Formulation of Activated Antigen Carriers

Abstract

The present application provides formulations of an activating antigen carrier (AAC), the formulations comprising an AAC comprising at least one antigen and an adjuvant, and a cryopreservation medium. In some aspects, the present invention provides pharmaceutical formulations comprising an activating antigen carrier (AAC), the formulations comprising a) an AAC, the AAC comprising at least one antigen and an adjuvant, and b) a cryopreservation medium. In some embodiments, the formulations comprise about 0.5×10 9 AAC ~ approx. 1 x 10 10 In some embodiments, the formulation comprises about 7×10 AAC. 9 In some embodiments, the formulation contains about 7×10 AAC prior to freezing. 9 Contains AAC.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 131,457, filed December 29, 2020, the contents of which are incorporated herein by reference in their entirety.

[0002] Submitting a sequence listing as an ASCII text file The contents of the following submission, a computer-readable format (CRF) sequence listing in an ASCII text file (filename: 750322003440SEQLIST.TXT, date recorded: December 23, 2021, size: 13,016 bytes), are hereby incorporated by reference in their entirety.

[0003] The present disclosure generally relates to formulations of activated antigen carriers (AAC) comprising at least one antigen and an adjuvant, and cryopreservation media. Methods of producing such AAC comprising at least one antigen and an adjuvant, methods of formulating cryopreservable formulations, and methods of cryopreserving the formulations are also provided. [Background technology]

[0004] Papillomaviruses are small, non-enveloped DNA viruses with a virion size of about 55 nm in diameter. Over 100 human papillomavirus (HPV) genotypes have been fully characterized, and many more are estimated to exist. HPV is a known cause of cervical cancer, as well as some vulvar, vaginal, penile, oropharyngeal, anal, and rectal cancers. Most HPV infections are asymptomatic and resolve spontaneously, but persistent infection with one of the oncogenic HPV types can progress to precancer or cancer. Other HPV-associated diseases may include common warts, plantar warts, flat warts, anogenital warts, anal lesions, epidermal dysplasia, focal epithelial thickening, oral papillomas, warty cysts, laryngeal papillomas, squamous intraepithelial lesions (SIL), cervical intraepithelial neoplasia (CIN), vulvar intraepithelial neoplasia (VIN), and vaginal intraepithelial neoplasia (VAIN).

[0005] Many of the known HPV types cause benign lesions, of which a subset are carcinogenic. Based on epidemiological and phylogenetic relationships, HPV types are classified into fifteen "high-risk types" (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82) and three "potential high-risk types" (HPV26, 53, and 66), both of which are known to manifest as low- and high-grade cervical changes and cancers, as well as other anogenital cancers, such as vulvar, vaginal, penile, anal, and perianal cancers, and head and neck cancers. Recently, an association of high-risk types HPV16 and HPV18 with breast cancer has also been described. Eleven HPV types classified as "low-risk" (HPV types 6, 11, 40, 42, 43, 44, 54, 61, 70, 72, and 81) are known to manifest as benign and low-grade cervical changes, genital warts, and recurrent respiratory papillomas. Cutaneous HPV types 5, 8, and 92 are associated with skin cancer. In several HPV-associated cancers, the immune system is depressed and the antitumor response is correspondingly severely impaired. See Suresh and Burtness Am J Hematol Oncol 13(6):20-27(2017).

[0006] Immunotherapy can be broadly divided into two main types: either passive or active intervention. Passive protocols include administration of pre-activated and / or engineered cells (e.g., CAR T cells), disease-specific therapeutic antibodies, and / or cytokines. Active immunotherapy strategies aim to stimulate immune system effector functions in vivo. Some current active protocols include vaccination strategies with disease-associated peptides, lysates, or allogeneic whole cells, injection of autologous dendritic cells (DCs) as a vehicle for tumor antigen delivery, and injection of immune checkpoint modulators. See Papaioannou, Nikos E., et al. Annals of translational medicine 4.14 (2016). Adoptive immunotherapy can be employed to modulate immune responses, enhance antitumor activity, and achieve the goal of treating or preventing HPV-associated cancer. CD8 stimulated by disease-associated antigens + Cytotoxic T lymphocytes (CTL) and CD4 + Helper T (Th) cells have the potential to target and destroy diseased cells, but current methods for inducing endogenous T cell responses face challenges. The formulations and vials described herein contain the AAC in cryopreservation medium and can be manufactured, stored, and transported without loss of functionality prior to administration to an individual in need thereof. The methods described herein can be used to efficiently create AAC, which can be an anucleated cell or an anucleated cell-derived entity, in a high-throughput manner, comprising at least one HPV antigen and an adjuvant, and can be utilized to induce robust T cell responses against HPV antigens. The disclosure herein also describes methods, treatments, doses, and regimens for treating individuals with HPV-associated cancers using AAC comprising HPV antigens and an adjuvant. All references cited herein, including patent applications and publications, are incorporated by reference in their entirety. The patent publications WO 2013 / 059343, WO 2015 / 023982, WO 2016 / 070136, WO 2017041050, WO 2017008063, WO 2017 / 192785, WO 2017 / 192786, WO 2019 / 178005, WO 2019 / 178006, WO 2020 / 072833, WO 2020 / 154696, and WO 2020 / 176789, U.S. Patent Application Publication No. 20180142198 and U.S. Patent Application Publication No. 20180201889 are expressly incorporated herein by reference in their entireties. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] International Publication No. 2013 / 059343 [Patent Document 2] International Publication No. 2015 / 023982 [Patent Document 3] International Publication No. 2016 / 070136 [Patent Document 4] International Publication No. 2017 / 041050 [Patent Document 5] International Publication No. 2017 / 008063 [Non-patent literature]

[0008] [Non-Patent Document 1] Papaioannou, Nikos E.,et al.Annals of translational medicine 4.14(2016) Summary of the Invention [Means for solving the problem]

[0009] In some aspects, the present invention provides pharmaceutical formulations comprising an activating antigen carrier (AAC), the formulation comprising: a) an AAC, the AAC comprising at least one antigen and an adjuvant; and b) a cryopreservation medium. In some embodiments, the formulation comprises about 0.5×10 9 AAC ~ approx. 1 x 10 10 In some embodiments, the formulation comprises about 7×10 AAC. 9 In some embodiments, the formulation contains about 7×10 AAC prior to freezing. 9 In some embodiments, the formulation contains about 9×10 AAC after thawing. 9 In some embodiments, the formulation comprises about 0.5×10 AAC. 9 1 x 10 cells / mL of AAC 9 In some embodiments, the formulation comprises about 0.7×10 9 In some embodiments, the formulation contains about 0.7×10 AAC / mL prior to freezing. 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation comprising about 1×10 cells / mL of AAC upon thawing. 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation containing approximately 1×10 cells / mL of AAC after thawing as measured by flow cytometry. 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation having approximately 0.7×10 cells / mL after thawing, as measured by a Coulter Counter. 9 Contains AAC at 100 / mL.

[0010] In some embodiments of the invention, at least about 70%, 80%, 90%, or 95% of the AAC in the formulation is functional. In some embodiments, the AAC in the formulation maintains functionality of about 70% or more. In some embodiments, the formulation comprises about 1×10 8 pieces / mL ~ approx. 1×10 9The composition comprises functional AAC in a population of AAC. In some embodiments, at least about 70%, 80%, 90%, or 95% of the AAC in the population are annexin stain positive. In some embodiments, the AAC in the formulation maintains about 70% or more annexin stain positive. In some embodiments, the annexin is annexin V.

[0011] In some embodiments of the present invention, the cryopreservation medium in the formulation comprises dimethyl sulfoxide (DMSO). In some embodiments, the cryopreservation medium comprises about 0.5% to about 5% DMSO. In some embodiments, the cryopreservation medium comprises about 2% DMSO. In some embodiments, the cryopreservation medium is CryoStor® CS2.

[0012] In some embodiments, the pH of the formulation is about 6.0 to about 8.5, In some embodiments, the pH of the formulation is about 7.6.

[0013] In some embodiments, the present invention provides a pharmaceutical formulation of AAC, the formulation comprising about 0.5×10 9 AAC ~ approx. 1 x 10 10 In some embodiments, the formulation comprises about 0.5×10 AAC in a cryopreservation medium, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is from about pH 6.0 to about pH 8.5. 9 AAC ~ approx. 1 x 10 10 In some embodiments, the formulation comprises about 7×10 AAC, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6. In some embodiments, the formulation comprises about 7×10 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation comprising about 9×10 AAC after thawing. 9 In some embodiments, the preparation comprises about 0.5×10 cells. 9 1 x 10 cells / mL of AAC 9 In some embodiments, the formulation comprises about 0.7×10 9In some embodiments, the formulation contains about 0.7×10 AAC / mL prior to freezing. 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation comprising about 1×10 cells / mL of AAC upon thawing. 9 In some embodiments, the formulation contains about 7×10 cells / mL of AAC in about 9.5 mL of cryopreservation medium. 9 In some embodiments, the formulation comprises an AAC, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6. In some embodiments, the cryopreservation medium is CryoStor® CS2. In some embodiments, the formulation is sterile. In some embodiments, the formulation comprises less than about 2 EU / mL endotoxin. In some embodiments, the formulation is mycoplasma-free.

[0014] In some embodiments of the invention, the AAC of the formulation comprises at least one human papillomavirus (HPV) antigen. In some embodiments, the HPV antigen is an HPV-16 antigen or an HPV-18 antigen. In some embodiments, the antigen comprises a peptide derived from HPV E6 and / or E7. In some embodiments, the antigen comprises a peptide derived from HPV E6 and a peptide derived from HPV E7. In some embodiments, the antigen comprises the amino acid sequence of any one of SEQ ID NOs: 1-4. In some embodiments, the antigen comprises the amino acid sequence of any one of SEQ ID NOs: 18-25. In some embodiments, the AAC comprises an antigen comprising the amino acid sequence of SEQ ID NO: 19 and an antigen comprising the amino acid sequence of SEQ ID NO: 23.

[0015] In some embodiments of the present invention, the AAC of the formulation comprises an adjuvant, and the adjuvant is a CpG oligodeoxynucleotide (ODN), LPS, IFN-α, a STING agonist, a RIG-I agonist, poly I:C, R837, R848, a TLR3 agonist, a TLR4 agonist, or a TLR 9 agonist. In some embodiments, the adjuvant is a CpG 7909 oligodeoxynucleotide (ODN).

[0016] In some aspects of the invention, the formulation comprises at least one antigen and adjuvant prepared by a process comprising: a) passing a cell suspension comprising input anucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input anucleated cells in suspension, thereby causing a perturbation of the input anucleated cells large enough to allow the at least one antigen and adjuvant to pass through, forming perturbed anucleated cells; and b) incubating the perturbed anucleated cells with the at least one antigen and adjuvant for a time sufficient to allow the at least one antigen and adjuvant to enter the perturbed anucleated cells, thereby producing an AAC comprising the at least one antigen and adjuvant. In some embodiments, the diameter of the constriction is about 1.6 μm to about 2.4 μm, or about 1.8 μm to about 2.2 μm. In some embodiments, the input anucleated cells are red blood cells.

[0017] In some aspects, the present invention provides a vial containing a pharmaceutical formulation, the pharmaceutical formulation comprising about 1×10 9 AAC ~ approx. 1 x 10 10 The AAC is contained in a cryopreservation medium, the AAC including at least one antigen and an adjuvant, and the pH of the formulation is about pH 6.0 to about pH 8.5. In some embodiments, the present invention provides a vial containing a pharmaceutical formulation, the pharmaceutical formulation comprising about 1×10 9 AAC ~ approx. 1 x 10 10 In some embodiments, the formulation contains about 7×10 AAC in a cryopreservation medium, the AAC including at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6. In some embodiments, the formulation contains about 7×10 AAC prior to freezing. 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation comprising about 9×10 AAC after thawing. 9 In some embodiments, the preparation comprises previously frozen AAC, the preparation containing approximately 9×10 cells after thawing as measured by flow cytometry. 9In some embodiments, the formulation comprises a previously frozen AAC, the formulation having approximately 7×10 AAC after thawing as measured by Coulter Counter. 9 In some embodiments, the formulation comprises about 0.5×10 AAC. 9 1 x 10 cells / mL of AAC 9 In some embodiments, the formulation comprises about 0.7×10 9 In some embodiments, the formulation contains about 0.7×10 AAC / mL prior to freezing. 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation comprising about 1×10 cells / mL of AAC upon thawing. 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation containing approximately 1×10 cells / mL of AAC after thawing as measured by flow cytometry. 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation having approximately 0.7×10 cells / mL after thawing, as measured by a Coulter Counter. 9 In some embodiments, the present invention provides a vial containing a pharmaceutical formulation, the pharmaceutical formulation comprising about 7×10 9 In some embodiments, the pharmaceutical formulation comprises about 7×10 AAC in about 9.5 mL of cryopreservation medium, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6. In some embodiments, the AAC is in about 9.5 mL of cryopreservation medium. In some embodiments, the pharmaceutical formulation comprises about 7×10 AAC in about 9.5 mL of cryopreservation medium. 9 In some embodiments, the formulation comprises an AAC, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6. In some embodiments, the formulation is sterile.

[0018] In some embodiments, the present invention provides a method of making a pharmaceutical formulation of AAC, the method comprising adding a cryopreservation medium to the AAC, the AAC comprising at least one antigen and an adjuvant. In some embodiments, the present invention provides a method of making a pharmaceutical formulation of AAC, the AAC comprising at least one antigen and an adjuvant, the method comprising: a) passing a cell suspension comprising input anucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input anucleated cells in suspension, thereby causing a perturbation of the input anucleated cells large enough to allow the at least one antigen and adjuvant to pass through, forming perturbed anucleated cells, and b) incubating the perturbed anucleated cells with the at least one antigen and adjuvant for a time sufficient to allow the at least one antigen and adjuvant to enter the perturbed anucleated cells, thereby producing an AAC comprising the at least one antigen and adjuvant, c) washing the AAC, and d) formulating the AAC in a cryopreservation medium. In some embodiments, the diameter of the constriction is about 1.6 μm to about 2.4 μm, or about 1.8 μm to about 2.2 μm. In some embodiments, the AAC is washed about six times. In some embodiments, the AAC is washed by centrifugation and resuspension, or by centrifugation and filtration. In some embodiments, the centrifugation is about 4000 rpm. In some embodiments, the AAC is washed about 1×10 9 AAC ~ approx. 1 x 10 10 The AAC is formulated in about 9 mL to about 10 mL of cryopreservation medium. In some embodiments, the pharmaceutical formulation contains about 7×10 9 In some embodiments, the formulation contains a previously frozen AAC, the formulation containing about 9×10 AAC after thawing. 9 In some embodiments, the preparation comprises about 0.5×10 cells. 9 1 x 10 cells / mL of AAC 9 In some embodiments, the formulation comprises about 0.7×10 9In some embodiments, the formulation contains about 0.7×10 AAC / mL prior to freezing. 9 In some embodiments, the formulation comprises a previously frozen AAC, and the formulation contains about 1×10 cells / mL of AAC after thawing, as measured by flow cytometry. 9 In some embodiments, the formulation comprises a previously frozen AAC, the formulation having approximately 0.7×10 cells / mL after thawing, as measured by a Coulter Counter. 9 In some embodiments, the AAC comprises about 7×10 9 The AAC is formulated in about 10 mL of cryopreservation medium. In some embodiments, the cryopreservation medium is CryoStor® CS2. In some embodiments, the input anucleated cells are red blood cells.

[0019] In some embodiments, the method further comprises freezing the AAC formulation at about −170° C. In some embodiments, the AAC formulation is frozen by a process comprising: a) placing the formulation in a chamber, b) reducing the temperature of the chamber to about −3° C., c) reducing the temperature of the chamber to about −140° C. at a rate of about −20° C. / min, d) reducing the temperature of the chamber to about −150° C. at a rate of about 1.5° C. / min, e) reducing the temperature of the chamber to about −170° C. at a rate of about 1.0° C. / min, and f) holding the temperature of the chamber at at least about −170° C. for at least about 10 minutes. [Brief description of the drawings]

[0020] [Figure 1] FIG. 1 shows the evaluation of platelet removal and RBC recovery performed over the LOVO process from seven different healthy donors.

[0021] [Diagram 2] FIG. 2 shows the average overall recovery of RBCs, platelets, and leukocytes for eleven runs across the RBC purification process, including cell washing and resuspension with delivery medium on the LOVO, and purification through a leukocyte depletion filter.

[0022] [Diagram 3] Figure 3A shows the increase in Annexin V+ population after red blood cells are passed through different chip configurations at operating pressures of 60 psi and 75 psi. Figure 3A shows the delivery of Ova647 after red blood cells are passed through different chip configurations at operating pressures of 60 psi and 75 psi.

[0023] [Figure 4] FIG. 4 shows the delivery of Ova647 after red blood cells were passed through the chip at different cell concentrations.

[0024] [Diagram 5] FIG. 5 shows the delivery of FAM-labeled E6 and E7 peptides after passage of red blood cells through the chip at different cell concentrations.

[0025] [Figure 6] FIG. 6 shows the delivery of FAM-labeled E7 peptide after red blood cells passed through the chip at different pressures.

[0026] [Figure 7] FIG. 7 shows a functional analysis as measured by IFNγ levels when AAC was diluted or undiluted during the 37° C. incubation period.

[0027] [Figure 8] FIG. 8 shows the average recovery rates of LOVO processing using two different protocols.

[0028] [Figure 9] FIG. 9 shows the LOVO process to achieve a target concentration of 7×10 8 AAC / mL.

[0029] [Figure 10] Figure 10 shows a representative load of 48 vials of SQZ-AAC-HPV cryopreserved using the developed protocol.

[0030] [Figure 11] FIG. 11 shows a representative load of 64 vials of SQZ-AAC-HPV cryopreserved using the two rack configurations.

[0031] [Figure 12] Figure 12 shows the post-thaw counts from five process development batches. The average AAC count across these five batches was 1.03 x 109 AAC / mL. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] In some aspects, the invention provides pharmaceutical formulations comprising an AAC, the AAC comprising at least one antigen and an adjuvant, and a cryopreservation medium. In some embodiments, the invention provides pharmaceutical formulations of an Activated Antigen Carrier (AAC), the formulation comprising about 0.5×10 9 1 x 10 cells / mL of AAC 10 In some embodiments, the formulation comprises about 0.7×10 cells / mL of AAC, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6. In some embodiments, the formulation comprises about 0.7×10 cells / mL of AAC in cryopreservation medium. 9 Contains AAC at 100 / mL.

[0033] In some aspects, the present invention provides a vial containing a pharmaceutical formulation, the pharmaceutical formulation being at about 0.5×10 9 1 x 10 cells / mL of AAC 10 The AAC comprises at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6.

[0034] In some aspects, the present invention provides a vial comprising a pharmaceutical formulation, the pharmaceutical formulation comprising about 0.7×10 9The AAC comprises at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6.

[0035] Also provided are formulations and vials containing AAC comprising at least one antigen and an adjuvant, and methods of preparing formulations of AAC comprising at least one antigen and an adjuvant. In some embodiments, the AAC is prepared by a process comprising: a) passing a cell suspension comprising a population of input anucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input anucleated cells in the suspension, thereby causing a perturbation of the input anucleated cells large enough to allow the at least one antigen and the adjuvant to pass through, forming perturbed input anucleated cells; b) incubating the population of perturbed input anucleated cells with the at least one antigen and the adjuvant for a time sufficient to allow the at least one antigen to enter the perturbed input anucleated cells, thereby producing an AAC comprising the at least one antigen and the adjuvant. In some embodiments, the antigen is an HPV antigen. Also provided are compositions for use in inducing an immune response to an HPV antigen or for treating HPV-associated cancer. Also provided is the use of a formulation comprising an effective amount of AAC in the manufacture of a medicament for stimulating an immune response to HPV antigens or treating HPV-associated cancer.

[0036] In some embodiments, a method is provided for producing a pharmaceutical formulation of an AAC, the AAC comprising at least one antigen and an adjuvant, the method comprising: a) passing a cell suspension comprising input non-nucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input non-nucleated cells in suspension, thereby causing a perturbation of the input non-nucleated cells large enough to allow the at least one antigen and adjuvant to pass through to form perturbed non-nucleated cells; and b) incubating the perturbed non-nucleated cells with the at least one antigen and adjuvant for a time sufficient to allow the at least one antigen and adjuvant to enter the perturbed non-nucleated cells, thereby producing an AAC comprising the at least one antigen and adjuvant; c) washing the AAC; and d) formulating the AAC in a cryopreservation medium.

[0037] Common methods The techniques and procedures described or referenced herein are generally well understood and may be found, for example, in Molecular Cloning: A Laboratory Manual (Sambrook et al., 2004). th ed.,Cold Spring Harbor Laboratory Press,Cold Spring Harbor,NY,2012);Current Protocols in Molecular Biology(FMAusubel,et al.eds.,2003);the series Methods in Enzymology(Academic Press,Inc.);PCR 2:A Practical Approach(MJMacPherson,BDHames and GRTaylor eds.,1995);Antibodies,A Laboratory Manual(Harlow and Lane,eds.,1988);Culture of Animal Cells:A Manual of Basic Technique and Specialized Applications(RIFreshney,6thed.,J.Wiley and Sons,2010);Oligonucleotide Synthesis(M.J.Gait,ed.,1984);Methods in Molecular Biology,Humana Press;Cell Biology:A Laboratory Notebook(J.E.Cellis,ed.,Academic Press,1998);Introduction to Cell and Tissue Culture(J.P.Mather and P.E.Roberts,Plenum Press,1998);Cell and Tissue Culture:Laboratory Procedures(A.Doyle,J.B.Griffiths,and D.G.Newell,eds.,J.Wiley and Sons,1993-8);Handbook of Experimental Immunology(D.M.Weir and C.C.Blackwell,eds.,1996);Gene Transfer Vectors for Mammalian Cells(J.M.Miller and M.P.Calos,eds.,1987);PCR:The Polymerase Chain Reaction,(Mullis et al.,eds.,1994);Current Protocols in Immunology(J.E.Coligan et al.,eds.,1991);Short Protocols in Molecular Biology(Ausubel et al.,eds.,J.Wiley and Sons,2002);Immunobiology(C.A.Janeway et al.,2004);Antibodies(P.Finch,1997);Antibodies:A Practical Approach(D.Catty.,ed.,IRL Press,1988-1989);Monoclonal Antibodies:A Practical Approach(P.Shepherd and C.Dean,eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999), The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995), and Cancer: Principles and Practice of Oncology (VT DeVita et al., eds., JBLippincott Company, 2011), are commonly employed by those skilled in the art using conventional methodologies.

[0038] definition For purposes of interpreting this specification, the following definitions will apply, except that where appropriate, terms used in the singular will include the plural and vice versa. In the event that any definition set forth below conflicts with any document incorporated herein by reference, the definition set forth above shall control.

[0039] As used herein, the singular forms "a," "an," and "the" include plural references unless otherwise indicated.

[0040] As used herein, the terms "comprising," "having," "containing," and "including," as well as other similar forms and their grammatical equivalents, are intended to be equivalent in meaning and open-ended in that the item or items following any one of these terms are not meant to be an exhaustive list of such items or items, or to be limited to only the listed item or items. For example, an article comprising components A, B, and C may consist of (i.e., include only) components A, B, and C, or may include not only components A, B, and C, but also one or more other components. Thus, "comprising" and similar forms and their grammatical equivalents are intended and understood to include disclosure of embodiments "consisting essentially of" or "consisting of."

[0041] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit, is encompassed within the disclosure, subject to the specific exclusion limits within the stated range, as are values ​​between the upper and lower limits of that range, as well as any other stated or intervening values ​​within that range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0042] The term "about" as used herein refers to the normal error range of each value, which is easily recognized by those skilled in the art. Reference to "about" a value or parameter herein includes (and describes) an embodiment that is directed to the value or parameter itself. For example, a description that refers to "about X" includes the description of "X".

[0043] As used herein, "anucleated cell" refers to a cell that lacks a nucleus. Such cells include, but are not limited to, red blood cells (RBCs), such as platelets, red blood cells, and reticulocytes. Reticulocytes are immature (e.g., not yet biconcave) red blood cells, and typically comprise about 1% of red blood cells in the human body. Reticulocytes are also anucleated. In certain embodiments, the systems and methods described herein are used for the treatment and / or processing of enriched (e.g., comprising a greater percentage of the total cell population than found in nature), purified, or isolated (e.g., in substantially pure or homogenous form from their natural environment) populations of anucleated cells (e.g., RBCs, reticulocytes, and / or platelets). In certain embodiments, the systems and methods described herein are used for the treatment and / or processing of whole blood, including RBCs (e.g., red blood cells or reticulocytes), platelets, and other blood cells. Purification or enrichment of these cell types is achieved using known methods such as density gradient systems (e.g., Ficoll-Hypaque), fluorescence activated cell sorting (FACS), magnetic cell sorting, or in vitro differentiation of erythroblasts and erythroid precursors.

[0044] The term "vesicle" as used herein refers to a structure that contains a liquid surrounded by a lipid bilayer. In some examples, the lipid bilayer is derived from a naturally occurring lipid composition. In some examples, the lipid bilayer may be sourced from a cell membrane. In some examples, the vesicles may be derived from various types of entities, such as cells. In such examples, the vesicles may retain molecules (such as intracellular proteins or membrane components) from the original entity. For example, a vesicle derived from a red blood cell may contain any number of intracellular proteins that were in the red blood cell and / or membrane components of the red blood cell. In some examples, the vesicle may contain any number of molecules within the cell in addition to the desired payload.

[0045] As used herein, "payload" refers to a substance that is delivered, e.g., loaded, into an anuclear cell-derived vesicle (e.g., AAC). "Payload," "cargo," "delivery material," and "compound" are used interchangeably herein. In some embodiments, payload may refer to proteins, small molecules, nucleic acids (e.g., RNA and / or DNA), lipids, carbohydrates, macromolecules, vitamins, polymers, fluorescent dyes and fluorophores, carbon nanotubes, quantum dots, nanoparticles, and steroids. In some embodiments, payload may refer to proteins or small molecule drugs. In some embodiments, payload may include one or more compounds.

[0046] The term "heterologous" when referring to nucleic acid sequences, such as coding sequences and control sequences, refers to sequences that are not normally linked together and / or are not normally associated with a particular cell. Thus, a "heterologous" region of a nucleic acid construct or vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature. For example, a heterologous region of a nucleic acid construct may include a coding sequence that is flanked by sequences that are not found in association with the coding sequence in nature. Another example of a heterologous coding sequence is a construct in which the coding sequence itself is not found in nature (e.g., a synthetic sequence with codons different from the native gene). Similarly, a cell transformed with a construct that is not normally present in the cell would be considered heterologous for the purposes of the present invention. Allelic variations or naturally occurring mutational events do not give rise to heterologous DNA as used herein.

[0047] The term "heterologous" as it relates to amino acid sequences, such as peptide and polypeptide sequences, refers to sequences that are not normally linked together and / or are not normally associated with a particular cell. Thus, a "heterologous" region of a peptide sequence is a segment of amino acids within or attached to another amino acid molecule that is not found in association with the other molecule in nature. For example, a heterologous region of a peptide construct may include an amino acid sequence of a peptide flanked by sequences that are not found in association with the amino acid sequence of the peptide in nature. Another example of a heterologous peptide sequence is a construct in which the peptide sequence itself is not found in nature (e.g., a synthetic sequence with encoded amino acids different from the native gene). Similarly, a cell transformed with a vector that expresses an amino acid construct that is not normally present in the cell would be considered heterologous for the purposes of the present invention. Allelic variations or naturally occurring mutational events do not give rise to a heterologous peptide as used herein.

[0048] The term "exogenous" when used with respect to an agent, such as an antigen or adjuvant, associated with a cell or AAC refers to an agent outside the cell or an agent delivered into the cell from outside the cell. The cell may or may not have the agent already present, and may or may not produce the agent after the exogenous agent is delivered.

[0049] The term "homologous" as used herein refers to molecules that are derived from the same organism. In some instances, the term refers to a nucleic acid or protein that is normally found or expressed in a given organism.

[0050] As used herein, "treatment" or "treating" is an approach to obtain beneficial or desired clinical results, including clinical results. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviating one or more symptoms caused by the disease, reducing the extent of the disease, stabilizing the disease (e.g., preventing or slowing the progression of the disease), preventing or slowing the spread of the disease (e.g., metastasis), preventing or slowing the recurrence of the disease, slowing or slowing the progression of the disease, ameliorating the disease state, remission (partially or completely) of the disease, reducing the dose of one or more other drugs required to treat the disease, slowing the progression of the disease, increasing or improving quality of life, increasing weight gain, and / or prolonging survival. "Treatment" also encompasses the reduction of pathological consequences of cancer (e.g., tumor volume, etc.). The methods of the present invention contemplate any one or more of these aspects of treatment.

[0051] As used herein, the term "prophylactic treatment" refers to treatment in which an individual is known or suspected to have a disorder or is at risk of having a disorder, but does not show symptoms of the disorder or shows minimal symptoms.The individual who receives prophylactic treatment can be treated before the onset of symptoms.In some embodiments, the individual can be treated when they have precancerous lesions, particularly precancerous lesions associated with HPV infection.

[0052] As used herein, "combination therapy" means that a first agent is administered in conjunction with another agent. "In conjunction with" refers to the administration of one therapeutic modality in addition to another, such as administering a composition of nucleated cells described herein in addition to administering an immunoconjugate described herein to the same individual. Thus, "in conjunction with" refers to the administration of one therapeutic modality before, during, or after the delivery of the other therapeutic modality to the individual.

[0053] As used herein, the term "co-administration" means that a first therapy and a second therapy in a combination therapy are administered within about 15 minutes, such as within about any one of 10 minutes, 5 minutes, or 1 minute. When a first therapy and a second therapy are administered simultaneously, the first therapy and the second therapy may be contained in the same composition (e.g., a composition that includes both the first therapy and the second therapy) or may be contained in separate compositions (e.g., the first therapy in one composition and the second therapy in another composition).

[0054] As used herein, the term "sequential administration" means that the first and second therapies in the combination therapy are administered at a time interval of more than about 15 minutes, such as about 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, or more. Either the first or second therapy can be administered first. The first and second therapies are contained in separate compositions that can be contained in the same or different packages or kits.

[0055] As used herein, the term "co-administration" means that the administration of a first therapy and a second therapy in a combination therapy overlap with each other.

[0056] In the context of cancer, the term "treating" includes any or all of killing cancer cells, inhibiting the growth of cancer cells, inhibiting the replication of cancer cells, reducing the overall tumor burden, and ameliorating one or more symptoms associated with the disease.

[0057] As used herein, the term "modulate" may refer to the act of changing, altering, modifying, or otherwise modifying the presence or activity of a particular target. For example, modulating an immune response may refer to any act that results in altering, altering, modifying, or otherwise modifying an immune response. In some examples, "modulation" refers to enhancing the presence or activity of a particular target. In some examples, "modulation" refers to suppressing the presence or activity of a particular target. In other examples, modulating the expression of a nucleic acid may include, but is not limited to, changes in the transcription of the nucleic acid, changes in mRNA abundance (e.g., increased mRNA transcription), corresponding changes in the degradation of mRNA, changes in mRNA translation, and the like.

[0058] As used herein, the term "inhibit" may refer to the action of blocking, reducing, eliminating, or otherwise antagonizing the presence or activity of a particular target. Inhibition may refer to partial or complete inhibition. For example, inhibiting an immune response may refer to any action that results in blocking, reducing, eliminating, or any other antagonism of an immune response. In other examples, inhibiting expression of a nucleic acid may include, but is not limited to, reducing transcription of the nucleic acid, reducing mRNA abundance (e.g., silencing mRNA transcription), degrading mRNA, inhibiting mRNA translation, gene editing, and the like. In other examples, inhibiting expression of a protein may include, but is not limited to, reducing transcription of a nucleic acid encoding a protein, reducing stability of an mRNA encoding a protein, inhibiting translation of a protein, reducing stability of a protein, and the like. In another example, inhibition may refer to the action of slowing or stopping growth, for example, delaying or preventing the growth of tumor cells.

[0059] As used herein, the term "suppress" may refer to the action of decreasing, reducing, hindering, restricting, alleviating, or otherwise diminishing the presence or activity of a particular target. Suppression may refer to partial or complete suppression. For example, suppressing an immune response may refer to any action that results in decreasing, reducing, hindering, restricting, alleviating, or otherwise diminishing an immune response. In other examples, suppressing expression of a nucleic acid may include, but is not limited to, reducing transcription of the nucleic acid, reducing mRNA abundance (e.g., silencing mRNA transcription), degrading mRNA, inhibiting mRNA translation, and the like. In other examples, suppressing expression of a protein may include, but is not limited to, reducing transcription of a nucleic acid encoding a protein, reducing stability of an mRNA encoding a protein, inhibiting translation of a protein, reducing stability of a protein, and the like.

[0060] As used herein, the term "enhancing" may refer to the action of improving, boosting, enhancing, or otherwise increasing the presence or activity of a particular target. For example, enhancing an immune response may refer to any action that results in improving, boosting, enhancing, or otherwise increasing an immune response. In an illustrative example, enhancing an immune response may refer to utilizing an antigen and / or an adjuvant to improve, boost, enhance, or otherwise increase an immune response. In other examples, enhancing expression of a nucleic acid may include, but is not limited to, increasing transcription of the nucleic acid, increasing mRNA abundance (e.g., increasing mRNA transcription), reducing degradation of the mRNA, increasing mRNA translation, and the like. In other examples, enhancing expression of a protein may include, but is not limited to, increasing transcription of the nucleic acid encoding the protein, increasing stability of the mRNA encoding the protein, increasing translation of the protein, increasing stability of the protein, and the like.

[0061] As used herein, the term "induce" may refer to the action of initiating, promoting, stimulating, establishing, or otherwise producing a result. For example, inducing an immune response may refer to any action that results in initiating, promoting, stimulating, establishing, or otherwise producing a desired immune response. In other examples, inducing expression of a nucleic acid may include, but is not limited to, initiating transcription of a nucleic acid, initiating translation of an mRNA, and the like. In other examples, inducing expression of a protein may include, but is not limited to, increasing transcription of a nucleic acid encoding a protein, increasing stability of an mRNA encoding a protein, increasing translation of a protein, increasing stability of a protein, and the like.

[0062] The term "polynucleotide" or "nucleic acid" as used herein refers to a polymeric form of nucleotides of any length, including ribonucleotides and deoxyribonucleotides. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers that contain purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of a polynucleotide can include sugar and phosphate groups (typically found in RNA or DNA), or modified or substituted sugar or phosphate groups. The backbone of a polynucleotide can include repeating units such as N-(2-aminoethyl)-glycine linked by peptide bonds (i.e., peptide nucleic acid). Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and phosphorothioates, and thus can be an oligodeoxynucleoside phosphoramidate (P-NH2) or a phosphorothioate-phosphorodiester mixed oligomer or a phosphoramidate-phosphodiester mixed oligomer.In addition, double-stranded polynucleotides can be obtained from the single-stranded polynucleotide products of chemical synthesis by either synthesizing the complementary strand and annealing the strands under suitable conditions, or synthesizing the complementary strand de novo using DNA polymerase with suitable primers.

[0063] The terms "polypeptide" and "protein" are used interchangeably to refer to polymers of amino acid residues and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, including but not limited to peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by the definition. The term also includes post-expression modifications of the polypeptide, such as glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for purposes of the present invention, "polypeptide" refers to proteins that contain modifications, such as deletions, additions, and substitutions (generally conserved in nature), relative to the native sequence, so long as the desired activity is maintained. These modifications may be deliberate, such as through site-directed mutagenesis, or may be accidental, such as through mutations of the host that produces the protein or errors due to PCR amplification.

[0064] As used herein, the term "adjuvant" refers to a substance that modulates and / or generates an immune response. Generally, an adjuvant is administered in conjunction with an antigen to result in an enhanced immune response to the antigen compared to the antigen alone. Various adjuvants are described herein.

[0065] The terms "CpG oligodeoxynucleotide" and "CpG ODN" herein refer to a DNA molecule of 10-30 nucleotides in length that contains a dinucleotide of cytosine and guanine separated by a phosphate (also referred to herein as a "CpG" dinucleotide, or "CpG"). The CpG ODN of the present disclosure contains at least one unmethylated CpG dinucleotide; that is, the cytosine in the CpG dinucleotide is not methylated (i.e., is not a 5-methylcytosine). The CpG ODN may have a partial or complete phosphorothioate (PS) backbone.

[0066] As used herein, "pharmacologically acceptable" or "pharmacologically compatible" means a substance that is not biologically or otherwise undesirable, e.g., the substance may be incorporated into a pharmaceutical composition administered to a patient without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. A pharma- ceutical acceptable carrier or excipient preferably meets the required standards of toxicity and manufacturing testing and / or is included in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration.

[0067] As used herein, a "microfluidic system" refers to a system in which small volumes (e.g., mL, nL, pL, fL) of fluid are processed to achieve discrete processing of small volumes of liquid. Certain implementations described herein include multiplexing, automation, and high-throughput screening. Fluids (e.g., buffers, solutions, payload-containing solutions, or cell suspensions) can be moved, mixed, separated, or otherwise processed. In certain embodiments described herein, a microfluidic system is used to apply a mechanical constriction to cells suspended in a buffer, inducing a perturbation (e.g., a hole) within the cell, thereby allowing the payload or compound to enter the cytosol of the cell.

[0068] As used herein, a "constriction" may refer to a portion of a microfluidic channel defined by an inlet portion, a center point, and an outlet portion, where the center point is defined by a width, a length, and a depth. In other examples, a constriction may refer to a pore or may be a portion of a pore. A pore may be contained on a surface (e.g., a filter and / or a membrane).

[0069] For any of the structural and functional characteristics described herein, methods for determining these characteristics are known in the art.

[0070] Formulation of AAC containing antigen In some embodiments, a pharmaceutical formulation is provided that comprises PBMCs, the formulation comprising: a) an AAC, the AAC comprising at least one antigen and an adjuvant; and b) a cryopreservation medium.

[0071] In some embodiments, the formulation comprises about 1×10 7 AAC ~ approx. 1 x 10 12 In some embodiments, the formulation comprises about 1×10 AAC. 9 AAC ~ approx. 1 x 10 11 In some embodiments, the formulation contains about 0.5×10 AAC in about 9 mL to about 10 mL. 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation contains about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×1010 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 , about 1.0×10 11 ~about 0.5×10 12 In some embodiments, the formulation contains about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation contains about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation comprises about 7×10 9 In some embodiments, the formulation contains about 7×10 AAC in about 9 mL to about 10 mL. 9 In some embodiments, the formulation contains about 6.65×10 AAC in about 9.5 mL. 9 In some embodiments, the formulation contains about 0.7×10 AAC in about 9.5 mL. 9 In some embodiments, the formulation contains about 0.7×10 AAC / mL after thawing. 9 Contains 1.0 x 10 cells / mL AAC after thawing. 9 The expected concentration of AAC / mL was 7.0 × 10 cells post-thaw as measured by the Coulter-based cell counting method, based on the negative bias of the Coulter-based counting method due to its lower sensitivity.8 AAC / mL. In some embodiments, the formulation comprises about 1×10 7 AAC ~ approx. 1 x 10 12 In some embodiments, the formulation comprises about 1×10 AAC. 9 AAC ~ approx. 1 x 10 11 In some embodiments, the formulation comprises about 0.5×10 AAC. 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation comprises about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 , about 1.0×10 11 ~about 0.5×10 12In some embodiments, the formulation comprises about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation comprises about 7×10 9 In some embodiments, the formulation comprises about 6.65×10 AAC. 9 Contains AAC.

[0072] In some embodiments, the amount of the formulation is about 2 mL to about 50 mL. In some embodiments, the amount of the formulation is about 5 mL to about 20 mL. In some embodiments, the amount of the formulation is any one of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50 mL or more. In some embodiments, the amount of the formulation is any one of about 1 to about 2, about 2 to about 3, about 3 to about 4, about 4 to about 5, about 5 to about 6, about 6 to about 7, about 7 to about 8, about 8 to about 9, or about 9 to about 10, about 10 to about 11, about 11 to about 12, about 12 to about 13, about 13 to about 14, about 14 to about 15, about 15 to about 16, about 16 to about 17, about 17 to about 18, about 18 to about 19, or about 19 to about 20 mL. In some embodiments, the amount of the formulation is about 9.5 mL.

[0073] In some embodiments, the formulation comprises about 1×10 6 ~Approx. 1×10 11 In some embodiments, the formulation comprises about 1×10 7 ~Approx. 1×10 10 In some embodiments, the formulation comprises about 0.5×10 6 , 0.7×10 6 , 1.0×10 6 , 0.5×10 7, 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , and 1.0×10 11 In some embodiments, the formulation comprises about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation comprises about 1×10 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , and 1 × 10 9 In some embodiments, the formulation comprises about 7×108 In some embodiments, the formulation comprises about 6.65×10 8 Contains AAC at 100 / mL.

[0074] In some embodiments, the formulation is sterile. In some embodiments, the formulation contains less than about 2 EU / mL endotoxin. In some embodiments, the formulation contains less than about any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 EU / mL endotoxin. In some embodiments, the formulation is mycoplasma-free.

[0075] Formulation of AAC in cryopreservation medium In some embodiments according to any one of the methods described herein, the AAC composition further comprises an agent that enhances AAC function compared to a corresponding AAC composition without the agent. In some embodiments, the AAC composition further comprises an agent that enhances AAC function upon freeze-thaw cycling compared to a corresponding AAC composition without the agent. In some embodiments, the agent is a cryopreservation agent and / or a cryoprotectant. In some embodiments, neither the cryopreservation agent nor the cryoprotectant prevents more than 10% or 20% cell death in the AAC composition comprising the agent compared to a corresponding AAC composition without the agent prior to any freeze-thaw cycle. In some embodiments, freeze-thaw cycling of the AAC composition comprising a cryopreservation agent and / or a cryoprotectant results in no more than 10%, 20%, 30%, 40%, or 50% loss of function compared to the corresponding AAC composition prior to the freeze-thaw cycle. In some embodiments, freeze-thaw cycles of an AAC composition comprising a cryopreservative and / or cryopreservative result in less than 10%, 20%, 30%, 40%, or 50% loss of function compared to freeze-thaw cycles of a corresponding AAC composition not comprising a cryopreservative and / or cryopreservative. In some embodiments, the function or functionality of an AAC composition comprising at least one antigen is measured by the percentage of AAC that are positive for Annexin V staining. In some embodiments, the function or functionality of an AAC composition is measured by the percentage of AAC that are positive for Annexin V staining. In some embodiments, the function or functionality of an AAC composition is measured by the percentage of AAC that are positive for CD235a staining. In some embodiments, the function or functionality of an AAC composition is measured by the percentage of anucleated cell-derived vesicles that are positive for CD235a and Annexin V staining. In some embodiments, at least about 70%, about 80%, or about 90% of the AAC is functional after up to 1, 2, 3, 4, or 5 freeze-thaw cycles. In some embodiments, the agent is an endocytosis enhancing compound, a stabilizer, or a cofactor, hi some embodiments, the agent is albumin.In some embodiments, the albumin is mouse, bovine, or human albumin. In some embodiments, the agent is one or more of mouse, bovine, or human albumin. In some embodiments, the agent is human albumin. In some embodiments, the agent is one or more of a divalent metal cation, glucose, ATP, potassium, glycerol, trehalose, D-sucrose, PEG1500, L-arginine, L-glutamine, or EDTA. In some embodiments, the divalent metal cation is one or more of Mg2+, Zn2+, or Ca2+. In some embodiments, the agent is one or more of sodium pyruvate, adenine, trehalose, dextrose, mannose, sucrose, human serum albumin (HSA), dimethyl sulfoxide (DMSO), HEPES, glycerin, glutathione, inosine, sodium phosphate dibasic, sodium phosphate monobasic, sodium metal ion, potassium metal ion, magnesium metal ion, chloride, acetate, gluoconate, sucrose, potassium hydroxide, or sodium hydroxide. In some embodiments, the agent is one or more of sodium pyruvate, adenine, Rejuvesol®, trehalose, dextrose, mannose, sucrose, human serum albumin (HSA), PlasmaLyte®, DMSO, Cryostor® CS2, Cryostor® CS5, Cryostor® CS10, Cryostor® CS15, HEPES, glycerol, glutathione, HypoThermosol®.

[0076] In some embodiments according to any one of the methods described herein, the process further comprises a step of incubating the composition of anucleated cells with an agent that enhances a function of the anucleated cells compared to corresponding anucleated cells prepared without the additional incubation step.

[0077] In some embodiments, the formulation comprises a cryopreservation medium. In some embodiments, the formulation comprises about 1×10 9 ~Approx. 1×1011 In some embodiments, the formulation contains about 0.5×10 AAC in about 9 mL to about 10 mL of cryopreservation medium. 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation comprises about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 AAC pieces, about 0.5 x 10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 AAC pieces, about 0.5 x 10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 AAC, approx. 1.0 x 10 11 ~about 0.5×10 12 In some embodiments, the formulation comprises about 1×10 9 , 2×10 9 , 3×109 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation comprises about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation comprises about 7×10 AAC in about 9.5 mL of cryopreservation medium. 9 In some embodiments, the formulation contains about 7×10 AAC in about 9 mL to about 10 mL of cryopreservation medium. 9 In some embodiments, the formulation contains about 6.65×10 AAC in about 9.5 mL of cryopreservation medium. 9 In some embodiments, the formulation comprises about 0.5×10 AAC in about 9.5 mL of cryopreservation medium. 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12In some embodiments, the formulation comprises about 0.5×10 AAC in a cryopreservation medium. 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 AAC, approx. 1.0 x 10 11 ~about 0.5×10 12 In some embodiments, the formulation comprises about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation comprises about 7×10 AAC in a cryopreservation medium. 9 In some embodiments, the formulation comprises about 6.65×10 AAC in a cryopreservation medium. 9 In some embodiments, the formulation comprises about 0.7×10 AAC in a cryopreservation medium. 9 In some embodiments, the formulation contains about 0.7×10 AAC / mL in cryopreservation medium after thawing. 9The cryopreservation medium contains 100% AAC / mL after thawing. In some embodiments, the cryopreservation medium contains CryoStor® CS2. In some embodiments, the cryopreservation medium is CryoStor® CS2.

[0078] In some embodiments, the composition comprising AAC comprises about 7×10 9 In some embodiments, the composition comprising the AAC comprises about 7×10 9 In some embodiments, the formulation contains about 6.65×10 AAC in about 9.5 mL of CryoStor® CS2. 9 The AAC is contained in approximately 9.5 mL of CryoStor® CS2.

[0079] In some embodiments, the AAC in the formulation maintains about 50% or more functionality after up to 1, 2, 3, 4, 5 freeze-thaw cycles. In some embodiments, the formulation maintains about 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more functionality after up to 1, 2, 3, 4, 5 freeze-thaw cycles. In some embodiments, the AAC in the formulation maintains about 70% or more functionality after storage at temperatures at or below -140°C for at least 12 months. In some embodiments, the formulation maintains about 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more functionality after storage at temperatures at or below -140°C for at least 12 months. In some embodiments, the formulation maintains about 70% or more functionality after storage at temperatures at or below -140°C for at least 6, 9, 12, 15, 18, 24, 30, or 36 months. In some embodiments, the formulation maintains about 70% or greater functionality after storage for at least 12 months at temperatures below -100°C, -110°C, -120°C, -130°C, -140°C, -150°C, -160°C, -170°C, -180°C, -190°C, or -200°C.

[0080] In some embodiments, the AAC in the formulation maintains about 50% or more annexin positive staining for up to 1, 2, 3, 4, 5 freeze-thaw cycles. In some embodiments, the formulation maintains about 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more annexin positive staining for up to 1, 2, 3, 4, 5 freeze-thaw cycles. In some embodiments, the AAC in the formulation maintains about 70% or more annexin positive staining after storage at temperatures at or below -140°C for at least 12 months. In some embodiments, the formulation maintains about 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more annexin positive staining after storage at temperatures at or below -140°C for at least 12 months. In some embodiments, the formulation maintains about 70% or greater annexin positive staining after storage for at least 6, 9, 12, 15, 18, 24, 30, or 36 months at temperatures at or below -140° C. In some embodiments, the formulation maintains about 70% or greater annexin positive staining after storage for at least 12 months at temperatures at or below -100° C., -110° C., -120° C., -130° C., -140° C., -150° C., -160° C., -170° C., -180° C., -190° C., or -200° C.

[0081] In some embodiments, the AAC in the formulation maintains about 50% or more of Annexin V and CD235a positive staining for up to 1, 2, 3, 4, 5 freeze-thaw cycles. In some embodiments, the formulation maintains about 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more of Annexin V and CD235a positive staining for up to 1, 2, 3, 4, 5 freeze-thaw cycles. In some embodiments, the AAC in the formulation maintains about 70% or more of Annexin V and CD235a positive staining after storage at temperatures at or below -140°C for at least 12 months. In some embodiments, the formulation maintains about 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more of Annexin V and CD235a positive staining after storage at temperatures at or below -140°C for at least 12 months. In some embodiments, the formulation maintains about 70% or greater Annexin V and CD235a positive staining after storage for at least 6, 9, 12, 15, 18, 24, 30, or 36 months at temperatures at or below -140° C. In some embodiments, the formulation maintains about 70% or greater Annexin V and CD235a positive staining after storage for at least 12 months at temperatures at or below -100° C., -110° C., -120° C., -130° C., -140° C., -150° C., -160° C., -170° C., -180° C., -190° C., or -200° C.

[0082] In some embodiments, the formulation comprising AAC comprises about 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12, and 1.0×10 12 In some embodiments, the formulation comprises about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~ approx. 0.5×10, approx. 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 , about 1.0×10 11 ~about 0.5×10 12 In some embodiments, the formulation comprises about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation comprises about 7×10 9 In some embodiments, the formulation comprises about 1×10 functional AAC. 9 ~Approx. 1×10 10 Includes functional AAC.

[0083] In some embodiments, the formulation comprises about 1×10 6 ~Approx. 1×10 11 In some embodiments, the formulation contains about 1×10 7 ~Approx. 1×10 10In some embodiments, the formulation contains about 0.5×10 6 , 0.7×10 6 , 1.0×10 6 , 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , and 1.0×10 11 In some embodiments, the formulation comprises about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation comprises about 1×10 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8, 7×10 8 , 8×10 8 , 9×10 8 , and 1 × 10 9 In some embodiments, the formulation comprises about 7×10 8 In some embodiments, the formulation contains about 1×10 8 ~Approx. 1×10 9 Contains functional AAC at 100 / mL.

[0084] In some embodiments, the formulation comprising AAC has a concentration of about 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation contains 0.5×10 functional AACs after thawing. 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 AAC pieces, about 0.5 x 10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 AAC pieces, about 0.5 x 10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 AAC pieces, about 0.5 x 10 10 ~Approx. 1.0×10 10 , about 1.0×1010 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 AAC, approx. 1.0 x 10 11 ~about 0.5×10 12 In some embodiments, the formulation contains about 1×10 functional AACs after thawing. 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation contains about 7×10 functional AACs after thawing. 9 In some embodiments, the formulation contains about 1×10 functional AAC after thawing. 9 ~Approx. 1×10 10 Includes functional AAC.

[0085] In some embodiments, the formulation contains about 1×10 6 ~Approx. 1×10 11 In some embodiments, the formulation contains about 1×10 functional AAC / mL after thawing. 7 ~Approx. 1×10 10 In some embodiments, the formulation contains about 0.5×10 functional AAC / mL after thawing. 6 , 0.7×10 6 , 1.0×10 6 , 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×1011 , 0.7×10 11 , and 1.0×10 11 In some embodiments, the formulation contains about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation contains about 1×10 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , and 1 × 10 9 In some embodiments, the formulation contains about 7×10 8 In some embodiments, the formulation contains about 1×10 functional AAC / mL after thawing. 8 ~Approx. 1×10 9 Contains functional AAC at 100 / mL.

[0086] In some embodiments, the cryopreservation medium includes dimethyl sulfoxide (DMSO). In some embodiments, the cryopreservation medium includes about 0.5% to about 25% DMSO. In some embodiments, the cryopreservation medium includes about 0.5% to about 5% DMSO. In some embodiments, the cryopreservation medium includes any one of about 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 10%, 15%, 20%, and 25% DMSO. In some embodiments, the cryopreservation medium includes any one of about 0.5% to about 5%, about 5% to about 10%, and about 10% to about 20% DMSO. In some embodiments, the cryopreservation medium includes about 2% DMSO.

[0087] In some embodiments, the pH of the formulation is about 5.0 to about 9.5. In some embodiments, the pH of the formulation is about 6.0 to about 8.5. In some embodiments, the pH of the formulation is about 7.6. In some embodiments, the pH of the formulation is about any one of 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, or 10. In some embodiments, the pH of the formulation is about any one of 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0. In some embodiments, the pH of the formulation is about 5 to about 6, about 6 to about 7, about 7 to about 8, about 8 to about 9, or about 9 to about 10. In some embodiments, the pH of the formulation is any one of about 7 to about 7.1, about 7.1 to about 7.2, about 7.2 to about 7.3, about 7.3 to about 7.4, about 7.4 to about 7.5, about 7.5 to about 7.6, about 7.6 to about 7.7, about 7.7 to about 7.8, about 7.8 to about 7.9, or about 7.9 to about 8.0.

[0088] In some embodiments, a pharmaceutical formulation of AAC is provided, the formulation comprising about 0.5×10 9 AAC ~ approx. 1 x 10 10 In some embodiments, a pharmaceutical formulation of an AAC is provided, the formulation comprising about 0.5×10 mAbs in a cryopreservation medium, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is about pH 6.0 to about pH 8.5.9 AAC ~ approx. 1 x 10 10 In some embodiments, the formulation comprises about 0.7×10 AAC, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6. 9 In some embodiments, the formulation contains about 0.7×10 AAC / mL after thawing. 9 Contains 100 / mL AAC after thawing.

[0089] In some embodiments, the formulation is at about 1×10 6 ~Approx. 1×10 11 In some embodiments, the formulation contains about 1×10 AAC / mL prior to freezing. 7 ~Approx. 1×10 10 In some embodiments, the formulation contains about 0.5×10 cells / mL of AAC prior to freezing. 6 , 0.7×10 6 , 1.0×10 6 , 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , and 1.0×10 11 In some embodiments, the formulation contains about 0.5×10 cells / mL of AAC prior to freezing. 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation contains about 1×10 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , and 1 × 10 9 In some embodiments, the formulation contains about 7×10 8 In some embodiments, the formulation contains about 6.65×10 AAC / mL prior to freezing. 8 / mL of AAC. In some embodiments, the concentration of AAC in the formulation is measured by Coulter Counter.

[0090] In some embodiments, the formulation comprising AAC has a concentration of about 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×1012 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation contains about 0.5×10 AAC prior to freezing. 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 AAC, approx. 1.0 x 10 11 ~about 0.5×10 12 In some embodiments, the formulation contains about 1×10 AAC prior to freezing. 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation contains about 7×10 AAC prior to freezing. 9 In some embodiments, the formulation contains about 6.65×10 AAC prior to freezing. 9 Contains AAC.

[0091] In some embodiments, the formulation contains about 1×10 6 ~Approx. 1×10 11 In some embodiments, the formulation contains about 1×10 AAC / mL after thawing. 7 ~Approx. 1×1010 In some embodiments, the formulation contains about 0.5×10 AAC / mL after thawing. 6 , 0.7×10 6 , 1.0×10 6 , 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , and 1.0×10 11 In some embodiments, the formulation contains about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation contains about 1×10 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×108 , 7×10 8 , 8×10 8 , 9×10 8 , 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , and 5 × 10 9 In some embodiments, the formulation contains about 7×10 8 In some embodiments, the formulation contains about 6.65×10 AAC / mL after thawing. 8 In some embodiments, the formulation contains about 1×10 AAC / mL after thawing. 9 Contains AAC at 100 / mL.

[0092] In some embodiments, the formulation contains about 1×10 6 ~Approx. 1×10 11 In some embodiments, the formulation contains about 1×10 AAC / mL after thawing. 7 ~Approx. 1×10 10 In some embodiments, the formulation contains about 0.5×10 AAC / mL as measured by Coulter Counter. 6 , 0.7×10 6 , 1.0×10 6 , 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , and 1.0×10 11In some embodiments, the formulation contains about 0.5×10 cells / mL of AAC after thawing. 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation contains about 1 x 10 cells / mL of AAC after thawing. 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , and 1 × 10 9 In some embodiments, the formulation contains about 7×10 cells / mL of AAC after thawing. 8 / mL AAC after thawing. In some embodiments, the formulation contains about 6.65 x 10 8 Contains 100 / mL AAC after thawing.

[0093] In some embodiments, the preparation contains about 1×10 6 ~Approx. 1×10 11In some embodiments, the formulation contains about 1 x 10 cells / mL of AAC after thawing. 7 ~Approx. 1×10 10 In some embodiments, the formulation contains about 0.5×10 cells / mL of AAC as measured by flow cytometry. 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , 1.0×10 9 , 0.5×10 10 , 1.0×10 10 , 0.5×10 11 , and 1.0×10 11 In some embodiments, the formulation contains about 0.5×10 PBMCs / mL after thawing. 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation contains about 5×10 cells / mL of AAC after thawing. 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×108 , 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 In some embodiments, the formulation contains about 1 x 10 cells / mL of AAC after thawing. 9 Contains 100 / mL AAC after thawing.

[0094] In some embodiments, the formulation comprising AAC has a concentration of about 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation contains about 0.5×10 AACs after thawing. 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×1011 ~Approx. 1.0×10 11 AAC, approx. 1.0 x 10 11 ~about 0.5×10 12 In some embodiments, the formulation contains about 1×10 AACs after thawing. 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation contains about 9×10 AACs after thawing. 9 In some embodiments, the formulation contains about 7×10 AAC after thawing. 9 In some embodiments, the formulation contains about 6.65×10 AAC after thawing. 9 Contains AAC.

[0095] In some embodiments of any one of the formulations described herein, the AAC is in about 2 mL to about 50 mL of cryopreservation medium. In some embodiments, the AAC is in about 5 mL to about 20 mL of cryopreservation medium. In some embodiments, the AAC is in about 1, 2, 3, 4, 5, 6, 7, 8, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50 mL or more of any one of the cryopreservation medium. In some embodiments, the AAC is in about 1 to about 2 mL, about 2 to about 3 mL, about 3 to about 4 mL, about 4 to about 5 mL, about 5 to about 6 mL, about 6 to about 7 mL, about 7 to about 8 mL, about 8 to about 9 mL, or about 9 to about 10 mL, about 10 to about 11 mL, about 11 to about 12 mL, about 12 to about 13 mL, about 13 to about 14 mL, about 14 to about 15 mL, about 15 to about 16 mL, about 16 to about 17 mL, about 17 to about 18 mL, about 18 to about 19 mL, or about 19 to about 20 mL of cryopreservation medium. In some embodiments, the AAC is in about 9.5 mL of cryopreservation medium.

[0096] In some embodiments, a pharmaceutical formulation of AAC is provided, the formulation comprising about 7×10 9 In some embodiments, the cryopreservation medium is CryoStor® CS2.

[0097] In some embodiments, the formulation is sterile. In some embodiments, the formulation contains less than about 2 EU / mL endotoxin. In some embodiments, the formulation contains less than about any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 EU / mL endotoxin. In some embodiments, the formulation is mycoplasma-free. Vials containing pharmaceutical preparations

[0098] In some embodiments, a vial containing any one of the pharmaceutical formulations described herein is provided.

[0099] In some embodiments, a vial containing a pharmaceutical formulation is provided, the pharmaceutical formulation comprising AAC, the formulation comprising about 1×10 9 AAC ~ approx. 1 x 10 10 In some embodiments, a pharmaceutical formulation of an AAC is provided, the formulation comprising about 1×10 AAC in a cryopreservation medium, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is about pH 6.0 to about pH 8.5. 9 AAC ~ approx. 1 x 10 10 The AAC comprises at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6.

[0100] In some embodiments of any of the vials described herein, the AAC is in about 2 mL to about 50 mL of cryopreservation medium. In some embodiments, the AAC is in about 5 mL to about 20 mL of cryopreservation medium. In some embodiments, the AAC is in about 1, 2, 3, 4, 5, 6, 7, 8, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50 mL or more of any one of the cryopreservation medium. In some embodiments, the AAC is in any one of about 1 to about 2 mL, about 2 to about 3 mL, about 3 to about 4 mL, about 4 to about 5 mL, about 5 to about 6 mL, about 6 to about 7 mL, about 7 to about 8 mL, about 8 to about 9 mL, about 9 to about 10 mL, about 10 to about 11 mL, about 11 to about 12 mL, about 12 to about 13 mL, about 13 to about 14 mL, about 14 to about 15 mL, about 15 to about 16 mL, about 16 to about 17 mL, about 17 to about 18 mL, about 18 to about 19 mL, or about 19 to about 20 mL of cryopreservation medium.

[0101] In some embodiments, the formulation comprises about 1×10 6 ~Approx. 1×10 11 In some embodiments, the formulation comprises about 1×10 7 ~Approx. 1×10 10 In some embodiments, the formulation comprises about 0.5×10 6 , 0.7×10 6 , 1.0×10 6 , 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , and 1.0×10 11In some embodiments, the formulation comprises about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation comprises about 1×10 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , and 1 × 10 9 In some embodiments, the formulation comprises about 7×10 8 In some embodiments, the formulation comprises about 6.65×10 8The cryopreservation medium contains 1000 pieces / mL of AAC. In some embodiments, the cryopreservation medium is CryoStor® CS2. In some embodiments, the cryopreservation medium contains DMSO. In some embodiments, the cryopreservation medium contains about 0.5% to about 25% DMSO. In some embodiments, the cryopreservation medium contains about 0.5% to about 5% DMSO. In some embodiments, the cryopreservation medium contains any one of about 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 10%, 15%, 20%, and 25% DMSO. In some embodiments, the cryopreservation medium contains any one of about 0.5% to about 5%, about 5% to about 10%, and about 10% to about 20% DMSO. In some embodiments, the cryopreservation medium contains about 2% DMSO.

[0102] In some embodiments, the pH of the formulation is about 5.0 to about 9.5. In some embodiments, the pH of the formulation is about 6.0 to about 8.5. In some embodiments, the pH of the formulation is about 7.6. In some embodiments, the pH of the formulation is about any one of 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, or 10. In some embodiments, the pH of the formulation is about any one of 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0. In some embodiments, the pH of the formulation is about 5 to about 6, about 6 to about 7, about 7 to about 8, about 8 to about 9, or about 9 to about 10. In some embodiments, the pH of the formulation is any one of about 7 to about 7.1, about 7.1 to about 7.2, about 7.2 to about 7.3, about 7.3 to about 7.4, about 7.4 to about 7.5, about 7.5 to about 7.6, about 7.6 to about 7.7, about 7.7 to about 7.8, about 7.8 to about 7.9, or about 7.9 to about 8.0.

[0103] In some embodiments, the formulation comprises about 1×10 9 AAC ~ approx. 1 x 10 11 In some embodiments, the formulation contains about 0.5×10 AAC in about 9 mL to about 10 mL. 7 , 0.7×10 7 , 1.0×10 7, 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation contains about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 AAC pieces, about 0.5 x 10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 , about 1.0×10 11 ~about 0.5×10 12 In some embodiments, the formulation contains about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10In some embodiments, the formulation contains about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation comprises about 7×10 9 In some embodiments, the formulation contains about 7×10 AAC in about 9 mL to about 10 mL. 9 In some embodiments, the formulation containing the AAC contains about 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation comprises about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×109 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 , about 1.0×10 11 ~about 0.5×10 12 In some embodiments, the formulation comprises about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation comprises about 7×10 9 In some embodiments, the formulation comprises about 0.7×10 AAC in a cryopreservation medium. 9 In some embodiments, the formulation contains about 0.7×10 AAC / mL in cryopreservation medium after thawing. 9 In some embodiments, the cryopreservation medium comprises CryoStor® CS2. In some embodiments, the cryopreservation medium is CryoStor® CS2. In some embodiments, the formulation contains about 1×10 AAC / mL after thawing. 6 ~Approx. 1×10 11 In some embodiments, the formulation contains about 1×10 AAC / mL after thawing. 7 ~Approx. 1×10 10 In some embodiments, the formulation contains about 0.5×10 AAC / mL after thawing. 6 , 0.7×10 6 , 1.0×10 6 , 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8, 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , and 1.0×10 11 In some embodiments, the formulation contains about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation contains about 1×10 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , and 1 × 10 9 In some embodiments, the formulation contains about 7×10 8 In some embodiments, the formulation contains about 6.65×10 AAC / mL after thawing.8 In some embodiments, the formulation contains about 1×10 AAC / mL after thawing. 9 Contains AAC at 100 / mL.

[0104] In some embodiments, the formulation contains about 1×10 6 ~Approx. 1×10 11 In some embodiments, the formulation contains about 1×10 AAC / mL after thawing. 7 ~Approx. 1×10 10 In some embodiments, the formulation contains about 0.5×10 AAC / mL as measured by Coulter Counter. 6 , 0.7×10 6 , 1.0×10 6 , 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , and 1.0×10 11 In some embodiments, the formulation contains about 0.5×10 cells / mL of AAC after thawing. 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×109 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation contains about 1 x 10 cells / mL of AAC after thawing. 8 , 2×10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , and 1 × 10 9 In some embodiments, the formulation contains about 7×10 cells / mL of AAC after thawing. 8 / mL AAC after thawing. In some embodiments, the formulation contains about 6.65 x 10 8 Contains 100 / mL AAC after thawing.

[0105] In some embodiments, the preparation contains about 1×10 6 ~Approx. 1×10 11 In some embodiments, the formulation contains about 1 x 10 cells / mL of AAC after thawing. 7 ~Approx. 1×10 10 In some embodiments, the formulation contains about 0.5×10 cells / mL of AAC as measured by flow cytometry. 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , 1.0×10 9 , 0.5×10 10 , 1.0×1010 , 0.5×10 11 , and 1.0×10 11 In some embodiments, the formulation contains about 0.5×10 PBMCs / mL after thawing. 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 In some embodiments, the formulation contains about 5×10 cells / mL of AAC after thawing. 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 In some embodiments, the formulation contains about 1 x 10 cells / mL of AAC after thawing. 9 Contains 100 / mL AAC after thawing.

[0106] In some embodiments, the formulation comprising AAC has a concentration of about 0.5×10 7 , 0.7×10 7 , 1.0×10 7 , 0.5×108 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation contains about 0.5×10 AACs after thawing. 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 AAC, approx. 1.0 x 10 11 ~about 0.5×10 12 In some embodiments, the formulation contains about 1×10 AACs after thawing. 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10In some embodiments, the formulation contains about 9×10 AACs after thawing. 9 In some embodiments, the formulation contains about 7×10 AAC after thawing. 9 In some embodiments, the formulation contains about 6.65×10 AAC after thawing. 9 Contains AAC.

[0107] In some embodiments, a pharmaceutical formulation of activated AAC is provided, the formulation comprising about 7×10 9 In some embodiments, the cryopreservation medium is CryoStor® CS2.

[0108] In some embodiments, the formulation is sterile. In some embodiments, the formulation contains less than about 2 EU / mL endotoxin. In some embodiments, the formulation contains less than about any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 EU / mL endotoxin. In some embodiments, the formulation is mycoplasma-free.

[0109] Composition of AAC Comprising Antigen and Adjuvant In some embodiments, the AAC comprises an antigen and an adjuvant delivered intracellularly. In some embodiments, the AAC comprises an HPV antigen and an adjuvant delivered intracellularly. In some embodiments, the AAC is derived from input anucleated cells. In some embodiments, the AAC is derived from input red blood cells. In some embodiments, the AAC is derived from input reticulocytes. In some embodiments, the AAC is derived from input red blood cells (RBCs). In some embodiments, the AAC is a vesicle derived from anucleated cells comprising HPV antigens and an adjuvant. In some embodiments, the AAC is a vesicle derived from RBCs comprising HPV antigens and an adjuvant.

[0110] In some embodiments, an AAC comprising at least one antigen and an adjuvant is prepared by: a) passing a cell suspension comprising input non-nucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input non-nucleated cells in suspension, thereby causing a perturbation of the input non-nucleated cells large enough to allow the at least one antigen and adjuvant to pass through to form perturbed input non-nucleated cells; and b) incubating the perturbed input non-nucleated cells with the at least one antigen and adjuvant for a time sufficient to allow the at least one antigen and adjuvant to enter the perturbed input non-nucleated cells, thereby producing an AAC comprising the at least one antigen and adjuvant.

[0111] In some embodiments, an AAC comprising an HPV antigen and an adjuvant is prepared by: a) passing a cell suspension comprising input anucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input anucleated cells in suspension, thereby causing a perturbation of the input anucleated cells large enough to allow the HPV antigen and adjuvant to pass through, forming perturbed input anucleated cells; and b) incubating the perturbed input anucleated cells with the HPV antigen and adjuvant for a time sufficient to allow the HPV antigen and adjuvant to enter the perturbed input anucleated cells, thereby producing an AAC comprising the HPV antigen and adjuvant. In some embodiments, the HPV antigen comprises an amino acid sequence of any one of SEQ ID NOs: 1-4 and 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 1-4 and 18-25.

[0112] In some embodiments, the non-nucleated cells are RBCs or platelets. In some embodiments, the non-nucleated cells are red blood cells or reticulocytes. In some embodiments, the AACs are non-nucleated cell-derived vesicles. In some embodiments, the non-nucleated cell-derived vesicles are RBC-derived vesicles or platelet-derived vesicles. In some embodiments, the non-nucleated cell-derived vesicles are red blood cell-derived vesicles or reticulocyte-derived vesicles.

[0113] In some embodiments, an AAC comprising at least one antigen and an adjuvant is prepared by: a) passing a cell suspension comprising input red blood cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input red blood cells in suspension, thereby causing a perturbation of the input red blood cells sufficient to allow the at least one antigen and adjuvant to pass through, forming perturbed input red blood cells; and b) incubating the perturbed input red blood cells with the at least one antigen and adjuvant for a time sufficient to allow the at least one antigen and adjuvant to enter the perturbed input red blood cells, thereby producing an AAC comprising the at least one antigen and adjuvant.

[0114] In some embodiments, the AAC comprising HPV antigens and adjuvants is prepared by: a) passing a cell suspension comprising input red blood cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input red blood cells in suspension, thereby causing a perturbation of the input red blood cells large enough to allow the HPV antigens and adjuvants to pass through, forming perturbed input red blood cells; and b) incubating the perturbed input red blood cells with the HPV antigens and adjuvants for a time sufficient to allow the HPV antigens and adjuvants to enter the perturbed input red blood cells, thereby producing an AAC comprising the HPV antigens and adjuvants. In some embodiments, the HPV antigen comprises an amino acid sequence of any one of SEQ ID NOs: 1-4 and 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 1-4 and 18-25.

[0115] In some embodiments, the width of the constriction is about 10% to about 99% of the average diameter of the input non-nucleated cells (e.g., red blood cells). In some embodiments, the width of the constriction is any one of about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 20% to about 60%, about 40% to about 60%, about 30% to about 45%, about 50% to about 99%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 60% to about 90%, about 60% to about 80%, and about 60% to about 70% of the average diameter of the input non-nucleated cells. In some embodiments, the width of the constriction is about 0.25 μm to about 4 μm, about 1 μm to about 4 μm, about 1.2 μm to about 3 μm, about 1.4 μm to about 2.6 μm, about 1.6 μm to about 2.4 μm, or about 1.8 μm to about 2.2 μm. In some embodiments, the width of the constriction is about 2.0 μm. In some embodiments, the width of the constriction is about 2.5 μm. In some embodiments, the width of the constriction is about 3.0 μm. In some embodiments, the width of the constriction is any one of about 0.25 μm, 0.5 μm, 1.0 μm, 1.2 μm, 1.4 μm, 1.6 μm, 1.8 μm, 2.0 μm, 2.2 μm, 2.4 μm, 2.6 μm, 2.8 μm, 3.0 μm, 3.2 μm, 3.4 μm, 3.6 μm, 3.8 μm, 4.0 μm, 4.2 μm, 4.4 μm, 4.6 μm, 4.8 μm, 5.0 μm, 5.2 μm, 5.4 μm, 5.6 μm, 5.8 μm, 6.0 μm or less. In some embodiments, the cell suspension comprising the input non-nucleated cells is passed through multiple constrictions, and the multiple constrictions are arranged in series and / or parallel.

[0116] In some embodiments, the HPV antigen is a pool of multiple polypeptides that elicit responses to the same and / or different HPV antigens. In some embodiments, the HPV antigen is a polypeptide that includes one or more antigenic HPV epitopes and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is complexed with other antigens or adjuvants. In some embodiments, the HPV antigen is capable of being processed into MHC class I-restricted peptides. In some embodiments, the HPV antigen is capable of being processed into MHC class II-restricted peptides.

[0117] In some embodiments, the composition further comprises an adjuvant.In some embodiments, the adjuvant is CpG oligodeoxynucleotide (ODN), LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic-polycytidylic acid (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist or TLR9 agonist.In some embodiments, the adjuvant is polyinosinic-polycytidylic acid (poly I:C).

[0118] Methods for Producing Pharmaceutical Formulations Comprising AACs Comprising Antigens and Adjuvants In some embodiments, the AAC contained within the pharmaceutical formulation is an anuclear cell-derived vesicle. In some embodiments, a method is provided for producing a composition comprising an AAC comprising an antigen and an adjuvant, where at least one of the antigen and the adjuvant is delivered intracellularly to the AAC. In some embodiments, a method is provided for producing a composition comprising an AAC comprising an HPV antigen and an adjuvant, where the HPV antigen and the adjuvant are delivered intracellularly to the AAC.

[0119] In some embodiments according to any one of the formulations described herein, an AAC comprising at least one antigen and an adjuvant is prepared by a process comprising: a) passing a cell suspension comprising an input anucleated population through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input anucleated cells in suspension, thereby causing a perturbation of the input anucleated cells large enough to allow the at least one antigen and the adjuvant to pass through, forming perturbed input anucleated cells; b) incubating the population of perturbed input anucleated cells with the at least one antigen and the adjuvant for a time sufficient to allow the at least one antigen to enter the perturbed input anucleated cells, thereby producing an AAC comprising the at least one antigen and the adjuvant.

[0120] In some embodiments, an AAC comprising HPV antigens and an adjuvant is prepared by a process comprising: a) passing a cell suspension comprising an input anucleated population through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input anucleated cells in the suspension, thereby causing a perturbation of the input anucleated cells large enough to allow the HPV antigens and adjuvant to pass through, forming perturbed input anucleated cells; and b) incubating the population of perturbed input anucleated cells with the HPV antigen and adjuvant for a time sufficient to allow at least one antigen to enter the perturbed input anucleated cells, thereby producing an AAC comprising the HPV antigen and adjuvant.

[0121] In some embodiments, the HPV antigen comprises a peptide derived from HPV E6. In some embodiments, the HPV antigen comprises a peptide derived from HPV E7. In some embodiments, the HPV antigen comprises a peptide derived from HPV E6 and a peptide derived from HPV E7.

[0122] In some embodiments, the input non-nucleated cells are red blood cells (RBCs) or platelets. In some embodiments, the input non-nucleated cells are red blood cells or reticulocytes. In some embodiments, the AAC are non-nucleated cell-derived vesicles. In some embodiments, the non-nucleated cell-derived vesicles are RBC-derived vesicles or platelet-derived vesicles. In some embodiments, the non-nucleated cell-derived vesicles are red blood cell-derived vesicles or reticulocyte-derived vesicles. In some embodiments, the input non-nucleated cells are autologous to the individual receiving the composition. In some embodiments, the non-nucleated cells are allogeneic to the individual receiving the composition.

[0123] In some embodiments, the width of the constriction portion is about 10% to about 99% of the average diameter of the input anuclear cells. In some embodiments, the width of the constriction portion is any one of about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 20% to about 60%, about 40% to about 60%, about 30% to about 45%, about 50% to about 99%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 60% to about 90%, about 60% to about 80%, and about 60% to about 70% of the average diameter of the input anuclear cells. In some embodiments, the width of the constriction is about 0.25 μm to about 4 μm, about 1 μm to about 4 μm, about 1.2 μm to about 3 μm, about 1.4 μm to about 2.6 μm, about 1.6 μm to about 2.4 μm, or about 1.8 μm to about 2.2 μm. In some embodiments, the width of the constriction is about 2.0 μm. In some embodiments, the width of the constriction is about 2.5 μm. In some embodiments, the width of the constriction is about 3.0 μm. In some embodiments, the width of the constriction is any one of about 0.25 μm, 0.5 μm, 1.0 μm, 1.2 μm, 1.4 μm, 1.6 μm, 1.8 μm, 2.0 μm, 2.2 μm, 2.4 μm, 2.6 μm, 2.8 μm, 3.0 μm, 3.2 μm, 3.4 μm, 3.6 μm, 3.8 μm, 4.0 μm, 4.2 μm, 4.4 μm, 4.6 μm, 4.8 μm, 5.0 μm, 5.2 μm, 5.4 μm, 5.6 μm, 5.8 μm, 6.0 μm or less. In some embodiments, the cell suspension comprising the input non-nucleated cells is passed through multiple constrictions, and the multiple constrictions are arranged in series and / or parallel.

[0124] In some embodiments, the HPV antigen is a pool of multiple polypeptides that elicit responses to the same and / or different HPV antigens. In some embodiments, the HPV antigen is a polypeptide that includes one or more antigenic HPV epitopes and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is delivered with other antigens or adjuvants. In some embodiments, the HPV antigen is a polypeptide that includes one or more antigenic HPV epitopes and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is complexed with itself, with other antigens, or with an adjuvant. In some embodiments, the HPV is HPV-16 or HPV-18. In some embodiments, the HPV antigen is comprised of an HLA-A2-specific epitope. In some embodiments, the HPV antigen is an HPV E6 antigen or an HPV E7 antigen. In some embodiments, at least one antigen includes a peptide derived from HPV E6 and / or HPV E7. In some embodiments, at least one antigen includes an HLA-A2-restricted peptide derived from HPV E6 and / or HPV E7. In some embodiments, the HPV antigens are capable of being processed into MHC class I-restricted peptides. In some embodiments, the HPV antigens are capable of being processed into MHC class II-restricted peptides.

[0125] In some embodiments, the composition further comprises an adjuvant.In some embodiments, the adjuvant is CpG oligodeoxynucleotide (ODN), LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic-polycytidylic acid (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist or TLR9 agonist.In some embodiments, the adjuvant is polyinosinic-polycytidylic acid (poly I:C).

[0126] In some embodiments, a method is provided for producing a pharmaceutical formulation of an AAC, the AAC comprising at least one antigen and an adjuvant, the method comprising: a) passing a cell suspension comprising input non-nucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input non-nucleated cells in suspension, thereby causing a perturbation of the input non-nucleated cells large enough to allow the at least one antigen and adjuvant to pass through, forming perturbed non-nucleated cells; and b) incubating the perturbed non-nucleated cells with the at least one antigen and adjuvant for a sufficient time to allow the at least one antigen and adjuvant to enter the perturbed non-nucleated cells, thereby producing an AAC comprising the at least one antigen and adjuvant; c) washing the AAC; and d) formulating the AAC in a cryopreservation medium. In some embodiments, the AAC is washed any one of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times. In some embodiments, the AAC is washed about 6 times. In some embodiments, the AAC is washed in PBS. In some embodiments, the AAC is washed in culture medium. In some embodiments, the culture medium is substantially the same as the culture medium for the input anucleated cells. In some embodiments, the AAC is washed in culture medium comprising one or more stabilizing agents. In some embodiments, the AAC is washed in culture medium comprising one or more cryopreservation agents. In some embodiments, the AAC is washed by centrifugation and resuspension. In some embodiments, the AAC is washed by centrifugation and filtration. In some embodiments, the AAC is washed by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more steps of centrifugation and resuspension. In some embodiments, the AAC is washed by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more steps of centrifugation and filtration.In some embodiments, the one or more centrifugation steps are performed at about any one of 100xg, 150xg, 200xg, 250xg, 300xg, 350xg, 400xg, 450xg, 500xg, 550xg, 600xg, 650xg, 700xg, 750xg, and 800xg. In some embodiments, the one or more centrifugation steps are performed at about any one of 1000 rpm, 1500 rpm, 2000 rpm, 2500 rpm, 3000 rpm, 3500 rpm, 4000 rpm, or 4500 rpm.

[0127] In some embodiments according to any one of the methods described herein, the formulation comprises about 1×10 7 AAC ~ approx. 1 x 10 12 In some embodiments, the formulation comprises about 1×10 AAC. 9 AAC ~ approx. 1 x 10 11 In some embodiments, the formulation contains about 0.5×10 AAC in about 9 mL to about 10 mL. 7 , 0.7×10 7 , 1.0×10 7 , 0.5×10 8 , 0.7×10 8 , 1.0×10 8 , 0.5×10 9 , 0.7×10 9 , 1.0×10 9 , 0.5×10 10 , 0.7×10 10 , 1.0×10 10 , 0.5×10 11 , 0.7×10 11 , 1.0×10 11 , 0.5×10 12 , 0.7×10 12 , and 1.0×10 12 In some embodiments, the formulation contains about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 AAC pieces, about 0.5 x 10 8 ~Approx. 1.0×10 8, about 1.0×10 8 ~about 0.5×10 9 AAC pieces, about 0.5 x 10 9 ~Approx. 1.0×10 9 , about 1.0×10 9 ~about 0.5×10 10 , about 0.5×10 10 ~Approx. 1.0×10 10 , about 1.0×10 10 ~about 0.5×10 11 , about 0.5×10 11 ~Approx. 1.0×10 11 AAC, approx. 1.0 x 10 11 ~about 0.5×10 12 In some embodiments, the formulation contains about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation contains about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , and 1 × 10 10 In some embodiments, the formulation comprises about 7×10 9 In some embodiments, the formulation contains about 7×10 AAC in about 9 mL to about 10 mL. 9 In some embodiments, the formulation contains about 6.65×10 AAC in about 9.5 mL. 9 In some embodiments, the formulation contains about 0.7×10 AAC in about 9.5 mL. 9In some embodiments, the formulation contains about 0.7×10 AAC / mL after thawing. 9 In some embodiments, the formulation contains about 7×10 cells / mL of AAC after thawing. 9 In some embodiments, the cryopreservation medium is CryoStor® CS2.

[0128] In some embodiments, the method further comprises cryopreserving (e.g., freezing) the formulation of AAC at about -80° C. to about -250° C. In some embodiments, the method further comprises cryopreserving (e.g., freezing) the formulation of AAC at about -170° C. In some embodiments, the method comprises freezing the formulation of AAC at -80° C., -90° C., -100° C., -110° C., -120° C., -130° C., -140° C., -150° C., -160° C., -170° C., -180° C., -190° C., -200° C., -210° C., -220° C., -230° C., -240° C., or -250° C. In some embodiments, the method includes heating the formulation of AAC at about -80°C to about -90°C, about -90°C to about -100°C, about -100°C to about -110°C, about -110°C to about -120°C, about -120°C to about -130°C, about -130°C to about -140°C, about -140°C to about -150°C, about -150°C to about -160°C, ... -170°C, -170°C to -180°C, -180°C to -190°C, -190°C to -200°C, -200°C to -210°C, -210°C to -220°C, -220°C to -230°C, -230°C to -240°C, or -230°C to -240°C.

[0129] In some embodiments, the formulation is cryopreserved by a process comprising: a) placing the formulation in a chamber; b) a first step of decreasing the temperature of the chamber to about 0° C. to about −20° C.; c) a second step of decreasing the temperature of the chamber to about −130° C. to about −150° C. at a rate of about −10° C. / min to about −30° C. / min; d) a third step of decreasing the temperature of the chamber to about −140° C. to about −160° C. at a rate of about −0.5° C. / min to about −5° C. / min; e) a fourth step of decreasing the temperature of the chamber to about −150° C. to about −200° C. at a rate of about −0.1° C. / min to about −5° C. / min; and f) maintaining the temperature of the chamber at about −150° C. to about −200° C. for at least about 5 to about 30 minutes. In some embodiments, the chamber is a cryopreservation chamber, such as, but not limited to, a cryopreservation chamber that facilitates a steady rate of temperature reduction, such as, for example, MR.FROSTY™ (Thermo Scientific™). In some embodiments, a different cryopreservation chamber is used for one or more of the above steps. In some embodiments, the formulation is then removed from the chamber and transferred to permanent storage (such as, but not limited to, a liquid nitrogen tank, and for example, the liquid phase, liquid vapor transition phase, or vapor phase of liquid nitrogen).

[0130] In some embodiments, the first step of decreasing the temperature of the chamber comprises decreasing the temperature to about 0° C., −1° C., −2° C., −3° C., or −4° C., or any temperature or range therebetween. In some embodiments, the second step of decreasing the temperature of the chamber comprises decreasing the temperature of the chamber to about −130° C., −131° C., −132° C., −133° C., −134° C., −135° C., −136° C., −137° C., −138° C., −139° C., −140° C., −141° C., −142° C., −143° C., −144° C., −145° C., −146° C., −147° C., −148° C., −149° C., −150° C., or any temperature or range therebetween. In some embodiments, the second step of decreasing the temperature of the chamber comprises decreasing the temperature at any one of about -1, -2, -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16, -17, -18, -19, -20 °C / min, or any rate or range therebetween. In some embodiments, the third step of decreasing the temperature of the chamber comprises decreasing the temperature of the chamber to about -140°C, -141°C, -142°C, -143°C, -144°C, -145°C, -146°C, -147°C, -148°C, -149°C, -150°C, -151°C, -152°C, -153°C, -154°C, -155°C, -156°C, -157°C, -158°C, -159°C, -160°C, or any temperature or range therebetween. In some embodiments, the third step of decreasing the temperature of the chamber comprises decreasing the temperature at about -0.5, -1, -1.5, -2, -2.5, -3, -3.5, -4, -4.5, -5°C / min, or any rate or range therebetween. In some embodiments, the fourth step of reducing the temperature of the chamber comprises reducing the temperature of the chamber to about -150°C, -152°C, -154°C, -156°C, -158°C, -160°C, -162°C, -164°C, -166°C, -168°C, -170°C, -172°C, -174°C, -176°C, -178°C, -180°C, -182°C, -184°C, -186°C, -188°C, -190°C, or any temperature or range therebetween.In some embodiments, the third step of decreasing the temperature of the chamber comprises decreasing the temperature at a rate of about any one of -0.1, -0.2, -0.3, -0.4, -0.5, -0.6, -0.7, -0.8, -0.9, -1, -1.1, -1.2, -1.3, -1.4, -1.5, -2, -2.5, -3, -3.5, -4, -4.5, or -5 degrees Celsius per minute. In some embodiments, the method comprises maintaining the temperature of the chamber at about -150°C, -152°C, -154°C, -156°C, -158°C, -160°C, -162°C, -164°C, -166°C, -168°C, -170°C, -172°C, -174°C, -176°C, -178°C, -180°C, -182°C, -184°C, -186°C, -188°C, -190°C, or any temperature or range therebetween, for about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 minutes, or any time interval or range therebetween.

[0131] In some embodiments, the formulation is cryopreserved (e.g., frozen) by a process comprising: a) placing the formulation in a chamber; b) decreasing the temperature of the chamber to about -3°C; c) decreasing the temperature of the chamber to about -140°C at a rate of about -20°C / min; d) decreasing the temperature of the chamber to about -150°C at a rate of about -1.5°C / min; e) decreasing the temperature of the chamber to about -170°C at a rate of about -1.0°C / min; and f) holding the temperature of the chamber at -170°C for at least about 10 minutes.

[0132] antigen In some embodiments of the methods, formulations or vials described herein, at least one antigen is an exogenous antigen. In some embodiments of the methods described herein, the exogenous antigen is an HPV antigen. Papillomaviruses are small non-enveloped DNA viruses with a virion size of about 55 nm in diameter. More than 100 HPV genotypes have been fully characterized, and it is estimated that a much higher number exists. HPV is a known cause of cervical cancer, as well as some vulvar, vaginal, penile, oropharyngeal, anal, and rectal cancers. Most HPV infections are asymptomatic and resolve spontaneously, but persistent infection with one of the oncogenic HPV types can progress to pre-cancer or cancer. Other HPV-associated diseases may include common warts, plantar warts, flat warts, anogenital warts, anal lesions, epidermal dysplasia, focal epithelial thickening, oral papillomas, verrucous cysts, laryngeal papillomas, squamous intraepithelial lesions (SIL), cervical intraepithelial neoplasia (CIN), vulvar intraepithelial neoplasia (VIN), and vaginal intraepithelial neoplasia (VAIN). Many of the known HPV types cause benign lesions, of which a subset are carcinogenic. Based on epidemiological and phylogenetic relationships, HPV types are classified into fifteen "high-risk types" (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82) and three "potential high-risk types" (HPV26, 53, and 66), both of which are known to manifest as low- and high-grade cervical changes and cancers, as well as other anogenital cancers, such as vulvar, vaginal, penile, anal, and perianal cancers, and head and neck cancers. Recently, an association of high-risk types HPV16 and HPV18 with breast cancer has also been described. Eleven HPV types classified as "low-risk" (HPV types 6, 11, 40, 42, 43, 44, 54, 61, 70, 72, and 81) are known to manifest as benign and low-grade cervical changes, genital warts, and recurrent respiratory papillomas. Cutaneous HPV types 5, 8, and 92 are associated with skin cancer. In several HPV-associated cancers, the immune system is depressed and antitumor responses are correspondingly severely impaired.See Suresh and Burtness, Am J Hematol Oncol 13(6):20-27(2017). In some embodiments, the exogenous antigen is a pool of multiple polypeptides that elicit responses against the same and / or different antigens. In some embodiments, the antigens in the pool of multiple antigens do not reduce immune responses directed against other antigens in the pool of multiple antigens. In some embodiments, the HPV antigen is a polypeptide that includes an antigenic HPV epitope and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is complexed with itself, with other antigens, or with an adjuvant. In some embodiments, the HPV is HPV-16 or HPV-18. In some embodiments, the HPV antigen is comprised of an HLA-A2-specific epitope. In some embodiments, the HPV antigen is an HPV E6 antigen or an HPV E7 antigen. In some embodiments, at least one antigen includes a peptide derived from HPV E6 and / or HPV E7. In some embodiments, at least one antigen comprises an HLA-A2 restricted peptide derived from HPV E6 and / or HPV E7. In some embodiments, the HLA-A2 restricted peptide comprises the amino acid sequence of any one of SEQ ID NOs: 1-4. In some embodiments, the HLA-A2 restricted peptide comprises the amino acid sequence of any one of SEQ ID NOs: 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% similarity to any one of SEQ ID NOs: 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% similarity to SEQ ID NO: 1. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% similarity to SEQ ID NO: 2. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 3. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 18. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 19. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 20.In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 21. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 22. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 23. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 24. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 25. In some embodiments, the HPV antigen comprises any one of the amino acid sequences of SEQ ID NOs: 18-25. In some embodiments, the HPV antigen is a plurality of antigens comprising at least one of the amino acid sequences of SEQ ID NOs: 18-25. In some embodiments, the exogenous antigen is a plurality of antigens comprising 2, 3, 4, 5, 6, 7, or 8 of any one of the amino acid sequences of SEQ ID NOs: 18-25. In some embodiments, the exogenous antigen is a plurality of antigens comprising an amino acid sequence having at least 90% similarity to SEQ ID NO: 19 and an amino acid sequence having at least 90% similarity to SEQ ID NO: 23. In some embodiments, the exogenous antigen is a plurality of antigens comprising the amino acid sequence of SEQ ID NO: 19 and the amino acid sequence of SEQ ID NO: 23. In some embodiments, the plurality of antigens is comprised within a pool of non-covalently linked peptides. In some embodiments, the plurality of antigens is comprised within a pool of non-covalently linked peptides, where each peptide comprises no more than one antigen. In some embodiments, the plurality of antigens is comprised within a pool of non-covalently linked peptides, where the amino acid sequence of SEQ ID NO: 19 and the amino acid sequence of SEQ ID NO: 23 are contained within separate peptides.

[0133] In some embodiments, the HPV antigen is in a pool of polypeptides that elicit responses against the same and / or different HPV antigens. In some embodiments, the antigens in the pool of antigens do not reduce immune responses directed against other antigens in the pool of antigens. In some embodiments, the HPV antigen is a polypeptide that includes an antigenic HPV antigen and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is complexed with itself, with other antigens, or with an adjuvant. In some embodiments, the HPV antigen is comprised of an HLA-A2-specific epitope. In some embodiments, the HPV antigen is comprised of an HLA-A11-specific epitope. In some embodiments, the HPV antigen is comprised of an HLA-B7-specific epitope. In some embodiments, the HPV antigen is comprised of an HLA-C8-specific epitope. In some embodiments, the HPV antigen comprises a portion or all of the N-terminal domain of a full-length HPV protein.

[0134] In some embodiments according to any one of the methods described herein, the AAC comprises a plurality of HPV antigens comprising a plurality of immunogenic epitopes. In further embodiments, after administration of an AAC comprising a plurality of antigens comprising a plurality of immunogenic epitopes to an individual, none of the plurality of immunogenic epitopes reduces the immune response in the individual against any of the other immunogenic epitopes. In some embodiments, the HPV antigen is a polypeptide and the immunogenic epitope is an immunogenic peptide epitope. In some embodiments, the immunogenic peptide epitope is fused with an adjacent polypeptide at the N-terminus and / or an adjacent polypeptide at the C-terminus. In some embodiments, the HPV antigen is a polypeptide comprising an immunogenic peptide epitope and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is a polypeptide comprising an immunogenic peptide epitope adjacent at the N-terminus and / or C-terminus to a heterologous peptide sequence. In some embodiments, the adjacent heterologous peptide sequence is derived from a disease-associated immunogenic peptide. In some embodiments, the adjacent heterologous peptide sequence is a non-naturally occurring sequence. In some embodiments, the flanking heterologous peptide sequences are derived from immunogenic synthetic long peptides (SLPs). In some embodiments, HPV antigens are capable of being processed into MHC class I-restricted and / or MHC class II-restricted peptides.

[0135] Adjuvants As used herein, the term "adjuvant" can refer to a substance that modulates and / or generates immune response either directly or indirectly. In some embodiments of the present invention, adjuvant is delivered intracellularly to a population of anuclear cells or anuclear-derived vesicles, such as a population of RBCs or RBC-derived vesicles (i.e., the cells or vesicles are incubated with adjuvant before, during, and / or after stenosis treatment, but before administration to an individual), to form an AAC that includes the adjuvant. In some examples, adjuvant is administered in conjunction with HPV antigen to enhance immune response to HPV antigen compared to HPV antigen alone. Thus, adjuvant can be used to boost the induction of immune cell response (e.g., T cell response) to mutant Ras antigen. Exemplary adjuvants include, but are not limited to, stimulator of interferon genes (STING) agonists, retinoic acid-inducible gene I (RIG-I) agonists, and agonists of TLR3, TLR4, TLR7, TLR8, and / or TLR9. Exemplary adjuvants include, but are not limited to, CpG ODN, interferon-α (IFN-α), polyinosinic:polycytidylic acid (poly I:C), imiquimod (R837), resiquimod (R848), or lipopolysaccharide (LPS). In some embodiments, the adjuvant is ODN, LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic:polycytidylic acid (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist.In certain embodiments, the adjuvant is CpG ODN.In some embodiments, the adjuvant is CpG ODN.In some embodiments, the CpG ODN is class A CpG ODN, class B CpG ODN, or class C CpG ODN.In some embodiments, the CpG ODN adjuvant comprises a selection from the group of CpG ODN 1018, CpG ODN 1585, CpG ODN 2216, CpG ODN 2336, CpG ODN 1668, CpG ODN 1826, CPG ODN 2006, CpG ODN 2007, CpG ODN BW006, CpG ODN D-SL01, CpG ODN 2395, CpG ODN M362, CpG ODN D-SL03. In some embodiments, the CpG ODN adjuvant is a CpG ODN 1826 (TCCATGACGTTCCTGACGTT (SEQ ID NO: 30)) or CpG ODN 2006 (also known as CpG 7909) (TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 31)) oligonucleotide. In some embodiments, the adjuvant is CpG 7909. In some embodiments, the RIG-I agonist comprises polyinosinic:polycytidylic acid (poly I:C). Multiple adjuvants can also be used in combination with HPV antigens to enhance elicitation of an immune response. In some embodiments, the AAC comprising an HPV antigen further comprises multiple adjuvants. Multiple adjuvants can also be used in combination with HPV antigens to enhance elicitation of an immune response. In some embodiments, the AAC comprising an HPV antigen further comprises multiple adjuvants. In some embodiments, the AAC comprising an HPV antigen further comprises any combination of the adjuvants CpG ODN, LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic:polycytidylic acid (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist.

[0136] Constriction used in the production of compositions of AAC containing antigens and adjuvants In some embodiments, the present invention provides a formulation comprising an AAC comprising at least one antigen and an adjuvant. In some embodiments, the anucleated cell is an RBC or a platelet. In some embodiments, the anucleated cell is an erythrocyte or a reticulocyte. In some embodiments, the anucleated cell is autologous to the individual receiving the AAC composition. In some embodiments, the anucleated cell is autologous to the individual receiving the AAC composition. In some embodiments, the at least one HPV antigen is delivered intracellularly to the anucleated cell. In some embodiments, the adjuvant is delivered intracellularly to the anucleated cell. Methods for introducing a payload into anucleated cells are known in the art.

[0137] In some embodiments, HPV antigens are introduced into anucleated cells by passing the cells through a constriction such that a transient pore is introduced into the membrane of the cell, thereby allowing HPV antigens to enter the cell. Examples of constriction-based delivery of compounds to cells are provided by WO 2013 / 059343, WO 2015 / 023982, WO 2016 / 070136, WO 2017041050, WO 2017008063, WO 2017 / 192785, WO 2017 / 192786, WO 2019 / 178005, WO 2019 / 178006, WO 2020 / 072833, WO 2020 / 154696, and WO 2020 / 176789, U.S. Patent Application Publication No. 20180142198, and U.S. Patent Application Publication No. 20180201889.

[0138] In some embodiments, the HPV antigens and adjuvants are delivered to anucleated cells (e.g., RBCs) by passing a cell suspension containing the anucleated cells through a constriction to generate the AAC of the present invention, where the constriction deforms the cells, thereby causing perturbation of the cells such that the HPV antigens and adjuvants enter the cells. In some embodiments, the constriction is contained within a microfluidic channel. In some embodiments, multiple constrictions can be arranged in parallel and / or in series within the microfluidic channel.

[0139] In some embodiments, the constriction in the microfluidic channel includes an entrance portion, a center point, and an exit portion. In some embodiments, the length, depth, and width of the constriction in the microfluidic channel can vary. In some embodiments, the width of the constriction in the microfluidic channel is a function of the diameter of the anucleated cell. Methods for determining the diameter of anucleated cells are known in the art, for example, high content imaging, cell counters, or flow cytometry.

[0140] In some embodiments of constriction-based delivery of HPV antigens to anucleated cell-derived vesicles, the width of the constriction is about 0.5 μm to about 10 μm. In some embodiments, the width of the constriction is about 1 μm to about 4 μm. In some embodiments, the width of the constriction is about 1 μm to about 3 μm. In some embodiments, the width of the constriction is about 1.5 μm to about 2.5 μm. In some embodiments, the width of the constriction is about 1.2 μm to about 2.8 μm. In some embodiments, the width of the constriction is about 0.5 μm to about 5 μm. In some embodiments, the width of the constriction is about 2 μm to about 2.5 μm. In some embodiments, the width of the constriction is about 1.5 μm to about 2 μm. In some embodiments, the width of the constriction is about 0.5 μm to about 3.5 μm. In some embodiments, the width of the constriction is about 3.2 μm to about 3.8 μm. In some embodiments, the width of the constriction is about 3.8 μm to about 4.3 μm. In some embodiments, the width of the constriction is about 0.25 μm, 0.5 μm, 1.0 μm, 1.2 μm, 1.4 μm, 1.6 μm, 1.8 μm, 2.0 μm, 2.2 μm, 2.4 μm, 2.6 μm, 2.8 μm, 3.0 μm, 3.2 μm, 3.4 μm, 3.6 μm, 3.8 μm, 4.0 μm, 4.2 μm, 4.4 μm, 4.6 μm, 4.8 μm, 5.0 μm, 5.2 μm, 5.4 μm, 5.6 μm, 5.8 μm, 6.0 μm or less. In some embodiments, the width of the constriction is about 2 μm. In some embodiments, the width of the constriction is about 2.2 μm. In some embodiments, the width of the constriction is about 2.5 μm. In some embodiments, the width of the constriction is about 3 μm.

[0141] Examples of parameters that may affect the delivery of compounds to the AAC include, but are not limited to, the dimensions of the constriction, the angle of incidence of the constriction, the surface properties of the constriction (e.g., roughness, chemical modification, hydrophilicity, hydrophobicity, etc.), the flow rate during operation (e.g., the passage time of cells through the constriction), the cell concentration, the concentration of the compound in the cell suspension, the buffer in the cell suspension, and the amount of time the AAC recovers or incubates after passing through the constriction, which may affect the passage of the delivered compound into the anucleated cell-derived vesicles. Additional parameters that affect the delivery of compounds to the AAC may include the velocity of the input anucleated cells in the constriction, the shear rate in the constriction, the viscosity of the cell suspension, the velocity component perpendicular to the flow rate, and the time in the constriction. In addition, multiple chips containing channels in series and / or parallel may affect the delivery to the anucleated cell-derived vesicles. Paralleling multiple chips may be useful to enhance throughput. Such parameters may be designed to control the delivery of the compounds. In some embodiments, the cell concentration is between about 10 and at least about 10 12 In some embodiments, the delivery compound concentration can be in the range of about 10 ng / mL to about 1 g / mL, or any concentration or concentration range therebetween. In some embodiments, the delivery compound concentration can be in the range of about 1 pM to at least about 2M, or any concentration or concentration range therebetween.

[0142] In some embodiments, the concentration of HPV antigen incubated with anuclear cells or AAC is about 0.01 μM to about 10 mM. For example, in some embodiments, the concentration of HPV antigen incubated with anuclear cells or AAC is less than about 0.01 μM, less than about 0.1 μM, less than about 1 μM, less than about 10 μM, less than about 100 μM, less than about 1 mM, or less than about 10 mM. In some embodiments, the concentration of HPV antigen incubated with P anuclear cells or AAC is greater than about 10 mM. In some embodiments, the concentration of HPV antigen incubated with anuclear cells or AAC is about 0.01 μM to about 0.1 μM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or about 1 mM to about 10 mM. In some embodiments, the concentration of the HPV antigen incubated with anucleated cells or AAC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of the HPV antigen incubated with anucleated cells or AAC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of the HPV antigen incubated with anucleated cells or AAC is about 1 μM.

[0143] In some embodiments, the concentration of the antigen incubated with the perturbed input anucleated cells is about 0.01 μM to about 10 mM. For example, in some embodiments, the concentration of the antigen incubated with the perturbed input anucleated cells is about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or less than about 10 mM. In some embodiments, the concentration of the antigen incubated with the perturbed input anucleated cells is greater than about 10 mM. In some embodiments, the concentration of the antigen incubated with the perturbed input anucleated cells is about 0.01 μM to about 0.1 μM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or about 1 mM to about 10 mM. In some embodiments, the concentration of antigen incubated with perturbed input anucleated cells is about 0.1 μM to about 1 mM. In some embodiments, the concentration of antigen incubated with perturbed input anucleated cells is about 0.1 μM to about 10 μM. In some embodiments, the concentration of antigen incubated with perturbed input anucleated cells is 1 μM.

[0144] In some embodiments, the molar ratio of antigen to adjuvant incubated with the perturbed input anucleated cells is anywhere from about 10000:1 to about 1:10000. For example, in some embodiments, the molar ratio of antigen to adjuvant incubated with the perturbed input anucleated cells is anywhere from about 10000:1, about 1000:1, about 100:1, about 10:1, about 1:1, about 1:10, about 1:100, about 1:1000, or about 1:10000. In some embodiments, the molar ratio of antigen to adjuvant incubated with perturbed input anucleated cells is about 10000:1 to about 1000:1, about 1000:1 to about 100:1, about 100:1 to about 10:1, about 10:1 to about 1:1, about 1:1 to about 1:10, about 1:10 to about 1:100, about 1:100 to about 1:1000, about 1:1000 to about 1:10000. In some embodiments, the molar ratio of antigen to adjuvant incubated with perturbed input anucleated cells is about 200:1. In some embodiments, the molar ratio of antigen to adjuvant incubated with perturbed input anucleated cells is about 20:1.

[0145] In some embodiments, the AAC comprises an adjuvant at a concentration of about 1 nM to about 1 mM. For example, in some embodiments, the AAC comprises an adjuvant at a concentration of less than about 0.01 μM, less than about 0.1 μM, less than about 1 μM, less than about 10 μM, less than about 100 μM, less than about 1 mM, or less than about 10 mM. In some embodiments, the AAC comprises an adjuvant at a concentration of more than about 10 mM. In some embodiments, the AAC comprises an adjuvant at a concentration of about 1 nM to about 10 nM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or about 1 mM to about 10 mM. In some embodiments, the AAC comprises an adjuvant at a concentration of about 0.1 μM to about 1 mM. In some embodiments, the AAC comprises an adjuvant at a concentration of about 1 μM.

[0146] In some embodiments, the AAC comprises at least one antigen at a concentration of about 1 nM to about 1 mM. For example, in some embodiments, the AAC comprises at least one antigen at a concentration of less than about 0.01 μM, less than about 0.1 μM, less than about 1 μM, less than about 10 μM, less than about 100 μM, less than about 1 mM, or less than about 10 mM. In some embodiments, the AAC comprises at least one antigen at a concentration greater than about 10 mM. In some embodiments, the AAC comprises at least one antigen at a concentration of about 1 nM to about 10 nM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or about 1 mM to about 10 mM. In some embodiments, the AAC comprises at least one antigen at a concentration of about 0.1 μM to about 1 mM. In some embodiments, the AAC comprises at least one antigen at a concentration of about 1 μM.

[0147] In some embodiments, the molar ratio of antigen to adjuvant in the AAC is anywhere from about 10,000:1 to about 1:10,000. For example, in some embodiments, the molar ratio of antigen to adjuvant in the AAC is anywhere from about 10,000:1, about 1,000:1, about 100:1, about 10:1, about 1:1, about 1:10, about 1:100, about 1:1000, or about 1:10,000. In some embodiments, the molar ratio of antigen to adjuvant in the modified PBMC is about 10000:1 to about 1000:1, about 1000:1 to about 100:1, about 100:1 to about 10:1, about 10:1 to about 1:1, about 1:1 to about 1:10, about 1:10 to about 1:100, about 1:100 to about 1:1000, or about 1:1000 to about 1:10000. In some embodiments, the molar ratio of antigen to adjuvant in the AAC is about 200:1. In some embodiments, the molar ratio of antigen to adjuvant in the AAC is about 20:1.

[0148] Characterization of AAC and internalization by antigen-presenting cells In embodiments of any one of the methods, vials, or formulations described herein, the AAC is produced by a process that includes: a) passing a cell suspension containing input non-nucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input non-nucleated cells in suspension, thereby causing a perturbation of the input non-nucleated cells large enough to allow the antigen and adjuvant to pass through, forming perturbed input non-nucleated cells; b) incubating the perturbed input non-nucleated cells with at least one antigen and adjuvant for a time sufficient to allow the at least one antigen and adjuvant to enter the perturbed input non-nucleated cells, thereby producing an AAC containing at least one antigen and adjuvant. In some embodiments, the AAC containing a payload (such as an HPV antigen and an adjuvant) exhibits distinct characteristics as compared to the input non-nucleated cells. In some embodiments, anucleated cell-derived vesicles containing a payload (such as HPV antigens and adjuvants) exhibit distinct characteristics compared to anucleated cells containing a payload introduced by other delivery methods (such as hemolytic loading or electroporation).

[0149] In some embodiments, the half-life of the AAC after administration to a mammal is decreased compared to the half-life of the input anucleated cells after administration to a mammal. In some embodiments, the hemoglobin content of the AAC is decreased compared to the hemoglobin content of the input anucleated cells. In some embodiments, the ATP production of the AAC is decreased compared to the ATP production of the input anucleated cells. In some embodiments, the AAC exhibits a globular morphology. In some embodiments, the input anucleated cells are red blood cells, and the AAC has a reduced biconcave shape compared to the input red blood cells. In some embodiments, the AAC is a red blood cell ghost. In some embodiments, the AAC vesicles prepared by the process have about 1.5 times more phosphatidylserine on their surface compared to the input anucleated cells. In some embodiments, the population profile of the AAC prepared by the process exhibits a higher average phosphatidylserine level on the surface compared to the input anucleated cells. In some embodiments, the population profile of at least 50% or more of the AAC prepared by the process exhibits higher phosphatidylserine levels on the surface compared to the input anucleated cells. In some embodiments, the AAC exhibits preferential uptake in tissues or cells compared to the input anucleated cells. In some embodiments, the AAC exhibits preferential uptake in phagocytes and / or antigen presenting cells compared to the input anucleated cells. In some embodiments, the AAC is modified to enhance uptake in tissues or cells compared to the input anucleated cells. In some embodiments, the AAC is modified to enhance uptake in phagocytes and / or antigen presenting cells compared to unmodified anucleated cell-derived vesicles. In some embodiments, the phagocytes and / or antigen presenting cells comprise one or more of dendritic cells or macrophages. In some embodiments, the tissue or cells comprise one or more of liver or spleen. In some embodiments, the anucleated cell-derived vesicles comprise CD47 on their surface.

[0150] In some embodiments of the above methods for generating AAC, the constriction is contained within a microfluidic channel. In some embodiments, the microfluidic channel contains multiple constrictions. In some embodiments, the multiple constrictions are arranged in series and / or parallel. In some embodiments, the constriction is between multiple micropillars, between multiple micropillars arranged in an array, or between one or more movable plates. In some embodiments, the constriction is a pore or is contained within a pore. In some embodiments, the pore is contained within a surface. In some embodiments, the surface is a filter. In some embodiments, the surface is a membrane. In some embodiments, the constriction size is a function of the diameter of the input anucleated cells in suspension. In some embodiments, the constriction size is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, or about 70% of the diameter of the input anucleated cells in suspension. In some embodiments, the constriction has a width of about 0.25 μm to about 4 μm. In some embodiments, the constriction has a width of about 4 μm, 3.5 μm, about 3 μm, about 2.5 μm, about 2 μm, about 1.5 μm, about 1 μm, about 0.5 μm, or about 0.25 μm. In some embodiments, the constriction has a width of about 2.2 μm. In some embodiments, the input anucleated cells are passed through the constriction under a pressure ranging from about 10 psi to about 90 psi. In some embodiments, the cell suspension is contacted with at least one antigen prior to, concurrently with, or after passing through the constriction.

[0151] In some embodiments, an AAC comprising a payload (e.g., at least one HPV antigen and an adjuvant) is prepared from input anucleated cells, the AAC having one or more of the following properties: (a) reduced circulating half-life in a mammal compared to the input anucleated cells, (b) reduced hemoglobin levels compared to the input anucleated cells, (c) spherical morphology, (d) increased surface phosphatidylserine levels compared to the input anucleated cells, or (e) reduced ATP production compared to the input anucleated cells.

[0152] In some embodiments, the input non-nucleated cells are mammalian cells. In some embodiments, the input non-nucleated cells are human cells. In some embodiments, the input non-nucleated cells are red blood cells or platelets. In some embodiments, the red blood cells are red blood cells or reticulocytes. In some embodiments, the non-nucleated cells are autologous to the individual receiving the composition. In some embodiments, the non-nucleated cells are autologous to the individual receiving the composition.

[0153] In some embodiments, the circulating half-life of the AAC in a mammal is reduced compared to the input anucleated cells. In some embodiments, the circulating half-life in a mammal is reduced by more than about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% compared to the input anucleated cells.

[0154] In some embodiments, the input non-nuclear cells are human cells and the circulating half-life of the AAC is less than about 1 minute, about 2 minutes, about 5 minutes, about 10 minutes, about 15 minutes, about 30 minutes, about 1 hour, about 6 hours, about 12 hours, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 10 days, about 25 days, about 50 days, about 75 days, about 100 days, or about 120 days.

[0155] In some embodiments, the input non-nucleated cells are red blood cells, and the hemoglobin level in the AAC is reduced compared to the input non-nucleated cells. In some embodiments, the hemoglobin level in the AAC is reduced by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 99%, or about 100% compared to the input non-nucleated cells. In some embodiments, the hemoglobin level in the AAC is about 1%, about 5%, about 10%, about 20%, about 30%, about 40%, or about 50% of the level of hemoglobin in the input non-nucleated cells.

[0156] In some embodiments, the input non-nucleated cells are red blood cells and the AAC are spherical in morphology. In some embodiments, the input non-nucleated cells are red blood cells and the AAC have a reduced biconcave shape compared to the input non-nucleated cells.

[0157] In some embodiments, the input anucleated cells are red blood cells or erythrocytes and the AAC are red blood cell ghosts (RBC ghosts).

[0158] In some embodiments, the AAC comprises CD47 on its surface.

[0159] In some embodiments, the AAC has increased surface phosphatidylserine levels compared to the input anucleated cells. In some embodiments, the AAC prepared by the process has more than about 1.5 times more phosphatidylserine on its surface compared to the input anucleated cells. In some embodiments, the AAC has about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 99%, about 100%, or more than about 100% phosphatidylserine on its surface compared to the input anucleated cells.

[0160] In some embodiments, the AAC has reduced ATP production compared to the input anucleated cells. In some embodiments, the AAC produces ATP at less than about 1%, about 5%, about 10%, about 20%, about 30%, about 40%, or about 50% of the level of ATP produced by the input anucleated cells. In some embodiments, the AAC does not produce ATP.

[0161] In some embodiments, the AAC exhibits enhanced uptake in tissues or cells compared to the input anucleated cells. In some embodiments, the AAC exhibits preferential uptake in the liver or spleen, or by phagocytes or antigen-presenting cells, compared to the uptake of the input anucleated cells.

[0162] In some embodiments, the AAC is further modified to enhance uptake in tissues or cells relative to the input anucleated cells, hi some embodiments, the AAC is further modified to enhance uptake in the liver or spleen, or by phagocytes or antigen presenting cells, relative to uptake of the input anucleated cells.

[0163] In some embodiments, the AAC exhibits enhanced uptake in the liver or spleen or by phagocytes and / or antigen presenting cells, and internalization of the AAC results in increased expression of maturation markers of the phagocytes or antigen presenting cells. In some embodiments, the phagocytes and / or antigen presenting cells are monocyte-derived dendritic cells (MODCs). In some embodiments, the maturation markers are one or more of CD80, CD86, CD83, and MHC-II. In some embodiments, expression of one or more of CD80, CD86, CD83, and MHC-II is increased by at least any one of about 10%, 20%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold, 10000-fold, or more in phagocytes and / or antigen presenting cells contacted with AAC comprising HPV antigens compared to phagocytes and / or antigen presenting cells not contacted with AAC comprising HPV antigens. In some embodiments, expression of one or more of CD80, CD86, CD83, and MHC-II is increased by at least any one of about 10%, 20%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold, 10,000-fold, or more in phagocytes and / or antigen presenting cells contacted with AAC comprising HPV antigens compared to phagocytes and / or antigen presenting cells contacted with input anucleated cells.

[0164] In some embodiments, the AAC comprising HPV antigens, or HPV antigens and adjuvants, exhibits increased uptake in the liver or spleen or by phagocytes and / or antigen presenting cells, and internalization of the AAC results in increased presentation of HPV antigens contained within anucleated cell-derived vesicles. In some embodiments, presentation of HPV antigens is increased by at least any one of about 10%, 20%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold, 10000-fold, or more in phagocytes and / or antigen presenting cells contacted with the AAC comprising HPV antigens, compared to corresponding anucleated cells containing the same HPV antigens introduced by other delivery methods, such as, but not limited to, hemolytic challenge.

[0165] In some embodiments, the HPV antigen, or the AAC comprising an HPV antigen and an adjuvant, exhibits increased uptake in the liver or spleen or by phagocytes and / or antigen presenting cells, and internalization of the AAC results in an increased ability of the phagocytes and / or antigen presenting cells to induce an antigen-specific immune response. In some embodiments, the antigen-specific immune response mediated by phagocytes and / or antigen presenting cells contacted with the HPV antigen, or the AAC comprising an HPV antigen and an adjuvant, is increased by at least any one of about 10%, 20%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold, 10000-fold, or more, compared to phagocytes and / or antigen presenting cells contacted with input anucleated cells. In some embodiments, the antigen-specific immune response mediated by phagocytes and / or antigen-presenting cells contacted with HPV antigens or AAC comprising HPV antigens and adjuvants is increased by at least about any one of 10%, 20%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold, 10000-fold, or more, compared to phagocytes and / or antigen-presenting cells contacted with anucleated cells comprising the same HPV antigens introduced by other delivery methods (such as, but not limited to, hemolytic challenge). In some embodiments, the antigen-specific immune response is an antigen-specific CD4+ T cell response. In some embodiments, the antigen-specific immune response is an antigen-specific CD8+ T cell response.

[0166] He also expressed HLA-A*02, HLA-A*01, and HLA-A*0 3、HLA-A*24、HLA-A*11、HLA-A*26、HLA-A*32、HLA- A*31、HLA-A*68、HLA-A*29、HLA-A*23、HLA-B*07、HLA-B*44、HLA-B*08、HLA-B*35、HLA-B*15、HLA-B*4 0、HLA-B*27、HLA-B*18、HLA-B*51、HLA-B*14、HLA-B*13、HLA-B*57、HLA-B*38、HLA-C*07、HLA-C*04、H HLA-C*03, HLA-C*06, HLA-C*05, HLA-C*12, HLA-C*02, HLA-C*01, HLA-C*08, HLA-C*1

[0167] In some embodiments of any one of the methods, compositions, or uses described herein, the phagocytes are selected from the group consisting of HLA-A*02, HLA-A*01, HLA-A*03, HLA-A*24, HLA-A*11, HLA-A*26, HLA-A*32, HLA-A*31, HLA-A*68, HLA-A*29, HLA-A*23, HLA-B*07, HLA-B*44, HLA-B*08, HLA-B*35, HLA-B* 15, HLA-B*40, HLA-B*27, HLA-B*18, HLA-B*51, HLA-B*14, HLA-B*13, HLA-B*57, HLA-B*38, HLA-C*07, HLA-C*04, HLA-C*03, HLA-C*06, HLA-C*05, HLA-C*12, HLA-C*02, HLA-C*01, HLA-C*08, and / or HLA-C*16 haplotypes. In some embodiments, the antigen presenting cells are human cells with HLA-A*02, HLA-A*11, HLA-B*07, or HLA-C*08 haplotypes. In some embodiments, the HPV antigens presented by the phagocytes and / or antigen presenting cells described herein are comprised of HLA-A2 specific epitopes. In some embodiments, the HPV antigens presented by the phagocytes and / or antigen-presenting cells described herein are comprised of HLA-A11 specific epitopes. In some embodiments, the HPV antigens presented by the phagocytes and / or antigen-presenting cells described herein are comprised of HLA-B7 specific epitopes. In some embodiments, the HPV antigens presented by the phagocytes and / or antigen-presenting cells described herein are comprised of HLA-C8 specific epitopes.

[0168] In some embodiments, the method includes administering to the individual an AAC comprising an HPV antigen and an adjuvant, wherein the AAC is taken up by a phagocyte and / or an antigen presenting cell. In some embodiments, the AAC is taken up by a phagocyte and / or an antigen presenting cell, and internalization of the AAC results in increased expression of a maturation marker of the phagocyte or antigen presenting cell. In some embodiments, the phagocyte and / or antigen presenting cell is a monocyte-derived dendritic cell (MODC). In some embodiments, the maturation marker is one or more of CD80, CD86, CD83, and MHC-II. In some embodiments, expression of one or more of CD80, CD86, CD83, and MHC-II is increased by at least any one of about 10%, 20%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold, 10,000-fold, or more in phagocytes and / or antigen-presenting cells contacted with AAC comprising an HPV antigen compared to phagocytes and / or antigen-presenting cells not contacted with AAC comprising an HPV antigen. In some embodiments, expression of one or more of CD80, CD86, CD83, and MHC-II is increased by at least any one of about 10%, 20%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold, 10,000-fold, or more in phagocytes and / or antigen presenting cells contacted with AAC comprising HPV antigens compared to phagocytes and / or antigen presenting cells contacted with input anucleated cells.

[0169] In some embodiments, the input anucleated cells were not (a) heat treated, (b) chemically treated, and / or (c) subjected to hypotonic or hypertonic conditions during preparation of the anucleated cell-derived vesicles. In some embodiments, osmolarity was maintained during preparation of the AAC from the input anucleated cells. In some embodiments, osmolarity was maintained at about 200 mOsm to about 600 mOsm. In some embodiments, osmolarity was maintained at about 200 mOsm to about 400 mOsm.

[0170] Systems and Kits In some aspects, the invention provides a system comprising one or more of a constriction, an anucleated cell suspension, an antigen, or an adjuvant for use in the methods disclosed herein. The system can include any embodiment described in the methods disclosed above, including a surface having a microfluidic channel or pores providing a cell deformation constriction, a cell suspension, a cell perturbation, delivery parameters, compounds, and / or applications. In some embodiments, the cell deformation constriction is sized for delivery to anucleated cells. In some embodiments, delivery parameters such as flow rate during operation, cell and compound concentration, velocity of cells within the constriction, and composition of the cell suspension (e.g., osmolality, salt concentration, serum content, cell concentration, pH, etc.) are optimized to maximize the response of the compound to suppress an immune response or induce tolerance.

[0171] Also provided are kits or articles of manufacture for use in treating individuals with HPV-associated cancer. In some embodiments, the kits include AACs that include intracellular antigens and intracellular adjuvants. In some embodiments, the kits include one or more of a constriction, an anucleated cell suspension, an HPV antigen, or an adjuvant for use in generating AACs for use in treating individuals with HPV-associated diseases, such as cancer. In some embodiments, the kits include compositions described herein (e.g., microfluidic channels or surfaces that include pores, cell suspensions, and / or compounds) in suitable packaging. Suitable packaging materials are known in the art and include, for example, vials (such as sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may be further sterilized and / or sealed.

[0172] The present invention also provides kits that include components of the methods described herein and may further include instructions for carrying out the method of treating an individual with an HPV-associated cancer and / or instructions for introducing HPV antigens and adjuvants into an anucleated cell. The kits described herein may further include other materials, including other buffers, diluents, filters, needles, syringes, and inserts, with instructions for carrying out any of the methods described herein, such as instructions for treating an individual with an HPV-associated cancer, or instructions for producing an AAC to contain an HPV antigen in the cell and an adjuvant in the cell.

[0173] Exemplary embodiments Embodiment 1. 1. A pharmaceutical formulation comprising an activating antigen carrier (AAC), the formulation comprising: a) an AAC comprising at least one antigen and an adjuvant; b) a cryopreservation medium.

[0174] Embodiment 2. The formulation is approximately 0.5 x 10 9 AAC ~ approx. 1 x 10 10 2. The pharmaceutical formulation of embodiment 1, comprising an AAC.

[0175] Embodiment 3. The formulation was approximately 7 × 10 9 3. The pharmaceutical formulation of embodiment 1 or 2, comprising an AAC.

[0176] Embodiment 4. The preparation contained approximately 7 × 10 9 4. The pharmaceutical formulation of any one of embodiments 1 to 3, comprising an AAC.

[0177] Embodiment 5. The formulation comprises a previously frozen AAC, the formulation containing approximately 9×10 9 5. The pharmaceutical formulation of any one of embodiments 1 to 4, comprising an AAC.

[0178] Embodiment 6. The formulation is approximately 0. 5×10 9 1 x 10 cells / mL of AAC 9 6. The pharmaceutical formulation of any one of embodiments 1 to 5, comprising:

[0179] Embodiment 7. The formulation is approximately 0.7 x 10 9 7. The pharmaceutical formulation of any one of embodiments 1 to 6, comprising:

[0180] Embodiment 8. The formulation had a total concentration of approximately 0.7 × 10 9 8. The pharmaceutical formulation of any one of embodiments 1 to 7, comprising:

[0181] EMBODIMENT 9. The formulation comprises a previously frozen AAC, the formulation containing approximately 1×10 9 9. The pharmaceutical formulation of any one of embodiments 1 to 8, comprising:

[0182] Embodiment 10. A pharmaceutical formulation described in any one of embodiments 1 to 9, wherein at least about 70%, 80%, 90%, or 95% of the AAC in the population are functional.

[0183] Embodiment 11. 11. The pharmaceutical formulation according to any one of embodiments 1 to 10, wherein the AAC in the formulation maintains about 70% or more of its functionality.

[0184] Embodiment 12. The formulation is approximately 1 x 10 8 pieces / mL ~ approx. 1×10 9 3. The pharmaceutical formulation of any one of embodiments 1 or 2, comprising:

[0185] Embodiment 13. A pharmaceutical formulation according to any one of embodiments 1 to 12, wherein at least about 70%, 80%, 90%, or 95% of the AAC in the population are positive for annexin staining.

[0186] Embodiment 14. 14. The pharmaceutical formulation according to any one of embodiments 1 to 13, wherein the AAC in the formulation that maintains about 70% or more of its functionality is positive for annexin staining.

[0187] EMBODIMENT 15. The pharmaceutical formulation of embodiment 13 or 14, wherein the annexin is annexin V.

[0188] EMBODIMENT 16. 16. The pharmaceutical formulation according to any one of embodiments 1 to 15, wherein the cryopreservation medium comprises dimethylsulfoxide (DMSO).

[0189] EMBODIMENT 17. 17. The pharmaceutical formulation according to any one of embodiments 1 to 16, wherein the cryopreservation medium comprises about 0.5% to about 5% DMSO.

[0190] EMBODIMENT 18. 18. The pharmaceutical formulation according to any one of the preceding embodiments, wherein the cryopreservation medium comprises about 2% DMSO.

[0191] EMBODIMENT 19. 19. The pharmaceutical formulation according to any one of the preceding embodiments, wherein the cryopreservation medium is CryoStor® CS2.

[0192] EMBODIMENT 20. 20. The pharmaceutical formulation according to claim 1, wherein the pH of the formulation is about 6.0 to about 8.5.

[0193] EMBODIMENT 21. 21. The pharmaceutical formulation according to any one of claims 1 to 20, wherein the pH of the formulation is about 7.6.

[0194] EMBODIMENT 22. A pharmaceutical formulation of AAC, the formulation comprising about 0.5×10 9 AAC ~ approx. 1 x 10 10 A pharmaceutical formulation comprising an AAC, the AAC comprising at least one antigen and an adjuvant, the pH of the formulation being from about pH 6.0 to about pH 8.5.

[0195] EMBODIMENT 23. A pharmaceutical formulation of AAC, the formulation comprising about 0.5×10 9 AAC ~ approx. 1 x 10 10 1. A pharmaceutical formulation comprising an AAC, the AAC comprising at least one antigen and an adjuvant, wherein the pH of the formulation is about pH 7.6.

[0196] EMBODIMENT 24. The preparation contained approximately 7 × 10 9 24. The pharmaceutical formulation of embodiment 22 or 23, comprising an AAC.

[0197] 25. The formulation comprises a previously frozen AAC, the formulation containing approximately 9×10 9 26. The pharmaceutical formulation according to any one of embodiments 22 to 25, comprising cells.

[0198] 26. The formulation is approximately 0.5 x 10 9 1 x 10 cells / mL of AAC 9 26. The pharmaceutical formulation of any one of embodiments 22 to 25, comprising:

[0199] EMBODIMENT 27. The formulation is approximately 0.7 x 10 9 27. The pharmaceutical formulation of any one of embodiments 22 to 26, comprising:

[0200] 28. The formulation had a total concentration of approximately 0.7 × 10 9 28. The pharmaceutical formulation of any one of embodiments 22 to 27, comprising:

[0201] 29. The formulation comprises a previously frozen AAC, the formulation containing approximately 1×10 9 29. The pharmaceutical formulation of any one of embodiments 22 to 28, comprising:

[0202] EMBODIMENT 30. A pharmaceutical formulation of AAC, the formulation comprising about 7×10 9 1. A pharmaceutical formulation comprising an AAC, the AAC comprising at least one antigen and an adjuvant, the pH of the formulation being about pH 7.6.

[0203] EMBODIMENT 31. The pharmaceutical formulation according to any one of embodiments 22 to 30, wherein the cryopreservation medium is CryoStor® CS2.

[0204] EMBODIMENT 32. The pharmaceutical formulation according to any one of embodiments 1 to 31, wherein the formulation is sterile.

[0205] EMBODIMENT 33. 33. The pharmaceutical formulation of any one of embodiments 1-32, wherein the formulation contains less than about 2 EU / mL endotoxin.

[0206] EMBODIMENT 34. 34. The formulation of any one of embodiments 1 to 33, wherein the formulation is mycoplasma-free.

[0207] EMBODIMENT 35. The formulation of any one of embodiments 1-34, wherein at least one antigen is a human papillomavirus (HPV) antigen.

[0208] EMBODIMENT 36. The formulation of embodiment 35, wherein the HPV is HPV-16 or HPV-18.

[0209] 37. The formulation of embodiment 35 or 36, wherein the antigen comprises a peptide derived from HPV E6 and / or HPV E7.

[0210] 38. The formulation of any one of embodiments 35-37, wherein the antigen comprises a peptide derived from HPV E6 and a peptide derived from HPV E7.

[0211] 39. The formulation of any one of embodiments 35-38, wherein the antigen comprises an amino acid sequence of any one of SEQ ID NOs: 1-4.

[0212] EMBODIMENT 40. The formulation of any one of embodiments 35 to 39, wherein the antigen comprises an amino acid sequence of any one of SEQ ID NOs: 18 to 25.

[0213] EMBODIMENT 41. The formulation of any one of embodiments 35 to 40, wherein the AAC comprises an antigen comprising the amino acid sequence of SEQ ID NO: 19 and an antigen comprising the amino acid sequence of SEQ ID NO: 23.

[0214] EMBODIMENT 42. The formulation of any one of embodiments 1-41, wherein the adjuvant is a CpG oligodeoxynucleotide (ODN), LPS, IFN-α, a STING agonist, a RIG-I agonist, poly I:C, R837, R848, a TLR3 agonist, a TLR4 agonist, or a TLR9 agonist.

[0215] EMBODIMENT 43. The formulation of embodiment 42, wherein the adjuvant is a CpG 7909 oligodeoxynucleotide (ODN).

[0216] EMBODIMENT 44. An AAC comprising at least one antigen and an adjuvant, a) passing a cell suspension containing input non-nucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input non-nucleated cells in the suspension, thereby causing a perturbation of the input non-nucleated cells sufficient to allow at least one of the antigen and the adjuvant to pass therethrough to form perturbed non-nucleated cells; The formulation of any one of embodiments 1-43, wherein the formulation is prepared by a process comprising: b) incubating the perturbed non-nuclear cells with at least one antigen and adjuvant for a time sufficient to allow the at least one antigen and adjuvant to enter the non-nuclear cells, thereby producing an AAC comprising the at least one antigen and adjuvant.

[0217] EMBODIMENT 45. 45. The method of embodiment 44, wherein the width of the constriction is from about 1.6 μm to about 2.4 μm or from about 1.8 μm to about 2.2 μm.

[0218] EMBODIMENT 46. 46. ​​The method of embodiment 44 or 45, wherein the input non-nucleated cells are red blood cells.

[0219] EMBODIMENT 47. A vial containing a pharmaceutical formulation according to any one of embodiments 1 to 46.

[0220] 48. A vial containing a pharmaceutical formulation, the pharmaceutical formulation being present in a cryopreservation medium at a concentration of about 1×10 9 AAC ~ approx. 1 x 10 10 a vial comprising an AAC, the AAC comprising at least one antigen and an adjuvant, the pH of the formulation being from about pH 6.0 to about pH 8.5.

[0221] 49. A vial containing a pharmaceutical formulation, the pharmaceutical formulation being present in a cryopreservation medium at a concentration of about 1×10 9 AAC ~ approx. 1 x 10 10a vial comprising an AAC, the AAC comprising at least one antigen and an adjuvant, wherein the pH of the formulation is about pH 7.6.

[0222] EMBODIMENT 50. The preparation contained approximately 7 × 10 9 50. The vial of embodiment 48 or 49, comprising an AAC.

[0223] EMBODIMENT 51. The formulation comprises a previously frozen AAC, the formulation having approximately 9×10 9 51. A vial according to any one of embodiments 48 to 50, comprising cells.

[0224] EMBODIMENT 52. The formulation is approximately 0.5 x 10 9 1 x 10 cells / mL of AAC 9 52. The vial of any one of embodiments 48 to 51, comprising: AAC in an amount of 100 / mL.

[0225] EMBODIMENT 53. The formulation is approximately 0.7 x 10 9 53. The vial of any one of embodiments 48 to 52, comprising 100 / mL of AAC.

[0226] EMBODIMENT 54. The formulation had a total concentration of approximately 0.7 × 10 9 54. A vial according to any one of embodiments 48 to 53, comprising 100 / mL of AAC.

[0227] EMBODIMENT 55. The formulation comprises a previously frozen AAC, the formulation having a concentration of about 1×10 9 55. A vial according to any one of embodiments 48 to 54, comprising 100 / mL of AAC.

[0228] EMBODIMENT 56. A vial containing a pharmaceutical formulation, the pharmaceutical formulation being present in a volume of about 7×10 9The AAC comprises at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6.

[0229] EMBODIMENT 57. The vial of any one of embodiments 48-56 or 39, wherein the AAC is present in about 9.5 mL of cryopreservation medium.

[0230] EMBODIMENT 58. A vial containing a pharmaceutical formulation, the pharmaceutical formulation being present in a volume of about 7×10 9 The AAC comprises at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6.

[0231] EMBODIMENT 59. The vial according to any one of embodiments 47 to 58, wherein the formulation is sterile.

[0232] 60. A method for making a pharmaceutical formulation of an AAC, the method comprising adding a cryopreservation medium to the AAC, the AAC comprising at least one antigen and an adjuvant.

[0233] 61. 1. A method of making a pharmaceutical formulation of an AAC, the AAC comprising at least one antigen and an adjuvant, the method comprising: a) passing a cell suspension containing input non-nucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input non-nucleated cells in the suspension, thereby causing a perturbation of the input non-nucleated cells sufficient to allow at least one of the antigen and the adjuvant to pass therethrough to form perturbed non-nucleated cells; b) incubating the perturbed non-nuclear cells with at least one antigen and an adjuvant for a period of time sufficient to allow the at least one antigen and the adjuvant to enter the non-nuclear cells, thereby producing an AAC comprising the at least one antigen and the adjuvant; c) washing the AAC; and d) formulating the AAC in a cryopreservation medium.

[0234] 62. 62. The method of embodiment 61, wherein the width of the constriction is from about 1.6 μm to about 2.4 μm, or from about 1.8 μm to about 2.2 μm.

[0235] 63. The method of embodiment 61 or 62, wherein the AAC is washed about 6 times.

[0236] 64. The method of any one of embodiments 61 to 63, wherein the AAC is washed by centrifugation and resuspension, or by centrifugation and filtration.

[0237] 65. 65. The method of embodiment 64, wherein the centrifugation is at about 4000 rpm.

[0238] 66. Approximately 1×10 9 AAC ~ approx. 1 x 10 10 The method of any one of embodiments 61-65, wherein the AAC is formulated in about 9 mL to about 10 mL of cryopreservation medium.

[0239] 67. The pharmaceutical preparation was diluted to approximately 7×10 9 67. The method of embodiment 66, comprising AACs.

[0240] 68. The formulation comprises a previously frozen AAC, the formulation having approximately 9×10 9 68. The method of any one of embodiments 66 or 67, comprising cells.

[0241] 69. The formulation is approximately 0.5 x 10 9 1 x 10 cells / mL of AAC 9The method of any one of embodiments 66 to 68, comprising:

[0242] EMBODIMENT 70. The formulation is approximately 0.7 x 10 9 The method of any one of embodiments 66 to 69, comprising:

[0243] EMBODIMENT 71. The formulation had a total concentration of approximately 0.7 × 10 9 The method of any one of embodiments 66 to 70, comprising:

[0244] EMBODIMENT 72. The formulation contains a previously frozen AAC, which upon thawing contains approximately 1×10 9 The method of any one of embodiments 66 to 71, comprising:

[0245] Embodiment 73. Approximately 7 x 10 9 The method of any one of embodiments 66-72, wherein the AAC is formulated in about 10 mL of cryopreservation medium.

[0246] 74. The method of any one of embodiments 66 to 73, wherein the cryopreservation medium is CryoStor® CS2.

[0247] 75. 75. The method of any one of embodiments 61-74, wherein the input non-nucleated cells are red blood cells.

[0248] 75. The method according to any one of embodiments 60 to 75, wherein the method further comprises freezing the formulation of AAC at about -170°C.

[0249] 76. The formulation of AAC is a) placing the formulation in a chamber; b) reducing the temperature of the chamber to approximately -3°C; c) decreasing the temperature of the chamber to about -140°C at a rate of about -20°C / min; d) decreasing the temperature of the chamber to about -150°C at a rate of about 1.5°C / min; e) decreasing the temperature of the chamber to about -170°C at a rate of about 1.0°C / min; f) maintaining the temperature of the chamber at about -170°C for at least about 10 minutes. EXAMPLES

[0250] Those skilled in the art will recognize that some embodiments are possible within the scope and spirit of the present invention. The present invention will now be described in more detail with reference to the following non-limiting examples. The following examples further illustrate the present invention but, of course, should not be construed as in any way limiting its scope.

[0251] Example 1 Development of AAC-HPV For the development of the AAC-HPV drug substance manufacturing process, process development studies were performed using whole blood collected from healthy donors and shipped to the manufacturer overnight under refrigerated conditions (2–8 °C). Whole Blood Dilution

[0252] Upon receipt of blood bags at the manufacturing lab, starting material information was verified against manufacturing batch records. Samples were aseptically collected from the blood bags and complete blood count (CBC) measurements were obtained via a hematology analyzer for information only. Also, RBC counts were obtained using a Coulter-based cell counter. The provisional criteria for total RBC count was ≥ 5 × 10 11 of total RBCs.

[0253] After sample collection, the starting whole blood was diluted with RPMI + 5% DMSO (dilution media) to reduce the cell concentration for processing in the LOVO Cell Wash System. The dilution media contains 5% DMSO and is similar to the media required for dissolution of SLPs and adjuvants used in the delivery process downstream of this unit operation.

[0254] Whole blood dilution ratio before LOVO cell washing An evaluation of whole blood dilution ratios was performed. For the purpose of this evaluation, whole blood collected from several healthy donors was diluted with dilution media at different ratios and processed on the LOVO. The LOVO parameters recommended by the equipment vendor (Fresenius Kabi) for platelet removal were used for this evaluation. After cell washing, the collected product was evaluated for cell counts and the graded recovery of RBCs was calculated. The RBC recovery results from the different whole blood dilution ratio evaluations are shown in Table 1. The measurements shown were obtained from either a Coulter-based cell counter or a complete blood count using a hematology analyzer. [Table 1]

[0255] As shown in Table 1, dilution ratios from 1:3 to 1:9 all show similar RBC recovery rates across the LOVO process. In the SQZ-AAC-HPV process, the expected amount of patient starting material (whole blood with anticoagulant) was 260-270 mL, and the volume of dilution medium was set to 1 L to simplify the manufacturing process. The final parameters of the whole blood dilution step are shown in Table 2. After whole blood dilution, the intermediate product is gravity filtered through a sterile single-use 40 μm blood filter to remove all potential cell aggregates. [Table 2] a Approximately an additional 60-70 mL of anticoagulant is added to the patient's starting material, for a total expected volume of 260-270 mL.

[0256] RBC purification and peptide + adjuvant introduction Samples were aseptically collected from the diluted blood bag and RBCs were counted. The diluted blood was then processed with the LOVO Cell Wash System, and cells were washed with a sterile filtered mixture of 1.5 mg / mL Poly I:C in RPMI 1640 media with 50 μM E6 SLP, 250 μM E7 SLP and 5% DMSO (referred to as the delivery medium) to remove platelets. After platelet removal, cells were resuspended in the delivery medium using the LOVO system. Following resuspension in the delivery medium, the in-process material was aseptically processed through a leukocyte reduction filter that removes white blood cells, resulting in a purified RBC suspension in the delivery medium. The purified cell suspension was then evaluated for RBC count and complete blood count (FIO) capturing WBCs and platelets. All processing was performed at ambient conditions.

[0257] RBC purification - platelet depletion and peptide + adjuvant introduction Following dilution of the whole blood, RBCs were washed and resuspended with delivery medium using the LOVO system under ambient conditions. The LOVO system utilizes a single-use LOVO kit consisting of a 4 μm spinning membrane, allowing for removal of platelets while maximizing recovery of RBCs. Using variable inlet and outlet flow rates, the LOVO system allows for washing and enrichment of cells. The processing parameters used to wash and resuspend RBCs with delivery medium in the LOVO system were provided by the instrument vendor (Fresenius Kabi). The recommended parameters provided by the vendor were evaluated during development activities.

[0258] An evaluation of platelet removal and RBC recovery was performed across the LOVO process from seven different healthy donors. The unit operation demonstrated an average RBC recovery of 89.12 ± 5.75% and an average platelet removal of 74.56 ± 10.52%, as shown in Figure 1. LOVO processing parameters for platelet removal are provided in Table 3. [Table 3]

[0259] RBC purification - Leukocyte removal (WBC removal) After washing of the RBCs and resuspension in the delivery medium, the intermediate product is filtered through a sterile, single-use, leukoreduction filtration assembly at ambient conditions. The filtration assembly consists of a leukoreduction filter (LRF), a 40 μm blood filter, and an 18 μm blood filter assembled in series. The leukoreduction filtration assembly allows for the removal of WBCs and any potential cellular aggregates. The leukoreduction filter has also been noted to remove platelets in a non-specific manner. Initial test runs with the leukoreduction filtration process attempted to leukoreduce incoming donor whole blood prior to other handling, but filtration times were observed to be prohibitively long. Ultimately, after the first RBC purifications were performed on the LOVO, a leukoreduction process was determined to be most suitable, reducing filtration times to <5 minutes.

[0260] Figure 2 shows the average overall recovery of RBCs, platelets, and WBCs for n=11 runs across the RBC purification steps, including cell washing and resuspension in delivery medium on the LOVO and purification through a leukoreduction filter. The data demonstrate adequate RBC purification in preparation for peptide and adjuvant delivery in subsequent processing steps.

[0261] Peptide (E6 and E7 SLPs) and adjuvant (Poly I:C) delivery A microfluidic chip with a 2.2 μm constriction was used for the development of the RBC delivery process. The microfluidic chip was selected to align with the chip constriction width used during preclinical trials. It is noted that the small number of residual WBCs left in the production process during the manufacturing of AAC-HPV prior to the delivery step (see Figure 2) do not clog the chip.

[0262] Preliminary studies to identify appropriate delivery parameters were performed using fluorescently labeled Ovalbumin (Ovalbumin 647) as a surrogate delivery material. Once the initial design space was established, validation studies were performed using fluorescently labeled E6 and E7 SLPs (FAM-E6 and FAM-E7). Poly I:C was also used as a delivery material, but fluorescently labeled Poly I:C was not available and was therefore not measured in these studies. E6 SLP: QLCTELQTTIHDIILECVYCKQQLL (SEQ ID NO: 19) E7 SLP: QLCTELQTYMLDLQPETTYCKQQLL (SEQ ID NO: 23)

[0263] Preliminary delivery evaluation with Ovalbumin 647 Target operating temperature 2-8°C based on preclinical scale delivery studies. RBC delivery with Ovalbumin 647 was analyzed using flow cytometry to measure cell delivery of Ovalbumin 647 and Annexin V+ phenotype (measurement of phosphatidylserine on the outer leaflet of the membrane) for each trial.

[0264] Pressure evaluation and microfluidic chip construction A study of operating pressures and microfluidic chip configurations was conducted to evaluate Ovalbumin 647 delivery and Annexin V positivity utilizing different numbers of 2.2 μm retracted chips arranged in parallel at different operating pressures. In this study, three separate chip configurations of the same chip type (single chip, two chips in parallel, four chips in parallel) and operating pressures (60 psi, 75 psi) were evaluated.

[0265] Figure 3 shows an increase in the Annexin V+ population in the test group performed at an operating pressure of 75 psi compared to the test group performed at an operating pressure of 60 psi. Furthermore, the population delivered with Ovalbumin 647 at an operating pressure of 75 psi showed the most consistent results (>90% delivery) across all three chip configurations tested. As a result of this evaluation, an operating pressure of 75 psi and four chip configurations were selected to maximize intracellular delivery and throughput of the delivery process.

[0266] Cell concentration assessment Due to the variation in the incoming red blood cell count from each donor, various cell concentrations are expected for the peptide and adjuvant delivery process. Evaluation of various cell concentrations was performed. Various concentrations of red blood cells were treated with Ovalbumin 647 as the delivery material through four chips in parallel at an operating pressure of 75 psi and analyzed for delivery.

[0267] The results in Figure 4 show that delivery using the previously selected operating parameters was 0.5 x 10 9 ~4.0×10 9 The results show that the cell concentration is consistent across a range of RBC concentrations from 0.1 to 1.0 cells / mL. As a result of this evaluation, an operating range for RBC delivery with SLPs and adjuvants was established for the cell concentrations tested. Cell concentrations in the manufacturing process for SQZ-AAC-HPV are expected to fall within the range tested.

[0268] Delivery assessment using labeled peptides (FAM-E6 and FAM-E7 SLPs) and poly I:C content After preliminary studies using Ovalbumin 647, validation studies were performed using FAM-labeled E6 and E7 SLPs and unlabeled Poly I:C. Studies were performed using the following delivery parameters: 4x tip configuration, 75 psi, 2-8 °C.

[0269] FIG. 5 shows that the % of the population delivered by FAM-E6 SLPs and FAM-E7 SLPs was >88% and >96%, respectively.

[0270] Reduced operating pressure for peptide (E6 and E7 SLP) and adjuvant (Poly I:C) delivery Two studies were performed using the same donor whole blood delivered at 70 psi with FAM-labeled E7 peptide, along with a 75 psi control for comparison of delivery, and the results are shown in FIG.

[0271] The results of these experiments demonstrated that a lower operating pressure of 70 psi resulted in equivalent FAM-E7 delivery as an operating pressure of 75 psi. As a result of this evaluation, the target operating pressure for peptide and adjuvant delivery was changed to 70 psi.

[0272] The final delivery parameters selected are shown in Table 4. [Table 4]

[0273] After development of the delivery process parameters was completed, Poly I:C content was measured from the SQZ-AAC-HPV drug product vials. Results for a representative batch are shown in Table 5. [Table 5]

[0274] Product standing (37℃ incubation) Following the 30 minute ambient rest step of the peptide and adjuvant delivery process, the AAC is diluted and then placed on a rocker in an incubator at 37° C. for an additional 2 hours of rest. Evaluations of rest time and pre-test dilution volume were performed to determine these parameters.

[0275] Studies compared settling times of 1 hour and 2 hours, and compared settling of diluted AAC (diluted in RPMI media) and undiluted AAC. These studies measured the incremental recovery over the settling period and the % of AAC population in the final drug product. Results of these evaluations showed improved recovery when the AAC was settling for 2 hours compared to a 1 hour settling period.

[0276] Additional evaluations were performed using diluted and undiluted AAC product set. The functional response of each drug from each test condition was evaluated.

[0277] The data reported in Figure 7 show significantly higher secreted IFN-γ levels when the diluted AAC is allowed to stand compared to undiluted AAC allowed to stand in the process. Based on this evaluation, a 1 L dilution of the delivered AAC was performed in the manufacturing process prior to standing at 37°C.

[0278] The average AAC recovery over the product settling step across n=15 studies was analyzed to be 93.6%. This data demonstrates that with the parameters evaluated and implemented for incubation, high AAC recovery is achieved (Table 6). [Table 6]

[0279] AAC-HPV Drug Substance Quantity for Clinical Manufacturing Due to continuous processing, a minimal in-process hold time for the AAC-HPV drug substance is desired. To enable this, samples are taken from the in-process AAC prior to the product settling step. During the 2-hour settling, samples are analyzed and the measured counts are used to calculate the total AAC in the final AAC-HPV drug substance with a correction factor of 0.9. The correction factor of 0.9 was established to account for the average incubation step recovery of 93.7% (rounded to 90%) observed during development.

[0280] After settling, the delivered AAC is gravity filtered through a sterile single-use 40 μm blood filter. After 40 μm filtration, the drug substance is washed and exchanged into the final formulation vehicle using LOVO.

[0281] Whole blood retention time Whole blood hold time is defined as the time from the end of whole blood collection (i.e., end of patient blood draw) to the start of whole blood dilution (start of production). Initial evaluation of whole blood hold time was performed at 36 and 50 hour hold times at 2-8°C. Testing consisted of splitting one healthy donor blood unit and using half to produce SQZ-AAC-HPV after 1 day hold (approximately 24 hours) as a control group, and the other half to produce SQZ-AAC-HPV drug product after 36 or 50 hours hold. The resulting SQZ-AAC-HPV drug product was analyzed for functional response. Products made from aged whole blood using either hold time (36 or 50 hours) elicit functional responses within assay and process variability similar to the control (24 hours). As a conservative approach, 36 hours was performed as the whole blood hold time for patient starting material. This hold time may be extended as more data is generated supporting longer hold times.

[0282] Example 2 Pharmaceutical Formulations The formulation SQZ-AAC-HPV was 7.0 × 10 8 Targeting a concentration of AAC of 0.01 cells / mL (as analyzed using a Coulter-based cell counter (Moxi GO II)), taking into account AAC losses during the formulation process, the AAC-HPV drug substance is prepared by formulating and filling vials in a CryoStor® CS2. The vials are stored frozen using a rate-controlled refrigerator with a chamber temperature of ≦−170° C., such that the vials reach and maintain a temperature of ≦−140° C. during manufacture, storage, and shipping.

[0283] AAC recovery after thawing confirms that this cryopreservation medium is suitable for SQZ-AAC-HPV drug products.

[0284] The following evaluations are performed to develop the drug formulation process:

[0285] Validation of LOVO system parameters for pharmaceutical formulations The initial LOVO protocol (Protocol 1) was developed with guidance from the equipment vendor (Fresenius Kabi). The goal of this protocol was to achieve a high theoretical washout (i.e., buffer exchange) for the process of 99.97%. This was made possible by creating a maximum outlet packed cell volume (outlet PCV) given by the following equation: Outlet PCV = (Inlet flow rate ÷ Outlet flow rate) x Inlet PCV.

[0286] The parameters for LOVO Protocol 1 are listed in Table 7 below. [Table 7]

[0287] After evaluating protocol 1 in n=13 experiments with material from 8 donors, the average stepwise recovery observed was 42.4%, as shown in Figure 8. The low recovery observed in the formulation step significantly impacted the manufacturing process yield. As a result of the low recovery, a second LOVO protocol was evaluated with the goal of increasing the manufacturing process yield.

[0288] In protocol 2, LOVO processing parameters were adjusted to target a lower maximum outlet PCV of 36% for all six wash cycles, improving recovery while maintaining a high theoretical washout of 99.96%. Parameters for LOVO protocol 2 can be found in Table 8 below. The protocol was performed on n=10 experiments with material from eight different donors, and as shown in Figure 8, the average AAC recovery increased to 74.5%. Due to the improved recovery, protocol 2 was selected for use in clinical manufacturing of SQZ-AAC-HPV. [Table 8]

[0289] The LOVO processing parameters were established as shown in Table 8 and used during the full-scale process development study, with the results shown in Figure 9. These results indicate a 7 x 10 8 We demonstrate that a target concentration of AAC of 100 / mL is achievable with these LOVO parameters.

[0290] Filling, inspecting and labeling vials Vials are filled in a biosafety cabinet. Vials are supplied sterile, fully stoppered, and ready to use. For filling, each vial is filled with 9.98g ± 5% product (i.e., 9.5 mL, which allows for an extractable volume of 8.9 mL). After filling, each vial is sealed, weighed, and then capped. Once vial filling is complete, an inspection booth with a lighted black and white background is used to visually inspect each filled vial for visible defects (including large clumps or aggregates). Each vial is then given a cold storage label.

[0291] A process performance capability (Ppk) assessment was performed on the filling process. The minimum filling Ppk achieved across the technology transfer batches was 4.66, indicating that the filling process was robust and in control. The results of this analysis are shown in Table 9. [Table 9] 1 Ppk = minimum of: (USL-Mean) / 3 * σ) or (Mean-LSL) / (3 * σ) 2 The total number of vials filled was 62, with 1 vial rejected due to visible particles.

[0292] Cryopreservation and storage Secondary storage boxes containing labeled SQZ-AAC-HPV vials are loaded into racks in a rate controlled refrigerator and then cryopreserved at a product temperature of 140°C or less. After cryopreservation, the vials are delivered to QC for release, characterization, stability testing, and placed in isothermal LN2 tanks for long-term storage. The remaining cryopreserved vials are stored in labeled secondary storage boxes and placed in isothermal LN2 tanks for long-term storage.

[0293] A CryoMed® controlled rate refrigerator with a 34L chamber volume and a custom cryopreservation protocol was used to cryopreserve the SQZ-AAC-HPV drug product. The custom freezing profile is designed to control the latent heat released during nucleation of the formulation. Ice nucleation in the formulation begins at approximately -5°C. To control the latent heat released during nucleation of the formulation, rapid cooling of the chamber must begin before the product temperature reaches the nucleation point (-5°C). During cryopreservation of SQZ-AAC-HPV, the chamber temperature is rapidly cooled to -140°C at a cooling rate of -20°C / min after the product temperature reaches -3°C, just above the nucleation point (-5°C). The product is then cooled to -150°C at a cooling rate of -1.5°C / min. Once the product temperature reaches -150°C, the chamber is cooled to -170°C at a cooling rate of -1°C / min and then held at -170°C for 10 minutes. A maximum chamber load of 64 vials was set for cryopreservation of SQZ-AAC-HPV, and one of the vials was used for product temperature observation. Details of the cryopreservation protocol are shown in Table 10. The chamber and product temperature profiles resulting from the cryopreservation protocol are shown in Figures 10 and 11. [Table 10]

[0294] Figure 10 shows a representative load of 48 vials of SQZ-AAC-HPV cryopreserved using the developed protocol. As shown in the product temperature trace above, SQZ-AAC-HPV cryopreserved at different locations within the cryochamber nucleate in similar times and reach final product temperatures below -140°C before cycle completion. The total cryopreservation cycle time for the representative chamber load is approximately 100 minutes.

[0295] Figure 11 shows a maximum load of 64 vials of SQZ-AAC-HPV cryopreserved using the two rack configurations. As shown in Figures 10 and 11, SQZ-AAC-HPV placed in both racks at different positions within the cryochamber nucleate in similar times and reach a final product temperature of -140°C or below before cycle completion. The total cryopreservation cycle time for the maximum chamber load is approximately 95 minutes.

[0296] Based on the temperature profiles from both chamber loads, we show that the developed protocol can achieve a consistent profile across all vial loads up to 64 vials.

[0297] AAC recovery after thawing To assess AAC stability and recovery after cryopreservation, formulations are thawed and tested for AAC counts using flow cytometry. Of note, in contrast to Coulter-based counting, an increase in AAC concentration was observed after thawing using flow cytometry analysis, resulting in higher AAC content per vial at release compared to the in-process data. A Coulter-based cell counter, the Moxi GO II, is used to count in-process AAC samples. In contrast, a flow cytometry method is used to identify and count AAC (CD235a+Annexin V+) during QC release of SQZ-AAC-HPV drug product. In-process AAC sample analysis using the less sensitive Moxi GO II counter has a negative bias relative to measurements of corresponding post-thaw measurements of SQZ-AAC-HPV using the flow cytometry method.

[0298] The targeted concentration during the final formulation step is 7.0 x 10 8 The AAC was 7.36 x 10 counts / mL for n=5 process development batches using Moxi GO II. 8 The AAC was 100 / mL (see FIG. 9).

[0299] The data shown in Figure 12 represents post-thaw counts from n=5 process development batches. The average AAC count for these five batches was 1.03x10 9 The AAC recovery through freeze-thaw cycles in Cryostor® CS2 excipient was greater than the expected post-thaw target concentration of 1.0x10 9 Post-thaw counts are consistent with these results (Table 11). [Table 11] a Overall process recovery = 100% x (vial filled x post-thaw AAC count x 9.5 mL) / whole blood starting RBC count. b Measured using a blood analyzer. c Measured by flow cytometry

[0300] Based on the average process recovery from whole blood to drug product (61.8%), the provisional minimum RBC in whole blood was 5.0 × 10 11 Total cells were collected from 32 vials of SQZ-AAC-HPV (5.0 × 10 in whole blood). 11 RBC x 61.8% mean process recovery / 9.5 x 10 9 It is estimated that this will result in a target AAC / drug vial. [Table 12-1] [Table 12-2] [Table 12-3]

Claims

1. 1. A pharmaceutical formulation comprising an activating antigen carrier (AAC), the formulation comprising: a) an AAC comprising at least one antigen and an adjuvant; b) a cryopreservation medium.

2. The formulation comprises: (a) Approximately 0.5 × 10 ９ AAC ~ about 1 x 10 １０ Including AACs, (b) containing about 7×10 9 AACs; (c) containing approximately 7×10 9 AACs prior to freezing; (d) comprising previously frozen AACs, said formulation comprising about 9×10 9 AACs upon thawing; (e) comprising about 0.5×10 9 cells / mL to about 1×10 9 cells / mL of AAC; (f) containing about 0.7×10 9 AAC / mL; (g) containing about 0.7×10 9 AAC / mL before freezing; (h) comprising previously frozen AACs, the formulation comprising, upon thawing, about 1×10 9 AACs / mL; and / or (i) comprising about 1 x 10 8 functional AACs / mL to about 1 x 10 9 functional AACs / mL; 2. The pharmaceutical formulation of claim 1.

3. The pharmaceutical formulation of claim 1 or 2, wherein (a) at least about 70%, 80%, 90%, or 95% of the AAC of the population of AAC are functional, and / or (b) the AAC in the formulation maintains greater than about 70% functionality.

4. The pharmaceutical formulation of any one of claims 1 to 3, wherein (a) at least about 70%, 80%, 90%, or 95% of the AAC in the population of AAC are positive for annexin staining, and / or (b) the AAC in the formulation remain positive for annexin staining at about 70% or more, and optionally, the annexin is annexin V.

5. 5. The pharmaceutical formulation of any one of claims 1 to 4, wherein the cryopreservation medium comprises: (a) dimethylsulfoxide (DMSO), optionally about 0.5% to about 5% DMSO or about 2% DMSO, and / or (b) CryoStor® CS2.

6. The pharmaceutical formulation of any one of claims 1 to 5, wherein the pH of the formulation is from about 6.0 to about 8.5 or about 7.

6.

7. A pharmaceutical formulation of AAC, the formulation comprising about 0.5×10 ９ AAC ~ about 1 x 10 １０ 1. A pharmaceutical formulation comprising an AAC, the AAC comprising at least one antigen and an adjuvant, wherein the pH of the formulation is from about pH 6.0 to about pH 8.5 or about 7.

6.

8. The formulation comprises: (a) Approximately 7 × 10 before freezing ９ Including AACs, (b) comprising previously frozen AAC, said preparation comprising approximately 9×10 9 cells upon thawing; (c) comprising about 0.5×10 9 cells / mL to about 1×10 9 cells / mL of AAC; (d) containing about 0.7×10 9 AAC / mL; (e) containing about 0.7×10 9 AAC / mL before freezing; (f) comprising previously frozen AACs, said formulation comprising about 1×10 9 AACs / mL upon thawing; and / or (g) about 7×10 9 AAC in about 9.5 mL of cryopreservation medium, the AAC comprising at least one antigen and an adjuvant, and the pH of the formulation is about pH 7.6; The pharmaceutical formulation according to claim 7.

9. 9. The pharmaceutical preparation of claim 7 or 8, wherein the cryopreservation medium is CryoStor® CS2.

10. The formulation comprises: (a) being sterile; (b) containing less than about 2 EU / mL endotoxin; and / or (c) is mycoplasma-free; The pharmaceutical formulation according to any one of claims 1 to 9.

11. The adjuvant is (a) a CpG oligodeoxynucleotide (ODN), LPS, IFN-α, a STING agonist, a RIG-I agonist, poly I:C, R837, R848, a TLR3 agonist, a TLR4 agonist, or a TLR9 agonist, and / or (b) CpG 7909 oligodeoxynucleotide (ODN) The formulation according to any one of claims 1 to 10,

12. The AAC comprising the at least one antigen and an adjuvant, a) passing a cell suspension comprising input non-nucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input non-nucleated cells in the suspension, thereby causing a perturbation of the input non-nucleated cells sufficient to allow the at least one antigen and the adjuvant to pass therethrough to form perturbed non-nucleated cells; 12. The formulation of any one of claims 1 to 11, wherein the formulation is prepared by a process comprising: b) incubating the perturbed non-nuclear cells with the at least one antigen and the adjuvant for a time sufficient to allow the at least one antigen and the adjuvant to enter the non-nuclear cells, thereby producing the AAC comprising the at least one antigen and the adjuvant.

13. The method of claim 12, wherein the diameter of the constriction is from about 1.6 μm to about 2.4 μm, or from about 1.8 μm to about 2.2 μm.

14. 13. The method of claim 11 or 12, wherein the input non-nucleated cells are red blood cells.

15. A vial containing a pharmaceutical formulation according to any one of claims 1 to 14.

16. A vial containing a pharmaceutical formulation, the pharmaceutical formulation being present in a cryopreservation medium at a concentration of about 1×10 ９ AAC ~ about 1 x 10 １０ a vial comprising an AAC, the AAC comprising at least one antigen and an adjuvant, the pH of said formulation being from about pH 6.0 to about pH 8.5 or about pH 7.

6.

17. The formulation comprises: (a) Approximately 7 × 10 before freezing ９ Including AACs, (b) comprising previously frozen AAC, said preparation comprising approximately 9×10 9 cells upon thawing; (c) comprising about 0.5×10 9 cells / mL to about 1×10 9 cells / mL of AAC; (d) containing about 0.7×10 9 AAC / mL; (e) containing about 0.7×10 9 AAC / mL prior to freezing; and / or (f) comprising previously frozen AAC, the formulation comprising about 1×10 9 AAC / mL upon thawing; 17. The vial of claim 16.

18. A vial containing a pharmaceutical formulation, the pharmaceutical formulation being present in a volume of about 7×10 in about 9.5 mL of cryopreservation medium. ９ a vial comprising an AAC, the AAC comprising at least one antigen and an adjuvant, the pH of said formulation being about pH 7.

6.

19. A method of making a pharmaceutical formulation of an AAC, the method comprising adding a cryopreservation medium to the AAC, the AAC comprising at least one antigen and an adjuvant.

20. 1. A method of making a pharmaceutical formulation of an AAC, the AAC comprising at least one antigen and an adjuvant, the method comprising: a) passing a cell suspension containing input non-nucleated cells through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input non-nucleated cells in the suspension; thereby causing a perturbation of the input anucleated cells sufficient to allow passage of the at least one antigen and the adjuvant to form perturbed anucleated cells; b) incubating the perturbed non-nuclear cells with the at least one antigen and the adjuvant for a time sufficient to allow the at least one antigen and the adjuvant to enter the non-nuclear cells, thereby producing the AAC comprising the at least one antigen and the adjuvant; c) washing the AAC; and d) formulating the AAC in a cryopreservation medium.

21. 21. The method of claim 20, wherein the diameter of the constriction is from about 1.6 μm to about 2.4 μm, or from about 1.8 μm to about 2.2 μm.

22. 22. The method of claim 20 or 21, wherein the AAC is (a) washed about six times, and / or (b) washed by centrifugation and resuspension, or by centrifugation and filtration, optionally wherein the centrifugation is at about 4000 rpm. Claim 23: (a) Approximately 1×10 ９ AAC ~ about 1 x 10 １０ AAC are formulated in about 9 mL to about 10 mL of the cryopreservation medium, or about 7×10 AAC are formulated in about 10 mL of the cryopreservation medium. (b) the pharmaceutical formulation comprises about 7×10 9 AACs prior to freezing; (c) the pharmaceutical formulation comprises previously frozen AAC, the formulation comprising approximately 9×10 9 cells upon thawing; (d) the pharmaceutical formulation comprises from about 0.5×10 9 cells / mL of AAC to about 1×10 9 cells / mL of AAC; (e) the pharmaceutical preparation comprises about 0.7×10 9 AAC / mL; (f) the pharmaceutical formulation comprises about 0.7×10 9 AAC / mL prior to freezing; and / or (g) the pharmaceutical formulation comprises previously frozen AAC, the formulation containing about 1×10 9 AAC / mL upon thawing; 23. The method according to any one of claims 20 to 22.

24. 24. The method of claim 23, wherein the cryopreservation medium is CryoStor® CS2.

25. The method of any one of claims 20 to 24, wherein the input non-nucleated cells are red blood cells.

26. 26. The method of any one of claims 19 to 25, wherein the method further comprises freezing the formulation of AAC at about -170°C.

27. The formulation of AAC comprises: a) placing said formulation in a chamber; b) reducing the temperature of the chamber to about -3°C; c) decreasing the temperature of the chamber to about −140° C. at a rate of about −20° C. / min; d) decreasing the temperature of the chamber to about -150°C at a rate of about -1.5°C / min; e) decreasing the temperature of the chamber to about −170° C. at a rate of about −1.0° C. / min; f) holding the temperature of the chamber at about -170°C for at least about 10 minutes.