gene editing system and have been genetically modified by the gene editing system. The terms "engineered cells" and "genetically modified cells" are used interchangeably throughout. Engineered human cells can be any of the exemplary cell types disclosed herein. Furthermore, because MHC class I molecules are expressed on all nucleated cells, engineered human cells can be any nucleated cell.

[0228] In some embodiments, when the cells are homozygous for HLA-B, the HLA-B alleles are selected from the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, HLA - selected from any one of HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HLA-B*40:02.

[0229] In some embodiments, when the cells are homozygous for HLA-C, the HLA-C alleles are selected from the following HLA-C alleles: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA -C*15:02, HLA-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:02.

[0230] In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, and the HLA-B alleles are the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38 ...57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA *18:01, HLA-B*44:03, HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA- B*52:01, HLA-B*51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HL A-B*40:02, and the HLA-C allele is selected from any one of the following HLA-C alleles: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA-C*16:02 ... HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:02.

[0231] In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the HLA-B and HLA-C alleles of the engineered human cells are the following HLA-B and HLA-C alleles: HLA-B*07:02 and HLA-C*07:02, HLA-B*08:01 and HLA-C*07:01, HLA-B*44:02 and HLA-C*05:01, HLA-B*35:01 and HLA-C*04:01, HLA-B*40:01 and HLA-C*03:04, HLA-B*57:01 and HLA-C*06:01. :02, HLA-B*14:02 and HLA-C*08:02, HLA-B*15:01 and HLA-C*03:03, HLA-B*13:02 and HLA-C*06:02, HLA-B*44:03 and HLA-C*16:01, HLA-B*38:01 and HLA-C*12:03, HLA-B*18:01 and HLA-C*07:01, HLA-B*44:03 and HLA-C*04:01, HLA-B*51:01 and HLA-C*15:02, HLA- B*49:01 and HLA-C*07:01, HLA-B*15:01 and HLA-C*03:04, HLA-B*18:01 and HLA-C*12:03, HLA-B*27:05 and HLA-C*02:02, HLA-B*35 :03 and HLA-C*04:01, HLA-B*18:01 and HLA-C*05:01, HLA-B*52:01 and HLA-C*12:02, HLA-B*51:01 and HLA-C*14:02, HLA-B*37:01 and and HLA-C*06:02, HLA-B*53:01 and HLA-C*04:01, HLA-B*55:01 and HLA-C*03:03, HLA-B*44:02 and HLA-C*07:04, HLA-B*44:03 and HLA-C*07:01, HLA-B*35:02 and HLA-C*04:01, HLA-B*15:01 and HLA-C*04:01, and HLA-B*40:02 and HLA-C*02:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*07:02 and HLA-C*07:02.In some embodiments, the HLA-B and HLA-C alleles are HLA-B*08:01 and HLA-C*07:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*05:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*35:01 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*40:01 and HLA-C*03:04. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*57:01 and HLA-C*06:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*14:02 and HLA-C*08:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*15:01 and HLA-C*03:03. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*13:02 and HLA-C*06:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:03 and HLA-C*16:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*38:01 and HLA-C*12:03. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*18:01 and HLA-C*07:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:03 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*51:01 and HLA-C*15:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*49:01 and HLA-C*07:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*15:01 and HLA-C*03:04. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*18:01 and HLA-C*12:03.In some embodiments, the HLA-B and HLA-C alleles are HLA-B*27:05 and HLA-C*02:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*35:03 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*18:01 and HLA-C*05:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*52:01 and HLA-C*12:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*51:01 and HLA-C*14:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*37:01 and HLA-C*06:02. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*53:01 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*55:01 and HLA-C*03:03. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*07:04. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*44:03 and HLA-C*07:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*35:02 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*15:01 and HLA-C*04:01. In some embodiments, the HLA-B and HLA-C alleles are HLA-B*40:02 and HLA-C*02:02.

[0232] In some embodiments, the cell is an immune cell. As used herein, "immune cell" refers to a cell of the immune system, including, for example, lymphocytes (e.g., T cells, B cells, natural killer cells ("NK cells," and NKT cells, or iNKT cells)), monocytes, macrophages, mast cells, dendritic cells, or granulocytes (e.g., neutrophils, eosinophils, and basophils). In some embodiments, the cell is a primary immune cell. In some embodiments, the immune system cell is a CD3 + , CD4 + , and CD8 + The immune cells may be selected from T cells, regulatory T cells (Tregs), B cells, NK cells, and dendritic cells (DCs). In some embodiments, the immune cells are allogeneic.

[0233] In some embodiments, the cell is a lymphocyte. In some embodiments, the cell is an adaptive immune cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is a B cell. In some embodiments, the cell is a NK cell. In some embodiments, the cell is a macrophage. In some embodiments, the lymphocyte is allogeneic.

[0234] As used herein, a T cell may be defined as a cell that expresses a T cell receptor ("TCR" or "αβ TCR" or "γδ TCR"), although in some embodiments, the TCR of a T cell may be genetically modified (e.g., by genetic modification to the TRAC or TRBC gene) to reduce its expression, and thus expression of the protein CD3 may be used as a marker to identify T cells by standard flow cytometry methods. CD3 is a multi-subunit signaling complex that associates with the TCR. Thus, T cells may be referred to as CD3+. In some embodiments, a T cell is a cell that expresses the CD3+ marker and either the CD4+ or CD8+ marker. In some embodiments, the T cell is allogeneic.

[0235] In some embodiments, T cells express the glycoprotein CD8 and are therefore CD8+ by standard flow cytometry and may be referred to as "cytotoxic" T cells. In some embodiments, T cells express the glycoprotein CD4 and are therefore CD4+ by standard flow cytometry and may be referred to as "helper" T cells. CD4+ T cells can differentiate into subsets and may be referred to as Th1 cells, Th2 cells, Th9 cells, Th17 cells, Th22 cells, T regulatory ("Treg") cells, or T follicular helper cells ("Tfh"). Each CD4+ subset releases specific cytokines that may have either pro- or anti-inflammatory, survival, or protective functions. T cells may be isolated from a subject by CD4+ or CD8+ selection methods.

[0236] In some embodiments, the T cells are memory T cells. In the body, memory T cells have encountered antigen. Memory T cells can be located in secondary lymphoid organs (central memory T cells) or recently infected tissues (effector memory T cells). Memory T cells can be CD8+ T cells. Memory T cells can be CD4+ T cells.

[0237] As used herein, "central memory T cells" can be defined as antigen-experienced T cells, which may express, for example, CD62L and CD45RO. Central memory T cells may be detected as CD62L+ and CD45RO+, and also express CCR7, and therefore may be detected as CCR7+ by standard flow cytometry methods.

[0238] As used herein, "early stem cell memory T cells" (or "Tscm") can be defined as T cells that express CD27 and CD45RA and are therefore CD27+ and CD45RA+ by standard flow cytometry. Tscm do not express the CD45 isoform CD45RO, and therefore, when stained for this isoform by standard flow cytometry, Tscm are also CD45RO-. Thus, CD45RO-CD27+ cells are also early stem cell memory T cells. Tscm cells also express CD62L and CCR7 and can therefore be detected as CD62L+ and CCR7+ by standard flow cytometry. Early stem cell memory T cells have been shown to correlate with increased persistence and therapeutic efficacy of cell therapy products.

[0239] In some embodiments, the cells are B cells. As used herein, a "B cell" can be defined as a cell that expresses CD19 and / or CD20, and / or B-cell maturation antigen ("BCMA"), and thus the B cells are CD19+, and / or CD20+, and / or BCMA+ by standard flow cytometry. The B cells are further negative for CD3 and CD56 by standard flow cytometry. The B cells can be plasma cells. The B cells can be memory B cells. The B cells can be naive B cells. The B cells can be IgM+ or have a class-switched B cell receptor (e.g., IgG+ or IgA+). In some embodiments, the B cells are allogeneic.

[0240] In some embodiments, the cells are mononuclear cells, e.g., derived from bone marrow or peripheral blood. In some embodiments, the cells are peripheral blood mononuclear cells ("PBMCs"). In some embodiments, the cells are PBMCs, e.g., lymphocytes or monocytes. In some embodiments, the cells are peripheral blood lymphocytes ("PBLs"). In some embodiments, the mononuclear cells are allogeneic.

[0241] Cells used in ACT and / or tissue regeneration therapy include, for example, stem cells, progenitor cells, and primary cells. Stem cells include, for example, pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), embryonic stem cells (ESCs), mesenchymal stem cells (MSCs, e.g., isolated from bone marrow (BM), peripheral blood (PB), placenta, umbilical cord (UC), or adipose tissue), hematopoietic stem cells (HSCs, e.g., isolated from BM or UC), neural stem cells (NSCs), tissue-specific progenitor stem cells (TSPSCs), and limbal stem cells (LSCs). Progenitor and primary cells include mononuclear cells (MNCs, e.g., isolated from BM or PB), endothelial progenitor cells (EPCs, e.g., isolated from BM, PB, and UC), neural progenitor cells (NPCs), and tissue-specific primary cells or cells derived therefrom (TSCs), including chondrocytes, myocytes, and keratinocytes. Also included are cells for organ or tissue transplantation, such as pancreatic islet cells, cardiomyocytes, thyroid cells, thymocytes, nerve cells, skin cells, and retinal cells.

[0242] In some embodiments, the human cells are isolated from a human subject. In some embodiments, the cells are isolated from human donor PBMCs or leukopaks. In some embodiments, the cells are from a subject with a condition, disorder, or disease. In some embodiments, the cells are from a human donor with Epstein-Barr virus ("EBV").

[0243] In some embodiments, the method is carried out ex vivo. As used herein, "ex vivo" refers to an in vitro method, such as an ACT therapy, in which cells can be transferred to a subject. In some embodiments, the ex vivo method is an in vitro method that includes an ACT therapy cell or cell population.

[0244] In some embodiments, the cells are derived from a cell line. In some embodiments, the cell line is derived from a human subject. In some embodiments, the cell line is a lymphoblastoid cell line ("LCL"). The cells may be cryopreserved and thawed. The cells may not have been previously cryopreserved.

[0245] In some embodiments, the cells are from a cell bank. In some embodiments, the cells are genetically modified and then transferred to a cell bank. In some embodiments, cells are removed from a subject, genetically modified ex vivo, and transferred to a cell bank. In some embodiments, a genetically modified population of cells is transferred to a cell bank. In some embodiments, a genetically modified population of immune cells is transferred to a cell bank. In some embodiments, a genetically modified population of immune cells comprising first and second subpopulations, the first and second subpopulations having at least one common genetic modification and at least one different genetic modification, is transferred to a cell bank.

[0246] F. Exemplary Gene Editing Systems Various suitable gene editing systems may be used to create the engineered cells disclosed herein, including, but not limited to, CRISPR / Cas systems, zinc finger nuclease (ZFN) systems, and transcription activator-like effector nuclease (TALEN) systems. Generally, gene editing systems involve the use of engineered cleavage systems to induce double-strand breaks (DSBs) or nicks (e.g., single-strand breaks, or SSBs) in target DNA sequences. Cleavage or nicking can occur by using specific nucleases, such as engineered ZFNs or TALENs, or by using CRISPR / Cas systems with engineered guide RNAs to induce specific cleavage or nicking of target DNA sequences. Additionally, targeted nucleases have been developed based on the Argonaute system (e.g., from T. thermophilus known as "TtAgo", see Swarts et al (2014) Nature 507(7491):258-261), which may also have potential for use in gene editing and gene therapy.

[0247] In some embodiments, the gene editing system is a TALEN system. Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be engineered to cleave specific sequences in DNA. They are created by fusing a TAL effector DNA binding domain to a DNA cleavage domain (a nuclease that cleaves DNA strands). Transcription activator-like effectors (TALEs) can be engineered to bind to desired DNA sequences and promote DNA cleavage at specific locations (see, for example, Boch, 2011, Nature Biotech). Restriction enzymes can be introduced into cells for use in gene editing or for in situ gene editing, a technique known as gene editing using engineered nucleases. Such methods and compositions for use therein are known in the art. See, for example, WO2019147805, WO2014040370, and WO2018073393, the contents of which are incorporated herein in their entireties.

[0248] In some embodiments, the gene editing system is a zinc finger system. Zinc finger nuclease (ZFN) is an artificial restriction enzyme that is generated by fusing a zinc finger DNA binding domain with a DNA cleavage domain. The zinc finger domain can be engineered to target specific desired DNA sequences, so that zinc finger nucleases can target unique sequences within complex genomes. The non-specific cleavage domain from type II restriction endonuclease FokI is typically used as the cleavage domain in ZFN. The cleavage is repaired by endogenous DNA repair mechanisms, allowing ZFN to precisely modify the genome of higher organisms. Such methods and compositions for use therein are known in the art. For example, see WO2011091324, the entire contents of which are incorporated herein by reference.

[0249] In some embodiments, the gene editing system is a CRISPR / Cas system, e.g., comprising a CRISPR guide RNA comprising a guide sequence and an RNA-guided DNA binding agent, as further described herein.

[0250] G. CRISPR guide RNA Provided herein are guide sequences useful for modifying target sequences, for example, using guide RNAs, including the disclosed guide sequences, with RNA-guided DNA-binding agents (e.g., CRISPR / Cas systems).

[0251] Each of the guide sequences disclosed herein may further comprise additional nucleotides to form a crRNA, for example, at its 3' end, the guide sequence has the following exemplary nucleotide sequence following it: in the 5' to 3' direction, GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 213). In the case of an sgRNA, the above-mentioned guide sequences may further comprise additional nucleotides (scaffold sequences) to form an sgRNA, for example, at the 3' end of the guide sequence, the following exemplary nucleotide sequence following it: in the 5' to 3' direction, GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 214) or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 215, which is SEQ ID NO: 214 without the four terminal Us). In some embodiments, none of the four terminal Us of SEQ ID NO: 214 are present. In some embodiments, only 1, 2, or 3 of the four terminal Us of SEQ ID NO: 214 are present.

[0252] In some embodiments, the sgRNA comprises any one of the guide sequences of SEQ ID NOs: 1-211 and additional nucleotides to form a crRNA, for example, with the following exemplary scaffold nucleotide sequence at its 3' end following the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGCACCGAGUCGGUGC (SEQ ID NO: 216) in the 5' to 3' direction. SEQ ID NO: 216 is missing 8 nucleotides, referencing the following wild-type guide RNA conserved sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 215). Other exemplary scaffold nucleotide sequences are provided in Table 6. In some embodiments, the sgRNA comprises any one of the guide sequences of SEQ ID NOs: 1-211 and an additional guide scaffold sequence in the 5' to 3' direction of Table 6, comprising a modified version of the scaffold sequence, as shown.

[0253] In some embodiments, the guide RNA is an sgRNA comprising any one of the sequences set forth in Table 2 (SEQ ID NOs: 249-343 and 344-438), Table 3 (SEQ ID NOs: 439-471 and 472-504), and Table 5 (SEQ ID NOs: 505-532 and 533-560). In some embodiments, the guide RNA is a chemically modified guide RNA. In some embodiments, the guide RNA is a chemically modified single guide RNA. The chemically modified guide RNA may comprise one or more of the modifications set forth in Tables 2, 3, 5, and 6. The chemically modified guide RNA may comprise one or more modified nucleotides in any one of SEQ ID NOs: 1003, 1007-1009, and 1011-1014.

[0254] In some embodiments, the guide RNA is an sgRNA comprising any one of SEQ ID NOs: 249-343, 439-471, and 505-532 with at least one chemical modification disclosed herein. In some embodiments, the guide RNA is an sgRNA comprising a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of SEQ ID NOs: 249-343, 439-471, and 505-532 with at least one chemical modification disclosed herein.

[0255] In some embodiments, the guide RNA is an sgRNA comprising the modification pattern set forth in SEQ ID NO: 1013 or 1014. In some embodiments, the guide RNA is an sgRNA comprising a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids in SEQ ID NOs: 344-438, 472-504, and 533-560.

[0256] In some embodiments, the guide RNA comprises an sgRNA comprising the modification pattern set forth in SEQ ID NO: 1003. In some embodiments, the guide RNA comprises an sgRNA comprising the modified nucleotides of SEQ ID NO: 1003, which comprises a guide sequence comprising a sequence selected from SEQ ID NOs: 1-211. In some embodiments, the guide RNA is an sgRNA comprising the sequence of SEQ ID NO: 1016, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to SEQ ID NO: 1016.

[0257] In some embodiments, the guide RNA comprises a single guide RNA comprising any one of the sequences of SEQ ID NOs: 344-438, 472-504, and 533-560, and 1016, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of the sequences of SEQ ID NOs: 344-438, 472-504, and 533-560, and 1016.

[0258] In some embodiments, the guide RNA comprises a guide sequence comprising any one of SEQ ID NOs: 13-18, 26, 37-39, 41, 43, 45, and 62. In some embodiments, the guide RNA comprises a single guide RNA comprising any one of the sequences of SEQ ID NOs: 356-361, 369, 380-382, 384, 386, 388, and 405, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of the sequences of SEQ ID NOs: 356-361, 369, 380-382, 384, 386, 388, and 405.

[0259] The guide RNA may further comprise a trRNA. In each composition and method embodiment described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or may be on separate RNAs (dgRNA). In the context of an sgRNA, the crRNA and trRNA components may be covalently linked, for example, via a phosphodiester bond or other covalent bond. In some embodiments, the crRNA and / or trRNA sequence may be referred to as the "scaffold" or "conserved portion" of the guide RNA.

[0260] In each of the composition, use, and method embodiments described herein, the guide RNA may comprise two RNA molecules as a "dual guide RNA" or "dgRNA." The dgRNA comprises a first RNA molecule comprising a crRNA, which comprises a guide sequence, e.g., as shown in Tables 2-5, and a second RNA molecule comprising a trRNA. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex by base pairing between portions of the crRNA and trRNA.

[0261] In each of the embodiments of the compositions, uses, and methods described herein, the guide RNA may comprise a single RNA molecule, referred to as a "single guide RNA" or "sgRNA." The sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Tables 2-5 covalently linked to a trRNA. The sgRNA may comprise 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Tables 2-5. In some embodiments, the crRNA and trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure by base pairing between portions of the crRNA and trRNA. In some embodiments, the crRNA and trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.

[0262] In some embodiments, the trRNA may comprise all or part of a trRNA sequence from a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise a specific secondary structure, such as, for example, one or more hairpin or stem-loop structures, or one or more bulges.

[0263] In some embodiments, compositions are provided that include one or more guide RNAs comprising any one of the guide sequences in Tables 2-5. In some embodiments, compositions are provided that include one or more guide RNAs comprising any one of the guide sequences in Tables 2-5, wherein the guide sequence is followed at its 3' end by a nucleotide of SEQ ID NO: 213-216. In some embodiments, one or more guide RNAs comprising any one of the guide sequences in Tables 2-5, wherein the guide sequence is followed at its 3' end by a nucleotide of SEQ ID NO: 213-216, are modified according to the modification pattern of any one of SEQ ID NOs: 1003, 1007-1009, and 1011-1014.

[0264] In some embodiments, compositions are provided that include one or more guide RNAs that include any one of the guide sequences in Tables 2-5. In one aspect, the invention provides compositions that include one or more gRNAs that include a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-211.

[0265] In other embodiments, compositions are provided that include at least one, e.g., at least two, gRNAs that include a guide sequence selected from any two or more of the guide sequences shown in Tables 2-5. In some embodiments, the compositions include at least two gRNAs, each including a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the guide sequences shown in Tables 2-5.

[0266] In some embodiments, the guide RNA compositions of the present invention are designed to recognize (e.g., hybridize to) a target sequence within HLA-A. For example, the HLA-A target sequence can be recognized and cleaved by a provided Cas cleavage vector that includes the guide RNA. In some embodiments, an RNA-guided DNA binding agent, e.g., a Cas cleavage vector, can be directed to a target sequence in HLA-A by the guide RNA, where the guide sequence of the guide RNA hybridizes to the target sequence, and the RNA-guided DNA binding agent, e.g., a Cas cleavage vector, cleaves the target sequence.

[0267] In some embodiments, the selection of one or more guide RNAs is determined based on a target sequence within HLA-A. In some embodiments, a composition comprising one or more guide sequences comprises guide sequences that are complementary to corresponding genomic regions shown in Tables 2-5 according to coordinates from the human reference genome hg38. The guide sequences of further embodiments may be complementary to sequences near the genomic coordinates listed in any of Tables 2-5 within HLA-A. For example, the guide sequences of further embodiments may be complementary to sequences comprising 10 contiguous nucleotides ± 10 nucleotides of the genomic coordinates listed in Tables 2-5.

[0268] Without being bound by any particular theory, modifications in certain regions of a target gene (e.g., frameshift mutations resulting from indels resulting from nuclease-mediated DSBs) may be less tolerated than mutations in other regions, and therefore the location of the DSB is an important factor in the amount or type of protein knockdown that can be achieved. In some embodiments, a gRNA that is complementary to or has complementarity with a target sequence within the target gene is used to direct the RNA-guided DNA-binding agent to a specific location within the target gene.

[0269] In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the target gene, hi some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the human HLA-A gene.

[0270] In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between the guide sequence of the guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is 20 nucleotides. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1 to 4 mismatches, where the guide sequence is 20 nucleotides.

[0271] In some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, e.g., a Cas nuclease described herein. In some embodiments, an RNA-guided DNA binding agent, e.g., an mRNA comprising an ORF encoding a Cas nuclease, is provided, used, or administered.

[0272] H. Modified gRNA and mRNA In some embodiments, a gRNA (e.g., an sgRNA, a short sgRNA, a dgRNA, or a crRNA) is modified. The term "modified" or "modification" in the context of a gRNA described herein includes the modifications described above, including, for example, (a) end modifications, e.g., 5'-end modifications or 3'-end modifications, including 5'- or 3'-protected end modifications; (b) nucleobase (or "base") modifications, including base substitution or removal; (c) sugar modifications, including modifications at the 2', 3', and / or 4' positions; (d) internucleoside linkage modifications; and (e) backbone modifications, which can include modifications or replacement of the phosphodiester bond and / or ribose sugar. Modifications of a nucleotide at a given position include modifications or replacement of the phosphodiester bond immediately 3' to the sugar of the nucleotide. Thus, for example, a nucleic acid containing a phosphorothioate between the first and second sugars from the 5' end is considered to contain a modification at position 1. The term "modified gRNA" refers to a gRNA having modifications to the chemical structure of one or more of the bases, sugars, and phosphodiester linkages or backbone moieties, including nucleotide phosphates, all of which are described and exemplified in detail herein.

[0273] Further description and exemplary patterns of modification are provided in Table 1 of WO2019 / 237069, published December 12, 2019, the entire contents of which are incorporated herein by reference.

[0274] In some embodiments, the gRNA comprises modifications at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more YA sites. In some embodiments, the pyrimidine at the YA site comprises a modification, including a modification that alters the internucleoside linkage immediately 3' to the sugar of the pyrimidine. In some embodiments, the adenine at the YA site comprises a modification, including a modification that alters the internucleoside linkage immediately 3' to the sugar of the adenine. In some embodiments, the pyrimidine and adenine at the YA site comprise a modification, such as a sugar, base, or internucleoside linkage modification. The YA modification can be any type of modification described herein. In some embodiments, the YA modification comprises one or more of phosphorothioate, 2'-OMe, or 2'-fluoro. In some embodiments, the YA modification comprises a pyrimidine modification comprising one or more of phosphorothioate, 2'-OMe, 2'-H, inosine, or 2'-fluoro. In some embodiments, the YA modification comprises a bicyclic ribose analog (e.g., LNA, BNA, or ENA) within the RNA duplex region comprising one or more YA sites. In some embodiments, the YA modification comprises a bicyclic ribose analog (e.g., LNA, BNA, or ENA) within the RNA duplex region comprising the YA site, wherein the YA modification is distal to the YA site.

[0275] In some embodiments, the guide sequence (or guide region) of a gRNA comprises one, two, three, four, five, or more YA sites ("guide region YA sites"), which may comprise a YA modification. In some embodiments, one or more YA sites located at the 5' end, 5' end, 6' end, 7' end, 8' end, 9' end, or 10' end of the 5'-end ("5' end," etc., refers to position 5 relative to the 3' end of the guide region, i.e., the 3'-most nucleotide within the guide region) comprise a YA modification. Modified guide region YA sites comprise a YA modification.

[0276] In some embodiments, the modified guide region YA site is within 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides of the 3'-terminal nucleotide of the guide region. For example, if the modified guide region YA site is within 10 nucleotides of the 3'-terminal nucleotide of the guide region and the guide region is 20 nucleotides long, the modified nucleotide of the modified guide region YA site is located at any of positions 11 to 20. In some embodiments, the modified guide region YA site is at or after nucleotide 4, 5, 6, 7, 8, 9, 10, or 11 from the 5' end of the 5' end.

[0277] In some embodiments, the modified guide region YA site is other than a 5'-end modification. For example, the sgRNA can include a 5'-end modification described herein and can further include a modified guide region YA site. Alternatively, the sgRNA can include an unmodified 5'-end and a modified guide region YA site. Alternatively, a short sgRNA can include a modified 5'-end and an unmodified guide region YA site.

[0278] In some embodiments, the modified guide region YA site comprises a modification that excludes at least one nucleotide located 5' from the guide region YA site. For example, if nucleotides 1-3 comprise phosphorothioate, nucleotide 4 comprises only 2'-OMe modifications, and nucleotide 5 is a pyrimidine in the YA site and comprises phosphorothioate, the modified guide region YA site comprises a modification that excludes at least one nucleotide located 5' from the guide region YA site (nucleotide 4) (phosphorothioate). In another example, if nucleotides 1-3 comprise phosphorothioate and nucleotide 4 is a pyrimidine in the YA site and comprises 2'-OMe, the modified guide region YA site comprises a modification that excludes at least one nucleotide located 5' from the guide region YA site (any of nucleotides 1-3) (2'-OMe). This condition is also always met when an unmodified nucleotide is located 5' from the modified guide region YA site.

[0279] In some embodiments, the modified guide region YA site comprises the modifications described for the YA site above. The guide region of the gRNA can be modified according to any embodiment comprising a modified guide region described herein. Any embodiment described elsewhere in this disclosure can be combined with any of the above embodiments to the extent feasible.

[0280] In some embodiments, the 5' and / or 3' end regions of the gRNA are modified.

[0281] In some embodiments, the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in the 3'-terminal region are modified. This modification may be referred to throughout as a "3'-terminal modification." In some embodiments, the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in the 3'-terminal region comprise two or more modifications. In some embodiments, the 3'-terminal modification comprises or further comprises any one or more of modified nucleotides selected from 2'-O-methyl (2'-O-Me) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In some embodiments, the 3'-terminal modification comprises or further comprises modifications of 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 3'-end of the gRNA. In some embodiments, the 3'-end modification comprises or further comprises one PS bond, the bond being between the last and penultimate nucleotide. In some embodiments, the 3'-end modification comprises or further comprises two PS bonds between the last three nucleotides. In some embodiments, the 3'-end modification comprises or further comprises four PS bonds between the last four nucleotides. In some embodiments, the 3'-end modification comprises or further comprises a PS bond between any one or more of the last 2, 3, 4, 5, 6, or 7 nucleotides. In some embodiments, the gRNA comprising a 3'-end modification comprises or further comprises a 3' tail, the 3' tail comprising modifications of any one or more of the nucleotides present in the 3' tail. In some embodiments, the 3' tail is fully modified. In some embodiments, the 3' tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 nucleotides, optionally wherein any one or more of these nucleotides are modified. In some embodiments, gRNAs are provided that comprise a 3' protected end modification.In some embodiments, the 3' tail comprises from 1 to about 20 nucleotides, from 1 to about 15 nucleotides, from 1 to about 10 nucleotides, from 1 to about 5 nucleotides, from 1 to about 4 nucleotides, from 1 to about 3 nucleotides, and from 1 to about 2 nucleotides. In some embodiments, the gRNA does not comprise a 3' tail.

[0282] In some embodiments, the 5'-end region is modified, e.g., the first 1, 2, 3, 4, 5, 6, or 7 nucleotides of the gRNA are modified. Throughout, this modification may be referred to as a "5'-end modification." In some embodiments, the first 1, 2, 3, 4, 5, 6, or 7 nucleotides of the 5'-end region comprise two or more modifications. In some embodiments, at least one of the terminal (i.e., first) 1, 2, 3, 4, 5, 6, or 7 nucleotides at the end of the 5'-end is modified. In some embodiments, both the 5'- and 3'-end regions (e.g., terminal) of the gRNA are modified. In some embodiments, only the 5'-end region of the gRNA is modified. In some embodiments, only the 3'-end region (plus or minus the 3' tail) of the conserved portion of the gRNA is modified. In some embodiments, the gRNA comprises modifications in 1, 2, 3, 4, 5, 6, or 7 of the first 7 nucleotides in the 5'-end region of the gRNA. In some embodiments, the gRNA comprises modifications at 1, 2, 3, 4, 5, 6, or 7 of the 7 terminal nucleotides in the 3'-terminal region. In some embodiments, 2, 3, or 4 of the first 4 nucleotides in the 5'-terminal region and / or 2, 3, or 4 of the terminal 4 nucleotides in the 3'-terminal region are modified. In some embodiments, 2, 3, or 4 of the first 4 nucleotides in the 5'-terminal region are linked with phosphorothioate (PS) linkages. In some embodiments, the 5'- and / or 3'-terminal modifications comprise 2'-O-methyl (2'-O-Me) or 2'-O-(2-methoxyethyl) (2'-O-moe) modifications. In some embodiments, the modifications comprise 2'-fluoro (2'-F) modifications to nucleotides. In some embodiments, the modifications comprise internucleotide phosphorothioate (PS) linkages. In some embodiments, the modifications comprise inverted abasic nucleotides. In some embodiments, the modifications comprise protected end modifications.In some embodiments, the modifications include two or more modifications selected from a blocking end modification, 2'-O-Me, 2'-O-moe, 2'-fluoro (2'-F), phosphorothioate internucleotide (PS) linkages, and inverted abasic nucleotides. In some embodiments, equivalent modifications are included.

[0283] In some embodiments, gRNAs are provided that include 5' and 3' end modifications. In some embodiments, the gRNAs include modified nucleotides that are not at the 5' or 3' end.

[0284] In some embodiments, sgRNAs are provided that include upper stem modifications, where the upper stem modifications include any one or more of US1-US12 modifications in the upper stem region. In some embodiments, sgRNAs are provided that include upper stem modifications, where the upper stem modifications include modifications of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all 12 nucleotides in the upper stem region. In some embodiments, sgRNAs are provided that include upper stem modifications, where the upper stem modifications include 1, 2, 3, 4, or 5 YA modifications at YA sites. In some embodiments, the upper stem modifications include 2'-OMe-modified nucleotides, 2'-O-moe-modified nucleotides, 2'-F-modified nucleotides, and / or combinations thereof. Other modifications described herein, such as 5'-end modifications and / or 3'-end modifications, can be combined with the upper stem modifications.

[0285] In some embodiments, the sgRNA comprises a modification in the hairpin region. In some embodiments, the hairpin region modification comprises at least one modified nucleotide selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, and / or combinations thereof. In some embodiments, the hairpin region modification is in the hairpin 1 region. In some embodiments, the hairpin region modification is in the hairpin 2 region. In some embodiments, the hairpin modification comprises one, two, or three YA modifications at the YA site. In some embodiments, the hairpin modification comprises at least one, two, three, four, five, or six YA modifications. Other modifications described herein, such as upper stem modifications, 5' end modifications, and / or 3' end modifications, can be combined with modifications in the hairpin region.

[0286] In some embodiments, the gRNA comprises a substituted and optionally shortened Hairpin 1 region, wherein at least one of the following nucleotide pairs is replaced with a Watson-Crick pairing nucleotide in the substituted and optionally shortened Hairpin 1: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and / or H1-4 and H1-9. "Watson-Crick pairing nucleotides" includes any pair capable of forming a Watson-Crick base pair, including AT, AU, TA, UA, CG, and GC pairs, as well as pairs comprising modified forms of any of the foregoing nucleotides with the same base-pairing preference. In some embodiments, the Hairpin 1 region lacks any one or two of H1-5 through H1-8. In some embodiments, the Hairpin 1 region lacks one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and / or H1-4 and H1-9. In some embodiments, the Hairpin 1 region lacks 1 to 8 nucleotides of the Hairpin 1 region. In any of the foregoing embodiments, the missing nucleotides can be one or more nucleotide pairs substituted with Watson-Crick pairing nucleotides (H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and / or H1-4 and H1-9) to form base pairs in the gRNA.

[0287] In some embodiments, the gRNA further comprises an upper stem region lacking at least one nucleotide, such as any of the shortened upper stem regions shown in Table 7 of U.S. Application No. 62 / 946,905, the contents of which are incorporated by reference in their entirety or described elsewhere herein, which can be combined with any of the shortened or substituted Hairpin 1 regions described herein.

[0288] In some embodiments, the sgRNAs provided herein are short single guide RNAs (short sgRNAs) that include a conserved portion of the sgRNA, e.g., a hairpin region, lacking at least 5-10 or 6-10 contiguous nucleotides, in some embodiments, 5-10 or 6-10 contiguous nucleotides.

[0289] In some embodiments, the short sgRNA lacks at least nucleotides 54-58 (AAAAA) of the conserved portion of the spyCas9 sgRNA. In some embodiments, the short sgRNA is a non-spyCas9 sgRNA that lacks nucleotides corresponding to nucleotides 54-58 (AAAAA) of the conserved portion of spyCas9, as determined, for example, by pairwise or structural alignment.

[0290] In some embodiments, the short sgRNAs described herein comprise a conserved portion that includes a hairpin region, wherein the hairpin region is missing 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides. In some embodiments, the missing nucleotides are 5-10 missing nucleotides or 6-10 missing nucleotides. In some embodiments, the missing nucleotides are contiguous. In some embodiments, the missing nucleotides span at least a portion of hairpin 1 and a portion of hairpin 2. In some embodiments, the 5-10 missing nucleotides comprise or consist of nucleotides 54-58, 54-61, or 53-60 of SEQ ID NO:215.

[0291] In some embodiments, the short sgRNAs described herein further comprise a nexus region, wherein the nexus region lacks at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides within the nexus region). In some embodiments, the short sgRNA lacks every nucleotide in the nexus region.

[0292] In some embodiments, a SpyCas9 short sgRNA described herein comprises the sequence NNNNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGCU (SEQ ID NO: 1002).

[0293] In some embodiments, the short sgRNAs described herein comprise the modification pattern set forth in SEQ ID NO: 1003: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGmUmGmC*mU (SEQ ID NO: 1003), where A, C, G, U, and N are adenine, cytosine, guanine, uracil, and any ribonucleotide, respectively, unless otherwise indicated. m indicates a 2'O-methyl modification, and * indicates a phosphorothioate internucleotide linkage.

[0294] In certain embodiments, using SEQ ID NO: 215 ("exemplary SpyCas9 sgRNA-1") as an example, the exemplary SpyCas9 sgRNA-1 further comprises one or more of the following: A. A shortened or substituted and optionally shortened hairpin 1 region, 1. At least one of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9 is substituted with a Watson-Crick paired nucleotide in Hairpin 1, and the Hairpin 1 region optionally comprises: a.One or two of H1-5 to H1-8, b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. lacking 1 to 8 nucleotides of the hairpin 1 region, or 2. The shortened Hairpin 1 region lacks 6 to 8 nucleotides, preferably 6 nucleotides; a. One or more of positions H1-1, H1-2, or H1-3 are deleted or substituted compared to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 215), or b. One or more of positions H1-6 through H1-10 are substituted compared to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 215); or 3. A shortened hairpin 1 region, wherein the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted compared to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 215); or B. A shortened upper stem region, wherein the shortened upper stem region lacks 1 to 6 nucleotides, and wherein 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region contain no more than 4 substitutions compared to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 215); or C. A substitution compared to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 215) in any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substitution nucleotide is not a pyrimidine followed by an adenine or an adenine preceded by a pyrimidine; or D. An exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 215) having an upper stem region, wherein the upper stem modification comprises any one or more modifications of US1-US12 in the upper stem region; 1. the modified nucleotides are optionally selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof; or 2. An exemplary SpyCas9 sgRNA-1, wherein the modified nucleotides optionally include 2'-OMe modified nucleotides.

[0295] In certain embodiments, an sgRNA, such as the exemplary SpyCas9 sgRNA-1, or an sgRNA comprising the exemplary SpyCas9 sgRNA-1, further comprises a 3' tail, e.g., a 3' tail of 1, 2, 3, 4, or more nucleotides. In certain embodiments, the tail comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphorothioate (PS) internucleotide linkages, and inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides. In certain embodiments, the modified nucleotides comprise a PS linkage between the nucleotides. In certain embodiments, the modified nucleotides comprise a 2'-OMe modified nucleotide and a PS linkage between the nucleotides.

[0296] In some embodiments, the gRNAs described herein further comprise a nexus region, wherein the nexus region lacks at least one nucleotide.

[0297] In some embodiments, the gRNA is chemically modified. A gRNA that includes one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or a "chemically modified" gRNA to describe the presence of one or more non-natural and / or naturally occurring components or structures used in place of, or in addition to, the standard A, G, C, and U residues. Modified nucleosides and nucleotides can include one or more of the following: (i) an alteration in the phosphodiester backbone linkage, e.g., replacement of one or both of the non-bridging phosphate oxygens and / or one or more of the bridging phosphate oxygens (exemplary backbone modifications); (ii) an alteration, e.g., replacement, of a component of the ribose sugar, e.g., the 2' hydroxyl of the ribose sugar (exemplary sugar modifications); (iii) extensive replacement of a phosphate moiety with a "dephosphorylated" linker (exemplary backbone modifications); (iv) a modification or replacement of a naturally occurring nucleobase, including with a non-standard nucleobase (exemplary base modifications); (v) a replacement or modification of the ribose phosphate backbone (exemplary backbone modifications); (vi) a modification of the 3' or 5' end of the oligonucleotide, e.g., removal, modification, or replacement of a terminal phosphate group, or conjugation of a moiety, cap, or linker (such 3' or 5' cap modifications can include sugar and / or backbone modifications); and (vii) a modification or replacement of the sugar (exemplary sugar modifications).

[0298] Chemical modifications such as those listed above can be combined to provide modified gRNAs comprising nucleosides and nucleotides (collectively "residues") that may have two, three, four, or more modifications. For example, modified residues may have a modified sugar and a modified nucleobase. In some embodiments, each base of the gRNA is modified, e.g., all bases have a modified phosphate group, such as a phosphorothioate group. In certain embodiments, all, or substantially all, of the phosphate groups of the gRNA molecule are replaced with phosphorothioate groups. In some embodiments, the modified gRNA comprises at least one modified residue at or near the 5' end of the RNA. In some embodiments, the modified gRNA comprises at least one modified residue at or near the 3' end of the RNA.

[0299] In some embodiments, the gRNA comprises one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) of the positions in the modified gRNA are modified nucleosides or nucleotides.

[0300] In some embodiments of backbone modification, the phosphate group of the modified residue can be modified by replacing one or more oxygen atoms with different substituents.In addition, modified residues, such as modified residues present in modified nucleic acids, can include large-scale replacement of unmodified phosphate moieties with modified phosphate groups, as described herein.In some embodiments, backbone modification of phosphate backbone can include modifications that result in either uncharged linkers or charged linkers with asymmetric charge distribution.

[0301] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters.

[0302] Nucleic acid-mimicking scaffolds can also be constructed in which the phosphate linker and ribose sugar are replaced with nuclease-resistant nucleoside or nucleotide surrogates. Such modifications can include backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by surrogate backbones. Examples can include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0303] Modified nucleosides and nucleotides may contain one or more modifications to the sugar, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) may be modified, e.g., replaced by a number of different "oxy" or "deoxy" substituents. In some embodiments, modifications to the 2' hydroxyl group may enhance the stability of the nucleic acid, as the hydroxyl can no longer be further deprotonated to form a 2'-alkoxide ion. Examples of 2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or a sugar), polyethylene glycol (PEG), O(CHCHO), and the like. n Examples of suitable 2' hydroxyl group modifications include CH2CH2OR, where R can be, for example, H or an optionally substituted alkyl, and n can be an integer from 0 to 20. In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, in which the 2'-hydroxyl group is replaced with fluorine. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, in which the 2' hydroxyl is replaced with, for example, C 1~6 Alkylene or C 1~6 The 2' hydroxyl group modification may include "locked" nucleic acids (LNAs) that may be connected to the 4' carbon of the same ribose sugar by a heteroalkylene bridge; exemplary bridges may include methylene, propylene, ether, or amino bridges. In some embodiments, the 2' hydroxyl group modification may include "unlocked" nucleic acids (UNAs) in which the ribose ring lacks a C2'-C3' bond. In some embodiments, the 2' hydroxyl group modification may include a methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).

[0304] A "deoxy" 2' modification can be hydrogen (i.e., a deoxyribose sugar, e.g., an overhanging portion of a partial dsRNA), halo (e.g., bromo, chloro, fluoro, or iodo), amino (where amino can be, e.g., NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), NH(CHCHNH) n and may include CH2CH2-amino (wherein amino is, e.g., as described herein), -NHC(O)R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano, mercapto, alkyl-thio-alkyl, thioalkoxy, and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, optionally substituted by amino, e.g., as described herein.

[0305] Sugar modifications can include sugar groups that contain one or more carbons and have the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, modified nucleic acids can include nucleotides containing, for example, arabinose as the sugar. Modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. Modified nucleic acids can also include one or more sugars that are L-configured, such as L-nucleosides.

[0306] The modified nucleosides and modified nucleotides described herein that can be incorporated into modified nucleic acids can contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to result in modified residues that can be incorporated into modified nucleic acids. The nucleobases of a nucleotide can be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of bases.

[0307] In embodiments using dual guide RNAs, each of the crRNA and tracrRNA can contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments involving an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, one or more or all of the nucleotides in the single-stranded overhangs of the gRNA molecule are deoxynucleotides.

[0308] In some embodiments, the gRNAs disclosed herein comprise one of the modification patterns disclosed in WO2018 / 107028A1, published June 14, 2018, the contents of which are incorporated herein by reference in their entirety.

[0309] The terms "mA," "mC," "mU," or "mG" may be used to refer to a nucleotide modified with 2'-O-Me. The terms "fA," "fC," "fU," or "fG" may be used to refer to a nucleotide substituted with 2'-F. "*" may be used to refer to a PS modification. The terms A*, C*, U*, or G* may be used to refer to a nucleotide that is linked to the next (e.g., 3') nucleotide with a PS bond. The terms "mA*," "mC*," "mU*," or "mG*" may be used to refer to a nucleotide substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide with a PS bond.

[0310] [Table 7]

[0311] I. Ribonucleoprotein Complexes In some embodiments, the present disclosure provides compositions comprising one or more gRNAs comprising one or more guide sequences from Tables 2-5 and an RNA-guided DNA-binding agent, e.g., a nuclease, e.g., a Cas nuclease, e.g., Cas9. In some embodiments, the RNA-guided DNA-binding agent has cleavage activity, which may also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nuclease. Examples of Cas9 nucleases include those in Type II CRISPR systems from S. pyogenes, S. aureus, and other prokaryotes (see, e.g., the list in the next paragraph), as well as modified (e.g., engineered or mutant) versions thereof. See, e.g., US2016 / 0312198A1, US2016 / 0312199A1. Other examples of Cas nucleases include the Csm or Cmr complexes of type III CRISPR systems, or the Cas10, Csm1, or Cmr2 subunits thereof, and the Cascade complex of type I CRISPR systems, or the Cas3 subunit thereof. In some embodiments, the Cas nuclease may be derived from a type IIA, type IIB, or type IIC system. For a discussion of various CRISPR systems and Cas nucleases, see, e.g., Makarova et al., NAT.REV.MICROBIOL. 9:467-477 (2011); Makarova et al., NAT.REV.MICROBIOL, 13:722-36 (2015); Shmakov et al., MOLECULAR CELL, 60:385-397 (2015). In some embodiments, the RNA-guided DNA binder comprises a Cas nickase. In some embodiments, the RNA-guided nickase is modified or derived from a Cas protein, such as a Class 2 Cas nuclease (which may be, for example, a Type II, Type V, or Type VI Cas nuclease), including, for example, Cas9, Cpfl, C2cl, C2c2, and C2c3 proteins, and modifications thereof.

[0312] Cas is a Cas snack kit The most common type of bacteria is Streptococcus pyogenes meningitidis、Campylobacter jejuni、Pasteurella multocida、Fibrobacter succinogene、Rhodospirillum rubrum、Nocardiopsis dassonvillei、Streptomyces pristinaespiralis、Streptomyces viridochromogenes、Streptomyces viridochromogenes Streptosporangium roseum Streptosporangium roseum Alicyclobacillus acidocaldarius Bacillus pseudomycoides Bacillus selenitireducens Exiguobacterium sibiricum Lactobacillus delbrueckii Lactobacillus salivarius、Lactobacillus buchneri、Treponema denticola、Microscilla marina、Burkholderiales bacterium、Polaromonas naphthalenivorans、Polaromonas sp.、Crocosphaera watsonii、Cyanothece sp.、Microcystis aeruginosa、Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp.、Lachnospiraceae bacterium ND2006、、、Acaryochloris marina is included。.

[0313] In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is a Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is a Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus sp.. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus or Lachnospiraceae.

[0314] In some embodiments, the Cas nickase is derived from a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nickase is derived from a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nickase is a nickase form of a Cas9 nuclease from Neisseria meningitidis. See, e.g., WO / 2020081568, which describes an Nme2Cas9 D16A nickase fusion protein. In some embodiments, the Cas nickase is derived from a Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nickase is derived from a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nickase is derived from a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nickase is derived from a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nickase is derived from a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nickase is derived from a Cpf1 nuclease from Acidaminococcus or Lachnospiraceae.As discussed elsewhere, nickases can be derived from nucleases by inactivating one of the two catalytic domains, for example, by mutating active site residues (D10, H840, etc.) essential for nucleolysis of N863 in Spy Cas9. Those skilled in the art will be familiar with techniques for readily identifying corresponding residues in other Cas proteins, such as sequence and structural alignments, as detailed below.

[0315] In some embodiments, a gRNA together with an RNA-guided DNA-binding agent is referred to as a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA-binding agent is a Cas nuclease. In some embodiments, a gRNA together with a Cas nuclease is referred to as a Cas RNP. In some embodiments, the RNP comprises type I, type II, or type III components. In some embodiments, the Cas nuclease is a Cas9 protein from a type II CRISPR / Cas system. In some embodiments, a gRNA together with Cas9 is referred to as a Cas9 RNP.

[0316] Wild-type Cas9 has two nuclease domains, RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 protein comprises more than one RuvC domain and / or more than one HNH domain. In some embodiments, the Cas9 protein is wild-type Cas9. In each of the composition, use, and method embodiments, Cas induces a double-strand break in the target DNA.

[0317] In some embodiments, chimeric Cas nucleases are used, in which one domain or region of a protein is replaced with a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.

[0318] In other embodiments, the Cas nuclease or Cas nickase may be from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of a cascade complex of a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.

[0319] In some embodiments, the RNA-guided DNA binding agent has single-stranded nickase activity, i.e., it can cleave one DNA strand to generate a single-stranded break (also known as a "nick"). In some embodiments, the RNA-guided DNA binding agent comprises a Cas nickase. A nickase is an enzyme that creates a nick in dsDNA, i.e., it cleaves one strand of the DNA double helix but not the other. In some embodiments, the Cas nickase is a version of a Cas nuclease (e.g., the Cas nucleases discussed above) in which the endonucleolytic active site has been inactivated, e.g., by one or more modifications (e.g., point mutations) in the catalytic domain. See, e.g., U.S. Patent No. 8,889,356 for a discussion of Cas nickases and exemplary catalytic domain modifications. In some embodiments, the Cas nickase, such as the Cas9 nickase, has an inactivated RuvC or HNH domain.

[0320] In some embodiments, the RNA-guided DNA binder is modified to contain only one functional nuclease domain. For example, the drug protein may be modified so that one of the nuclease domains is mutated or completely or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, a nickase with a RuvC domain that has reduced activity is used. In some embodiments, a nickase with an inactive RuvC domain is used. In some embodiments, a nickase with an HNH domain that has reduced activity is used. In some embodiments, a nickase with an inactive HNH domain is used.

[0321] In some embodiments, conserved amino acids within the Cas protein nuclease domain are substituted to reduce or alter nuclease activity. In some embodiments, the Cas nuclease may comprise an amino acid substitution within the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may comprise an amino acid substitution within the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB-A0Q7Q2(CPF1_FRATN))).

[0322] In some embodiments, an mRNA encoding a nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), thereby introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, a nickase is used with two separate guide RNAs that target opposite strands of DNA, generating a double nick in the target DNA. In some embodiments, a nickase is used with two separate guide RNAs that are selected to be in close proximity to each other, generating a double nick in the target DNA.

[0323] In some embodiments, the RNA-guided DNA binding agent lacks cleavase and nickase activity. In some embodiments, the RNA-guided DNA binding agent comprises a dCas DNA-binding polypeptide. The dCas polypeptide essentially lacks catalytic (cleavase / nickase) activity while possessing DNA-binding activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-guided DNA binding agent or dCas DNA-binding polypeptide lacking cleavase and nickase activity is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) whose endonucleolytic active site has been inactivated, e.g., by one or more modifications (e.g., point mutations) in its catalytic domain. See, e.g., US2014 / 0186958A1, US2015 / 0166980A1.

[0324] In some embodiments, the RNA-guided DNA binding agent comprises (e.g., is or comprises) one or more heterologous functional domains.

[0325] In some embodiments, the RNA-guided DNA binding agent comprises an APOBEC3 deaminase. In some embodiments, the APOBEC3 deaminase is APOBEC3A (A3A). In some embodiments, the A3A is human A3A. In some embodiments, the A3A is wild-type A3A.

[0326] In some embodiments, the RNA-guided DNA binder comprises a deaminase and an RNA-guided nickase. In some embodiments, the mRNA further comprises a linker connecting the sequence encoding A3A to the sequence encoding the RNA-guided nickase. In some embodiments, the linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, the linker is a peptide linker. In some embodiments, the peptide linker is any stretch of amino acids having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, or more amino acids. In some embodiments, the peptide linker is a 16-residue "XTEN" linker or a variant thereof (see, e.g., the Examples, and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 900), SGSETPGTSESA (SEQ ID NO: 901), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 902).

[0327] In some embodiments, the heterologous functional domain may facilitate the transport of the RNA-guided DNA binding agent to the cell nucleus. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binding agent may be fused with 1 to 10 NLS(s). In some embodiments, the RNA-guided DNA binding agent may be fused with 1 to 5 NLS(s). In some embodiments, the RNA-guided DNA binding agent may be fused with one NLS. When one NLS is used, the NLS may be fused at the N- or C-terminal end of the sequence of the RNA-guided DNA binding agent. It may also be inserted within the sequence of the RNA-guided DNA binding agent. In other embodiments, the RNA-guided DNA binding agent may be fused with more than one NLS. In some embodiments, the RNA-guided DNA binding agent may be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused with two NLSs. In certain situations, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA binding agent is fused to two NLS sequences (e.g., SV40) fused at the carboxy-terminal end. In some embodiments, the RNA-guided DNA binding agent may be fused to two NLSs, one linked to the N-terminal end and one linked to the C-terminal end. In some embodiments, the RNA-guided DNA binding agent may be fused to three NLSs. In some embodiments, the RNA-guided DNA binding agent may not be fused to an NLS. In some embodiments, the NLS may be a single moiety, such as the SV40 NLS, PKKKRKV (SEQ ID NO: 600) or PKKKRRV (SEQ ID NO: 601). In some embodiments, the NLS may be a bimoiety, such as the nucleoplasmin NLS, KRPAATKKAGQAKKKK (SEQ ID NO: 602). In certain embodiments, a single PKKKRKV (SEQ ID NO: 600) NLS may be fused at the C-terminal end of the RNA-guided DNA binding agent. One or more linkers are optionally included at the fusion site.

[0328] In some embodiments, the RNA-guided DNA binder comprises an editor. An exemplary editor is BC22n, which comprises H. sapiens APOBEC3A fused to S. pyogenes-D10A Cas9 nickase by an XTEN linker and an mRNA encoding BC22n. An mRNA encoding BC22n is provided (SEQ ID NO: 806).

[0329] In some embodiments, the heterologous functional domain can modify the intracellular half-life of the RNA-guided DNA binder. In some embodiments, the half-life of the RNA-guided DNA binder can be increased. In some embodiments, the half-life of the RNA-guided DNA binder can be decreased. In some embodiments, the heterologous functional domain can increase the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain can decrease the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain can function as a signal peptide for protein degradation. In some embodiments, the protein degradation can be mediated by proteolytic enzymes such as proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain can comprise a PEST sequence. In some embodiments, the RNA-guided DNA binder can be modified by the addition of ubiquitin or polyubiquitin chains. In some embodiments, the ubiquitin can be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neural progenitor cell-expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-related (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).

[0330] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami). Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric In other embodiments, the marker domain may be a purification tag and / or an epitope tag.Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag1, Softag3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent protein.

[0331] In additional embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent to mitochondria.

[0332] In further embodiments, the heterologous functional domain may be an effector domain, such as an editor domain. When an RNA-guided DNA binding agent is directed to its target sequence, for example, when a Cas nuclease is directed to the target sequence by a gRNA, the effector, such as an editor domain, may modify or affect the target sequence. In some embodiments, the effector, such as an editor domain, may be selected from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcription activation domain, or a transcription repression domain. In some embodiments, the heterologous functional domain is a nuclease, such as a FokI nuclease. See, for example, U.S. Patent No. 9,023,649. In some embodiments, the heterologous functional domain is a transcription activator or a transcription repressor. See, for example, Qi et al., "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression," Cell 152:1173-83 (2013); Perez-Pinera et al., "RNA-guided gene activation by CRISPR-Cas9-based transcription factors," Nat. Methods 10:973-6 (2013); Mali et al., "CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering," Nat. Biotechnol. 31:833-8 (2013); Gilbert et al., "CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes," Cell 154:442-51 (2013). Thus, RNA-guided DNA binders essentially become transcription factors that can be directed to bind to desired target sequences using guide RNAs.

[0333] J. Determining Guide RNA Efficacy In some embodiments, the efficacy of the guide RNA is determined when delivered or expressed together with other components that form an RNP (e.g., an RNA-guided DNA binder). In some embodiments, the guide RNA is expressed together with an RNA-guided DNA binder, such as a Cas protein, e.g., Cas9. In some embodiments, the guide RNA is delivered to or expressed in a cell line that already stably expresses an RNA-guided DNA nuclease, e.g., a Cas nuclease or nickase, e.g., a Cas9 nuclease or nickase. In some embodiments, the guide RNA is delivered to the cell as part of an RNP. In some embodiments, the guide RNA is delivered to the cell together with an mRNA encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease or nickase, e.g., a Cas9 nuclease or nickase.

[0334] As described herein, the use of the RNA-guided DNA nucleases and guide RNAs disclosed herein can lead to site-specific binding that causes DSBs, SSBs, and / or nucleic acid modifications in DNA or pre-mRNA, which, upon repair by the cellular machinery, can generate errors in the form of insertion / deletion (indel) mutations. Many mutations resulting from indels alter the reading frame, introduce premature stop codons, or induce exon skipping, thus producing non-functional proteins.

[0335] In some embodiments, the efficacy of a particular guide RNA is determined based on an in vitro model. In some embodiments, the in vitro model is a T cell line. In some embodiments, the in vitro model is HEK293 T cells. In some embodiments, the in vitro model is HEK293 cells stably expressing Cas9 (HEK293_Cas9). In some embodiments, the in vitro model is a lymphoblastoid cell line. In some embodiments, the in vitro model is primary human T cells. In some embodiments, the in vitro model is primary human B cells. In some embodiments, the in vitro model is primary human peripheral blood lymphocytes. In some embodiments, the in vitro model is primary human peripheral blood mononuclear cells.

[0336] In some embodiments, the number of off-target sites at which deletions or insertions occur in an in vitro model is determined, for example, by analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA and guide RNA. In some embodiments, such determination involves analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA, guide RNA, and donor oligonucleotides. An exemplary procedure for such determination is provided in the Examples below.

[0337] In some embodiments, the effectiveness of a particular gRNA is determined across multiple in vitro cell models for the guide RNA selection process. In some embodiments, cell line comparisons of data with selected guide RNAs are performed. In some embodiments, cross-screening is performed across multiple cell models.

[0338] In some embodiments, the effectiveness of guide RNA is evaluated by target cleavage efficiency.In some embodiments, the effectiveness of guide RNA is measured by the percentage of editing at target position, for example, HLA-A or CIITA.In some embodiments, deep sequencing can be used to identify the presence of modifications (for example, insertions, deletions) introduced by gene editing.The percentage of indels can be calculated by next-generation sequencing (NGS).

[0339] In some embodiments, the efficacy of a guide RNA is measured by the number and / or frequency of indels at off-target sequences within the genome of a target cell type. In some embodiments, effective guide RNAs are provided that generate indels at off-target sites at a very low frequency (e.g., less than 5%) compared to the frequency of indel generation in the cell population and / or at the target site. Accordingly, the present disclosure provides guide RNAs that do not exhibit off-target indel formation in a target cell type (e.g., T cells or B cells) or that have a frequency of off-target indel formation of less than 5% compared to the frequency of indel generation in the cell population and / or at the target site. In some embodiments, the present disclosure provides guide RNAs that do not exhibit any off-target indel formation in a target cell type (e.g., T cells or B cells). In some embodiments, guide RNAs are provided that generate indels at fewer than five off-target sites, e.g., as assessed by one or more methods described herein. In some embodiments, guide RNAs are provided that generate indels at no more than four, three, two, or one off-target site(s), e.g., as assessed by one or more methods described herein. In some embodiments, the off-target site(s) do not occur within a protein-coding region in the target cell (e.g., T cell or B cell) genome.

[0340] In some embodiments, linear amplification is used to detect gene editing events, such as the formation of insertion / deletion ("indel") mutations, translocations, and homology-directed repair (HDR) events in target DNA. For example, linear amplification using unique sequence-tagged primers and isolating the tagged amplification products (referred to herein as the "UnIT," or "Unique Identifier Tagmentation" method) may be used.

[0341] In some embodiments, the effectiveness of guide RNA is measured by the number of chromosomal rearrangements in target cell type.Kromatid dGH assay can be used to detect chromosomal rearrangements, including, for example, translocation, reciprocal translocation, translocation to off-target chromosome, deletion (i.e., chromosomal rearrangement in which fragments are lost during cell replication cycle due to editing events).In some embodiments, target cell type has less than 10, less than 8, less than 5, less than 4, less than 3, less than 2, or less than 1 chromosomal rearrangement.In some embodiments, target cell type does not have chromosomal rearrangement.

[0342] K. Delivery of gRNA Compositions Lipid nanoparticles (LNP compositions) are well-known vehicles for the delivery of nucleotide and protein cargoes and may be used to deliver the guide RNAs, compositions, or pharmaceutical formulations disclosed herein. In some embodiments, the LNP compositions deliver nucleic acids, proteins, or nucleic acids together with proteins.

[0343] In some embodiments, the invention includes a method for delivering any one of the gRNAs disclosed herein to a subject, wherein the gRNA is formulated as a LNP. In some embodiments, the LNP comprises the gRNA and Cas9 or an mRNA encoding Cas9.

[0344] In some embodiments, the invention includes a composition comprising any one of the disclosed gRNAs and LNPs, hi some embodiments, the composition further comprises Cas9 or an mRNA encoding Cas9.

[0345] In some embodiments, the LNP composition comprises a cationic lipid. In some embodiments, the LNP composition comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate), also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate), or another ionizable lipid. See, e.g., the lipids of WO / 2017 / 173054 and the references cited therein. In some embodiments, the LNP composition comprises a cationic lipid amine to RNA phosphate (N:P) molar ratio of about 4.5, 5.0, 5.5, 6.0, or 6.5. In some embodiments, in the context of LNP lipids, the terms cationic and ionizable are interchangeable, e.g., ionizable lipids are cationic depending on the pH.

[0346] In some embodiments, the gRNAs disclosed herein are formulated as LNP compositions for use in preparing a medicament for treating a disease or disorder.

[0347] Electroporation is a well-known means for delivery of cargo, and any electroporation methodology can be used to deliver any one of the gRNAs disclosed herein. In some embodiments, electroporation can be used to deliver any one of the gRNAs and Cas9 or mRNA encoding Cas9 disclosed herein.

[0348] In some embodiments, the invention includes methods for delivering any one of the gRNAs disclosed herein to cells ex vivo, wherein the gRNA is formulated as an LNP or is not formulated as an LNP. In some embodiments, the LNP comprises the gRNA and Cas9 or an mRNA encoding Cas9.

[0349] In some embodiments, the guide RNA compositions described herein, alone or encoded in one or more vectors, are formulated in or administered via lipid nanoparticles. See, e.g., WO / 2017 / 173054 and WO2019 / 067992, the contents of which are incorporated by reference in their entireties.

[0350] In certain embodiments, the present invention includes DNA or RNA vectors encoding any of the guide RNAs comprising any one or more of the guide sequences described herein. In some embodiments, in addition to the guide RNA sequence, the vector further comprises a nucleic acid that does not encode the guide RNA. The nucleic acid that does not encode the guide RNA includes, but is not limited to, a promoter, an enhancer, a regulatory sequence, and a nucleic acid encoding an RNA-guided DNA nuclease (which may be a nuclease such as Cas9). In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, or a crRNA and a trRNA. In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding an sgRNA and an mRNA encoding an RNA-guided DNA nuclease, which may be a Cas nuclease, e.g., Cas9 or Cpfl. In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, and an mRNA encoding an RNA-guided DNA nuclease, which may be a Cas protein, e.g., Cas9. In one embodiment, the Cas9 is derived from Streptococcus pyogenes (i.e., Spy Cas9). In some embodiments, the nucleotide sequence encoding the crRNA, trRNA, or crRNA and trRNA (which may also be an sgRNA) comprises or consists of a guide sequence flanked by all or part of repeat sequences from a naturally occurring CRISPR / Cas system. A nucleic acid comprising or consisting of a crRNA, trRNA, or crRNA and trRNA may further comprise a vector sequence, wherein the vector sequence comprises or consists of a nucleic acid sequence not found with the crRNA, trRNA, or crRNA and trRNA in nature.

[0351] L. Treatment Methods and Uses Any of the engineered human cells and compositions described herein can be used in methods of treating various diseases and disorders, as described herein. In some embodiments, the genetically modified cells (engineered cells) and / or populations of genetically modified cells (engineered cells) and compositions may be used in methods of treating various diseases and disorders. In some embodiments, methods of treating any one of the diseases or disorders described herein are included, comprising administering any one or more of the compositions described herein.

[0352] In some embodiments, the methods and compositions described herein can be used to treat diseases or disorders requiring delivery of a therapeutic agent. In some embodiments, the invention provides a method of providing immunotherapy to a subject, comprising administering to the subject an effective amount of an engineered cell (or engineered cell population) described herein, e.g., any of the cell aspects and embodiments described above.

[0353] In some embodiments, the method comprises administering to a subject a composition comprising the engineered cells described herein as adoptive cell transfer therapy, hi some embodiments, the engineered cells are allogeneic cells.

[0354] In some embodiments, the method comprises administering to a subject a composition comprising the engineered cells described herein, wherein the cells produce, secrete, and / or express a polypeptide (e.g., a targeting receptor) useful for treating a disease or disorder in the subject. In some embodiments, the cells act as a cell factory to produce a soluble polypeptide. In some embodiments, the cells act as a cell factory to produce an antibody. In some embodiments, the cells continuously secrete the polypeptide in vivo. In some embodiments, the cells continuously secrete the polypeptide for at least 1, 2, 3, 4, 5, or 6 weeks after transplantation in vivo. In some embodiments, the cells continuously secrete the polypeptide for more than 6 weeks after transplantation in vivo. In some embodiments, the soluble polypeptide (e.g., an antibody) is secreted at a rate of at least 10 per day. 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , or 10 8 In some embodiments, the polypeptide is an antibody and is produced by the cells at a concentration of at least 10 copies per day. 8 It is produced by cells at copy numbers.

[0355] In some embodiments of the methods, the methods comprise administering a lymphodepleting agent or an immunosuppressant prior to administering to a subject an effective amount of an engineered cell (or engineered cells) as described herein, e.g., a cell of any of the foregoing cell aspects and embodiments. In another aspect, the invention provides methods of preparing engineered cells (e.g., engineered cell populations).

[0356] Immunotherapy is the treatment of disease by activating or suppressing the immune system. Immunotherapies designed to induce or amplify an immune response are classified as activating immunotherapies. Cell-based immunotherapy has proven effective in the treatment of several cancers. Immune effector cells, such as lymphocytes, macrophages, dendritic cells, natural killer (NK) cells, cytotoxic T lymphocytes (CTLs), T helper cells, and B cells, or their precursors, such as hematopoietic stem cells (HSCs) or induced pluripotent stem cells (iPSCs), can be programmed to act in response to abnormal antigens expressed on the surface of tumor cells. Cancer immunotherapy thus enables components of the immune system to destroy tumors or other cancer cells. Cell-based immunotherapy has also proven effective in the treatment of autoimmune diseases or transplant rejection. Immune effector cells, such as regulatory T cells (Tregs) or mesenchymal stem cells, can be programmed to act in response to self- or transplant antigens expressed on the surface of normal tissues.

[0357] In some embodiments, the present invention provides methods for preparing engineered cells (e.g., engineered cell populations). The engineered cell populations can be used in immunotherapy.

[0358] In some embodiments, the present invention provides methods of treating a subject in need thereof, comprising administering engineered cells prepared by the methods of preparing cells described herein, e.g., any of the foregoing aspects and embodiments of the methods of preparing cells.

[0359] In some embodiments, the engineered cells can be used to treat cancer, infectious diseases, inflammatory diseases, autoimmune diseases, cardiovascular diseases, neurological diseases, ophthalmological diseases, renal diseases, liver diseases, musculoskeletal diseases, red blood cell diseases, or transplant rejection. In some embodiments, the engineered cells can be used in cell transplantation into, for example, the heart, liver, lung, kidney, pancreas, skin, or brain. (See, e.g., Deuse et al., Nature Biotechnology 37:252-258 (2019)).

[0360] In some embodiments, the engineered cells can be used as cell therapy, including allogeneic stem cell therapy. In some embodiments, the cell therapy comprises induced pluripotent stem cells (iPSCs). iPSCs may be induced to differentiate into other cell types, including, for example, beta pancreatic islet cells, neurons, and blood cells. In some embodiments, the cell therapy comprises hematopoietic stem cells. In some embodiments, the stem cells comprise mesenchymal stem cells, which can develop into bone, cartilage, muscle, and fat cells. In some embodiments, the stem cells comprise ocular stem cells. In some embodiments, the allogeneic stem cell transplant comprises an allogeneic bone marrow transplant. In some embodiments, the stem cells comprise pluripotent stem cells (PSCs). In some embodiments, the stem cells comprise induced embryonic stem cells (ESCs).

[0361] The engineered human cells disclosed herein are suitable for further manipulation, for example, by introducing further edited or modified genes or alleles.The cells of the present invention can also be suitable for further manipulation, for example, by introducing exogenous nucleic acids encoding targeting receptors, such as TCRs, CARs, and UniCARs.CARs are also known as chimeric immune receptors, chimeric T cell receptors, or artificial T cell receptors.In some embodiments, the TCR is a wild-type or variant TCR.

[0362] In some embodiments, the cell therapy is transgenic T cell therapy. In some embodiments, the cell therapy comprises Wilms Tumor 1 (WT1) targeting transgenic T cells. In some embodiments, the cell therapy comprises a targeting receptor or donor nucleic acid encoding a targeting receptor for a commercially available T cell therapy, such as CAR T cell therapy. There are currently several targeting receptors approved for cell therapy. The cells and methods provided herein can be used with these known constructs. Commercially available approved cell products containing targeting receptor constructs for use as cell therapies include, for example, Kymriah® (tisagenlecleucel), Yescarta® (axicabtagene ciloleucel), Tecartus™ (brexucabtagene autoleucel), Tabelecleucel (Tab-cel®), Viralym-M (ALVR105), and Viralym-C.

[0363] In some embodiments, the methods provide for administering the engineered cells to a subject, wherein the administration is by injection. In some embodiments, the methods provide for administering the engineered cells to a subject, wherein the administration is by intravascular injection or infusion. In some embodiments, the methods provide for administering the engineered cells to a subject, wherein the administration is a single dose.

[0364] In some embodiments, the method provides for reducing signs or symptoms associated with a disease in a subject treated with a composition disclosed herein. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts for more than one week. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts for more than two weeks. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts for more than three weeks. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts for more than one month.

[0365] In some embodiments, the methods provide for administering engineered cells to a subject, wherein the subject has a response to the administered cells, including a reduction in signs or symptoms associated with the disease being treated by the cell therapy. In some embodiments, the subject has a response that lasts for more than one week. In some embodiments, the subject has a response that lasts for more than one month. In some embodiments, the subject has a response that lasts for at least one to six weeks.

[0366] [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6] [Table 8-7] [Table 8-8] [Table 8-9] [Table 8-10] [Table 8-11] [Table 8-12] [Table 8-13]

Table 8-14

Table 8-15

Table 8-16

Table 8-17

Table 8-18

Table 8-19

Table 8-20

Table 8-21

Table 8-22

Table 8-23

Table 8-24

Table 8-25

Table 8-26

Table 8-27

Table 8-28

Table 8-29

Table 8-30

[0367] The following examples are provided to illustrate certain disclosed embodiments and should not be construed in any way as limiting the scope of the disclosure.

[0368] Example 1: General Method 1.1. Next Generation Sequencing (“NGS”) and Analysis of On-Target Cleavage Efficiency. Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen, catalog no. QE09050) according to the manufacturer's protocol.

[0369] To quantitatively determine the editing efficiency at the target location in the genome, deep sequencing was used to identify the presence of insertions, deletions, and substitutions introduced by gene editing. PCR primers were designed around the target site in the gene of interest (e.g., HLA-A) to amplify the genomic region of interest. Primer sequence design was performed using standard techniques.

[0370] For sequencing, an additional PCR was performed according to the manufacturer's protocol (Illumina) to add chemistry. The amplicons were sequenced on an Illumina MiSeq instrument. After excluding reads with low quality scores, the reads were aligned to the human reference genome (e.g., hg38). Reads overlapping the target region of interest were realigned to the local genome sequence to improve alignment. The number of wild-type reads relative to the number of reads containing CT mutations, CA / G mutations, or indels was then calculated. Insertions and deletions were scored in a 20-bp region centered around the predicted Cas9 cleavage site. The indel percentage is defined as the total number of sequence reads with one or more base insertions or deletions within the 20-bp score region divided by the total number of sequencing reads containing wild-type. CT or CA / G mutations were scored in a 40-bp region encompassing 10 bp upstream and 10 bp downstream of the 20-bp sgRNA target sequence. The CT editing percentage is defined as the total number of sequencing reads with one or more CT mutations within a 40-bp region divided by the total number of sequencing reads containing the wild type. The percentage of CA / G mutations is calculated similarly.

[0371] 1.2. Preparation of T cell culture medium. The T cell culture medium compositions used below are described here. "X-VIVO Base Medium" consists of X-VIVO™ 15 Medium, 1% Penstrep, 50 μM beta-mercaptoethanol, and 10 mM NAC. In addition to the components mentioned above, other variable medium components used were: 1. serum (fetal bovine serum (FBS)), and 2. cytokines (IL-2, IL-7, IL-15).

[0372] 1.3. Preparation of lipid nanoparticles. Lipid components were dissolved in 100% ethanol at various molar ratios. RNA cargo (e.g., Cas9 mRNA and sgRNA) was dissolved in 25 mM citrate buffer, 100 mM NaCl (pH 5.0) to obtain an RNA cargo concentration of approximately 0.45 mg / mL.

[0373] The lipid-nucleic acid assembly contained the ionizable lipid A ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate), also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate), cholesterol, DSPC, and PEG2k-DMG in molar ratios of 50:38:9:3, respectively. The lipid-nucleic acid assembly was formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA weight ratio of 1:1 or 1:2.

[0374] Lipid nanoparticles (LNP composition) were prepared using cross-flow technology by impinging jet mixing of lipids in ethanol with two volumes of RNA solution and one volume of water. Lipids in ethanol were mixed with two volumes of RNA solution by cross-mixing. A fourth water stream was mixed with the cross-flow outlet stream through a series of tees (see Figure 2 in WO2016010840). The LNP composition was held at room temperature (RT) for 1 hour and further diluted with water (approximately 1:1 v / v). The LNP composition was concentrated using tangential flow filtration with a flat-sheet cartridge (Sartorius, 100 kD MWCO) and buffer exchanged into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) using a PD-10 desalting column (GE). Alternatively, the LNPs were optionally concentrated using a 100 kDa Amicon spin filter and buffer exchanged into TSS using a PD-10 desalting column (GE). The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNPs were stored at 4° C. or -80° C. until further use.

[0375] 1.4. In Vitro Transcription of mRNA ("IVT") Capped, polyadenylated mRNA containing N1-methylpseudo-U was generated by in vitro transcription using a linearized plasmid DNA template and T7 RNA polymerase. Plasmid DNA containing the T7 promoter, transcription sequence, and polyadenylation sequence was linearized by incubation with XbaI at 37°C for 2 hours under the following conditions: 200 ng / μL plasmid, 2 U / μL XbaI (NEB), and 1x reaction buffer. XbaI was inactivated by heating the reaction to 65°C for 20 minutes. The linearized plasmid was purified from enzymes and buffer salts. The IVT reaction to generate modified mRNA was performed by incubation at 37°C for 1.5 to 4 hours under the following conditions: 200 ng / μL plasmid, 2 U / μL XbaI (NEB), and 1x reaction buffer. The reaction mixture contained 50 ng / μL linearized plasmid, 2–5 mM each of GTP, ATP, CTP, and N1-methyl pseudo-UTP (Trilink), 10–25 mM ARCA (Trilink), 5 U / μL T7 RNA polymerase (NEB), 1 U / μL mouse RNase inhibitor (NEB), 0.004 U / μL inorganic E. coli pyrophosphatase (NEB), and 1x reaction buffer. TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U / μL, and the reaction was incubated for an additional 30 minutes to remove the DNA template. mRNA was purified using the MegaClear Transcription Cleanup Kit (ThermoFisher) or the RNeasy Maxi Kit (Qiagen) according to the manufacturer's protocol. Alternatively, mRNA was purified by a precipitation protocol, which in some cases was followed by HPLC-based purification. Briefly, after DNase digestion, mRNA was purified using LiCl precipitation, ammonium acetate precipitation, and sodium acetate precipitation. For HPLC-purified mRNA, after LiCl precipitation and reconstitution, mRNA was purified by RP-IP HPLC (see, e.g., Kariko, et al. Nucleic Acids Research, 2011, Vol. 39, No. 21 e142). Fractions selected for pooling were combined and desalted by sodium acetate / ethanol precipitation as described above.In a further alternative method, mRNA was purified by LiCl precipitation followed by further purification by tangential flow filtration. RNA concentration was determined by measuring light absorbance at 260 nm (Nanodrop), and transcripts were analyzed by capillary electrophoresis on a Bioanlayzer (Agilent).

[0376] Streptococcus pyogenes ("Spy") Cas9 mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID NOs: 801-803 (see sequences in Table 6). BC22n mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID NOs: 804-805. UGI mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID NOs: 807-808. When SEQ ID NOs: 801-808 are referred to below with respect to RNA, it is understood that T should be replaced with U (which was N1-methylpseudouridine as described above). The messenger RNAs used in the examples include a 5' cap and a 3' polyadenylation region, e.g., up to 100 nt, and are identified by SEQ ID NOs: 801-808 in Table 6.

[0377] Example 2: Screening of HLA-A guide RNAs with Cas9 Eighty-eight sgRNAs designed for disruption of the HLA-A gene were screened for efficacy in T cells by assessing the loss of two allelic versions of the MHC I surface proteins, HLA-A2 and HLA-A3. The donor's HLA-A phenotype was A*02:01:01G and 03:01:01G. The percentage of T cells double-negative for HLA-A2 and A3 ("%A2- / A3-") was determined by flow cytometry after editing at the HLA-A locus with Cas9 ribonucleoprotein (RNP) and each test guide by electroporation. Generally, unless otherwise indicated, guide RNAs used throughout the examples identified as "GXXXXXX" refer to 100-nt modified sgRNA formats, such as those shown in the tables provided herein, unless otherwise indicated.

[0378] 2.1. RNP electroporation of T cells Cas9 editing activity was assessed using electroporation of Cas9 ribonucleoprotein (RNP). Upon thawing, Pan CD3+ T cells (StemCell, HLA-A*02.01 / A*03.01) were cultured at a concentration of 0.5 × 10^ in T cell RPMI medium composed of RPMI 1640 (Invitrogen, catalog 22400-089) containing 5% (v / v) fetal bovine serum, 1x Glutamax (Gibco, catalog 35050-061), 50 μM 2-mercaptoethanol, 100 μM non-essential amino acids (Invitrogen, catalog 11140-050), 1 mM sodium pyruvate, 10 mM HEPES buffer, 1% penicillin-streptomycin, and 100 U / mL recombinant human interleukin-2 (Peprotech, catalog 22400-089). 6 T cells were plated at a density of 10 ...

[0379] The HLA-A-targeting sgRNAs were removed from their storage plates and denatured at 95°C for 2 minutes, followed by cooling at room temperature for 10 minutes. An RNP mixture of 20 μM sgRNA and 10 μM Cas9-NLS protein (SEQ ID NO: 800) was prepared and incubated at 25°C for 10 minutes. 5 μL of the RNP mixture was combined with 100,000 cells in 20 μL of P3 electroporation buffer (Lonza). 22 μL of the RNP / cell mixture was transferred to the corresponding wells of a Lonza shuttle 96-well electroporation plate. Cells were electroporated in duplicate using the manufacturer's pulse code. T cell RPMI medium was added to the cells immediately after electroporation. Electroporated T cells were then cultured and collected for NGS sequencing two days after editing, as described in Example 1.

[0380] Flow cytometry Seven days after editing, T cells were phenotyped by flow cytometry to determine HLA-A protein expression after editing at the HLA-A locus. Briefly, T cells were incubated with a cocktail of antibodies targeting two allelic versions of the MHC I surface protein corresponding to the cell donor's genotypes, HLA-A2 (eBioscience catalog number 17-9876-42) and HLA-A3 (eBioscience catalog number 12-5754-42). Cells were then washed, processed on a Cytoflex flow cytometer (Beckman Coulter), and analyzed using the FlowJo software package. T cells were gated based on size, shape, viability, and HLA-A2 and HLA-A3 expression. Table 7 shows the average percentage of double-negative cells for HLA-A2 and HLA-A3 after editing at the HLA-A locus.

[0381] [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4]

[0382] Example 3: HLA-A guided screening using BC22n and Cas9 HLA-A guide RNAs were screened for efficacy in T cells by assessing the loss of HLA-A cell surface expression. The percentage of T cells negative for HLA-A protein in an HLA-A2 background ("% HLA-A2-") was assayed by flow cytometry after HLA-A editing by mRNA delivery.

[0383] 3.1. mRNA electroporation of T cells Cas9 and BC22n editing activity was assessed using electroporation of mRNA encoding Cas9 (SEQ ID NO: 802), mRNA encoding BC22n (SEQ ID NO: 806), or mRNA encoding UGI (SEQ ID NO: 807), as provided below. Upon thawing, Pan CD3+ T cells (StemCell, HLA-A*02.01 / A*02.01) were cultured at 1 × 10^ in TCGM composed of CTS OpTmizer T Cell Expansion SFM (Thermofisher, catalog A3705001) supplemented with 5% human AB serum (Gemini, catalog 100-512), 1X GlutaMAX (Thermofisher, catalog 35050061), 10 mM HEPES (Thermofisher, catalog 15630080), 1X penicillin-streptomycin, and further supplemented with 200 U / mL IL-2 (Peprotech, catalog 200-02), 10 ng / ml IL-7 (Peprotech, catalog 200-07), and 10 ng / ml IL-15 (Peprotech, catalog 2000-15). 6T cells were plated at a density of 10 ...

[0384] HLA-A sgRNAs were removed from their storage plates, denatured at 95°C for 2 minutes, and then incubated at room temperature for 5 minutes. The BC22n electroporation mixture was prepared with 100,000 T cells, 200 ng of mRNA encoding UGI, 200 ng of mRNA encoding BC22n, and 20 pmoles of sgRNA in P3 buffer (Lonza). The Cas9 electroporation mixture was prepared with 100,000 T cells, 200 ng of mRNA encoding UGI, 200 ng of mRNA encoding Cas9, and 20 pmoles of sgRNA in P3 buffer (Lonza). Each mixture was transferred to the corresponding well of a Lonza Shuttle 96-well electroporation plate. Cells were electroporated in duplicate using the manufacturer's pulse code using a Lonza Shuttle 96w. Immediately after electroporation, cells were harvested in pre-warmed TCGM without cytokines and incubated at 37°C for 15 minutes. Electroporated T cells were then cultured in TCGM further supplemented with 200 U / mL IL-2 (Peprotech, Cat. 200-02), 10 ng / ml IL-7 (Peprotech, Cat. 200-07), and 10 ng / ml IL-15 (Peprotech, Cat. 200-15) and collected for flow cytometry 8 days after editing.

[0385] Flow Cytometry On day 8 after editing, T cells were phenotyped by flow cytometry to determine HLA-A protein expression. Briefly, T cells were incubated with an antibody targeting HLA-A2 (eBioscience catalog number 17-9876-42). Then, the cells were washed, processed on a Cytoflex flow cytometer (Beckman Coulter), and analyzed using the FlowJo software package. T cells were gated based on size, shape, viability, and HLA-A2 expression. Table 8 shows the percentage of cells negative for HLA-A surface protein after genome editing of HLA-A with BC22n or Cas9.

[0386] [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4]

[0387] Example 4: NK cell functional killing assay T cells edited in various combinations to disrupt CIITA, HLA-A, or B2M or overexpress HLA-E were tested for their ability to resist natural killer (NK) cell-mediated killing.

[0388] 4.1. T Cell Engineering and Purification Upon thawing, Pan CD3+ T cells (StemCell, HLA-A*02.01 / A*03.01) were cultured at a concentration of 0.5 × 10^ in T cell RPMI medium composed of RPMI 1640 (Invitrogen, catalog 22400-089) containing 5% (v / v) fetal bovine serum, 1x Glutamax (Gibco, catalog 35050-061), 50 μM 2-mercaptoethanol, 100 μM non-essential amino acids (Invitrogen, catalog 11140-050), 1 mM sodium pyruvate, 10 mM HEPES buffer, 1% penicillin-streptomycin, and 100 U / mL recombinant human interleukin-2 (Peprotech, catalog 200-02). 6 T cells were activated with TransAct™ (1:100 dilution, Miltenyi Biotec) and plated at a density of 1000 cells / mL.

[0389] One day after activation, T cells were edited to disrupt the B2M gene as described in Table 9. Briefly, an LNP composition containing Cas9 mRNA targeting B2M and sgRNA G000529 (SEQ ID NO: 245) was formulated as described in Example 1. The LNP composition was incubated at 37°C for 15 minutes in RPMI-based medium containing the cytokines listed above supplemented with 1 μg / ml recombinant human ApoE3 (Peprotech, catalog 350-02). The LNP mixture was added to 2 million activated T cells to give a final concentration of 2.5 μg total LNP / mL.

[0390] [Table 11]

[0391] Two days after activation, additional T cells were edited with an LNP composition to disrupt the CIITA gene. This was performed as described for B2M editing using an LNP composition containing Cas9 mRNA targeting CIITA and sgRNA G013675 (SEQ ID NO: 246). The LNP composition used in this step was formulated with lipid A, cholesterol, DSPC, and PEG2k-DMG in molar ratios of 50:38.5:10:1.5, respectively. The lipid-nucleic acid assembly was formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA weight ratio of 1:2.

[0392] Three days after activation, all edited and non-edited cells were resuspended in fresh medium without TransAct. B2M-edited T cell samples were transduced with a lentivirus expressing HLA-E from the EF1a promoter (SEQ ID NO: 1000) at an MOI of 10 by centrifugation at 1000g and 37°C for 1 hour. CIITA-edited T cell samples were further edited with an LNP composition to disrupt the HLA-A gene. Editing was performed as described for B2M editing above using an LNP composition containing HLA-A-targeting Cas9 mRNA and sgRNA G019000 formulated with lipid A, cholesterol, DSPC, and PEG2k-DMG at a molar ratio of 50:38.5:10:1.5, respectively. The lipid-nucleic acid assembly was formulated at a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA weight ratio of 1:2. Four days after activation, all cells were transferred to GREX plates (Wilson Wolf, catalog 80240M) for growth.

[0393] Seven days after activation, HLA-E-infected T cells were selected for HLA-E expression using biotinylated anti-HLA-E antibody (Biolegend) and anti-biotin microbeads (Miltenyi Biotec, catalog no. 130-090-485), and magnetic LS columns (Miltenyi Biotec, catalog no. 130-042-401) according to the manufacturer's protocol.

[0394] Similarly, 9 days after activation, CIITA-edited T cells were negatively selected for lack of MHC II expression using biotinylated anti-HLA class II antibody (Miltenyi, catalog 130-104-823), anti-biotin microbeads (Miltenyi Biotec, catalog 130-090-485), and magnetic LS column (Miltenyi Biotec, catalog 130-042-401) according to the manufacturer's protocol.

[0395] 4.2 Flow cytometry NK cell-mediated cytotoxicity against engineered T cells was assayed. To do this, T cells were cocultured with HLA-B / C-matched CTV-labeled NK cells at effector-to-target (E:T) ratios of 10:1, 5:1, 2.5:1, 1.25:1, and 0.625:1 for 21 hours. Cells were stained with 7AAD (BD Pharmingen, catalog 559925), processed on a Cytoflex flow cytometer (Beckman Coulter), and analyzed using the FlowJo software package. T cells were gated based on CTV negativity, size, and shape and viability. Table 10 and Figure 2 show the percentage of T cell lysis after NK cell challenge.

[0396] [Table 12]

[0397] Example 5: LNP dose response curves for top HLA-A guides 5.1 T cell preparation Cryopreserved CD8 / CD4+ selected T cells isolated from Leukopacks (Hemacare) were thawed and cu...

Claims

**Claim 1**: An engineered human cell that reduces or eliminates surface expression of HLA-A compared to unmodified cells and includes genetic modification in the HLA-A gene, wherein: i) the cell is homozygous for HLA-B and homozygous for HLA-C, or ii) the genetic modification is a. within genomic coordinates chr6:29942854 - chr6:29942913 and b. includes at least one nucleotide within genomic coordinates selected from chr6:29943518 - chr6:29943619, the cell is homozygous for HLA-B and homozygous for HLA-C, the engineered human cell. **Claim 2**: The engineered cell according to claim 1, wherein the cell reduces or eliminates the expression of at least one HLA-A allele selected from HLA-A1, HLA-A2, HLA-A3, HLA-A11, and HLA-A24. **Claim 3**: i) the genetic modification includes at least one nucleotide within genomic coordinates chr6:29942864 - chr6:29942903, ii) the genetic modification includes at least one nucleotide within genomic coordinates chr6:29943528 - chr6:29943609, iii) the genetic modification includes at least one nucleotide within genomic coordinates selected from chr6:29942864 - 29942884, chr6:29942868 - 29942888, chr6:29942876 - 29942896, chr6:29942877 - 29942897, and chr6:29942883 - 29942903, iv) the genetic modification includes at least one nucleotide within genomic coordinates selected from chr6:29943528 - 29943548, chr6:29943529 - 29943549, chr6:29943530 - 29943550, chr6:29943537 - 29943557, chr6:29943549 - 29943569, and chr6:29943589 - 29943609, v) the genetic modification includes at least one nucleotide within genomic coordinates chr6:29942876 - 29942897, vi) the genetic modification includes at least one nucleotide within genomic coordinates chr6:29943528 - 29943550, vii) the gene modification comprises at least one nucleotide within genomic coordinates selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, and chr6:29942877-29942897, and / or viii) the gene modification comprises at least one nucleotide within genomic coordinates selected from chr6:29943528-29943548, chr6:29943529-29943549, and chr6:29943530-29943550, The engineered cell according to claim 1 or 2. **Claim 4** An engineered human cell that reduces or eliminates surface expression of HLA-A as compared to an unmodified cell and comprises a gene modification in the HLA-A gene, i) the gene modification comprises at least one nucleotide within genomic coordinates selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046, or ii) the gene modification includes an indel, a C-to-T substitution, or an A-to-G substitution within genomic coordinates selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046 the manipulated human cell. **Claim 5** i) the cell is homozygous for HLA-B and homozygous for HLA-C ii) the gene modification includes at least 5, 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinates, and / or iii) the gene modification includes at least one C-to-T substitution or at least one A-to-G substitution within the genomic coordinates The manipulated cell according to claim 4. **Claim 6** HLA-A expression is a. chr6: 29942864 - 29942884, chr6: 29942868 - 29942888, chr6: 29942876 - 29942896, chr6: 29942877 - 29942897, chr6: 29942883 - 29942903, chr6: 29943126 - 29943146, chr6: 29943528 - 29943548, chr6: 29943529 - 29943549, chr6: 29943530 - 29943550, chr6: 29943537 - 29943557, chr6: 29943549 - 29943569, chr6: 29943589 - 29943609, and chr6: 29944026 - 29944046, chr6: 29934330 - 29934350, chr6: 29943115 - 29943135, chr6: 29943135 - 29943155, chr6: 29943140 - 29943160, chr6: 29943590 - 29943610, chr6: 29943824 - 29943844, chr6: 29943858 - 29943878, chr6: 29944478 - 29944498, and chr6: 29944850 - 29944870, b. chr6: 29942864 - 29942884, chr6: 29942868 - 29942888, chr6: 29942876 - 29942896, chr6: 29942877 - 29942897, chr6: 29942883 - 29942903, chr6: 29943126 - 29943146, chr6: 29943528 - 29943548, chr6: 29943529 - 29943549, chr6: 29943530 - 29943550, chr6: 29943537 - 29943557, chr6: 29943549 - 29943569, chr6: 29943589 - 29943609, and chr6: 29944026 - 29944046, c. chr6: 29942864 - 29942884, chr6: 29942868 - 29942888, chr6: 29942876 - 29942896, chr6: 29942877 - 29942897, chr6: 29942883 - 29942903, chr6: 29943528 - 29943548, chr6: 29943529 - 29943549, chr6: 29943530 - 29943550, chr6: 29943537 - 29943557, chr6: 29943549 - 29943569, and chr6: 29943589 - 29943609, d. chr6: 29942864 - 29942884, chr6: 29942868 - 29942888, chr6: 29942876 - 29942896, chr6: 29942877 - 29942897, and chr6: 29942883 - 29942903, e. chr6: 29943528 - 29943548, chr6: 29943529 - 29943549, chr6: 29943530 - 29943550, chr6: 29943537 - 29943557, chr6: 29943549 - 29943569, and chr6: 29943589 - 29943609, f. chr6: 29942864 - 29942884, chr6: 29942868 - 29942888, chr6: 29942876 - 29942896, and chr6: 29942877 - 29942897, g. chr6: 29943528 - 29943548, chr6: 29943529 - 29943549, and chr6: 29943530 - 29943550, h. chr6: 29945290 - 29945310, chr6: 29945296 - 29945316, and chr6: 29945297 - 29945317, chr6: 29945300 - 29945320, i. chr6: 29890117 - 29890137, chr6: 29927058 - 29927078, chr6: 29934330 - 29934350, chr6: 29942541 - 29942561, chr6: 29942542 - 29942562, chr6: 29942543 - 29942563, chr6: 29942543 - 29942563, chr6: 29942550 - 29942570, chr6: 29942864 - 29942884, chr6: 29942868 - 29942888, chr6: 29942876 - 29942896, chr6: 29942876 - 29942896, chr6: 29942877 - 29942897, chr6: 29942883 - 29942903, chr6: 29943062 - 29943082, chr6: 29943063 - 29943083, chr6: 29943092 - 29943112, chr6: 29943115 - 29943135, chr6: 29943118 - 29943138, chr6: 29943119 - 29943139, chr6: 29943120 - 29943140, chr6: 29943126 - 29943146, chr6: 29943128 - 29943148, chr6: 29943129 - 29943149, chr6: 29943134 - 29943154, chr6: 29943134 - 29943154, chr6: 29943135 - 29943155, chr6: 29943136 - 29943156, chr6: 29943140 - 29943160, chr6: 29943142 - 29943162, chr6: 29943143 - 29943163, chr6: 29943188 - 29943208, chr6: 29943528 - 29943548, chr6: 29943529 - 29943549, chr6: 29943530 - 29943550, chr6: 29943536 - 29943556, chr6: 29943537 - 29943557, chr6: 29943538 - 29943558, chr6: 29943549 - 29943569, chr6: 29943556 - 29943576, chr6: 29943589 - 29943609, chr6: 29943590 - 29943610, chr6: 29943590 - 29943610chr6: 29943599 - 29943619, chr6: 29943600 - 29943620, chr6: 29943601 - 29943621, chr6: 29943602 - 29943622, chr6: 29943603 - 29943623, chr6: 29943774 - 29943794, chr6: 29943779 - 29943799, chr6: 29943780 - 29943800, chr6: 29943822 - 29943842, chr6: 29943824 - 29943844, chr6: 29943857 - 29943877, chr6: 29943858 - 29943878, chr6: 29943859 - 29943879, chr6: 29943860 - 29943880, chr6: 29944026 - 29944046, chr6: 29944077 - 29944097, chr6: 29944078 - 29944098, chr6: 29944458 - 29944478, chr6: 29944478 - 29944498, chr6: 29944597 - 29944617, chr6: 29944642 - 29944662, chr6: 29944643 - 29944663, chr6: 29944772 - 29944792, chr6: 29944782 - 29944802, chr6: 29944850 - 29944870, chr6: 29944907 - 29944927, chr6: 29945024 - 29945044, chr6: 29945097 - 29945117, chr6: 29945104 - 29945124, chr6: 29945105 - 29945125, chr6: 29945116 - 29945136, chr6: 29945118 - 29945138, chr6: 29945119 - 29945139, chr6: 29945124 - 29945144, chr6: 29945176 - 29945196, chr6: 29945177 - 29945197, chr6: 29945177 - 29945197, chr6: 29945180 - 29945200, chr6: 29945187 - 29945207, chr6: 29945188 - 29945208, chr6: 29945228 - 29945248, chr6: 29945230 - 29945250, chr6: 29945231 - 29945251,chr6: 29945232-29945252, chr6: 29945308-29945328, chr6: 29945361-29945381, chr6: 29945362-29945382, and chr6: 31382543-31382563, j. chr6: 29942815 - 29942835, chr6: 29942816 - 29942836, chr6: 29942817 - 29942837, chr6: 29942817 - 29942837, chr6: 29942828 - 29942848, chr6: 29942837 - 29942857, chr6: 29942885 - 29942905, chr6: 29942895 - 29942915, chr6: 29942896 - 29942916, chr6: 29942898 - 29942918, chr6: 29942899 - 29942919, chr6: 29942900 - 29942920, chr6: 29942904 - 29942924, chr6: 29942905 - 29942925, chr6: 29942912 - 29942932, chr6: 29942913 - 29942933, chr6: 29943490 - 29943510, chr6: 29943497 - 29943517, chr6: 29943498 - 29943518, chr6: 29943502 - 29943522, chr6: 29943502 - 29943522, chr6: 29943511 - 29943531, chr6: 29943520 - 29943540, chr6: 29943521 - 29943541, chr6: 29943566 - 29943586, chr6: 29943569 - 29943589, chr6: 29943569 - 29943589, chr6: 29943570 - 29943590, chr6: 29943573 - 29943593, chr6: 29943578 - 29943598, chr6: 29943585 - 29943605, chr6: 29943589 - 29943609, chr6: 29943568 - 29943588, and chr6: 29942815 - 29942835, k. chr6: 29942884 - 29942904, chr6: 29943519 - 29943539, chr6: 29942863 - 29942883, l. chr6: 29943517 - 29943537, and chr6: 29943523 - 29943543, m.chr6: 29942845 - 29942869, chr6: 29942852 - 29942876, chr6: 29942865 - 29942889, chr6: 29942891 - 29942915, chr6: 29942895 - 29942919, chr6: 29942903 - 29942927, chr6: 29942904 - 29942928, chr6: 29943518 - 29943542, chr6: 29943525 - 29943549, chr6: 29943535 - 29943559, chr6: 29943538 - 29943562, chr6: 29943539 - 29943563, chr6: 29943547 - 29943571, chr6: 29943547 - 29943571, chr6: 29943548 - 29943572, chr6: 29943555 - 29943579, chr6: 29943556 - 29943580, chr6: 29943557 - 29943581, chr6: 29943558 - 29943582, chr6: 29943559 - 29943583, chr6: 29943563 - 29943587, chr6: 29943564 - 29943588, chr6: 29943565 - 29943589, chr6: 29943568 - 29943592, chr6: 29943571 - 29943595, chr6: 29943572 - 29943596, chr6: 29943595 - 29943619, chr6: 29943596 - 29943620, and chr6: 29943600 - 29943624, n. chr6: 29942885 - 29942905, chr6: 29942895 - 29942915, chr6: 29942896 - 29942916, chr6: 29942898 - 29942918, chr6: 29942899 - 29942919, chr6: 29942900 - 29942920, chr6: 29942904 - 29942924, chr6: 29943511 - 29943531, chr6: 29943520 - 29943540, chr6: 29943521 - 29943541, chr6: 29943529 - 29943549, chr6: 29943566 - 29943586, chr6: 29943568 - 29943588, chr6: 29943569 - 29943589, chr6: 29943569 - 29943589, chr6: 29943570 - 29943590, chr6: 29943573 - 29943593, chr6: 29943578 - 29943598, chr6: 29943585 - 29943605, and chr6: 29943589 - 29943609, and o. chr6: 29942469 - 29942489, chr6: 29943058 - 29943078, chr6: 29943063 - 29943083, chr6: 29943080 - 29943100, chr6: 29943187 - 29943207, chr6: 29943192 - 29943212, chr6: 29943197 - 29943217, chr6: 29943812 - 29943832, chr6: 29944349 - 29944369, chr6: 29944996 - 29945016, chr6: 29945018 - 29945038, and chr6: 29945341 - 29945361, chr6: 29945526 - 29945546, the engineered cell according to any one of claims 1 to 5, which is reduced or eliminated by a gene editing system that binds to an HLA - A genomic target sequence containing at least 5 consecutive nucleotides within the genomic coordinates selected from Claim 7: (i) The HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates selected from chr6:29942854 - chr6:29942913 and chr6:29943518 - chr6:29943619. (ii) The HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr6:29942876 - 29942897. (iii) The HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within the genomic coordinates chr6:29943528 - 29943550, and / or (iv) The HLA-A expression is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates selected from chr6:29942864 - 29942884, chr6:29942868 - 29942888, chr6:29942876 - 29942896, chr6:29942877 - 29942897, chr6:29942883 - 29942903, chr6:29943126 - 29943146, chr6:29943528 - 29943548, chr6:29943529 - 29943549, chr6:29943530 - 29943550, chr6:29943537 - 29943557, chr6:29943549 - 29943569, chr6:29943589 - 29943609, and chr6:29944026 - 29944046. An engineered cell according to any one of claims 1 to 6. Claim 8: The engineered cell according to claim 6 or 7, wherein the HLA-A genomic target sequence comprises at least 10, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides within the genomic coordinates. Claim 9: The engineered cell according to any one of claims 5 to 8, wherein the cell is homozygous for HLA-B and homozygous for HLA-C. **Claim 10**: (i) the HLA-B allele is selected from any one of the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HLA-B*40:02; (ii) the HLA-C allele is selected from any one of the following HLA-C alleles: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA-C*15:02, HLA-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:

02. iii) the HLA-B allele is selected from any one of the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HLA-B*40:02; and the HLA-C allele is selected from any one of the following HLA-C alleles: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA-C*15:02, HLA-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:02 iv) the HLA-B and HLA-C alleles are selected from any one of the following HLA-B and HLA-C alleles: HLA-B*07:02 and HLA-C*07:02, HLA-B*08:01 and HLA-C*07:01, HLA-B*44:02 and HLA-C*05:01, HLA-B*35:01 and HLA-C*04:01, HLA-B*40:01 and HLA-C*03:04, HLA-B*57:01 and HLA-C*06:02, HLA-B*14:02 and HLA-C*08:02, HLA-B*15:01 and HLA-C*03:03, HLA-B*13:02 and HLA-C*06:02, HLA-B*44:03 and HLA-C*16:01, HLA-B*38:01 and HLA-C*12:03, HLA-B*18:01 and HLA-C*07:01, HLA-B*44:03 and HLA-C*04:01, HLA-B*51:01 and HLA-C*15:02, HLA-B*49:01 and HLA-C*07:01, HLA-B*15:01 and HLA-C*03:04, HLA-B*18:01 and HLA-C*12:03, HLA-B*27:05 and HLA-C*02:02, HLA-B*35:03 and HLA-C*04:01, HLA-B*18:01 and HLA-C*05:01, HLA-B*52:01 and HLA-C*12:02, HLA-B*51:01 and HLA-C*14:02, HLA-B*37:01 and HLA-C*06:02, HLA-B*53:01 and HLA-C*04:01, HLA-B*55:01 and HLA-C*03:03, HLA-B*44:02 and HLA-C*07:04, HLA-B*44:03 and HLA-C*07:01, HLA-B*35:02 and HLA-C*04:01, HLA-B*15:01 and HLA-C*04:01, and HLA-B*40:02 and HLA-C*02:02; v) the HLA-B and HLA-C alleles are HLA-B*07:02 and HLA-C*07:02; vi) the HLA-B and HLA-C alleles are HLA-B*08:01 and HLA-C*07:01; vii) the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*05:01, and / or viii) the HLA-B and HLA-C alleles are HLA-B*35:01 and HLA-C*04:01, The engineered cell according to any one of claims 1 to 9. **Claim 11** The cell has reduced expression of MHC class II protein on the surface of the cell, and / or the cell has genetic modification of a gene selected from CIITA, HLA-DR, HLA-DQ, HLA-DP, RFX5, RFXB / ANK, RFXAP, CREB, NF-YA, NF-YB, and NF-YC, and / or the cell has genetic modification in the CIITA gene, and / or the cell has reduced expression of TRAC protein or TRBC protein on the surface of the cell, The engineered cell according to any one of claims 1 to 10. **Claim 12** The engineered cell contains an exogenous nucleic acid encoding a targeted receptor or a ligand of the receptor expressed on the surface of the engineered cell, optionally, the targeted receptor is a CAR or a TCR, and / or the engineered cell further contains an exogenous nucleic acid encoding a polypeptide secreted by the engineered cell, The engineered cell according to any one of claims 1 to 11. **Claim 13** i) the engineered cell is an immune cell, ii) the engineered cell is a primary cell, iii) the engineered cell is a monocyte, macrophage, mast cell, dendritic cell, or granulocyte, iv) the engineered cell is a lymphocyte, and / or v) the cell is a T cell, The engineered cell according to any one of claims 1 to 12. **Claim 14** the genetic modification includes at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within the genomic locus, and / or the genetic modification includes an indel, and / or the genetic modification includes at least one C to T substitution or at least one A to G substitution within the genomic locus, The engineered cell according to any one of claims 1 to 13. **Claim 15** A pharmaceutical composition comprising the engineered cell according to any one of claims 1 to 14. **Claim 16** A cell population comprising the engineered cell according to any one of claims 1 to 14.

17. A pharmaceutical composition comprising the cell population according to claim 16.

18. When the cell population is measured by flow cytometry, at least 65%, at least 70%, at least 80%, at least 90%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% HLA-A negative, and / or When the cell population is measured by flow cytometry, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% CIITA negative, and / or When the cell population is measured by flow cytometry, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% endogenous TCR protein negative, The population according to claim 16 or the pharmaceutical composition according to claim 15 or 17.

19. A method of producing engineered human cells with reduced or eliminated surface expression of HLA-A protein compared to unmodified cells, wherein the cells are homozygous for HLA-B, homozygous for HLA-C, and the cells are a. HLA-A guide RNA, wherein i. a guide sequence selected from SEQ ID NOs: 1 to 211, or ii. at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1 to 211, or iii. a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1 to 211, or iv. a guide sequence that binds to a target site comprising a genomic region listed in Tables 2 to 5, or v. a guide sequence that is complementary to at least 17, 18, 19, or 20 consecutive nucleotides of a genomic region listed in Tables 1 to 2 and 5, or a guide sequence that is complementary to at least 17, 18, 19, 20, 21, 22, 23, or 24 consecutive nucleotides of a genomic region listed in Table 4, or vi. comprising a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v), the HLA-A guide RNA, and optionally, b. contacting the composition with an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder, the method. **Claim 20** A method for reducing the surface expression of HLA-A protein in human cells as compared to unmodified cells, the method comprising contacting the cells with a. an HLA-A guide RNA, wherein i. the guide sequence is selected from SEQ ID NOs: 1-211, or ii. at least 17, 18, 19, or 20 consecutive nucleotides of the sequence selected from SEQ ID NOs: 1-211, or iii. a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from SEQ ID NOs: 1-211, or iv. a guide sequence that binds to a target site containing the genomic regions listed in Tables 2-5, or v. a guide sequence that is complementary to at least 17, 18, 19, or 20 consecutive nucleotides of the genomic regions listed in Tables 1-2 and 5, or a guide sequence that is complementary to at least 17, 18, 19, 20, 21, 22, 23, or 24 consecutive nucleotides of the genomic regions listed in Table 4, or vi. a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from (v), and optionally b. contacting the composition with an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder, the method. **Claim 21** The RNA-guided DNA binder comprises a Cas9 protein, or the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is S. pyogenes Cas9, N. meningitidis Cas9, S. thermophilus Cas9, S. aureus Cas9, Cpf1 from F. novicida, Cpf1 from Acidaminococcus sp., or Cpf1 from Lachnospiraceae bacterium ND2006, or the RNA-guided DNA binder or the nucleic acid encoding the RNA-guided DNA binder is a C-T base editor, an A-G base editor, or an APOBEC3A deaminase (A3A) and an RNA-guided nickase, The composition according to claim 19 or 20. **Claim 22** Further comprising reducing or eliminating surface expression of MHC class II protein in said cells as compared to unmodified cells by contacting said cells with a gene editing system that targets a gene selected from CIITA, HLA-DR, HLA-DQ, HLA-DP, RFX5, RFXB / ANK, RFXAP, CREB, NF-YA, NF-YB, and NF-YC, and / or further comprising contacting said cells with CIITA guide RNA, and / or further comprising reducing or eliminating surface expression of TCR protein in said cells as compared to unmodified cells, The method according to any one of claims 19 to 21. **Claim 23** Further comprising contacting said cells with an exogenous nucleic acid, and optionally, said exogenous nucleic acid encodes a targeted receptor or polypeptide secreted by said cells, The method according to any one of claims 19 to 22. **Claim 24** Further comprising contacting said cells with a DNA-dependent protein kinase inhibitor (DNA-PKi), and optionally, said DNA-PKi is Compound 1, The method according to claim 23. **Claim 25** Said engineered cells are allogeneic cells and / or primary cells, and / or said cells are T cells, and optionally, said T cells are CD4+ T cells, CD8+ T cells, or memory T cells, or said cells are B cells, and optionally, said B cells are plasma B cells or memory B cells, or said cells are stem cells, and optionally, said stem cells are pluripotent stem cells (PSCs), hematopoietic stem cells (HSCs), induced pluripotent stem cells (iPSCs), mesenchymal stem cells (MSCs), neural stem cells (NSCs), or marginal stem cells (LSCs), The engineered cells, cell population, pharmaceutical composition, or method according to any one of claims 1 to 24. **Claim 26** Comprising an exogenous nucleic acid encoding a polypeptide secreted by said cells, or contacting said cells with said exogenous nucleic acid, said secreted polypeptide being an antibody or antibody fragment, or a full-length IgG antibody, single-chain antibody, or neutralizing antibody, or a cytokine, or, Comprising an exogenous nucleic acid encoding a targeting receptor, or contacting said cell with an exogenous nucleic acid encoding a targeting receptor, wherein the targeting receptor is a T cell receptor (TCR), a chimeric antigen receptor (CAR), or an APRIL (a proliferation-inducing ligand). The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1 to 25.

27. The cell is engineered with a gene editing system, and optionally, the gene editing system is Comprising a transcription activator-like effector nuclease (TALEN) or a zinc finger nuclease, or An RNA-guided DNA binder, or a nucleic acid encoding an RNA-guided DNA binder, and optionally, the RNA-guided DNA binder is Cas9. The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1 to 26.

28. The HLA-A guide RNA, the RNA-guided DNA binder, and / or the exogenous nucleic acid are provided to the cell by a vector, and optionally, the HLA-A guide RNA and the RNA-guided DNA binder are provided by the same vector. The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 19 to 27.

29. A lipid nucleic acid assembly composition comprising the HLA-A guide RNA and / or the exogenous nucleic acid, and optionally an RNA-guided DNA binder, is provided to the cell, and optionally, the lipid nucleic acid assembly composition is a lipid nanoparticle (LNP). The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 19 to 28.

30. I) The HLA-A guide RNA comprises a single guide RNA comprising any one of the sequences of SEQ ID NOs: 344 to 438, 472 to 504, 533 to 560, and 1016, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of the sequences of SEQ ID NOs: 344 to 438, 472 to 504, and 533 to 560, and 1016. II) The HLA-A guide RNA comprises a guide sequence comprising any one of SEQ ID NOs: 13-18, 26, 37-39, 41, 43, 45, and 62, or the HLA-A guide RNA comprises any one of the sequences of SEQ ID NOs: 356-361, 369, 380-382, 384, 386, 388, and 405, or a single guide RNA comprising a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of the sequences of SEQ ID NOs: 356-361, 369, 380-382, 384, 386, 388, and 405, and / or III) The HLA-A guide RNA comprises at least one modification, and Optionally, the at least one modification is (i) a 2'-O-methyl (2'-O-Me) modified nucleotide, (ii) a phosphorothioate (PS) bond between nucleotides, (iii) a 2'-fluoro (2'-F) modified nucleotide, (iv) a modification at one or more of the first 5 nucleotides at the 5' end of the guide RNA, (v) a modification at one or more of the last 5 nucleotides at the 3' end of the guide RNA, (vi) a PS bond between the first 4 nucleotides of the guide RNA, (vii) a PS bond between the last 4 nucleotides of the guide RNA, (viii) a 2'-O-Me modified nucleotide at the first 3 nucleotides at the 5' end of the guide RNA, (ix) a 2'-O-Me modified nucleotide at the last 3 nucleotides at the 3' end of the guide RNA, or a combination of one or more of (i)-(ix). The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 19-29.

31. The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1-30 for use in the expression of a TCR having specificity for a polypeptide expressed by a cancer cell.

32. The engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1-30 for use as an adoptive cell transfer (ACT) therapy to be administered to a subject. Use of an engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1-30 in the manufacture of a medicament for the treatment of cancer, an infectious disease, or an autoimmune disease in a subject.

34. A cell bank, a. an engineered cell according to any one of claims 1-14 and 25-33, or an engineered cell produced by the method according to any one of claims 19-33, and b. a catalog containing information documenting the HLA-B and HLA-C alleles of the donor cells in the cell bank, Optionally, the cell bank contains at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, or 40 donor cells having a unique combination of HLA-B and HLA-C alleles compared to other donor cells in the cell bank. The cell bank.

35. Use of an engineered cell in the manufacture of a medicament for the treatment of cancer, an infectious disease, or an autoimmune disease in a subject, wherein the medicament is for administration to a recipient subject in need thereof, a. determining the HLA-B and HLA-C alleles of the recipient subject, and b. selecting an engineered cell or cell population according to any one of claims 1-46, 48, 50-52, and 67-88, or an engineered cell produced by the method according to any one of claims 56 and 58-88, wherein the engineered cell contains at least one of the same HLA-B or HLA-C alleles as the recipient subject, and is for administration according to a method comprising: Optionally, the subject has the HLA-B and HLA-C alleles of the engineered cell. The use.

36. Use of an engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1-30 in the manufacture of a medicament for the treatment of cancer, an infectious disease, or an autoimmune disease in a subject, wherein the medicament is for administration to a subject who is partially matched for adoptive cell transfer (ACT) therapy, and the partially matched subject has the HLA-B and HLA-C alleles of the engineered cell or cell population. Claim 37: The manipulated cell or cell population comprises HLA-B and HLA-C alleles shared with the subject, or the HLA-B and HLA-C alleles of the manipulated cell or cell population comprise one or more HLA-B and HLA-C alleles of the subject, or the HLA-B and HLA-C alleles of the manipulated cell or cell population comprise one or both HLA-B alleles and / or one or both HLA-C alleles of the subject, A manipulated cell, cell population, pharmaceutical composition, or method according to any one of claims 32, 33, 35, and 36.