Non-uis-identity-mediated end-binding

Abstract

Provided herein are compositions and methods for inserting cassettes into designated genomic loci to produce engineered cells, such as T cells, using non-viral gene editing techniques. Methods of using the engineered cells to treat or prevent disease in a subject are also provided. TIFF2024513967000012.tif101153

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 174,468, filed April 13, 2021, the entirety of which is incorporated by reference herein for all purposes. [Background technology]

[0002] Background of the disclosure The application of clustered, regularly interspaced short palindromic repeats (CRISPR) proteins and CRISPR-associated (Cas) proteins has revolutionized molecular biology by enabling genome editing. CRISPR-mediated gene editing is a powerful and potentially practical tool that has the potential to generate new scientific tools, correct clinically relevant mutations, and develop new cell-based immunotherapies. Viral delivery vectors and electroporation have emerged as two strategies for CRISPR-based editing in immune cells. However, the field of gene therapy is fraught with complexity with viral delivery vectors.

[0003] It provides immune engineering with both a scientific tool and a potential therapeutic tool to allow the manipulation of T cells, hematopoietic stem cells, and induced pluripotent stem cells. Until the discovery of CRISPR-Cas gene editing in human cells, gene therapy targeting the immune system relied almost exclusively on viral vectors such as retroviruses and lentiviruses to insert transgenes by (semi-)random integration of genes. However, in clinical trials, insertion into protooncogenes and lethal systemic immune responses to viral vectors led to unexpected outcomes such as leukemia. Despite improvements in viral vectors to minimize genetic damage and immune responses, viral insertions (such as lentiviruses used clinically to generate CAR-T cells) can cause overexpression of genes, e.g., overexpression of genes that are not endogenously regulated, limiting the clinical utility of this method.

[0004] Non-viral CRISPR-Cas gene editing has been described. However, the editing efficiency and / or survival rate using such systems are generally low. For example, using current methods, the editing efficiency is increased at the expense of reduced cell survival rate, and vice versa. There is a need for improved non-viral CRISPR-Cas gene editing methods, such as methods with improved editing efficiency and survival rate. Summary of the Invention

[0005] overview Provided herein is a composition for modifying a target nucleic acid, the composition comprising: (a) a targetable nuclease protein; and (b) a plasmid donor template comprising: (i) a homology directed repair (HDR) template, (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template, and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein each of the first CDL target sequence and the second CDL target sequence is cleavable by the targetable nuclease protein or a complex comprising the targetable nuclease protein, and the composition is formulated for non-viral delivery to a cell.

[0006] Also provided herein is a composition for modifying a target nucleic acid, the composition comprising: (a) a CRISPR-Cas RNA-guided nuclease; (b) a donor guide RNA (gRNA); and (c) a plasmid donor template comprising: (i) a homology-directed repair (HDR) template; (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template; and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein (1) the donor gRNA comprises at least 17 nucleotides complementary to each of the first CDL target sequence and the second CDL target sequence; and (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a three base pair protospacer adjacent motif (PAM) located 3' of the CDL target sequence; and the composition is formulated for non-viral delivery to a cell.

[0007] Provided herein is a method for modifying a target nucleic acid of a cell, the method comprising providing a cell and introducing or having introduced into the cell a composition formulated for non-viral delivery, the composition comprising (a) a targetable nuclease protein; and (b) a plasmid donor template comprising (i) a homology directed repair (HDR) template, (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template, and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein each of the first CDL target sequence and the second CDL target sequence is cleavable by the targetable nuclease protein or a complex comprising the targetable nuclease protein.

[0008] Also provided herein is a method for modifying a target nucleic acid of a cell, the method comprising providing a cell and introducing or having introduced into the cell a composition formulated for non-viral delivery, the composition comprising: (a) a CRISPR-Cas RNA-guided nuclease; (b) a donor guide RNA (gRNA); and (c) a plasmid donor template comprising: (i) a homology directed repair (HDR) template; (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template; and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein (1) the donor gRNA comprises at least 17 nucleotides complementary to each of the first CDL target sequence and the second CDL target sequence; and (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a three base pair protospacer adjacent motif (PAM) located 3' of the CDL target sequence.

[0009] Also provided herein is a method for modifying a genomic target sequence in a cell, the method comprising providing a cell and introducing or having introduced into the cell a composition formulated for non-viral delivery, the composition comprising: (a) a CRISPR-Cas RNA-guided nuclease; (b) a donor guide RNA (gRNA); and (c) a plasmid donor template comprising: (i) a homology directed repair (HDR) template comprising a nucleic acid for insertion flanked by homology arms; (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template; and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein (1) the donor gRNA comprises at least one complementary sequence to each of the first CDL target sequence and the second CDL target sequence. and (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a three base pair protospacer adjacent motif (PAM) located 3' to the CDL target sequence, the donor gRNA comprises at least 17 nucleotides that are complementary to a genomic target sequence of the cell, the homology arms are complementary to nucleic acid sequences that flank the genomic target sequence of the cell, and the nucleic acid for insertion is configured to be inserted into the genomic target sequence of the cell.

[0010] In some embodiments, the targetable nuclease protein is an RNA-guided nuclease. In some embodiments, the composition further comprises an RNA that comprises at least 17 nucleotides that are complementary to the CDL target sequence. In some embodiments, the RNA-guided nuclease is a Cas protein.

[0011] In some embodiments, the composition further comprises a donor guide RNA (gRNA) configured to form a complex with the targetable nuclease protein, wherein (1) the donor gRNA comprises at least 17 nucleotides complementary to each of a first CDL target sequence and a second CDL target sequence, and (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a three base pair protospacer adjacent motif (PAM) located 3' to the CDL target sequence. In some embodiments, the composition further comprises a first donor guide RNA (gRNA) comprising at least 17 nucleotides complementary to a first CDL target sequence and a second donor gRNA comprising at least 17 nucleotides complementary to a second CDL target sequence, each donor gRNA being configured to form a separate complex comprising a targetable nuclease protein, each of the first CDL target sequence and the second CDL target sequence being operably linked to a 3 base pair protospacer adjacent motif (PAM) located 3' of the CDL target sequence. In some embodiments, one or more donor gRNAs comprise at least 17 nucleotides complementary to a genomic target sequence of the cell. In some embodiments, the HDR template comprises homology arms complementary to nucleic acid sequences flanking the genomic target sequence of the cell. In some embodiments, the homology arms are each independently selected from a length of at least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800 bp, at least 900 bp, 1000 bp, at least 1100 bp, at least 1200 bp, at least 1300 bp, 1400 bp, at least 1500 bp, at least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900 bp, or at least 2000 bp.

[0012] In some embodiments, (a) the targetable nuclease comprises an RNA-guided nuclease comprising CRISPR-CAS; (b) the composition further comprises a donor guide RNA (gRNA) configured to form a complex comprising the targetable nuclease protein; and (c) (1) the donor gRNA comprises at least 17 nucleotides complementary to each of the first CDL target sequence and the second CDL target sequence; and (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a three base pair protospacer adjacent motif (PAM) located 3' to the CDL target sequence.

[0013] In some embodiments, the composition further comprises a second targetable nuclease protein, and the second targetable nuclease protein or a complex comprising the second targetable nuclease protein is capable of cleaving a genomic target sequence of a cell. In some embodiments, the second targetable nuclease protein is an RNA-guided nuclease. In some embodiments, the composition further comprises a second RNA comprising at least 17 nucleotides complementary to the genomic target sequence. In some embodiments, the RNA-guided nuclease is a Cas protein. In some embodiments, the composition further comprises a targeting guide RNA (gRNA) configured to form a complex comprising the second targetable nuclease protein, wherein (1) the targeting gRNA comprises at least 17 nucleotides complementary to the genomic target sequence, and (2) the genomic target sequence is operably linked to a three-base pair protospacer adjacent motif (PAM) located 3' of the genomic target sequence.

[0014] In some embodiments, the first CDL target sequence, the second CDL target sequence, and the genomic target sequence comprise the same nucleic acid sequence.

[0015] In some embodiments, the genomic target sequence comprises a safe-harbor nucleic acid sequence. In some embodiments, the safe-harbor nucleic acid sequence comprises the nucleic acid sequence GAGCCATGCTTGGCTTACGA. In some embodiments, one or both of the PAM sequences are encoded between the CDL target sequence and the HDR template, or neither of the PAM sequences are encoded between the CDL target sequence and the HDR template.

[0016] In some embodiments, the targetable nuclease and each gRNA, respectively, are in a molar ratio of 1:10 to 2: 1. In some embodiments, the targetable nuclease and donor template, respectively, are in a molar ratio of 10:1 to 1000:1.

[0017] In some embodiments, the targetable nuclease protein and / or the second targetable nuclease protein comprises a transcription activator-like (TAL) effector DNA binding protein and a nuclease.

[0018] In some embodiments, the targetable nuclease protein and / or the second targetable nuclease protein comprises a zinc finger DNA binding protein and a nuclease.

[0019] In some embodiments, the targetable nuclease protein and / or the second targetable nuclease protein are fused to a nuclear localization signal (NLS) sequence.

[0020] In some embodiments, the targetable nuclease protein and / or the second targetable nuclease protein is a Cas9 protein.

[0021] Also provided herein is a method for modifying target nucleic acid in a cell, the method comprises introducing any composition described herein into the cell or non-virally introducing any composition described herein into the cell, and HDR template is integrated into the target nucleic acid.In some embodiments, the introduction comprises electroporation.In some embodiments, the cell is a primary cell.In some embodiments, the primary cell is a primary T cell.

[0022] Also provided herein is a ribonucleoprotein complex for modifying a target nucleic acid comprising any of the compositions described herein.

[0023] Also provided herein is a ribonucleoprotein complex for modifying a target nucleic acid, the ribonucleoprotein complex comprising (a) a CRISPR-CAS RNA-guided nuclease and (b) a donor guide RNA (gRNA) comprising at least 17 nucleotides that are complementary to a codelivered linearization (CDL) target sequence, wherein the composition is formulated for non-viral delivery to a cell. In some embodiments, the composition further comprises a plasmid donor template comprising: (i) a homology directed repair (HDR) template; (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template; and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein (1) the donor gRNA comprises at least 17 nucleotides complementary to each of the first CDL target sequence and the second CDL target sequence; and (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a three base pair protospacer adjacent motif (PAM) located 3' of the CDL target sequence.

[0024] Also provided herein is a method for modifying a target nucleic acid in a cell, the method comprising introducing any of the ribonucleoprotein complexes described herein into the cell. In some embodiments, the introduction comprises electroporation. In some embodiments, the cell is a primary cell. In some embodiments, the primary cell is a primary T cell. In some embodiments, the method is performed in vivo, in vitro, or ex vivo.

[0025] Also provided herein is a method of forming a ribonucleoprotein (RNP) complex, the method comprising incubating or having been incubated with (a) a CRISPR-CAS RNA-guided nuclease and (b) a donor guide RNA (gRNA) comprising at least 17 nucleotides complementary to a co-delivered linearization (CDL) target sequence. In some embodiments, the Cas protein and gRNA are incubated together at 37° C. for at least 17 minutes. In some embodiments, the molar ratio of gRNA:Cas protein is 0.25:1 to 4:1. In some embodiments, the RNP complex has a size of less than 100 nm. In some embodiments, the RNP complex has a size of 20 nm to 90 nm.

[0026] Also provided herein is a composition comprising a plasmid donor template comprising (i) a homology directed repair (HDR) template, (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template, and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein each of the first CDL target sequence and the second CDL target sequence is cleavable by a targetable nuclease protein or a complex comprising a targetable nuclease protein. In some embodiments, the composition further comprises a donor guide RNA (gRNA) configured to form a complex comprising the targetable nuclease protein. In some embodiments, the composition comprises a targetable nuclease protein.

[0027] In some embodiments, the donor template comprises the sequence, from 5' to 3', P1a-N1-P2b-H-P3c-N2-P4d, in which: (1) P1, P2, P3, and P4 are PAM sequences; (2) N1 is a first CDL target sequence and N2 is a second CDL target sequence; (3) H is an HDR template; (4) a is 0 and b is 1, or a is 1 and b is 0; and (5) c is 0 and d is 1, or c is 1 and d is 0.

[0028] In certain aspects, described herein is a method for modifying a target nucleic acid in a cell, comprising providing a cell and introducing or having introduced into the cell a composition formulated for non-viral delivery, the composition comprising (a) a targetable nuclease protein; and (b) a plasmid donor template comprising (i) a homology directed repair (HDR) template, (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template, and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein each of the first CDL target sequence and the second CDL target sequence is cleavable by the targetable nuclease protein or a complex comprising the targetable nuclease protein. In an aspect, described herein is a method for modifying a target nucleic acid of a cell, comprising providing a cell and introducing or having introduced into the cell a composition formulated for non-viral delivery, the composition comprising: (a) a CRISPR-Cas RNA-guided nuclease; (b) a donor guide RNA (gRNA); and (c) a plasmid donor template comprising: (i) a homology directed repair (HDR) template; (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template; and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein (1) the donor gRNA comprises at least 17 nucleotides complementary to each of the first CDL target sequence and the second CDL target sequence; and (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a three base pair protospacer adjacent motif (PAM) located 3' of the CDL target sequence.In certain aspects, described herein is a method for modifying a genomic target sequence in a cell, comprising providing a cell and introducing or having introduced into the cell a composition formulated for non-viral delivery, the composition comprising: (a) a CRISPR-Cas RNA-guided nuclease; (b) a donor guide RNA (gRNA); and (c) a plasmid donor template comprising: (i) a homology directed repair (HDR) template comprising a nucleic acid for insertion flanked by homology arms, (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template, and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, wherein (1) the donor gRNA comprises a small complementary sequence to each of the first CDL target sequence and the second CDL target sequence. (2) each of the first and second CDL target sequences is operably linked to a 3 base pair protospacer adjacent motif (PAM) located 3' of the CDL target sequence, the donor gRNA comprises at least 17 nucleotides complementary to a genomic target sequence of the cell, the homology arms are complementary to nucleic acid sequences flanking the genomic target sequence of the cell, and the nucleic acid for insertion is configured to be inserted into the genomic target sequence of the cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is an immune cell. In some embodiments, the immune cell is a T cell. In some embodiments, the T cell is a primary T cell. In some embodiments, the introduction of the composition formulated for non-viral delivery includes electroporation. In some embodiments, the amount of donor template is at least about 80, 10-120, 10, 20, 30, 40, 50, 60, 70, 90, 100, 110, or 120 μg. In some embodiments, the number of cells for each electroporation reaction is at least about 5, 1-10, 1, 2, 3, 4, 6, 7, 8, 9, or 10e7. In some embodiments, the total number of cells provided is at least greater than 10e7, and more than one electroporation reaction is performed. In some embodiments, the total volume of the cell suspension is about 1 mL.In certain embodiments, the method results in increased template insertion in a genomic target sequence of a cell compared to an otherwise identical control composition that does not contain the CDL target sequence, and optionally results in at least about a 1-5, 1, 2, 3, 4, or 5-fold increase in template insertion compared to the control.

[0029] definition As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0030] As used herein, "CRISPR-Cas" system refers to a type of bacterial system for defense against foreign nucleic acids. CRISPR-Cas systems are found in a wide range of eubacterial and archaeal organisms. CRISPR-Cas systems include subtypes I, II, and III. Wild-type type II CRISPR-Cas systems utilize RNA-mediated nucleases, such as Cas9 proteins, complexed with guide RNA and activating RNA (e.g., single-stranded guide RNA or sgRNA) to recognize and cleave foreign nucleic acids, such as foreign nucleic acids that contain natural or modified nucleotides.

[0031] As used herein, the term "targetable nuclease" refers to a protein capable of recognizing and binding to a cognate nucleic acid sequence (e.g., a target gene and / or a CDL target sequence in a genome). In some embodiments, the targetable nuclease can modify the cognate nucleic acid sequence. In some embodiments, the targetable nuclease can be an RNA-guided nuclease, e.g., a Cas protein. In other embodiments, the targetable nuclease can be a fusion protein that includes a protein that can bind to the cognate nucleic acid sequence (e.g., a transcription activator-like (TAL) effector DNA binding protein or a zinc finger DNA binding protein) and a protein that can modify the cognate nucleic acid sequence (e.g., a nuclease, a transcription activator, or a repressor). In some embodiments, the targetable nuclease has nuclease activity. In other embodiments, the targetable nuclease does not have nuclease activity. In some embodiments, the targetable nuclease can modify the cognate nucleic acid sequence by cleaving the target nucleic acid. The cleaved target nucleic acid can then undergo homologous recombination with an adjacent homology-directed repair template, such as through homology-directed repair (HDR) or homology-mediated end joining (HMEJ). In other embodiments, the targetable nuclease (e.g., a targetable nuclease that does not have any nuclease activity) can regulate the expression of a cognate nucleic acid sequence. For example, the targetable nuclease can be a fusion protein that includes a TAL effector DNA binding protein and a transcriptional activator.

[0032] As used herein, the term "plasmid donor template" refers to a polynucleotide comprising a homology directed repair (HDR) template and a CDL target sequence. The HDR template may comprise a 5' homology arm, a nucleotide insert (e.g., a sequence encoding an exogenous sequence and / or a heterologous protein or fragment thereof), and a 3' homology arm (see, e.g., FIG. 1). As further described herein, pre-incubation of the plasmid donor template with an RNP complex comprising a targetable nuclease (e.g., a Cas protein) and a donor gRNA prior to electroporation improves knock-in yields, such as improving knock-in efficiency and / or reducing cytotoxicity.

[0033] As used herein, the term "co-delivery linearization (CDL) target sequence" refers to a nucleotide sequence that is recognized and bound by a targetable nuclease. In some embodiments, a targetable nuclease, such as a transcription activator-like (TAL) effector DNA binding protein or a zinc finger DNA binding protein, can directly recognize and bind to a CDL target sequence. In other embodiments, a targetable nuclease, such as an RNA-guided nuclease, can indirectly recognize and bind to a CDL target sequence via a donor gRNA. The RNA-guided nuclease binds to the donor gRNA while the donor gRNA is hybridized to the CDL target sequence. In some embodiments, the CDL target sequence is part of a genomic target nucleic acid.

[0034] As used herein, "RNA-guided nuclease" refers to a nuclease that binds to a guide RNA (gRNA) and selectively binds to a region in a DNA polynucleotide using the gRNA. In general, an RNA-guided nuclease can selectively bind to almost any sequence in a DNA polynucleotide that is complementary to the gRNA. In some embodiments, the RNA-guided nuclease has nuclease activity and can cleave bonds (e.g., phosphodiester bonds) between nucleotides in a DNA polynucleotide. In other embodiments, the RNA-guided nuclease does not have nuclease activity and can be used to selectively bind and / or localize other proteins (e.g., transcriptional activators or repressors) fused to the RNA-guided nuclease to a region of interest in a DNA polynucleotide.

[0035] As used herein, the term "guide RNA" or "gRNA" refers to a DNA-targeting RNA that can guide an RNA-guided nuclease (e.g., a Cas protein) to a cognate nucleic acid sequence by hybridizing to the cognate nucleic acid sequence. In some embodiments, the guide RNA can be a single-stranded guide RNA (sgRNA) that includes (1) a guide sequence (e.g., the crRNA-equivalent portion of the single-stranded guide RNA) that guides the RNA-guided nuclease to the cognate nucleic acid sequence and (2) a scaffold sequence (e.g., the tracrRNA-equivalent portion of the single-stranded guide RNA) that interacts with the RNA-guided nuclease. In other embodiments, the guide RNA can be two components consisting of (1) a guide sequence (e.g., the crRNA-equivalent portion of the single-stranded guide RNA) that guides the RNA-guided nuclease to the cognate nucleic acid sequence and (2) a scaffold sequence (e.g., the tracrRNA-equivalent portion of the single-stranded guide RNA) that interacts with the RNA-guided nuclease. A portion of the guide sequence can hybridize to a portion of the scaffold sequence to form two component guide RNAs.

[0036] As used herein, the term "targeted guide RNA" or "targeted gRNA" refers to a gRNA that can hybridize to a cognate nucleic acid sequence to be modified at a location within a DNA polynucleotide where integration of an HDR template is desired, e.g., the genome of a T cell and / or a safe harbor location on the genome.

[0037] As used herein, the term "donor guide RNA" or "donor gRNA" refers to a gRNA that can hybridize to a CDL target sequence in a plasmid donor template. In some embodiments, the CDL target sequence can be complementary (e.g., partially complementary or fully complementary) to an equal length portion of the sequence of the donor gRNA.

[0038] As used herein, the term "single-stranded guide RNA" or "sgRNA" refers to a DNA-targeting RNA that includes (1) a guide sequence (e.g., the crRNA-equivalent portion of the single-stranded guide RNA) that targets Cas to a cognate nucleic acid sequence and (2) a scaffold sequence (e.g., the tracrRNA-equivalent portion of the single-stranded guide RNA) that interacts with a Cas protein.

[0039] As used herein, the term "complementary" or "complementarity" refers to the ability of base pairing between nucleic acid bases, nucleosides, or nucleotides, as well as the ability of base pairing between one polynucleotide and another polynucleotide. In some embodiments, one polynucleotide may have "full complementarity" or be "full complementarity" with another polynucleotide. This means that when the two polynucleotides are optionally aligned, each nucleotide in one polynucleotide can participate in Watson-Crick base pairing with the corresponding nucleotide in the other polynucleotide. In other embodiments, one polynucleotide may have "partial complementarity" or be "partially complementary" with another polynucleotide. This means that when two polynucleotides are optionally aligned, at least 60% (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 97%) but less than 100% of the nucleotides in one polynucleotide can participate in Watson-Crick base pairing with the corresponding nucleotides in the other polynucleotide. In other words, when two polynucleotides hybridize, there is at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) mismatched nucleotide base pair. Examples of nucleotide pairs involved in Watson-Crick base pairing include adenine and thymine, cytosine and guanine, and adenine and uracil, and all of these pairs are formed by hydrogen bonds. Examples of mismatched bases include guanine and uracil, guanine and thymine, and adenine and cytosine pairing.

[0040] As used herein, the term "Cas protein" refers to a clustered regularly interspaced short palindromic repeats protein or nuclease. The Cas protein can be a wild-type Cas protein or a Cas protein mutant. The Cas9 protein is an example of a Cas protein belonging to a type II CRISPR-Cas system (e.g., Rath et al., Biochimie 117:119, 2015). Other examples of Cas proteins are described in more detail herein. Naturally occurring type II Cas proteins generally require both crRNA and tracrRNA for site-specific DNA recognition and cleavage. The crRNA binds to the tracrRNA through a partial complementary region and guides the Cas protein to a region in the target DNA that is homologous to the crRNA, referred to as the "protospacer." Naturally occurring type II Cas proteins cleave DNA and generate blunt ends at double-stranded breaks at sites specified by guide sequences contained within the crRNA transcript. In some embodiments of the compositions and methods described herein, the Cas protein binds to a target gRNA or a donor gRNA to form a ribonucleoprotein (RNP) complex. In some embodiments of the compositions and methods described herein, the Cas protein has nuclease activity. In other embodiments, the Cas protein does not have nuclease activity.

[0041] As used herein, the term "Cas protein mutant" refers to a Cas protein having at least one amino acid substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid substitutions) relative to the sequence of a wild-type Cas protein, and / or a truncated version or fragment of a wild-type Cas protein. In some embodiments, the Cas protein mutant has at least 75% sequence identity (e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of a wild-type Cas protein. In some embodiments, the Cas protein mutant is a fragment of a wild-type Cas protein and has at least one amino acid substitution relative to the sequence of a wild-type Cas protein. The Cas protein mutant can be a Cas9 protein mutant. In some embodiments, the Cas protein mutant has nuclease activity. In other embodiments, the Cas protein mutant has no nuclease activity.

[0042] As used herein, the term "ribonucleoprotein complex" or "RNP complex" refers to a complex comprising a Cas protein or a variant thereof (e.g., a Cas9 protein or a variant thereof) and a gRNA.

[0043] As used herein, the term "modify" in the context of modifying a target nucleic acid in the genome of a cell refers to inducing a change (e.g., a cleavage) in the target nucleic acid. In some embodiments, the change can be a structural change in the sequence of the target nucleic acid. For example, the modification can be in the form of inserting a nucleotide sequence into the target nucleic acid. For example, an exogenous nucleotide sequence can be inserted into the target nucleic acid. It is also possible to excise the target nucleic acid and replace it with an exogenous nucleotide sequence. As another example, the modification can be in the form of cleaving the target nucleic acid without inserting a nucleotide sequence into the target nucleic acid. For example, the target nucleic acid can be cleaved and excised. Such modifications can be made, for example, by inducing a double-stranded break in the target nucleic acid or by inducing a pair of single-stranded nicks in opposing strands adjacent to the target nucleic acid. Methods of inducing single- or double-stranded breaks in or within a target nucleic acid include using a targetable nuclease (e.g., a Cas protein) described herein directed to the target nucleic acid. In other embodiments, modifying the target nucleic acid includes targeting another protein to the target nucleic acid and does not include cleaving the target nucleic acid. [Brief description of the drawings]

[0044] This application includes the following figures. The drawings are intended to illustrate certain embodiments and / or features of the compositions and methods and to supplement the description(s) of the compositions and methods. The drawings do not limit the scope of the compositions and methods unless the written description explicitly indicates that such is the case. [Figure 1]Conceptual diagram showing an exemplary mechanism of CDL (co-delivery linearization) plasmid design to mediate genomic insertion of a cassette. As shown on the right, the addition of a CDL sequence (a Cas9 target sequence with identity to the Cas9 genomic target for HDR integration) and a three base pair protospacer adjacent motif (PAM) outside the homology arms flanking the cassette activates the Cas9-sgRNA ribonucleoprotein (RNP)-mediated endonuclease to release the cassette and homology arms from the plasmid in addition to the Cas9-sgRNA RNP-mediated cleavage within the genome. In contrast, in the standard plasmid shown on the left, the Cas9-sgRNA RNP does not cleave the plasmid but only the genomic locus. [Figure 2A-1] Figure 2 is a flow cytometry dot plot and graph showing knock-in (KI) efficiency and KI cell yield of T cells electroporated with CRISPR RNP and a homology-directed repair (HDR) template of either a standard plasmid or a CDL plasmid. Figure 2A shows a series of flow cytometry dot plots of T cells electroporated with CRISPR RNP and various doses (increasing from left to right, ranging from 0 to 100 mg / L) of a homology-directed repair (HDR) template of either a standard plasmid (top panel) or a CDL plasmid encoding a MYC-tagged surface protein (bottom panel). Figure 2B is a graph showing KI% for varying doses of either the standard plasmid or the CDL plasmid. Figure 2C is a graph showing KI+ viable cells (live / dead stain; ThermoFisher) yield per million starting cells for varying doses of either the standard plasmid or the CDL plasmid. [Figure 2A-2] See legend to Figure 2A-1. [Figure 2B] See legend to Figure 2A-1. [Figure 2C] See legend to Figure 2A-1. [Diagram 3] 1 is a graph showing the CD8 / CD4 ratio at varying doses of either standard or CDL plasmid. [Figure 4] 1 is a graph showing transgene expression in T cells electroporated with three plasmids containing the CDL sequence GAGCCATGCTTGGCTTACGA and three plasmids without the CDL sequence, 6 days after electroporation. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0045] Detailed Description of the Disclosure In the following, various aspects and embodiments of the compositions and methods of the present invention are listed and described. The specific embodiments are not intended to define the scope of the compositions and methods. Rather, the embodiments only provide non-limiting examples of various compositions and methods that are at least included within the scope of the disclosed compositions and methods. This description should be read from the perspective of a person skilled in the art, and therefore does not necessarily include information that is known to a person skilled in the art.

[0046] I. Introduction Viral modified T cells have been approved for cancer immunotherapy, but more versatile and precise genome modification for broader adoptive cell therapy is needed (Yin et al., Nat Rev Clin Oncol, 16(5):281-295, 2019; Dunbar et al., Science 359:6372, 2018; Cornu et al., Nat Med 23:415-423, 2017; and David and Doherty, Toxicol Sci 155:315-325, 2017). The CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated proteins) nuclease system is a genetically engineered nuclease system based on a bacterial system that can be used to manipulate genomes. This system is based in part on the adaptive immune response of many bacteria and archaea. When a virus or plasmid invades bacteria, the invader's DNA segment is converted into CRISPR RNA (crRNA) by an "immune" response. The crRNA binds to another type of RNA, called tracrRNA, through a region of partial complementarity and guides a Cas (e.g., Cas9) nuclease to a region of homology with the crRNA in the target DNA, called the "protospacer." The Cas (e.g., Cas9) nuclease cleaves the DNA and generates blunt ends at the double-stranded break at the site specified by the 20-nucleotide guide sequence contained within the crRNA transcript. The Cas (e.g., Cas9) nuclease may require both the crRNA and tracrRNA for site-specific DNA recognition and cleavage. This system has currently been engineered by combining the crRNA and tracrRNA into one molecule (the "single-stranded guide RNA" or "sgRNA") and engineering the crRNA equivalent portion of the sgRNA to guide a Cas (e.g., Cas9) nuclease to target any desired sequence (see, e.g., Jinek et al. (2012) Science 337:816-821; Jinek et al. (2013) eLife 2:e00471; and Segal (2013) eLife 2:e00563).Thus, by engineering the CRISPR-Cas system, one can create double-stranded breaks at desired targets within a cell's genome and utilize the cell's endogenous mechanisms to repair the induced breaks by homology-directed repair (HDR) or non-homologous end joining (NHEJ).

[0047] As described herein, the inventors have found that when added to the end of a homology-directed repair (HDR) template, the sequence targeted by nucleases can increase the efficiency of modifying target nucleic acid.Non-viral strategies, such as electroporation, for delivering CRISPR-Cas systems to cells for gene modification avoid many of the complications associated with viral delivery, such as lethal systemic immune responses to viral vectors, inefficiencies in viral delivery, and viral insertion-associated gene overexpression.However, in some cases, the use of non-viral strategies for CRISPR-Cas system delivery requires large amounts of HDR template, which can cause dose-dependent cytotoxicity.

[0048] II. Composition The present disclosure provides compositions and methods for modifying a target nucleic acid, comprising: (a) a targetable nuclease protein; and (b) a plasmid donor template comprising: (i) a homology directed repair (HDR) template; (ii) a first co-delivered linearization (CDL) target sequence operably linked to the 5' of the HDR template; and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, each of the first CDL target sequence and the second CDL target sequence being cleavable by the targetable nuclease protein or a complex comprising the targetable nuclease protein, and formulated for non-viral delivery to a cell. As described in further detail herein, in some embodiments, when the targetable nuclease is a transcription activator-like (TAL) effector, the TAL effector can directly recognize and bind to the CDL target sequence. In some embodiments, when the targetable nuclease is a zinc finger, the zinc finger can directly recognize and bind to the CDL target sequence. In other embodiments, when the targetable nuclease is an RNA-guided nuclease (e.g., a Cas protein), the RNA-guided nuclease can indirectly bind to the CDL target sequence via a donor gRNA that can hybridize to the CDL target sequence. Without being bound by any theory, the targetable nuclease serves to cleave the CDL target sequence, thereby excising the HDR template from the plasmid donor template, and the HDR template can participate in homology-mediated end joining (HMEJ). Not only can the knock-in efficiency reduce DNA-induced cytotoxicity, but it can also be maintained or even increased using a smaller amount of plasmid donor template through the HMEJ-directed process described herein. Thus, the CDL target sequence can improve the efficiency of insertion of the HDR template into the target cell while simultaneously reducing toxicity and increasing the overall yield of edited cells.

[0049] III. CRISPR / Cas In some embodiments of the compositions and methods described herein, the targetable nuclease is an RNA-guided nuclease and the donor template further comprises a protospacer adjacent motif (PAM) immediately adjacent to the CDL target sequence. The composition may also further comprise a target guide RNA (gRNA) that is complementary to the target nucleic acid to be modified, e.g., a genomic target sequence, such as a desired site for transgene insertion in a cell (e.g., a T cell). The target gRNA may form a first RNP complex with the first RNA-guided nuclease and guide the first RNA-guided nuclease (e.g., a Cas protein) to the target nucleic acid. In some embodiments, a portion of the target gRNA (e.g., a portion of the target gRNA that is at least 17 nucleotides (e.g., 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides)) is complementary to the target nucleic acid.

[0050] The composition may also further comprise a donor gRNA that is complementary to the CDL target sequence. The donor gRNA may form a second RNP with the second RNA-guided nuclease. The CDL target sequence in the donor template may hybridize to the donor gRNA or a portion thereof. Thus, the complex comprising the second RNA-guided nuclease, the donor gRNA, and the donor template may facilitate the excision of the HDR template and promote homologous recombination that occurs at the integration site of the target nucleic acid cleaved by the target gRNA, without wishing to be bound by theory. In some embodiments, the sequences of the target gRNA and the donor gRNA are the same. In some embodiments, the sequences of the target gRNA and the donor gRNA are different. In some embodiments, the first RNA-guided nuclease and the second RNA-guided nuclease are the same. In other embodiments, the first RNA-guided nuclease and the second RNA-guided nuclease are different.

[0051] The composition may contain a molar ratio of targetable nuclease to target gRNA and / or donor gRNA, respectively, of 1:10 to 2:1 (e.g., 1:5 to 2:1, 2:5 to 2:1, 3:5 to 2:1, 4:5 to 2:1, 1:1 to 2:1, 1:10 to 1:1, 1:10 to 4:5, 1:10 to 3:5, 1:10 to 2:5, or 1:10 to 1:5). The composition may comprise a targetable nuclease and a plasmid donor template in a ratio of 10:1 to 1000:1 (e.g., 50:1 to 1000:1, 100:1 to 1000:1, 200:1 to 1000:1, 300:1 to 1000:1, 400:1 to 1000:1, 500:1 to 1000:1, 600:1 to 1000:1, 700:1 to 1000: The molar ratio of the aryl group to the aryl group may be 1, 800:1 to 1000:1, 900:1 to 1000:1, 10:1 to 900:1, 10:1 to 800:1, 10:1 to 700:1, 10:1 to 600:1, 10:1 to 500:1, 10:1 to 400:1, 10:1 to 300:1, 10:1 to 200:1, 10:1 to 100:1, or 10:1 to 50:1.

[0052] RNA-guided nucleases can also be fused with localization peptides or proteins. For example, RNA-guided nucleases can be fused with one or more nuclear localization signal (NLS) sequences, which can guide the nuclease and the RNP complex it forms to the nucleus and modify the target nucleic acid. Examples of NLS sequences include those well known in the art, such as those described in Lange et al., J Biol Chem.282(8):5101-5,2007, and include, but are not limited to, AVKRPAATKKAGQAKKKKLD, MSRRRKANPTKLSENAKKLAKEVEN, PAAKRVKLD, KLKIKRPVK, and PKKKRKV. Other examples of peptides or proteins that can be used with RNA-guided nucleases, such as cell penetrating peptides and cell targeting peptides, are available in the art, for example, those described in Vives et al., Biochim Biophys Acta. 1786(2):126-38, 2008.

[0053] IV. Single-stranded guide RNA The Cas protein can be guided to the respective cognate DNA (e.g., CDL target sequence and / or genomic target sequence) to be cleaved by a single-stranded guide RNA (sgRNA). The sgRNA is a naturally occurring bipartite guide RNA (crRNA and tracrRNA) engineered into a single contiguous sequence. The sgRNA can include a guide sequence (e.g., the crRNA-equivalent portion of the sgRNA) that targets the Cas protein to the cognate nucleic acid sequence and a scaffold sequence (e.g., the tracrRNA-equivalent portion of the sgRNA) that interacts with the Cas protein. The sgRNA can be selected using software. As a non-limiting example, considerations for selecting the sgRNA can include, for example, the PAM sequence of the Cas9 protein used and a strategy to minimize off-target modification. Tools such as NUPACK® and CRISPR Design Tool can be used to provide sequences for preparing sgRNAs, evaluating target modification efficiency, and / or evaluating cleavage at off-target sites.

[0054] Guide Sequence The guide sequence in the sgRNA can be complementary to a specific sequence in the cognate nucleic acid sequence (e.g., CDL target sequence and / or genomic target sequence). The 3' end of the cognate nucleic acid sequence can be followed by a PAM sequence. The guide sequence is generally complementary to about 20 nucleotides upstream of the PAM sequence. Generally, the Cas9 protein or a variant thereof cleaves about 3 nucleotides upstream of the PAM sequence. The guide sequence of the sgRNA can be complementary to either strand of the cognate nucleic acid sequence.

[0055] In some embodiments, the guide sequence of the sgRNA comprises about 10 to about 2000 nucleic acids, e.g., about 10 to about 100 nucleic acids, about 10 to about 500 nucleic acids, about 10 to about 1000 nucleic acids, about 10 to about 1500 nucleic acids, about 10 to about 2000 nucleic acids, about 50 to about 100 nucleic acids, about 50 to about 500 nucleic acids, about 50 to about 600 nucleic acids, about 50 to about 700 nucleic acids, about 50 to about 800 nucleic acids, about 50 to about 900 nucleic acids, about 50 to about 100 nucleic acids, about 50 to about 1500 nucleic acids, about 50 to about 2000 nucleic acids, about 50 to about 100 nucleic acids, about 50 to about 5 ... The guide sequence of the sgRNA may comprise about 1000 nucleic acids, about 50 to about 1500 nucleic acids, about 50 to about 2000 nucleic acids, about 100 to about 500 nucleic acids, about 100 to about 1000 nucleic acids, about 100 to about 1500 nucleic acids, about 100 to about 2000 nucleic acids, about 500 to about 1000 nucleic acids, about 500 to about 1500 nucleic acids, about 500 to about 2000 nucleic acids, about 1000 to about 1500 nucleic acids, about 1000 to about 2000 nucleic acids, or about 1500 to about 2000 nucleic acids. In some embodiments, the guide sequence of the sgRNA comprises about 100 nucleic acids at the 5' end of the sgRNA that can guide the Cas protein to the cognate nucleic acid sequence site using RNA-DNA complementary base pairing. In some embodiments, the guide sequence comprises 20 nucleic acids at the 5' end of the sgRNA that can direct the Cas protein to a site of a cognate nucleic acid sequence (e.g., a CDL target sequence and / or a genomic target sequence) using RNA-DNA complementary base pairing. In other embodiments, the guide sequence comprises fewer than 20 nucleic acids, e.g., 19, 18, or 17 or fewer, that are complementary to the cognate nucleic acid sequence. In some cases, the guide sequence in the sgRNA comprises at least one nucleic acid mismatch in the region of complementarity of the cognate nucleic acid sequence. In some cases, the guide sequence comprises about 1 to about 10 nucleic acid mismatches in the region of complementarity of the cognate nucleic acid sequence.

[0056] Scaffold sequence The scaffold sequence in the sgRNA serves as a protein-binding sequence that interacts with the Cas protein or its mutants. In some embodiments, the scaffold sequence in the sgRNA may comprise two complementary nucleotide stretches that hybridize with each other to form a double-stranded RNA duplex (dsRNA duplex). The scaffold sequence may have a structure such as a lower stem, a bulge, an upper stem, a nexus, and / or a hairpin. In some embodiments, the scaffold sequence in the sgRNA can be about 90 nucleic acids to about 120 nucleic acids, e.g., about 90 nucleic acids to about 115 nucleic acids, about 90 nucleic acids to about 110 nucleic acids, about 90 nucleic acids to about 105 nucleic acids, about 90 nucleic acids to about 100 nucleic acids, about 90 nucleic acids to about 95 nucleic acids, about 95 nucleic acids to about 120 nucleic acids, about 100 nucleic acids to about 120 nucleic acids, about 105 nucleic acids to about 120 nucleic acids, about 110 nucleic acids to about 120 nucleic acids, or about 115 nucleic acids to about 120 nucleic acids.

[0057] V. Guide RNA (gRNA) Guide RNA (gRNA), including target gRNA and donor gRNA described herein, generally refers to a DNA-targeting RNA that includes (1) a guide sequence that is complementary to a cognate nucleic acid sequence (e.g., a CDL target sequence and / or a genomic target sequence) and guides an RNA-guided nuclease to the cognate nucleic acid sequence, and (2) a scaffold sequence that interacts with and binds to the RNA-guided nuclease. In some embodiments of the present disclosure, the target gRNA and the donor gRNA have the same sequence. In some embodiments of the present disclosure, the target gRNA and the donor gRNA include the same sequence, such as sharing a nucleic acid sequence that can hybridize to both the target sequence to be modified and the CDL target sequence. In other embodiments of the present disclosure, the target gRNA and the donor gRNA have different sequences. In the compositions and methods described herein, the gRNA includes a portion that is complementary to the cognate nucleic acid sequence. When the gRNA forms an RNP complex with a targetable nuclease (e.g., a first RNA-guided nuclease), the RNP complex can be guided to the cognate nucleic acid sequence by the complementarity between the gRNA and the cognate nucleic acid sequence. In some embodiments, the targetable nuclease is a Cas9 protein. The Cas9 protein first "recognizes" the cognate nucleic acid sequence by identifying a three-base pair protospacer adjacent motif (PAM) located 3' of the cognate nucleic acid sequence. Once the PAM is identified, the gRNA of the RNP complex hybridizes to the cognate nucleic acid sequence upstream of the PAM. In some embodiments, the gRNA comprises a portion of nucleotides that is complementary to a portion of the cognate nucleic acid sequence about 20 nucleotides upstream of the PAM sequence. Generally, the Cas9 protein or a variant thereof cleaves about 3 nucleotides upstream of the PAM sequence. The gRNA can be selected using software. As a non-limiting example, considerations for selecting a gRNA may include, for example, the PAM sequence of the RNA-guided nuclease used and a strategy to minimize off-target modification. Tools such as NUPACK® and CRISPR Design Tool can be used to provide sequences for preparing gRNAs, evaluating target modification efficiency, and / or evaluating cleavage at off-target sites.

[0058] In some embodiments, the gRNA comprises at least a 17 nucleotide (e.g., 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide) portion complementary to a portion of the cognate nucleic acid sequence. In some embodiments, the gRNA may be fully complementary or partially complementary to the cognate nucleic acid sequence. In some embodiments, at least 60% (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 97%) of the nucleotides in the cognate nucleic acid sequence may participate in Watson-Crick base pairing with the corresponding nucleotides of the gRNA.

[0059] As described in more detail herein, the CDL target sequences and PAMs on one or both ends of the HDR template can be designed in different configurations.

[0060] In some embodiments of the present disclosure, the target gRNA and the donor gRNA have the same sequence (e.g., the genomic target sequence and the CDL target sequence are the same) and each forms a complex with the cognate targetable nuclease (e.g., both have the same sequence and form an RNP complex with the cognate Cas protein). In this case, the gRNA can form a first RNP complex with the RNA-guided nuclease. The first RNP complex can bind to the target nucleic acid via hybridization between the gRNA and the target nucleic acid. The gRNA can form a second RNP complex with the RNA-guided nuclease and the donor template. In this second RNP complex, the gRNA can bind to a DNA-binding protein target sequence in the donor template to carry the donor template to a desired subcellular location (e.g., the nucleus) for homologous recombination to occur at the cleaved target nucleic acid. In some embodiments, the gRNA and the DNA-binding protein target sequence have only partial complementarity. In some embodiments of the present disclosure, the target gRNA and the donor gRNA have different sequences (e.g., the genomic target sequence and the CDL target sequence are distinct). Each of the distinct target gRNA and the donor gRNA can form a complex with the same targetable nuclease (e.g., each forms an RNP complex with the same Cas protein). Each of the distinct target gRNA and the donor gRNA can form a complex with the different targetable nuclease (e.g., each forms an RNP complex with the same Cas protein).

[0061] VI. Donor template The HDR template, the CDL target sequence, and the corresponding PAM sequence can have any different configuration in the plasmid donor template to enhance the homology-directed repair between the HDR template and the target nucleic acid. In general, the donor template comprises (i) a homology-directed repair (HDR) template, (ii) a first co-delivery linearization (CDL) target sequence operably linked to the 5' of the HDR template, and (iii) a second CDL target sequence operably linked to the 3' of the HDR template, each of the first CDL target sequence and the second CDL target sequence being cleavable by a targetable nuclease protein or a complex comprising a targetable nuclease protein. In an embodiment, when the targetable nuclease is a Cas protein (e.g., Cas9), each of the first CDL target sequence and the second CDL target sequence is operably linked to a three-base pair PAM located 3' of the CDL target sequence. The CDL target sequence and the corresponding PAM can be oriented such that the PAM is located between the CDL target sequence and the HDR template. The CDL target sequence and the corresponding PAM can be oriented such that the CDL target sequence is located between the PAM and the HDR template. The CDL target sequence and the corresponding PAM in the plasmid donor template can be oriented independently. The PAM corresponding to the first CDL target sequence can be located between the CDL target sequence and the HDR template. The first CDL target sequence can be located between the PAM and the HDR template. The PAM corresponding to the second CDL target sequence can be located between the CDL target sequence and the HDR template. The second CDL target sequence can be located between the PAM and the HDR template. In a non-limiting example, the PAM corresponding to the first CDL target sequence is located between the first CDL target sequence and the HDR template, and the PAM corresponding to the second CDL target sequence is located between the second CDL target sequence and the HDR template.

[0062] In some embodiments, the size or length of the plasmid donor template is about 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, 550 bp, 600 bp, 650 bp, 700 bp, 750 bp, 800 bp, 850 bp, 900 bp, 1 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb, 1.8 kb, 1.9 kb, 2.0 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3.1 kb, 3.2 kb, 3.3 kb, 3.4 kb, 3.5 kb, 3.6 kb, 3.7 kb, 3.8 kb, 3 ... b, 1.9kb, 2.0kb, 2.1kb, 2.2kb, 2.3kb, 2.4kb, 2.5kb, 2.6kb, 2.7kb, 2.8kb, 2.9kb, 3kb, 3.1kb, 3.2kb, 3.3k b, 3.4kb, 3.5kb, 3.6kb, 3.7kb, 3.8kb, 3.9kb, 4.0kb, 4.1kb, 4.2kb, 4.3kb, 4.4kb, 4.5kb, 4.6kb, 4.7kb, 4.8 kb, 4.9kb, 5.0kb, 5.1kb, 5.2kb, 5.3kb, 5.4kb, 5.5kb, 5.6kb, 5.7kb, 5.8kb, 5.9kb, 6.0kb, 6.1kb, 6.2kb, 6 .3kb, 6.4kb, 6.5kb, 6.6kb, 6.7kb, 6.8kb, 6.9kb, 7.0kb, 7.1kb, 7.2kb, 7.3kb, 7.4kb, 7.5kb, 7.6kb, 7.7kb, or greater than 7.8kb, 7.9kb, 8.0kb, 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, 10.0kb, or any size between these sizes, or greater than 10kb. For example, the size of the template can be about 200 bp to about 500 bp, about 200 bp to about 750 bp, about 200 bp to about 1 kb, about 200 bp to about 1.5 kb, about 200 bp to about 2.0 kb, about 200 bp to about 2.5 kb, about 200 bp to about 3.0 kb, about 200 bp to about 3.5 kb, about 200 bp to about 4.0 kb, about 200 bp to about 4.5 kb, about 200 bp to about 5.0 kb. In some cases, the size of the template is large enough and in sufficient quantity to be lethal as naked DNA.

[0063] In some embodiments, the donor template encodes a heterologous protein or a fragment thereof. In some embodiments, the donor template comprises a control sequence, e.g., a promoter sequence and / or an enhancer sequence, for controlling the expression of the heterologous protein or a fragment thereof, e.g., after insertion into the genome of the cell. The heterologous protein may comprise a chimeric antigen receptor (CAR). The heterologous protein may comprise a T cell receptor (TCR).

[0064] In some embodiments, the plasmid donor template includes an exogenous sequence, such as an exogenous nucleotide sequence. The exogenous sequence may include an encoded heterologous protein or a fragment thereof. The exogenous sequence may include a gene or a portion thereof. The exogenous nucleotide sequence may be a short sequence, e.g., 3-100 nucleotides in length. The exogenous nucleotide sequence of interest may be a single nucleotide. Also, the exogenous nucleotide sequence may be a long sequence, e.g., 500-3000 nucleotides in length. The exogenous nucleotide sequence of interest may or may not code for a polypeptide sequence. Additionally, the exogenous nucleotide sequence of interest may be inserted into a cell such that it forms a chimeric gene upon insertion. For example, an exogenous receptor portion may be inserted in frame into an endogenous receptor coding sequence to produce a chimeric receptor coding sequence that, after editing, includes an exogenous receptor portion operably linked to an endogenous intracellular portion (e.g., for signal transduction).

[0065] In some examples, the gene or a portion thereof may be a protein-coding nucleotide sequence (i.e., a nucleotide sequence that encodes a polypeptide sequence). In general, any protein-coding nucleotide may be used. In some examples, the protein-coding nucleotide sequence encodes a protein useful for autologous cell therapy (e.g., autologous T cell therapy). In some examples, the protein-coding nucleotide sequence may include, but is not limited to, a factor that regulates the immune system, a cytokine, a factor that regulates T cell function, a factor that promotes T cell survival, a factor that promotes T cell function, or an immune checkpoint inhibitor. The protein-coding nucleotide sequence, particularly a secreted protein or a membrane-bound protein, may include a nucleotide sequence that encodes a signal peptide. The signal peptide may be endogenous to the protein encoded by the protein-coding nucleotide sequence. The signal peptide may be exogenous to the protein encoded by the protein-coding nucleotide sequence.

[0066] In some cases, the gene or a part thereof may be a non-protein-coding nucleotide sequence. In general, any non-protein-coding nucleotide may be used. In some cases, the non-protein-coding nucleotide sequence may be a nucleotide sequence useful for autologous cell therapy (e.g., autologous T cell therapy). In some cases, the non-protein-coding nucleotide sequence may include, but is not limited to, shRNA, siRNA, miRNA, and lncRNA.

[0067] Nucleotide sequences encoding at least a portion of a gene (e.g., an exogenous gene of interest) can generally be any size, although practical considerations may be taken into account, such as the impact of gene size on overall template size and subsequent overall editing efficiency. Thus, in certain embodiments, modified genome-edited or genome-editable cells are provided herein that express exogenous genes having a length of 100 bases or more at higher HR efficiency rates (e.g., higher percentage of population with integrated polynucleotide sequence) than previously described, particularly when using non-viral delivery methods. Improved HR efficiency rates apply equally to genes having a length of 100 bases or more, such as introducing exogenous sequences having a length of 200 bases or more, a length of 400 bases or more, a length of 500 bases or more, a length of 600 bases or more, a length of 750 bases or more, a length of 1000 bases or more, a length of 1500 bases or more, a length of 2000 bases or more, a length of 3000 bases or more, or a length of 4000 bases or more. At least a portion of the gene may be 800 bases or more in length. At least a portion of the gene may be 1600 bases or more in length.

[0068] The exogenous sequence may be 100-200 bases in length, 100-300 bases in length, 100-400 bases in length, 100-500 bases in length, 100-600 bases in length, 100-700 bases in length, 100-800 bases in length, 100-900 bases in length, or 100-1000 bases in length. The exogenous sequence may be 100-2000 bases in length, 100-3000 bases in length, 100-4000 bases in length, 100-5000 bases in length, 100-6000 bases in length, 100-7000 bases in length, 100-8000 bases in length, 100-9000 bases in length, or 100-10000 bases in length. The exogenous sequence can be 1000-2000 bases in length, 1000-3000 bases in length, 1000-4000 bases in length, 1000-5000 bases in length, 1000-6000 bases in length, 1000-7000 bases in length, 1000-8000 bases in length, 1000-9000 bases in length, or 1000-10000 bases in length.

[0069] The exogenous sequence can be 10 or more bases in length, 20 or more bases in length, 30 or more bases in length, 40 or more bases in length, 50 or more bases in length, 60 or more bases in length, 70 or more bases in length, 80 or more bases in length, 90 or more bases in length, or 95 or more bases in length. The exogenous sequence can be 1-100 bases in length, 1-90 bases in length, 1-80 bases in length, 1-70 bases in length, 1-60 bases in length, 1-50 bases in length, 1-40 bases in length, or 1-30 bases in length. The exogenous sequence can be 1-20 bases in length, 2-20 bases in length, 3-20 bases in length, 5-20 bases in length, 10-20 bases in length, or 15-20 bases in length. The exogenous sequence can be 1-10 bases in length, 2-10 bases in length, 3-10 bases in length, 5-10 bases in length, 1-5 bases in length, or 1-15 bases in length. The exogenous sequence can be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, The exogenous sequence can be 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 115, 120, 125, 150, 175, 200, 225, or 250 bases in length.The exogenous sequence may be approximately 200bp, 250bp, 300bp, 350bp, 400bp, 450bp, 500bp, 550bp, 600bp, 650bp, 700bp, 750bp, 800bp, 850bp, 900bp, 1kb, 1.1kb, 1.2kb, 1.3kb, 1.4kb, 1.5kb, 1.6kb, 1.7kb, 1.8kb, 1.9kb, 2.0kb, 2.1kb, 2.2kb, 2.3kb, 2.4kb, 2.5kb, 2.6kb, 2.7kb, 2.8kb, 2.9kb, 3kb, 3.1kb, 3.2kb, 3.3kb, 3.4kb, 3.5kb, 3.6kb, 3.7kb, 3.8kb, 3.9 ...1kb, 3.2 The template may be greater than 5kb, 3.6kb, 3.7kb, 3.8kb, 3.9kb, 4.0kb, 4.1kb, 4.2kb, 4.3kb, 4.4kb, 4.5kb, 4.6kb, 4.7kb, 4.8kb, 4.9kb, 5.0kb, 5.1kb, 5.2kb, 5.3kb, 5.4kb, 5.5kb, 5.6kb, 5.7kb, 5.8kb, 5.9kb, 6.0kb, 6.1kb, 6.2kb, 6.3kb, 6.4kb, 6.5kb, 6.6kb, 6.7kb, 6.8kb, 6.9kb, 7.0kb or any size between these sizes.

[0070] In instances where multiple exogenous sequences are introduced, the multiple exogenous sequences may have different sizes, for example, a first exogenous sequence may be 100 bases or more and a second exogenous sequence may be 100 bases or more, or a first foreign sequence may be 100 bases or more and a second foreign sequence may be 100 bases or less (e.g., 1-100 bases in length).

[0071] Generally, the plasmid donor template is a circular DNA plasmid. In some cases, the plasmid donor template is a double-stranded plasmid. In some cases, the plasmid donor template is a single-stranded plasmid. In some cases, the plasmid donor template is a minicircle. In some cases, the plasmid donor template is a nanoplasmid.

[0072] The CDL target sequence and / or HDR template components (e.g., homology arms, gene of interest, etc.) can be introduced into any form of dsDNA template, including linear dsDNA sequences produced by PCR, restriction enzyme digestion, or any other linearization method, as well as circular dsDNA sequences, such as plasmids. In the case of a plasmid, the CDL target sequence can be cloned into the plasmid outside of the homology arms and DNA insertion region, including but not limited to the region adjacent to the end(s) of the homology arm(s). As with linear dsDNA templates, a DNA-binding protein complex (e.g., RNP made from Cas9 and gRNA) is briefly incubated with the plasmid DNA template to allow binding of the DNA plasmid by the RNP prior to introduction (e.g., electroporation) into the cell. See, for example, Figures 1, 2, and 10B of International Patent Application No. WO2018232356 and paragraph

[0100] of International Patent Application No. WO2019084552.

[0073] The plasmid donor template may further comprise one or more additional spacer sequences between the CDL target sequence and the HDR template. In some embodiments, the spacer sequence may have at least 2 nucleotides, e.g., 2 to 24 nucleotides (e.g., 2 to 22, 2 to 20, 2 to 18, 2 to 16, 2 to 14, 2 to 12, 2 to 10, 2 to 8, 2 to 6, 2 to 4, 4 to 24, 6 to 24, 8 to 24, 10 to 24, 12 to 24, 14 to 24, 16 to 24, 18 to 24, 20 to 24, or 22 to 24 nucleotides; 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides).

[0074] VII. Targetable Nucleases As described above, in some embodiments of the compositions and methods described herein, the targetable nuclease is an RNA-guided nuclease (e.g., a Cas protein). The targetable nuclease can recognize the sequence of a cognate nucleic acid sequence (e.g., a target gene and / or a CDL target sequence in a genome) and bind to and modify the cognate nucleic acid sequence. In other embodiments, the targetable nuclease can be a fusion protein that includes a protein that can bind to the cognate nucleic acid sequence and a protein that can modify the cognate nucleic acid sequence (e.g., a nuclease, a transcriptional activator, or a repressor).

[0075] In some embodiments, the targetable nuclease has nuclease activity.For example, the targetable nuclease can modify the homologous nucleic acid sequence by cleaving the homologous nucleic acid sequence.The cleaved homologous nucleic acid sequence can then undergo homologous recombination (e.g., via HMEJ) with a nearby homology-directed repair (HDR) template (e.g., the HDR template that provides the plasmid donor template).For example, Cas nuclease can guide the cleavage of one or both strands at a position of the homologous nucleic acid sequence. Non-limiting examples of Cas nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Cas nucleases include Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, homologs, variants, mutants, and derivatives thereof. There are three major types of Cas nucleases (type I, type II, and type III), with ten subtypes including five type I, three type II, and two type III proteins (see, e.g., Hochstrasser and Doudna, Trends Biochem Sci, 2015:40(1):58-66). Type II Cas nucleases include Cas1, Cas2, Csn2, Cas9, and Cfp1. These Cas nucleases are well known to those skilled in the art. For example, the amino acid sequence of the wild-type Cas9 polypeptide of Streptococcus pyogenes is described, for example, in NBCI reference sequence number NP_269215, and the amino acid sequence of the wild-type Cas9 polypeptide of Streptococcus thermophilus is described, for example, in NBCI reference sequence number WP_011681470.

[0076] Cas nucleases, such as Cas9 nuclease, are known to be effective in the treatment of various bacterial infections including Veillonella atypical, Fusobacterium nucleatum, Filifactor alocis, Solobacterium moorei, Coprococcus catus, Treponema denticola, Peptoniphilus duerdenii, Catenibacterium mitsuokai, Streptococcus mutans, Listeria innocua, Staphylococcus pseudintermedius, and Staphylococcus pneumoniae. pseudintermedius, Acidaminococcus intestine, Olsenella uli, Oenococcus kitaharae, Bifidobacterium bifidum, Lactobacillus rhamnosus, Lactobacillus gasseri, Finegoldia magna, Mycoplasma mobile, Mycoplasma gallisepticum, Mycoplasma ovipneumoniae, Mycoplasma canis canis, Mycoplasma synoviae, Eubacterium rectale, Streptococcus thermophilus, Eubacterium doricumdolichum, Lactobacillus coryniformis subsp. Torquens, Ilyobacter polytropus, Ruminococcus albus, Akkermansia muciniphila, Acidothermus cellulolyticus, Bifidobacterium longum, Bifidobacterium dentium, Corynebacterium diphtheria, Elusimicrobium minutum, Nitratifractor salus ginseng salsuginis, Sphaerochaeta globus, Fibrobacter succinogenes subsp. succinogenes, Bacteroides fragilis, Capnocytophaga ochracea, Rhodopseudomonas palustris, Prevotella micans, Prevotella ruminicola, Flavobacterium columnare, Aminomonas paucivorans, Rhodospirillum rubrum rubrum, Candidatus Puniceispirillum marinum, Verminephrobacter eiseniae, Ralstonia szygiisyzygii, Dinoroseobacter shibae, Azospirillum, Nitrobacter hamburgensis, Bradyrhizobium, Wolinella succinogenes, Campylobacter jejuni subsp. jejuni, Helicobacter mustelae, Bacillus cereus, Acidovorax ebreus, Clostridium perfringens, Parvibaculum labamentivorans, The bacterial strains may be derived from a variety of bacterial species, including, but not limited to, Bacillus subtilis, Bacillus oryzae, Bacillus subtilis, Bacillus anguineus, Bacillus subtilis, Bacillus moniliformis ...

[0077] Cas9 protein refers to an RNA-guided double-stranded DNA-binding nuclease protein or nickase protein. Wild-type Cas9 nuclease has two functional domains, e.g., RuvC and HNH, that cleave different DNA strands. Cas9 can induce double-stranded breaks in genomic DNA (target DNA) when both functional domains are active. Cas9 enzyme is a nuclease that is active in Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacter, and other organisms. The Cas9 protein may comprise one or more catalytic domains of a Cas9 protein derived from bacteria belonging to the group consisting of: Bacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, and Campylobacter. In some embodiments, the Cas9 protein is a fusion protein, e.g., the two catalytic domains are derived from different bacterial species.

[0078] In some embodiments, the Cas protein can be a Cas protein mutant. For example, a useful mutant of the Cas9 nuclease is RuvC - or HNH -It may contain a single inactive catalytic domain, such as an enzyme or nickase. Cas9 nickase has only one active functional domain and can create a single-strand break or nick by cleaving only one strand of a cognate nucleic acid sequence. In some embodiments, the Cas9 nuclease can be a mutant Cas9 nuclease with one or more amino acid mutations. For example, a mutant Cas9 with at least a D10A mutation is a Cas9 nickase. In other embodiments, a mutant Cas9 nuclease with at least a H840A mutation is a Cas9 nickase. Other examples of mutations present in Cas9 nickase include, but are not limited to, N854A and N863A. When at least two DNA-targeting RNAs that target opposite DNA strands are used, Cas9 nickase can be used to introduce a double-strand break. The double-stranded break induced by the double nick can be repaired by NHEJ or HDR (Ran et al., 2013, Cell, 154:1380-1389). Non-limiting examples of Cas9 nucleases or nickases are described, for example, in U.S. Patent Nos. 8,895,308, 8,889,418, and 8,865,406, and U.S. Patent Publication Nos. 2014 / 0356959, 2014 / 0273226, and 2014 / 0186919. Cas9 nucleases or nickases may be codon-optimized for the target cell or organism.

[0079] In some embodiments, the Cas protein mutant lacks cleavage (e.g., complete cleavage or nickase) activity. The Cas protein mutant may include one or more point mutations that eliminate the nickase activity of the protein. In some embodiments, the Cas protein mutant may be fused to other proteins and function as a targeting domain to guide the other proteins to a target nucleic acid. For example, a Cas protein mutant lacking cleavage activity may be fused to a transcription activation or repression domain that controls gene expression (Ma et al., Protein and Cell, 2(11):879-888, 2011; Maeder et al., Nature Methods, 10:977-979, 2013; and Konermann et al., Nature, 517:583-588, 2014). A Cas protein mutant lacking cleavage activity may be used to target genomic regions, resulting in transcriptional regulation by RNA. In some embodiments, a Cas protein mutant lacking any cleavage activity may be used to target an exogenous protein to a target nucleic acid. The exogenous protein may be fused to the Cas protein mutant. The exogenous protein may be an effector protein domain. The exogenous protein may be a transcription activator or a transcription repressor. Other examples of exogenous proteins include, but are not limited to, VP64-p65-Rta (VPR), VP64, P65, Krab, ten-eleven translocation (TET) methylcytosine dioxygenase, and DNA methyltransferase (DNMT). Specific Cas protein mutants that lack cleavage (e.g., nickase) activity are also described below.

[0080] In some embodiments, the Cas nuclease can be a high fidelity or enhanced specificity Cas9 polypeptide variant with reduced off-target effects and potent on-target cleavage. Non-limiting examples of Cas9 polypeptide variants with enhanced on-target specificity include the SpCas9(K855A), SpCas9(K810A / K1003A / R1060A) (also referred to as eSpCas9(1.0)), and SpCas9(K848A / K1003A / R1060A) (also referred to as eSpCas9(1.1)) variants described in Slaymaker et al., Science, 351(6268):84-8 (2016), as well as the SpCas9(K855A), SpCas9(K810A / K1003A / R1060A) (also referred to as eSpCas9(1.0)) variants described in Kleinstiver et al., Science, 351(6268):84-8 (2016), which contain one, two, three, or four N497A, R661A, Q695A, and Q926A mutations. et al., Nature, 529(7587):490-5 (2016) (e.g., SpCas9-HF1 contains all four mutations).

[0081] In some embodiments, the targetable nuclease can also be a fusion protein that includes a protein that can bind to a cognate nucleic acid sequence and a protein that can cleave the cognate nucleic acid sequence. For example, the protein that can recognize and bind to a cognate nucleic acid sequence can be a Cas protein mutant that does not have any cleavage activity. The Cas protein that does not have any cleavage activity can be a Cas9 polypeptide that includes two suppressing mutations (D10A and H840A) in the RuvC1 and HNH nuclease domains, which is also called dCas9 (Jinek et al., Science, 2012, 337:816-821, and Qi et al., Cell, 152(5):1173-1183). In one embodiment, the dCas9 polypeptide from Streptococcus pyogenes comprises at least one mutation at positions D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, A987, or any combination thereof. Descriptions of such dCas9 polypeptides and variants thereof are provided, for example, in International Patent Application No. WO2013 / 176772. The dCas9 enzyme may comprise a mutation at D10, E762, H983, or D986, in addition to a mutation at H840 or N863. In some cases, the dCas9 enzyme may comprise a D10A or D10N mutation. The dCas9 enzyme may also comprise H840A, H840Y, or H840N. In some embodiments, the dCas9 enzyme comprises the substitutions D10A and H840A, D10A and H840Y, D10A and H840N, D10N and H840A, D10N and H840Y, or D10N and H840N. The substitutions can be conservative or non-conservative that render the Cas9 polypeptide catalytically inactive and capable of binding to the cognate nucleic acid sequence.

[0082] In other embodiments, the protein capable of recognizing and binding to a cognate nucleic acid sequence can be a transcription activator-like (TAL) effector DNA-binding protein or a zinc finger DNA-binding protein. TAL effector DNA-binding proteins typically have a central domain that is 33-35 amino acids long and includes a DNA-binding tandem repeat sequence that includes two hypervariable amino acid residues at positions 12 and 13 that can recognize one or more specific DNA base pairs. Zinc finger DNA-binding proteins have a DNA-binding motif that is characterized by the presence or absence of one or more zinc ions to coordinate and stabilize the folding of the motif. Zinc finger DNA-binding proteins include multiple finger-like projections that make tandem contacts with the target molecule. Some zinc finger DNA-binding proteins also form salt bridges to stabilize the finger-like fold. They were first identified as the DNA-binding motif of the transcription factor TFIIIA from Xenopus laevis, but are now recognized to bind DNA, RNA, protein, and / or lipid substrates.

[0083] In some embodiments, the targetable nuclease in the compositions and methods described herein can be a fusion protein comprising a TAL effector DNA binding protein and a protein capable of cleaving a cognate nucleic acid sequence (also referred to as a "transcription activator-like effector nuclease (TALEN)"). In other embodiments, the targetable nuclease in the compositions and methods described herein can be a fusion protein comprising a zinc finger DNA binding protein and a protein capable of cleaving a cognate nucleic acid sequence. For example, the protein capable of cleaving a cognate nucleic acid sequence can be a wild-type or mutated FokI endonuclease or the catalytic domain of FokI. Detailed descriptions of TALENs and their use for gene editing can be found, for example, in U.S. Pat. Nos. 8,440,431, 8,440,432, 8,450,471, 8,586,363, and 8,697,853, as well as Scharenberg et al., Curr Gene Ther, 2013, 13(4):291-303; Gaj et al., Nat Methods, 2012, 9(8):805-7; Beurdeley et al., Nat Commun, 2013, 4:1762; and Joung and Sander, Nat Rev Mol Cell Biol, 2013, 14(1):49-55.Examples of zinc finger DNA binding proteins fused to proteins capable of cleaving a target nucleic acid are described in the art, see Urnov et al., Nature Reviews Genetics, 2010, 11:636-646 and Gaj et al., Nat Methods, 2012, 9(8):805-7, U.S. Patent Nos. 6,534,261, 6,607,882, 6,746,838, 6,794,136, 6,824,978, 6,866,997, 6,933,113, 6,979,539, 7,013,219, 7,030,215, 7,020,220, and 7,030,215. Nos. 7,220,719, 7,241,573, 7,241,574, 7,585,849, 7,595,376, 6,903,185, 6,479,626, and U.S. Application Publication Nos. 2003 / 0232410 and 2009 / 0203140.

[0084] In other embodiments, the targetable nuclease does not have nuclease activity. For example, the targetable nuclease (e.g., the targetable nuclease without any nuclease activity) can regulate the expression of the homologous nucleic acid sequence. In some embodiments, the targetable nuclease can be a fusion protein that includes a protein that can bind to the homologous nucleic acid sequence, such as a Cas protein mutant (e.g., dCas9) that does not have any cleavage activity described above, a TAL effector DNA binding protein, and a zinc finger DNA binding protein, and a protein that can modify the homologous nucleic acid sequence, such as a transcription activator or repressor.

[0085] Targetable nucleases can also be fused to localization peptides or proteins. For example, targetable nucleases can be fused to one or more nuclear localization signal (NLS) sequences, which can guide targetable nucleases and the RNP complexes they form to the nucleus and modify cognate nucleic acid sequences. Examples of NLS sequences include those well known in the art, such as those described in Lange et al., J Biol Chem.282(8):5101-5,2007, and include, but are not limited to, AVKRPAATKKAGQAKKKKLD, MSRRRKANPTKLSENAKKLAKEVEN, PAAKRVKLD, KLKIKRPVK, and PKKKRKV. Other examples of peptides or proteins that can be used for targetable nucleases, such as cell penetrating peptides and cell targeting peptides, are available in the art, for example, those described in Vives et al., Biochim Biophys Acta. 1786(2):126-38, 2008.

[0086] The targetable nuclease that modifies the target nucleic acid (e.g., a genomic target sequence, such as a T cell genome) can be the same as the targetable nuclease that can cleave the CDL target sequence. In an illustrative, non-limiting example, the targetable nuclease that modifies the target nucleic acid and the targetable nuclease that can cleave the CDL target sequence are both Cas9 proteins. The targetable nuclease that modifies the target nucleic acid can be separate from the targetable nuclease that can cleave the CDL target sequence. For example, the targetable nuclease that modifies the target nucleic acid can be a Cas9 protein, and the targetable nuclease that can cleave the CDL target sequence can be a TALEN, ZFN, or non-Cas9 protein. In other examples, the targetable nuclease that modifies the target nucleic acid can be a TALEN, ZFN, or non-Cas9 protein, and the targetable nuclease that can cleave the CDL target sequence can be a Cas9 protein.

[0087] The targetable nuclease capable of cleaving the first CDL target sequence can be the same as the targetable nuclease capable of cleaving the second CDL target sequence. In an illustrative non-limiting example, the targetable nuclease capable of cleaving the first CDL target sequence and the targetable nuclease capable of cleaving the second CDL target sequence are both Cas9 proteins. The targetable nuclease capable of cleaving the first CDL target sequence can be separate from the targetable nuclease capable of cleaving the second CDL target sequence. For example, the targetable nuclease capable of cleaving the first CDL target sequence can be a Cas9 protein, and the targetable nuclease capable of cleaving the second CDL target sequence can be a TALEN, ZFN, or non-Cas9 protein. In other examples, the targetable nuclease capable of cleaving a first CDL target sequence can be a TALEN, ZFN, or non-Cas9 protein, and the targetable nuclease capable of cleaving a second CDL target sequence can be a Cas9 protein.

[0088] VIII. CDL Target Sequence A co-delivered linearization (CDL) target sequence is a nucleotide sequence that is recognized and bound by a targetable nuclease that can cleave the CDL target sequence. In the compositions and methods described herein, the CDL target sequence flanks the HDR template, which can be linearized or excised from the plasmid donor template. Without being bound by theory, the linearized / excised HDR template can facilitate homology-mediated end joining (HMEJ), while delivery as a plasmid can reduce cytotoxicity. Thus, the CDL target sequence helps to improve knock-in cell yield, such as through improved homology-directed repair efficiency and / or reduced cytotoxicity.

[0089] In some embodiments, the CDL target sequence can be directly recognized and bound by a DNA binding protein, such as a TAL effector DNA binding protein or a zinc finger DNA binding protein. In other embodiments, the CDL target sequence can be indirectly recognized and bound via the donor gRNA by a DNA binding protein, such as an RNA-guided nuclease. In some embodiments, at least 60% (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 97%) of the nucleotides in the CDL target sequence can participate in Watson-Crick base pairing with the corresponding nucleotides in the donor gRNA. In some embodiments, the CDL target sequence can have at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) mismatched nucleotide with the corresponding nucleotide in the donor gRNA when the CDL target sequence and the donor gRNA are hybridized. Examples of mismatched bases include guanine and uracil, guanine and thymine, and adenine and cytosine pairings. In some embodiments, the CDL target sequence is part of a target nucleic acid (eg, a genomic target of a cell).

[0090] Generally, the CDL target sequence is present at both ends of the HDR template in the plasmid donor template as described above. The CDL target sequence and the corresponding PAM in the plasmid donor template in the case of the Cas system may have different configurations as described above. In some embodiments, the CDL target sequence is complementary to equal-length portions of the sequence of the donor gRNA. In some embodiments, the CDL target sequence has at least 17 nucleotides, e.g., 17-20 nucleotides (e.g., 17-19, 17-18, 18-20, 18-19, or 17, 18, 19, or 20 nucleotides). In some embodiments, the CDL target sequence is partially complementary, i.e., contains nucleotide mismatches to equal-length portions of the sequence of the donor gRNA. For example, a DNA-binding protein target sequence having 20 nucleotides may have 1-6 nucleotide mismatches (e.g., 1-5, 1-4, 1-3, 1-2; 1, 2, 3, 4, 5, or 6 nucleotide mismatches) to a 20 nucleotide portion of the sequence of the donor gRNA.

[0091] IX. Gene-targeting nucleic acids in cells The compositions described herein may be used in methods of modifying target nucleic acids in cells, such as eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, etc. Optionally, the cell is a mammalian cell, such as a human cell. The cell may be in vitro, ex vivo, or in vivo. The cell may also be a primary cell, a germ cell, a stem cell, or a progenitor cell. The progenitor cell may be, for example, a pluripotent stem cell or a hematopoietic stem cell. In some embodiments, the cell is a primary hematopoietic cell, a primary hematopoietic stem cell, or a primary T cell. In some embodiments, the primary hematopoietic cell is an immune cell. In some embodiments, the immune cell is a T cell. In some embodiments, the T cell is a regulatory T cell, an effector T cell, or a naive T cell. In some embodiments, the T cell is a CD4 + In some embodiments, the T cells are CD8 +In some embodiments, the T cells are CD4 + CD8 + In some embodiments, the T cells are CD4 - CD8 - In some embodiments, the T cells are αβ T cells, and in some embodiments, the T cells are γδ T cells. Provided are any population of cells modified by any of the methods described herein. In some embodiments, the method further comprises expanding the population of modified cells.

[0092] In certain embodiments, a population of cells (e.g., a population of T cells) is provided. The population of cells may comprise any of the modified cells described herein. The modified cells may be a heterogeneous population of cells and / or within a heterogeneous population of various cell types. The population of cells may be heterogeneous with respect to the percentage of genome edited cells. The population of cells may comprise more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, or more than 90% of the population of cells comprising the integrated nucleotide sequence. In certain aspects, a population of cells comprises an integrated nucleotide sequence comprising at least a portion of a gene, the integrated nucleotide sequence being integrated at an endogenous genomic target locus and oriented such that at least a portion of the gene can be expressed, the population of cells being substantially free of viral-mediated delivery components, and wherein greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80%, or greater than 90% of the cells in the population comprise the integrated nucleotide sequence.

[0093] The population of cells may comprise more than 91%, more than 92%, more than 93%, more than 94%, more than 95%, more than 96%, more than 97%, more than 98%, more than 99%, more than 99.5%, or more than 99.9% of the population of cells comprising the integrated nucleotide sequence. The population of cells may comprise more than 20% of the population comprising the integrated nucleotide sequence. The population of cells may comprise more than 30% of the population comprising the integrated nucleotide sequence. The population of cells may comprise more than 60% of the population comprising the integrated nucleotide sequence. The population of cells may comprise more than 70% of the population comprising the integrated nucleotide sequence.

[0094] The cell may include a cell that includes a sequence that is inserted non-virally, such as an exogenous sequence. The cell may be virus-free. The cell may be substantially virus-free. The cell may include at least one nucleic acid sequence that is inserted non-virally into at least one target region (e.g., including at least one heterologous gene). In some embodiments, the cell does not include a viral vector for introducing at least one nucleic acid sequence, such as a donor template.

[0095] The cell may comprise one or more primary cells that comprise a non-virally inserted exogenous sequence having a size of at least 200 base pairs.The primary cell may be a primary hematopoietic cell or a primary hematopoietic stem cell.The primary cell may be a primary hematopoietic cell, and the primary hematopoietic cell may be an immune cell.The immune cell may be a T cell.The primary cell may be a human cell.In some embodiments, the primary cell does not comprise a viral vector. The sizes of the exogenous sequences are approximately 200bp, 250bp, 300bp, 350bp, 400bp, 450bp, 500bp, 550bp, 600bp, 650bp, 700bp, 750bp, 800bp, 850bp, 900bp, 1kb, 1.1kb, 1.2kb, 1.3kb, 1.4kb, 1.5kb, 1.6kb, 1.7kb, 1.8kb, 1.9kb, 2.0kb, 2.1kb, 2.2kb, 2.3kb, 2.4kb, 2.5kb, 2.6kb, 2.7kb, 2.8kb, 2.9kb, 3.0kb, 3.1kb, 3.2kb, 3.3kb, 3.4kb, 3.5kb, 3.6kb, 3.7kb, 3.8kb, 3.9 ... The length may exceed a length selected from the group consisting of 4kb, 2.5kb, 2.6kb, 2.7kb, 2.8kb, 2.9kb, 3kb, 3.1kb, 3.2kb, 3.3kb, 3.4kb, 3.5kb, 3.6kb, 3.7kb, 3.8kb, 3.9kb, 4.0kb, 4.1kb, 4.2kb, 4.3kb, 4.4kb, 4.5kb, 4.6kb, 4.7kb, 4.8kb, 4.9kb, and 5.0kb. The size of the exogenous sequence may be greater than 1.5kb. The size of the exogenous sequence may be about 200 bp to about 500 bp, about 200 bp to about 750 bp, about 200 bp to about 1 kb, about 200 bp to about 1.5 kb, about 200 bp to about 2.0 kb, about 200 bp to about 2.5 kb, about 200 bp to about 3.0 kb, about 200 bp to about 3.5 kb, about 200 bp to about 4.0 kb, about 200 bp to about 4.5 kb, about 200 bp to about 5.0 kb. The size of the exogenous sequence may be greater than about 1 kb. The exogenous sequence may include a regulatory sequence, and optionally, the regulatory sequence includes a promoter sequence and / or an enhancer sequence.

[0096] The exogenous sequence may encode a heterologous protein or a fragment thereof. The exogenous sequence may encode a chimeric antigen receptor (CAR). The exogenous sequence may encode a T cell receptor (TCR).

[0097] The cells may include primary human T cells that contain a non-virally inserted DNA template having a size greater than 1 kb.

[0098] The cells can include primary human T cells that include at least one nucleic acid sequence that includes at least one heterologous gene non-virally inserted into at least one target region of one or both of an endogenous T cell receptor alpha subunit constant gene (TRAC) and an endogenous T cell receptor beta subunit constant gene (TRBC), the at least one heterologous gene including at least one of (1) a variable region of a heterologous T cell receptor alpha (TCR-α) chain gene, and (2) a variable region of a heterologous T cell receptor beta (TCR-β) chain gene. In some embodiments, the T cells do not include a viral vector for introducing the at least one nucleic acid sequence into the T cells. In some embodiments, the at least one nucleic acid sequence has a size of at least 1.5 kb. In some embodiments, the at least one nucleic acid sequence has a size of at least 500 bp. In some embodiments, the target region is in exon 1, 2, or 3 of TRAC. In some embodiments, the target region is in exon 1, 2, or 3 of TRBC. In some embodiments, the T cells are CD8+ T cells or CD4+ T cells. In some embodiments, the at least one heterologous gene comprises at least one of (1) a) a variable region or b) a variable region and a constant region of a heterologous T cell receptor alpha (TCR-α) chain gene, and (2) a) a variable region or b) a variable region and a constant region of a heterologous T cell receptor beta (TCR-β) chain gene. In some embodiments, the at least one heterologous gene comprises each of (1) a) a variable region or b) a variable region and a constant region of a heterologous T cell receptor alpha (TCR-α) chain gene, and (2) a) a variable region or b) a variable region and a constant region of a heterologous T cell receptor beta (TCR-β) chain gene. In some embodiments, the T cell comprises each of (1) a) a variable region or b) a variable region and a constant region of a heterologous TCR-α chain gene, and (2) a) a variable region or b) a variable region and a constant region of a heterologous TCR-β chain gene. In some embodiments, the heterologous gene, upon expression, forms an antigen-specific T cell receptor (TCR).In some embodiments, the heterologous TCR-α chain gene and the heterologous TCR-β chain gene are operably linked by a linker sequence, optionally the linker sequence being a cleavable linker sequence or a multicistronic element. In some embodiments, the heterologous TCR-α chain gene and the heterologous TCR-β chain gene are inserted into TRAC. In some embodiments, expression of at least one heterologous gene is driven by an endogenous promoter. In some embodiments, expression of one or both of TRAC and TRBC is decreased in the cells compared to control T cells, and the control T cells are primary human T cells lacking a non-viral insert.

[0099] The cells can include primary human T cells comprising at least one nucleic acid sequence comprising at least one heterologous gene inserted into at least one target region of one or both of an endogenous T cell receptor alpha subunit constant gene (TRAC) and an endogenous T cell receptor beta subunit constant gene (TRBC), wherein the at least one heterologous gene comprises at least one of (1) a variable region of a heterologous T cell receptor alpha (TCR-α) chain gene, and (2) a variable region of a heterologous T cell receptor beta (TCR-β) chain gene, and the T cells do not comprise a viral vector for introducing the at least one nucleic acid sequence into the T cells.

[0100] The cell may include a primary cell comprising at least one nucleic acid sequence comprising at least one heterologous gene non-virally inserted into at least one target region of the genome of the cell. In some embodiments, the at least one heterologous gene encodes a CAR or other chimeric receptor. In some embodiments, the at least one heterologous gene comprises at least one or both of (1) a variable region of a heterologous T cell receptor alpha (TCR-α) chain gene and (2) a variable region of a heterologous T cell receptor beta (TCR-β) chain gene. In some embodiments, the primary cell is a T cell. In some embodiments, the cell does not comprise a viral vector for introducing the at least one nucleic acid sequence into the cell. In some embodiments, the at least one nucleic acid sequence has a size of at least 1.5 kb. In some embodiments, the at least one nucleic acid sequence has a size of at least 500 bp. In some embodiments, the target region is in TRAC, e.g., exon 1, 2, or 3 of TRAC. In some embodiments, the target region is in TRBC, e.g., exon 1, 2, or 3 of TRBC. In some embodiments, the T cells are CD8+ T cells or CD4+ T cells. In some embodiments, expression of at least one heterologous gene is driven by an endogenous promoter. In some embodiments, expression of one or both of TRAC and TRBC is decreased in the T cells compared to control T cells, and the control T cells are primary human T cells lacking a non-viral insert.

[0101] In some cases, CARs are referred to as first generation, second generation, and / or third generation CARs. In some embodiments, first generation CARs are CARs that provide only a CD3 chain-induced signal upon antigen binding. In some embodiments, second generation CARs are those that provide such a signal as well as a costimulatory signal, e.g., those that include an intracellular signaling domain from a costimulatory receptor such as CD28 or CD137. In some embodiments, third generation CARs of some embodiments are those that include multiple costimulatory domains of different costimulatory receptors. In some embodiments, the chimeric antigen receptor comprises an extracellular portion that includes an antibody or fragment described herein. In some embodiments, the chimeric antigen receptor comprises an extracellular portion that includes an antibody or fragment described herein and an intracellular signaling domain. In some embodiments, the antibody or fragment comprises an scFv or single domain VH antibody, and the intracellular domain comprises an ITAM. In some embodiments, the intracellular signaling domain comprises the signaling domain of the zeta chain of CD3 (CD3 zeta chain). In some embodiments, the chimeric antigen receptor comprises a transmembrane domain that links the extracellular domain and the intracellular signaling domain. In some embodiments, the transmembrane domain comprises the transmembrane portion of CD28. The extracellular domain and the transmembrane may be directly or indirectly linked. In some embodiments, the extracellular domain and the transmembrane are linked by a spacer as described herein. In some embodiments, the chimeric antigen receptor comprises an intracellular domain of a T cell costimulatory molecule, such as between the transmembrane domain and the intracellular signaling domain. In some embodiments, the T cell costimulatory molecule is CD28 or 41BB. In some embodiments, the CAR comprises an antibody, e.g., an antibody fragment, a transmembrane domain that is or comprises a transmembrane portion of CD28 or a functional variant thereof, and an intracellular signaling domain that comprises a signaling portion of CD28 or a functional variant thereof and a signaling portion of CD3 zeta or a functional variant thereof.In some embodiments, the CAR comprises an antibody, e.g., an antibody fragment, a transmembrane domain that is or includes a transmembrane portion of CD28 or a functional variant thereof, and an intracellular signaling domain that includes a signaling portion of 4-1BB or a functional variant thereof and a signaling portion of CD3 zeta or a functional variant thereof. In some such embodiments, the receptor further comprises a spacer that includes a portion of an Ig molecule, such as a hinge-only spacer, e.g., a human Ig molecule, such as an Ig hinge, e.g., an IgG4 hinge. In some embodiments, the transmembrane domain of the receptor, e.g., the CAR, is a transmembrane domain of human CD28 or a variant thereof, e.g., the 27 amino acid transmembrane domain of human CD28 (Accession Number: P10747.1). In some embodiments, the chimeric antigen receptor comprises an intracellular domain of a T cell costimulatory molecule. In some embodiments, the T cell costimulatory molecule is CD28 or 41BB. In some embodiments, the intracellular signaling domain comprises the intracellular costimulatory signaling domain of human CD28 or a functional variant or portion thereof, such as the 41 amino acid domain thereof and / or such a domain having an LL to GG substitution at positions 186-187 of the native CD28 protein. In some embodiments, the intracellular domain comprises the intracellular costimulatory signaling domain of 41BB or a functional variant or portion thereof, such as the 42 amino acid cytoplasmic domain of human 4-1BB (Accession Number: Q07011.1) or a functional variant or portion thereof. In some embodiments, the intracellular signaling domain comprises the human CD3 zeta stimulatory signaling domain or a functional variant thereof, such as the 112 AA cytoplasmic domain of human CD3 zeta isoform 3 (Accession Number: P20963.2) or the CD3 zeta signaling domain, as described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.

[0102] The method for modifying a target nucleic acid in a cell described herein comprises introducing a composition described herein into the cell, and the HDR template is incorporated into the target nucleic acid.As demonstrated in the examples, pre-incubating a targetable nuclease (e.g., an RNA-guided nuclease) and a donor gRNA RNP complex with a donor template (including a CDL target sequence modified HDR template) before introducing the composition into the cell increases the yield of knockout cells.In some embodiments, the composition described herein is introduced into the cell by electroporation.

[0103] In some cases, cells are taken from a subject, modified using any of the methods described herein, and administered to the subject. In other cases, the compositions described herein can be delivered to a subject in vivo. See, e.g., U.S. Pat. No. 9,737,604 and Zhang et al. "Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy", NPG Asia Materials Volume 9, page e441 (2017).

[0104] In certain embodiments, the compositions described herein may be used in a method of modifying a target nucleic acid in a primary cell. The compositions described herein may be used in a method of inducing stable genetic modification of a target nucleic acid in a primary cell. In some embodiments, the method includes introducing a composition comprising a Cas protein (e.g., a Cas9 protein), one or more single-stranded guide RNAs (sgRNAs), and an anionic polymer into the primary cell. The sgRNA may include a first nucleotide sequence that is complementary to the target nucleic acid and a second nucleotide sequence that interacts with the Cas protein (e.g., a Cas9 protein). In some embodiments, the Cas protein (e.g., a Cas9 protein) and the sgRNA may be incubated together to form an RNP complex before being introduced into the primary cell. The composition comprising the Cas protein (e.g., a Cas9 protein), one or more single-stranded guide RNAs (sgRNAs), and a plasmid donor template may be electroporated into the primary cell. In some embodiments, the primary cells are selected from the group consisting of immune cells (e.g., primary T cells), blood cells, their progenitor or stem cells, mesenchymal cells, and combinations thereof. In some cases, the immune cells are selected from the group consisting of T cells, B cells, dendritic cells, natural killer cells, macrophages, neutrophils, eosinophils, basophils, mast cells, their precursors, and combinations thereof. The progenitor or stem cells may be selected from the group consisting of hematopoietic progenitor cells, hematopoietic stem cells, and combinations thereof. In some cases, the blood cells are blood stem cells. In some cases, the mesenchymal cells are selected from the group consisting of mesenchymal stem cells, mesenchymal progenitor cells, mesenchymal precursor cells, differentiated mesenchymal cells, and combinations thereof. The differentiated mesenchymal cells may be selected from the group consisting of bone cells, chondrocytes, muscle cells, adipocytes, stromal cells, fibroblasts, dermal cells, and combinations thereof. In some embodiments, the primary cells may comprise a population of primary cells. In some cases, the population of primary cells comprises a heterogeneous population of primary cells. In other cases, the population of primary cells comprises a homogenous population of primary cells.

[0105] In some embodiments, the primary cells are isolated from a mammal before the composition described herein is introduced into the primary cells. For example, the primary cells can be taken from a human subject. In some cases, the composition described herein is introduced into the primary cells, and then the primary cells or their progeny are returned to the mammal. In other words, the genetically modified primary cells undergo autologous transplantation. In other cases, the genetically modified primary cells undergo allogeneic transplantation. For example, primary cells that have not undergone stable genetic modification are isolated from a donor subject, and then the genetically modified primary cells are transplanted into a recipient subject that is different from the donor subject.

[0106] The compositions described herein can be introduced into cells (e.g., primary cells) using methods and techniques available in the art. Non-limiting examples of suitable methods include electroporation, particle gun technology, and direct microinjection. In some embodiments, the step of introducing the compositions described herein into the cells comprises electroporating the composition into the cells.

[0107] In some embodiments, stable genetic modification of the target nucleic acid is induced in more than about 5% of the cell population (e.g., a primary cell population), e.g., about 6%, about 7%, about 8%, about 9%, about 10%, about 12%, about 14%, about 16%, about 18%, about 20%, about 22%, about 24%, about 26%, about 28%, or about 30% of the cell population. In some embodiments, stable genetic modification of the target nucleic acid is induced in more than about 50% of the cell population (e.g., a primary cell population), e.g., about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about Induced in 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%. In other embodiments, stable genetic modification of the target nucleic acid is induced in greater than about 70% of the cell population, e.g., about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of the cell population. In yet other embodiments, stable genetic modification of the target nucleic acid is induced in greater than about 90% of the cell population, e.g., about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of the cell population.

[0108] In other embodiments, stable genetic modification of a target nucleic acid comprises replacing a genetic mutation in the target nucleic acid (e.g., correcting a point mutation or single nucleotide polymorphism (SNP) in a target nucleic acid associated with a disease) or inserting an open reading frame (ORF) comprising a normal copy of the target nucleic acid (e.g., knocking in a wild-type cDNA of a target nucleic acid associated with a disease).

[0109] In some embodiments, any of the methods described herein may also include purifying cells (e.g., primary cells) that have a stable genetic modification of the target nucleic acid. In some cases, the composition isolated by the purification step comprises cells that have at least about 80% stable genetic modification of the target nucleic acid, such as about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more stable genetic modification of the target nucleic acid.

[0110] The disclosed materials, compositions, and components may be used in, in combination with, in the preparation of, or are products of, the disclosed methods and compositions. These and other materials are disclosed herein, and when combinations, subsets, interactions, groups, etc. of these materials are disclosed, it is understood that each is specifically contemplated and described herein, although specific references to each of the various individual and collective combinations and permutations of these compounds cannot be expressly disclosed. For example, when a method is disclosed and discussed, and a number of modifications that can be made to a number of molecules that comprise this method are discussed, each and every combination and permutation of this method, and possible modifications, are specifically contemplated, unless specifically indicated to the contrary. Similarly, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of the present disclosure, including, but not limited to, steps in methods that use the disclosed compositions. Thus, while a variety of additional steps may be performed, it is understood that each of these additional steps may be performed with any specific method step or combination of method steps in the disclosed methods, and each such combination or subset of combinations should be considered to be specifically contemplated and disclosed.

[0111] Publications cited herein and the material for which they are cited are specifically incorporated herein by reference in their entireties. EXAMPLES

[0112] The following examples are offered by way of illustration only, and not by way of limitation. One of ordinary skill in the art will readily recognize that there are a variety of non-critical parameters that could be changed or modified to yield essentially the same or similar results.

[0113] Example 1 - Experimental Method T cell culture T cells were enriched from peripheral blood mononuclear cells (PBMCs) prepared using Lymphoprep (STEMCELL Technologies) from normal donor leukopacks (STEMCELL Technologies) using the EasySep Human T Cell Isolation Kit (STEMCELL Technologies). T cells were then activated with CD3 / CD28 Dynabeads (ThermoFisher, 40203D) at a bead-to-cell ratio of 1:1 in TexMACS medium (Miltenyi 130-197-196) supplemented with 3% human AB serum (Gemini Bio) and 12.5 ng / ml human IL-7 and IL-15 (Miltenyi, premium grade) and grown for 48 h at 37°C and 5% CO2 before electroporation.

[0114] Preparation of RNP and T cell electroporation CRISPR RNPs were prepared by combining 120 μM sgRNA (Synthego) targeting the DNA sequence AAGTCTCTCAGCTGGTACA (SEQ ID NO:1), 62.5 μM sNLS-SpCas9-sNLS protein (Aldevron), and P3 buffer (Lonza) in a ratio of 5:1:3:6. A range of masses (final concentrations ranging from 0 to 100 mg / l) of plasmid DNA (plasmids carrying HDR templates [~5.7 kb inserts encoding transgenes with Myc epitope tags and 450 bp flanking homology arms] with or without CDL sequences flanking the HDR homology arms) were mixed with 3.5 μl of RNP. T cells were counted, centrifuged at 90×G for 10 min, supplement (Lonza) was added, and resuspended in 10^6 cells / 14.5 μl of P3. 14.5 μl of the T cell suspension was added to the DNA / RNP mixture, transferred to wells on a Lonza 384-well Nucleocuvette plate and pulsed with the Lonza HT Nucleofector System with code EH-115. The cells were left to rest for 15 min at room temperature before being transferred to a 96-well plate (Sarstedt) in TexMACS medium supplemented with 12.5 ng / ml human IL-7 and IL-15 (Miltenyi, premium grade).

[0115] Flow cytometry analysis Transgene expression (gene of interest with Myc epitope tag) was detected by staining with anti-Myc antibody (Cell Signaling Technology, clone 9B11) and analysis on an Attune NxT flow cytometer. Other antibodies used were TCR alpha / beta antibody (BioLegend, clone IP26), CD4 antibody (BioLegend, clone RPA-T4), and CD8 antibody (BioLegend, clone SK1).

[0116] array CRISPR protospacer (e.g., CDL target sequence): GAGCCATGCTTGGCTTACGA

[0117] CRISPR whole site, protospacer, and exemplary PAM: GAGCCATGCTTGGCTTACGAGGG

[0118] Standard plasmid donor backbone sequence used (X indicates where the 5696 bp long transgene insert was located. Standard capital letters indicate homology arms): TIFF2024513967000002.tif120159TIFF2024513967000003.tif223160

[0119] CDL plasmid donor backbone sequence used (X indicates where the 5696 bp long transgene insert was located. Bold indicates the protospacer (CDL target sequence). Lower case italics indicate PAM. Regular capital letters indicate homology arms): TIFF2024513967000004.tif216160TIFF2024513967000005.tif128160

[0120] Example 2 - Co-delivery linearization (CDL) design for CRISPR-mediated gene editing of T cells Genetic engineering of T cells using RNP electroporation was investigated in comparison to a plasmid donor template and either (1) a homology-directed repair template cassette (HDRT) featuring a standard HDRT design of the transgene simply flanked by homology arms (Figure 1-left panel), or (2) a co-delivered linearized (CDL) design in which the HDRT is further flanked by a CDL target sequence (a CRISPR target site matching the protospacer of the CRISPR gRNA used to target the T cell genome) and a protospacer adjacent motif (PAM) (Figure 1-right panel).

[0121] As shown in Figure 2, T cells were electroporated with RNP complexes containing varying amounts of standard or CDL plasmid donor template and subsequently assessed for transgene integration by flow cytometry (Figure 2A, quantified in Table 1). The CDL design showed a higher KI% for lower doses of HDRT DNA than the standard HDRT plasmid without the CDL sequence modification (Figure 2B, quantified in Table 2). Furthermore, overall T cell yields were increased for these lower DNA doses compared to the standard HDRT plasmid (Figure 2C, quantified in Table 3). Thus, the CDL donor plasmid design demonstrated a significantly increased (P<0.0001) yield of engineered T cells compared to the standard plasmid design. Furthermore, in contrast to the standard HDRT plasmid, the ratio of CD8 to CD4 T cells was less than approximately 0.5 when using all concentrations of the CDL HDRT template tested (Figure 3, quantified in Table 4). Variability in knock-in cell yield across T cells derived from four individual donors was also assessed using standard or CDL plasmids at various doses, as percent coefficient of variation (%CV) and maximum to minimum ratio (fold max / min). Notably, at doses of 0.5 and below, the yield difference was clearly lower with the CDL design compared to the standard plasmid design (Table 5). The data demonstrated that the CDL donor plasmid design provided improved donor-to-donor yields and improved yield consistency in electroporation-mediated Cas9 T cell editing, which represents a major advantage in cell engineering processes.

[0122] Table 1. Representative flow images for quantification of knock-in percentage (Myc-tag%) TIFF2024513967000006.tif31162

[0123] Table 2. Quantification of knock-in percentage (Myc-tag%) TIFF2024513967000007.tif32161

[0124] Table 3. Quantification of knock-in cell yield TIFF2024513967000008.tif27161

[0125] Table 4. Quantification of CD8 / CD4 ratio TIFF2024513967000009.tif28161

[0126] Table 5. Variability in knock-in cell yield across multiple donors TIFF2024513967000010.tif52144

[0127] Example 3 - Performance on clinical scale platform and incorporation of CDL sequences into HDR cassettes increases the rate of transgene integration into cells after clinical scale transfection Materials and Methods Isolation and activation of primary human T cells: Fresh cell populations collected by apheresis from healthy donors were obtained from HemaCare Corporation. CD4 and CD8 T cells were isolated from the donor cell population using Miltenyi's Positive Isolation Kit for CD4 CD8 Isolation and Miltenyi's AutoMACS Pro Separator. The isolated CD4 / 8 T cells were activated after isolation using ThermoFisher Dynabeads Human T-Activator CD3 / CD28. Cells were activated in Miltenyi TexMACS medium supplemented with 3% human AB serum (Gemini Bio) and IL7 and IL15 (Miltenyi Biotech). After addition of activation medium, cells were incubated at 37°C for 48 hours.

[0128] Preparation of primary human T cells for electroporation: After activation, T cells were removed from the activation vessel and transferred to a 50 mL conical tube. The bead removal protocol provided by Miltenyi Biotech was followed to obtain a bead-free activated cell population.

[0129] Preparation of ribonucleoprotein complexes for electroporation:Single-stranded guide RNA targeting the GS94 locus was obtained from Synthego Corporation and resuspended in TE / water to working concentration. The caspase protein spCas9 was obtained from Aldevron. The guide RNA and caspase protein were complexed at room temperature to form a ribonucleoprotein (RNP) complex.

[0130] Plasmid DNA: Plasmid DNA containing the CDL sequence was designed in-house and prepared by Elim Bio.

[0131] Transfection of primary T cells via electroporation: Activated T cells prepared as above were counted and 5e7 cells were transferred per electroporation reaction to a 50 mL conical tube. Cells were pelleted at 300 x g for 5 min, then washed with DPBS and pelleted at 300 x g for 5 min. Cells were then resuspended in Lonza P3 buffer. The volume of buffer was calculated so that the total volume of cell suspension after addition of RNP and DNA was 1 mL. To evaluate the performance across multiple DNA constructs, three CDL constructs containing transgene "X" and three non-CDL constructs were selected for testing. For each construct, 20 μg of DNA was used per transfection. DNA was mixed with RNP solution and then mixed thoroughly with cell suspension. The cell, RNP, and DNA suspension were then transferred to a Lonza LV cartridge. Cells were electroporated on the Lonza LV instrument and allowed to recover for 10 min at room temperature after electroporation. The cell mixture was then transferred to a G-rex100 (Wilson Wolf Manufacturing) containing 350 mL of medium and incubated at 37°C.

[0132] Analysis of results by flow cytometry:Results were collected by flow cytometry on day 6 post-transfection or day 8 post-activation. To prepare cells for analysis, control wells were mixed to obtain a homogenous solution and counted using AOPI staining using a Nexcelom K2 Cellometer to distinguish between live and dead cells. Using the obtained value, 2e5 cells were removed from each well and transferred to a 96-well V-bottom plate. Cells were pelleted and then washed once with Stain Buffer (BD Biosciences) and pelleted at 400×g for 5 min. Staining solution was prepared during centrifugation. Flow panels include Myc PE (BioLegend) and Zombie L / D stain (BioLegend). Cells were resuspended in staining solution and incubated at 4°C for 30 min. After incubation, Stain Buffer was added to the wells and cells were pelleted at 400×g for 5 min. Cells were then washed once with Stain Buffer and resuspended in Stain Buffer supplemented with counting beads (ThermoFisher). Flow analysis was performed on a ThermoFisher Attune cytometer and results were analyzed using FlowJo software.

[0133] result Clinical-scale platform performance: The effect of modifying the nucleic acid sequence of a plasmid containing a homology-directed repair template to include CDL sequences immediately upstream of the 5'HDR arm and downstream of the 3'HDR arm was evaluated in the context of the CRISPR-Cas9 system described above, on a platform and scale relevant for clinical manufacturing of cell therapy products. The objectives of this study were to demonstrate the utility of CDL sequences in a clinical setting and to demonstrate the applicability of the technology to manufacture cell therapy products.

[0134] Following clinical-scale transfection, incorporation of a CDL sequence into the HDR cassette increases the rate of transgene integration into cells.T cells electroporated with plasmids containing the CDL sequence GAGCCATGCTTGGCTTACGA and a sequence encoding a transgene, or a control plasmid containing a sequence encoding a transgene without the CDL sequence, were assessed for both cell number and transgene expression 6 days after electroporation. The length of the polynucleotide sequence encoding the transgene was 6533 base pairs long (for plasmid pS3798), 7042 base pairs long (for plasmid pS3631), and 6236 base pairs long (for plasmid pS3797). The results shown in Figure 4 show a significant (p<0.05) increase in expression of the transgene in conditions that received a plasmid containing the CDL sequence compared to conditions that received a control non-CDL site-containing plasmid. The difference is evident in the percentage of cells carrying an integrated transgene. Transgene expression, assessed by flow cytometry, increased on average from 3.35% in the non-CDL condition to 9.76% in the CDL condition at 20ug DNA. Overall, these data demonstrate the enhancing effect of the incorporation of CDL sequences on the gene editing process.

[0135] References TIFF2024513967000011.tif231159

Claims

1. 1. A composition for modifying a target nucleic acid, comprising: The composition comprises: (a) a targetable nuclease protein; (b) (i) homology-directed repair (HDR) template; (ii) a first codelivered linearization (CDL) targeting sequence operably linked to the 5′ of the HDR template; and (iii) a second CDL target sequence operably linked to the 3′ of the HDR template. A plasmid donor template comprising: Including, each of the first CDL target sequence and the second CDL target sequence is cleavable by the targetable nuclease protein or a complex comprising the targetable nuclease protein; The composition is formulated for non-viral delivery to a cell. The composition.

2. 2. The composition of claim 1, wherein the targetable nuclease protein is an RNA-guided nuclease, optionally wherein the RNA-guided nuclease is a Cas protein, and optionally wherein the composition further comprises an RNA comprising at least 17 nucleotides complementary to the first CDL target sequence and / or the second CDL target sequence.

3. 3. The composition of claim 2, further comprising a donor guide RNA (gRNA) configured to form a complex with the targetable nuclease protein, wherein (1) the donor gRNA comprises at least 17 nucleotides complementary to each of the first CDL target sequence and the second CDL target sequence, and (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a 3 base pair protospacer adjacent motif (PAM) located 3' to the CDL target sequence.

4. 3. The composition of claim 2, further comprising a first donor guide RNA (gRNA) comprising at least 17 nucleotides complementary to the first CDL target sequence and a second donor gRNA comprising at least 17 nucleotides complementary to the second CDL target sequence, each donor gRNA configured to form a separate complex comprising the targetable nuclease protein, wherein each of the first CDL target sequence and the second CDL target sequence is operably linked to a 3 base pair protospacer adjacent motif (PAM) located 3' to the CDL target sequence.

5. 5. The composition of claim 3 or 4, wherein one or more of the donor gRNAs comprises at least 17 nucleotides complementary to a genomic target sequence of the cell.

6. 1. A composition for modifying a target nucleic acid, comprising: The composition comprises: (a) a CRISPR-CAS RNA-guided nuclease; (b) a donor guide RNA (gRNA); and (c) (i) homology-directed repair (HDR) template; (ii) a first codelivered linearization (CDL) targeting sequence operably linked to the 5′ of the HDR template; and (iii) a second CDL target sequence operably linked to the 3′ of the HDR template. A plasmid donor template comprising: Including, (1) the donor gRNA comprises at least 17 nucleotides complementary to each of the first CDL target sequence and the second CDL target sequence; (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a 3 base pair protospacer adjacent motif (PAM) located 3' of the CDL target sequence; The composition is formulated for non-viral delivery to a cell. The composition.

7. 3. The composition of claim 2, wherein the composition further comprises a second targetable nuclease protein, wherein the second targetable nuclease protein or a complex comprising the second targetable nuclease protein is capable of cleaving a genomic target sequence of the cell, optionally wherein the second targetable nuclease protein is an RNA-guided nuclease, optionally wherein the RNA-guided nuclease is a Cas protein, and optionally wherein the composition further comprises a second RNA comprising at least 17 nucleotides complementary to the genomic target sequence.

8. 8. The composition of claim 7, further comprising a targeting guide RNA (gRNA) configured to form a complex with the second targetable nuclease protein, wherein (1) the targeting gRNA comprises at least 17 nucleotides complementary to the genomic target sequence, and (2) the genomic target sequence is operably linked to a 3 base pair protospacer adjacent motif (PAM) located 3' to the genomic target sequence, and optionally, the first CDL target sequence, the second CDL target sequence, and the genomic target sequence comprise the same nucleic acid sequence.

9. 9. The composition of claim 7 or 8, wherein the genomic target sequence comprises a safe-harbor nucleic acid sequence, optionally wherein the safe-harbor nucleic acid sequence comprises the nucleic acid sequence GAGCCATGCTTGGCTTACGA (SEQ ID NO:2).

10. 4. The composition of claim 3, wherein one or both of the PAM sequences are encoded between the CDL target sequence and the HDR template, or neither of the PAM sequences are encoded between the CDL target sequence and the HDR template.

11. 8. The composition of claim 7, wherein the targetable nuclease protein and / or the second targetable nuclease protein is a Cas9 protein, or comprises a transcription activator-like (TAL) effector DNA binding protein and nuclease, or comprises a zinc finger DNA binding protein and nuclease.

12. The composition described in claim 2, wherein the targetable nuclease protein or the RNA-guided nuclease has nuclease activity.

13. 11. A method for modifying the target nucleic acid in a cell comprising introducing into the cell the composition of claim 1 or non-virally introducing into the cell the composition of claim 1, The method, wherein the HDR template is incorporated into the target nucleic acid.

14. The method of claim 13 , wherein the introducing comprises electroporation.

15. The method of claim 13 or 14, wherein the cell is a primary cell or a primary T cell.

16. A ribonucleoprotein complex for modifying a target nucleic acid comprising the composition of claim 1.

17. A ribonucleoprotein complex for modifying a target nucleic acid, comprising: The ribonucleoprotein complex comprises: (a) a CRISPR-Cas RNA-guided nuclease, and (b) a donor guide RNA (gRNA) that includes at least 17 nucleotides that are complementary to a codelivered linear (CDL) target sequence; Including, The ribonucleoprotein complex is formulated for non-viral delivery to a cell.

18. The method of claim 13, wherein the method is performed in vitro or ex vivo.

19. 1. A method for forming a ribonucleoprotein (RNP) complex, comprising: (a) a CRISPR-CAS RNA-guided nuclease; (b) a donor guide RNA (gRNA) comprising at least 17 nucleotides that are complementary to a co-delivery linearization (CDL) target sequence; The method comprises incubating or having been incubated with

20. (i) homology-directed repair (HDR) template; (ii) a first codelivered linearization (CDL) targeting sequence operably linked to the 5′ of the HDR template; and (iii) a second CDL target sequence operably linked to the 3′ of the HDR template. A plasmid donor template comprising A composition comprising: The composition, wherein each of the first CDL target sequence and the second CDL target sequence is cleavable by a targetable nuclease protein or a complex comprising the targetable nuclease protein.

21. 1. A method for modifying a target nucleic acid in a cell, comprising: The method comprises: providing said cells; introducing or having introduced into said cells a composition formulated for non-viral delivery; Including, The composition comprises: (a) a targetable nuclease protein; (b) (i) homology-directed repair (HDR) template; (ii) a first codelivered linearization (CDL) targeting sequence operably linked to the 5′ of the HDR template; and (iii) a second CDL target sequence operably linked to the 3′ of the HDR template. A plasmid donor template comprising: Including, each of the first CDL target sequence and the second CDL target sequence is cleavable by the targetable nuclease protein or a complex comprising the targetable nuclease protein; The method.

22. 1. A method for modifying a target nucleic acid in a cell, comprising: The method comprises: providing said cells; introducing or having been introduced into said cells a composition formulated for non-viral delivery; Including, The composition comprises: (a) a CRISPR-Cas RNA-guided nuclease; (b) a donor guide RNA (gRNA); and (c) (i) homology-directed repair (HDR) template; (ii) a first codelivered linearization (CDL) targeting sequence operably linked to the 5′ of the HDR template; and (iii) a second CDL target sequence operably linked to the 3′ of the HDR template. A plasmid donor template comprising: Including, (1) the donor gRNA comprises at least 17 nucleotides complementary to each of the first CDL target sequence and the second CDL target sequence; (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a 3 base pair protospacer adjacent motif (PAM) located 3' of the CDL target sequence; The method.

23. 1. A method for modifying a genomic target sequence of a cell, comprising: The method comprises: providing said cells; introducing or having been introduced into said cells a composition formulated for non-viral delivery; Including, The composition comprises: (a) a CRISPR-Cas RNA-guided nuclease; (b) a donor guide RNA (gRNA); and (c) (i) a homology directed repair (HDR) template comprising a nucleic acid for insertion flanked by homology arms; (ii) a first codelivered linearization (CDL) targeting sequence operably linked to the 5′ of the HDR template; and (iii) a second CDL target sequence operably linked to the 3′ of the HDR template. A plasmid donor template comprising: Including, (1) the donor gRNA comprises at least 17 nucleotides complementary to each of the first CDL target sequence and the second CDL target sequence; (2) each of the first CDL target sequence and the second CDL target sequence is operably linked to a 3 base pair protospacer adjacent motif (PAM) located 3' of the CDL target sequence; the donor gRNA comprises at least 17 nucleotides complementary to the genomic target sequence of the cell; The homology arms are complementary to nucleic acid sequences that flank the genomic target sequence of the cell, and the nucleic acid for insertion is configured to be inserted into the genomic target sequence of the cell. The method.

Images