Recombinant Adeno-Associated Virus Encoding Methyl-CPG-Binding Protein 2 for Treating Pitt-Hopkins Syndrome by Intrathecal Delivery

Abstract

Methods and materials are provided for treating Pitt-Hopkins syndrome, comprising intrathecal delivery of recombinant adeno-associated virus 9 (rAAV9) encoding methyl-CpG binding protein 2 (MECP2).

Description

[Technical field]

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 174,327, filed April 13, 2021, and U.S. Provisional Patent Application No. 63 / 211,822, filed June 17, 2021, which are incorporated by reference in their entireties herein.

[0002] Incorporation by Reference of Electronically Submitted Materials The computer readable form of the sequence listing, filed concurrently herewith and identified as follows, is incorporated by reference in its entirety: ASCII text file named "56067_SeqListing.txt", created on April 12, 2022, file size 17,282 bytes.

[0003] The present invention relates to methods and materials for treating Pitt-Hopkins syndrome using recombinant adeno-associated virus 9 (rAAV9) encoding methyl-CpG binding protein 2 (MECP2). [Background technology]

[0004] Pitt-Hopkins syndrome (PTHS) is a neurological disorder caused by mutations in the TCF4 gene that result in haploinsufficiency, occurring in 1 in 34,000 to 41,000 individuals. Patients present with developmental delay, intellectual disability, microcephaly, and seizures, along with a wide range of behavioral symptoms (Non-Patent Document 1). Unfortunately, due to the large size of the TCF4 gene and the large number of splice variants, complete gene replacement therapy is currently not a viable option for the treatment of PTHS. Therefore, there is a need to develop novel therapeutic strategies to treat PTHS patients.

[0005] The MECP2 transcription factor regulates the transcription of thousands of genes. MECP2 is a 52 kDa nuclear protein expressed in a variety of tissues, but is abundant in neurons and has been best studied in the nervous system. There are two isoforms of MECP2 in humans, known as MECP2A and MECP2B [Non-Patent Document 2]. The two isoforms are derived from alternatively spliced ​​mRNA transcripts and have different translation initiation sites. MECP2B contains exons 1, 3, and 4 and is the predominant isoform in the brain. MECP2 reversibly binds to methylated DNA and regulates gene expression [Non-Patent Document 3]. These functions map to the methyl-binding domain (MBD) and transcriptional repressor domain (TRD), respectively [Non-Patent Document 4]. Originally conceived as a transcriptional repressor, MECP2 can both induce and repress target gene expression [Non-Patent Document 5]. MECP2 is hypothesized to support proper neural development and maintenance. In neurons, MECP2 promotes the translation of synaptic activity into gene expression through DNA binding and interaction with different binding partners [Non-Patent Document 6 and Non-Patent Document 7]. In astrocytes, MECP2 deficiency is associated with apneic events in mice [Non-Patent Document 8]. MECP2 deficiency can cause reduced brain size, increased neuronal packing density, reduced neuronal soma size, and reduced dendritic cell complexity [Non-Patent Document 9]. Importantly, neuronal death is not associated with MECP2 deficiency [Non-Patent Document 10]. MECP2 is also found outside the nervous system, although levels vary in different tissues.

[0006] Adeno-associated virus (AAV) is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb long, including an inverted terminal repeat (ITR) of 145 nucleotides. The nucleotide sequence of the AAV serotype 2 (AAV2) genome is presented in (12), amended by (11). Cis-acting sequences directing viral DNA replication (rep), encapsidation / packaging, and host cell chromosomal integration are contained within the ITR. Three AAV promoters (designated p5, p19, and p40 from their relative map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. The two rep promoters (p5 and p19), coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The Rep protein has multiple enzymatic properties that are ultimately responsible for the replication of the viral genome. The Cap gene is expressed from the p40 promoter and encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Non-Patent Document 13.

[0007] AAV has unique characteristics that make it attractive as a vector for delivering foreign DNA to cells, for example in gene therapy. AAV infection of cells in culture is non-cytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV can infect many mammalian cells, allowing the possibility to target many different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and persist as transcriptionally active nuclear episomes (extrachromosomal elements) essentially for the life of those cells. The AAV proviral genome is infectious as DNA cloned into plasmids making the construction of recombinant genomes feasible. Moreover, because signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal ∼4.3 kb of the genome (encoding the replication and structural capsid protein, rep-cap) can be replaced with foreign DNA, such as a gene cassette containing a promoter, DNA of interest and a polyadenylation signal. Rep and cap proteins can be provided in trans. Another important feature of AAV is that it is an extremely stable and robust virus. It easily withstands the conditions used to inactivate adenovirus (56°C to 65°C for several hours), making cryopreservation of AAV less important. AAV can be lyophilized. Finally, AAV-infected cells are not resistant to superinfection. Multiple AAV serotypes exist, providing diverse tissue tropism. Known serotypes include, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and AAVrh74. AAV9 is described in Patent Document 1 and Non-Patent Document 14.

[0008] Interestingly, the clinical features of PTHS overlap with Rett syndrome, another autism spectrum disorder caused by mutations in methyl-CpG binding protein 2 (MECP2). The similarity of disease phenotypes may lead to misdiagnosis of PTHS patients. In fact, a case study showed reduced MECP2 protein levels in blood samples from PTHS patients (unpublished clinical data). Therefore, there remains a need in the art for methods to treat both Rett syndrome and PTHS, as well as methods to disrupt the affected underlying pathways, which may lead to the development of new therapeutic approaches. [Prior art documents] [Patent documents]

[0009] [Patent Document 1] U.S. Patent No. 7,198,951 [Non-patent literature]

[0010] [Non-Patent Document 1] Rosenfeld et al.,Genet.Mut.11:797-805,2009 [Non-Patent Document 2] Weaving et al., Journal of Medical Genetics, 42:1-7(2005) [Non-Patent Document 3] Guy et al.,Annual Review of Cell and Developmental Biology,27:631-652(2011) [Non-Patent Document 4] Nan&Bird,Brain&Development,23,Suppl1:S32-37(2001) [Non-Patent Document 5] Chahrour et al.,Science,320:1224-1229(2008) [Non-Patent Document 6] Ebert et al.,Nature,499:341-345(2013) [Non-Patent Document 7] Lyst et al.,Nature Neuroscience,16:898-902(2013) [Non-Patent Document 8] Lioy et al.,Nature,475:497-500(2011) [Non-Patent Document 9] Armstrong et al., Journal of Neuropathology and Experimental Neurology, 54:195-201 (1995) [Non-Patent Document 10] Leonard et al.,Nature Reviews,Neurology,13:37-51(2017) [Non-Patent Document 11] Ruffing et al., J Gen Virol, 75:3385-3392 (1994) [Non-Patent Document 12] Srivastava et al., J Virol, 45:555-564 (1983) [Non-Patent Document 13] Muzyczka,Current Topics in Microbiology and Immunology,158:97-129(1992) [Non-Patent Document 14] Gao et al., J. Virol., 78:6381-6388 (2004) Summary of the Invention

[0011] The present disclosure provides gene therapy methods and materials useful for treating Pitt-Hopkins syndrome (PTHS) in patients in need of such treatment. In particular, the present disclosure provides a gene therapy vector expressing MeCP2 as a therapeutic agent for PTHS.

[0012] The present disclosure provides a method of treating PTHS, comprising administering to a subject in need thereof a recombinant adeno-associated virus (rAAV9) or rAAV viral particle encoding methyl-CpG binding protein 2 (MECP2). In some embodiments, the rAAV is administered by direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery. In some embodiments, the rAAV is administered to the patient in the Trendelenberg position. For example, the patient has a mutation in the TCF4 gene.

[0013] The present disclosure provides a method of increasing methyl-CpG binding protein 2 (MECP2) levels in a subject suffering from PTHS, comprising administering to the subject a recombinant adeno-associated virus (rAAV9) or rAAV viral particle encoding MECP2. In some embodiments, the rAAV is administered by direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery. In some embodiments, the rAAV is administered to the patient in the Trendelenburg position. For example, the patient has a mutation in the TCF4 gene.

[0014] The present disclosure also provides a method of delivering a polynucleotide sequence encoding methyl-CpG binding protein 2 (MECP2) to a subject suffering from PTHS, comprising administering to the subject a recombinant adeno-associated virus (rAAV9) or rAAV viral particle encoding MECP2. In some embodiments, the rAAV is administered by direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery. In some embodiments, the rAAV is administered to the patient in the Trendelenburg position. For example, the patient has a mutation in the TCF4 gene.

[0015] The present disclosure also provides methods and compositions for upregulating expression of MECP2 protein in a subject suffering from PTHS, where such upregulation can be induced by reactivation of the MECP2 gene.

[0016] In other embodiments, the patient suffers from one or more of the following conditions: intellectual disability, including moderate intellectual disability or severe intellectual disability, delayed development of mental and motor skills (psychomotor delay), breathing problems, recurrent seizures (epilepsy), and characteristic facial features, delayed or absent speech or loss of speech, poor communication skills, poor socialization skills, hyperventilation, apnea, cyanosis, clubbing of fingers and / or toes, thin eyebrows, sunken eyes, strabismus, a prominent nose with a high bridge, a prominent double peak on the upper lip (Cupid's bow), a wide mouth with thick lips, hypertelorism, thick and / or cupped ears, constipation, gastrointestinal problems, microcephaly, myopia, short stature, mild brain abnormalities, small hands and / or feet, a single crease across the palm of the hand, a large ... These symptoms include: flat feet, thickening of the pads of the fingers and / or toes, cryptorchidism, stereotypy, involuntary movements of the hands, loss of gait, loss of muscle tone, scoliosis, sleep disorders, coordination or balance problems, anxiety, behavioral problems, teeth grinding, excessive saliva and drooling, heart problems, irregular heartbeat, feeding problems or swallowing problems.

[0017] Exemplary involuntary hand movements include mechanical, repetitive hand movements such as hand wringing, hand washing, or clenching. Exemplary cardiac problems include irregular heart rhythms, such as abnormally long intervals between beats as measured by an electrocardiogram, or other types of arrhythmias.

[0018] The present disclosure also provides a composition for treating PTHS in a subject in need thereof, the composition comprising a rAAV or rAAV viral particle encoding MECP2. In some embodiments, the composition is formulated for direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery. The disclosed composition is administered to the patient in the Trendelenburg position. For example, the patient has a mutation in the TCF4 gene.

[0019] The present disclosure provides a composition for increasing methyl-CpG binding protein 2 (MECP2) levels in a subject suffering from PTHS, comprising an rAAV or rAAV viral particle encoding MECP2. In some embodiments, the composition is formulated for direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery. The disclosed composition is administered to the patient in the Trendelenburg position. For example, the patient has a mutation in the TCF4 gene.

[0020] The present disclosure also provides a composition for delivering a polynucleotide sequence encoding methyl-CpG binding protein 2 (MECP2) to a subject suffering from PTHS, comprising an rAAV or rAAV viral particle encoding MECP2. In some embodiments, the composition is formulated for direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery. The disclosed composition is administered to the patient in the Trendelenburg position. For example, the patient has a mutation in the TCF4 gene.

[0021] In other embodiments, the patient suffers from one or more of the following conditions: intellectual disability, including moderate intellectual disability or severe intellectual disability, delayed development of mental and motor skills (psychomotor delay), breathing problems, recurrent seizures (epilepsy), and distinctive facial features, delayed or absent speech or loss of speech, poor communication skills, poor socialization skills, hyperventilation, apnea, cyanosis, clubbing of the fingers and / or toes, thin eyebrows, sunken eyes, a prominent nose with a high bridge, a prominent upper lip, These include: two crooked peaks (Cupid's bow), wide mouth with thick lips, widely spaced teeth, thick and / or cupped ears, constipation, gastrointestinal problems, microcephaly, myopia, strabismus, short stature, mild brain abnormalities, small hands and / or feet, single palmar crease, flat feet, thickened pads of the fingers and / or toes, cryptorchidism, stereotypy, involuntary movements of the hands, loss of gait, loss of muscle tone, scoliosis, sleep disorders, coordination or balance problems, anxiety, behavioral problems, teeth grinding, excessive saliva and drooling, heart problems, irregular heartbeat, feeding or swallowing problems.

[0022] In addition, the present disclosure provides the use of an rAAV or rAAV viral particle encoding MECP2 for the preparation of a drug in a subject in need of the drug for the treatment of PTHS. In some embodiments, the drug is formulated for direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery. The disclosed drug is administered to the patient in the Trendelenburg position. For example, the patient has a mutation in the TCF4 gene.

[0023] The present disclosure provides the use of rAAV or rAAV viral particles encoding methyl-CpG binding protein 2 (MECP2) for the preparation of a medicament for increasing MECP2 levels in a subject suffering from PTHS. In some embodiments, the drug is formulated for direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery. The disclosed drug is administered to the patient in the Trendelenburg position. For example, the patient has a mutation in the TCF4 gene.

[0024] The present disclosure also provides the use of a rAAV or rAAV viral particle encoding methyl-CpG binding protein 2 (MECP2) to prepare a medicament for delivering a polynucleotide sequence encoding MECP2 to a subject suffering from PTHS. In some embodiments, the medicament is formulated for direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery. The disclosed medicament is administered to the patient in the Trendelenburg position. For example, the patient has a mutation in the TCF4 gene.

[0025] In other embodiments, the patient suffers from one or more of the following conditions: intellectual disability, including moderate intellectual disability or severe intellectual disability, delayed development of mental and motor skills (psychomotor delay), breathing problems, recurrent seizures (epilepsy), and distinctive facial features, delayed or absent speech or loss of speech, poor communication skills, poor socialization skills, hyperventilation, apnea, cyanosis, clubbing of the fingers and / or toes, thin eyebrows, sunken eyes, a prominent nose with a high bridge, a prominent upper lip, These include: two crooked peaks (Cupid's bow), wide mouth with thick lips, widely spaced teeth, thick and / or cupped ears, constipation, gastrointestinal problems, microcephaly, myopia, strabismus, short stature, mild brain abnormalities, small hands and / or feet, single palmar crease, flat feet, thickened pads of the fingers and / or toes, cryptorchidism, stereotypy, involuntary movements of the hands, loss of gait, loss of muscle tone, scoliosis, sleep disorders, coordination or balance problems, anxiety, behavioral problems, teeth grinding, excessive saliva and drooling, heart problems, irregular heartbeat, feeding or swallowing problems.

[0026] In one embodiment, the rAAV administered in the disclosed methods, compositions, or uses comprises a nucleotide sequence encoding MECP2, such as the nucleotide sequence of SEQ ID NO: 3. Further, the rAAV comprises a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO: 3 and encodes a protein that retains MECP2 activity.

[0027] In addition, the disclosure provides an rAAV administered in the disclosed methods, compositions, or uses, which further comprises a promoter sequence of SEQ ID NO: 2. For example, the rAAV comprises a promoter sequence of SEQ ID NO: 2 and a nucleotide sequence of SEQ ID NO: 3. The disclosure also provides an rAAV which further comprises an SV40 intron, a synthetic polyadenylation signal sequence, and an inverted terminal repeat (ITR), such as a mutant ITR and a wild-type ITR.

[0028] In exemplary embodiments, the rAAV administered in the disclosed methods, compositions or uses comprises the nucleotide sequence of SEQ ID NO:5, or nucleotides 151-2558 of SEQ ID NO:1, or nucleotides 151-2393 of SEQ ID NO:5. In addition, the rAAV comprises a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO:5, or nucleotides 151-2558 of SEQ ID NO:1, or nucleotides 151-2393 of SEQ ID NO:5, and expresses a protein that retains MECP2 activity.

[0029] In any of the disclosed methods, compositions, or uses, the rAAV is of the AAV serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or AAVrh74. In certain embodiments, the rAAV is of the AAV serotype AAV9.

[0030] In any of the disclosed methods, compositions, or uses, a patient is administered a composition comprising the disclosed rAAV and an agent that increases the viscosity and / or density of the composition. For example, in some embodiments, the agent is a contrast agent. The contrast agent can be 20-40% non-ionic low osmolarity compound or contrast agent, or about 25% to about 35% non-ionic low osmolarity compound, such as iohexol, iobitridol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, or a mixture of two or more thereof. The disclosed compositions can be formulated for any means of delivery, such as direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery.

[0031] In some embodiments, a patient is administered a composition comprising a disclosed rAAV, the composition comprising an agent that increases the viscosity of the composition by about 0.05%, or about 1%, or 1.5%, or about 2%, or about 2.5%, or about 3%, or about 4%, or about 5%, or about 6%, or about 7%, or about 8%, or about 9%, or about 10%. In some embodiments, the agent increases the viscosity of the composition by about 1% to about 5%, or about 2% to 12%, or about 5% to about 10%, or about 1% to about 20%, or about 10% to about 20%, or about 10% to about 30%, or about 20% to about 40%, or about 20% to about 50%, or about 10% to about 50%, or about 1% to about 50%.

[0032] In some embodiments, a patient is administered a composition comprising a disclosed rAAV, the composition comprising an agent that increases the density of the composition by about 0.05%, or about 1%, or 1.5%, or about 2%, or about 2.5%, or about 3%, or about 4%, or about 5%, or about 6%, or about 7%, or about 8%, or about 9%, or about 10%. In some embodiments, the agent increases the density of the composition by about 1% to about 5%, or about 2% to 12%, or about 5% to about 10%, or about 1% to about 20%, or about 10% to about 20%, or about 10% to about 30%, or about 20% to about 40%, or about 20% to about 50%, or about 10% to about 50%, or about 1% to about 50%.

[0033] As used herein, a "subject" may be any animal, and may be referred to as a patient. Preferably, the subject is a vertebrate, and more preferably, the subject is a mammal, such as a livestock animal (e.g., cow, horse, pig) or a pet (e.g., dog, cat). In some embodiments, the subject is a human. In some embodiments, the subject is a pediatric subject. In some embodiments, the subject is a pediatric subject, e.g., a subject in the range of 1-10 years old. In some embodiments, the subject is 4-15 years old. The subject, in one embodiment, is an adolescent subject, e.g., a subject in the range of 10-19 years old. In other embodiments, the subject is an adult (18 years or older). [Brief description of the drawings]

[0034] [Figure 1] Schematic diagram of rAAV9.P546.MECP2 is provided. [Diagram 2] Figure 2 shows that PTHS-induced astrocytes with TCF4 deletion (iAstrocytes) have differentiation problems. Representative images of iAstrocytes from normal and TCF4 mutant cells after differentiation are provided. [Diagram 3] Figure 1 shows that PTHS iAstrocytes with missense mutations have dysregulated TCF4 protein levels, or dysregulated protein isoforms, while deletion mutations have reduced TCF4 levels. Representative Western blots of TCF4 levels in neural progenitor cells (A, NPCs) and iAstrocytes (B) show variable expression when normalized to control levels. TCF4 and GAPDH protein levels were quantified and normalized to healthy controls. Importantly, individuals with gene deletions show reduced TCF4 levels. Statistical analysis performed using one-way ANOVA on combined control data (N=3). [Figure 4] We show that PTHS iAstrocytes result in abnormal neurite morphology and reduced motor neuron survival. Representative images of neurons (black) seeded on top of astrocytes (A). Quantification of neurons shows a decrease in survival, scaffold length and average neurite length (B). [Diagram 5] Figure 1 shows that PTHS NPCs have reduced MECP2 levels. Representative Western blots of patient NPCs (N=3). MECP2 and GAPDH protein levels were quantified and normalized to healthy control lines. Statistical analysis was performed using one-way ANOVA (N=min. 2 experiments). [Figure 6] We show that a TCF4 deletion mutation prevented iAstrocyte differentiation from neural progenitor cells (NPCs) and that transduction with AAV9.P546.MECP2 (10 and 100 MOI) 2 days prior to differentiation restored differentiation. [Figure 7]Figure 1 shows that AAV9.P546.MECP2 was well tolerated in wild-type (WT) mice. (A) Survival in WT mice treated with any vector dose was not significantly different from survival in untreated WT mice (p=0.1525) (Log-Rank / Mantel Cox test). (B) Severity scores in untreated WT and vector-treated WT mice show that treatment does not have a significant effect on the scores. [Figure 8-1]10 demonstrate that AAV9.P546.MECP2 treatment in wild type animals does not impair survival, behavior or locomotion. (A) At 60 days, vector-treated WT mice do not have a statistically different severity score compared to untreated WT. p-values: (untreated KO, p<0.0001; WT1.50x109, P>0.9999; WT3.75x109, p=0.9992; WT7.50x109, p>0.9999; WT1.50x1010, p=0.9512; WT3.00x1010, p=0.9876; WT6.00x1010, p>0.9999. (B) At 90 days, vector-treated WT mice have a statistically different severity score compared to untreated WT. Except for 10vg, none had a statistically different severity score compared to WT. p-values: (untreated KO, p<0.0001; 1.50x109, p>0.9999; 3.75x109, p=0.9911; 7.50x109, p>0.8146; 1.50x1010, p=0.9983; 3.00x1010, p=0.0442; 6.00x1010, p>0.4566. (C-D) Distance and speed Open field assays for speed were performed on days 49-63. (C) Vector-treated WT mice do not have significantly different open field speeds compared to untreated WT mice. p-values ​​compared to untreated WT (untreated KO, p<0.0001, 1.50x109, p>0.9999; 3.75x109, p>0.9999; 7.50x109, p=0.9959; 1.50x109, p=0.9959). (D) Vector-treated WT mice do not have significantly different open field distances compared to untreated WT mice. p-values ​​compared to untreated WT (untreated KO, p=0.0037, 1.5x10, p>0.9999; 3.75x10, p>0.9999; 7.5x10, p=0.4199; 1.5x10, p=0.9998; 3.0x10, p=9976; 6.0x10, p=0.7980). Mean severity scores at 60 and 90 days are given + / - 2-4 days to account for some time point variability in the biweekly scoring intervals.WT untreated n=40, KO untreated n=43, WT-1.50x109 n=11, WT-3.75x109 n=32, WT-7.50x109 n=16, WT-1.50x1010 n=36, WT-3.00x1010 n=20, WT-6.00x1010 =18. Statistical significance was determined using ANOVA with Tukey's test. Significance is relative to untreated WT mice. [Figure 8-2] Same as above. [Figure 9] Figure 1 shows that AAV9.P546.MECP2 results in a dose-dependent increase in MECP2 protein in wild-type brain. A) Anti-MeCP2 Western blot shows a dose-dependent elevation of total MeCP2 protein in various brain regions 3 weeks after ICV injection of P1. (Cb=cerebellum, Med=medulla, Hipp=hippocampus, Ctx=cortex, Mid=midbrain). TG3 shows samples taken from a severe mouse model of MeCP2 duplication syndrome 1. B) Quantitation of panel A. High doses of AVXS-201, but not moderate doses, double MECP2 expression in selected brain regions. [Figure 10] FIG. 1 shows that intrathecal injection of AAV9.P546.MECP2 in non-human primates does not prevent weight gain. The weights of three AVXS-201 treated animals are compared to those of control subjects (circles). [Figure 11-1] FIG. 1 shows that intrathecal injection of AAV9.P546.MECP2 in non-human primates does not affect hematological values ​​over 18 months after injection. Values ​​for three AVXS-201 treated animals are compared to control subjects (circles). [Figure 11-2] Same as above. [Figure 12-1] Figure 1 shows that intrathecal injection of AAV9.P546.MECP2 in non-human primates does not affect serum chemistry over 12-18 months after injection. Liver and electrolyte values ​​are similar between AAV9.P546.MECP2-treated and control-treated subjects. Values ​​for three AAV9.P546.MECP2-treated animals are compared to control subjects (circles). [Figure 12-2] Same as above. [Figure 13-1]Figure 1 shows that intrathecal injection of AAV9.P546.MECP2 in non-human primates does not affect serum chemistry over 12-18 months after injection. Heart and kidney values ​​are similar between AAV9.P546.MECP2-treated and control-treated subjects. Values ​​for three AAV9.P546.MECP2-treated animals are compared to control subjects (circles). [Figure 13-2] Same as above. [Figure 14] Figure 1 shows similar levels of MeCP2 expression throughout the brain of AAV9.P546.MECP2-treated and control non-human primates. Anti-MeCP2 immunohistochemistry showed no gross structural abnormalities or obvious differences in MeCP2 expression. OC = occipital cortex, TC = temporal cortex, LSc = lumbar spinal cord, Thal = thalamus, Hipp = hippocampus, Cb = cerebellum. [Figure 15] Figure 1 provides western blots of brain regions from control and AAV9.P546.MeCP2-injected non-human primates showing similar levels of MeCP2. Total MeCP2 levels and GAPDH loading controls are shown. Quantitation of panels A and B is shown below each blot. Dashed lines in the graphs indicate the average normalized value detected across controls. OC = occipital cortex, TC = temporal cortex, LSc = lumbar spinal cord, Thal = thalamus, Hipp = hippocampus, Cb = cerebellum. Values ​​are shown as mean ± SEM. [Figure 16] Figure 1 provides in situ hybridization showing vector-derived transcripts in all examined regions of the brain of non-human primates treated with AAV9.P546.MECP2, but not controls. The figure shows probes for GAPDH and vector-derived MECP2 mRNA, along with a nuclear label (Dapi). OC = occipital cortex, TC = temporal cortex, LSc = lumbar spinal cord, Hipp = hippocampus, Cb = cerebellum. Scale bar = 20 μm. [Figure 17]In situ hybridization shows vector-derived transcripts in all examined regions of the brain of AVXS-201-treated but not control non-human primates 18 months after injection. The figure shows probes for GAPDH and vector-derived MECP2 mRNA along with nuclear labeling (Dapi). OC=occipital cortex, TC=temporal cortex, CA1 and CA3=hippocampal regions, CC=corpus callosum, Thal=thalamus, Cau=caudate nucleus, Put=putamen, SColli=superior colliculus, Med=medulla, Cb=cerebellum, Cerv=cervical spinal cord, Thor=thoracic spinal cord, Lumb=lumbar spinal cord. Scale bar=20 μm. [Figure 18] 1 provides a schematic and photograph of the location of ICV injection sites in mice. [Figure 19] 1 provides microscopic images and photographs of the location of ICV injection sites in mice. [Figure 20] GFP protein expression in the brain following ICV injection of scAAV9.P546.GFP in mice. [Figure 21] 13 provides MeCP2 protein expression in the brain following ICV injection of scAAV9.P546.MeCP2 in wild type and TCF+ / − mice. [Figure 22] 13 provides MeCP2 protein nuclear intensity in the hippocampus and thalamus with Z-stacks recorded in different zones. [Diagram 23] Same as above. [Figure 24] Graphs measuring nuclear intensity in the anterior and posterior cortex, hippocampus, and thalamus are provided. [Diagram 25] 13 provides data from a marble-burying assay following ICV injection of scAAV9.P546.GFP in mice. [Figure 26] 13 provides data from an open field test following ICV injection of scAAV9.P546.GFP in mice. [Figure 27] 13 provides data from an elevated plus maze test following ICV injection of scAAV9.P546.GFP in mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0035] The present disclosure provides data using NPCs and iAstrocytes obtained from PTHS patients demonstrating that the patients have reduced expression of TCF4 and MECP2. Accordingly, the present disclosure provides a method of treating PTHS comprising administering rAAV expressing MECP2.

[0036] Provided is an rAAV, such as self-complementary AAV9 (scAAV9), herein referred to as scAAV.P546.MECP2 or "AVXS-201". The gene cassette (nucleotides 151-2393 of the AVXS-201 genome shown in SEQ ID NO:5) has in sequence a 546 bp promoter fragment (SEQ ID NO:2) from the mouse MECP2 gene (nucleotides 74085586-74086323 of NC_000086.7 in reverse), an SV40 intron, human MECP2B cDNA (SEQ ID NO:3) (CCDS database #CCDS48193.1), and a synthetic polyadenylation signal sequence (SEQ ID NO:4). The gene cassette is flanked by mutant AAV2 inverted terminal repeats (ITRs) and wild-type AAV2 inverted terminal repeats, both of which allow packaging of the self-complementary AAV genome. The genome lacks AAV rep and cap DNA, ie, there is no AAV rep or cap DNA between the ITRs of the genome.

[0037] TCF4 is involved in oligodendrocyte maturation and abnormal neuronal morphology in Pitt-Hopkins syndrome (2-4) (Li et al., Mol. Psych. 24:1235-1246, 2019; Crux et al., PLoS One 13(6):1-9, 2018; Fu et al., J. Neurosci. 29:11399-11408, 2009). However, the role of other cell types in this disorder is less understood. Using a direct conversion technique, we reprogrammed human fibroblasts from patients with multiple neurological and neurodegenerative disorders into neural progenitor cells (NPCs) and subsequently differentiated them into astrocytes (iAstrocytes) (Meyer et al., Proc. Natl. Acad. Sci. USA 111(2):829-832, 2014). By co-culturing iAstrocytes with GFP-expressing mouse neurons, a role for astrocytes in the disease pathology of many neurological disorders, including Rett syndrome and Pitt-Hopkins syndrome, has been demonstrated.

[0038] Interestingly, all PTHS patient cell lines showed downregulation of the transcription factor methyl-CpG binding protein 2 (MeCP2). This is particularly important because MeCP2 mutations lead to Rett syndrome, which shares some clinical overlap with PTHS patients. Furthermore, both transcription factors MeCP2 and TCF4 share downstream pathways. Combined, these observations suggest that increasing MeCP2 gene levels may be a powerful alternative strategy for PTHS.

[0039] Taken together, these findings suggest that i) PTHS astrocytes play a role in the disease, ii) PTHS astrocytes should be targeted therapeutically in addition to neurons, and iii) modulation of MECP2 levels using gene therapy constructs is a potential therapeutic strategy for the treatment of PTHS. The present disclosure provides for the utilization of AAV9 p546.MECP2 constructs to therapeutically treat both astrocytes and / or neurons.

[0040] In one aspect, the invention provides a method for intrathecal administration (i.e., administration into the subarachnoid space of the brain or spinal cord) of a polynucleotide encoding MECP2 to a patient, comprising administering an rAAV9 having a genome comprising the polynucleotide. In some embodiments, the rAAV9 genome is a self-complementary genome. In other embodiments, the rAAV9 genome is a single-stranded genome.

[0041] The method delivers a polynucleotide encoding MECP2 to the brain and spinal cord of a patient (i.e., the patient's central nervous system). Some target areas of the brain contemplated for delivery include, but are not limited to, the motor cortex and the brain stem. Some target cells of the central nervous system contemplated for delivery include, but are not limited to, neuronal cells and glial cells. Examples of glial cells include microglial cells, oligodendrocytes, and astrocytes.

[0042] "Treatment" includes administering an effective dose or effective multiple doses of a composition comprising an rAAV of the invention to a subject (including a human patient) in need thereof via an intrathecal route. If the dose is administered prior to the onset of the disorder / disease, the administration is prophylactic. If the dose is administered after the onset of the disorder / disease, the administration is therapeutic. In an embodiment of the invention, an effective dose is one that alleviates (either eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, ameliorates at least one symptom associated with the disorder / disease state being treated, delays or prevents progression to the disorder / disease state, reduces the extent of the disease, causes remission (partial or complete remission) of the disease, and / or prolongs survival.

[0043] In any of the methods, compositions and uses disclosed herein, the patient has a mutation in the gene encoding the transcription factor TCF4 (also known as ITF2, SEF2 or E2-2) that results in impaired or reduced function of the TCF4 protein. Missense, nonsense, frameshift, and splice site mutations, as well as translocations and large deletions involving the TCF4 gene, have been shown to cause Pitt-Hopkins Syndrome (PTHS).

[0044] The TCF4 gene (MIM number 610954) is located on chromosome 18q21.2 and contains 20 exons (the first and last are non-coding) spanning 360 kb. This transcription factor is a late expressed basic helix-loop-helix (bHLH) protein that functions as a homo- or heterodimer. TCF4 exhibits transcriptional regulatory activity that is highly expressed during early human development throughout the central nervous system, sclerotome, peribronchial and renal mesenchyme, and gonadal buds, where it plays an important role in cell proliferation, lineage commitment, and cell differentiation.

[0045] Several alternatively spliced ​​TCF4 variants have been described, allowing the translation of at least 18 protein isoforms with different N-terminal sequences. The following are exemplary mutations in the TCF4 gene known to cause PTHS: whole gene deletions, e.g., large rearrangements several megabases in size, partial gene deletions, e.g., deletions involving one or more of exons 7-20, balanced translocations, e.g., deletions that disrupt the coding sequence of the gene, missense mutations, e.g., deletions involving the bHLH domain of TCF4, nonsense mutations and frameshift mutations, e.g., mutations that span the entire gene from exons 7 to 18, and splice site mutations, e.g., those affecting donor and acceptor consensus splice sites, resulting in a shift in the reading frame. Exemplary genomic mutations include t(14;18)(q13.1;q21.2) and t(2;18)(q37;q21.2), which are balanced de novo translocations with breakpoints in the latter half of the gene, respectively. Further exemplary mutations in the TCF4 gene are provided in Tables 1 and 2 below and are described in Amiel et al. Am. J. Hum. Genet. 80(5):988-993, 2007, Pontual et al. Human Mut. 30:669-676, 2009, Goodspeed et al. J. Clin. Neurology 33(3):233-244, 2018, and Zweier et al. J. Med. Genet. 45(11):738-44, 2008, which are incorporated herein by reference in their entirety.

[0046] [Table 1]

[0047] [Table 2-1]

[0048] [Table 2-2]

[0049]

Table 2-3

[0050]

Table 2-4

[0051]

Table 2-5

[0052]

Table 3-1

[0053]

Table 3-2

[0054]

Table 3-3

[0055]

Table 3-4

[0056]

Table 3-5

[0057]

Table 3-6

[0058] In treating PTHS, the methods provide benefits in the subject including, but not limited to, improved muscle tone, improved walking and mobility, improved speech, reduced breathing problems, reduced apnea, reduced seizures, reduced anxiety, normalized eating behavior, increased socialization, increased IQ, normalized sleep patterns, and / or increased mobility.

[0059] Combination therapies are also contemplated by the present invention. Combination, as used herein, includes both simultaneous and sequential treatments. Combination of the methods of the present invention with standard medical treatments for PTHS is specifically contemplated, along with combinations with novel therapies.

[0060] Delivery after birth to an individual in need thereof is contemplated, although in utero delivery to the fetus is also contemplated. In another aspect, the present invention provides a rAAV genome. The rAAV genome comprises one or more AAV ITRs adjacent to a polynucleotide encoding MECP2. The polynucleotide is operably linked to transcriptional regulatory DNA, specifically promoter DNA and polyadenylation signal sequence DNA, that are functional in target cells to form a "gene cassette". The gene cassette may include a promoter that allows specific expression in neurons or specific expression in glial cells. Examples include neuron-specific enolase and glial fibrillary acidic protein promoters. Inducible promoters under the control of ingested drugs may also be used. Examples include, but are not limited to, systems such as the tetracycline (TET on / off) system [Urlinger et al., Proc. Natl. Acad. Sci. USA 97(14):7963-7968 (2000)] and the ecdysone receptor regulatory system [Palli et al., Eur J. Biochem 270:1308-1315 (2003)]. The gene cassette may further comprise intron sequences to facilitate processing of the RNA transcript when the polynucleotide is expressed in a mammalian cell.

[0061] The rAAV genome of the present invention lacks AAV rep and cap DNA, i.e., there is no AAV rep or cap DNA between the ITRs of the genome. The AAV DNA (e.g., ITRs) in the rAAV genome can be derived from any AAV serotype from which a recombinant virus can be derived, including, but not limited to, AAV serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and AAVrh74. The nucleotide sequences of the genomes of AAV serotypes are known in the art. For example, the AAV9 genome is provided in Gao et al., J. Virol., 78:6381-6388 (2004).

[0062] In another aspect, the present invention provides a DNA plasmid comprising the rAAV genome of the present invention. The DNA plasmid is transferred to a cell that is permissive for infection by a helper virus of AAV (e.g., adenovirus, E1-deleted adenovirus, or herpesvirus) to assemble the rAAV genome into an infectious viral particle having an AAV9 capsid protein. Techniques for producing rAAV particles in which the packaged AAV genome, rep and cap genes, and helper virus functions are provided to the cell are standard in the art. The production of rAAV requires the presence of the following components in a single cell (herein referred to as a packaging cell): the rAAV genome, AAV rep and cap genes separate from (i.e., not present in) the rAAV genome, and helper virus functions. The production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692, which is incorporated herein by reference in its entirety. In various embodiments, the AAV capsid protein can be modified to enhance delivery of the recombinant vector. Modifications to capsid proteins are generally known in the art, see, e.g., US2005 / 0053922 and US2009 / 0202490, the disclosures of which are incorporated herein by reference in their entireties. AAV gene therapy As used herein, the term "AAV" is a common abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells in which certain functions are provided by a co-infecting helper virus. Currently, there are 13 characterized serotypes of AAV. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). However, it is well known that the various serotypes are very closely related, both structurally and functionally, even at the genetic level, so it is fully expected that these same principles will be applicable to additional AAV serotypes. (See, e.g., Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J.R. Puttson, ed., and Rose, Comprehensive Virology 3:1-61 (1974).) For example, all AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes, and they all have three related capsid proteins, such as those expressed in AAV2. The degree of relatedness is further suggested by heteroduplex analysis, which reveals extensive cross-hybridization between serotypes along the length of the genome, and the presence of similar self-annealing segments at the ends that correspond to the "inverted terminal repeats" (ITRs). Similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control.

[0063] As used herein, "AAV vector" refers to a vector that contains one or more polynucleotides of interest (or transgenes) flanked by AAV terminal repeats (ITRs) that can replicate and be packaged into infectious viral particles when present in a host cell transfected with a vector that encodes and expresses the rep and cap gene products.

[0064] "AAV virion" or "AAV virus particle" or "AAV vector particle" refers to a viral particle that consists of at least one AAV capsid protein and an encapsidated polynucleotide AAV vector. When a particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene delivered to a mammalian cell), it is typically referred to as an "AAV vector particle" or simply an "AAV vector". Thus, since such a vector is contained within the AAV vector particle, the production of an AAV vector particle necessarily includes the production of an AAV vector.

[0065] Adeno-associated virus (AAV) is a replication-defective parvovirus whose single-stranded DNA genome is about 4.7 kb long, including the inverted terminal repeats (ITRs). Exemplary ITR sequences can be 130 base pairs long, or 141 base pairs long (e.g., ITR sequences). There are multiple AAV serotypes. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the nucleotide sequence of the AAV serotype 2 (AAV2) genome is presented in Srivastava et al., J Virol, 45:555-564 (1983), as amended by Ruffing et al., J Gen Virol, 75:3385-3392 (1994). As other examples, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077, the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829, the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829, the AAV-5 genome is provided in GenBank Accession No. AF085716, the complete genome of AAV-6 is provided in GenBank Accession No. NC_001862, at least portions of the genomes of AAV-7 and AAV-8 are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Pat. Nos. 7,282,199 and 7,790,449 regarding AAV-8), and the AAV-9 genome is described in Gao et al. al., J. Virol., 78:6381-6388 (2004), the AAV-10 genome is provided in Mol. Ther., 13(1):67-76 (2006), and the AAV-11 genome is provided in Virology, 330(2):375-383 (2004). The cloning of the AAVrh.74 serotype is described in Rodino-Klapac., et al. Journal of translational medicine 5, 45 (2007). Cis-acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and host cell chromosomal integration are contained within the ITRs.Three AAV promoters (designated p5, p19, and p40 from their relative map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. The two rep promoters (p5 and p19), coupled with differential splicing of a single AAV intron (at AAV2 nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The Rep proteins have multiple enzymatic properties that are ultimately involved in the replication of the viral genome. The Cap gene is expressed from the p40 promoter and encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are responsible for the production of the three associated capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0066] AAV has unique characteristics that make it attractive as a vector for delivering foreign DNA to cells, for example in gene therapy. AAV infection of cells in culture is non-cytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV can infect many mammalian cells, allowing the possibility to target many different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and persist as transcriptionally active nuclear episomes (extrachromosomal elements) essentially for the life of those cells. The AAV proviral genome is infectious as DNA cloned into plasmids making the construction of recombinant genomes feasible. Moreover, because signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal ∼4.3 kb of the genome (encoding the replication and structural capsid protein, rep-cap) can be replaced with foreign DNA, such as a gene cassette containing a promoter, DNA of interest and a polyadenylation signal. Rep and cap proteins can be provided in trans. Another important feature of AAV is that it is an extremely stable and robust virus. It easily withstands the conditions used to inactivate adenovirus (56°C to 65°C for several hours), making cryopreservation of AAV less important. AAV can be lyophilized. Finally, AAV-infected cells do not resist superinfection.

[0067] The recombinant AAV genome of the present disclosure comprises the nucleic acid molecule of the present disclosure and one or more AAV ITRs flanking the nucleic acid molecule. The AAV DNA of the rAAV genome can be derived from any AAV serotype from which a recombinant virus can be derived, including, but not limited to, AAV serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVRH10, AAVRH74, AAV11, AAV12, AAV13, or Anc80, AAV7m8, and derivatives thereof). The production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692. Other types of rAAV variants, such as rAAVs with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). As noted in the Background section above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0068] The provided recombinant AAV (i.e., infectious, encapsidated rAAV particles) comprise a rAAV genome. The term "rAAV genome" refers to a polynucleotide sequence derived from a modified native AAV genome. In some embodiments, the rAAV genome has been modified to remove the native cap and rep genes. In some embodiments, the rAAV genome comprises endogenous 5' and 3' inverted terminal repeats (ITRs). In some embodiments, the rAAV genome comprises ITRs from an AAV serotype different from the AAV serotype from which the AAV genome is derived. In some embodiments, the rAAV genome comprises a transgene of interest flanked at the 5' and 3' ends by inverted terminal repeats (ITRs). In some embodiments, the rAAV genome comprises a "gene cassette." In exemplary embodiments, the genomes of both rAAVs lack AAV rep and cap DNA, i.e., there is no AAV rep or cap DNA between the ITRs of the rAAV genome.

[0069] The rAAV genomes provided herein, in some embodiments, comprise one or more AAV ITRs flanking the transgene polynucleotide sequence. The transgene polynucleotide sequence is operably linked to transcriptional control elements (including, but not limited to, promoters, enhancers, and / or polyadenylation signal sequences) that are functional in the target cell to form a "gene cassette". Exemplary promoters are the pIRF promoter, chicken beta actin promoter (CBA), and the P546 promoter comprising the polynucleotide sequence set forth in SEQ ID NO:2. Additional promoters are contemplated herein, including, but not limited to, simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters (such as, but not limited to, actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter).

[0070] Further provided herein are P546 promoter sequences and nucleotide sequences that exhibit transcription-enhancing activity or promoter sequences that are at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the P546 (SEQ ID NO:2) sequence.

[0071] Other examples of transcriptional control elements are tissue-specific control elements, such as promoters that allow specific expression in neurons or specific expression in glial cells. Examples include the neuron-specific enolase and glial fibrillary acidic protein promoters. Inducible promoters are also contemplated. Non-limiting examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline-regulated promoters. The gene cassette may also include an intron sequence to facilitate processing of the transgene RNA transcript when expressed in mammalian cells. One example of such an intron is the SV40 intron.

[0072] Conservative nucleotide substitutions within the rAAV9 genome, including but not limited to within a gene cassette within the rAAV9 genome, are contemplated. For example, an MECP2 cDNA in a gene cassette can have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to an MECP2 nucleotide sequence, such as the nucleotide sequence of SEQ ID NO:3, that encodes a protein that retains MECP2 activity.

[0073] The rAAV genomes provided herein comprise a polynucleotide that encodes the MECP2 protein (SEQ ID NO: 3). In some embodiments, the rAAV genomes provided herein comprise a polynucleotide that encodes a polypeptide comprising an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence encoded by an MECP2 cDNA.

[0074] The rAAV genomes provided herein comprise nucleotides 151-2393 of the nucleotide sequence set forth as SEQ ID NO:1, or nucleotides 151-2393 of the nucleotide sequence set forth as SEQ ID NO:5. In some embodiments, the rAAV genomes provided herein comprise a polypeptide that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to nucleotides 151-2393 of the nucleotide sequence set forth as SEQ ID NO:1, or nucleotides 151-2393 of the nucleotide sequence set forth as SEQ ID NO:5.

[0075] The terms "sequence identity", "percent sequence identity", or "percent identity" in the context of nucleic acid or amino acid sequences refer to residues in two sequences that are the same when aligned for maximum correspondence. The length of sequence identity comparison can be over the entire length of a genome, the entire length of a gene coding sequence, or a fragment of at least about 500-5000 nucleotides is desirable. However, identity between smaller fragments, e.g., identity between at least about 9 nucleotides, usually at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 nucleotides or more, may also be desirable. Percent sequence identity can be determined by techniques known in the art. For example, homology can be determined by directly comparing sequence information between two polypeptide molecules by aligning the sequence information and using readily available computer programs such as ALIGN, ClustalW2, and BLAST. In one embodiment, when BLAST is used as the alignment tool, the following default parameters are used: genetic code=standard; filter=none; strand=both; cutoff=60; prediction=10; matrix=BLOSUM62; explanation=50 sequences; sort=high score; database=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+Swiss protein+Spupdate+PIR.

[0076] The rAAV genome provided herein, in some embodiments, encodes an MECP2 protein and a polynucleotide sequence that hybridizes under stringent conditions to the polynucleotide sequence set forth in SEQ ID NO:3, or its complement.

[0077] The DNA plasmid of the present disclosure comprises the rAAV genome of the present disclosure. The DNA plasmid is transferred to a cell that is permissive for infection by a helper virus (e.g., adenovirus, E1 deleted adenovirus, or herpesvirus) for AAV to assemble the rAAV genome into an infectious viral particle. Techniques for producing rAAV particles in which the packaged AAV genome, rep and cap genes, and helper virus functions are provided to the cell are standard in the art. Production of rAAV requires the following components to be present in a single cell (referred to herein as a packaging cell): the rAAV genome, AAV rep and cap genes separate from (i.e., not present in) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be derived from any AAV serotype from which a recombinant virus may be derived, and may be derived from an AAV serotype different from the rAAV genomic ITRs, including, but not limited to, AAV serotypes AAV-9, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAVrh.74, AAV-8, AAV-10, AAV-11, AAV-12, and AAV-13. The production of pseudotyped rAAV is disclosed, for example, in WO 01 / 83692, which is incorporated herein by reference in its entirety.

[0078] The method for generating packaging cells is to create a cell line that stably expresses all the components necessary for the production of AAV particles, for example, a plasmid (or multiple plasmids) containing a rAAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes separated from the rAAV genome, and a selectable marker such as the neomycin resistance gene is integrated into the genome of the cell. The AAV genome has been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and suitable for large-scale production of rAAV. Other examples of suitable methods use adenovirus or baculovirus, rather than a plasmid, to introduce the rAAV genome and / or the rep and cap genes into the packaging cells.

[0079] The general principles of rAAV production have been reviewed, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533-539, and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97-129. Various approaches have been described by Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mol. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., Mol. Cell. Biol., 7:349 (1988). Samulski et al. al., J. Virol., 63:3822-3828 (1989); U.S. Pat. No. 5,173,414; WO95 / 13365 and corresponding U.S. Pat. No. 5,658.776, WO95 / 13392; WO96 / 17947; PCT / US98 / 18600; WO97 / 09441 (PCT / US96 / 14423); WO97 / 08298 (PCT / US96 / 13872); WO97 / 21825 (PCT / US96 / 20777); WO97 / 06243 (PCT / FR96 / 01064); WO99 / 11764; Perrin et al. Vaccine 13:1244-1250 (1995); Paul et al. Human Gene Therapy 4:609-615 (1993); Clark et al. Gene Therapy 3:1124-1132 (1996); U.S. Patent No. 5,786,211; U.S. Patent No. 5,871,982, and U.S. Patent No. 6,258,595. The above documents are incorporated herein by reference in their entireties, with particular emphasis on the portions of the documents relating to rAAV production.

[0080] Thus, the present disclosure provides packaging cells that produce infectious rAAV. In one embodiment, the packaging cells can be stably transformed cancer cells, such as HeLa cells, 293 cells, and PerC.6 cells (synonymous 293 lines). In another embodiment, the packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblast cells), WI-38 cells (human fetal fibroblast cells), Vero cells (monkey kidney cells), and FRhL-2 cells (fetal rhesus lung cells).

[0081] rAAV can be purified by standard methods in the art, such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper viruses are known in the art, including, for example, those disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002); U.S. Patent No. 6,566,118 and WO 98 / 09657.

[0082] In another aspect, the invention contemplates a composition comprising a rAAV, such as rAAV9, that encodes a MECP2 polypeptide. The compositions provided herein comprise rAAV and a pharma- ceutically acceptable excipient. Acceptable excipients are non-toxic to recipients, preferably inert at the dosages and concentrations used, and include, but are not limited to, buffers such as phosphate [e.g., phosphate-buffered saline (PBS)], citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or copolymers such as Tween, poloxamer 188, non-ionic surfactants such as Pluronic® (e.g., Pluronic F68) or polyethylene glycol (PEG). The compositions provided herein can include a pharma- ceutically acceptable aqueous excipient containing a non-ionic low osmolality compound, such as iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, and the aqueous excipient containing a non-ionic low osmolality compound can have one or more of the following properties: an osmolality of about 180 mgI / mL, a vapor pressure osmometry osmolality of about 322 mOsm / kg water, an osmolality of about 273 mOsm / L, an absolute viscosity of about 2.3 cp at 20° C. and about 1.5 cp at 37° C., and a specific gravity of about 1.164 at 37° C.

[0083] An exemplary composition includes an agent for increasing the viscosity and / or density of the composition. For example, the composition includes a contrast agent for increasing the viscosity and / or density of the composition. An exemplary composition includes about 20-40% of a non-ionic hypoosmolar compound or contrast agent, or about 25% to about 35% of a non-ionic hypoosmolar compound. An exemplary composition includes scAAV or rAAV viral particles formulated in 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% poloxamer 188, and about 25% to about 35% of a non-ionic hypoosmolar compound. Another exemplary composition includes scAAV formulated in 1×PBS and 0.001% Pluronic F68.IG.

[0084] Sterile injectable solutions are prepared by incorporating the required amount of rAAV in a suitable solvent with various other ingredients as listed above, if necessary, and then sterile filtering. In general, dispersions are prepared by incorporating sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and other ingredients as listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred method of preparation is vacuum drying and freeze-drying technology, which yields a powder of active ingredients and any additional desired ingredients from their previously sterile filtered solutions.

[0085] The titer and dosage of rAAV administered in the methods of the invention will vary depending on, for example, the particular rAAV, the method of administration, the therapeutic goal, the individual, the time of administration, and the cell type being targeted, and can be determined by standard methods in the art. The titer of rAAV is approximately 1 x 10 per ml. 6 , about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×10 10 , about 1×10 11 , about 1×10 12 , about 1×10 13 ~Approx. 1×10 14 , or more for DNase resistant particles (DRP). Dosages may be expressed in units of viral genomes (vg). These dosages for RAAV range from approximately 1×10 9vg or more, about 1×10 10 vg or more, about 1×10 11 vg or more, about 1×10 12 vg or more, approximately 6×10 12 vg or more, about 1×10 13 vg or more, approximately 1.3×10 13 vg or more, approximately 1.4×10 13 vg or more, approximately 2×10 13 vg or higher, 3x10 13 vg or more, approximately 6×10 13 vg or more, about 1×10 14 vg or more, about 3x10 14 That's about 6 x 10 14 vg or more, about 1×10 15 vg or more, approximately 3×10 15 vg or more, approximately 6×10 15 vg or more, about 1×10 16 vg or more, approximately 3×10 16 vg or more, or about 6×10 16 For neonates, the dose of rAAV is approximately 1×10 9 vg or more, about 1×10 10 vg or more, about 1×10 11 vg or more, about 1×10 12 vg or more, approximately 6×10 12 More than that, about 1×10 13 vg or more, approximately 1.3×10 13 vg or more, approximately 1.4×10 13 vg or more, approximately 2×10 13 vg or more, approximately 3×10 13 vg or more, approximately 6×10 13 vg or more, about 1×10 14 vg or more, approximately 3×10 14 vg or more, approximately 6×10 14 vg or more, about 1×10 15 vg or more, approximately 3×10 15 vg or more, approximately 6×10 15 vg or more, about 1×10 16 vg or more, approximately 3×10 16 vg or more, or about 6×10 16 vg or higher.

[0086] Methods of transducing target cells with rAAV in vivo or in vitro are contemplated by the present disclosure. In vivo methods include administering an effective dose or effective multiple doses of a composition comprising the rAAV of the present disclosure to an animal (including a human) in need thereof. If the dose is administered before the onset of the disorder / disease, the administration is prophylactic. If the dose is administered after the onset of the disorder / disease, the administration is therapeutic. In an embodiment of the present disclosure, an effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, delays or prevents progression to the disorder / disease state, delays or prevents progression of the disorder / disease state, reduces the extent of the disease, causes remission (partial or complete remission) of the disease, and / or prolongs survival. An example of a disease contemplated for prevention or treatment by the methods of the present disclosure is PTHS.

[0087] Transduction of cells with the rAAV of the invention results in sustained expression of the MECP2 polypeptide encoded by the rAAV. In some embodiments, it is contemplated that the target expression level is about 10% to about 25% of the normal (or wild-type) physiological expression level in a subject without PTHS, or about 25% to about 50% of the normal (or wild-type) physiological expression level in a subject without PTHS, or about 50% to about 75% of the normal (or wild-type) physiological expression level in a subject without PTHS, or about 75% to about 125% of the normal (or wild-type) physiological expression level in a subject without PTHS. The target expression level can be about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120%, or about 125% of the normal expression level.

[0088] The term "transduction" is used to refer to the administration / delivery of the coding region for MECP2 to a recipient cell, either in vivo or in vitro, via a replication-deficient rAAV of the present disclosure, resulting in expression of MECP2 in the recipient cell.

[0089] In some embodiments of the therapeutic method of the present invention, an agent that increases the viscosity and / or density of the composition is administered to the patient. For example, a non-ionic low osmolality contrast agent is also administered to the patient. Such contrast agents include, but are not limited to, iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, and mixtures of two or more of the contrast agents. In some embodiments, the therapeutic method thus further comprises administering iohexol to the patient. It is contemplated that the non-ionic low osmolality contrast agent increases the transduction of target cells in the central nervous system of the patient. It is contemplated that when the rAAV of the present disclosure is used in combination with the contrast agent described herein, the transduction of cells is increased compared to the transduction of cells when the rAAV of the present disclosure is used alone. In various embodiments, transduction of cells is increased by at least about 1%, or at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 120%, at least about 150%, at least about 180%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500% or more when a vector of the present disclosure is used in combination with an imaging agent described herein compared to transduction of a vector of the present disclosure when not used in combination with an imaging agent. In further embodiments, transduction of cells is increased by about 10% to about 50%, or about 10% to about 100%, or about 5% to 10%, or about 5% to about 50%, or about 1% to about 500%, or about 10% to about 200%, or about 10% to about 300%, or about 10% to about 400%, or about 100% to about 500%, or about 150% to about 300%, or about 200% to about 500%, when a vector of the present disclosure is used in combination with an imaging agent described herein, compared to transduction of a vector of the present disclosure when not used in combination with an imaging agent.

[0090] In some embodiments, it is contemplated that placing the patient in Trendelenburg (head down) position increases transduction of cells. In some embodiments, for example, the patient is tilted head down at about 1 degree to about 30 degrees, about 15 degrees to about 30 degrees, about 30 degrees to about 60 degrees, about 60 degrees to about 90 degrees, or about 90 degrees to about 180 degrees during or after intrathecal vector injection. In various embodiments, transduction of cells is increased by at least about 1%, or at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 120%, at least about 150%, at least about 180%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500% or more when Trendelenburg positioning is used as described herein compared to when Trendelenburg positioning is not used.

[0091] In further embodiments, transduction of cells is increased by about 10% to about 50%, or about 10% to about 100%, or about 5% to 10%, or about 5% to about 50%, or about 1% to about 500%, or about 10% to about 200%, or about 10% to about 300%, or about 10% to about 400%, or about 100% to about 500%, or about 150% to about 300%, or about 200% to about 500%, when a vector of the present disclosure is used in combination with an imaging agent and Trendelenburg position as described herein, compared to transduction of a vector of the present disclosure when not used in combination with an imaging agent and Trendelenburg position.

[0092] The present disclosure also provides embodiments of methods of treatment in which intrathecal administration of the vectors and imaging agents of the present disclosure to the central nervous system of a patient in need thereof while in the Trendelenburg position results in a further increase in patient survival compared to the patient survival when the vectors of the present disclosure are administered in the absence of the imaging agent and the Trendelenburg position. In various embodiments, intrathecal administration of the vectors and imaging agents of the present disclosure to the central nervous system of a patient in need thereof while in the Trendelenburg position results in an increase in patient survival of at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200% or more compared to the patient survival when the vectors of the present disclosure are administered in the absence of the imaging agent and the Trendelenburg position.

[0093] Combination therapy is also contemplated by the present disclosure. Combination as used herein includes both simultaneous and sequential therapy. Combination of the methods of the present disclosure with standard medical treatments is particularly contemplated, as well as combination with novel therapies. In some embodiments, combination therapy includes administering an immunosuppressant in combination with the gene therapy disclosed herein.

[0094] Administration of an effective dose of the composition may be by routes standard in the art, including, but not limited to, intramuscular, parenteral, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraosseous, intraocular, intrarectal, or intravaginal. The route of administration and serotype of the AAV components of the rAAV of the present disclosure (particularly the AAV ITRs and capsid proteins) can be selected and / or adapted by one of skill in the art taking into account the disease state to be treated and the target cells / tissues expressing the MECP2 protein.

[0095] The present disclosure provides for local and systemic administration of effective doses of rAAV and compositions of the present disclosure. For example, systemic administration is administration into the circulatory system so that the entire body is affected. Systemic administration includes enteral administration, such as absorption through the digestive tract, and parenteral administration by injection, infusion, or implantation. Immunosuppressants The immunosuppressant may be administered after administration of gene therapy, before or after the initiation of an immune response to the rAAV in the subject. In addition, the immunosuppressant may be administered simultaneously with gene therapy or protein replacement therapy. The immune response in the subject includes an adverse immune response or inflammatory response following or caused by administration of the rAAV to the subject. The immune response may be the production of antibodies in the subject in response to the administered rAAV.

[0096] Exemplary immunosuppressants include glucocorticosteroids, Janus kinase inhibitors, calcineurin inhibitors, mTOR inhibitors, cytostatic agents such as purine analogs, methotrexate, and cyclophosphamide, inosine monophosphate dehydrogenase (IMDH) inhibitors, biologics such as monoclonal antibodies or fusion proteins.

[0097] The immunosuppressant may be an anti-inflammatory steroid, which is a steroid that reduces inflammation and suppresses or modulates the immune system of a subject. Exemplary anti-inflammatory steroids are glucocorticoids such as prednisolone, betamethasone, dexamethasone, hydrocortisone, methylprednisolone, deflazacort, budesonide, or prednisone.

[0098] Janus kinase inhibitors are inhibitors of the JAK / STAT signaling pathway by targeting one or more of the enzymes of the Janus kinase family. Exemplary Janus kinase inhibitors include tofacitinib, baricitinib, upadacitinib, peficitinib, and oclacitinib.

[0099] Calcineurin inhibitors bind to cyclophilin and inhibit the activity of calcineurin. Exemplary calcineurin inhibitors include cyclosporine, tacrolimus, and picecrolimus.

[0100] mTOR inhibitors reduce or inhibit the serine / threonine-specific protein kinase mTOR. Exemplary mTOR inhibitors include sirolimus, everolimus, and temsirolimus.

[0101] Immunosuppressants include immunosuppressant macrolides. The term "immunosuppressant macrolide" refers to a macrolide drug that suppresses or modulates the immune system of a subject. Macrolides are a class of drugs that contain a large macrocyclic lactone ring to which one or more deoxy sugars, such as cladinose or desoamine, are attached. The lactone ring is usually 14, 15, or 16 members. Macrolides belong to the polyketide class of drugs and can be natural products. Examples of immunosuppressant macrolides include tacrolimus, pimecrolimus, and sirolimus.

[0102] Purine analogs block nucleotide synthesis and include IMDH inhibitors. Exemplary purine analogs include azathioprine, mycophenolic acid, and lefunomide. Exemplary immunosuppressant biologics include abatacept, adalimumab, anakinra, certolizumab, etanercept, golimumab, infliximab, ixekizumab, natalizumab, rituximab, secukinumab, tocilizumab, ustekinenumab, vedolizumab, basiliximab, belatacept, and daclizumab.

[0103] In particular, the immunosuppressant is an anti-CD20 antibody. The term anti-CD20 specific antibody refers to an antibody that specifically binds to CD20 or inhibits or reduces the expression or activity of CD20. Exemplary anti-CD20 antibodies include rituximab, ocrelizumab, or ofatumumab.

[0104] Additional examples of immunosuppressive antibodies include anti-CD25 antibodies (or anti-IL2 or anti-TAC antibodies) such as basiliximab and daclizumab, as well as anti-CD3 antibodies such as muromonab-CD3, otelixizumab, teplizumab, and visilizumab, and anti-CD52 antibodies such as alemtuzumab.

[0105] The following examples are offered by way of illustration and not by way of limitation: Numerical ranges recited include each integer value within each range, including the minimum and maximum recited integers. EXAMPLES

[0106] Example 1 TCF4 protein levels are variable within individuals with missense mutations. Direct conversion of patient fibroblasts into neural progenitor cells (NPCs) allows for the study of disease mechanisms in specific cell types of interest. This in vitro cell model can be used to identify patient responders based on the presence of specific disease markers of cellular stress. If disease markers are present, this information can be used to select potential treatments from a selection of therapeutic molecules, such as small molecules or biologics, and determine their effects on the PTHS phenotype.

[0107] Fibroblasts from six PTHS patients carrying either heterozygous missense or deletion mutations in TCF4 were obtained and are summarized in Table 3 below. Fibroblasts were converted into induced neural progenitor cells (iNPCs) using retroviruses, SOX2, KLF4, cMyc, and Oct3 / 4, and chemically defined media as previously described (Meyer et al., PNAS 829-832 (2014)). NPCs were then differentiated into astrocytes (iAstrocytes). Neural progenitor cells were cultured to confluence on fibronectin-coated dishes in NPC medium (DMEM / F12 medium containing 1% N2 supplement (Life Technologies), 1% B27, 1% Anti-antibiotic-antimycotic, 20ng / ml fibroblast growth factor 2). iAstrocytes were differentiated by seeding a small amount of NPCs on another fibronectin-coated dish in astrocyte induction medium (DMEM medium containing 0.2% N2). These induced astrocytes are referred to herein as iastrocytes or iAST. Neurons were converted from NPCs by transduction with retro-Ngn2.

[0108] [Table 4]

[0109] After 5 days of differentiation, induced astrocytes were seeded into either 96-well (10,000 cells / well), 384-well (2,500 cells / well), 24-well Seahorse plates (20,000 cells / well), or 96-well Seahorse plates (10,000 cells / well). Representative images of iAstrocytes from healthy and TCF4 mutant cells after differentiation are provided in Figure 2.

[0110] Initial studies on three of these patient lines investigated the levels of TCF4 protein in patient neural progenitor cells and iAstrocytes. Western blots of TCF4 (isoforms B, D, E, F, M, N, O, Q) found differential levels in PTHS iAstrocytes and NPCs compared to healthy controls (Figure 3A and B). Importantly, patients with heterozygous gene deletions had a 50% reduction in TCF4 levels, whereas missense mutations either did not result in changes in protein levels or resulted in significant upregulation, suggesting potentially toxic overexpression (Figure 3B).

[0111] In addition, GFP+ neurons co-cultured with iAstrocytes from TCF4 patients show reduced neuronal viability (Figure 4A and B). PTHS iAstrocytes induced changes in neuronal morphology (Figure 4B). Thus, this direct conversion technique and co-culture assay can be utilized to identify new disease mechanisms while simultaneously evaluating potential therapeutic strategies (including but not limited to gene therapy) to treat patients with PTHS.

[0112] Western blot data showing reduced MECP2 levels in NPCs of all patient lines tested (Figure 5). Interestingly, PTHS iA harboring a mutation resulting in TCF4 gene deletion also negatively affected iAstrocyte differentiation (Figure 2). Furthermore, co-culture analysis of iAstrocytes derived from PTHS patients showed poor support for neurons, providing a platform for screening potential therapeutic approaches (Figure 4A and B). The reduced MECP2 levels observed in NPCs harboring TCF4 mutations suggests that restoration of MECP2 is a promising approach to treat PTHS. This is further supported by the restoration of differentiation observed when NPCs containing TCF4 deletion mutations were transduced with MECP2.AAV9 (Figure 6). Thus, MECP2.AAV9 gene therapy may be used to treat PTHS.

[0113] Example 2 ScAAV9.P546.MECP2 construct The scAAV9.P546.MECP2 recombinant viral genome (SEQ ID NO:5; shown in FIG. 1) contains the 546 promoter (P546 promoter) driving expression of the human MECP2 cDNA, and a synthetic polyadenylation signal. The gene cassette (nucleotides 151-2558 of SEQ ID NO:5) is flanked by mutant AAV2 inverted terminal repeats (ITRs) and wild-type AAV2 ITRs that allow packaging of the self-complementary AAV genome.

[0114] [Table 5]

[0115] Self-complementary AAV9 (scAAV9) was produced in 293 cells by a transient transfection procedure using a double-stranded AAV2-ITR-based vector with a plasmid encoding the Rep2Cap9 sequence as previously described [Gao et al., J. Virol., 78:6381-6388 (2004)] together with the adenovirus helper plasmid pHelper (Stratagene, Santa Clara, CA). Virus was produced and purified by two cesium chloride density gradient purification steps, dialyzed against PBS, formulated with 0.001% Pluronic-F68 to prevent virus aggregation, and stored at 4°C. All vector preparations were titrated by quantitative PCR using Taq-Man technology. Vector purity was assessed by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA).

[0116] scAAV9 was produced in 293 cells by a transient transfection procedure using a double-stranded AAV2-ITR-based vector with a plasmid encoding the Rep2Cap9 sequence as previously described [Gao et al., see above] together with the adenoviral helper plasmid pHelper (Stratagene, Santa Clara, CA). Virus was produced in three separate batches for the experiment, purified by two cesium chloride density gradient purification steps, dialyzed against PBS, formulated with 0.001% Pluronic-F68 to prevent virus aggregation, and stored at 4°C. All vector preparations were titrated by quantitative PCR using Taq-Man technology. Vector purity was assessed by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA).

[0117] scAAV9.P546.MECP2 was tested to determine whether the TCF4 deletion mutation impedes iAstrocyte differentiation from neural progenitor cells (NPCs). Healthy NPCs differentiate efficiently into induced astrocytes (iA) as shown by decreased nestin (progenitor cell marker, green) and increased GFAP (astrocyte marker, purple) staining. TCF4 deletion (untreated) results in decreased differentiation efficiency as shown by increased nestin and decreased GFAP staining. As shown in Figure 2, transduction of TCF4 knockout patient NPCs in vitro with scAAV9.P546.MECP2 (10 and 100 MOI) 2 days prior to differentiation restored iA differentiation. The data indicate that increasing the expression levels of MECP2 improves iAstrocyte differentiation from NPCs.

[0118] This scAAV is also described in International Publication No. WO2018 / 094251 and U.S. Patent Application No. 2020 / 179467, both of which are incorporated by reference in their entireties. The following studies are disclosed in these applications and provide data regarding scAAV9 expression in wild-type mice and non-human primates.

[0119] Example 3 Data from wild-type mice and non-human primates Treatment of wild-type mice with scAAV9.P546.MECP2 is safe and well tolerated An important concern regarding MECP2 replacement therapy is assessing its impact on cells expressing an intact copy of MECP2. scAAV9.P546.Mecp2 was designed with this in mind by incorporating a fragment of the mouse Mecp2 promoter to support physiological regulation of the MECP2 transgene. To test the safety of scAAV9.P546.MECP2, survival and behavioral analyses were performed in a cohort of wild-type mice injected ICV at P1 with scAAV9.P546.MECP2.

[0120] A total of 131 wild-type male mice were treated with various ICV doses of AVXS-201 and followed for survival (Figure 7A). 10 vg), no mortality was recorded and 21 treated animals survived to P342. No mortality was recorded in the PBS-treated group, with 3.50 × 10 9 , 2.78×10 10 and 1.13x10 11 One death was recorded in each of the vg-treated groups. Behavioral scoring using the criteria from Box 1 showed that the vector-treated group, which had a mean phenotypic score of 1, was predominantly more aggressive than the two highest dose groups (5.56 × 10 10 and 1.13x10 11 vg, Figure 7B). Open field testing at 2-3 months of age showed no statistical difference between vector-treated and PBS-treated wild-type males (Figure 8A-B). Interestingly, 13x10 11A significant decrease in rotarod performance was detected in the vg cohort (Figure 8C). These combined data suggest a toxic effect of MECP2 overexpression at the maximum AVXS-201 dose. Taken together, these data suggest that in the "worst case scenario" of scAAV9.P546.MECP2 treatment only transducing wild-type cells, there would be minimal impact on animal survival and behavior at the targeted therapeutic dose.

[0121] Physiological levels of MECP2 are maintained in the brains of wild-type mice treated with therapeutic doses of scAAV9.P546.MECP2 To further explore the levels associated with symptomatic MECP2 overexpression, wild-type male mice were treated with 1.44 x 10 10 vg therapeutic target or 1.13x10 11 PBS or scAAV9.P546.MECP2 was injected ICV at P1 at the maximum tested dose of 1.5 vg. Animals were euthanized 3 weeks post-injection and brains were harvested for Western blot. For comparison, tissues were blotted along with brains from a mouse model of MECP2 overexpression, designated Tg3. Brains were cut into separate regions (Cb=cerebellum, Med=medulla, Hipp=hippocampus, Ctx=cortex and Mid=midbrain; FIG. 9) and individual regions were homogenized for blotting. Data were normalized to MECP2 levels in PBS-treated wild-type brains. Target therapeutic dose (1.44x10 10 vg) had 1-1.5-fold higher MECP2 levels in wild-type tissue across all regions examined. 11 vg) ranged from 1.31-2.56-fold wild-type levels, but did not reach the 2.31-3.93-fold levels seen in Tg3 tissue (Figure 9B). These data, along with the behavioral and survival data presented earlier, provide confidence that scAAV9.P546.MECP2, when administered at the target dose, expresses protein at near-physiological levels. Importantly, therapeutic doses do not approach the two-fold protein levels associated with MECP2 duplication syndrome. This demonstrates the safety of MECP2 replacement approaches using gene therapy.

[0122] Over the course of 18 months following intrathecal injection of scAAV9.P546.MECP2, the body weight, hematology, and serum chemistry of non-human primates were unremarkable To investigate the safety and tolerability of ScAAV9.P546.MECP and the associated intrathecal injection procedure, three treated male cynomolgus monkeys were followed for 18 months after injection. Dosing parameters are shown in Table 5.

[0123] [Table 6]

[0124] Two animals were dosed with the intended therapeutic dose (approximately 1.44 × 10 per kg of body weight). 9 vg equivalent) and one animal was treated with approximately two times lower dose (approximately 7.00 × 10 8vg equivalents were administered. The intrathecal injection procedure has been previously described by Meyer et al., Molecular Therapy: The Journal of the American Society of Gene Therapy, 23:477-487 (2015). Briefly, the vector was mixed with contrast agent to verify vector diffusion. Anesthetized subjects were placed in lateral decubitus position and a posterior midline injection site was prepared at approximately the L4 / 5 level (below the conus medullaris). Under sterile conditions, a styletted spinal needle was inserted and subarachnoid cannulation was confirmed by clear CSF flow from the needle. 0.8 ml of CSF was withdrawn to reduce pressure in the subarachnoid space and the vector solution was injected immediately after. After injection, the animal was maintained in Trendelenburg position and its body tilted head-down for 10 min. Treated animals were dosed at 6 or 12 months of age, and body weights, blood counts, and serum chemistry were collected monthly for the first 6 months after injection, and every 2 months thereafter. Body weights are shown in FIG. 10, blood counts in FIG. 11, and serum chemistry in FIG. 12 and 13, graphed with values ​​from control-treated animals from the same colony at the Mannheimer Foundation (Homestead, FL). Overall, body weights, cell counts, and serum values ​​from vector-treated animals were consistent with those from control-treated animals. No values ​​deviated substantially from the control in more than two consecutive observations in a given animal, except for amylase, which was higher in two vector-treated animals at baseline. These data indicate that AVXS-201 and the intrathecal injection procedure are safe and well tolerated.

[0125] Histopathological analysis of tissues from non-human primates following intrathecal injection of scAAV9.P546.MECP2 Samples of visceral and nervous system tissues from animals 15C38, 15C49, and 15C34 (described above) were sent to GEMpath Inc. (Longmont, CO) for paraffin embedding, sectioning, and hematoxylin and eosin staining. Slides were read and reports were generated by a GEMpath Board-certified veterinary pathologist. Tissues sampled and examined are shown in Table 6. The pathology report noted that scAAV9.P546.MECP2 treatment did not induce lesions in any protocol-specified tissues at 6 weeks or 18 months.

[0126] [Table 7]

[0127] Physiological levels of MECP2 in the non-human primate brain following intrathecal injection of scAAV9.P546.MECP2 Two 12-month-old male cynomolgus monkeys were administered 7.7 × 10 12vg / kg of AVXS-201 was injected intrathecally. Animals were allowed to survive for 6 weeks after injection and were euthanized for analysis of MECP2 expression. Selected brain regions were analyzed for total MECP2 expression by immunohistochemistry (no obvious elevation of MECP2 was detected in cortical and subcortical regions, FIG. 14), nor proximal to the injection site (lumbar spinal cord, FIG. 14). Importantly, these data also do not show any gross abnormalities in tissues from injected animals. To further examine transgene expression, brain regions were homogenized and compared to historical control tissues from animals from the same colony (FIG. 15). Samples from occipital and temporal cortex, hypothalamus, lumbar spinal cord, thalamus, amygdala, hippocampus, and cerebellum were analyzed by Western blot for total MECP2 expression. Across all regions examined, no region showed MECP2 expression levels more than twice those of controls. Elevated MECP2 was detected in the hypothalamus and amygdala, regions proximal to the third and lateral ventricles, respectively, but not in the cerebellum. Furthermore, the lumbar spinal cord, proximal to the injection site, did not show elevated MECP2 levels (Figure 15). These data suggest that the combination of viral dose and expression construct modulates MECP2 expression. Additionally, in situ hybridization (ISH) was performed to detect vector-derived transcripts and determine their distribution in the brain at 6 weeks and 18 months post-injection (Figures 16 and 17). All examined regions of the brain and spinal cord (occipital cortex, temporal cortex, hippocampus, corpus callosum, thalamus, caudate nucleus, putamen, superior colliculus, pons, medulla, cerebellum, cervical, thoracic, and lumbar spinal cord) showed expression of vector-derived transcripts that were absent in tissues from control-treated animals. These data demonstrate the specificity of the ISH probe for vector-derived MECP2 transcripts and show that the scAAV9.P546.MECP2 promoter construct is functional in NHP nervous system tissues. These data show that scAAV9.P546.MECP2 is widely distributed throughout the CNS and expressed at physiological levels when administered by lumbar puncture.

[0128] Example 4 TCF + / - Behavioral analysis in mice Wild type and TCF + / -We investigated the expression and behavioral effects of MeCP2 in wild-type and TCF mice. + / - Mice were administered 1.5e10 viral genomes (vg) per animal of scAAV9.P546.GFP or scAAV9.P546.MECP2 by ICV injection within 36 hours of birth (postnatal day 2 (P2)). AAV was diluted in PBS to achieve a total injection volume of 5 μL per injection.

[0129] The animals were anesthetized with isoflurane in a chamber for 1 min. Finally, the animals were decapitated, and the brains were removed and placed in 4% PFA / 0.1M PBS. The brains were cut using a cryogenic microtone, and the slices were observed under a fluorescent microscope. As shown in Figure 20, GFP was expressed in the cortex and hippocampus of treated mice. In addition, wild-type and TCF after injection were significantly higher in the control mice than in the control mice. + / - MeCP2 protein was expressed in the mouse brain (see FIG. 21). This study demonstrated that injection of scAAV9.P546.MECP2 did not result in strong overexpression of MeCP2 protein in the brain.

[0130] Confocal microscopy was used to examine the nuclear intensity of MeCP2 protein expression in the hippocampus, cortex (anterior and posterior), and thalamus. As shown in Figures 22-24, ICV injection of scAAV9.P546.MECP2 resulted in a reduction in TCF expression similar to that observed in wild-type mice. + / - The MeCP2 nuclear intensity in the cortex and hippocampus of mice was obtained.

[0131] On P60, the behavior of treated mice was analyzed. Marble burying experiments were performed as described in Angoa-Perez et al. J. Vis. Exp. 82:50978, 2013. As shown in Figure 25 and the table below, ICV injection of scAAV9.P546.MECP2 improved performance in the marble burying experiment.

[0132] [Table 8]

[0133] In addition, an open field test was performed as described by Kraeuter et al. Methods Mol. Biol. 1916:99-103, 2019. Similarly, ICV injection of scAAV9.P546.MECP2 improved TCF + / - It also led to improved performance in the open field test in mice (Figure 26).

[0134] [Table 9]

[0135] In addition, elevated plus maze assays were performed as described by Komada et al. J. Vis. Exp. 22(22):1088, 2008, and demonstrated that ICV injection of scAAV9.P546.MECP2 significantly increased TCF + / - This resulted in improved performance in mice (Figure 27).

[0136] [Table 10]

[0137] Example 5 Prophetic examples in humans To therapeutically test the potential of this construct in humans, scAAV9.P546.MECP2 is delivered to the patient's cerebrospinal fluid (CSF). For CSF delivery, the viral vector is mixed with a contrast agent (Omnipaque or similar). For example, the composition may include a non-ionic low osmolarity contrast agent selected from the group consisting of iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, and combinations thereof. The patient is held in the Trendelenburg position with head tilted downward at an angle of 15-30 degrees for 5, 10, or 15 minutes immediately after lumbar CSF injection. The CSF dose will range from 1e13 viral genomes (vg) per patient to 1e15 vg / patient, based on age group. New CSF delivery techniques using new injection tools developed can also be used. Intravenously delivered doses will range from 1e13 vg / kilogram (kg) of body weight to 2e14 vg / kg.

[0138] While the present invention has been described with respect to various embodiments and examples, it will be understood that modifications and improvements will occur to those skilled in the art. Accordingly, only such limitations as appear in the claims should be placed on the invention.

[0139] All documents referenced herein are incorporated by reference in their entirety. array P546 promoter sequence (SEQ ID NO:2) GTGAACAACGCCAGGCTCCTCAACAGGCAACTTTGCTACTTCTACAGAAAATGATAATAAAGAAATGCTGGTGAAGTCAAATGCTTATCACAATGGTGAACTACTCAGCAGGGAGGCTCTAATAGGCGCCAAGAGCCTAGACTTCCTTAAGCGCCAGAGTCCACAAGGGCCCAGTTAATCCTCAACATTCAAATGCTGCCCACAAAACCAGCCCCTCTGTGCCCTAGCCGCCTCTTTTTTCCAAGTGACAGTAGAACTCCACCAATCCGCAGCTGAATGGGGTCCGCCTCTTTTCCCTGCCTAAACAGACAGGAACTCCTGCCAATTGAGGGCGTCACCGCTAAGGCTCCGCCCCAGCCTGGGCTCCACAACCAATGAAGGGTAATCTCGACAAAGAGCAAGGGGTGGGGCGCGGGCGCGCAGGTGCAGCAGCACACAGGCTGGTCGGGAGGGCGGGGCGCGACGTCTGCCGTGCGGGGTCCCGGCATCGGTTGCGCGCGCGCTCCCTCCTCTCGGAGAGAGGGCTGTGGTAAAACCCGTCCGGAAAAC Coding region sequence (human MECP2 cds) (SEQ ID NO: 3) PolyA sequence (synthetic) (SEQ ID NO:4) AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGTTTTTTGTGTG scAAV9.P546.MECP2 (SEQ ID NO:5) 5'ITR (SEQ ID NO:6) Ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtgg SV40 intron (SEQ ID NO:7) Ggtaagtttagtcttttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcctcagtcgatgttgcctttacttctaggc 3'ITR (SEQ ID NO:8) agg aaccccctagt gatggagttg gccactccct ctctgcgcgctcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggcggcctcagtg agcgagcgag cgcgcagaga gggagtgg

Claims

1. A composition for treating Pitt-Hopkins syndrome (PTHS) in a subject, the composition comprising a recombinant adeno-associated virus (rAAV9) encoding methyl-CpG binding protein 2 (MECP2).

2. A composition for increasing methyl-CpG binding protein 2 (MECP2) levels in a subject suffering from Pitt-Hopkins syndrome, the composition comprising a recombinant adeno-associated virus (rAAV9) or rAAV viral particle encoding MECP2.

3. A composition for delivering a polynucleotide sequence encoding methyl-CpG binding protein 2 (MECP2) to a subject suffering from PTHS, the composition comprising a recombinant adeno-associated virus (rAAV9) or rAAV viral particle encoding MECP2.

4. The composition of any one of claims 1 to 3, wherein the rAAV comprises the nucleotide sequence of SEQ ID NO:

3.

5. The composition of claim 4, wherein the rAAV further comprises a promoter sequence of SEQ ID NO:

2.

6. The composition of claim 4 , wherein the rAAV further comprises an SV40 intron and a synthetic polyadenylation signal sequence.

7. The composition of claim 4, wherein the rAAV further comprises an inverted terminal repeat (ITR).

8. The composition of claim 7 , wherein the rAAV comprises a mutant ITR and a wild-type ITR.

9. The rAAV A) nucleotides 151 to 2393 of the nucleotide sequence of SEQ ID NO:5; or B) Nucleotides 151 to 2558 of the nucleotide sequence of SEQ ID NO:1 The composition according to any one of claims 1 to 3, comprising:

10. The composition of any one of claims 1 to 3, wherein the composition is formulated for direct injection into cerebrospinal fluid, intraventricular, intrathecal, or intravenous delivery.

11. The composition described in any one of claims 1 to 3, wherein the subject has a mutation in the TCF4 gene.

12. The subject is afflicted with one or more of the following conditions, which may include intellectual disability, developmental delay, breathing problems, recurrent seizures (epilepsy), and distinctive facial features, delayed or absent speech, poor communication skills, poor socialization skills, hyperventilation, apnea, cyanosis, clubbing of the fingers and / or toes, thin eyebrows, sunken eyes, a prominent nose with a high bridge, a prominent double peak on the upper lip (Cupid's bow), a wide mouth with thick lips, widely spaced teeth, thick and / or 4. The composition of any one of claims 1 to 3, wherein the symptoms are cupped ears, constipation, gastrointestinal problems, microcephaly, myopia, strabismus, short stature, mild brain abnormalities, small hands and / or feet, single palmar crease, flat feet, thickening of the pads of the fingers and / or toes, cryptorchidism, stereotypy, involuntary movements of the hands, loss of gait, loss of muscle tone, scoliosis, sleep disorders, coordination or balance problems, anxiety, behavioral problems, teeth grinding, excessive saliva and drooling, cardiac problems, cardiac arrhythmia, eating problems or swallowing problems.

13. Use of a recombinant adeno-associated virus (rAAV9) encoding methyl-CpG binding protein 2 (MECP2) for the preparation of a medicament for the treatment of Pitt-Hopkins syndrome (PTHS) in a subject in need of said treatment.

14. Use of a recombinant adeno-associated virus (rAAV9) encoding methyl-CpG binding protein 2 (MECP2) for the preparation of a medicament for increasing methyl-CpG binding protein 2 (MECP2) levels in a subject suffering from Pitt-Hopkins syndrome.

15. Use of a recombinant adeno-associated virus (rAAV9) encoding methyl-CpG binding protein 2 (MECP2) for the preparation of a medicament for delivering said polynucleotide sequence encoding methyl-CpG binding protein 2 (MECP2) to a subject suffering from PTHS.

16. The use according to any one of claims 13 to 15, wherein the rAAV comprises the nucleotide sequence of SEQ ID NO:

3.

17. The use of claim 16, wherein the rAAV further comprises a promoter sequence of SEQ ID NO:

2.

18. The use of claim 16, wherein the rAAV further comprises an SV40 intron and a synthetic polyadenylation signal sequence.

19. The use of claim 16, wherein the rAAV further comprises an inverted terminal repeat (ITR).

20. The use of claim 19, wherein the rAAV comprises a mutant ITR and a wild-type ITR.

21. The rAAV A) nucleotides 151 to 2393 of the nucleotide sequence of SEQ ID NO:5; or B) Nucleotides 151 to 2558 of the nucleotide sequence of SEQ ID NO:1 The use according to any one of claims 13 to 15, comprising:

22. The use according to any one of claims 13 to 15, wherein the medicament is formulated to be administered using direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, or intravenous delivery.

23. The use according to any one of claims 13 to 15, wherein the subject has a mutation in the TCF4 gene.

24. The subject is afflicted with one or more of the following conditions, which may include intellectual disability, developmental delay, breathing problems, recurrent seizures (epilepsy), and distinctive facial features, delayed or absent speech, poor communication skills, poor socialization skills, hyperventilation, apnea, cyanosis, clubbing of the fingers and / or toes, thin eyebrows, sunken eyes, a prominent nose with a high bridge, a prominent double peak on the upper lip (Cupid's bow), a wide mouth with thick lips, widely spaced teeth, thick and / or cleft brows, and / or ridged foreheads.

16. The use according to any one of claims 13 to 15, wherein the symptoms of rheumatoid arthritis are: lopsided ears, constipation, gastrointestinal problems, microcephaly, myopia, strabismus, short stature, mild brain abnormalities, small hands and / or feet, single palmar creases, flat feet, thickening of the pads of the fingers and / or toes, cryptorchidism, stereotypy, involuntary movements of the hands, loss of gait, loss of muscle tone, scoliosis, sleep disorders, coordination or balance problems, anxiety, behavioural problems, teeth grinding, excessive saliva and drooling, heart problems, arrhythmia, eating problems or swallowing problems.

Images