Non-viral DNA vectors expressing therapeutic antibodies and uses thereof

Abstract

This application describes methods and compositions comprising ceDNA vectors useful for expressing antibodies and antigen-binding fragments thereof in cells, tissues or subjects, and methods for treating and / or preventing various diseases, disorders and cancers. The technology described herein relates to capsid-free (e.g., non-viral) DNA vectors with covalently closed ends (referred to herein as "closed-end DNA vectors" or "ceDNA vectors"), where the ceDNA vectors comprise a nucleic acid sequence encoding one or more polypeptides selected from the group consisting of an antibody heavy chain and an antibody light chain.

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims priority to U.S. Provisional Application No. 63 / 180,382, filed April 27, 2021, the entire contents of which are incorporated herein by reference in their entirety.

[0002] FIELD OF THE INVENTION The present disclosure relates to the field of antibody therapy, including non-viral vectors for expressing antibodies or antigen-binding fragments thereof in subjects or cells. The present disclosure also relates to nucleic acid constructs, promoters, vectors, and host cells containing nucleic acids, as well as methods for delivering transgenes encoding antibodies or antigen-binding fragments thereof to target cells, tissues, organs, or organisms. For example, the present disclosure provides methods for expressing antibodies or antigen-binding fragments thereof, e.g., from expressing cells, using non-viral ceDNA vectors for the treatment of subjects with infections, diseases, or disorders. Any infections, diseases, or disorders that can be treated with antibody therapeutics are contemplated by the present disclosure. The methods and compositions can also be applied, e.g., for therapeutic or prophylactic purposes, in subjects in need thereof. [Background technology]

[0003] Antibody-based therapeutics, such as mAbs, have been shown to be one of the most successful strategies for treating immune disorders, cancer, and infectious diseases. To achieve a sufficiently high concentration of antibodies for long-lasting therapeutic effects, antibody therapy is traditionally delivered by repeated administration, for example, by multiple injections. However, this dosing regimen results in inconsistent antibody levels throughout the treatment period, limited efficacy per administration, and high costs for antibody administration and consumption.

[0004] Recombinant AAV (rAAV) is perhaps the most well-studied vector for gene transfer in humans, with hundreds of clinical trials demonstrating the safety of transduction. Adeno-associated viruses (AAV) belong to the family Parvoviridae and, more specifically, constitute the genus Dependoparvovirus. Vectors derived from AAV (i.e., rAVV or AAV vectors) are attractive for delivering genetic material because (i) they can infect (transduce) a wide variety of non-dividing and dividing cell types, including muscle cells and neurons; (ii) they lack viral structural genes, thereby reducing host cell responses to viral infection (e.g., interferon-mediated responses); (iii) wild-type viruses are considered non-pathogenic in humans; (iv) in contrast to wild-type AAV, which can integrate into the host cell genome, replication-deficient AAV vectors lack replication (rep) genes and generally persist episomally, thus limiting the risk of insertional mutagenesis or genotoxicity; and (v) compared to other vector systems, AAV vectors are generally considered to be relatively weakly immunogenic and therefore do not elicit a significant immune response (see (ii)), thereby resulting in persistence of vector DNA and potentially long-term expression of therapeutic transgenes.

[0005] However, the use of AAV particles as gene delivery vectors presents several significant drawbacks. One significant drawback associated with rAAV is the limited viral packaging capacity of approximately 4.5 kb of heterologous DNA (Dong et al., 1996; Athanasopoulos et al., 2004; Lai et al., 2010). As a result, the use of AAV vectors is limited to protein-coding capacities of less than 150,000 Da. Particularly in the context of antibody delivery, AAV packaging limitations present a significant challenge for efficient delivery of both the heavy and light chains that form the native antibody structure. A second drawback is that, as a result of the prevalence of wild-type AAV infection in the population, rAAV gene therapy candidates must be screened for the presence of neutralizing antibodies that eliminate the vector from patients. A third drawback relates to capsid immunogenicity, which prevents re-administration to patients who were not excluded from initial treatment. In response to vectors that effectively act as a "booster" shot, the patient's immune system may be stimulated to generate high-titer anti-AAV antibodies that prevent future treatment. Pre-existing immunity can severely limit transduction efficiency. Several recent reports have demonstrated a correlation with immunogenicity in high-dose situations. Another notable drawback is the relatively slow onset of AAV-mediated gene expression, given that single-stranded AAV DNA must be converted to double-stranded DNA prior to heterologous gene expression.

[0006] Additionally, conventional AAV virions with capsids can be produced by introducing a plasmid containing the AAV genome, rep gene, and cap gene (Grimm et al., 1998). However, such encapsidated AAV viral vectors have been shown to inefficiently transduce certain cell and tissue types, and the capsids also induce immune responses.

[0007] Thus, the use of adeno-associated virus (AAV) vectors for the delivery of antibody therapeutics is limited due to the single administration to the patient (due to the patient immune response), the limited range of transgene genetic material suitable for delivery in AAV vectors due to minimal viral packaging capacity (approximately 4.5 kb), and slow AAV-mediated gene expression.

[0008] There remains a need in the art for the delivery of antibodies and antibody-based therapeutics by alternative routes or modes of administration for the development of improved therapeutics. Summary of the Invention

[0009] The technology described herein relates to capsid-free (e.g., non-viral) DNA vectors with covalently closed ends (referred to herein as "closed-end DNA vectors" or "ceDNA vectors"), where the ceDNA vectors comprise nucleic acid sequences encoding one or more polypeptides selected from the group consisting of antibody heavy chains and antibody light chains. These ceDNA vectors can be used to produce antibodies or antigen-binding fragments thereof for the treatment, monitoring, and diagnosis of diseases and disorders (e.g., immune disorders, cancer, infectious diseases). Application to a subject of one or more ceDNA vectors expressing one or more nucleic acid sequences encoding one or more polypeptides selected from the group consisting of antibody heavy chains and antibody light chains is useful for treating, preventing, or reducing the severity of a disease or disorder in a subject; being minimally invasive in delivery; being repeatable and administered on demand; having a rapid onset of therapeutic effect; and / or resulting in sustained expression of the antibody or antigen-binding fragment thereof. Furthermore, ceDNA vectors can be used to deliver transgenes (e.g., nucleic acid sequences) encoding antibodies or antigen-binding fragments thereof to cells or tissues, thereby circumventing the adaptive immune response and producing the desired antibody specificity without immunization or passive transfer. That is, the ceDNA vector enters cells via endocytosis, then escapes from the endosomal compartment and is transported to the nucleus. The transcriptionally active ceDNA episome results in the expression of the encoded antibody, which can then be secreted from the cell into the circulation. Thus, ceDNA vectors can enable continuous, sustained, and long-term delivery of antibodies (e.g., therapeutic antibodies described herein, or antigen-binding fragments therein) administered via a single injection.

[0010] According to some embodiments, the ceDNA vector comprising one or more nucleic acid sequences encoding one or more polypeptides selected from the group consisting of an antibody heavy chain and an antibody light chain is present in a liposomal nanoparticle formulation (LNP).

[0011] A ceDNA vector comprising one or more nucleic acid sequences encoding one or more polypeptides selected from the group consisting of antibody heavy and light chains described herein is a non-encapsidated, linear, double-stranded DNA molecule formed from continuous strands of complementary DNA with covalently closed ends (linear, continuous, and non-encapsidated structures), and comprises a 5' inverted terminal repeat (ITR) sequence and a 3' ITR sequence, where the 5' ITR and 3' ITR can have the same symmetrical three-dimensional configuration relative to each other (i.e., symmetric or substantially symmetric), or alternatively, the 5' ITR and 3' ITR can have a different three-dimensional configuration relative to each other (i.e., asymmetric ITR). In addition, the ITRs can be derived from the same or different serotypes. According to some embodiments, the ceDNA vector can comprise ITR sequences that have a symmetrical three-dimensional spatial configuration (i.e., they are the same or are mirror images of each other) such that their structures are the same shape in geometric space or have the same A, C-C', and B-B' loops in three-dimensional space. According to some embodiments, one ITR may be derived from one AAV serotype and the other ITR may be derived from a different AAV serotype.

[0012] Thus, some aspects of the technology described herein relate to ceDNA vectors for improved protein expression and / or production of antibodies or antigen-binding fragments thereof, comprising ITR sequences flanking a nucleic acid sequence encoding one or more polypeptides selected from the group consisting of an antibody heavy chain and an antibody light chain, wherein the ITR sequences are selected from the following: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (ITR) (e.g., an asymmetric modified ITR); (ii) two modified ITRs (e.g., an asymmetric modified ITR) in which the modified ITR pair has a different three-dimensional spatial configuration relative to each other; (iii) a symmetric or substantially symmetric WT-WT ITR pair in which each WT-ITR has the same three-dimensional spatial configuration; or (iv) a symmetric or substantially symmetric modified ITR pair in which each mod-ITR has the same three-dimensional spatial configuration. The ceDNA vectors disclosed herein can be produced in eukaryotic cells and thus can lack prokaryotic DNA modifications and bacterial endotoxin contamination in insect cells.

[0013] According to a first aspect, the present disclosure provides a capsid-free closed-ended DNA (ceDNA) vector composition comprising a ceDNA vector comprising at least one nucleic acid sequence between adjacent inverted repeat terminal repeats (ITRs), wherein the at least one nucleic acid sequence encodes a heavy chain (HC) and / or a light chain (LC) of an antibody or antigen-binding fragment thereof. According to some embodiments, the at least one nucleic acid sequence encodes the HC of the antibody or antigen-binding fragment thereof. According to some embodiments, the at least one nucleic acid sequence encodes the LC of the antibody or antigen-binding fragment thereof. According to some embodiments, the at least one nucleic acid sequence encodes both the HC and the LC of the antibody or antigen-binding fragment thereof.

[0014] According to another aspect, the present disclosure provides a combination of capsid-free closed-end DNA (ceDNA) vectors, comprising: a first ceDNA vector comprising at least one nucleic acid sequence between adjacent inverted terminal repeats (ITRs), wherein the at least one nucleic acid sequence encodes a heavy chain (HC) of an antibody or antigen-binding fragment thereof; and a second ceDNA vector comprising at least one nucleic acid sequence between adjacent inverted terminal repeats (ITRs), wherein the at least one nucleic acid sequence encodes a light chain (LC) of an antibody or antigen-binding fragment thereof.

[0015] According to embodiments and embodiments of the above aspects, the HC and LC are present in a molar ratio of 1:10 or 10:1, preferably 1:3 to 3:1, and most preferably 1.5:1 (HC:LC). According to embodiments and embodiments of the above aspects, the HC and LC are present in a molar ratio of 1:1 to 2.5:1 (HC:LC). According to embodiments and embodiments of the above aspects, the HC and LC are present in a molar ratio of 1.5:1 to 2.5:1 (HC:LC). According to embodiments and embodiments of the above aspects, the HC and LC are present in a molar ratio of about 1.5:1 (HC:LC). According to embodiments and embodiments of the above aspects, the HC and LC are present in a molar ratio of about 2.0:1 (HC:LC). According to embodiments and embodiments of the above aspects, the HC and LC are present in a molar ratio of about 2.5:1 (HC:LC). According to embodiments and embodiments of the above aspects, the first ceDNA and the second ceDNA together express at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 μg / mL of an antibody comprising an HC and an LC. According to embodiments and embodiments of the above aspects, the at least one nucleic acid comprises a dual ORF comprising a first ORF and a second ORF between adjacent inverted repeat tails (ITRs), wherein the first ORF encodes the HC of the antibody and the second ORF encodes the LC of the antibody, and the first ORF and the second ORF do not overlap. According to some embodiments, the dual ORF is bidirectional. According to embodiments and embodiments of the above aspects, the ceDNA vector comprises a promoter sequence, an enhancer sequence operably linked to at least one nucleic acid sequence. According to embodiments and embodiments of the above aspects, the ceDNA vector comprises at least one polyA sequence. According to embodiments and embodiments of the above aspects, the ceDNA vector comprises a 5'UTR and / or an intron sequence. According to embodiments and embodiments of the above aspects, the ceDNA vector comprises a 3'UTR sequence. According to embodiments and specific embodiments of the above aspects, the ceDNA vector comprises an enhancer sequence. According to embodiments and specific embodiments of the above aspects, at least one ITR comprises a functional terminal separation site and a Rep binding site.According to embodiments and embodiments of the above aspects, one or both ITRs are derived from a virus selected from parvovirus, dependovirus, and adeno-associated virus (AAV). According to embodiments and embodiments of the above aspects, the adjacent ITRs are symmetrical or asymmetrical with respect to each other. According to some embodiments, the adjacent ITRs are symmetrical or substantially symmetrical. According to some embodiments, the adjacent ITRs are asymmetrical. According to embodiments and embodiments of the above aspects, one or both ITRs are wild-type, or both ITRs are wild-type ITRs. According to embodiments and embodiments of the above aspects, the adjacent ITRs are derived from different viral serotypes. According to embodiments and embodiments of the above aspects, the adjacent ITRs are selected from any pair of viral serotypes shown in Table 2. According to embodiments and embodiments of the above aspects, one or both ITRs comprise a sequence selected from one or more of the sequences in Table 3. According to embodiments and embodiments of the above aspects, at least one of the ITRs is altered from the wild-type AAV ITR sequence by a deletion, addition, or substitution that affects the overall three-dimensional conformation of the ITR. According to embodiments and embodiments of the above aspects, one or both ITRs are derived from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. According to embodiments and embodiments of the above aspects, one or both ITRs are synthetic. According to embodiments and embodiments of the above aspects, one or both ITRs are not wild-type ITRs, or both ITRs are not wild-type ITRs. According to embodiments and embodiments of the above aspects, one or both ITRs are modified by deletion, insertion, and / or substitution in at least one ITR region selected from A, A', B, B', C, C', D, and D'. According to embodiments and embodiments of the above aspects, the deletion, insertion, and / or substitution results in the deletion of all or part of the stem-loop structure normally formed by the A, A', B, B'C, or C' regions.According to embodiments and specific embodiments of the above aspects, one or both of the ITRs are modified by deletion, insertion, and / or substitution, resulting in the deletion of all or part of the stem-loop structure normally formed by the B and B' regions. According to embodiments and specific embodiments of the above aspects, one or both of the ITRs are modified by deletion, insertion, and / or substitution, resulting in the deletion of all or part of the stem-loop structure normally formed by the C and C' regions. According to embodiments and specific embodiments of the above aspects, one or both of the ITRs are modified by deletion, insertion, and / or substitution, resulting in the deletion of part of the stem-loop structure normally formed by the B and B' regions and / or part of the stem-loop structure normally formed by the C and C' regions. According to embodiments and specific embodiments of the above aspects, one or both of the ITRs typically comprises a single stem-loop structure in the region comprising a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C' regions. According to embodiments and specific embodiments of the above aspects, one or both of the ITRs typically comprise a single stem and two loops in a region comprising a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C' regions. According to embodiments and specific embodiments of the above aspects, one or both of the ITRs typically comprise a single stem and a single loop in a region comprising a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C' regions. In some embodiments, both ITRs are modified in a manner that results in overall three-dimensional symmetry when the ITRs are inverted relative to each other. According to embodiments of the above aspects, the vector composition is encapsulated in a lipid nanoparticle (LNP).

[0016] According to another aspect, the present disclosure provides a capsid-free closed-end DNA (ceDNA) vector comprising a nucleic acid sequence selected from Table 7.

[0017] According to another aspect, the present disclosure provides a capsid-free closed-end DNA (ceDNA) vector comprising a nucleic acid sequence at least 85% identical to SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:407, or SEQ ID NO:408.

[0018] According to another aspect, the present disclosure provides a capsid-free closed-end DNA (ceDNA) vector consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:407, or SEQ ID NO:408.

[0019] According to another aspect, the present disclosure provides a method of expressing an antibody or antigen-binding fragment thereof in a cell, comprising contacting the cell with a ceDNA vector or ceDNA vector composition of any of the aspects or embodiments herein. According to some embodiments, the cell is in vitro or in vivo. According to embodiments, at least one nucleic acid sequence is codon-optimized for expression in the cell.

[0020] According to another aspect, the present disclosure provides a method of treating a subject having a bacterial, viral, parasitic, or fungal infection, the method comprising administering to the subject a ceDNA vector or ceDNA vector composition of any of the aspects or embodiments herein.

[0021] According to another aspect, the present disclosure provides a method of treating a subject having cancer, the method comprising administering to the subject a ceDNA vector or ceDNA vector composition of any of the aspects or embodiments herein.

[0022] According to another aspect, the present disclosure provides a method of treating a subject having an autoimmune disease or disorder, the method comprising administering to the subject a ceDNA vector or ceDNA vector composition of any of the aspects or embodiments herein.

[0023] According to another aspect, the present disclosure provides a method for preventing a bacterial, viral, parasitic, or fungal infection in a subject, the method comprising administering to the subject a ceDNA vector or ceDNA vector composition of any of the aspects or embodiments herein.

[0024] According to another aspect, the present disclosure provides a method for preventing cancer in a subject, the method comprising administering to the subject a ceDNA vector or ceDNA vector composition of any of the aspects or embodiments herein.

[0025] According to another aspect, the present disclosure provides a method of treating an autoimmune disease in a subject, the method comprising administering to the subject a ceDNA vector or ceDNA vector composition of any of the aspects or embodiments herein. According to embodiments and embodiments of the above aspects, the subject is administered one or more additional therapeutic agents. According to embodiments and embodiments of the above aspects, the ceDNA vector or ceDNA vector composition is administered by intravenous, subcutaneous, intratumoral, or intramuscular injection. According to embodiments and embodiments of the above aspects, the method further comprises administering to the subject an immunomodulatory agent.

[0026] According to another aspect, the present disclosure provides a ceDNA vector or a pharmaceutical composition comprising the ceDNA vector of any of the aspects or embodiments herein. According to several embodiments, the pharmaceutical composition further comprises one or more additional therapeutic agents.

[0027] According to another aspect, the present disclosure provides a composition comprising a ceDNA vector or ceDNA vector composition of any of the aspects or embodiments herein and a lipid. According to some embodiments, the lipid is a lipid nanoparticle (LNP).

[0028] According to another aspect, the present disclosure provides a kit comprising a ceDNA vector or ceDNA vector composition, or pharmaceutical composition of any of the aspects or embodiments herein.

[0029] These and other aspects of the disclosure are described in further detail below. [Brief explanation of the drawings]

[0030] Embodiments of the present disclosure, briefly summarized above and discussed in more detail below, can be understood by reference to exemplary embodiments of the present disclosure, which are depicted in the accompanying drawings. However, the accompanying drawings illustrate only typical embodiments of the present disclosure and therefore should not be considered limiting in scope, as the present disclosure may admit of other equally effective embodiments. [Figure 1A] 1 shows an exemplary structure of a ceDNA vector for expressing an antibody or antigen-binding fragment thereof, e.g., HC or LC, disclosed herein, comprising asymmetric ITRs. In this embodiment, the exemplary ceDNA vector comprises an expression cassette containing a CAG promoter, a WPRE, and BGHpA. An open reading frame (ORF) encoding a transgene (e.g., a nucleic acid sequence encoding an antibody or antigen-binding fragment thereof) can be inserted into the cloning site (R3 / R4) between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs): a wild-type AAV2 ITR upstream (5' end) of the expression cassette and a modified ITR downstream (3' end). Thus, the two ITRs flanking the expression cassette are asymmetric with respect to each other. [Figure 1B] 1 shows an exemplary structure of a ceDNA vector for expression of an antibody or antigen-binding fragment thereof (e.g., HC or LC) disclosed herein, comprising a CAG promoter, a WPRE, and asymmetric ITRs with an expression cassette containing BGHpA. An open reading frame (ORF) encoding a transgene, e.g., a nucleic acid encoding an antibody or fusion protein, can be inserted into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs): a modified ITR upstream (5' end) of the expression cassette and a wild-type ITR downstream (3' end). [Figure 1C]1 shows an exemplary structure of a ceDNA vector for expression of an antibody or antigen-binding fragment thereof disclosed herein, comprising asymmetric ITRs with an expression cassette containing an enhancer / promoter, a transgene (e.g., a nucleic acid sequence encoding an antibody or antigen-binding fragment thereof), a post-transcriptional element (WPRE), and a poly(A) signal. An open reading frame (ORF) allows for insertion of the transgene into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs) that are asymmetric with respect to each other: a modified ITR upstream (5' end) and a modified ITR downstream (3' end) of the expression cassette, where both the 5' and 3' ITRs are modified ITRs but have different modifications (i.e., do not have the same modifications). [Figure 1D] 1 shows an exemplary structure of a ceDNA vector for expression of an antibody or antigen-binding fragment thereof (e.g., HC or LC) disclosed herein, comprising a CAG promoter, a WPRE, and an expression cassette containing BGHpA, and including symmetrically or substantially symmetrically modified ITRs as defined herein. An open reading frame (ORF) encoding a transgene (e.g., a nucleic acid sequence encoding an antibody or antigen-binding fragment thereof) is inserted into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two modified inverted terminal repeats (ITRs), in which the 5'- and 3'-modified ITRs are symmetric or substantially symmetric. [Figure 1E]

[0023] Figure 1 shows an exemplary structure of a ceDNA vector for expression of an antibody or antigen-binding fragment thereof (e.g., HC or LC) disclosed herein, comprising symmetric or substantially symmetric modified ITRs as defined herein, with an expression cassette containing an enhancer / promoter, transgene, post-transcriptional element (WPRE), and polyA signal. An open reading frame (ORF) allows for insertion of a transgene (e.g., a nucleic acid sequence encoding an antibody or its antigen-binding portion) into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two modified inverted terminal repeats (ITRs), with the 5'- and 3'-modified ITRs being symmetric or substantially symmetric. [Figure 1F] 1 shows an exemplary structure of a ceDNA vector for expression of an antibody or antigen-binding fragment thereof (e.g., HC or LC) disclosed herein, comprising a CAG promoter, a WPRE, and an expression cassette containing BGHpA, and comprising a symmetric WT-ITR or a substantially symmetric WT-ITR as defined herein. An open reading frame (ORF) encoding a transgene (e.g., a nucleic acid encoding an antibody or antigen-binding fragment thereof) is inserted into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two wild-type inverted terminal repeats (WT-ITR), in which the 5'WT-ITR and 3'WT-ITR are symmetric or substantially symmetric. [Figure 1G] 1 shows an exemplary structure of a ceDNA vector for expression of an antibody or antigen-binding fragment thereof disclosed herein, comprising symmetric or substantially symmetric modified ITRs as defined herein, with an expression cassette containing an enhancer / promoter, transgene, post-transcriptional element (WPRE), and polyA signal. The open reading frame (ORF) allows for insertion of the transgene into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two wild-type inverted terminal repeats (WT-ITRs), with the 5'WT-ITR and 3'WT-ITR being symmetric or substantially symmetric. [Figure 2A]The T-shaped stem-loop structure of the wild-type left ITR of AAV2 is provided, along with identification of the A-A', B-B', and C-C' arms, and two Rep binding sites (RBE and RBE'), and the terminal resolution site (trs) is also shown. The RBE contains a series of four double tetramers that are thought to interact with either Rep78 or Rep68. In addition, the RBE' is also thought to interact with the Rep complex assembled on the wild-type or mutant ITR in the construct. The D and D' regions contain transcription factor binding sites and other conserved structures. [Figure 2B] The proposed Rep catalytic nicking and ligation activity in the wild-type left ITR of AAV2 is shown, including the A-A' arm, the B-B' arm, the C-C' arm, and the T-shaped stem-loop structure of the wild-type left ITR of AAV2, along with identification of two Rep binding sites (RBE and RBE'), as well as the terminal separation sites (trs), and the D and D' regions containing several transcription factor binding sites and other conserved structures. [Figure 3A] The primary structure (polynucleotide sequence) (left) and secondary structure (right) of the RBE-containing portions of the A-A' arm and the C-C' and B-B' arms of the wild-type left AAV2 ITR are provided. [Figure 3B] An exemplary mutant ITR (also referred to as a modified ITR) sequence for the left ITR is shown. The primary structure (left) and predicted secondary structure (right) of the RBE portion of the A-A', C, and B-B' arms of an exemplary mutant left ITR (ITR-1, left) are shown. [Figure 3C] The primary structure (left) and secondary structure (right) of the A-A' loop and the RBE-containing portions of the B-B' and C-C' arms of the wild-type right AAV2 ITR are shown. [Figure 3D]An exemplary right-modified ITR is shown. The primary structure (left) and predicted secondary structure (right) of the RBE-containing portions of the A-A' arm and the B-B' and C arms of an exemplary mutant right ITR (ITR-1, right) are shown. Any combination of left and right ITRs (e.g., AAV2 ITRs or other viral serotype or synthetic ITRs) can be used as taught herein. Each of the polynucleotide sequences in Figures 3A-3D refers to the sequence used in the plasmid or bacmid / baculovirus genome used to produce the ceDNA described herein. The corresponding ceDNA secondary structure, predicted from the ceDNA vector configuration of the plasmid or bacmid / baculovirus genome and predicted Gibbs free energy values, is also included in each of Figures 3A-3D. [Figure 4A] FIG. 4C is a schematic diagram showing the upstream process for generating baculovirus infected insect cells (BIIC), which are useful for producing ceDNA vectors for expression of antibodies or antigen-binding fragments thereof disclosed herein, in the process described in the schematic diagram of FIG. 4B. [Figure 4B] FIG. 1 is a schematic diagram of an exemplary method for the production of ceDNA. [Figure 4C] 1 shows biochemical methods and processes for confirming the production of ceDNA vectors. [Figure 4D]Figure 4D is a schematic diagram illustrating a process for identifying the presence of ceDNA in DNA recovered from cell pellets obtained during the ceDNA production process of Figure 4B. Figure 4D shows, on the left, the schematic expected bands of an exemplary ceDNA that is either uncut or digested with a restriction endonuclease and then subjected to electrophoresis on either a native or denaturing gel. The leftmost schematic is a native gel, showing multiple bands suggesting that in its duplex and uncut form, ceDNA exists in at least a monomeric and dimeric state, appearing as a faster-migrating, smaller monomer and a slower-migrating dimer that is twice the size of the monomer. The second schematic diagram from the left shows that when ceDNA is cut with a restriction endonuclease, the original band disappears and a faster-migrating (e.g., smaller) band appears, corresponding to the expected fragment size remaining after cleavage. Under denaturing conditions, the original double-stranded DNA is single-stranded and migrates as a species twice as large as that observed on a native gel due to the covalent attachment of the complementary strand. Thus, in the second-to-the-right schematic, digested ceDNA exhibits a similar linkage distribution to that observed on a native gel, but the bands migrate as fragments twice the size of their native counterparts. The rightmost schematic shows that uncut ceDNA under denaturing conditions migrates as a single-stranded open circle, and thus the observed bands are twice the size of those observed under native conditions where the circle is not opened. In this figure, "kb" is used to indicate the relative size of nucleotide molecules based on the length of the nucleotide chain (e.g., for single-stranded molecules observed under denaturing conditions) or the number of base pairs (e.g., for double-stranded molecules observed under native conditions), depending on the context. Figure 4E shows DNA with a discontinuous structure. ceDNA can be cleaved by a restriction endonuclease with a single recognition site on the ceDNA vector, generating two DNA fragments with different sizes (1 kb and 2 kb) under both neutral and denaturing conditions. Figure 4E also shows ceDNA with a linear and continuous structure.The ceDNA vector can be cleaved by a restriction endonuclease to generate two DNA fragments that migrate as 1 kb and 2 kb in neutral conditions, but under denaturing conditions the strands remain connected, producing single strands that migrate as 2 kb and 4 kb. [Figure 4E]Figure 4D is a schematic diagram illustrating a process for identifying the presence of ceDNA in DNA recovered from cell pellets obtained during the ceDNA production process of Figure 4B. Figure 4D shows, on the left, the schematic expected bands of an exemplary ceDNA that is either uncut or digested with a restriction endonuclease and then subjected to electrophoresis on either a native or denaturing gel. The leftmost schematic is a native gel, showing multiple bands suggesting that in its duplex and uncut form, ceDNA exists in at least a monomeric and dimeric state, appearing as a faster-migrating, smaller monomer and a slower-migrating dimer that is twice the size of the monomer. The second schematic diagram from the left shows that when ceDNA is cut with a restriction endonuclease, the original band disappears and a faster-migrating (e.g., smaller) band appears, corresponding to the expected fragment size remaining after cleavage. Under denaturing conditions, the original double-stranded DNA is single-stranded and migrates as a species twice as large as that observed on a native gel due to the covalent attachment of the complementary strand. Thus, in the second-to-the-right schematic, digested ceDNA exhibits a similar linkage distribution to that observed on a native gel, but the bands migrate as fragments twice the size of their native counterparts. The rightmost schematic shows that uncut ceDNA under denaturing conditions migrates as a single-stranded open circle, and thus the observed bands are twice the size of those observed under native conditions where the circle is not opened. In this figure, "kb" is used to indicate the relative size of nucleotide molecules based on the length of the nucleotide chain (e.g., for single-stranded molecules observed under denaturing conditions) or the number of base pairs (e.g., for double-stranded molecules observed under native conditions), depending on the context. Figure 4E shows DNA with a discontinuous structure. ceDNA can be cleaved by a restriction endonuclease with a single recognition site on the ceDNA vector, generating two DNA fragments with different sizes (1 kb and 2 kb) under both neutral and denaturing conditions. Figure 4E also shows ceDNA with a linear and continuous structure.The ceDNA vector can be cleaved by a restriction endonuclease to generate two DNA fragments that migrate as 1 kb and 2 kb in neutral conditions, but under denaturing conditions the strands remain connected, producing single strands that migrate as 2 kb and 4 kb. [Figure 5] 1 is an illustrative photograph of an example denaturing gel run of ceDNA vectors digested (+) or undigested (-) with endonucleases (EcoRI for ceDNA constructs 1 and 2, BamH1 for ceDNA constructs 3 and 4, SpeI for ceDNA constructs 5 and 6, and XhoI for ceDNA constructs 7 and 8). Constructs 1-8 are described in Example 1 of International Application No. US 18 / 49996, which is incorporated by reference in its entirety. The sizes of the bands highlighted with asterisks were determined and are indicated below the figure. [Figure 6] 6 is a graph showing the detection of antibody expression with the ceDNA constructs tested in Example 6. Anti-spike human IgG (***) was used to detect antibody expression, which was quantified by ng / ml anti-spike hIgG up to 35 days after injection of the ceDNA construct. As shown in Figure 6, with the ceDNA dual vector ceDNA-1856 (encoding the LC) and ceDNA-1859 (encoding the HC) co-formulated in LNP1 (ceDNA-1:LNP1), approximately 1 μg / mL of monoclonal antibodies against SARS-CoV-2 were detected by day 14, and up to approximately 8 μg / mL of antibodies were detected by day 35. Vehicle (V): Contains ceDNA dual vector construct 1856 / 1859 co-formulated in LNP formulation 1 (ceDNA-1 LNP1(1)), ceDNA dual vector construct 1856 / 1859 in LNP formulation 2 (ceDNA-1 LNP2(2)), and single ceDNA construct 2157 (dual ORFs of HC and LC in a single ceDNA ("bidirectional single ceDNA vector")) formulated in LNP formulation 1 (ceDNA-2 LNP1(3)). [Figure 7A] Schematic diagrams of various ceDNA vector formats are shown. [Figure 7B]Figure 1 shows antibody production levels using a dual ORF construct (constitutive promoter linked to ORF 1) and a liver-specific promoter linked to ORF 2, a Furin / 2A truncated design of a single ceDNA vector, and a dual vector design of ceDNA-1 (ceDNA 1856 and 1859), all encoding anti-SARS-CoV-2 spike (S) antibodies. The dual vector design produced the highest expressing construct. [Figure 7C] Graph showing LNP delivery of dual vector, ceDNA-1; "ceDNA dual vector construct 1856 / 1859 co-formulated in LNP formulation 1") achieved sustained therapeutic-relevant anti-spike hIgG concentrations of 8ug / mL in mice compared to expression of a single vector of ceDNA (dual ORF ceDNA 2157, "ceDNA-2"). [Figure 8] 1 compares the dose-dependent increase in antibody expression between a ceDNA dual vector design and a ceDNA dual ORF design for expressing antibody HC and LC after hydrodynamic delivery. [Figure 9] 1 is a graph showing the results of an in vitro screen using ceDNA vector constructs with various HC:LC molar ratios. [Figure 10] 1 is a graph showing in vivo results using ceDNA vector constructs with fixed HC or LC in various HC:LC molar ratios. [Figure 11A] 1 is a graph showing the dissociation constant (KD) values ​​of cell line-derived (recombinant LS) or ceDNA-derived antibody 1 (serum-purified ceDNA-derived LS), and cell line-derived (recombinant LS-GAALIE) or ceDNA-derived (serum-purified ceDNA-derived LS-GAALIE) antibody 2 when they associate with and then dissociate from the FcγRIIIa-V receptor. [Figure 11B] 1 is a graph showing the dissociation constant (KD) values ​​of cell line-derived (recombinant LS) or ceDNA-derived (serum-purified ceDNA-derived LS) antibody 1, and cell line-derived (recombinant LS-GAALIE) or ceDNA-derived (serum-purified ceDNA-derived LS-GAALIE) antibody 2 when they associate with and then dissociate from the FcγRIIIaF receptor. DETAILED DESCRIPTION OF THE INVENTION

[0031] According to embodiments of the present disclosure, compositions for delivering antibodies or antigen-binding fragments thereof by ceDNA vectors are provided. In some embodiments, the antibodies or antigen-binding fragments described herein are useful for therapeutic purposes. In some embodiments, the antibodies or antigen-binding fragments described herein are useful for diagnostic purposes.

[0032] I. Definition Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by one of ordinary skill in the art to which this disclosure belongs. It is understood that the present disclosure is not limited to the particular methodology, protocols, and reagents, etc., described herein, and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present disclosure, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3), Robert S. Porter et al. (eds.), Fields Virology, 6 thEdition, published by Lippincott Williams & Wilkins (Philadelphia, PA, USA) (2013); Knipe, D. M. and Howley, P. M. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, 2014 (ISBN 0815345305,9780815345305), Lewin's Genes XI, Published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055), Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA (2012) (ISBN 1936113414), Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X), Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542), Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338 Strobe, (ed.) John Wiley and Sons, Inc., 2003 (ISBNs 0471142735, 9780471142737), the contents of all of which are incorporated herein by reference in their entireties.

[0033] As used herein, the term "antibody" is intended to refer to an immunoglobulin molecule composed of four polypeptide chains, two heavy (H) chains and two light (L) chains, interconnected by disulfide bonds. Each heavy chain is composed of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region is composed of three domains: CH1, CH2, and CH3. Each light chain is composed of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The light chain constant region is composed of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability called complementarity determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. As used herein, the term "monoclonal antibody" refers to a population of substantially homogeneous antibodies, i.e., the antibody molecules comprising the population are identical in amino acid sequence except for possible naturally occurring mutations that may be present in minor amounts. A "plurality" of such monoclonal antibodies and fragments in a composition refers to a concentration of identical (i.e., in amino acid sequence except for possible naturally occurring mutations that may be present in minor amounts) antibodies and fragments that exceeds the concentration that would normally be present naturally in the blood of a host organism, e.g., a mouse or human.

[0034] As used herein, the term "CDR" refers to a complementarity-determining region within an antibody variable sequence. There are three CDRs in each of the heavy and light chain variable regions, designated CDR1, CDR2, and CDR3 for each variable region. As used herein, the term "CDR" refers to a group of three CDRs occurring in a single variable region that can bind to an antigen. The exact boundaries of these CDRs are defined differently according to different systems. The system described by Kabat (Kabat et al. (1987; 1991) Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md.) not only provides an unambiguous residue numbering system applicable to any antibody variable region, but also provides precise residue boundaries defining the three CDRs. These CDRs are sometimes referred to as Kabat CDRs. Chothia and coworkers (Chothia & Lesk (1987) J. Mol. Biol. 196:901-917; and Chothia et al. (1989) Nature 342:877-883) have used the Kabat CDRs to We have found that certain subportions within CDRs adopt nearly identical peptide backbone conformations despite great diversity at the amino acid sequence level. These subportions are designated as L1, L2, and L3, or H1, H2, and H3, or L-CDR1, L-CDR2, and L-CDR3, or H-CDR1, H-CDR2, and H-CDR3, where "L" and "H" represent the light chain and heavy chain regions, respectively. These regions are sometimes referred to as Chothia CDRs and have boundaries that overlap with Kabat CDRs. Other boundaries defining CDRs that overlap with Kabat CDRs are described by Padlan (1995) FASEB J. 9:133-139 and MacCallum (1996) J. Mol. Biol. 262(5):732-45. Still other CDR boundary definitions may not strictly follow one of the systems herein, but still overlap with Kabat CDRs.However, they may be shortened or lengthened in light of predictions or experimental findings that particular residues or groups of residues, or even entire CDRs, do not significantly affect antigen binding (see, e.g., Lu X et al., MAbs. 2019 Jan;11(1):45-57). While the methods used herein may utilize CDRs defined according to any of these systems, certain embodiments use CDRs defined by Kabat or Chothia.

[0035] As used herein, the term "antigen-binding fragment" or "antigen-binding portion" of an antibody (or simply "antibody fragment") refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Binding fragments include Fab, Fab', F(ab')2, Fabc, Fv, single chain, and single-chain antibodies. Examples of binding fragments encompassed by the term "antigen-binding fragment" of an antibody include: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CH1 domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; (v) a dAb fragment consisting of the VH domain (Ward et al. (1989) Nature 341:544-546); and (vi) an isolated complementarity-determining region (CDR). Furthermore, although the two domains of an Fv fragment, VL and VH, are encoded by separate genes, they can be joined by a synthetic linker that allows them to be produced using recombinant methods as a single protein chain in which the VL and VH regions pair to form a monovalent molecule (known as single-chain Fv (scFv); see, e.g., Bird et al. (1988) Science 242:423-426 and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single-chain antibodies are also intended to be encompassed by the term "antigen-binding portion" of an antibody. Other forms of single-chain antibodies, such as diabodies, are also encompassed.Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but with a linker that is too short to allow pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains on another chain and creating two antigen-binding sites (see, e.g., Holliger et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak et al. (1994) Structure 2:1121-1123). The antibody moieties of the present disclosure are described in further detail in U.S. Patent Nos. 6,090,382, 6,258,562, and 6,509,015, each of which is incorporated herein by reference in its entirety.

[0036] The term "CL" refers to an "immunoglobulin light chain constant region" or "light chain constant region," i.e., the constant region derived from an antibody light chain. The term "CH" refers to an "immunoglobulin heavy chain constant region" or "heavy chain constant region," which can be further divided into CH1, CH2, and CH3 domains (IgA, IgD, IgG) or CH1, CH2, CH3, and CH4 domains (IgE, IgM) depending on the antibody isotype. The Fc region of an antibody heavy chain is further described herein. In any of the embodiments of the present disclosure, an antibody or antigen-binding fragment of the present disclosure comprises any one or more of CL, CH1, CH2, and CH3. It will be understood that production in, for example, a mammalian cell line may remove one or more C-terminal lysines of the antibody heavy chain (see, e.g., Liu et al. mAbs 6(5):1145-1154 (2014)). Thus, antibodies or antigen-binding fragments of the present disclosure can comprise heavy chain, CH1-CH3, CH3, or Fc polypeptides, with or without a C-terminal lysine residue. In other words, embodiments are encompassed in which the C-terminal residue of a heavy chain, CH1-CH3, or Fc polypeptide is not lysine, as well as embodiments in which lysine is the C-terminal residue. In certain embodiments, a composition comprises multiple antibodies and / or antigen-binding fragments of the present disclosure, wherein the antibodies or antigen-binding fragments do not comprise a lysine residue at the C-terminus of the heavy chain, CH1-CH3, or Fc polypeptide, and the antibodies or antigen-binding fragments comprise a lysine residue at the C-terminus of the heavy chain, CH1-CH3, or Fc polypeptide. A "chimeric antibody" refers to an antibody in which some portions of the amino acid sequences of the heavy and light chains are homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular class, while the remaining segments of the chains are homologous to corresponding sequences from another species.

[0037] A "humanized antibody" refers to an antibody that comprises at least one chain containing variable region framework residues substantially derived from a human antibody chain (referred to as the acceptor immunoglobulin or antibody) and at least one complementarity-determining region (CDR) substantially derived from a non-human antibody (e.g., murine). In addition, humanized antibodies typically undergo further modifications to improve affinity and / or immunogenicity.

[0038] The term "multivalent antibody" refers to an antibody that contains two or more antigen recognition sites. For example, a "bivalent" antibody has two antigen recognition sites, while a "tetravalent" antibody has four antigen recognition sites. Terms such as "monospecific," "bispecific," "trispecific," and "tetraspecific" refer to the number of different antigen recognition site specificities (as opposed to the number of antigen recognition sites) present in a multivalent antibody. For example, all of the antigen recognition sites of a "monospecific antibody" bind to the same epitope. A "bispecific" or "double-specific" antibody has at least one antigen recognition site that binds to a first epitope and at least one antigen recognition site that binds to a second epitope that is different from the first epitope. A "multivalent monospecific" antibody has multiple antigen recognition sites that all bind to the same epitope. A "multivalent bispecific" antibody has multiple antigen recognition sites, some of which bind to a first epitope and some of which bind to a second epitope that is different from the first epitope.

[0039] The term "human antibody," as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. Human antibodies may include amino acid residues, for example, in the CDRs, particularly CDR3, that are not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). However, as used herein, the term "human antibody" is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species (e.g., a mouse) have been grafted onto human framework sequences.

[0040] The term "recombinant human antibody," as used herein, is intended to include all human antibodies that are prepared, expressed, generated, or isolated by recombinant means (e.g., antibodies expressed using a recombinant expression vector transfected into a host cell).

[0041] As used herein, a "neutralizing antibody" is an antibody that is capable of neutralizing, i.e., preventing, inhibiting, reducing, hindering, or interfering with, the ability of a pathogen to initiate and / or perpetuate infection in a host. This inhibition can be assessed by measuring one or more indicators of biological activity (either in vitro or in vivo), cellular activation, and / or receptor binding.

[0042] As used herein, the term "antigen" refers to a molecule containing one or more epitopes (linear, conformational, or both) that stimulate the host's immune system to generate an antigen-specific humoral and / or cellular response. This term is used interchangeably with the term "immunogen." B cell epitopes typically contain at least about five amino acids, but can be as few as three or four amino acids. T cell epitopes (e.g., CTL epitopes) contain at least about seven to nine amino acids, and helper T cell epitopes contain at least about 12 to 20 amino acids. Typically, epitopes contain about 7 to 15 amino acids, including 9, 10, 11, 12, 13, 14, or 15 amino acids. This term includes polypeptides containing modifications (e.g., deletions, additions, and substitutions (generally conservative in nature)) compared to the native sequence, so long as the protein maintains its ability to elicit an immunological response as defined herein. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the antigens.

[0043] The term "epitope," also referred to as an antigenic determinant, is a molecular determinant (e.g., a polypeptide determinant) that can be specifically bound by a binding agent, immunoglobulin, or T-cell receptor. Epitopes include chemically active surface groups of molecules, such as amino acids, sugar side chains, phosphoryl, or sulfonyl groups, and in certain embodiments, may have specific three-dimensional structural and / or charge characteristics. Epitopes can be defined as structural or functional. Functional epitopes are generally a subset of structural epitopes and contain residues that directly contribute to the affinity of the interaction. Epitopes can be linear or conformational, i.e., composed of non-linear amino acids. An epitope recognized by an antibody or antigen-binding fragment of an antibody is a structural element of the antigen that interacts with the CDR (e.g., complementary site) of the antibody or fragment. An epitope can be formed by contributions from several amino acid residues that interact with the CDR of the antibody to confer specificity. An antigenic fragment can contain two or more epitopes. In certain embodiments, an antibody specifically binds to an antigen when it recognizes its target antigen in a complex mixture of proteins and / or macromolecules. For example, antibodies are said to "bind to the same epitope" when they cross-compete (one prevents the binding or modulatory effect of the other).

[0044] As used herein, the term "surface plasmon resonance" refers to an optical phenomenon that allows for the analysis of real-time biospecific interactions by detecting changes in protein concentration within a biosensor matrix, for example, using a BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, NJ). For further explanation, see Example 1 of U.S. Patent No. 6,258,562 and Jonsson et al. (1993) Ann. Biol. Clin. 51:19, Jonsson et al. (1991) Biotechniques 11:620-627, Jonsson et al. (1995) J. Mol. Recognit. 8:125, and Jonsson et al. (1991) Anal. Biochem. 198:268.

[0045] As used herein, "specifically binds" refers to an antibody or antigen-binding fragment that does not significantly associate or bind with any other molecule or component in a sample, while specifically binding to the antibody or antigen-binding fragment. 5 M -1 (The on-rate [K on ] off rate [K off ]) or greater affinity or K a (i.e., the equilibrium association constant of a particular binding interaction, in units of 1 / M). Alternatively, affinity refers to the equilibrium dissociation constant (K d ) (e.g., 10 -5 M~10 -13 M).

[0046] Antibodies can be classified as "high affinity" or "low affinity" antibodies. A "high affinity" antibody has a specific affinity of at least 10 7 M -1 , at least 10 8 M -1 , at least 10 9 M -1 , at least 10 10 M -1 , at least 10 11 M -1 , at least 10 12 M -1 Or at least 10 13 M -1 K a A "low affinity" antibody refers to an antibody having a 7 M -1 Up to 10 6 M -1 Up to 10 5 M -1 K up to a Alternatively, affinity refers to an antibody having the equilibrium dissociation constant (K) of a particular binding interaction, which has units of M. d ) (e.g., 10 -5 M~10 -13 M).

[0047] "Koff The term "off rate constant," as used herein, is intended to refer to the off rate constant for dissociation of an antibody from the antibody / antigen complex.

[0048] "K d The term "dissociation constant," as used herein, is intended to refer to the dissociation constant of a particular antibody-antigen interaction.

[0049] "I C 50 The term "," as used herein, is intended to refer to the concentration of inhibitor required to inhibit a biological endpoint of interest.

[0050] As used herein, the terms "heterologous nucleic acid sequence" and "transgene" are used interchangeably and refer to a nucleic acid of interest (other than a nucleic acid encoding a capsid polypeptide) that can be incorporated into, delivered and expressed by, a ceDNA vector disclosed herein. According to some embodiments, the term "heterologous nucleic acid" is intended to refer to a nucleic acid (or transgene) that is not present in, expressed by, or derived from a contacting cell or subject.

[0051] As used herein, the terms "expression cassette" and "transcription cassette" are used interchangeably and refer to a linear stretch of nucleic acid that includes a transgene operably linked to one or more promoters or other regulatory sequences sufficient to direct transcription of the transgene, but does not include capsid coding sequences, other vector sequences, or inverted terminal repeat regions. An expression cassette may additionally include one or more cis-acting sequences (e.g., promoters, enhancers, or repressors), one or more introns, and one or more post-transcriptional regulatory elements.

[0052] The terms "polynucleotide" and "nucleic acid," used interchangeably herein, refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, the terms include single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. An "oligonucleotide" generally refers to a polynucleotide of about 5 to about 100 nucleotides, either single- or double-stranded DNA. However, for purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides, also known as "oligomers" or "oligos," can be isolated from genes or chemically synthesized by methods known in the art. The terms "polynucleotide" and "nucleic acid" should be understood to include single-stranded (e.g., sense or antisense) and double-stranded polynucleotides, as applicable to the described embodiments.

[0053] The DNA may be in the form of, for example, an antisense molecule, a plasmid DNA, a DNA-DNA duplex, a precondensed DNA, a PCR product, a vector (P1, PAC, BAC, YAC, artificial chromosome), an expression cassette, a chimeric sequence, a chromosomal DNA, or derivatives and combinations of these groups. The DNA may be in the form of a minicircle, a plasmid, a bacmid, a minigene, a ministring DNA (a linear covalently closed DNA vector), a closed-end linear double-stranded DNA (CELiD or ceDNA), a doggybone (dbDNA™) DNA, a dumbbell-shaped DNA, a minimally immunologically defined gene expression (MIDGE) vector, a viral vector, or a non-viral vector. The RNA may be in the form of a small interfering RNA (siRNA), a Dicer substrate dsRNA, a short hairpin RNA (shRNA), an asymmetric interfering RNA (aiRNA), a microRNA (miRNA), an mRNA, a rRNA, a tRNA, a viral RNA (vRNA), or a combination thereof. Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and have similar binding properties as the reference nucleic acid. Examples of such analogs and / or modified residues include phosphorothioates, phosphorodiamidate morpholino oligomers (morpholinos), phosphoramidates, methyl phosphonates, chiral methyl phosphonates, 2'-O-methyl ribonucleotides, locked nucleic acids (LNA™), and peptide nucleic acids (PNAs). Unless otherwise specified, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid. Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the sequence explicitly indicated.

[0054] A "nucleotide" contains the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate group.

[0055] "Base" includes purines and pyrimidines, which further include the naturally occurring compounds adenine, thymine, guanine, cytosine, uracil, inosine, and naturally occurring analogues, and synthetic derivatives of purines and pyrimidines, including, but not limited to, modifications that place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkyl halides.

[0056] As used herein, the term "nucleic acid construct" refers to a single- or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, or that is modified to contain a segment of nucleic acid in a manner that would not otherwise occur in nature, or that is synthetic. The term nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present disclosure. An "expression cassette" comprises a DNA coding sequence operably linked to a promoter.

[0057] "Hybridizable" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA) contains a sequence of nucleotides that allows it to non-covalently bind, i.e., "anneal" or "hybridize" to another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to a complementary nucleic acid) under appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength, forming Watson-Crick base pairs and / or G / U base pairs. As is known in the art, standard Watson-Crick base pairings include adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C). Additionally, it is also known in the art that guanine (G) bases pair with uracil (U) for hybridization between two RNA molecules (e.g., dsRNA). For example, G / U base pairing, in the context of tRNA anticodon base pairing with codons in mRNA, is partially responsible for the degeneracy (i.e., redundancy) of the genetic code. In the context of this disclosure, guanine (G) in the protein-binding segment (dsRNA duplex) of a subject DNA-targeting RNA molecule is considered complementary to uracil (U), and vice versa. Thus, if a G / U base pair can be made at a given nucleotide position in the protein-binding segment (dsRNA duplex) of a subject DNA-targeting RNA molecule, that position is not considered non-complementary, but instead is considered complementary.

[0058] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymeric forms of amino acids of any length, which may include coded and non-coded amino acids, amino acids that are chemically or biochemically modified or derivatized, and polypeptides with modified peptide backbones.

[0059] A DNA sequence "encoding" a particular antibody or antigen-binding fragment thereof is a DNA nucleic acid sequence that is transcribed into a specific RNA and / or protein. The DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein, or the DNA polynucleotide may encode an RNA that is not translated into a protein (e.g., tRNA, rRNA, or DNA-targeting RNA, also called "non-coding" RNA or "ncRNA").

[0060] As used herein, the term "terminal repeat" or "TR" includes any viral terminal repeat or synthetic sequence containing at least one minimally necessary origin of replication and a region containing a palindromic hairpin structure. The Rep-binding sequence ("Rep-binding sequence, RBS") (also referred to as an RBE (Rep-binding element)) and terminal separation site ("TRS") together constitute the "minimally necessary origin of replication," and thus, a TR contains at least one RBS and at least one TRS. TRs that are reverse complements of each other within a given stretch of a polynucleotide sequence are typically referred to as "inverted terminal repeats" or "ITRs," respectively. In the context of viruses, ITRs mediate replication, viral packaging, integration, and proviral rescue. Unexpectedly, TRs that are not reverse complements over their entire length can still perform the traditional functions of ITRs; therefore, the term ITR is used herein to refer to TRs in a ceDNA genome or ceDNA vector that can mediate replication of the ceDNA vector. It will be understood by those skilled in the art that there may be three or more ITRs or asymmetric ITR pairs in a composite ceDNA vector construct. The ITRs may be AAV or non-AAV ITRs, or may be derived from AAV or non-AAV ITRs. For example, the ITRs may be derived from the Parvoviridae family, which includes Parvoviruses and Dependoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19), or the SV40 hairpin that serves as the origin of SV40 replication may be used as an ITR, which may be further modified by truncation, substitution, deletion, insertion, and / or addition. The Parvoviridae family of viruses consists of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. Dependoparvoviruses include the adeno-associated virus (AAV) family of viruses that are capable of replication in vertebrate hosts, including, but not limited to, humans, primates, bovine, canine, equine, and ovine species.For convenience herein, an ITR located 5' to (upstream of) an expression cassette in a ceDNA vector is referred to as the "5' ITR" or "left ITR," and an ITR located 3' to (downstream of) an expression cassette in a ceDNA vector is referred to as the "3' ITR" or "right ITR."

[0061] "Wild-type ITR" or "WT-ITR" refers to the sequence of a naturally occurring ITR sequence in an AAV or other dependovirus, e.g., that retains Rep binding activity and Rep nicking ability. The nucleic acid sequence of a WT-ITR from any AAV serotype may differ slightly from the naturally occurring canonical sequence due to degeneracy in the genetic code or drift; therefore, WT-ITR sequences encompassed for use herein include WT-ITR sequences that result from naturally occurring variations (e.g., replication errors) that occur during the production process.

[0062] As used herein, the term "substantially symmetric WT-ITR" or "substantially symmetric WT-ITR pair" refers to a pair of WT-ITRs within a single ceDNA genome or ceDNA vector, both of which are wild-type ITRs with reverse-complementary sequences throughout their entire length. For example, an ITR can be considered to have a wild-type sequence even if it has one or more nucleotides that deviate from the naturally occurring canonical sequence, as long as the changes do not affect the sequence's properties and overall three-dimensional structure. In some embodiments, the deviating nucleotides represent conservative sequence changes. As a non-limiting example, a sequence has at least 95%, 96%, 97%, 98%, or 99% sequence identity (e.g., as measured using BLAST with default settings) with a canonical sequence and has a symmetric three-dimensional spatial organization relative to the other WT-ITR, such that their three-dimensional structures have the same shape in geometric space. A substantially symmetric WT-ITR has the same A, C-C', and B-B' loops in three-dimensional space. Substantially symmetric WT ITRs can be functionally confirmed as WT by determining that they have an operable Rep binding site (RBE or RBE') and terminal resolution site (trs) that pairs with the appropriate Rep protein. Optionally, other functions can be tested, including transgene expression under permissive conditions.

[0063] As used herein, the phrases "modified ITR" or "mod-ITR" or "mutated ITR" are used interchangeably herein and refer to an ITR that has a mutation in at least one or more nucleotides compared to a wild-type ITR from the same serotype. The mutation may result in a change in some or more of the A, C, C', B, and B' regions of the ITR, and may result in a change in the three-dimensional spatial configuration (i.e., its three-dimensional structure in geometric space) compared to the three-dimensional spatial configuration of a wild-type ITR from the same serotype.

[0064] As used herein, the term "asymmetric ITR," also referred to as an "asymmetric ITR pair," refers to a pair of ITRs within a single ceDNA genome or ceDNA vector that are not reverse complements across their entire length. As a non-limiting example, an asymmetric ITR pair does not have a symmetrical three-dimensional spatial configuration relative to its cognate ITR, such that their three-dimensional structures are different shapes in geometric space. In other words, an asymmetric ITR pair differs in overall geometric structure, i.e., the configuration of their A, C-C', and B-B' loops in three-dimensional space (e.g., compared to the cognate ITR), differs. The sequence difference between the two ITRs can be due to one or more nucleotide additions, deletions, truncations, or point mutations. According to some embodiments, one ITR of the asymmetric ITR pair can be a wild-type AAV ITR sequence, and the other ITR can be a modified ITR (e.g., a non-wild-type or synthetic ITR sequence) as defined herein. In another embodiment, neither ITR of the asymmetric ITR pair is a wild-type AAV sequence, but rather the two ITRs are modified ITRs that have different shapes in geometric space (i.e., different overall geometric structures). In some embodiments, one mod-ITR of the asymmetric ITR pair can have a short C-C' arm, and the other ITR can have a different modification (e.g., a single arm, or a short B-B' arm) such that they have a different three-dimensional spatial organization compared to their cognate asymmetric mod-ITR.

[0065] As used herein, the term "symmetric ITRs" refers to a pair of ITRs within a single ceDNA genome or ceDNA vector that are mutated or modified relative to the wild-type Dependvirus ITR sequence and are reverse-complementary across their entire length. Neither ITR is the wild-type ITR AAV2 sequence (i.e., they are modified ITRs, also referred to as mutant ITRs), and may differ in sequence from the wild-type ITR due to nucleotide additions, deletions, substitutions, truncations, or point mutations. For convenience herein, the ITR located 5' to (upstream of) the expression cassette in the ceDNA vector is referred to as the "5' ITR" or "left ITR," and the ITR located 3' to (downstream of) the expression cassette in the ceDNA vector is referred to as the "3' ITR" or "right ITR."

[0066] As used herein, the term "substantially symmetric modified ITR" or "substantially symmetric mod-ITR pair" refers to a pair of modified ITRs within a single ceDNA genome or ceDNA vector, both of which have reverse-complementary sequences throughout their entire length. For example, modified ITRs can be considered substantially symmetric even if there are some nucleotide sequence deviations from the reverse-complementary sequence, as long as the changes do not affect the properties and overall shape. As a non-limiting example, the sequences have at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity (measured using BLAST with default settings) to a canonical sequence and have a symmetric three-dimensional spatial organization relative to their cognate modified ITR, such that their three-dimensional structures have the same shape in geometric space. In other words, a substantially symmetric modified ITR pair has the same A, C-C', and B-B' loops organized in three-dimensional space. According to some embodiments, the ITRs from a mod-ITR pair may have different reverse-complementary nucleotides but still have the same symmetrical three-dimensional spatial configuration. That is, both ITRs have mutations that result in the same overall three-dimensional shape. For example, one ITR (e.g., the 5' ITR) of a mod-ITR pair may be derived from one serotype, and the other ITR (e.g., the 3' ITR) may be derived from a different serotype, but both may have the same corresponding mutation (e.g., if the 5' ITR has a deletion in the C region, the cognate modified 3' ITR of the different serotype will have a deletion in the corresponding position in the C' region), thereby resulting in the modified ITR pair having the same symmetrical three-dimensional spatial configuration. In such embodiments, each ITR of a modified ITR pair can be derived from a different serotype (e.g., AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12), such as a combination of AAV2 and AAV6, with modifications of some ITRs mirrored at corresponding positions in the cognate ITRs of the different serotypes. In one embodiment, a substantially symmetrical modified ITR pair refers to a pair of modified ITRs (mod-ITRs), so long as the nucleotide sequence differences between the ITRs do not affect their properties or overall shape, and they have substantially the same shape in three-dimensional space.As a non-limiting example, a mod-ITR has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a canonical mod-ITR, as determined by standard means known in the art, such as BLAST (Basic Local Alignment Search Tool) or BLASTN with default settings, and has a symmetrical three-dimensional spatial organization such that their three-dimensional structures have the same shape in geometric space. A substantially symmetric mod-ITR pair will have the same A, C-C', and B-B' loops in three-dimensional space. For example, if the modified ITR of a substantially symmetric mod-ITR pair has a deletion of the C-C' arm, the cognate mod-ITR will have a corresponding deletion of the C-C' loop and a similar three-dimensional structure of the remaining A and B-B' loops that are the same shape in geometric space as its cognate mod-ITR.

[0067] As used herein, "internal ribosomal entry site" (IRES) is meant to refer to a nucleotide sequence (>500 nucleotides) that allows translation initiation in the middle of an mRNA sequence (Kirn, J.I.T. et al., 2011. PLoS One 6(4):el 8556, the contents of which are incorporated herein by reference in their entirety). The use of an IRES sequence ensures simultaneous expression of the genes before and after the IRES, although the sequence following the IRES may be transcribed and translated at a lower level than the sequence preceding the IRES sequence.

[0068] As used herein, "2A peptide" is meant to refer to a small, self-cleaving peptide derived from a virus (e.g., foot-and-mouth disease virus (F2A), porcine teschovirus-1 (P2A), oceanic acinar virus (T2A), or equine rhinitis A virus (E2A)). The designation 2A specifically refers to a region of a picornavirus polyprotein where a glycyl-prolyl bond at the O-terminus of the 2A peptide results in ribosomal skipping (Kim, J. I. T. et al. 2011. PLoS One 6(4), the contents of which are incorporated herein by reference in their entirety). This skipping results in cleavage between the 2A peptide and the peptide immediately downstream.

[0069] The term "flanking" refers to the relative position of one nucleic acid sequence with respect to another. Generally, in the sequence ABC, B is adjacent to A and C. Similarly for the sequence AxBxC. Thus, a flanking sequence precedes or follows the flanked sequence, but need not be contiguous with or immediately adjacent to the flanked sequence. According to some embodiments, the term flanking refers to the terminal repeats at each end of a linear, double-stranded ceDNA vector.

[0070] As used herein, the term "ceDNA genome" refers to an expression cassette that further incorporates at least one inverted terminal repeat region. The ceDNA genome may further comprise one or more spacer regions. According to some embodiments, the ceDNA genome is incorporated into a plasmid or viral genome as an intermolecular double-stranded polynucleotide of DNA.

[0071] As used herein, the term "ceDNA spacer region" refers to an intervening sequence that separates functional elements in a ceDNA vector or ceDNA genome. According to some embodiments, the ceDNA spacer region maintains two functional elements at a desired distance for optimal functionality. According to some embodiments, the ceDNA spacer region provides or increases the genetic stability of the ceDNA genome, for example, within a plasmid or baculovirus. According to some embodiments, the ceDNA spacer region facilitates rapid genetic manipulation of the ceDNA genome by providing a convenient location for cloning sites, etc. For example, in certain aspects, an oligonucleotide "polylinker" containing several restriction endonuclease sites, or a non-open reading frame sequence designed to lack known protein (e.g., transcription factor) binding sites, can be positioned in the ceDNA genome to separate cis-acting elements, e.g., inserting a 6-mer, 12-mer, 18-mer, 24-mer, 48-mer, 86-mer, 176-mer, etc., between the terminal separation site and the upstream transcriptional regulatory element. Similarly, a spacer can be incorporated between the polyadenylation signal sequence and the 3' terminal separation site.

[0072] As used herein, "Rep binding site," "Rep binding element," "RBE," and "RBS" are used interchangeably and refer to the binding site of a Rep protein (e.g., AAV Rep 78 or AAV Rep 68) that, upon binding by the Rep protein, enables the Rep protein to perform its site-specific endonuclease activity on the sequence incorporating the RBS. An RBS sequence and its reverse complement together form a single RBS. RBS sequences are well known in the art and include, for example, the RBS sequence 5'-GCGCGCTCGCTCGCTC-3', which is the RBS sequence identified in AAV2. Any known RBS sequence can be used in embodiments of the present disclosure, including other known AAV RBS sequences and other naturally occurring or synthetic RBS sequences. Without being bound by theory, the nuclease domain of the Rep protein binds to the double-stranded nucleic acid sequence GCTC, and thus two known AAV Rep proteins directly bind and stably assemble to the double-stranded oligonucleotide 5'-(GCGC)(GCTC)(GCTC)(GCTC)-3'. In addition, soluble aggregated conformers (i.e., an indefinite number of interrelated Rep proteins) dissociate and bind to oligonucleotides containing the Rep binding site. Each Rep protein interacts with both the nitrogenous bases and the phosphodiester backbone on each strand. The interactions with the nitrogenous bases provide sequence specificity, while the interactions with the phosphodiester backbone are non- or low-sequence specific, stabilizing the protein-DNA complex.

[0073] As used herein, the terms "terminal separation site" and "TRS" are used interchangeably and refer to the region where Rep forms a tyrosine-phosphodiester bond with 5'-thymidine, generating a 3'-OH residue that serves as a substrate for DNA elongation via a cellular DNA polymerase, such as DNA pol delta or DNA pol epsilon. Alternatively, the Rep-thymidine complex can participate in a coordinate ligation reaction. According to some embodiments, the TRS minimally contains non-base-paired thymidines. According to some embodiments, the nicking efficiency of the TRS can be controlled, at least in part, by its distance from the RBS within the same molecule. When the acceptor substrate is a complementary ITR, the resulting product is an intermolecular duplex. TRS sequences are known in the art and include, for example, the hexanucleotide sequence 5'-GGTTGA-3' identified in AAV2. Any known TRS sequence can be used in embodiments of the present disclosure, including other known AAV TRS sequences and other naturally known or synthetic TRS sequences such as AGTT, GGTTGG, AGTTGG, AGTTGA, and other motifs such as RRTTRR.

[0074] As used herein, the term "ceDNA" refers to capsid-free, closed-ended, linear, double-stranded (ds) duplex DNA for synthetic or other non-viral gene transfer. A detailed description of ceDNA is provided in International Application No. US2017 / 020828, filed March 3, 2017, the entire contents of which are expressly incorporated herein by reference. Certain methods for producing ceDNA containing various inverted terminal repeat (ITR) sequences and configurations using cell-based methods are described in Example 1 of International Application Nos. US18 / 49996, filed September 7, 2018, and US2018 / 064242, filed December 6, 2018, each of which is incorporated herein by reference in its entirety. Certain methods for generating synthetic ceDNA vectors containing various ITR sequences and configurations are described, for example, in International Application No. US2019 / 14122, filed January 18, 2019, the entire contents of which are incorporated herein by reference. As used herein, the terms "ceDNA vector" and "ceDNA" are used interchangeably and refer to a closed-end DNA vector containing at least one terminal palindrome. According to some embodiments, the ceDNA contains two covalently closed ends.

[0075] As used herein, the term "ceDNA-plasmid" refers to a plasmid that contains a ceDNA genome as an intermolecular duplex.

[0076] As used herein, the term "ceDNA-bacmid" refers to an infectious baculovirus genome that contains a ceDNA genome as an intermolecular duplex that can be propagated as a plasmid in E. coli, thereby acting as a shuttle vector for baculovirus.

[0077] As used herein, the term "ceDNA-baculovirus" refers to a baculovirus that contains a ceDNA genome as an intermolecular duplex within the baculovirus genome.

[0078] As used herein, the terms "ceDNA-baculovirus-infected insect cells" and "ceDNA-BIIC" are used interchangeably and refer to invertebrate host cells (including but not limited to insect cells (e.g., Sf9 cells)) infected with a ceDNA-baculovirus.

[0079] As used herein, the term "closed-end DNA vector" refers to a capsid-free DNA vector that has at least one covalently closed end and at least a portion of the vector has an intramolecular double-stranded structure.

[0080] As defined herein, a "reporter" refers to a protein that can be used to provide a detectable readout. Reporters generally produce a measurable signal, such as fluorescence, color, or luminescence. A reporter protein coding sequence encodes a protein whose presence in a cell or organism is easily observed. For example, fluorescent proteins cause cells to fluoresce when excited with a particular wavelength of light, luciferase causes cells to catalyze a light-producing reaction, and enzymes such as β-galactosidase convert a substrate into a colored product. Exemplary reporter polypeptides useful for experimental or diagnostic purposes include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), green fluorescent protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase, and others known in the art.

[0081] As used herein, the term "effector protein" refers to a polypeptide that provides a detectable readout, for example, as a reporter polypeptide, or more appropriately, as a cell-killing polypeptide, such as a toxin or agent that renders the cell susceptible to killing by a selected agent or its absence. Effector proteins include any protein or peptide that directly targets or damages the DNA and / or RNA of a host cell. For example, effector proteins may include, but are not limited to, restriction endonucleases (whether genomic or extrachromosomal) that target host cell DNA sequences, proteases that target polypeptides required for cell survival, DNA gyrase inhibitors, and ribonuclease-type toxins. In some embodiments, the expression of an effector protein controlled by a synthetic biological circuit described herein may participate as a factor in another synthetic biological circuit, thereby expanding the range and complexity of the responsiveness of the biological circuit system.

[0082] Transcriptional regulators refer to transcriptional activators and repressors that activate or repress transcription of a transgene (e.g., a nucleic acid encoding an antibody or antigen-binding fragment thereof described herein). A promoter is a region of nucleic acid that initiates transcription of a particular gene. Transcriptional activators typically bind near a transcriptional promoter and recruit RNA polymerase to directly initiate transcription. Repressors bind to a transcriptional promoter and sterically hinder transcription initiation by RNA polymerase. Other transcriptional regulators can serve as either activators or repressors depending on where they bind and on cellular and environmental conditions. Non-limiting examples of transcriptional regulator classes include, but are not limited to, homeodomain proteins, zinc finger proteins, winged helix (forkhead) proteins, and leucine-zipper proteins.

[0083] As used herein, a "repressor protein" or "inducer protein" is a protein that binds to a regulatory sequence element and represses or activates, respectively, transcription of a sequence operably linked to the regulatory sequence element. Preferred repressor and inducer proteins described herein are sensitive to the presence or absence of at least one input agent or environmental input. Preferred proteins described herein are modular in form, for example, containing separable DNA-binding and input agent-binding or response elements or domains.

[0084] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce toxic, allergic, or similar untoward reactions when administered to a host.

[0085] As used herein, an "input agent responsive domain" is a domain of a transcription factor that responds to a condition or input agent such that it binds to or otherwise renders a linked DNA-binding fusion domain responsive to the presence of that condition or input. According to some embodiments, the presence of the condition or input results in a conformational change in the input agent responsive domain or the protein to which it is fused, which modifies the transcriptional regulatory activity of the transcription factor.

[0086] The term "in vivo" refers to an assay or process that occurs in or within an organism, such as a multicellular animal. According to some of the aspects described herein, a method or use may be said to occur "in vivo" when a unicellular organism, such as a bacterium, is used. The term "ex vivo" refers to methods and uses that are carried out using living cells with intact membranes outside the body of a multicellular animal or plant, e.g., explants, cultured cells (including primary cells and cell lines), transformed cell lines, and extracted tissues or cells (including blood cells), among others. The term "in vitro" refers to assays and methods that do not require the presence of cells with intact membranes, such as cell extracts, and can refer to introducing a programmable synthetic biological circuit into a non-cellular system, e.g., a medium that does not contain cells or cell systems, such as a cell extract.

[0087] As used herein, the term "promoter" refers to any nucleic acid sequence that regulates the expression of another nucleic acid sequence by driving the transcription of that nucleic acid sequence, which may be a heterologous target gene encoding a protein or RNA. A promoter can be constitutive, inducible, repressible, tissue-specific, or any combination thereof. A promoter is a control region of a nucleic acid sequence where the initiation and rate of transcription of the remainder of the nucleic acid sequence are controlled. A promoter can also contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. In some embodiments of the aspects described herein, a promoter can drive the expression of transcription factors that regulate its own expression. Within the promoter sequence, transcription initiation sites, as well as protein binding domains involved in the binding of RNA polymerase, will be found. Eukaryotic promoters often, but not necessarily, contain "TATA" and "CAT" boxes. A variety of promoters, including inducible promoters, can be used to drive the expression of transgenes in the ceDNA vectors disclosed herein. The promoter sequence is bounded at its 3' end by a transcription initiation site and extends upstream (5' orientation) to include the minimum number of bases or elements necessary to initiate transcription at a level detectable above background. According to some embodiments, the promoters of the present disclosure are liver-specific promoters.

[0088] As used herein, the term "enhancer" refers to a cis-acting regulatory sequence (e.g., 10 to 1,500 base pairs) that binds to one or more proteins (e.g., activator proteins or transcription factors) to increase transcriptional activation of a nucleic acid sequence. Enhancers can be located upstream of the start site of the gene they regulate or up to 1,000,000 base pairs downstream of the start site of the gene. Enhancers can be located within intronic or exonic regions of unrelated genes.

[0089] A promoter can be said to drive expression or drive transcription of the nucleic acid sequence it regulates. The phrases "operably linked," "operably positioned," "operably linked," "under control," and "under transcriptional control" indicate that the promoter is in the correct functional location and / or orientation with respect to a nucleic acid sequence and regulates to control transcription initiation and / or expression of that sequence. As used herein, an "inverted promoter" refers to a promoter in which a nucleic acid sequence is in an inverted orientation, whereby what was the coding strand is now the non-coding strand, and vice versa. Inverted promoter sequences can be used in various embodiments to regulate the state of a switch. Additionally, in various embodiments, a promoter can be used in conjunction with an enhancer.

[0090] A promoter may be one naturally associated with a gene or sequence, which may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and / or exons of a given gene or sequence. Such a promoter may be referred to as "endogenous." Similarly, according to some embodiments, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.

[0091] According to some embodiments, the coding nucleic acid segment is placed under the control of a "recombinant promoter" or "heterologous promoter," both of which refer to a promoter that is not normally associated with an operably linked encoded nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers to an enhancer that is not normally associated with a given nucleic acid sequence in its natural environment. Such promoters or enhancers can include promoters or enhancers of other genes, promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and synthetic promoters or enhancers that are not "naturally occurring," i.e., may contain different elements of different transcriptional regulatory regions and / or mutations that alter expression through methods of genetic engineering known in the art. In addition to synthetically producing promoter and enhancer nucleic acid sequences, promoter sequences can be produced using recombinant cloning and / or nucleic acid amplification techniques, including PCR, for the synthetic biological circuits and modules disclosed herein (see, e.g., U.S. Pat. Nos. 4,683,202 and 5,928,906, each of which is incorporated herein by reference). Furthermore, it is contemplated that regulatory sequences that direct transcription and / or expression of sequences within non-nuclear organelles, such as mitochondria, chloroplasts, etc., can be similarly employed.

[0092] As described herein, an "inducible promoter" is characterized by initiating or enhancing transcriptional activity when in the presence of, affected by, or contacted by an inducer or inducing agent. As defined herein, an "inducer" or "inducing agent" can be endogenous or can be a compound or protein, usually exogenous, administered in such a way that it is active in inducing transcriptional activity from an inducible promoter. In some embodiments, the inducer or inducing agent, i.e., a chemical, compound, or protein, can itself be the result of transcription or expression of a nucleic acid sequence (i.e., the inducer can be an inducer protein expressed by another component or module), can itself be under the control of, or be an inducible promoter. In some embodiments, an inducible promoter is induced in the absence of certain agents, such as a repressor. Examples of inducible promoters include, but are not limited to, tetracycline, metallothionine, ecdysone, mammalian viruses (e.g., adenovirus late promoter and mouse mammary tumor virus long terminal repeat (MMTV-LTR)), as well as other steroid-responsive promoters, rapamycin-responsive promoters, and the like.

[0093] The terms "DNA regulatory sequence," "control element," and "regulatory element," used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, proteolysis signals, etc., that provide for and / or regulate the transcription of a non-coding sequence (e.g., a DNA-targeting RNA) or a coding sequence (e.g., a site-directed modifying polypeptide or a Cas9 / Csn1 polypeptide) and / or regulate the translation of the encoded polypeptide.

[0094] As used herein, the term "open reading frame (ORF)" is intended to refer to a sequence of several nucleotide triplets that can be translated into a peptide or protein. An open reading frame preferably includes an initiation codon, i.e., a combination of three subsequent nucleotides that usually encodes the amino acid methionine (ATG), at its 5' end, and also includes a subsequent region that usually exhibits a length that is a multiple of three nucleotides. An ORF preferably terminates with a stop codon (e.g., TAA, TAG, TGA). Typically, this is the only stop codon of the open reading frame. Thus, an open reading frame in the context of the present invention is a nucleotide sequence consisting of several nucleotides that preferably begins with an initiation codon (e.g., ATG) and preferably ends with a stop codon (e.g., TAA, TGA, or TAG), divisible by three. An open reading frame may be isolated or incorporated into a longer nucleic acid sequence, such as a ceDNA vector as described herein.

[0095] "Operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For example, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. An "expression cassette" comprises a DNA sequence operably linked to a promoter or other regulatory sequence sufficient to direct transcription of a transgene in a ceDNA vector. Suitable promoters include, for example, tissue-specific promoters. The promoter may also be of AAV origin.

[0096] As used herein, the term "subject" refers to a human or animal to whom treatment, including prophylactic treatment, with a ceDNA vector according to the present disclosure is provided. As used herein, the term "subject" includes humans and other animals. Typically, a subject is a human. For example, a subject can be an adult, teenager, child (ages 2-14), infant (birth-2 years), or newborn (up to 2 months). In certain embodiments, a subject is up to 4 months old, or up to 6 months old. In some embodiments, an adult is about 65 years old or older, or about 60 years old or older. In some embodiments, a subject is a pregnant woman or a woman who is trying to become pregnant. In other embodiments, a subject is not a human, for example, a non-human primate, such as a baboon, chimpanzee, gorilla, or macaque. In certain embodiments, a subject may be a pet, such as a dog or cat.

[0097] As used herein, the term "host cell" includes any cell type that is amenable to transformation, transfection, transduction, etc. with a nucleic acid construct or ceDNA expression vector of the present disclosure. By way of non-limiting example, host cells include isolated primary cells, pluripotent stem cells, CD34 + The host cells may be either human cells, induced pluripotent stem cells, or any of several immortalized cell lines (e.g., HepG2 cells). Alternatively, the host cells may be in situ or in vivo cells in a tissue, organ, or organism.

[0098] The term "exogenous" refers to a substance present in a cell other than its natural source. As used herein, the term "exogenous" can refer to a nucleic acid (e.g., a nucleic acid encoding a polypeptide) or polypeptide that is not normally found and that has been introduced into a biological system, such as a cell or organism, by a process involving the hand of man, where it is desired to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, "exogenous" can refer to a nucleic acid or polypeptide that is found in relatively low amounts and that has been introduced into a biological system, such as a cell or organism, by a process involving the hand of man, where it is desired to increase the amount of the nucleic acid or polypeptide in the cell or organism, e.g., to result in ectopic expression or levels. In contrast, the term "endogenous" refers to a substance that is natural to a biological system or cell.

[0099] The term "sequence identity" refers to the relatedness between two nucleotide sequences. For purposes of this disclosure, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 3.0.0 or later. Optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and an EDNAFULL (the EMBOSS version in NCBI NUC4.4) substitution matrix. The Needle output labeled "Longest Identity" (obtained using the -nobrief option) is used as the percent identity, calculated as follows: (identical deoxyribonucleotides × 100) / length of alignment - total number of gaps in the alignment). The length of the alignment is preferably at least 10 nucleotides, preferably at least 25 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides.

[0100] As used herein, the term "homology" or "homology" is defined as the percentage of nucleotide residues that are identical to those of the corresponding sequence on the target chromosome, after aligning the sequences as necessary and introducing gaps to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in a variety of ways within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ClustalW2, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms necessary to achieve maximum alignment across the entire length of the sequences being compared. In some embodiments, for example, a nucleic acid sequence (e.g., a DNA sequence) of an arm of homology is considered "homologous" if the sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to the corresponding native or unedited nucleic acid sequence (e.g., genomic sequence) of the host cell.

[0101] As used herein, the term "heterologous" refers to a nucleotide or polypeptide sequence that is not found in a naturally occurring nucleic acid or protein, respectively. A heterologous nucleic acid sequence may be linked (e.g., by genetic engineering) to a naturally occurring nucleic acid sequence (or a variant thereof) to generate a chimeric nucleotide sequence that encodes a chimeric polypeptide. A heterologous nucleic acid sequence may be linked (e.g., by genetic engineering) to a variant polypeptide to generate a nucleic acid sequence that encodes a fusion variant polypeptide. Alternatively, the term "heterologous" may refer to a nucleic acid sequence that does not naturally occur in a cell or subject.

[0102] A "vector" or "expression vector" is a replicon, such as a plasmid, bacmid, phage, virus, virion, or cosmid, to which another DNA segment, i.e., an "insert," may be attached to bring about replication of the attached segment in a cell. A vector may be a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector may be viral or non-viral in origin and / or final form, although for purposes of this disclosure, "vector," as the term is used herein, generally refers to a ceDNA vector. The term "vector" encompasses any genetic element that, when associated with the appropriate control elements, is capable of replication and transfer of genetic sequences to a cell. According to some embodiments, the vector may be an expression vector or a recombinant vector.

[0103] As used herein, the term "expression vector" refers to a vector that directs the expression of RNA or polypeptides from sequences linked to transcriptional regulatory sequences on the vector. The expressed sequences are often, but not necessarily, heterologous to the cell. Expression vectors can contain additional elements; for example, an expression vector can have two replication systems, allowing it to be maintained in two organisms, such as human cells for expression and prokaryotic hosts for cloning and amplification. The term "expression" refers to the cellular processes involved in the production of RNA and proteins, and, where appropriate, secreted proteins, including, but not limited to, transcription, transcript processing, translation, and protein folding, modification, and processing. "Expression product" includes RNA transcribed from a gene and polypeptides obtained by translation of mRNA transcribed from a gene. The term "gene" refers to a nucleic acid sequence (DNA) that is transcribed into RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. A gene may or may not include regions preceding and following the coding region, such as 5' untranslated (5'UTR) or "leader" sequences and 3'UTR or "trailer" sequences, as well as intervening sequences (introns) between individual coding segments (exons).

[0104] By "recombinant vector" is meant a vector containing a heterologous nucleic acid sequence, or a "transgene" that can be expressed in vivo. It should be understood that the vectors described herein, according to some embodiments, can be combined with other suitable compositions and therapies. According to some embodiments, the vector is episomal. The use of a suitable episomal vector provides a means of maintaining a nucleotide of interest in a subject in high copy number extrachromosomal DNA, thereby eliminating the potential effects of chromosomal integration.

[0105] As used herein, the terms "administration," "administering," and variations thereof refer to the introduction of a composition or agent (e.g., a ceDNA described herein) into a subject, including simultaneous and sequential introduction of one or more compositions or agents. "Administration" can refer, for example, to therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. "Administration" also encompasses in vitro and ex vivo treatments. Introduction of a composition or agent into a subject is by any suitable route, including oral, pulmonary, intranasal, parenteral (intravenous, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intratumoral, or topical. Administration includes self-administration and administration by another. Administration can be performed by any suitable route. A suitable route of administration allows the composition or agent to perform its intended function. For example, if the suitable route is intravenous, the composition is administered by introducing the composition or agent into the subject's vein.

[0106] As used herein, the term "infection" refers to the initial invasion of a pathogen into a host and the state in which the pathogen becomes established in or on the cells or tissues of the host. Such a state does not necessarily constitute or lead to disease.

[0107] As used herein, the term "immune response" is meant to refer to any functional manifestation of a subject's immune system to either foreign antigens or self-antigens, regardless of whether the outcome of these responses is beneficial or harmful to the subject.

[0108] As used herein, the term "biological sample" refers to any type of substance of biological origin (including, for example, DNA, RNA, lipids, carbohydrates, and proteins) isolated from a subject. The term "biological sample" includes tissues, cells, and biological fluids isolated from a subject. Biological samples include, for example, but are not limited to, whole blood, plasma, serum, semen, saliva, tears, urine, fecal material, sweat, buccal fluid, skin, cerebrospinal fluid, bone marrow, bile, hair, muscle biopsy, organ tissue, or other substances of biological origin known to those of skill in the art. Biological samples can be obtained from subjects for diagnostic or research purposes, or can be obtained from healthy subjects as controls or for basic research.

[0109] As used herein, the term "cancer" refers to a disease in which abnormal cells divide uncontrollably and can invade other tissues. There are over 100 different types of cancer. Most cancers are named for the organ or cell type in which they begin; for example, a cancer that begins in the colon is called colon cancer, and a cancer that begins in the melanocytes of the skin is called melanoma. Cancer types can be divided into broader categories. The major categories of cancer include carcinoma (meaning cancer that begins in the skin or in tissues lining or covering internal organs, and its subtypes, including adenocarcinoma, basal cell carcinoma, squamous cell carcinoma, and transitional cell carcinoma), sarcoma (meaning cancer that begins in bone, cartilage, fat, muscle, blood vessels, or other connective or supportive tissue), leukemia (meaning cancer that begins in blood-forming tissues (e.g., bone marrow) and causes large numbers of abnormal blood cells to be produced and enter the blood), lymphoma and myeloma (meaning cancer that begins in cells of the immune system), and central nervous system (CNS) cancer (meaning cancer that begins in the tissues of the brain and spinal cord). The term "myelodysplastic syndrome" refers to a type of cancer in which the bone marrow does not make enough healthy blood cells (white blood cells, red blood cells, and platelets) and abnormal cells are present in the blood and / or bone marrow. Myelodysplastic syndrome can lead to acute myeloid leukemia (AML).In certain embodiments, the cancer is acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), anal cancer, bile duct cancer, bladder cancer, bone cancer, intestinal cancer, brain cancer, breast cancer, cancer of unknown primary site, metastatic cancer to bone, metastatic cancer to brain, metastatic cancer to liver, metastatic cancer to lung, carcinoma, cervical cancer, choriocarcinoma, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), colon cancer, colorectal cancer, endometrial cancer, eye cancer, gallbladder cancer, gastric cancer, gestational trophoblastic neoplasia (GMT), or gestational trophoblastic neoplasia (GMT). tumor (GTT), hairy cell leukemia, head and neck cancer, Hodgkin's lymphoma, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, melanoma skin cancer, mesothelioma, male cancer, molar pregnancy, oral cavity and oropharyngeal cancer, myeloma, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, non-Hodgkin's lymphoma (NHL), esophageal cancer, ovarian cancer, pancreatic cancer, penile cancer, prostate cancer, rare cancers, rectal cancer, salivary gland cancer, secondary cancers, skin cancer (non-melanoma), soft tissue sarcoma, gastric cancer, testicular cancer, thyroid cancer, cancer of unknown primary cancer, uterine cancer, vaginal cancer, vulvar cancer.

[0110] As used herein, the term "dose" refers to the amount of a substance (e.g., a ceDNA described herein) that is ingested or administered to a subject at one time.

[0111] As used herein, the term "dosing" refers to the administration of a substance (e.g., a ceDNA described herein) to achieve a therapeutic goal (e.g., treatment).

[0112] The term "combination" in the phrase "a first agent in combination with a second agent" includes, for example, simultaneous administration of the first agent and the second agent, which may be dissolved or mixed in the same pharmaceutically acceptable carrier, or administration of the first agent followed by administration of the second agent, or administration of the second agent followed by administration of the first agent. Thus, the present disclosure includes methods of combination therapeutic treatment and combination pharmaceutical compositions.

[0113] The term "combined" in the phrase "combined therapeutic treatment" includes administering an agent in the presence of a second agent. Combination therapeutic treatment methods include methods in which a first, second, third, or additional agent is administered simultaneously. Combination therapeutic treatment methods also include methods in which a first or additional agent is administered in the presence of a second or additional agent, where the second or additional agent may, for example, have been previously administered. Combination therapeutic treatment methods may be performed in stages by different actors. For example, one actor may administer a first agent to a subject, and a second actor may administer a second agent to the subject, and the administering steps may be performed simultaneously, nearly simultaneously, or at separate times, as long as the first agent (and additional agent) is administered after the second agent (and additional agent). The actor and subject may be the same entity (e.g., a human).

[0114] As used herein, the term "combination therapy" refers to the administration of two or more therapeutic agents (e.g., an antibody or antigen-binding fragment described herein and another drug). The other drug may be administered simultaneously with, before, or after the administration of an antibody or antigen-binding fragment described herein.

[0115] As used herein, the phrases "nucleic acid therapy," "therapeutic nucleic acid," and "TNA" are used interchangeably and refer to any modality of treatment that uses nucleic acids as the active ingredient of a therapeutic agent to treat a disease or disorder. As used herein, these terms refer to RNA-based therapeutic agents and DNA-based therapeutic agents. Non-limiting examples of RNA-based therapeutic agents include mRNA, antisense RNA and oligonucleotides, ribozymes, aptamers, interfering RNA (RNAi), Dicer substrate dsRNA, short hairpin RNA (shRNA), asymmetric interfering RNA (aiRNA), and microRNA (miRNA). Non-limiting examples of DNA-based therapeutics include minicircle DNA, minigenes, viral DNA (e.g., lentivirus or AAV genome) or nonviral synthetic DNA vectors, closed-end linear double-stranded DNA (ceDNA / CELiD), plasmids, bacmids, doggybone™ DNA vectors, minimally immunologically defined gene expression (MIDGE) vectors, nonviral ministring DNA vectors (linear covalently closed DNA vectors), or dumbbell-shaped DNA minimal vectors ("dumbbell DNA"). According to some embodiments, the therapeutic nucleic acid is ceDNA.

[0116] As used herein, the term "therapeutic effect" refers to a result of treatment, which result is deemed to be desirable and beneficial. A therapeutic effect can include, directly or indirectly, the prevention, reduction, or elimination of disease symptoms. A therapeutic effect can also include, directly or indirectly, the prevention, reduction, or elimination of the progression of disease symptoms.

[0117] For any therapeutic agent described herein, the therapeutically effective amount can be initially determined from preliminary in vitro studies and / or animal models. The therapeutically effective dose can also be determined from human data. The applied dose can be adjusted based on the relative bioavailability and efficacy of the administered compound. Adjusting the dose to achieve maximum efficacy based on the above methods and other well-known methods is within the ability of one skilled in the art. The following summarizes general principles for determining therapeutic efficacy, which can be found in Chapter 1 of Goodman and Gilman's *The Pharmacological Basis of Therapeutics*, 10th Edition, McGraw-Hill (New York) (2001), incorporated herein by reference.

[0118] Pharmacokinetic principles provide the basis for modifying dosing regimens to achieve the desired degree of therapeutic effect while minimizing unacceptable side effects. In situations where the plasma concentration of a drug can be measured and is related to the therapeutic window, additional guidance regarding dosage modifications is available.

[0119] As used herein, "viral infection" is meant to refer to the invasion and proliferation of a virus in the body of a subject.

[0120] As used herein, the terms "treat," "treating," and / or "treatment" include arresting, substantially inhibiting, slowing, or reversing the progression of a condition, substantially ameliorating the clinical symptoms of a condition, or substantially preventing the appearance of clinical symptoms of a condition, or achieving beneficial or desired clinical results. Treating further refers to achieving one or more of the following: (a) reducing the severity of the disorder, (b) limiting the onset of symptoms characteristic of the disorder being treated, (c) limiting the worsening of symptoms characteristic of the disorder being treated, (d) limiting the recurrence of the disorder in patients who previously had the disorder, and (e) limiting the recurrence of symptoms in patients who were previously asymptomatic for the disorder.

[0121] Beneficial or desired clinical results, such as pharmacological and / or physiological effects, include, but are not limited to, preventing a disease, disorder, or condition from occurring in a subject who may be predisposed to the disease, disorder, or condition, but who has not yet experienced or exhibited symptoms of the disease (prophylactic treatment), alleviating the symptoms of the disease, disorder, or condition, reducing the severity of the disease, disorder, or condition, stabilizing (i.e., not worsening) the disease, disorder, or condition, preventing the spread of the disease, disorder, or condition, delaying or slowing the progression of the disease, disorder, or condition, ameliorating or alleviating the disease, disorder, or condition, and combinations thereof, as well as prolonging survival as compared to expected survival if not receiving treatment.

[0122] A person "in need of treatment" includes a mammal, such as a human, already with the disease or disorder, infection, or cancer.

[0123] As used herein, the terms "increase," "enhance," and "elevate" (and similar terms) generally refer to the act of increasing, directly or indirectly, a concentration, level, function, activity, or behavior relative to natural, expected, or average, or relative to a control condition.

[0124] As used herein, the terms "suppress," "reduce," "interfere," "inhibit," and / or "reduce" (and similar terms) generally refer to the act of directly or indirectly decreasing a concentration, level, function, activity, or behavior relative to natural, expected, or average, or relative to a control condition.

[0125] As used herein, "control" is intended to refer to a reference standard. In some embodiments, the control is a negative control sample obtained from a healthy patient. In other embodiments, the control is a positive control sample obtained from a patient diagnosed with a disease, injury, infection, or cancer. In still other embodiments, the control is a historical control or standard reference value or range of values ​​(such as a previously tested control sample or a group of samples representing baseline or normal values). The difference between the test sample and the control may be an increase or, conversely, a decrease. The difference may be qualitative or quantitative, e.g., a statistically significant difference. In some examples, the difference is an increase or decrease of at least about 5%, e.g., at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, or more than 500% compared to the control.

[0126] As used herein, the terms "comprising" or "comprises" are used in reference to compositions, methods, and their respective components that are essential to the method or composition, but are open to the inclusion of non-specified elements, whether essential or not.

[0127] As used herein, the term "consisting essentially of" refers to elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic, novel, or functional characteristics of the embodiment. The use of "comprises" indicates inclusion rather than limitation.

[0128] The term "consisting of" refers to the compositions, methods, and their respective components described herein, excluding any elements not recited in the description of the embodiments.

[0129] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "method" includes one or more methods, and / or steps of the type described herein and / or that will become apparent to those skilled in the art upon reading this disclosure, etc. Similarly, the word "or" is intended to include "and" unless the context clearly dictates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The abbreviation "eg" is derived from the Latin "exempli gratia," and is used herein to indicate a non-limiting example. Thus, the abbreviation "eg" is synonymous with "for example."

[0130] Except in working examples or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood to be modified in all instances by the term "about." When used in connection with percentages, the term "about" can mean ±1%. The present disclosure is further illustrated by the following examples, but the scope of the present disclosure should not be limited thereto.

[0131] Groupings of alternative elements or embodiments of the present disclosure disclosed herein should not be construed as limiting. Members of each group may be referenced and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group may be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to include the modified group, thus satisfying all Markush group descriptions used in the appended claims.

[0132] Other terms are defined herein within the description of various aspects of the disclosure.

[0133] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments and examples of the present disclosure have been described herein for illustrative purposes, those skilled in the art will recognize that various equivalent modifications are possible within the scope of the present disclosure. For example, while method steps or functions may be presented in a given order, alternative embodiments may perform the functions in a different order, or the functions may be performed substantially simultaneously. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the present disclosure can be modified, as appropriate, to employ the compositions, functions, and concepts of the above-mentioned references and applications to provide further embodiments of the present disclosure. Furthermore, due to considerations of biological functional equivalence, some changes can be made to protein structure without affecting the type or amount of biological or chemical activity. These and other changes can be made to the present disclosure in light of the detailed description. All such modifications are intended to be within the scope of the appended claims.

[0134] Particular elements of any of the foregoing embodiments can be combined with or substituted for elements of other embodiments. Furthermore, although advantages associated with certain embodiments of the present disclosure have been described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments necessarily exhibit such advantages, to be within the scope of the present disclosure.

[0135] The techniques described herein are further illustrated by the following examples, which should not be construed as further limiting in any way. It is understood that the present disclosure is not limited to the particular methodology, protocols, and reagents described herein, and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present disclosure, which is defined solely by the claims.

[0136] II. Expression of antibodies or antigen-binding fragments thereof from ceDNA vectors The technology described herein generally relates to the expression and / or production of antibodies or antigen-binding fragments thereof in cells from one or more non-viral DNA vectors, e.g., the ceDNA vectors described herein. In particular, ceDNA vectors for the expression of antibodies or antigen-binding fragments thereof comprise a pair of ITRs (e.g., symmetric or asymmetric as described herein) and, between the ITR pair, a nucleic acid encoding an antibody heavy chain (HC) and / or antibody light chain (LC), or portion thereof, as described herein, operably linked to a promoter or regulatory sequence. A distinct advantage of ceDNA vectors for the expression of antibodies or antigen-binding fragments thereof over traditional AAV vectors, and even lentiviral vectors, is that there are no size constraints on the nucleic acid sequence encoding the desired HC or LC, or both the HC and LC. It is a feature of the present disclosure that the HC and LC can be expressed from the same ceDNA or from different cultured ceDNAs.

[0137] As will be appreciated, the ceDNA vector technology described herein can be adapted to any level of complexity or used in a modular fashion, whereby the expression of different components of an antibody (e.g., HC, LC, linker) can be controlled in an independent manner. For example, the ceDNA vector technology designed herein can use a single ceDNA vector to express both the HC and LC of an antibody or antigen-binding fragment thereof, or portions thereof, or can use multiple ceDNA vectors, where each vector expresses the HC or LC, or portions thereof, or other components, each independently controlled by the same or different promoters. The following embodiments are specifically contemplated herein and can be adapted by those skilled in the art as needed.

[0138] According to some embodiments, a single ceDNA vector can be used to express the LC of an antibody or antigen-binding fragment thereof under the control of a single promoter. According to some embodiments, a single ceDNA vector can be used to express the HC of an antibody or antigen-binding fragment thereof under the control of a single promoter.

[0139] According to some embodiments, a single ceDNA vector can be used to express both the LC and HC of an antibody or antigen-binding fragment thereof under the control of a single promoter (e.g., a strong promoter), optionally using an IRES sequence to ensure proper expression of each component.

[0140] Also contemplated herein, in another embodiment, is a single ceDNA vector containing at least two inserts (e.g., expressing an HC or an LC), where the expression of each insert is under the control of its own promoter, which may include multiple copies of the same promoter, multiple different promoters, or any combination thereof.

[0141] It is a finding of the present disclosure that it is often desirable to express components of an antibody, e.g., the HC or LC, at different expression levels, thus controlling the stoichiometry of the individual components expressed to ensure efficient combination in the cell, as described in more detail below.

[0142] According to some embodiments, the present disclosure provides one or more ceDNA vectors comprising one or more nucleic acid sequences encoding an antibody or antigen-binding fragment thereof. Targets, i.e., antigens, of the antibodies or antigen-binding fragments described herein can be selected from a variety of pathogens, including, for example, bacterial, viral, fungal, and parasitic infectious agents. Suitable targets can also include cancer or cancer-associated antigens, etc. Still other targets can include autoimmune conditions, such as rheumatoid arthritis (RA) or multiple sclerosis (MS).

[0143] In certain embodiments, an antibody or antigen-binding fragment of the present disclosure specifically binds to its target antigen.

[0144] As used herein, "specifically binds" refers to an antibody or antigen-binding fragment that does not significantly associate or bind with any other molecule or component in a sample, while specifically binding to the antibody or antigen-binding fragment. 5 M -1 (The on-rate [K on ] off rate [K off Alternatively, affinity can be defined as the equilibrium dissociation constant (Kd) of a particular binding interaction, which has units of M (e.g., 10 -5 M~10 -13 M).

[0145] According to some embodiments, the term "specifically binds" refers to a binding affinity, expressed as Kd, for an antigen of at least about 10 when measured, for example, by a real-time label-free biolayer interference assay, e.g., Octet® HTX biosensor, or surface plasmon resonance, e.g., BIACORE™, or solution affinity ELISA, at 25°C or 37°C. -8 It refers to the antigen-binding protein M.

[0146] Antibodies can be classified as "high affinity" or "low affinity" antibodies. A "high affinity" antibody is one that binds to at least 10 7 M -1 , at least 10 8 M -1 , at least 10 9 M -1 , at least 10 10 M -1 , at least 10 11 M -1 , at least 10 12 M -1 Or at least 10 13 M -1 A "low affinity" antibody refers to an antibody with a Ka of 107 M -1 Up to 10 6 M -1 Up to 10 5 M -1 Alternatively, affinity may be expressed in M ​​units (e.g., 10), as measured, for example, by a real-time label-free biolayer interference assay, e.g., an Octet® HTX biosensor, at 25° C. or 37° C., by surface plasmon resonance, e.g., a BIACORE™, or by a solution affinity ELISA. -5 M~10 -13 It can be defined as the equilibrium dissociation constant (Kd) of a specific binding interaction with the molecule (M).

[0147] In certain embodiments, the antibodies of the present disclosure are capable of neutralizing infection by a pathogen. As used herein, a "neutralizing antibody" is one that is capable of neutralizing, i.e., preventing, inhibiting, reducing, hindering, or interfering with, the ability of a pathogen to initiate and / or perpetuate infection in a host. The terms "neutralizing antibody" and "neutralizing antibody(ies)" are used interchangeably herein. In any of the embodiments of the present disclosure, the antibody or antigen-binding fragment is capable of preventing and / or neutralizing infection in an in vitro model of infection and / or an in vivo animal model of infection and / or in humans.

[0148] A distinct advantage of ceDNA vectors over traditional AAV vectors and even lentiviral vectors is that there are no size constraints on the nucleic acid sequence(s) encoding the antibody or antigen-binding fragment thereof. Furthermore, depending on the required stoichiometry, the molar ratio of HC and LC (or HCVR or LCVR) can be varied and the same or different promoters can be used for optimal expression.

[0149] According to some embodiments, a ceDNA vector for expression of a desired antibody or antigen-binding fragment thereof comprises a nucleic acid sequence encoding the HC of the antibody or antigen-binding fragment thereof in a first ceDNA vector and a nucleic acid sequence encoding the LC of the antibody or antigen-binding fragment thereof in a second ceDNA vector. According to some embodiments, the nucleic acid sequence encoding the LC is under the control of a first promoter. According to some embodiments, the nucleic acid sequence encoding the HC is under the control of a second promoter. According to some embodiments, the first and second promoters are the same. According to some embodiments, the first and second promoters are different.

[0150] According to some embodiments, a first ceDNA vector comprising a nucleic acid sequence encoding the HC of an antibody or antigen-binding fragment thereof and a second ceDNA vector comprising a nucleic acid sequence encoding the LC of an antibody or antigen-binding fragment thereof are mixed at a molar ratio (HC:LC) of 1:10 to 1:10 and co-formulated. According to some embodiments, a first ceDNA vector comprising a nucleic acid sequence encoding the HC of an antibody or antigen-binding fragment thereof and a second ceDNA vector comprising a nucleic acid sequence encoding the LC of an antibody or antigen-binding fragment thereof are mixed at a molar ratio (HC:LC) of 3:1 to 1:1 and co-formulated. According to some embodiments, a first ceDNA vector comprising a nucleic acid sequence encoding the HC of an antibody or antigen-binding fragment thereof and a second ceDNA vector comprising a nucleic acid sequence encoding the LC of an antibody or antigen-binding fragment thereof are mixed at a molar ratio (HC:LC) of 3:1 and co-formulated. In some embodiments, a first ceDNA vector comprising a nucleic acid sequence encoding the HC of an antibody or antigen-binding fragment thereof and a second ceDNA vector comprising a nucleic acid sequence encoding the LC of an antibody or antigen-binding fragment thereof are mixed and co-formulated at a molar ratio of 2:1 (HC:LC). In some embodiments, a first ceDNA vector comprising a nucleic acid sequence encoding the HC of an antibody or antigen-binding fragment thereof and a second ceDNA vector comprising a nucleic acid sequence encoding the LC of an antibody or antigen-binding fragment thereof are mixed and co-formulated at a molar ratio of 1.5:1 (HC:LC). In some embodiments, a first ceDNA vector comprising a nucleic acid sequence encoding the HC of an antibody or antigen-binding fragment thereof and a second ceDNA vector comprising a nucleic acid sequence encoding the LC of an antibody or antigen-binding fragment thereof are mixed and co-formulated at a molar ratio of 3:1 to 2:1. In some embodiments, a first ceDNA vector comprising a nucleic acid sequence encoding the HC of an antibody or antigen-binding fragment thereof and a second ceDNA vector comprising a nucleic acid sequence encoding the LC of an antibody or antigen-binding fragment thereof are mixed and co-formulated at a molar ratio (HC:LC) selected from 1:10, 5:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:5, or 1:10.

[0151] According to some embodiments, a ceDNA vector for expression of an antibody or antigen-binding fragment thereof described herein comprises a nucleic acid sequence encoding the HC of the antibody or antigen-binding fragment thereof and a nucleic acid sequence encoding the LC of the antibody or antigen-binding fragment thereof. According to some embodiments, the nucleic acid sequence encoding the HC of the antibody or antigen-binding fragment thereof comprises a first open reading frame (ORF), and the nucleic acid sequence encoding the LC of the antibody or antigen-binding fragment thereof comprises a second ORF, wherein the first ORF and the second ORF are under the control of a bicistronic promoter.

[0152] For example, it is well within the capabilities of one of ordinary skill in the art to take a known and / or publicly available protein sequence of an antibody disclosed herein (e.g., HC, LC, HV, LV) and reverse engineer a cDNA sequence to encode such a protein. The cDNA can then be codon-optimized to be compatible with the intended host cell and inserted into a ceDNA vector as described herein.

[0153] III. General ceDNA Vectors for Use in Antibody and Fusion Protein Production Embodiments of the present disclosure are based on methods and compositions comprising closed-ended linear double-stranded (ceDNA) vectors capable of expressing antibodies or antigen-binding fragments thereof. As described herein, targets (i.e., antigens) of the antibodies or antigen-binding fragments described herein can be selected from a variety of pathogens, including, for example, bacterial, viral, fungal, and parasitic infectious agents. Suitable targets can further include cancer or cancer-associated antigens, etc. Still other targets can include autoimmune conditions, such as rheumatoid arthritis (RA) or multiple sclerosis (MS).

[0154] In some embodiments, the transgene is a nucleic acid sequence encoding the HC and LC of an antibody or antigen-binding portion thereof. In some embodiments, the transgene is a nucleic acid sequence encoding the HC of an antibody or antigen-binding portion thereof. In some embodiments, the transgene is a nucleic acid sequence encoding the LC of an antibody or antigen-binding portion thereof. The ceDNA vector is preferably double-stranded, e.g., self-complementary, over at least a portion of the molecule, such as an expression cassette (e.g., the ceDNA is not a double-stranded circular molecule). The ceDNA vector has covalently closed ends and is therefore resistant to exonuclease digestion (e.g., exonuclease I or exonuclease III), for example, at 37°C for 1 hour or more.

[0155] Generally, ceDNA vectors for expression of the antibodies or antigen-binding fragments thereof disclosed herein comprise, in the 5' to 3' direction, a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleic acid sequence of interest (e.g., an expression cassette described herein), and a second AAV ITR. The ITR sequences are selected from either: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (e.g., an asymmetric modified ITR), (ii) two modified ITRs (e.g., an asymmetric modified ITR) in which the mod-ITR pair have different three-dimensional spatial configurations relative to each other, or (iii) a symmetric or substantially symmetric WT-WT ITR pair in which each WT-ITR has the same three-dimensional spatial configuration, or (iv) a symmetric or substantially symmetric modified ITR pair in which each mod-ITR has the same three-dimensional spatial configuration.

[0156] Methods and compositions including ceDNA vectors for producing antibodies or antigen-binding fragments thereof are encompassed herein and may further include delivery systems, such as, but not limited to, liposomal nanoparticle delivery systems. Non-limiting exemplary liposomal nanoparticle systems encompassed for use are disclosed herein. According to some embodiments, the present disclosure provides lipid nanoparticles comprising ceDNA and ionized lipids. For example, lipid nanoparticle formulations made and loaded with ceDNA obtained by the process are disclosed in International Application No. US2018 / 050042, filed September 7, 2018, and incorporated herein.

[0157] The ceDNA vector as disclosed herein does not have the packaging constraints imposed by the limited space in the viral capsid.In contrast to the enclosed AAV genome, the ceDNA vector represents a versatile eukaryotic alternative to the prokaryotically produced plasmid DNA vector.This allows the insertion of control elements, such as the regulatory switches disclosed herein, large transgenes, multiple transgenes, etc.

[0158] 1A-1E show schematic diagrams of non-limiting exemplary ceDNA vectors for expressing antibodies and antigen-binding fragments thereof, or the sequences of corresponding ceDNA plasmids. The ceDNA vectors for expressing antibodies and antigen-binding fragments thereof do not contain capsids and can be derived from plasmids encoding, in that order, a first ITR, an expression cassette containing a transgene, and a second ITR. The expression cassette can include one or more regulatory sequences that enable and / or control expression of the transgene; for example, the expression cassette can include, in that order, one or more of an enhancer / promoter, an ORF reporter (transgene), a post-transcriptional regulatory element (e.g., WPRE), and a polyadenylation and termination signal (e.g., BGH polyA).

[0159] The expression cassette may also contain an internal ribosome entry site (IRES) and / or a 2A element. Cis-regulatory elements include, but are not limited to, promoters, riboswitches, insulators, mir regulatory elements, post-transcriptional regulatory elements, tissue- and cell-type-specific promoters, and enhancers. According to some embodiments, the ITRs may act as promoters for the transgene. According to some embodiments, the ceDNA vector may contain additional components for regulating the expression of the transgene, such as a regulatory switch for controlling and regulating the expression of antibodies and antigen-binding fragments thereof, and, if desired, a regulatory switch that is a kill switch that enables controlled cell death of cells containing the ceDNA vector.

[0160] An expression cassette may comprise more than 4000 nucleotides, 5000 nucleotides, 10,000 nucleotides, 20,000 nucleotides, 30,000 nucleotides, 40,000 nucleotides, or 50,000 nucleotides, or any range of about 4000-10,000 nucleotides, 10,000-50,000 nucleotides, or more than 50,000 nucleotides. According to some embodiments, an expression cassette may comprise a transgene in the range of 500-50,000 nucleotides in length. According to some embodiments, an expression cassette may comprise a transgene in the range of 500-75,000 nucleotides in length. According to some embodiments, an expression cassette may comprise a transgene that is in the range of 500-10,000 nucleotides in length. According to some embodiments, an expression cassette may comprise a transgene that is in the range of 1000-10,000 nucleotides in length. According to some embodiments, the expression cassette can contain a transgene ranging from 500 to 5,000 nucleotides in length. ceDNA vectors do not have the size limitations of encapsidated AAV vectors, thus allowing delivery of large expression cassettes to result in efficient transgene expression. According to some embodiments, the ceDNA vector lacks prokaryote-specific methylation.

[0161] The sequences provided in the expression cassettes, ceDNA vector expression constructs for expression of the antibodies and antigen-binding fragments thereof described herein, can be codon-optimized for the target host cell. As used herein, the term "optimized codons" or "codon optimization" refers to the process of modifying a nucleic acid sequence by replacing at least one, two or more, or a substantial number of codons in the native sequence (e.g., a prokaryotic sequence) with codons more frequently or most frequently used in the genes of a target vertebrate, such as a mouse or human, for enhanced expression in the cells of that vertebrate. Various species exhibit specific biases for certain codons for specific amino acids. Typically, codon optimization does not alter the amino acid sequence of the original translated protein. Optimized codons can be determined, for example, using Aptagen's GENE FORGE® codon optimization and custom gene synthesis platform (Aptagen, Inc., 2190 Fox Mill Rd. Suite 300, Herndon, Va. 20171) or another public database. According to some embodiments, the nucleic acid is optimized for human expression.

[0162] The transgenes expressed by the ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein encode the antibodies and antigen-binding fragments thereof. There are many structural features of ceDNA vectors that distinguish them from plasmid-based expression vectors. ceDNA vectors may have one or more of the following characteristics: lack of original (i.e., uninserted) bacterial DNA, lack of a prokaryotic replication origin, be self-contained (i.e., do not require any sequences other than the two ITRs containing the Rep binding and terminal separation sites (RBS and TRS), or any exogenous sequences between the ITRs), have ITR sequences that form hairpins, and have no bacterial-type DNA methylation, or indeed any other methylation that would be considered abnormal by a mammalian host. Generally, it is preferred that the vectors do not contain any prokaryotic DNA, although it is contemplated that some prokaryotic DNA may be inserted as exogenous sequences, such as, but not limited to, promoter or enhancer regions. Another important feature that distinguishes ceDNA vectors from plasmid expression vectors is that ceDNA vectors are single-stranded linear DNA with closed ends, whereas plasmids are always double-stranded DNA.

[0163] The ceDNA vectors for expression of antibodies and antigen-binding fragments thereof produced by the methods provided herein preferably have a linear, continuous, rather than discontinuous, structure as determined by restriction enzyme digestion assays ( FIG. 4D ). A linear, continuous structure is believed to be more stable against attack by cellular endonucleases and less likely to undergo recombination, leading to mutagenesis. Therefore, a ceDNA vector with a linear, continuous structure is a preferred embodiment. Continuous, linear, single-stranded, intramolecularly duplexed ceDNA vectors may lack sequences encoding AAV capsid proteins, with the termini covalently linked. These ceDNA vectors are structurally distinct from plasmids (including the ceDNA plasmids described herein), which are circular, double-stranded nucleic acid molecules of bacterial origin. While the complementary strands of a plasmid can be separated following denaturation to produce two nucleic acid molecules, a ceDNA vector, although having complementary strands, is a single DNA molecule and therefore remains a single molecule even when denatured. According to some embodiments, the ceDNA vectors described herein, unlike plasmids, can be produced without prokaryotic cell-type DNA base methylation. Thus, ceDNA vectors and ceDNA-plasmids differ both in terms of their structure (specifically, linear vs. circular) and the methods used to produce and purify these different entities (see below), as well as in terms of their DNA methylation, which is of prokaryotic cell type in the case of ceDNA-plasmids and eukaryotic cell type in the case of ceDNA-vectors.

[0164] The use of ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein has several advantages over plasmid-based expression vectors, including, but not limited to, the following: 1) plasmids contain bacterial DNA sequences and are subject to prokaryotic cell-specific methylation (e.g., methylation of 6-methyladenosine and 5-methylcytosine), whereas capsid-free AAV vector sequences are of eukaryotic origin and are not subject to prokaryotic cell-specific methylation. As a result, capsid-free AAV vectors are less likely to induce inflammatory and immune responses compared to plasmids; 2) plasmids require the presence of resistance genes during the production process, whereas ceDNA vectors do not; and 3) circular plasmids are not delivered to the nucleus upon introduction into cells and require overloading to avoid degradation by cellular nucleases, whereas ceDNA vectors contain viral cis-elements (i.e., ITRs), which can be designed to confer resistance to nucleases and target and deliver to the nucleus. The minimal defined elements essential for ITR function are the Rep binding site (RBS; for AAV2, 5'-GCGCGCTCGCTCGCTC-3'' (SEQ ID NO: __)) and the terminal separation site (TRS; 5'-AGTTGG-3' (for AAV2) plus a variable palindromic sequence allowing hairpin formation; and 4). ceDNA vectors do not have the over-representation of CpG dinucleotides often found in prokaryotic-derived plasmids, which have been reported to bind members of the Toll-like family of receptors and induce T cell-mediated immune responses. In contrast, transduction with the capsid-free AAV vectors disclosed herein can use a variety of delivery reagents and efficiently target cells and tissue types that are difficult to transduce with conventional AAV virions.

[0165] A. Inverted terminal repeat (ITR) As disclosed herein, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof contain a transgene or nucleic acid sequence positioned between two inverted terminal repeat (ITR) sequences, which may be an asymmetric ITR pair or a symmetric or substantially symmetric ITR pair, as these terms are defined herein. The ceDNA vectors disclosed herein may include ITR sequences selected from: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (e.g., an asymmetric modified ITR), (ii) two modified ITRs (e.g., an asymmetric modified ITR) in which the mod-ITR pair have different three-dimensional spatial configurations relative to each other, or (iii) a symmetric or substantially symmetric WT-WT ITR pair in which each WT-ITR has the same three-dimensional spatial configuration, or (iv) a symmetric or substantially symmetric modified ITR pair in which each mod-ITR has the same three-dimensional spatial configuration. The methods of the present disclosure may further include a delivery system, such as, but not limited to, a liposomal nanoparticle delivery system.

[0166] According to some embodiments, the ITR sequences may be derived from viruses of the Parvoviridae family, which includes two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect insects. Parvovirinae (also called parvoviruses) includes the Dependovirus genus, whose members, under most conditions, require co-infection with a helper virus, such as an adenovirus or a herpesvirus, for productive infection. The Dependovirus family includes adeno-associated viruses (AAVs), which typically infect humans (e.g., serotypes 2, 3A, 3B, 5, and 6) or primates (e.g., serotypes 1 and 4), as well as related viruses that infect other warm-blooded animals (e.g., bovine, canine, equine, and ovine adeno-associated viruses). Parvoviruses and other members of the family Parvoviridae are generally described in Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication," Chapter 69 in FIELDS VIROLOGY (3d Ed. 1996).

[0167] ITRs are exemplified herein, and the example herein is the AAV2 WT-ITR, however, one of skill in the art will recognize that ITRs from any known parvovirus, e.g., dependovirus, such as AAV (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genomes, see e.g., NCBI: NC002077, NC001401, NC001729, NC001829, NC006152, NC006260, NC006261), chimeric ITRs, or ITRs from any synthetic AAV, as described above, can be used. According to some embodiments, the AAV can infect warm-blooded animals, such as avian (AAAV), bovine (BAAV), canine, equine, and ovine adeno-associated viruses. According to some embodiments, the ITRs are derived from B19 parvovirus (GenBank accession number NC000883), Minute Virus from Mouse (MVM) (GenBank accession number NC001510), goose parvovirus (GenBank accession number NC_001701), or snake parvovirus 1 (GenBank accession number NC006148). According to some embodiments, the 5'WT-ITR can be derived from one serotype and the 3'WT-ITR can be derived from a different serotype, as discussed herein.

[0168] Those skilled in the art know that ITR sequences have the general structure of a double-stranded Holliday junction, typically a T- or Y-shaped hairpin structure (see, e.g., Figures 2A and 3A), and each WT-ITR is formed by two palindromic arms or loops (B-B' and C-C') embedded in a larger palindromic arm (A-A'), and a single-stranded D sequence (the order of these palindromic sequences defines the flip- or flop-orientation of the ITR). See, for example, the structural analysis and sequence comparison of ITRs from different AAV serotypes (AAV1 to AAV6) described in Grimm et al., J. Virology, 2006;80(1);426-439; Yan et al., J. Virology, 2005;364-379; Duan et al., Virology 1999;261;8-14. Based on the exemplary AAV2 ITR sequences provided herein, one skilled in the art can readily determine the WT-ITR sequence from any AAV serotype for use in a ceDNA vector or ceDNA-plasmid. See, for example, the sequence comparison of ITRs from different AAV serotypes (AAV1 through AAV6, as well as avian AAV (AAAV) and bovine AAV (BAAV)) in Grimm et al., J. Virology, 2006;80(1);426-439, showing the percent identity of the AAV2 left ITR to the left ITRs from other serotypes: AAV-1 (84%), AAV-3 (86%), AAV-4 (79%), AAV-5 (58%), AAV-6 (left ITR) (100%), and AAV-6 (right ITR) (82%).

[0169] (i) Symmetric ITR pair In some embodiments, a ceDNA vector for expression of an antibody or antigen-binding fragment thereof described herein comprises, in the 5' to 3' direction, a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleic acid sequence of interest (e.g., an expression cassette described herein), and a second AAV ITR, wherein the first ITR (5'ITR) and the second ITR (3'ITR) are symmetrical or substantially symmetrical with respect to each other; i.e., the ceDNA vector may comprise ITR sequences with a symmetrical three-dimensional spatial organization, such that their structures are the same shape in geometric space or have the same A, C-C', and B-B' loops in three-dimensional space. In such embodiments, the symmetrical or substantially symmetrical ITR pair may be a modified ITR (e.g., a mod-ITR) that is not a wild-type ITR. A mod-ITR pair may have one or more modifications from the wild-type ITR and have the same sequence that is the reverse complement (inverted) of each other. In alternative embodiments, the modified ITR pair is substantially symmetrical as defined herein, i.e., the modified ITR pair may have different sequences but may have corresponding or identical symmetrical three-dimensional shapes.

[0170] (a) Wild-type ITR According to some embodiments, the symmetric or substantially symmetric ITRs are wild-type (WT-ITR) as described herein. That is, both ITRs have wild-type sequences, but are not necessarily WT-ITRs of the same AAV serotype. That is, according to some embodiments, one WT-ITR can be derived from one AAV serotype and the other WT-ITR can be derived from a different AAV serotype. In such embodiments, the WT-ITR pair is substantially symmetric as defined herein, that is, they can have one or more conservative nucleotide modifications while maintaining a symmetric three-dimensional spatial configuration.

[0171] Thus, as disclosed herein, a ceDNA vector contains a transgene or nucleic acid sequence positioned between two adjacent wild-type inverted terminal repeat (WT-ITR) sequences, which are reverse-complementary (inverted) to each other, or alternatively, are substantially symmetrical to each other. That is, the WT-ITR pair has a symmetrical three-dimensional spatial configuration. According to some embodiments, the wild-type ITR sequence (e.g., AAV WT-ITR) comprises a functional Rep binding site (RBS; e.g., for AAV2, 5'-GCGCGCTCGCTCGCTC-3', SEQ ID NO: __) and a functional terminal separation site (TRS; e.g., 5'-AGTT-3').

[0172] According to certain aspects, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof can be obtained from a vector polynucleotide encoding a nucleic acid operably positioned between two WT inverted terminal repeat sequences (WT-ITRs) (e.g., AAV WT-ITRs). That is, both ITRs have wild-type sequences, but are not necessarily WT-ITRs of the same AAV serotype. That is, according to some embodiments, one WT-ITR can be derived from one AAV serotype and the other WT-ITR can be derived from a different AAV serotype. In such embodiments, the WT-ITR pair is substantially symmetrical as defined herein, i.e., they can have one or more conservative nucleotide modifications while maintaining a symmetrical three-dimensional spatial configuration. According to some embodiments, the 5'WT-ITR is derived from one AAV serotype and the 3'WT-ITR is derived from the same or a different AAV serotype. According to some embodiments, the 5'WT-ITR and 3'WT-ITR are mirror images of each other, i.e., they are symmetrical. According to some embodiments, the 5'WT-ITR and the 3'WT-ITR are derived from the same AAV serotype.

[0173] WT ITRs are well known. According to certain embodiments, the two ITRs are derived from the same AAV2 serotype. In certain embodiments, WT ITRs from other serotypes can be used. There are several homologous serotypes, for example, AAV2, AAV4, AAV6, and AAV8. According to some embodiments, closely homologous ITRs (e.g., ITRs with similar loop structures) can be used. In other embodiments, more diverse AAV WT ITRs, such as AAV2 and AAV5, can be used, and in yet other embodiments, substantially WT ITRs can be used, i.e., they have the basic loop structure of the WT but have some conservative nucleotide changes that do not alter or affect the properties. When WT-ITRs from the same viral serotype are used, one or more regulatory sequences can also be used. According to certain embodiments, the regulatory sequence is a regulatory switch that allows for adjustment of the activity of the ceDNA, for example, the expression of the encoded antibody and its antigen-binding fragment.

[0174] In some embodiments, one aspect of the technology described herein relates to a ceDNA vector for expression of antibodies and antigen-binding fragments thereof, the ceDNA vector comprising at least one nucleic acid sequence encoding, for example, an HC and / or LC, operably positioned between two wild-type inverted terminal repeats (WT-ITRs), which may be from the same serotype, different serotypes, or may be substantially symmetrical with respect to each other (i.e., have a symmetrical three-dimensional spatial organization such that their structures are the same shape in geometric space, or have the same A, C-C', and B-B' loops in three-dimensional space). According to some embodiments, the symmetric WT-ITRs comprise functional terminal separation sites and Rep binding sites. According to some embodiments, the nucleic acid sequence encodes a transgene, and the vector is not in a viral capsid.

[0175] In some embodiments, the WT-ITRs are identical but are reverse complements of each other. For example, the sequence AACG in the 5' ITR can be CGTT (i.e., the reverse complement) of the corresponding sequence in the 3' ITR. In some examples, the 5' WT-ITR sense strand comprises the sequence ATCGATCG, and the corresponding 3' WT-ITR sense strand comprises CGATCGAT (i.e., the reverse complement of ATCGATCG). In some embodiments, the WT-ITR ceDNA further comprises a terminal separation site and a replication protein binding site (RPS) (also referred to as a replicative protein binding site), e.g., a Rep binding site.

[0176] Exemplary WT-ITR sequences for use in ceDNA vectors for expression of antibodies and antigen-binding fragments thereof, including WT-ITRs, are shown in Table 2 herein, which shows pairs of WT-ITRs (5'WT-ITR and 3'WT-ITR).

[0177] As an illustrative example, the present disclosure provides a ceDNA vector for expression of antibodies and antigen-binding fragments thereof, comprising a promoter, with or without a regulatory switch, operably linked to a transgene (e.g., a nucleic acid sequence), wherein the ceDNA lacks capsid protein and is (a) produced from a ceDNA-plasmid (see, e.g., Figures 1F-1G) encoding WT-ITRs, each WT-ITR having the same number of intramolecularly duplexed base pairs in its hairpin secondary configuration (preferably excluding any AAA or TTT terminal loop deletions in this configuration compared to these reference sequences), and (b) identified as ceDNA using the assay for identifying ceDNA by agarose gel electrophoresis under native and denaturing conditions of Example 1.

[0178] According to some embodiments, adjacent WT-ITRs are substantially symmetrical to one another. In this embodiment, the 5' WT-ITR can be derived from one serotype of AAV and the 3' WT-ITR can be derived from a different serotype of AAV, such that the WT-ITRs are not identical reverse complements. For example, the 5' WT-ITR can be derived from AAV2 and the 3' WT-ITR can be derived from a different serotype (e.g., AAV1, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12). In some embodiments, the WT ITRs may be selected from two different parvoviruses selected from any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, snake parvovirus (e.g., royal python parvovirus), bovine parvovirus, caprine parvovirus, avian parvovirus, canine parvovirus, equine parvovirus, shrimp parvovirus, porcine parvovirus, or insect AAV. According to some embodiments, such a combination of WT ITRs is a combination of WT ITRs from AAV2 and AAV6. According to some embodiments, substantially symmetric WT ITRs, when inverted relative to the other ITR, are at least 90% identical, at least 95% identical, at least 96%...97%...98%...99%...99.5%, and all points in between, and have the same symmetric three-dimensional spatial configuration. According to some embodiments, WT-ITR pairs are substantially symmetric because they have symmetric three-dimensional spatial configurations (e.g., have the same three-dimensional configuration of the A, C-C', B-B', and D arms). According to certain embodiments, a substantially symmetric WT-ITR pair is inverted relative to the other and is at least 95% identical, at least 96%...97%...98%...99%...99.5%, and all points in between, to each other, and one WT-ITR retains a Rep binding site (RBS) and terminal separation region (trs) of 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60).In some embodiments, a substantially symmetric WT-ITR pair is inverted relative to each other and is at least 95% identical, at least 96%...97%...98%...99%...99.5%, and all points in between, where one WT-ITR retains a Rep binding site (RBS) and terminal separation region (trs) of 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO:__), in addition to a variable palindromic sequence that allows for hairpin secondary structure formation. Homology can be determined by standard means known in the art, such as BLAST (Basic Local Alignment Search Tool), BLASTN, with default settings.

[0179] In some embodiments, the structural element of an ITR can be any structural element involved in the functional interaction of an ITR with a large Rep protein (e.g., Rep78 or Rep68). In certain embodiments, the structural element provides selectivity for the interaction of an ITR with a large Rep protein, i.e., determines, at least in part, which Rep protein functionally interacts with the ITR. In other embodiments, the structural element physically interacts with a large Rep protein when the Rep protein is bound to the ITR. Each structural element can be, for example, the secondary structure of the ITR, the nucleic acid sequence of the ITR, the space between two or more elements, or any combination of the above. In one embodiment, the structural element is selected from the group consisting of A and A' arms, B and B' arms, C and C' arms, D arm, Rep binding site (RBE) and RBE' (i.e., complementary RBE sequences), and terminal separation site (trs).

[0180] By way of example only, Table 2 shows exemplary WT-ITR combinations.

[0181] Table 2: Exemplary combinations of WT-ITRs from the same or different serotypes, or different parvoviruses. The order shown does not indicate the ITR position, for example, "AAV1, AAV2" specifies that the ceDNA can contain a WT-AAV1 ITR at the 5' position and a WT-AAV2 ITR at the 3' position, or vice versa, a WT-AAV2 ITR at the 5' position and a WT-AAV1 ITR at the 3' position. Abbreviations: AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), or AAV serotype 12 (AAV12), AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genomes (e.g., NCBI: NC002077, NC001401, NC001729, NC001829, NC006152, NC006260, NC006261). 006261), ITRs from warm-blooded animals (avian AAV (AAAV), bovine AAV (BAAV), canine, equine, and ovine AAV), ITRs from B19 parvovirus (GenBank accession number NC000883), minute virus of mice (MVM) (GenBank accession number NC001510), goose: goose parvovirus (GenBank accession number NC001701), snake: snake parvovirus 1 (GenBank accession number NC006148).

[0182] [Table 2-1]

[0183] [Table 2-2]

[0184] [Table 2-3]

[0185] By way of example only, Table 3 shows the sequences of exemplary WT-ITRs from several different AAV serotypes.

[0186] [Table 3]

[0187] According to some embodiments, the nucleic acid sequence of the WT-ITR sequence may be modified (e.g., by modifying 1, 2, 3, 4, 5 or more nucleotides, or any range therein), whereby the modification is a substitution of a complementary nucleotide, e.g., G for C and vice versa, T for A and vice versa.

[0188] In certain embodiments of the present disclosure, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof do not have a WT-ITR consisting of a nucleic acid sequence selected from any of SEQ ID NOs: 1, 2, 5-14. In alternative embodiments of the present disclosure, when a ceDNA vector has a WT-ITR comprising a nucleic acid sequence selected from any of SEQ ID NOs: 1, 2, 5-14, the adjacent ITR is also WT, and the ceDNA vector comprises a regulatory switch, e.g., as disclosed herein and in International Application No. US 18 / 49996 (see, e.g., Table 11 of International Application No. US 18 / 49996, which is incorporated herein by reference in its entirety). According to some embodiments, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof comprise a regulatory switch as disclosed herein and the selected WT-ITR having a nucleic acid sequence selected from any of the group consisting of SEQ ID NOs: 1, 2, 5-14.

[0189] The ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein may comprise a WT-ITR structure that retains operable RBE, trs, and RBE' portions. Figures 2A and 2B, using wild-type ITRs for illustrative purposes, show one possible mechanism for the operation of the trs portion within the wild-type ITR portion of a ceDNA vector. According to some embodiments, the ceDNA vectors for expression of antibodies and antigen-binding fragments thereof contain one or more functional WT-ITR polynucleotide sequences, including a Rep binding site (RBS; 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO:__) for AAV2) and a terminal separation site (TRS; 5'-AGTT). According to some embodiments, at least one WT-ITR is functional. In alternative embodiments, where the ceDNA vectors for expression of antibodies and antigen-binding fragments thereof comprise two WT-ITRs that are substantially symmetrical to each other, at least one WT-ITR is functional and at least one WT-ITR is non-functional.

[0190] B. Common modified ITRs (mod-ITRs) of ceDNA vectors containing asymmetric or symmetric ITR pairs As discussed herein, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof can contain a symmetric ITR pair or an asymmetric ITR pair. In either case, one or both ITRs can be modified ITRs, the difference being that in the first case (i.e., symmetric mod-ITR), the mod-ITRs have the same three-dimensional spatial organization (i.e., have the same A-A', C-C', and B-B' arm organization), while in the second case (i.e., asymmetric mod-ITR), the mod-ITRs have a different three-dimensional spatial organization (i.e., have a different A-A', C-C', and B-B' arm organization).

[0191] According to some embodiments, a modified ITR is an ITR that is modified by deletion, insertion, and / or substitution compared to a wild-type ITR sequence (e.g., an AAV ITR). According to some embodiments, at least one of the ITRs in the ceDNA vector comprises a functional Rep binding site (RBS; e.g., for AAV2, 5'-GCGCGCTCGCTCGCTC-3') and a functional terminal separation site (TRS; e.g., 5'-AGTT-3'). According to some embodiments, at least one of the ITRs is a non-functional ITR. According to some embodiments, each of the different or modified ITRs is not a wild-type ITR from a different serotype.

[0192] While specific alterations and mutations of ITRs are described in detail herein, in the context of ITRs, "altered" or "mutated" or "modified" refers to nucleotides that have been inserted, deleted, and / or substituted relative to the wild-type, reference, or original ITR sequence. An altered or mutant ITR may be an engineered ITR. As used herein, "engineered" refers to aspects that have been manipulated by the hand of man. For example, a polypeptide is considered "engineered" when at least one aspect of the polypeptide, e.g., its sequence, has been manipulated by the hand of man and is different from the aspect in which it occurs in nature.

[0193] According to some embodiments, mod-ITRs can be synthetic. According to some embodiments, synthetic ITRs are based on ITR sequences from two or more AAV serotypes. In other embodiments, synthetic ITRs do not contain AAV base sequences. In yet other embodiments, synthetic ITRs preserve the ITR structure described above but have little or no AAV-origin sequences. According to some aspects, synthetic ITRs can preferentially interact with wild-type Rep or Rep of a particular serotype, or in some cases, are not recognized by wild-type Rep but are recognized only by mutant Rep.

[0194] Those skilled in the art can determine corresponding sequences in other serotypes by known means. For example, determine whether there are changes in the A, A', B, B', C, C', or D regions and determine the corresponding region in another serotype. BLAST® (Basic Local Alignment Search Tool) or other homology alignment programs can be used in their default settings to determine corresponding sequences. The present disclosure further provides populations and multiple ceDNA vectors containing mod-ITRs from combinations of different AAV serotypes. That is, one mod-ITR can be derived from one AAV serotype and the other mod-ITR can be derived from a different serotype. Without being bound by theory, according to some embodiments, one ITR may be derived from or based on an AAV2 ITR sequence, and the other ITR of the ceDNA vector may be derived from or based on any one or more ITR sequences of AAV serotype 1 (AAV1), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), or AAV serotype 12 (AAV12).

[0195] Any parvovirus ITR can be used for modification as an ITR or as a basic ITR. Preferably, the parvovirus is a dependovirus. More preferably, it is AAV. The serotype selected can be based on the tissue tropism of the serotype. AAV2 has broad tissue tropism, AAV1 preferentially targets neurons and skeletal muscle, and AAV5 targets neurons, retinal pigment epithelium, and photoreceptors. AAV6 preferentially targets skeletal muscle and lung. AAV8 preferentially targets liver, skeletal muscle, heart, and pancreatic tissue. AAV9 preferentially targets liver, skeletal, and lung tissue. According to some embodiments, the modified ITR is based on the AAV2 ITR.

[0196] More specifically, the ability of a structural element to functionally interact with a particular large Rep protein can be altered by modifying the structural element. For example, the nucleic acid sequence of a structural element can be modified compared to the wild-type sequence of the ITR. According to some embodiments, structural elements of the ITR (e.g., the A arm, A' arm, B arm, B' arm, C arm, C' arm, D arm, RBE, RBE', and trs) can be removed and replaced with wild-type structural elements from a different parvovirus. For example, the replacement structure can be from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, snake parvovirus (e.g., royal python parvovirus), bovine parvovirus, caprine parvovirus, avian parvovirus, canine parvovirus, equine parvovirus, shrimp parvovirus, porcine parvovirus, or insect AAV. For example, the ITRs can be AAV2 ITRs, with the A or A' arms or RBE replaced with structural elements from AAV5. In another embodiment, the ITRs can be AAV5 ITRs, with the C or C' arms, RBE, and trs replaced with structural elements from AAV2. In another embodiment, the AAV ITRs can be AAV5 ITRs, with the B and B' arms replaced with the AAV2 ITR B and B' arms.

[0197] By way of example only, Table 4 shows exemplary modifications (e.g., deletions, insertions, and / or substitutions) of at least one nucleotide in a region of a modified ITR, where X indicates the modification (e.g., deletion, insertion, and / or substitution) of at least one nucleic acid in that section relative to the corresponding wild-type ITR. In some embodiments, any modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in any of the C and / or C' and / or B and / or B' regions retains three consecutive T nucleotides (i.e., TTT) in at least one terminal loop. For example, if the modification results in either a single-arm ITR (e.g., a single C-C' arm or a single B-B' arm), or a two-arm ITR with a modified C-B' arm or C'-B arm, or at least one truncated arm (e.g., a truncated C-C' arm and / or a truncated B-B' arm), at least the single arm, or at least one of the arms of the two-arm ITR (one arm may be truncated), retains three consecutive T nucleotides (i.e., TTT) in at least one terminal loop. According to some embodiments, the truncated C-C' arm and / or the truncated B-B' arm has three consecutive T nucleotides (i.e., TTT) in the terminal loop.

[0198] Table 4: Exemplary combinations of modifications (e.g., deletions, insertions, and / or substitutions) of at least one nucleotide for different B-B' and C-C' regions or arms of an ITR (X indicates a nucleotide modification, e.g., addition, deletion, or substitution of at least one nucleotide in the region).

[0199] [Table 4]

[0200] In some embodiments, mod-ITRs for use in ceDNA vectors for expression of antibodies and antigen-binding fragments thereof comprise an asymmetric ITR pair or a symmetric mod-ITR pair disclosed herein and may include any one of the modification combinations shown in Table 4, as well as a modification of at least one nucleotide in any one or more of the regions selected from A' and C, C and C', C' and B, B and B', and B' and A. According to some embodiments, any modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in the C or C' or B or B' region still preserves the terminal loop of the stem-loop. According to some embodiments, any modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide between C and C' and / or B and B' retains three consecutive T nucleotides (i.e., TTT) in at least one terminal loop. In alternative embodiments, any modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide between C and C' and / or between B and B' preserves three consecutive A nucleotides (i.e., AAA) in at least one terminal loop. According to some embodiments, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, as well as a modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in any one or more of the regions selected from A', A, and / or D. For example, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, as well as at least one modification (e.g., deletion, insertion, and / or substitution) in the A region. According to some embodiments, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, as well as a modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in the A' region.According to some embodiments, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, as well as a modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in the A and / or A' region. According to some embodiments, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, as well as a modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in the D region.

[0201] According to some embodiments, the nucleotide sequence of a structural element can be modified (e.g., by modifying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides, or any range therein) to produce a modified structural element. According to some embodiments, particular modifications to the ITRs are exemplified herein (e.g., SEQ ID NOS: 3, 4, 15-47, 101-116, or 165-187) or shown in Figures 7A-7B of International Application No. US2018 / 064242, filed December 6, 2018 (e.g., SEQ ID NOS: 97-98, 101-103, 105-108, 111-112, 117-134, 545-54 of International Application No. US2018 / 064242). According to some embodiments, the ITRs may be modified (e.g., by modifying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides, or any range therein). In other embodiments, the ITRs can have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to one of the modified ITRs of SEQ ID NOs: 3, 4, 15-47, 101-116, or 165-187, or to the RBE-containing sections of the A-A' arm and the C-C' and B-B' arms set forth in SEQ ID NOs: 3, 4, 15-47, 101-116, or 165-187, or Tables 2-9 of International Application No. US 18 / 49996 (i.e., SEQ ID NOs: 110-112, 115-190, 200-468), which are incorporated by reference herein in their entirety.

[0202] According to some embodiments, modified ITRs can include, for example, removal or deletion of all of a particular arm, e.g., all or part of the A-A' arm, or all or part of the B-B' arm, or all or part of the C-C' arm, or alternatively, removal of 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs forming the stem of a loop, so long as there is still a final loop capping the stem (e.g., a single arm) (see, e.g., ITR-21 in Figure 7A of International Application No. US2018 / 064242, filed December 6, 2018). According to some embodiments, modified ITRs can include removal of 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the B-B' arm. According to some embodiments, the modified ITRs can include the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the C-C' arm (see, e.g., ITR-1 in Figure 3B or ITR-45 in Figure 7A of International Application No. US2018 / 064242, filed December 6, 2018). According to some embodiments, the modified ITRs can include the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the C-C' arm and 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the B-B' arm. Any combination of base pair removals is contemplated; for example, six base pairs in the C-C' arm and two base pairs in the B-B' arm can be removed. As an illustrative example, Figure 3B shows an exemplary modified ITR having at least seven base pairs deleted from each of the C and C' portions, a substitution of a nucleotide in the loop between the C and C' regions, and a deletion of at least one base pair from each of the B and B' regions, such that the modified ITR comprises two arms in which at least one arm (e.g., C-C') is truncated. According to some embodiments, the modified ITR also comprises a deletion of at least one base pair from each of the B and B' regions, such that the B-B' arm is also truncated relative to the WT ITR.

[0203] According to some embodiments, the modified ITRs may have a 1-50 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotide deletion relative to the full-length wild-type ITR sequence. According to some embodiments, the modified ITRs may have a 1-30 nucleotide deletion relative to the full-length WT ITR sequence. According to some embodiments, the modified ITRs have a 2-20 nucleotide deletion relative to the full-length wild-type ITR sequence.

[0204] According to some embodiments, the modified ITRs do not contain any nucleotide deletions in the RBE-containing portions of the A or A' regions so as not to interfere with DNA replication (e.g., binding to the RBE by Rep proteins or nicking at the terminal separation site). According to some embodiments, modified ITRs encompassed for use herein have one or more deletions in the B, B', C, and / or C regions described herein.

[0205] According to some embodiments, ceDNA vectors for expression of antibodies and antigen-binding fragments comprising symmetric or asymmetric ITR pairs comprise a regulatory switch as disclosed herein and at least one selected modified ITR having a nucleotide sequence selected from any of the group consisting of SEQ ID NOs: 3, 4, 15-47, 101-116, or 165-187.

[0206] In another embodiment, the structure of the structural element can be modified. For example, the structural element can have a change in stem height and / or the number of nucleotides in the loop. For example, the stem height can be about 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides or more, or any range therein. According to some embodiments, the stem height can be about 5 nucleotides to about 9 nucleotides and functionally interact with Rep. In another embodiment, the stem height can be about 7 nucleotides and functionally interact with Rep. In another example, the stem height can be about 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides or more, or any range therein.

[0207] In another embodiment, the number of GAGY binding sites or GAGY-related binding sites in an RBE or extended RBE can be increased or decreased. According to some examples, an RBE or extended RBE can contain 1, 2, 3, 4, 5, 6 or more GAGY binding sites, or any range therein. Each GAGY binding site can independently be the exact GAGY sequence or a sequence similar to GAGY, so long as the sequence is sufficient to bind to the Rep protein.

[0208] In another embodiment, the spacing between two elements (such as, but not limited to, an RBE and a hairpin) can be altered (e.g., increased or decreased) to alter functional interactions with a large Rep protein. For example, the spacing can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides or more, or any range therein.

[0209] The ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein may contain ITR structures that are modified with respect to the wild-type AAV2 ITR structure disclosed herein, while still retaining operable RBE, trs, and RBE' portions. Figures 2A and 2B show one possible mechanism for engineering the trs portion within the wild-type ITR portion of a ceDNA vector for expression of antibodies and antigen-binding fragments thereof. According to some embodiments, the ceDNA vectors for expression of antibodies and antigen-binding fragments thereof contain one or more functional ITR polynucleotide sequences, including a Rep binding site (RBS; for AAV2, 5'-GCGCGCTCGCTCGCTC-3') and a terminal separation site (TRS; 5'-AGTT). According to some embodiments, at least one ITR (wild-type or modified ITR) is functional. In an alternative embodiment in which the ceDNA vector for expression of antibodies and antigen-binding fragments thereof comprises two modified ITRs that are different or asymmetric from each other, at least one modified ITR is functional and at least one modified ITR is non-functional.

[0210] According to some embodiments, the modified ITRs (e.g., left or right ITRs) of the ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein have modifications in the loop arm, truncated arm, or spacer. Exemplary sequences of ITRs having modifications in the loop arm, truncated arm, or spacer are listed in Table 2 (i.e., SEQ ID NOS: 135-190, 200-233), Table 3 (e.g., SEQ ID NOS: 234-263), Table 4 (e.g., SEQ ID NOS: 264-293), Table 5 (e.g., SEQ ID NOS: 294-318 herein), Table 6 (e.g., SEQ ID NOS: 319-468), and Tables 7-9 (e.g., SEQ ID NOS: 101-110, 111-112, 115-134), or Table 10A or 10B (e.g., SEQ ID NOS: 9, 100, 469-483, 484-499) of International Application No. US 18 / 49996 (incorporated herein by reference in its entirety).

[0211] According to some embodiments, modified ITRs for use in ceDNA vectors for expression of antibodies and antigen-binding fragments thereof, including asymmetric ITR pairs or symmetric mod-ITR pairs, are selected from any one or combination of those set forth in Tables 2, 3, 4, 5, 6, 7, 8, 9, and 10A-10B of International Application No. US 18 / 49996, which is incorporated herein by reference in its entirety.

[0212] Additional exemplary modified ITRs for use in ceDNA vectors for expression of antibodies and antigen-binding fragments thereof comprising asymmetric or symmetric mod-ITR pairs in each of the above classes are shown in Tables 5A and 5B. The predicted secondary structures of the right-modified ITRs in Table 5A are shown in Figure 7A of International Application No. US2018 / 064242, filed December 6, 2018, and the predicted secondary structures of the left-modified ITRs in Table 5B are shown in Figure 7B of International Application No. US2018 / 064242, filed December 6, 2018, which are incorporated by reference herein in their entireties.

[0213] Tables 5A and 5B list the sequence numbers of exemplary right- and left-modified ITRs.

[0214] Table 5A: Exemplary modified right ITRs. These exemplary modified right ITRs can include an RBE GCGCGCTCGCTCGCTC-3' (spacer ACTGAGGC), a spacer complement GCCTCAGT, and an RBE' (i.e., the complement of the RBE) GAGCGAGCGAGCGCGC.

[0215] [Table 5A]

[0216] Table 5B: Exemplary modified left ITRs. These exemplary modified left ITRs can include an RBE GCGCGCTCGCTCGCTC-3', a spacer ACTGAGGC, a spacer complement GCCTCAGT, and an RBE complement (RBE') GAGCGAGCGAGCGCGCGC.

[0217] [Table 5B]

[0218] According to some embodiments, a ceDNA vector for expression of antibodies and antigen-binding fragments thereof comprises, in a 5' to 3' direction, a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleotide sequence of interest (e.g., an expression cassette described herein), and a second AAV ITR, wherein the first ITR (5'ITR) and the second ITR (3'ITR) are asymmetric with respect to each other, i.e., they have different three-dimensional spatial configurations. In exemplary embodiments, the first ITR can be a wild-type ITR and the second ITR can be a mutant or modified ITR, or vice versa, where the first ITR can be a mutant or modified ITR and the second ITR can be a wild-type ITR. According to some embodiments, the first ITR and the second ITR are both mod-ITRs, but have different sequences or have different modifications, and thus are not the same modified ITR but have different three-dimensional spatial configurations. In other words, a ceDNA vector with asymmetric ITRs contains ITRs in which any changes in one ITR relative to the WT-ITR are not reflected in the other ITRs, or alternatively, the asymmetric ITRs may have modified asymmetric ITR pairs that have different sequences and three-dimensional shapes relative to each other. Exemplary asymmetric ITRs for use in generating ceDNA-plasmids in ceDNA vectors for expression of antibodies and antigen-binding fragments thereof are shown in Table 5A and Figure 5B.

[0219] In alternative embodiments, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof contain two symmetric mod-ITRs. That is, both ITRs have the same sequence but are reverse complements of each other. According to some embodiments, a symmetric mod-ITR pair contains at least one or any combination of deletions, insertions, or substitutions compared to the wild-type ITR sequence from the same AAV serotype. The additions, deletions, or substitutions in the symmetric ITRs are the same but are reverse complements of each other. For example, an insertion of three nucleotides into the C region of the 5' ITR is reflected by an insertion of three reverse complementary nucleotides into the corresponding section of the C' region of the 3' ITR. For illustrative purposes only, if the addition is AACG in the 5' ITR, the addition is CGTT in the 3' ITR at the corresponding site. For example, if the 5' ITR sense strand is ATCGATCG, with an AACG addition between the G and A, the sequence ATCGAACGATCG is obtained. The corresponding 3' ITR sense strand is CGATCGAT (the reverse complement of ATCGATCG), with the addition of CGTT (ie, the reverse complement of AACG) between the T and C, resulting in the sequence CGATCGTTCGAT (the reverse complement of ATCGAACGATCG).

[0220] In alternative embodiments, the modified ITR pair is substantially symmetrical as defined herein, i.e., the modified ITR pair may have different sequences but may have corresponding or identical symmetrical three-dimensional shapes. For example, one modified ITR may be derived from one serotype, and the other modified ITR may be derived from a different serotype, but they have the same mutation (e.g., nucleotide insertion, deletion, or substitution) in the same region. In other words, for illustrative purposes only, the 5'-modified ITR may be derived from AAV2 and have a deletion in the C region, and the 3'-modified ITR may be derived from AAV5 and have a corresponding deletion in the C' region. Provided that the 5'-modified ITR and the 3'-modified ITR have the same or symmetrical three-dimensional spatial configuration, they are encompassed by their use herein as a modified ITR pair.

[0221] According to some embodiments, a substantially symmetric mod-ITR pair has the same A, C-C', and B-B' loops in three-dimensional space. For example, if the modified ITR of a substantially symmetric mod-ITR pair has a deletion of the C-C' arm, the cognate mod-ITR has a corresponding deletion of the C-C' loop and has a similar three-dimensional structure of the remaining A and B-B' loops that are the same shape in geometric space as the cognate mod-ITR. By way of example only, substantially symmetric ITRs can have a symmetric spatial organization such that their structures are the same shape in geometric space. This can occur, for example, when a GC pair is modified to, for example, a CG pair, or vice versa, or when an AT pair is modified to a TA pair, or vice versa. Thus, using the above illustrative examples of a modified 5' ITR as ATCGAACGATCG and a modified 3' ITR as CGATCGTTCGAT (i.e., the reverse complement of ATCGAACGATCG), these modified ITRs can be modified, for example, when the 5' ITR is ATCGAAC C It would still be symmetrical if it had the sequence ATCG (where the G in the addition is modified to C, and the substantially symmetric 3' ITR would have the sequence CGATCGTTCGAT, without the corresponding modification of a plus T). According to some embodiments, such modified ITR pairs are substantially symmetrical because the modified ITR pair has symmetric stereochemistry.

[0222] Table 6 shows exemplary symmetrically modified ITR pairs (i.e., left-modified ITRs and symmetrically right-modified ITRs) for use in ceDNA vectors for expression of antibodies and antigen-binding fragments thereof. The bold (red) portions of the sequences identify the partial ITR sequences (i.e., the sequences of the A-A', C-C', and B-B' loops), which are also shown in Figures 31A-46B. These exemplary modified ITRs can include an RBE GCGCGCTCGCTCGCTC-3', a spacer ACTGAGGC, a spacer complement, and an RBE' (i.e., a complement of the RBE) GAGCGAGCGAGCGCGC.

[0223] Table 6: Exemplary symmetric modified ITR pairs in ceDNA vectors for expression of antibodies and antigen-binding fragments thereof

[0224] [Table 6-1]

[0225] [Table 6-2]

[0226] [Table 6-3]

[0227] According to some embodiments, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof comprising asymmetric ITR pairs may comprise ITRs having modifications corresponding to any of the modifications in the ITR sequences or ITR subsequences set forth in any one or more of Tables 5A-5B herein, or shown in Figures 7A-7B of International Application No. US2018 / 064242, filed December 6, 2018 (incorporated herein in its entirety), or disclosed in Tables 2, 3, 4, 5, 6, 7, 8, 9, or 10A-10B of International Application No. US18 / 49996, filed September 7, 2018 (incorporated herein by reference in its entirety).

[0228] B. Exemplary ceDNA Vectors As described above, the present disclosure relates to recombinant ceDNA expression vectors and ceDNA vectors encoding antibodies and antigen-binding fragments thereof, comprising any one of the above-described asymmetric, symmetric, or substantially symmetric ITR pairs. In certain embodiments, the present disclosure relates to recombinant ceDNA vectors for expression of antibodies and antigen-binding fragments thereof having adjacent ITR sequences and a transgene, wherein the ITR sequences are asymmetric, symmetric, or substantially symmetric with respect to each other, as defined herein, and the ceDNA further comprises a nucleic acid sequence of interest (e.g., an expression cassette comprising the nucleic acid of the transgene) located between the adjacent ITRs, wherein the nucleic acid molecule lacks a viral capsid protein-encoding sequence.

[0229] The ceDNA expression vector for expression of antibodies and antigen-binding fragments thereof may be any ceDNA vector that can be conveniently subjected to recombinant DNA procedures, including the nucleic acid sequences described herein, provided that at least one ITR is modified. The ceDNA vector for expression of antibodies and antigen-binding fragments thereof of the present disclosure is compatible with the host cell into which the ceDNA vector is introduced. In certain embodiments, the ceDNA vector may be linear. In certain embodiments, the ceDNA vector may exist as an extrachromosomal entity. In certain embodiments, the ceDNA vector of the present disclosure may contain elements that allow integration of the donor sequence into the genome of the host cell. As used herein, "transgene," "nucleic acid sequence," and "heterologous nucleic acid sequence" are synonymous and encode antibodies and antigen-binding fragments thereof, as described herein.

[0230] 1A-1G, schematic diagrams of the functional components of two non-limiting plasmids useful for generating ceDNA vectors for the expression of antibodies and antigen-binding fragments thereof are shown. Figures 1A, 1B, 1D, and 1F show the constructs of ceDNA vectors for the expression of antibodies and antigen-binding fragments thereof or the sequences of the corresponding ceDNA plasmids. The ceDNA vectors are capsid-free and can be derived from a plasmid encoding, in this order, a first ITR, an expressible transgene cassette, and a second ITR, where the first and second ITR sequences are asymmetric, symmetric, or substantially symmetric with respect to each other, as defined herein. The ceDNA vectors for the expression of antibodies and antigen-binding fragments thereof are capsid-free and can be derived from a plasmid encoding, in this order, a first ITR, an expressible transgene (protein or nucleic acid), and a second ITR, where the first and second ITR sequences are asymmetric, symmetric, or substantially symmetric with respect to each other, as defined herein. In some embodiments, the expressible transgene cassette optionally includes an enhancer / promoter, one or more homology arms, a donor sequence, a post-transcriptional regulatory element (e.g., WPRE, e.g., SEQ ID NO: 67), and a polyadenylation and termination signal (e.g., BGH polyA, e.g., SEQ ID NO: 68).

[0231] Figure 5 is a gel confirming the production of ceDNA from multiple plasmid constructs using the methods described in the Examples. The ceDNA is confirmed by the characteristic banding pattern in the gel, as discussed above with respect to Figure 4A and in the Examples.

[0232] (i) Regulatory elements The ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein, comprising asymmetric or symmetric ITR pairs as defined herein, may further comprise a particular combination of cis-regulatory elements, including, but not limited to, promoters, riboswitches, insulators, mir regulatory elements, post-transcriptional regulatory elements, tissue- and cell-type-specific promoters, and enhancers.

[0233] According to some embodiments, the sequences of the various cis-regulatory elements can be selected from any of those disclosed in International Application No. US2021 / 023891, filed March 24, 2021, which is incorporated by reference in its entirety.

[0234] In embodiments, the second nucleic acid sequence comprises a regulatory sequence and a nucleic acid sequence encoding a nuclease. In certain embodiments, the gene regulatory sequence is operably linked to the nucleic acid sequence encoding the nuclease. In certain embodiments, the regulatory sequence is suitable for controlling expression of the nuclease in a host cell. In certain embodiments, the regulatory sequence comprises a suitable promoter sequence capable of directing transcription of a gene operably linked to the promoter sequence, such as a nucleic acid sequence encoding a nuclease of the present disclosure. In certain embodiments, the second nucleic acid sequence comprises an intron sequence linked to the 5' end of the nucleic acid sequence encoding the nuclease. In certain embodiments, an enhancer sequence is provided upstream of the promoter to increase the efficiency of the promoter. In certain embodiments, the regulatory sequence comprises an enhancer and a promoter, and the second nucleic acid sequence comprises an intron sequence upstream of the nucleic acid sequence encoding the nuclease, the intron comprising one or more nuclease cleavage sites, and the promoter is operably linked to the nucleic acid sequence encoding the nuclease.

[0235] Suitable promoters can be derived from viruses and therefore can be referred to as viral promoters, or they can be derived from any organism, including prokaryotes or eukaryotes. Suitable promoters can be used to drive expression by any RNA polymerase (e.g., pol I, pol II, pol III). Exemplary promoters include the SV40 early promoter, the mouse mammary tumor virus long terminal repeat (LTR) promoter; the adenovirus major late promoter (Ad MLP); the herpes simplex virus (HSV) promoter, the cytomegalovirus (CMV) promoter, e.g., the CMV immediate early promoter region (CMVIE), the Rous sarcoma virus (RSV) promoter, the human U6 micronucleus promoter (U6, e.g., SEQ ID NO: 80) (Miyagishi et al., Nature Biotechnology 20, 497-500 (2002)), the enhanced U6 promoter (e.g., Xia et al., Nucleic Acids Res. 2003 Sep.1;31(17)), human H1 promoter (H1) (e.g., SEQ ID NO: 81 or SEQ ID NO: 155), CAG promoter, human alpha 1-antitrypsin (HAAT) promoter (e.g., SEQ ID NO: 82), and the like. In certain embodiments, these promoters are modified at their downstream intron-containing ends to contain one or more nuclease cleavage sites. In certain embodiments, the DNA containing the nuclease cleavage sites is exogenous to the promoter DNA.

[0236] According to some embodiments, the promoter may be a promoter from a human gene such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin, human muscle creatine, or human metallothionein.

[0237] According to some embodiments, the promoter is a tissue-specific promoter. According to further embodiments, the tissue-specific promoter is a liver-specific promoter. According to some embodiments, the antibody or antigen-binding fragment thereof is targeted to and / or produced in the liver by a liver-specific promoter.

[0238] Any liver-specific promoter known in the art is contemplated for use in the present disclosure. According to some embodiments, the liver-specific promoter is selected from, but is not limited to, natural or synthetic human alpha-1-antitrypsin (HAAT). According to one embodiment, delivery to the liver can be achieved using endogenous ApoE-specific targeting of a composition comprising a ceDNA vector to hepatocytes via the low-density lipoprotein (LDL) receptor present on the surface of hepatocytes.

[0239] Non-limiting examples of suitable promoters for use in accordance with the present disclosure include, but are not limited to, any of the following: CAG promoter, EF1a promoter, IE2 promoter and rat EF1-α promoter, mEF1 promoter, or 1E1 promoter fragment.

[0240] According to some embodiments, the promoter can be selected from any promoter sequence disclosed in International Application No. US2021 / 023891, filed March 24, 2021, the contents of which are incorporated herein by reference in their entirety.

[0241] (ii) Polyadenylation sequence: A sequence encoding a polyadenylation sequence may be included in a ceDNA vector for expression of antibodies and antigen-binding fragments thereof to stabilize the mRNA expressed from the ceDNA vector and to aid in nuclear transport and translation. According to some embodiments, the ceDNA vector does not contain a polyadenylation sequence. In other embodiments, the ceDNA vector for expression of antibodies and antigen-binding fragments thereof contains at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 45, at least 50, or more adenine dinucleotides. According to some embodiments, the polyadenylation sequence contains about 43 nucleotides, about 40-50 nucleotides, about 40-55 nucleotides, about 45-50 nucleotides, about 35-50 nucleotides, or any range therebetween.

[0242] The expression cassette can include any polyadenylation sequence known in the art or variations thereof. Some expression cassettes can also include an SV40 late polyA signal upstream enhancer (USE) sequence. In some embodiments, the USE sequence can be used in combination with an SV40 pA or heterologous polyA signal. The polyA sequence is positioned 3' to the transgene encoding the antibody and antigen-binding fragment thereof.

[0243] According to some embodiments, the polyadenylation sequence can be selected from any of the polyadenylation sequences disclosed in International Application No. US2021 / 023891, filed March 24, 2021, the contents of which are incorporated herein by reference in their entirety.

[0244] The expression cassette may also contain posttranscriptional elements to increase transgene expression. According to some embodiments, the Woodchuck Hepatitis Virus (WHP) posttranscriptional regulatory element (WPRE) is used to increase transgene expression. Other posttranscriptional processing elements can be used, such as the posttranscriptional element from the thymidine kinase gene of herpes simplex virus or hepatitis B virus (HBV).

[0245] According to some embodiments, the post-transcriptional regulatory element can be selected from any of the post-transcriptional regulatory element sequences disclosed in International Application No. US2021 / 023891, filed March 24, 2021, the contents of which are incorporated herein by reference in their entirety.

[0246] According to some embodiments, the one or more nucleic acid sequences encoding the antibody or antigen-binding fragment thereof can also encode a secretory sequence so that the protein is targeted to the Golgi apparatus and endoplasmic reticulum, where it can be folded into the correct conformation by chaperone molecules as it passes through the ER and exits the cell. Exemplary secretory sequences include, but are not limited to, the VH-02 and VK-A26 and IgK signal sequences, as well as the Gluc secretory signal, which enables tagged proteins to be secreted from the cytoplasm, and the TMD-ST secretory sequence, which targets tagged proteins to the Golgi apparatus.

[0247] According to some embodiments, the secretory sequence can be selected from any of the secretory sequences disclosed in International Application No. US2021 / 023891, filed March 24, 2021, the contents of which are incorporated herein by reference in their entirety.

[0248] (iii) Nuclear localization sequence According to some embodiments, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof comprise one or more nuclear localization sequences (NLSs), e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs. According to some embodiments, the one or more NLSs are located at or near the amino terminus, at or near the carboxy terminus, or a combination thereof (e.g., one or more NLSs at the amino terminus and / or one or more NLSs at the carboxy terminus). When multiple NLSs are present, each can be selected independently from the other NLSs, such that a single NLS is present in multiple copies and / or in combination with one or more other NLSs present in some or all of the copies.

[0249] According to some embodiments, the NLS can be selected from any of the NLSs disclosed in International Application No. US2021 / 023891, filed March 24, 2021, the contents of which are incorporated herein by reference in their entirety.

[0250] C. Exemplary ceDNA Anti-CoV-2 S Vectors According to some embodiments, as an exemplary capsid-free closed-end DNA (ceDNA) vector comprising at least one nucleic acid sequence comprising an antibody or antigen-binding fragment thereof, the ceDNA construct is selected from the constructs shown in Table 7.

[0251] [Table 7]

[0252] According to some embodiments, an exemplary ceDNA vector is ceDNA-1856, which comprises SEQ ID NO: 404, as shown below. CCTGCAGGCA GCTGCGCGCT CGCTCGCTCA CTGAGGCCGC CCGGGCAAAG CCCGGGCGTCGGGCGACCTT TGGTCGCCCG GCCTCAGTGA GCGAGCGAGC GCGCAGAGAG GGAGTGGCCA ACTCCATCAC TAGGGGTTCC TTGTAGTTAA TGATTAACCC GCCATGCTAC TTATCGCGGC CGCGGGGGAG GCTGCTGGTG AATATTAACC AAGGTCACCC CAGTTATCGG AGGAGCAAAC AGGGGCTAAG TCCACCGGGG GAGGCTGCTG GTGAATATTA ACCAAGGTCA CCCCAGTTAT CGGAGGAGCA AACAGGGGCT AAGTCCACCG GGGGAGGCTG CTGGTGAATA TTAACCAAGG TCACCCCAGT TATCGGAGGA GCAAACAGGG GCTAAGTCCA CGGTACCCAC TGGGAGGATG TTGAGTAAGA TGGAAAACTA CTGATGACCC TTGCAGAGAC AGAGTATTAG GACATGTTTG AACAGGGGCC GGGCGATCAG CAGGTAGCTC TAGAGGATCC CCGTCTGTCT GCACATTTCG TAGAGCGAGT GTTCCGATAC TCTAATCTCC CTAGGCAAGG TTCATATTTG TGTAGGTTAC TTATTCTCCT TTTGTTGACT AAGTCAATAA TCAGAATCAG CAGGTTTGGA GTCAGCTTGG CAGGGATCAG CAGCCTGGGT TGGAAGGAGG GGGTATAAAA GCCCCTTCAC CAGGAGAAGC CGTCACACAG ATCCACAAGC TCCTGAAGAG GTAAGGGTTT AAGGGATGGT TGGTTGGTGG GGTATTAATG TTTAATTACC TGGAGCACCT GCCTGAAATC ACTTTTTTTC AGGTTGGGTT TAAACCGCAG CCACCATGGA CATGAGAGTG CCCGCCCAGC TGCTGGGCCT GCTGCTGCTG TGGCTGTCCGGAGCCAGATG CGAAATCGTG CTGACCCAGA GCCCTGGCAC CCTGAGCCTGTCACCCGGCG AACGGGCTAC CCTGTCTTGT AGAGCCTCTC AGACCGTGTC CAGCACCAGCCTGGCCTGGT ACCAGCAGAA ACCTGGACAG GCTCCTAGAC TGCTGATCTA CGGAGCTTCTAGTAGAGCCA CCGGCATCCC CGATAGATTC AGCGGCAGCG GCAGCGGCAC TGATTTCACCCTGACAATTA GCCGGCTGGA ACCTGAGGAC TTTGCCGTGT ATTACTGCCA GCAACACGACACCAGCCTGA CATTCGGCGG CGGAACCAAA GTTGAGATCA AGCGGACCGT GGCCGCTCCATCTGTGTTCA TCTTTCCACC TAGCGACGAG CAGCTGAAGT CCGGCACAGC CTCTGTGGTGTGCCTGCTCA ACAACTTCTA CCCTCGCGAG GCCAAGGTGC AGTGGAAGGT GGACAACGCCCTGCAAAGCG GCAACAGCCA GGAGAGCGTC ACAGAACAGG ACAGCAAGGA CTCTACATACAGCCTGAGCA GCACACTGAC CCTCAGCAAG GCCGATTACG AGAAGCACAAGGTTTACGCCTGCGAGGTGA CCCACCAGGG CCTGTCCAGC CCTGTGACAAAGAGCTTCAA TAGAGGCGAATGTTGATAGT TAATTAAGAG CATCTTACCGCCATTTATTCCCATATTTGT TCTGTTTTTCTTGATTTGGG TATACATTTA AATGTTAATA AAACAAAATGGTGGGGCAAT CATTTACATTTTTAGGGATA TGTAATTACTAGTTCAGGTG TATTGCCACA AGACAAACAT GTTAAGAAACTTTCCCGTTA TTTACGCTCTGTTCCTGTTA ATCAACCTCT GGATTACAAA ATTTGTGAAAGATTGACTGA TATTCTTAACTATGTTGCTC CTTTTACGCTGTGTGGATAT GCTGCTTTATAGCCTCTGTA TCTAGCTATTGCTTCCCGTA CGGCTTTCGT TTTCTCCTCC TTGTATAAATCCTGGTTGCT GTCTCTTTTAGAGGAGTTGT GGCCCGTTGT CCGTCAACGT GGCGTGGTGTGCTCTGTGTT TGCTGACGCAACCCCCACTG GCTGGGGCAT TGCCACCACC TGTCAACTCCTTTCTGGGACTTTCGCTTTC CCCCTCCCGA TCGCCACGGC AGAACTCATC GCCGCCTGCCTTGCCCGCTG CTGGACAGGG GCTAGGTTGC TGGGCACTGA TAATTCCGTG GTGTTGTCTGTGCCTTCTAG TTGCCAGCCA TCTGTTGTTT GCCCCTCCCC CGTGCCTTCC TTGACCCTGGAAGGTGCCAC TCCCACTGTC CTTTCCTAAT AAAATGAGGA AATTGCATCG CATTGTCTGAGTAGGTGTCA TTCTATTCTG GGGGGTGGGG TGGGGCAGGA CAGCAAGGGG GAGGATTGGGAAGACAATAG CAGGCATGCT GGGGATGCGG TGGGCTCTAT GGCTCTAGAG CATGGCTACGTAGATAAGTA GCATGGCGGG TTAATCATTA ACTACACCTG CAGGAGGAAC CCCTAGTGATGGAGTTGGCC ACTCCCTCTC TGCGCGCTCG CTCGCTCACT GAGGCCGGGC GACCAAAGGTCGCCCGACGC CCGGGCGGCC TCAGTGAGCG AGCGAGCGCG CAGCTGCCTG CAGG

[0253] According to some embodiments, the ceDNA vector is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:404.

[0254] According to some embodiments, an exemplary ceDNA vector is ceDNA-1859, comprising SEQ ID NO: 405, as shown below. CCTGCAGGCA GCTGCGCGCT CGCTCGCTCA CTGAGGCCGC CCGGGCAAAG CCCGGGCGTC GGGCGACCTT TGGTCGCCCG GCCTCAGTGA GCGAGCGAGC GCGCAGAGAG GGAGTGGCCA ACTCCATCAC TAGGGGTTCC TTGTAGTTAA TGATTAACCC GCCATGCTAC TTATCGCGGC CGCGGGGGAG GCTGCTGGTG AATATTAACC AAGGTCACCC CAGTTATCGG AGGAGCAAAC AGGGGCTAAG TCCACCGGGG GAGGCTGCTG GTGAATATTA ACCAAGGTCA CCCCAGTTAT CGGAGGAGCA AACAGGGGCT AAGTCCACCG GGGGAGGCTG CTGGTGAATA TTAACCAAGG TCACCCCAGT TATCGGAGGA GCAAACAGGG GCTAAGTCCA CGGTACCCAC TGGGAGGATG TTGAGTAAGA TGGAAAACTA CTGATGACCC TTGCAGAGAC AGAGTATTAG GACATGTTTG AACAGGGGCC GGGCGATCAG CAGGTAGCTC TAGAGGATCC CCGTCTGTCT GCACATTTCG TAGAGCGAGT GTTCCGATAC TCTAATCTCC CTAGGCAAGG TTCATATTTG TGTAGGTTAC TTATTCTCCT TTTGTTGACT AAGTCAATAA TCAGAATCAG CAGGTTTGGA GTCAGCTTGG CAGGGATCAG CAGCCTGGGT TGGAAGGAGG GGGTATAAAA GCCCCTTCAC CAGGAGAAGC CGTCACACAG ATCCACAAGC TCCTGAAGAG GTAAGGGTTT AAGGGATGGT TGGTTGGTGG GGTATTAATG TTTAATTACC TGGAGCACCT GCCTGAAATC ACTTTTTTTC AGGTTGGGTT TAAACCGCAG CCACCATGGA ATTCGGCCTG TCCTGGGTCT TTCTGGTGGC CATCCTGAAG GGCGTGCAGTGCCAGGTCCA GCTGGTTCAG AGCGGCGCCG AGGTTAAGAA ACCTGGCGCC AGCGTGAAAG TGTCCTGCAA GGCCAGCGGC TACCCCTTCA CCAGCTACGG CATCTCTTGG GTGCGGCAGG CCCCTGGACA AGGACTGGAG TGGATGGGAT GGATCAGCAC TTACCAGGGC AATACCAACT ACGCCCAGAA ATTCCAGGGC AGAGTGACAA TGACCACCGA CACCAGCACAACCACAGGCT ACATGGAACT GCGGAGACTG AGAAGCGATG ATACAGCCGT GTACTACTGCGCCAGAGATT ATACAAGAGG TGCTTGGTTC GGCGAGAGCC TGATCGGCGG ATTCGACAAC TGGGGACAAG GCACCCTGGT GACCGTGTCA TCCGCCTCTA CCAAGGGCCC TAGCGTGTTTCCACTGGCCC CTAGCTCTAA AAGCACAAGC GGCGGCACCG CCGCTCTGGG ATGTCTGGTGAAGGACTACT TCCCAGAGCC CGTGACCGTG AGCTGGAACA GCGGCGCTCT CACATCTGGGGTGCATACCT TTCCCGCCGT GCTGCAGTCT TCTGGACTGT ACAGCCTGAG CAGCGTGGTGACCGTGCCCT CCAGCAGCCT GGGCACACAG ACCTACATCT GCAACGTGAA CCACAAGCCA TCTAATACCA AGGTGGATAA GAAGGTGGAA CCTAAGAGCT GTGACAAGAC ACACACATGC CCCCCCTGCC CTGCTCCTGA GCTGCTGGCC GGCCCCTCCG TGTTTCTCTT CCCTCCTAAA CCCAAGGACA CACTGATGAT TAGCCGGACC CCAGAGGTGA CCTGTGTGGT GGTTGACGTG AGTCACGAAG ATCCTGAAGT GAAGTTCAAC TGGTACGTGG ACGGCGTGGA GGTGCATAAC GCCAAAACCA AGCCTCGGGAAGAGCAGTAC AACAGCCACCT ATAGAGTGGT GAGCGTGCTT ACAGTGCTGC ATCAGGACTG GCTGAACGGC AAGGAATACA AGTGCAAGGT GTCCAACAAA GCCCTGCCTC TGCCTGAAGA AAAGACCATC AGCAAGGCCA AGGGCCAACC AAGAGAGCTACCCA GCCAGCCAT GAGCTGACCA AGAATCAGGT GTCCCTGACC TGCCTGGTCA AAGGCTTCTA CCCTAGCGAC ATCGCCGTCG AGTGGGAGAG CAATGGCCAG CCTGAGAACA ACTACAAGAC CACCCCTCCT GTGCTGGACA GCGACGGCAG CTTCTTCCTG TATAGCAAGC TGAGCCAGCCAGGGGGGGG GCAATGTGTT CAGCTGTAGC GTGCTGCACG AGGCCCTGCA CAGCCACTAC ACACAGAAGT CTCTGAGCCT GTCTCCTGGC AAGTGATAGT TAATTAAGAG CATCTTACCG CCATTTATTC CCATATTTGT TCTGTTTTTC TTGATTTGGG TATACATTTA AAGTAATACAGATCAGAGATGAGAT CATTTACATT TTTAGGGATA TGTAATTACT AGTTCAGGTG TATTGCCACA AGACAAACAT GTTAAGAAAC TTTCCCGTTA TTTACGCTCT GTTCCTGTTA ATCAACCTCT GGATTACAAA ATTTGTGAAAGATTGACTGA TATTCTTAAC TATGTTGCTCTCGTTGGCTAT GCTGCTAT AGCCTCTGTA TCTAGCTATT GCTTCCCGTA CGGCTTTCGT TTTCTCCTCC TTGTATAAAT CCTGGTTGCT GTCTCTTTTA GAGGAGTTGT GGCCCGTTGT CCGTCAACGT GGCGTGGTGT GCTCTGTGTT TGCTGACGCA ACCCCCACTGGCTGGGGCAT TGCCACCACC TGTCAACTCC TTTCTGGGAC TTTCGCTTTC CCCCTCCCGA TCGCCACGGC AGAACTCATC GCCGCCTGCC TTGCCCGCTG CTGGACAGGG GCTAGGTTGC TGGGCACTGA TAATTCCGTG GTGTTGTCTG TGCCTTCTAG TTGCCAGCCA TCTGTTGTTT GCCCCTCCCC CGTGCCTTCC TTGACCCTGG AAGGTGCCAC TCCCACTGTC CTTTCCTAAT AAAATGAGGA AATTGCATCG CATTGTCTGA GTAGGTGTCA TTCTATTCTG GGGGGTGGGG TGGGGCAGGA CAGCAAGGGG GAGGATTGGG AAGACAATAG CAGGCATGCT GGGGATGCGG TGGGCTCTAT GGCTCTAGAG ATGGCTACG TAGATAAGTA GCATGGCGGG TTAATCATTA ACTACACCTG CAGGAGGAAC CCCTAGTGAT GGAGTTGGCC ACTCCCTCTC TGCGCGCTCG CTCGCTCACT GAGGCCGGGC GACCAAAGGT CGCCCGACGC CCGGGCGGCC TCAGTGAGCG AGCGAGCGCG CAGCTGCCTG CAGG

[0255] According to some embodiments, the ceDNA vector is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:405.

[0256] According to some embodiments, an exemplary ceDNA vector is ceDNA-1966, which comprises SEQ ID NO: 406, as shown below. CCTGCAGGCA GCTGCGCGCT CGCTCGCTCA CTGAGGCCGC CCGGGCAAAG CCCGGGCGTCGGGCGACCTT TGGTCGCCCG GCCTCAGTGA GCGAGCGAGC GCGCAGAGAG GGAGTGGCCAACTCCATCAC TAGGGGTTCC TTGTAGTTAA TGATTAACCC GCCATGCTAC TTATCGCGGCCGCGGGGGAG GCTGCTGGTG AATATTAACC AAGGTCACCC CAGTTATCGG AGGAGCAAACAGGGGCTAAG TCCACCGGGG GAGGCTGCTG GTGAATATTA ACCAAGGTCA CCCCAGTTATCGGAGGAGCA AACAGGGGCT AAGTCCACCG GGGGAGGCTG CTGGTGAATA TTAACCAAGGTCACCCCAGT TATCGGAGGA GCAAACAGGG GCTAAGTCCA CGGTACCCAC TGGGAGGATG TTGAGTAAGA TGGAAAACTA CTGATGACCC TTGCAGAGAC AGAGTATTAG GACATGTTTG AACAGGGGCC GGGCGATCAG CAGGTAGCTC TAGAGGATCC CCGTCTGTCT GCACATTTCGTAGAGCGAGT GTTCCGATAC TCTAATCTCC CTAGGCAAGG TTCATATTTG TGTAGGTTACTTATTCTCCT TTTGTTGACT AAGTCAATAA TCAGAATCAG CAGGTTTGGA GTCAGCTTGGCAGGGATCAG CAGCCTGGGT TGGAAGGAGG GGGTATAAAA GCCCCTTCAC CAGGAGAAGCCGTCACACAG ATCCACAAGC TCCTGAAGAG GTAAGGGTTT AAGGGATGGT TGGTTGGTGGGGTATTAATG TTTAATTACC TGGAGCACCT GCCTGAAATC ACTTTTTTTC AGGTTGGGTT TAAACCGCAG CCACCATGGA ATTCGGCCTG AGCTGGGTGT TCCTGGTGGC TATCCTGAAGGGCGTGCAGT GCCAGGTGCA GCTGGTTCAG AGCGGCGCTG AGGTTAAGAA ACCTGGCGCTAGCGTGAAAG TGAGCTGCAA GGCTAGCGGC TACCCTTTCA CAAGCTACGG CATCTCTTGGGTGCGGCAGG CTCCTGGACA AGGACTGGAG TGGATGGGAT GGATCAGCAC TTACCAGGGC AATACAAACT ACGCTCAGAA ATTCCAGGGC AGAGTGACAA TGACAACAGA CACAAGCACA ACAACAGGCT ACATGGAACT GCGGAGACTG AGAAGCGACG ACACAGCTGT GTACTACTGCGCTAGAGACT ATACAAGAGG CGCTTGGTTC GGCGAGAGCC TGATCGGCGG ATTCGACAACTGGGGACAAG GCACACTGGT GACAGTGTCA AGCGCTTCTA CAAAGGGCCC TAGCGTGTTCCCACTGGCTC CTAGCTCTAA AAGCACAAGC GGCGGCACAG CTGCTCTGGG ATGCCTGGTG AAGGACTACT TCCCAGAGCC TGTGACAGTG AGCTGGAACA GCGGCGCTCT GACATCTGGG GTGCACACAT TCCCTGCTGT GCTGCAGTCT TCTGGACTGT ACAGCCTGAG CAGCGTGGTGACAGTGCCTA GCAGCAGCCT GGGCACACAG ACATACATCT GCAACGTGAA CCACAAGCCATCTAATACAA AGGTGGACAA GAAGGTGGAA CCTAAGAGCT GCGACAAGAC ACACACATGCCCTCCTTGCC CTGCTCCTGA GCTGCTGGCT GGCCCTAGCG TGTTCCTGTT CCCTCCTAAA CCTAAGGACA CACTGATGAT TAGCCGGACA CCAGAGGTGA CCTGCGTGGT GGTTGACGTG AGCCACGAAG ACCCTGAAGT GAAGTTCAAC TGGTACGTGG ACGGCGTGGA GGTGCACAACGCTAAAACAA AGCCTCGGGA AGAGCAGTAC AACAGCACAT ATAGAGTGGT GAGCGTGCTT ACAGTGCTGC ACCAGGACTG GCTGAACGGC AAGGAATACA AGTGCAAGGT GAGCAACAAAGCTCTGCCTC TGCCTGAAGA AAAGACAATC AGCAAGGCTA AGGGCCAACC AAGAGAGCCTCAAGTGTACA CACTGCCTCC TAGCAGAGAC GAGCTGACAA AGAATCAGGT GAGCCTGACA TGCCTGGTGA AAGGCTTCTA CCCTAGCGAC ATCGCTGTGG AGTGGGAGAG CAATGGCCAG CCTGAGAACA ACTACAAGAC AACACCTCCT GTGCTGGACA GCGACGGCAG CTTCTTCCTGTATAGCAAGC TGACAGTGGA CAAGAGCAGG TGGCAGCAGG GCAATGTGTT CAGCTGCAGCGTGCTGCACG AGGCTCTGCA CAGCCACTAC ACACAGAAGT CTCTGAGCCT GTCTCTGGCAAGTGATAGT TAATTAAGAG CATCTTACCG CCATTTATTC CCATATTTTGT TCTGTTTTTC TTGATTTGGG TATACATTTA AATGTTAATA AAACAAAATG GTGGGGCAAT CATTTACATTTTTAGGGATA TGTAATTACT AGTTCAGGTG TATTGCCACA GACAAACAT GTTAAGAAACTTTCCCGTTA TTTACGCTCT GTTCCTGTTA ATCAACCTCT GGATTACAAA ATTTGTGAAAGATTGACTGA TATTCTTAAC TATGTTGCTC CTTTTACGCT GTGTGGATAT GCTGCTTTATAGCCTCTGTA TCTAGCTATT GCTTCCCGTA CGGCTTTCGT TTTCTCCTCC TTGTATAAATCCTGGTTGCT GTCTCTTTTA GAGGAGTTGT GGCCCGTTGT CCGTCAACGT GGCGTGGTGTGCTCTGTGTT TGCTGACGCA ACCCCCACTG GCTGGGGCAT GCCACCACC TGTCAACTCCTTTCTGGGAC TTTCGCTTTC CCCCTCCCGA TCGCCACGGC AGAACTCATC GCCGCCTGCCTTGCCCGCTG CTGGACAGGG GCTAGGTTGC TGGGCACTGA AATTCCGTG GTGTTGTCTGTGCCTTCTAG TTGCCAGCCA TCTGTTGTTT GCCCCTCCCC CGTGCCTTCC TTGACCCTGGAAGGTGCCAC TCCCACTGTC CTTTCCTAAT AAAATGAGGA ATTGCATCG CATTGTCTGAGTAGGTGTCA TTCTATTCTG GGGGTGGGG TGGGGCAGGA AGCAAGGGG GAGGATTGGGAAGACAATAG CAGGCATGCT GGGGATGCGG TGGGCTCTAT GGCTCTAGAG ATGGCTACGTAGATAAGTA CATGGCGGG TTAATCATTA ACTACACCTG CAGGAGGAAC CCTAGTGATGGAGTTGGCC ACTCCCTCTC TGCGCGCTCG CTCGCTCACT GAGGCCGGGC GACCAAAGGTCGCCCGACGC GGGCGGCC TCAGTGAGCGAGCGAGCGCG CAGCTGCCTG CAGG

[0257] According to some embodiments, the ceDNA vector is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:406.

[0258] According to some embodiments, an exemplary ceDNA vector is ceDNA-1967, which comprises SEQ ID NO: 407, as shown below. CCTGCAGGCA GCTGCGCGCT CGCTCGCTCA CTGAGGCCGC CCGGGCAAAG CCCGGGCGTCGGGCGACCTT TGGTCGCCCG GCCTCAGTGA GCGAGCGAGC GCGCAGAG GGAGTGGCCAACTCCATCAC TAGGGGTTCC TTGTAGTTAA TGATTAACCC GCCATGCTAC TTATCGCGGC CGCGGGGGAG GCTGCTGGTG AATATTAACC AAGGTCACCC CAGTTATCGG AGGAGCAAACAGGGGCTAAG TCCACCGGGG GAGGCTGCTG GTGAATATTA ACCAAGGTCA CCCCAGTTAT CGGAGGAGCA AACAGGGGCT AAGTCCACCG GGGGAGGCTG CTGGTGAATA TTAACCAAGGTCACCCCAGT TATCGGAGGA GCAAACAGGG GCTAAGTCCA CGGTACCCAC TGGGAGGATGTTGAGTAAGA TGGAAAACTA CTGATGACCC TTGCAGAGAC AGAGTATTAG GACATGTTTGAACAGGGGCC GGGCGATCAG CAGGTAGCTC TAGAGGATCC CCGTCTGTCT GCACATTTCGTAGAGCGAGT GTTCCGATAC TCTAATCTCC CTAGGCAAGG TTCATATTTG TGTAGGTTAC TTATTCTCCT TTTGTTGACT AAGTCAATAA TCAGAATCAG CAGGTTTGGA GTCAGCTTGG CAGGGATCAG CAGCCTGGGT TGGAAGGAGG GGGTATAAAA GCCCCTTCAC CAGGAGAAGCCGTCACACAG ATCCACAAGC TCCTGAAGAG GTAAGGGTTT AAGGGATGGT TGGTTGGTGGGGTATTAATG TTTAATTACC TGGAGCACCT GCCTGAAATC ACTTTTTTTC AGGTTGGGTTTAAACCGCAG CCACCATGGA CATGAGAGTG CCTGCTCAGC TGCTGGGCCT GCTGCTGCTG TGGCTGAGCG GAGCTAGATG CGAAATCGTG CTGACCCAGA GCCCTGGCAC CCTGAGCCTGTCACCTGGCG AACGGGCTAC CCTGTCTTGC AGAGCTTCTC AGACCGTGAG CAGCACCAGCCTGGCTTGGT ACCAGCAGAA ACCTGGACAG GCTCCTAGAC TGCTGATCTA CGGAGCTTCTAGCAGAGCTA CCGGCATCCC TGACAGATTC AGCGGCAGCG GCAGCGGCAC TGACTTCACC CTGACAATTA GCCGGCTGGA ACCTGAGGAC TTCGCTGTGT ATTACTGCCA GCAACACGAC ACCAGCCTGA CATTCGGCGG CGGAACCAAA GTTGAGATCA AGCGGACCGT GGCTGCTCCATCTGTGTTCA TCTTCCCACC TAGCGACGAG CAGCTGAAGA GCGGCACAGC TTCTGTGGTG TGCCTGCTGA ACAACTTCTA CCCTCGGGAG GCTAAGGTGC AGTGGAAGGT GGACAACGCTCTGCAAAGCG GCAACAGCCA GGAGAGCGTG ACAGCAAGG ACAGCAAGGA CTCTACATACAGCCTGAGCA GCACACTGAC CCTGAGCAAG GCTGACTACG AGAAGCACAA GGTTTACGCT TGCGAGGTGA CCCACCAGGG CCTGAGCAGC CCCTGTGACAA AGAGCTTCAA TAGAGGCGAATGCTGATAGT TAATTAAGAG CATCTTACCG CCATTTATTC CCATATTTGT TCTGTTTTTC TTGATTTGGG TATACATTTA AATGTTAATA AAACAAAATG GTGGGGCAAT CATTTACATTTTAGGGATA TGTAATTACT AGTTCAGGTG TATTGCCACA AGACAAACAT GTTAAGAAACTTTCCCGTTA TTTACGCTCT GTTCCTGTTA ATCAACCTCCT GGATTACAAA ATTTGTGAAA GATTGACTGA TATTCTTAAC TATGTTGCTC CTTTTACGCT GTGTGGATAT GCTGCTTTAT AGCCTCTGTA TCTAGCTATT GCTTCCGTA CGGCTTTCGTT TTTCTCCTCC TTGTATAAATCCTGGTTGCT GTCTCTTT GAGGAGTTGT GGCCCGTTGT CCGTCAACGT GGCGTGGTGT GCTCTGTGTT TGCTGACGCA ACCCCCACTG GCTGGGGCAT TGCCACCACC TGTCAACTCC TTTCTGGGAC TTTCGCTTTC CCCCTCCCGA TCGCCACGGC AGAACTCATC GCCGCCTGCCTTGCCCGCTG CTGGACAGGG GCTAGGTTGC TGGGCACTGA TAATTCCGTG GTGTTGTCTGTGCCTTCTAG TTGCCAGCCA TCTGTTGTTT GCCCCTCCCC CGTGCCTTCC TTGACCCTGGAAGGTGCCAC TCCCACTGTC CTTTCCTAAT AAAATGAGGA AATTGCATCG CATTGTCTGAGTAGGTGTCA TTCTATTCTG GGGGGTGGGG TGGGGCAGGA CAGCAAGGGG GAGGATTGGGAAGACAATAG CAGGCATGCT GGGGATGCGG TGGGCTCTAT GGCTCTAGAG CATGGCTACG TAGATAAGTA GCATGGCGGG TTAATCATTA ACTACACCTG CAGGAGGAAC CCCTAGTGATGGAGTTGGCC ACTCCCTCTC TGCGCGCTCG CTCGCTCACT GAGGCCGGGC GACCAAAGGT CGCCCGACGC CCGGGCGGCC TCAGTGAGCG AGCGAGCGCG CAGCTGCCTG CAGG

[0259] According to some embodiments, the ceDNA vector is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:407.

[0260] According to some embodiments, an exemplary ceDNA vector is ceDNA-2157, which comprises SEQ ID NO: 408, as shown below. CCTGCAGGCA GCTGCGCGCT CGCTCGCTCA CTGAGGCCGC CCGGGCAAAG CCCGGGCGTCGGGCGACCTT TGGTCGCCCG GCCTCAGTGA GCGAGCGAGC GCGCAGAGAG GGAGTGGCCAACTCCATCAC TAGGGGTTCC TTGTAGTTAA TGATTAACCC GCCATGCTAC TTATCTACGT AGCCATGCAT ATGTACCACA TTTGTAGAGG TTTTACTTGC TTTAAAAAAC CTCCCACATCTCCCCCTGAA CCTGAAACAT AAAATGAATG CAATTGTTGT TGTTAACTTG TTTATTGCAG CTTATAATGG TTACAAATAA AGCAATAGCA TCACAAATTT CACAAATAAA GCATTTTTTT CACTGCATTC TAGTTGTGGT TTGTCCAAAC TCATCAATGT ATCTTATCAT GTCTGTAAAATACAGCATAG CAAAACTTTA ACCTCCAAAT CAAGCCTCTA CTTGAATCCT TTTCTGAGGGATGAATAAGG CATAGGCATC AGGGGCTGTT GCCAATGTGC ATTAGCTGTT TGCAGCCTCACCTTCTTTCA TGGAGTTTAA GATATAGTGT ATTTTCCCAA GGTTTGAACT AGCTCTTCATTTCTTTATGT TTTAAATGCA CTGACCTCCC ACATTCCCTT TTTAGTAAAA TATTCAGAAATAATTTAAAT ACATCATTGC AATGAAAATA AATGTTTTTT ATTAGGCAGA ATCCAGATGCTCAAGGCCCT TCATAATATC CCCCAGTTTA GTAGTTGGAC TTAGGGAACA AAGGAACCTT TAATAGAAAT TGGACAGCAA GAAAGCGAGC TTAATTAACT ATCAACATTC GCCTCTATTGAAGCTCTTTG TCACAGGGCT GGACAGGCCC TGGTGGGTCA CCTCGCAGGC GTAAACCTTGTGCTTCTCGT AATCGGCCTT GCTGAGGGTC AGTGTGCTGC TCAGGCTGTA TGTAGAGTCCTTGCTGTCCT GTTCTGTGAC GCTCTCCTGG CTGTTGCCGC TTTGCAGGGC GTTGTCCACCTTCCACTGCA CCTTGGCCTC GCGAGGGTAG AAGTTGTTGA GCAGGCACAC CACAGAGGCTGTGCCGGACT TCAGCTGCTC GTCGCTAGGT GGAAAGATGA ACACAGATGG AGCGGCCACG GTCCGCTTGA TCTCAACTTT GGTTCCGCCG CCGAATGTCA GGCTGGTGTC GTGTTGCTGGCAGTAATACA CGGCAAAGTC CTCAGGTTCC AGCCGGCTAA TTGTCAGGGT GAAATCAGTGCCGCTGCCGC TGCCGCTGAA TCTATCGGGG ATGCCGGTGG CTCTACTAGA AGCTCCGTAGATCAGCAGTC TAGGAGCCTG TCCAGGTTTC TGCTGGTACC AGGCCAGGCT GGTGCTGGACACGGTCTGAG AGGCTCTACA AGACAGGGTA GCCCGTTCGC CGGGTGACAG GCTCAGGGTG CCAGGGCTCT GGGTCAGCAC GATTTCGCAT CTGGCTCCGG ACAGCCACAG CAGCAGCAGGCCCAGCAGCT GGGCGGGCAC TCTCATGTCC ATGGTGGCTG CGGTTTAAAC TCAGTTCCAAAGGTTGGAAT CTAAAAGAGA GAAACAATTA GAATCAGTAG TTTAACACAT TATACACTTAAAAATTTTAT ATTTACCTTA GAGTAATTAT TCACTGTCCC AGGTCAGTGG TGGTGCCTGAAGCTGAGGAG ACAGGGCCCT GTCCTCGTCC GTATTTAAGC AGTGGATCCA GAGGGGCAACGGGGGAGGCT GCTGGTGAAT ATTAACCAAG GTCACCCCAG TTATCGGAGG AGCAAACAGG GGCTAAGTCC ACTGGCTGGG ATCTGAGTCG CCCGCCTACG CTGCCCGGAC GCTTTGCCTGGGCAGTGTAC AGCTTCCACT GCACTTACCG AAAGGAGTCA TTGTACCTGG CTCAGAAACCACAGCGTCCT GTGTCCAAGG TGGAGGGGGT GGCGTGAGTC AGACAGTCTC TGGGAGAGTACCACTTAGCT GGCCCTCTGC TCTCACTGCA GAATCCTTAG TGGCTGTTCC ACTGGTAGCAAGATCCAGTA CCTCTAGACC AGCCTGACCA ACATGGTGAA ACCCCGTCCC TGTCAAAAAT AGAAAAAATT AGCCGGGTGT GGTGGCACAG GCCTGTAATC CCAGTTACTT GGGAGGCTGAGGCTGACCAA CATGGAGAAA CCCGTCTCTA CTAAAAATAG AAAATTAGCC AGGTGTGGTGGCACATGCTT GTAATCCCAG CTACTTGGGA GGCTGAGGCA GGGGAAGGTT GTGGTGAGATGAGATTGTGT CACTGCACTC CAGCCTGGGC GACAGAGCAA ACCTCCATCT CAAAAAACAA AACAAAACAA AACAAAAAAA CCAAATGTTT ATTTGCCACA AAAACCCTAT CAGATGGGCG TCTTTATCAT TTCCATTGTA CAGATGGGGA AACAGGCTTC GGGGTCGGGG CATAGCCACT TACTGACGAC TCCCCACCCA GCAAGTGGTT TTGAACCCGG ACCCTCTCAC ACTACCTAAACCACGCCAGG ACAACCTCTG CTCCTCTCCA CCGAAATTCC AAGGGGTCGA GTGGATGTTGGAGGTGGCAT GGGCCCAGAG AGGTCTCTGA CCTCTGCCCC AGCTCCAAGG TCAGCAGGCA GGGAGGGCTG TGTGTTTGCT GTTTGCTGCT TGCAATGTTT GCCCATTTTA GGGACATGAG TAGGCTGAAG TTTGTTCAGT GTGGACTTCA GAGGCAGCAC ACAAACAGCT GCTGGAGGATGGGAACTGAG GGGTTGGAAG GGGGCAGGGT GAGCCCAGAA ACTCCTGTGT GCCTCTGAGCCTACATTCTT AACTACCCTC CGCCAGCTACTCCATT AGCCTTACTT ATATTAGTCT AAGTAGGACA GAGGGACAAA GAGCAGGAAC ACGGGGAGGCACAAGTTCTC GCATCGATTG TACCAAAGTA CAAGCGTTAA TGATTAACTG TACCAAAGTACAAGCGTTAA TGATTAACTG TACCAAAGTA CAAGCGTTAA TGATTAACGGC GGGA TGGTGAATAT TAACCAAGGT CACCCCAGTT ATCGGAGGAG CAAACAGGGG CTAAGTCCACCGGGGGAGGC TGCTGGTGAA TATTAACCAA GGTCACCCCA GTTATCGGAG GAGCAAACAGGGGCTAAGTC CACCGGGGA GGGACTCACCATGACCT CCAGTTATCGGAGGAGCAAA CAGGGGCTAA GTCACGGTA CCCACTGGGA GGATGTTGAG TAAGATGGAAAACTACTGAT GACCCTTGCA GAGACAGAGT ATTAGGACAT GTTTGAACAG GGGCCGGGCG ATCAGCAGGT AGCTCTAGAG GATCCCCGTC TGTCTGCACA TTTCGTAGAG CGAGTGTTCCGATACTCTAA TCTCCCTAGG CAAGGTTCAT ATTTGTGTAG GTTACTTATT CTCCTTTTGTTGACTAAGTC AATAATCAGA ATCAGCAGGT TTGGAGTCAG CTTGGAGCCAGGTCGGGGGGGG GGAGGGGGTA TAAAAGCCCC TTCACCAGGA GAAGCCGTCA CACAGATCCACAAGCTCCTG AAGAGGTAAG GGTTTAAGGG ATGGTTGGTT GGTGGGGTAT TAATGTTTAATTACCTGGAG CACCTGCCTG AAATCACTTT TTTTCAGGTT GGACCAGGTCCAGTCCA TGGAATTCGG CCTGTCCTGG GTCTTTCTGG TGGCCATCCT GAAGGGCGTG CAGTGCCAGGTCCAGCTGGT TCAGAGCGGC GCCGAGGTTA AGAAACCTGG CGCCAGCGTG AAAGTGTCCTGCAAGGCCAG CGGCTACCCC TTCACCAGCT ATTGGGGGGGGCCGGGGCT GACAAGGACT GGAGTGGATG GGATGGATCA GCACTTACCA GGGCAATACC AACTACGCCCAGAAATTCCA GGGCAGAGTG ACAATGACCA CCGACACCAG CACAACCACA GGCTACATGG AACTGCGGAG ACTGAGAAGC GATGATACAG CCGTGTACTA CTGCGCCAGA GATTATACAAGAGGTGCTTG GTTCGGCGAG AGCCTGATCG GCGGATTCGA CAACTGGGGA CAAGGCACCCTGGTGACCGT GTCATCCGCC TCTACCAAGG GCCCTAGCGT GTTTCCACTG GCCCCTAGCTCTAAAAGCAC AAGCGGCGGC ACCGCCGCTC TGGGATGTCT GGTGAAGGAC TACTTCCCAGAGCCCGTGAC CGTGAGCTGG AACAGCGGCG CTCTCACATC TGGGGTGCAT ACCTTTCCCG CCGTGCTGCA GTCTTCTGGA CTGTACAGCC TGAGCAGCGT GGTGACCGTG CCCTCCAGCAGCCTGGGCAC ACAGACCTAC ATCTGCAACG TGAACCACAA GCCATCTAAT ACCAAGGTGGATAAGAAGGT GGAACCTAAG AGCTGTGACA AGACACACAC ATGCCCCCCC TGCCCTGCTCCTGAGCTGCT GGCCGGCCCC TCCGTGTTTC TCTTCCCTCC TAAACCCAAG GACACACTGATGATTAGCCG GACCCCAGAG GTGACCTGTG TGGTGGTTGA CGTGAGTCAC GAAGATCCTG AAGTGAAGTT CAACTGGTAC GTGGACGGCG TGGAGGTGCA TAACGCCAAA ACCAAGCCTCGGGAAGAGCA GTACAACAGC ACCTATAGAG TGGTGAGCGT GCTTACAGTG CTGCATCAGG ACTGGCTGAA CGGCAAGGAA TACAAGTGCA AGGTGTCCAA CAAAGCCCTG CCCTGCCTGAAGAAAAGAC CATCAGCAAG GCCAAGGGCC AACCAAGAGA GCCTCAAGTG TACACCCTGC CCCCCAGCAG AGATGAGCTG ACCAAGAATC AGGTGTCCCT GACCTGCCTG GTCAAAGGCT TCTACCCTAG CGACATCGCC GTCGAGTGGG AGAGCAATGG CCAGCCTGAG AACACTACAAGACCACCCC TCCTGTGCTG GACAGCGACG GCAGCTTCTT CCTGTATAGC AAGCTGACCGTGGACAAGTC CAGGTGGCAG CAGGGCAATG TGTTCAGCTG TAGCGTGCTG CACGAGGCCCTGCACAGCCA CTACACACAG AAGTCTCTGA GCCTGTCTC TGGCAAGTGA TAGCTTAAGGAGCATCTTAC CGCCATTTAT TCCCATATTT GTTCTGTTTT TCTTGATTTG GGTATACATT TAAATGTTAA TAAAACAAAA TGGTGGGGCA ATCATTTACA TTTTTAGGGA TATGTAATTACTAGTTCAGG TGTATTGCCA CAAGACAAAC ATGTTAAGAA ACTTTCCCGT TATTTACGCTCTGTTCCTGT TAATCAACCT CTGGATTACA AAATTTGTGA AAGATTGACT GATATTCTTA ACTATGTTGC TCCTTTTACG CTGTGTGGAT ATGCTGCTTT ATAGCCTCTG TATCTAGCTATTGCTTCCCG TACGGCTTTC GTTTTCTCCT CCTTGTATAA ATCCTGGTTG CTGTCTCTTT TAGAGGAGTT GTGGCCCGTT GTCCGTCAAC GTGGCGTGGT GTGCTCTGTG TTTGCTGACGCAACCCCCAC TGGCTGGGGC ATTGCCACCA CCTGTCAACT CCTTTCTGGG ACTTTCGCTT TCCCCCTCCC GATCGCCACG GCAGAACTCA TCGCCGCCTG CCTTGCCCGC TGCTGGACAGGGGCTAGGTT GCTGGGCACT GATAATTCCG TGGTGTTGTC TGTGCCTTCT AGTTGCCAGC CATCTGTTGT TTGCCCCTCC CCCGTGCCTT CCTTGACCCT GGAAGGTGCC ACTCCCACTG TCCTTTCCTA ATAAAATGAG GAAATTGCAT CGCATTGTCT GAGTAGGTGT CATTCTATTC TGGGGGGTGG GGTGGGGCAG GACAGCAAGG GGGAGGATTG GGAAGACAAT AGCAGGCATG CTGGGGATGC GGTGGGCTCT ATGGCTCTAG AGCATGGCTA CGTAGATAAG TAGCATGGCG GGTTAATCAT TAACTACACC TGCAGGAGGA ACCCCTAGTG ATGGAGTTGG CCACTCCCTC TCTGCGCGCT CGCTCGCTCA CTGAGGCCGG GCGACCAAAG GTCGCCCGAC GCCCGGGCGG CCTCAGTGAG CGAGCGAGCG CGCAGCTGCC TGCAGG

[0261] According to some embodiments, the ceDNA vector is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:408.

[0262] According to some embodiments, SEQ ID NO:404 comprises the following components, where the numbers indicate nucleic acid residues: 856...921 = Immunoglobulin kappa variable 1D-33 signal peptide 856..1566 = LC1 (light chain 1) codon optimized 922..1242=S309_VL (variable light chain) 1243..1563=hIgKappa constant region [P01834] 1243..1563 = S309 constant region (human kappa).

[0263] According to some embodiments, SEQ ID NO:405 comprises the following components, where the numbers indicate nucleic acid residues: 856..912=Human IGHV3-43 heavy chain signal peptide 856..2286 = HC1 heavy chain 1 (HC1) codon optimized 913..1293 = S309_VH (variable heavy chain) 1294..2283 = S309 constant region (hIgG1) with GAALIE and LS mutations.

[0264] According to some embodiments, SEQ ID NO:406 comprises the following components, where the numbers indicate nucleic acid residues: 856..912=Human IGHV3-43 heavy chain signal peptide [P0DP04] 856.2286=HC1_Codon Optimization 913..1293=S309_VH 1294..2283 S309 Constant region (hIgG1) with GAALIE and LS mutations.

[0265] According to some embodiments, SEQ ID NO:407 comprises the following components, where the numbers indicate nucleic acid residues: 856..921=Immunoglobulin kappa variable 1D-33 signal peptide 856..1566=LC1_codon optimized 922..1242=S309_VL 1243..1563=hIgKappa constant region [P01834] 1243..1563 = S309 constant region (human kappa).

[0266] According to some embodiments, SEQ ID NO:408 comprises the following components, where the numbers indicate nucleic acid residues: 1..141=Left-ITR_v1 142..193=Spacer_Left-ITR_536 Complement (194.415) = SV40_polyA 416..810=HBB_3pUTR Complement (416.810) = HBBv2_3pUTR 811..818=PacI_site Complement(822..1532) = Translation 1532-822 Complement (822..1532) = LC1_codon optimized Complement (825..1145) = hIgKappa constant region [P01834] Complement (825..1145) = S309 constant region (human kappa) Complement (1146..1466) = S309_VL (variable light chain) Complement (1467..1532) = Immunoglobulin kappa variable 1D-33 signal peptide [P01593.2] Complement(1533..1539)=Mod_Minimum_Consensus_Kozak Complement(1533..1542)=Mod_Minimum_Consensus_Kozak_v2 1543..1550=PmeI_site Complement(1551.2822) = CpGmin_hAAT_promoter_set Spacer complement (2823..2832) = 10mer_2A Complement (2823..3048) 3xHNF1-4_ProEnh_10mer Enhancer complement (2833..2952) = ProEnh Complement (2959..2975) = HNF4 site Complement (2976..2988) = HNF1 site Complement (2989..3005) = HNF4 site Complement (3006..3018) = HNF1 site Complement (3019..3035) = HNF4 site Complement (3036..3048) = HNF1 site 3049..3120=Serpin Enhancers 3122..3193=Serpin Enhancers 3195..3266=Serpin Enhancers 3427..3610=Mouse TTR 5pUTR (NM_013697.5) 3579...3610 = EPD experimentally determined 5'UTR 3590...3610 = EPD experimentally determined 5'UTR 3611..3701=MVM introns 3703...3709=SexAI_site.

[0267] 3710..3719=Mod_Minimum_Consensus_Kozak_v2 3713..3719=Mod_Minimum_Consensus_Kozak 3720..3776=Human IGHV3-43 heavy chain signal peptide [P0DP04] 3720..5150=HC1_Codon Optimization 3777..4157=S309_VH 4158..5147 = S309 constant region (hIgG1) with GAALIE and LS mutations 5154..5159=AflII_site 5160..5740=WPRE_3pUTR 5741..5965=bGH 5966..6026=Spacer_Right-ITR_v1 6027..6156=Right-ITR_v1

[0268] V. Methods for the production of ceDNA vectors A. General production Certain methods for producing ceDNA vectors for expression of antibodies and antigen-binding fragments thereof, comprising asymmetric or symmetric ITR pairs as defined herein, are described in Section IV of International Application No. US 18 / 49996, filed September 7, 2018, which is incorporated herein by reference in its entirety. According to some embodiments, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof disclosed herein can be produced using insect cells, as described herein. In alternative embodiments, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof disclosed herein can be produced synthetically, and in some embodiments, by cell-free methods, as disclosed in International Application No. US 19 / 14122, filed January 18, 2019, which is incorporated herein by reference in its entirety.

[0269] As described herein, in one embodiment, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof can be obtained, for example, by a process comprising: a) incubating a population of host cells (e.g., insect cells) harboring a polynucleotide expression construct template (e.g., ceDNA-plasmid, ceDNA-bacmid, and / or ceDNA-baculovirus), wherein the host cells lack viral capsid-encoding sequences, under conditions effective and for a time sufficient to induce production of the ceDNA vector in the host cells in the presence of Rep proteins; and b) recovering and isolating the ceDNA vector from the host cells. The presence of Rep proteins induces replication of the vector polynucleotide with modified ITRs to produce the ceDNA vector in the host cells, with the exception that viral particles (e.g., AAV virions) are not expressed. Therefore, there are no size limitations, such as those naturally imposed by AAV or other virus-based vectors.

[0270] The presence of a ceDNA vector isolated from a host cell can be confirmed by digesting the DNA isolated from the host cell with a restriction enzyme that has a single recognition site on the ceDNA vector and analyzing the digested DNA material on a non-denaturing gel to confirm the presence of a characteristic linear and continuous DNA band compared to linear and discontinuous DNA.

[0271] In yet another aspect, the present disclosure provides for the use of host cell lines that have stably integrated a DNA vector polynucleotide expression template (ceDNA template) into their own genome in the production of non-viral DNA vectors, as described, for example, in Lee, L. et al. (2013) Plos One 8(8):e69879. Preferably, Rep is added to the host cells at an MOI of about 3. When the host cell line is a mammalian cell line, e.g., HEK293 cells, the cell line may have a stably integrated polynucleotide vector template, and a second vector, such as a herpesvirus, may be used to introduce Rep proteins into the cells, allowing for excision and amplification of the ceDNA in the presence of Rep and a helper virus.

[0272] According to some embodiments, the host cells used to generate ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein are insect cells, and baculovirus is used to deliver both the polynucleotide encoding the Rep protein and the non-viral DNA vector polynucleotide expression construct template for ceDNA, e.g., as described in Figures 4A-4C and Example 1. According to some embodiments, the host cells are engineered to express the Rep protein.

[0273] The ceDNA vector is then harvested and isolated from the host cells. The time for harvesting and collecting the ceDNA vector described herein from the cells can be selected and optimized to achieve high-yield production of the ceDNA vector. For example, the harvest time can be selected taking into account cell viability, cell morphology, cell growth, etc. In one embodiment, the cells are grown and harvested after sufficient time has passed since baculovirus infection to produce the ceDNA vector, but before most of the cells begin to die due to baculovirus toxicity. The DNA vector can be isolated using a plasmid purification kit, such as the Qiagen Endo-Free Plasmid Kit. Other methods developed for plasmid isolation can also be adapted for DNA vectors. Generally, any nucleic acid purification method can be employed.

[0274] The DNA vectors can be purified by any means known to those skilled in the art for purifying DNA. According to some embodiments, the ceDNA vectors are purified as DNA molecules. In other embodiments, the ceDNA vectors are purified as exosomes or microparticles.

[0275] The presence of ceDNA vectors for expression of antibodies and antigen-binding fragments thereof can be confirmed by digesting vector DNA isolated from cells with a restriction enzyme that has a single recognition site on the DNA vector and analyzing both the digested and undigested DNA material using gel electrophoresis to confirm the presence of a characteristic linear and continuous DNA band compared to linear and discontinuous DNA. Figures 4C and 4D show one embodiment for identifying the presence of closed-ended ceDNA vectors produced by the processes herein.

[0276] According to some embodiments, the ceDNA is produced synthetically in a cell-free environment.

[0277] B.ceDNA Plasmid The ceDNA-plasmid is a plasmid used in the subsequent production of ceDNA vectors for the expression of antibodies and antigen-binding fragments thereof. According to some embodiments, the ceDNA-plasmid can be constructed using known techniques to provide, as operably linked components in the transcriptional direction, at least (1) a modified 5' ITR sequence, (2) an expression cassette containing cis-regulatory elements, such as a promoter, an inducible promoter, a regulatory switch, an enhancer, and the like, and (3) a modified 3' ITR sequence (the 3' ITR sequence is symmetrical to the 5' ITR sequence). In some embodiments, the expression cassette flanked by ITRs contains cloning sites for introducing exogenous sequences. The expression cassette replaces the rep and cap coding regions of the AAV genome.

[0278] In one aspect, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof are derived from plasmids, referred to herein as "ceDNA-plasmids," that encode, in this order, a first adeno-associated virus (AAV) inverted terminal repeat (ITR), an expression cassette comprising a transgene, and a mutated or modified AAV ITR, wherein the ceDNA-plasmid lacks the AAV capsid protein coding sequence. In an alternative embodiment, a ceDNA-plasmid encodes, in this order, a first (or 5') modified or mutated AAV ITR, an expression cassette comprising a transgene, and a second (or 3') modified AAV ITR, wherein the ceDNA-plasmid lacks the AAV capsid protein coding sequence, and the 5' and 3' ITRs are symmetrical with respect to each other. In an alternative embodiment, the ceDNA-plasmid encodes, in that order, a first (or 5') modified or mutated AAV ITR, an expression cassette containing a transgene, and a second (or 3') mutated or modified AAV ITR, wherein the ceDNA-plasmid lacks the AAV capsid protein coding sequence, and the 5' and 3' modified ITRs have the same modifications (i.e., they are reverse complementary or symmetrical to each other).

[0279] In further embodiments, the ceDNA-plasmid system lacks viral capsid protein coding sequences (i.e., it lacks not only the AAV capsid gene but also the capsid genes of other viruses). In addition, in certain embodiments, the ceDNA-plasmid also lacks the AAV Rep protein coding sequence. Thus, in preferred embodiments, the ceDNA-plasmid lacks functional AAV cap and AAV rep genes (GG-3' in the case of AAV2) as well as a variable palindrome sequence that allows hairpin formation.

[0280] The ceDNA-plasmids of the present disclosure can be generated using the native nucleic acid sequence of the genome of any AAV serotype known in the art, in one embodiment, the ceDNA-plasmid backbone is derived from the AAV1, AAV2, AAV3, AAV4, AAV5, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genome. See, e.g., NCBI: NC002077, NC001401, NC001729, NC001829, NC006152, NC006260, NC006261; Kotin and Smith, The Springer Index of Viruses, available at the URL maintained by Springer (www web address: oesys.springer.de / viruses / database / mkchapter.asp?virID=42.04) (Note - references to a URL or database refer to the URL or database contents as of the effective filing date of this application). In a specific embodiment, the ceDNA-plasmid backbone is derived from the AAV2 genome. In another specific embodiment, the ceDNA-plasmid backbone is a synthetic backbone engineered to include 5' and 3' ITRs from one of these AAV genomes.

[0281] The ceDNA-plasmid may optionally contain a selectable or selectable marker for use in establishing a ceDNA vector-producing cell line. In one embodiment, the selectable marker may be inserted downstream (i.e., 3') of the 3' ITR sequence. In another embodiment, the selectable marker may be inserted upstream (i.e., 5') of the 5' ITR sequence. Suitable selectable markers include, for example, those that confer drug resistance. Selectable markers may be, for example, the blasticidin S resistance gene, kanamycin, geneticin, etc. In a preferred embodiment, the drug selectable marker is the blasticidin S resistance gene.

[0282] Exemplary ceDNA (e.g., rAAV0) vectors for expression of antibodies and antigen-binding fragments thereof are produced from rAAV plasmids. Methods for producing rAAV vectors can include (a) providing a host cell with an rAAV plasmid as described above, where both the host cell and the plasmid lack a capsid protein-encoding gene, (b) culturing the host cell under conditions that allow for the production of a ceDNA genome, and (c) harvesting the cells and isolating the AAV genome produced from the cells.

[0283] C. Exemplary Methods for Producing ceDNA Vectors from ceDNA Plasmids Also provided herein are methods for generating capsid-free ceDNA vectors for expression of antibodies and antigen-binding fragments thereof, particularly methods with yields high enough to provide sufficient vectors for in vivo experiments.

[0284] According to some embodiments, a method for producing a ceDNA vector for expressing antibodies and antigen-binding fragments thereof comprises the steps of: (1) introducing a nucleic acid construct comprising an expression cassette and two symmetric ITR sequences into host cells (e.g., Sf9 cells); (2) optionally establishing a clonal cell line, e.g., by using a selectable marker present on the plasmid; (3) introducing a Rep-encoding gene into the insect cells (either by transfection or infection with a baculovirus carrying the gene); and (4) recovering the cells and purifying the ceDNA vector. The nucleic acid construct comprising the expression cassette and two ITR sequences described above for producing a ceDNA vector can be in the form of a ceDNA-plasmid, or a bacmid or baculovirus generated from the ceDNA plasmid as described below. The nucleic acid construct can be introduced into the host cells by transfection, viral transduction, stable integration, or other methods known in the art.

[0285] D. Cell line Host cell lines used in producing ceDNA vectors for expression of antibodies and antigen-binding fragments thereof can include insect cell lines derived from Spodoptera frugiperda (Sf9, Sf21, etc.) or Trichoplusia ni cells, or other eukaryotic cell lines, including other invertebrate, vertebrate, or mammalian cells. Other cell lines known to those skilled in the art, such as HEK293, Huh-7, HeLa, HepG2, Hep1A, 911, CHO, COS, MeWo, NIH3T3, A549, HT1 180, monocytes, and mature and immature dendritic cells, can also be used. Host cell lines can be transfected for stable expression of ceDNA-plasmids for high-yield ceDNA vector production.

[0286] The ceDNA-plasmid can be introduced into Sf9 cells by transient transfection using reagents known in the art (e.g., liposomes, calcium phosphate) or physical means (e.g., electroporation). Alternatively, stable Sf9 cell lines stably incorporating the ceDNA-plasmid into their genome can be established. Such stable cell lines can be established by incorporating a selection marker into the above-mentioned ceDNA-plasmid. If the ceDNA-plasmid used to transfect the cell line contains a selection marker such as an antibiotic, cells transfected with the ceDNA-plasmid and incorporating the ceDNA-plasmid DNA into their genome can be selected by adding the antibiotic to the cell growth medium. Resistant clones of cells can then be isolated and propagated by single-cell dilution or colony transfer techniques.

[0287] Isolate and purify E. ceDNA vector Exemplary processes for obtaining and isolating ceDNA vectors are described in Figures 4A-4E and in the specific examples below. ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein can be obtained from producer cells expressing AAV Rep proteins and further transformed with ceDNA-plasmids, ceDNA-bacmids, or ceDNA-baculoviruses. Plasmids useful for producing ceDNA vectors include plasmids encoding antibodies and antigen-binding fragments thereof, or plasmids encoding one or more REP proteins.

[0288] According to some embodiments, the polynucleotide encodes an AAV Rep protein (Rep78 or 68) that is delivered to a producer cell in a plasmid (Rep-plasmid), a bacmid (Rep-bacmid), or a baculovirus (Rep-baculovirus). The Rep-plasmid, Rep-bacmid, and Rep-baculovirus can be generated by the methods described above.

[0289] Methods for producing ceDNA vectors for expression of antibodies and antigen-binding fragments thereof are described herein. The expression constructs used to generate ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein can be plasmids (e.g., ceDNA-plasmids), bacmids (e.g., ceDNA-bacmids), and / or baculoviruses (e.g., ceDNA-baculoviruses). By way of example only, ceDNA vectors can be generated from cells co-infected with ceDNA-baculovirus and Rep-baculovirus. The Rep protein produced from the Rep-baculovirus can replicate the ceDNA-baculovirus to generate the ceDNA vector. Alternatively, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof can be generated from cells stably transfected with a construct comprising a sequence encoding the AAV Rep protein (Rep78 / 52) delivered in a Rep-plasmid, Rep-bacmid, or Rep-baculovirus. The ceDNA-baculovirus can be transiently transfected into cells and replicated by the Rep proteins to produce the ceDNA vector.

[0290] The bacmid (e.g., ceDNA-bacmid) can be transfected into permissive insect cells, such as Sf9, Sf21, Tni (Trichoplusia ni) cells, or High Five cells, to generate a ceDNA-baculovirus, a recombinant baculovirus containing sequences comprising the symmetric ITRs and an expression cassette. The ceDNA-baculovirus can be reinfected into insect cells to obtain the next generation of recombinant baculovirus. Optionally, this step can be repeated one or more times to produce larger quantities of recombinant baculovirus.

[0291] The time for harvesting and harvesting the ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein from cells can be selected and optimized to achieve high-yield production of the ceDNA vectors. For example, the harvest time can be selected taking into consideration cell viability, cell morphology, cell growth, etc. Typically, cells can be harvested after sufficient time has passed since baculovirus infection to produce the ceDNA vector (e.g., the ceDNA vector), but before the majority of the cells begin to die due to viral toxicity. The ceDNA vectors can be isolated from Sf9 cells using a plasmid purification kit, such as the Qiagen ENDO-FREE PLASMID® kit. Other methods developed for plasmid isolation can also be adapted for ceDNA vectors. Generally, any nucleic acid purification method known in the art, as well as commercially available DNA extraction kits, can be employed.

[0292] Alternatively, purification can be achieved by subjecting the cell pellet to an alkaline lysis process, centrifuging the resulting lysate, and performing chromatographic separation. As a non-limiting example, this process can be carried out by loading the supernatant onto an ion exchange column (e.g., SARTOBIND Q®) that retains nucleic acids, followed by elution (e.g., with a 1.2 M NaCl solution), and performing further chromatographic purification on a gel filtration column (e.g., 6 Fast Flow GE). The capsid-free AAV vector is then recovered, for example, by precipitation.

[0293] According to some embodiments, ceDNA vectors for expressing antibodies and their antigen-binding fragments can also be purified in the form of exosomes or microparticles. It is known in the art that many cell types release not only soluble proteins but also complex protein / nucleic acid cargoes through shedding of membrane microvesicles (Cocucci et al., 2009, EP 10306226.1). Such vesicles include microvesicles (also called microparticles) and exosomes (also called nanovesicles), both of which contain proteins and RNA as cargo. Microvesicles are generated by direct budding of the plasma membrane, while exosomes are released into the extracellular environment upon fusion of multivesicular endosomes with the plasma membrane. Therefore, microvesicles and / or exosomes containing ceDNA vectors can be isolated from cells transduced with ceDNA plasmids or bacmids or baculoviruses produced with the ceDNA plasmids.

[0294] Microvesicles can be isolated by filtering the culture medium or subjecting it to ultracentrifugation at 20,000 × g, while exosomes can be isolated at 100,000 × g. The optimal duration of ultracentrifugation can be determined experimentally and depends on the specific cell type from which vesicles are isolated. Preferably, the culture medium is first cleared by low-speed centrifugation (e.g., 2000 × g for 5–20 minutes) and then subjected to spin concentration, for example, using an AMICON® spin column (Millipore, Watford, UK). Microvesicles and exosomes can be further purified via FACS or MACS by using specific antibodies that recognize specific surface antigens present on microvesicles and exosomes. Other microvesicle and exosome purification methods include, but are not limited to, immunoprecipitation, affinity chromatography, filtration, and magnetic beads coated with specific antibodies or aptamers. During purification, vesicles are washed, for example, with phosphate-buffered saline. One advantage of using microvesicles or exosomes to deliver ceDNA-containing vesicles is that these vesicles can be targeted to various cell types by containing on them membrane proteins that are recognized by specific receptors on each cell type (see also EP 10306226).

[0295] Another aspect of the present disclosure herein relates to a method for purifying ceDNA vectors from host cell lines that have stably integrated the ceDNA construct into their genome. According to some embodiments, the ceDNA vectors are purified as DNA molecules. In another embodiment, the ceDNA vectors are purified as exosomes or microparticles.

[0296] Figure 5 of International Application No. US 18 / 49996 shows a gel confirming the production of ceDNA from several ceDNA-plasmid constructs using the methods described in the Examples. The ceDNA is confirmed by the characteristic banding pattern in the gel, as discussed with respect to Figure 4D in the Examples.

[0297] VI. Pharmaceutical Compositions In another aspect, pharmaceutical compositions are provided, comprising a ceDNA vector for expression of the antibodies and antigen-binding fragments thereof described herein, and a pharmaceutically acceptable carrier or diluent.

[0298] The ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein can be incorporated into pharmaceutical compositions suitable for administration to a subject for in vivo delivery to the subject's cells, tissues, or organs. Typically, the pharmaceutical composition comprises a ceDNA vector disclosed herein and a pharmaceutically acceptable carrier.

[0299] The pharmaceutical formulations disclosed herein include liquids, such as aqueous solutions, that can be administered directly, and lyophilized powders that can be reconstituted into a solution by adding a diluent prior to administration. In certain embodiments, formulations comprising the ceDNA vectors disclosed herein, with or without at least one additional therapeutic agent, can be formulated as lyophilizates using appropriate excipients. Lyophilization can be carried out using a standard lyophilization cycle on a commercially available lyophilizer (e.g., a VirTis Lab Scale Lyophilizer).

[0300] According to some embodiments, the ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein can be incorporated into pharmaceutical compositions suitable for the desired route of therapeutic administration (e.g., parenteral administration). Passive tissue transduction via high-pressure intravenous or intra-arterial infusion, as well as intracellular injections such as intranuclear microinjections or intracytoplasmic injections, are also contemplated. Pharmaceutical compositions for therapeutic purposes can be formulated as solutions, microemulsions, dispersions, liposomes, or other ordered structures suitable for high ceDNA vector concentrations. Sterile injection solutions can be prepared by incorporating the required amount of ceDNA vector compounds in an appropriate buffer, optionally with one or a combination of the ingredients listed above, followed by filter sterilization containing the ceDNA vector, and can be formulated to deliver the transgene in the nucleic acid to recipient cells, resulting in therapeutic expression of the transgene or donor sequence therein. The composition can also include a pharmaceutically acceptable carrier.

[0301] Pharmaceutically active compositions, including ceDNA vectors for expression of antibodies and antigen-binding fragments thereof, can be formulated to deliver transgenes for a variety of purposes to cells, e.g., cells of a subject.

[0302] Pharmaceutical compositions for therapeutic purposes typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable for high ceDNA vector concentration. Sterile injectable solutions can be prepared by incorporating the required amount of ceDNA vector compounds in an appropriate buffer with one or a combination of the above-listed ingredients, as needed, and sterilizing by filtration.

[0303] In certain embodiments, formulations for parenteral administration can be stored in lyophilized form or in a solution. Compounds of the invention generally are parenteral formulations placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.

[0304] In certain embodiments, once the pharmaceutical formulation has been formulated, it may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or as a dehydrated or lyophilized powder. In certain embodiments, such formulations may be stored either in a ready-to-use form or in a form (e.g., lyophilized) that is reconstituted prior to administration.

[0305] The ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein can be incorporated into pharmaceutical compositions suitable for local, systemic, intra-amniotic, intrathecal, intracranial, intra-arterial, intravenous, intralymphatic, intraperitoneal, subcutaneous, tracheal, intratissue (e.g., intramuscular, intracardiac, intrahepatic, intrarenal, intracerebral), intrathecal, intravesical, conjunctival (e.g., extraorbital, intraorbital, retroorbital, intraretinal, subretinal, choroidal, subchoroidal, intrainterstitial, intracavitary, intravitreal), and intracochlear, and mucosal (e.g., oral, rectal, nasal) administration. Passive tissue transduction via high-pressure intravenous or intra-arterial infusion is also contemplated, as are intracellular injections such as intranuclear microinjection or intracytoplasmic injection.

[0306] According to some embodiments, the methods provided herein include delivering one or more ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein to a host cell. Also provided herein are cells produced by such methods and organisms (such as animals, plants, or fungi) containing or produced from such cells. Nucleic acid delivery methods may include lipofection, nucleofection, microinjection, particle bombardment, liposomes, immunoliposomes, polycations, or lipid:nucleic acid conjugates, naked DNA, and drug-enhanced DNA uptake. Lipofection is described, for example, in U.S. Pat. Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam™ and Lipofectin™). Delivery may be to cells (e.g., in vitro or ex vivo administration) or to target tissues (e.g., in vivo administration).

[0307] Various techniques and methods for delivering nucleic acids to cells are known in the art. For example, nucleic acids such as ceDNA for expressing antibodies and their antigen-binding fragments can be formulated in lipid nanoparticles (LNPs), lipidoids, liposomes, lipid nanoparticles, lipoplexes, or core-shell nanoparticles. Typically, LNPs are composed of nucleic acid (e.g., ceDNA) molecules, one or more ionized or cationic lipids (or their salts), one or more nonionic or neutral lipids (e.g., phospholipids), molecules that prevent aggregation (e.g., PEG or PEG-lipid conjugates), and optionally sterols (e.g., cholesterol).

[0308] Another method for delivering nucleic acids, such as ceDNA for expressing antibodies and antigen-binding fragments thereof, into cells is by complexing the nucleic acid with a ligand that is internalized by the cell. For example, the ligand can bind to a receptor on the cell surface and be internalized via endocytosis. The ligand can be covalently linked to a nucleotide in the nucleic acid. Exemplary conjugates for delivering nucleic acids into cells are described, for example, in International Publication Nos. 2015 / 006740, 2014 / 025805, 2012 / 037254, 2009 / 082606, 2009 / 073809, 2009 / 018332, 2006 / 112872, 2004 / 090108, 2004 / 091515, and 2017 / 177326.

[0309] Nucleic acids, such as ceDNA, for expression of antibodies and antigen-binding fragments thereof can also be delivered to cells by transfection. Useful transfection methods include, but are not limited to, lipid-mediated transfection, cationic polymer-mediated transfection, or calcium phosphate precipitation. Transfection reagents are well known in the art and include TurboFect transfection reagent (Thermo Fisher Scientific), Pro-Ject reagent (Thermo Fisher Scientific), TRANSPASS™ P protein transfection reagent (New England Biolabs), CHARIOT™ protein delivery reagent (Active Motif), PROTEOJUICE™ protein transfection reagent (EMD Millipore), 293fectin, LIPOFECTAMINE™ 2000, LIPOFECTAMINE™ 3000 (Thermo Fisher Scientific), LIPOFECTAMINE™ (Thermo Fisher Scientific), LIPOFECTIN™ (Thermo Fisher Scientific), DMRIE-C, CELLFECTIN™ (Thermo Fisher Scientific), OLIGOFECTAMINE™ (Thermo Fisher Scientific), and LIPOFECTAMINE™ (Thermo Fisher Scientific). Scientific), LIPOFECTACE(TM), FUGENE(TM)(Roche, Basel, Switzerland), FUGENE(TM) HD(Roche), TRANSFECTAM(TM)(Transfectam, Promega, Madison, Wis.), TFX-10(TM)(Pr omega), TFX-20(TM)(Promega), TFX-50(TM)(Promega), TRANSFECTIN(TM)(BioRad, Hercules, Calif.), SILENTFECT(TM)(Bio-Rad), Effectene(TM)(Qiagen, Valencia, Calif.).), DC-chol (Avanti Polar Lipids), GENEPORTER™ (Gene Therapy Systems, San Diego, Calif.), DHARMAFECT 1™ (Dharmacon, Lafayette, Colo.), DHARMAFECT 2™ (Dharmacon), DHARMAFECT 3™ (Dharmacon), DHARMAFECT 4™ (Dharmacon), ESCORT™ III (Sigma, St. Louis, Mo.), and ESCORT™ IV (Sigma Chemical Co.). Nucleic acids, such as cDNA, can also be delivered to cells via microfluidics methods known to those skilled in the art.

[0310] The ceDNA vectors for expressing the antibodies and antigen-binding fragments thereof described herein can also be administered directly to an organism for in vivo cell transduction. Administration can be by any of the routes typically used to ultimately bring molecules into contact with blood or tissue cells, including, but not limited to, injection, infusion, topical application, and electroporation. Suitable methods for administering such nucleic acids are available and well known to those skilled in the art, and while more than one route can be used to administer a particular composition, certain routes can often provide a more immediate and effective response than other routes.

[0311] ceDNA vectors for expression of antibodies and antigen-binding fragments thereof according to the present disclosure can be incorporated into liposomes for delivery to cells or target organs in a subject. Liposomes are vesicles with at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic drug delivery in the context of formulation development. They act by fusing with cell membranes and rearranging their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposomal compositions for such delivery are composed of compounds with phospholipids, particularly phosphatidylcholine, although these compositions may also contain other lipids. Exemplary liposomes and liposomal formulations, including, but not limited to, polyethylene glycol (PEG)-functionalized compounds, are disclosed in International Application Nos. US2018 / 050042, filed September 7, 2018, and US2018 / 064242, filed December 6, 2018; see, e.g., the section entitled "Pharmaceutical Formulations."

[0312] ceDNA vectors can be delivered in vitro or in vivo using various delivery methods known in the art or modifications thereof. For example, in some embodiments, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof are delivered by creating transient punctures in cell membranes using mechanical, electrical, ultrasonic, hydrodynamic, or laser-based energy, thereby facilitating DNA entry into targeted cells. For example, ceDNA vectors can be delivered by squeezing cells through size-restricted channels or by temporarily disrupting cell membranes by other means known in the art. According to some embodiments, the ceDNA vector alone is injected as naked DNA directly into any one or more tissues selected from the lung, liver, kidney, gallbladder, prostate, adrenal gland, heart, intestine, stomach, skin, thymus, cardiac muscle, or skeletal muscle. According to some embodiments, the ceDNA vector is delivered by a gene gun. Gold or tungsten spherical particles (1-3 μm diameter) coated with capsid-free AAV vectors can be accelerated to high speeds by pressurized gas and penetrate into target tissue cells.

[0313] Specifically contemplated herein are compositions comprising a ceDNA vector and a pharmaceutically acceptable carrier for expression of antibodies and antigen-binding fragments thereof. According to some embodiments, the ceDNA vector is formulated in a lipid delivery system, such as the liposomes described herein. According to some embodiments, such compositions are administered by any route desired by a skilled practitioner. The compositions can be administered to a subject by different routes, including orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, intrapleurally, intravenously, intraarterially, intraperitoneally, subcutaneously, intramuscularly, intranasally, intrathecally, and intraarticularly, or combinations thereof. For veterinary use, the compositions can be administered in a suitably acceptable formulation according to standard veterinary practice. A veterinarian can readily determine the most appropriate dosing regimen and route of administration for a particular animal. The compositions can be administered by conventional syringes, needleless injection devices, "microprojectile bombardment guns," or other physical methods such as electroporation ("EP"), "hydrodynamic methods," or ultrasound.

[0314] In some cases, ceDNA vectors for the expression of antibodies and their antigen-binding fragments are delivered by hydrodynamic injection, a simple and highly efficient method for the direct intracellular delivery of any water-soluble compound and particle to skeletal muscles throughout the viscera and limbs.

[0315] According to some embodiments, ceDNA vectors for the expression of antibodies and antigen-binding fragments thereof are delivered by ultrasound by creating nanoscopic pores in the membrane, facilitating the intracellular delivery of DNA particles to cells of internal organs or tumors, so the size and concentration of the plasmid DNA play a major role in the efficiency of this system. According to some embodiments, ceDNA vectors are delivered by magnetofection by using a magnetic field to concentrate the nucleic acid-containing particles in the target cells.

[0316] According to some embodiments, chemical delivery systems can be used, for example, by using nanomer complexes comprising the compression of negatively charged nucleic acids with cationic liposomes / micelles or polycationic nanomer particles belonging to cationic polymers. Cationic lipids used in delivery methods include, but are not limited to, monovalent cationic lipids, polyvalent cationic lipids, guanidine-containing compounds, cholesterol-derivatized compounds, cationic polymers (e.g., poly(ethyleneimine), poly-L-lysine, protamine, other cationic polymers), and lipid-polymer hybrids.

[0317] A. Exosomes: In some embodiments, ceDNA vectors for expression of antibodies and antigen-binding fragments thereof disclosed herein are delivered by packaging them into exosomes. Exosomes are small membrane vesicles of endocytic origin that are released into the extracellular environment following fusion of multivesicular bodies with the plasma membrane. Their surface consists of a lipid bilayer from the plasma membrane of the donor cell, and they contain cytosol from the cell that produced the exosome and exhibit membrane proteins from the parent cell on their surface. Exosomes are produced by various cell types, including epithelial cells, B and T lymphocytes, mast cells (MCs), as well as dendritic cells (DCs). According to some embodiments, exosomes with diameters of 10 nm to 1 μm, 20 nm to 500 nm, 30 nm to 250 nm, or 50 nm to 100 nm are contemplated for use. Exosomes can be isolated for delivery to target cells either by using their donor cells or by introducing specific nucleic acids into them. Various approaches known in the art can be used to produce exosomes containing the capsid-free AAV vectors of the present disclosure.

[0318] B. Microparticles / Nanoparticles According to some embodiments, the ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein are delivered via lipid nanoparticles. Generally, lipid nanoparticles comprise an ionizable amino lipid (e.g., heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate, DLin-MC3-DMA, phosphatidylcholine (1,2-distearoyl-sn-glycero-3-phosphocholine, DSPC), cholesterol, and a coating lipid (polyethylene glycol-dimyristolglycerol, PEG-DMG), as disclosed, for example, by Tam et al. (2013). Advances in Lipid Nanoparticles for siRNA delivery. Pharmaceuticals 5(3):498-507.

[0319] According to some embodiments, the lipid nanoparticles have an average diameter of about 10 to about 1000 nm. According to some embodiments, the lipid nanoparticles have a diameter of less than 300 nm. According to some embodiments, the lipid nanoparticles have a diameter of about 10 to about 300 nm. According to some embodiments, the lipid nanoparticles have a diameter of less than 200 nm. According to some embodiments, the lipid nanoparticles have a diameter of about 25 to about 200 nm. According to some embodiments, the lipid nanoparticle preparation (e.g., a composition comprising a plurality of lipid nanoparticles) has a size distribution, with an average size (e.g., diameter) of about 70 nm to about 200 nm, more typically an average size of about 100 nm or less.

[0320] Various lipid nanoparticles known in the art can be used to deliver the ceDNA vector for expressing the antibody and its antigen-binding fragments disclosed herein.For example, various delivery methods using lipid nanoparticles are described in US Patent No. 9,404,127, US Patent No. 9,006,417 and US Patent No. 9,518,272.

[0321] C. Conjugate According to some embodiments, the ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein are conjugated (e.g., covalently linked to an agent that increases cellular uptake). An "agent that increases cellular uptake" is a molecule that promotes the transport of nucleic acids through lipid membranes. For example, nucleic acids may be conjugated to lipophilic compounds (e.g., cholesterol, tocopherol, etc.), cell penetrating peptides (CPPs) (e.g., penetratin, TAT, Syn1B, etc.), and polyamines (e.g., spermine). Further examples of agents that increase cellular uptake are disclosed, for example, in Winkler (2013). Oligonucleotide conjugates for therapeutic applications. Ther. Deliv. 4(7); 791-809.

[0322] According to some embodiments, the ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein are conjugated to a polymer (e.g., a polymer molecule) or a folate molecule (e.g., a folic acid molecule). In general, delivery of polymer-conjugated nucleic acids is known in the art, for example, as described in WO 2000 / 34343 and WO 2008 / 022309. According to some embodiments, the ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein are conjugated to a poly(amide) polymer, for example, as described by U.S. Pat. No. 8,987,377. According to some embodiments, the nucleic acids described by the present disclosure are conjugated to a folic acid molecule, as described in U.S. Pat. No. 8,507,455.

[0323] According to some embodiments, the ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein are conjugated to carbohydrates, for example, as described in U.S. Pat. No. 8,450,467.

[0324] D. Nanocapsules Alternatively, nanocapsule formulations of ceDNA vectors for expressing the antibodies and antigen-binding fragments thereof disclosed herein can be used. Nanocapsules can generally entrap substances in a stable and reproducible manner. To avoid side effects caused by intracellular polymer overload, such fine particles (approximately 0.1 μm in size) should be designed using polymers that can be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.

[0325] E. Liposomes The ceDNA vectors for expression of antibodies and antigen-binding fragments thereof according to the present disclosure can be incorporated into liposomes for delivery to cells or target organs in a subject. Liposomes are vesicles with at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic drug delivery in the context of formulation development. They act by fusing with cell membranes and rearranging their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposome compositions for such delivery are composed of compounds containing phospholipids, particularly phosphatidylcholine, although these compositions may also contain other lipids.

[0326] The formation and use of liposomes are generally known to those skilled in the art. Liposomes with improved serum stability and circulation half-lives have been developed (U.S. Patent No. 5,741,516). Furthermore, various methods for preparing liposomes and liposome-like preparations as potential drug carriers have been described (U.S. Patent Nos. 5,567,434, 5,552,157, 5,565,213, 5,738,868, and 5,795,587).

[0327] F. Exemplary Liposome and Lipid Nanoparticle (LNP) Compositions The ceDNA vectors for expression of antibodies and antigen-binding fragments thereof according to the present disclosure can be attached to liposomes for delivery to cells, e.g., cells requiring transgene expression. Liposomes are vesicles with at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic drug delivery in the context of formulation development. They act by fusing with cell membranes and rearranging their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposome compositions for such delivery are composed of compounds containing phospholipids, particularly phosphatidylcholine, although these compositions may also contain other lipids.

[0328] Lipid nanoparticles (LNPs) containing ceDNA vectors are disclosed in International Application Nos. US2018 / 050042, filed September 7, 2018, and US2018 / 064242, filed December 6, 2018, which are incorporated herein in their entireties, and are contemplated for use in the methods and compositions for ceDNA vectors for expression of antibodies and antigen-binding fragments thereof disclosed herein.

[0329] In some embodiments, the present disclosure provides liposomal formulations containing one or more compounds having polyethylene glycol (PEG) functional groups (so-called "PEGylated compounds"), which can reduce immunogenicity / antigenicity, provide hydrophilic and hydrophobic properties to the compounds, and reduce dosing frequency. Alternatively, the liposomal formulations simply contain polyethylene glycol (PEG) polymers as additional components. In such embodiments, the molecular weight of the PEG or PEG functional group can be between 62 Da and about 5,000 Da.

[0330] According to some embodiments, the present disclosure provides liposomal formulations that will deliver APIs with extended- or controlled-release profiles over a period of hours to weeks. In some related embodiments, the liposomal formulations can include aqueous chambers bounded by a lipid bilayer. In other related embodiments, the liposomal formulations encapsulate APIs with components that undergo a physical transition at elevated temperatures, releasing the API over a period of hours to weeks.

[0331] According to some embodiments, the liposomal formulation comprises sphingomyelin and one or more lipids disclosed herein. According to some embodiments, the liposomal formulation comprises an optisome.

[0332] In some aspects, the present disclosure provides a lipid composition comprising N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, (distearoyl-sn-glycero-phosphoethanolamine), MPEG (methoxypolyethylene glycol conjugated lipid, HSPC (hydrogenated soy phosphatidylcholine), PEG (polyethylene glycol), DSPE (distearoyl-sn-glycero-phosphoethanolamine), DSPC (distearoylphosphatidylcholine), DOPC (dioleoylphosphatidylcholine), DPPG (dipalmitoylphosphatidylglycerol), EPC (egg phosphatidylcholine), DOPS (dioleoyl ... DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DO and DMPG (dimyristoylphosphatidylglycerol), DSPG (distearoylphosphatidylglycerol), DEPC (dioleoyl-sn-glycero-phosphoethanolamine), cholesterol sulfate (CS), dipalmitoylphosphatidylglycerol (DPPG), DOPC (dioleoyl-sn-glycero-phosphatidylcholine), or any combination thereof.

[0333] According to some embodiments, the present disclosure provides a liposome formulation comprising a phospholipid, cholesterol, and a PEGylated lipid in a molar ratio of 56:38:5. According to some embodiments, the total lipid content of the liposome formulation is 2-16 mg / mL. According to some embodiments, the present disclosure provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, a lipid containing an ethanolamine functional group, and a PEGylated lipid. According to some embodiments, the present disclosure provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, a lipid containing an ethanolamine functional group, and a PEGylated lipid in a molar ratio of 3:0.015:2, respectively. According to some embodiments, the present disclosure provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, cholesterol, and a PEGylated lipid. According to some embodiments, the present disclosure provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group and cholesterol. According to some embodiments, the PEGylated lipid is PEG-2000-DSPE. According to some aspects, the present disclosure provides a liposome formulation comprising DPPG, soy PC, an MPEG-DSPE lipid conjugate, and cholesterol.

[0334] According to some embodiments, the present disclosure provides liposome formulations comprising one or more lipids containing a phosphatidylcholine functional group and one or more lipids containing an ethanolamine functional group. According to some embodiments, the present disclosure provides liposome formulations comprising one or more lipids containing a phosphatidylcholine functional group, a lipid containing an ethanolamine functional group, and a sterol, such as cholesterol. According to some embodiments, the liposome formulation comprises DOPC / DEPC and DOPE.

[0335] According to some embodiments, the present disclosure provides liposomal formulations further comprising one or more pharmaceutical excipients, for example, sucrose and / or glycine.

[0336] In some embodiments, the present disclosure provides liposome formulations having either a unilamellar or multilamellar structure. In some embodiments, the present disclosure provides liposome formulations comprising multivesicular particles and / or foam-based particles. In some embodiments, the present disclosure provides liposome formulations having a size larger than that of typical nanoparticles, approximately 150 to 250 nm. In some embodiments, the liposome formulation is a lyophilized powder.

[0337] In some embodiments, the present disclosure provides liposomal formulations prepared and loaded with the ceDNA vectors disclosed or described herein by adding a weak base to a mixture containing isolated ceDNA outside the liposome. This addition increases the pH outside the liposome to approximately 7.3, driving the API into the liposome. In some embodiments, the present disclosure provides liposomal formulations having an acidic pH inside the liposome. In such cases, the inside of the liposome may be pH 4 to 6.9, more preferably pH 6.5. In other embodiments, the present disclosure provides liposomal formulations prepared using intraliposomal drug stabilization techniques. In such cases, a polymeric or non-polymeric highly charged anion and an intraliposomal entrapment agent, such as polyphosphate or sucrose octasulfate, are utilized.

[0338] According to some embodiments, the present disclosure provides lipid nanoparticles containing ceDNA and ionized lipids. For example, lipid nanoparticle formulations prepared and loaded with ceDNA obtained by the process are disclosed in International Application No. US2018 / 050042, filed September 7, 2018, and incorporated herein. This can be achieved by high-energy mixing of ethanolic lipids with aqueous ceDNA at low pH, which protonates the ionized lipids and provides favorable energetics for ceDNA / lipid association and nucleation of the particles. The particles can be further stabilized by aqueous dilution and removal of the organic solvent. The particles can be concentrated to a desired level.

[0339] Typically, lipid nanoparticles are prepared at a total lipid to ceDNA (mass or weight) ratio of about 10:1 to 60:1. According to some embodiments, the lipid to ceDNA ratio (mass / mass ratio, w / w ratio) can be within the range of about 1:1 to about 60:1, about 1:1 to about 55:1, about 1:1 to about 50:1, about 1:1 to about 45:1, about 1:1 to about 40:1, about 1:1 to about 35:1, about 1:1 to about 30:1, about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, about 6:1 to about 9:1, or about 30:1 to about 60:1. According to some embodiments, lipid particles (e.g., lipid nanoparticles) are prepared at a ceDNA (mass or weight) to total lipid ratio of about 60:1. According to some embodiments, lipid particles are prepared with a total lipid-to-ceDNA (mass or weight) ratio of about 10:1 to 30:1. According to some embodiments, the lipid-to-ceDNA ratio (mass / mass ratio, w / w ratio) can be within the range of about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amount of lipid and ceDNA can be adjusted to provide a desired N / P ratio, e.g., an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10, or greater. Generally, the total lipid content of lipid particle formulations can range from about 5 mg / mL to about 30 mg / mL.

[0340] Ionizable lipids are typically used to condense nucleic acid cargoes, such as ceDNA, at low pH and to induce membrane association and membrane fusion.Generally, ionizable lipids are lipids that contain at least one amino group that is positively charged or protonated under acidic conditions, such as pH 6.5 or less.Ionizable lipids are also referred to herein as cationic lipids.

[0341] Exemplary ionizable lipids are described in International PCT Patent Publication Nos. 2015 / 095340, 2015 / 199952, 2018 / 011633, 2017 / 049245, 2015 / 061467, 2012 / 040184, 2012 / 000104, 2015 / 074085, 2016 / 081029, 2017 / 004143, 2017 / 075531, 2017 / 117528, 2011 / 022460, 2013 / 148541, 2013 / 116126, 2014 / 010026, 2015 ... 11 / 153120, 2012 / 044638, 2012 / 054365, 2011 / 090965, 2013 / 016058, 2012 / 162210, 2008 / 042973, 2010 / 129709, 2010 / 1 No. 44740, No. 2012 / 099755, No. 2013 / 049328, No. 2013 / 086322, No. 2013 / 086 No. 373, No. 2011 / 071860, No. 2009 / 132131, No. 2010 / 048536, No. 2010 / 088537 No. 2010 / 054401, No. 2010 / 054406, No. 2010 / 054405, No. 2010 / 054384, Same No. 2012 / 016184, Same No. 2009 / 086558, Same No. 2010 / 042877, Same No. 2011 / 000106, Same No. 2011 / 000107, 2005 / 120152, 2011 / 141705, 2013 / 126803, 20 06 / 007712, 2011 / 038160, 2005 / 121348, 2011 / 066651, 2009 / 127060, 2011 / 141704, 2006 / 069782, 2012 / 031043, 2013 / 006825, 2013 / 033563, 2013 / 089151, 2017 / 099823, 2015 / 095346, and 2013 / 086354, and U.S. Patent Publication Nos. 2016 / 0311759, 2015 / 0376115, 2016 / 0151284, 2017 / 0210697, 2015 / 0140070, and 2013 / 0178541,Same No. 2013 / 0303587, No. 2015 / 0141678, No. 2015 / 0239926, No. 2016 / 0376224, No. 2017 / 0119904, No. 2012 / 014989 No. 4, No. 2015 / 0057373, No. 2013 / 0090372, No. 2013 / 0274523, No. 2013 / 0274504, No. 2013 / 0274504, No. 2009 / 0023 No. 673, No. 2012 / 0128760, No. 2010 / 0324120, No. 2014 / 0200257, No. 2015 / 0203446, No. 2018 / 0005363, No. 2014 / 0 308304, 2013 / 0338210, 2012 / 0101148, 2012 / 0027796, 2012 / 0058144, 2013 / 0323269, 2011 / 0117125, 2011 / 0256175, 2012 / 0202871, 2011 / 0076335, 2006 / 0083780, 2013 / 0123338, 2 015 / 0064242, 2006 / 0051405, 2013 / 0065939, 2006 / 0008910, 2003 / 0022649, 2010 / 0130588, Nos. 2013 / 0116307, 2010 / 0062967, 2013 / 0202684, 2014 / 0141070, 2014 / 0255472, 2014 / 0039032, 2018 / 0028664, 2016 / 0317458, and 2013 / 0195920, the contents of all of which are incorporated herein by reference in their entireties.

[0342] According to some embodiments, the ionizable lipid is MC3(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoic acid (DLin-MC3-DMA or MC3), having the following structure:

[0343] [ka]

[0344] The lipid DLin-MC3-DMA is described in Jayaraman et al., Angew. Chem. Int. Ed Engl. (2012), 51(34):8529-8533, the contents of which are incorporated herein by reference in their entirety.

[0345] According to some embodiments, the ionizable lipid is the lipid ATX-002, described in WO 2015 / 074085, the contents of which are incorporated herein by reference in their entirety.

[0346] According to some embodiments, the ionizable lipid is (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine (compound 32), which is described in WO 2012 / 040184, the contents of which are incorporated herein by reference in their entirety.

[0347] According to some embodiments, the ionizable lipid is compound 6 or compound 22, described in WO 2015 / 199952, the contents of which are incorporated herein by reference in their entirety.

[0348] Without limitation, the ionizable lipids may comprise 20-90% (mol) of the total lipids present in the lipid nanoparticles. For example, the ionizable lipid molar content may be 20-70% (mol), 30-60% (mol), or 40-50% (mol) of the total lipids present in the lipid nanoparticles. According to some embodiments, the ionizable lipids comprise about 50 mol% to about 90 mol% of the total lipids present in the lipid nanoparticles.

[0349] In some embodiments, the lipid nanoparticles may further comprise a non-cationic lipid. Non-ionic lipids include amphipathic lipids, neutral lipids, and anionic lipids. Thus, the non-cationic lipid may be a neutral, uncharged, zwitterionic, or anionic lipid. Non-cationic lipids are typically used to enhance membrane fusogenicity.

[0350] Exemplary non-cationic lipids contemplated for use in the methods and compositions disclosed herein are described in International Application Nos. US2018 / 050042, filed September 7, 2018, and US2018 / 064242, filed December 6, 2018. Exemplary non-cationic lipids are described in International Application Publication No. 2017 / 099823 and U.S. Patent Publication No. 2018 / 0028664, the contents of both of which are incorporated herein by reference in their entireties.

[0351] The non-cationic lipids may comprise 0-30% (mol) of the total lipids present in the lipid nanoparticles. For example, the non-cationic lipid content is 5-20% (mol) or 10-15% (mol) of the total lipids present in the lipid nanoparticles. In various embodiments, the molar ratio of ionizable lipid to neutral lipid ranges from about 2:1 to about 8:1.

[0352] According to some embodiments, the lipid nanoparticles are completely free of phospholipids. According to some aspects, the lipid nanoparticles may further comprise components such as sterols to provide membrane integrity.

[0353] One exemplary sterol that can be used in lipid nanoparticles is cholesterol and its derivatives. Exemplary cholesterol derivatives are described in International Application No. 2009 / 127060 and U.S. Patent Publication No. 2010 / 0130588, the contents of both of which are incorporated herein by reference in their entirety.

[0354] Components that provide membrane integrity, such as sterols, may comprise 0-50% (mol) of the total lipids present in the lipid nanoparticles. According to some embodiments, such components comprise 20-50% (mol), 30-40% (mol), or even 30-40% (mol) of the total lipid content of the lipid nanoparticles.

[0355] According to some aspects, the lipid nanoparticles may further comprise polyethylene glycol (PEG) or conjugated lipid molecules. These are generally used to inhibit aggregation of the lipid nanoparticles and / or provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic-polymer lipid (CPL) conjugates, and mixtures thereof. According to some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, for example, a (methoxypolyethylene glycol)-conjugated lipid. Exemplary PEG-lipid conjugates include PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG diacylglycerol succinate (PEGS-DAG) (4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG)), PEG dialkoxypropylcarbamate, N-(carbonyl-methoxypolyethyleneglycol), ... Examples of PEG-lipid conjugates include, but are not limited to, PEG-lipid conjugates such as PEG-lipid conjugates (sodium PEG-lipid conjugates), ...

[0356] In some embodiments, the PEG-lipid is a compound defined in U.S. Patent Application Publication No. 2018 / 0028664, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-lipid is disclosed in U.S. Patent Application Publication No. 2015 / 0376115 or U.S. Patent Application Publication No. 2016 / 0376224, the contents of both of which are incorporated herein by reference in their entirety.

[0357] The PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. The PEG-lipid can be, for example, PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol (1-[8'-(cholest-5-en-3[beta]-oxy)carboxamido-3',6'-dioxaotanyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG -DMB (3,4-ditetradecoxylbenzyl-[omega]-methyl-poly(ethylene glycol) ether), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid may be selected from the group consisting of PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000].

[0358] Lipids conjugated with molecules other than PEG can also be used instead of PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (CPL) conjugates can be used instead of or in addition to PEG-lipids. Exemplary conjugated lipids, i.e., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids, are described in WO 1996 / 010392, WO 1998 / 051278, WO 2002 / 087541, WO 2005 / 026372, WO 2008 / 147438, WO 2009 / 102006, WO 2009 / 102009 ... Nos. 09 / 086558, 2012 / 000104, 2017 / 117528, 2017 / 099823, 2015 / 199952, 2017 / 004143, 2015 / 095346, 2012 / 000104, 2012 / 000104, and 2010 / 006282, U.S. Patent Application Publication Nos. 2003 / 0077829, 2005 / 0175682, 2008 / 0020058, 2011 / 0117125, 2013 / 0303587, 2018 / 0028664, 2015 / 0376115, 2016 / 0376224, 2016 / 0317458, Nos. 2013 / 0303587, 2013 / 0303587, and 2011 / 0123453, and U.S. Patent Nos. 5,885,613, 6,287,591, 6,320,017, and 6,586,559, the contents of all of which are incorporated herein by reference in their entireties.

[0359] According to some embodiments, one or more additional compounds may be a therapeutic agent. The therapeutic agent may be selected from any class suitable for the therapeutic purpose. In other words, the therapeutic agent may be selected from any class suitable for the therapeutic purpose. In other words, the therapeutic agent may be selected according to the desired therapeutic purpose and biological effect.

[0360] According to some embodiments, the additional compound is another antibody or antigen-binding fragment thereof described herein.

[0361] According to some embodiments, the additional agent is an antiviral agent or a vaccine. According to some embodiments, the additional agent is selected from the group consisting of an anti-inflammatory agent, an antimalarial agent, and an antibody or antigen-binding fragment thereof that specifically binds to CoV-S. In further embodiments, the antimalarial agent is chloroquine or hydroxychloroquine. According to some embodiments, the anti-inflammatory agent is an antibody, such as sarilumab, tocilizumab, or gimsilumab.

[0362] In some embodiments, the additional compound is an immunostimulant. Also provided herein are pharmaceutical compositions comprising the insect cells encapsulated in the produced lipid nanoparticles, or synthetically produced ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof described herein, and a pharmaceutically acceptable carrier or excipient.

[0363] According to some aspects, the present disclosure provides lipid nanoparticle formulations further comprising one or more pharmaceutical excipients. According to some embodiments, the lipid nanoparticle formulations further comprise sucrose, Tris, trehalose, and / or glycine.

[0364] The ceDNA vector can be complexed with the lipid portion of the particle or encapsulated in the lipid portion of the lipid nanoparticle. According to some embodiments, the ceDNA can be completely encapsulated in the lipid portion of the lipid nanoparticle, thereby protecting it from degradation by, for example, nucleases in aqueous solution. According to some embodiments, the ceDNA in the lipid nanoparticle is not substantially degraded after exposing the lipid nanoparticle to nucleases at 37°C for at least about 20, 30, 45, or 60 minutes. According to some embodiments, the ceDNA in the lipid nanoparticle is not substantially degraded after incubating the particles in serum at 37°C for at least about 30, 45, or 60 minutes, or for at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours.

[0365] In certain embodiments, the lipid nanoparticles are substantially non-toxic to a subject, e.g., a mammal, such as a human. According to some aspects, the lipid nanoparticle formulation is a lyophilized powder.

[0366] According to some embodiments, lipid nanoparticles are solid core particles with at least one lipid bilayer.In other embodiments, lipid nanoparticles have a non-bilayer structure, i.e., non-lamellar (i.e., non-bilayer) morphology.Without limitation, non-bilayer morphology can include, for example, three-dimensional tube, rod, cubic symmetry, etc.For example, the morphology (lamellar vs. non-lamellar) of lipid nanoparticles can be easily evaluated and characterized using Cryo-TEM analysis as described in US2010 / 0130588 (the contents of which are incorporated herein by reference in their entirety).

[0367] According to some further embodiments, lipid nanoparticles having a non-lamellar morphology are electron dense. According to some aspects, the present disclosure provides lipid nanoparticles that are either unilamellar or multilamellar in structure. According to some aspects, the present disclosure provides lipid nanoparticle formulations comprising multivesicular particles and / or effervescent base particles.

[0368] By controlling the composition and concentration of the lipid components, the rate at which the lipid conjugates exchange with the lipid particle can be controlled, which in turn controls the rate at which the lipid nanoparticles become fusogenic.In addition, other variables, including, for example, pH, temperature, or ionic strength, can be used to change and / or control the rate at which the lipid nanoparticles become fusogenic.Other methods that can be used to control the rate at which the lipid nanoparticles become fusogenic will be clear to those skilled in the art based on this disclosure.It will also be clear that by controlling the composition and concentration of the lipid conjugates, the lipid particle size can be controlled.

[0369] The pKa of formulated cationic lipids can be correlated with the effectiveness of LNPs for delivery of nucleic acids (see Jayaraman et al., Angewandte Chemie, International Edition (2012), 51(34), 8529-8533; Semple et al., Nature Biotechnology 28, 172-176(2010), both of which are incorporated by reference in their entireties). A preferred range of pKa is from about 5 to about 7. The pKa of cationic lipids can be determined in lipid nanoparticles using an assay based on the fluorescence of 2-(p-toluidino)-6-naphthalenesulfonic acid (TNS).

[0370] VII. Treatment method The ceDNA vectors for expression of the antibodies and antigen-binding fragments thereof disclosed herein can also be used in methods for delivering nucleic acid sequences of interest to target cells (e.g., host cells), particularly for delivering antibodies or antigen-binding fragments to cells of a subject in need thereof to treat a disease or disorder.

[0371] Targets, i.e., antigens, of the antibodies or antigen-binding fragments described herein can be selected from a variety of pathogens, including, for example, bacterial, viral, fungal, and parasitic infectious agents. Suitable targets can further include cancer or cancer-associated antigens, etc. Still other targets can include autoimmune conditions, such as rheumatoid arthritis (RA) or multiple sclerosis (MS).

[0372] Additionally, the present disclosure provides a method for delivering an antibody or antigen-binding fragment thereof to cells in a subject in need thereof, comprising multiple administrations of a ceDNA vector of the present disclosure encoding the antibody and antigen-binding fragment thereof. Because the ceDNA vector of the present disclosure does not induce the immune response typically observed against encapsidated viral vectors, such a multiple-administration strategy may be more successful in ceDNA-based systems. The ceDNA vector is administered in an amount sufficient to transfect cells of the desired tissue and result in sufficient levels of gene transfer and expression of the antibody and antigen-binding fragment thereof without undue side effects.

[0373] Delivery of ceDNA vectors for producing the antibodies and antigen-binding fragments thereof described herein is not limited to delivery of expressed antibodies and antigen-binding fragments thereof. For example, the ceDNA vectors described herein, whether produced by conventional methods (e.g., using cell-based production methods (e.g., insect cell production methods)) or synthetically produced, can be used with other delivery systems provided to provide part of a gene therapy. One non-limiting example of a system that can be combined with a ceDNA vector according to the present disclosure includes a system that separately delivers one or more cofactors or immunosuppressive factors for effective gene expression of a ceDNA vector expressing an antibody or ...

Claims

1. 1. A capsid-free closed-ended DNA (ceDNA) vector composition comprising: A first ceDNA vector comprising at least one nucleic acid sequence between adjacent inverted terminal repeats (ITRs), a first ceDNA vector, wherein the at least one nucleic acid sequence encodes a heavy chain (HC) of an antibody or an antigen-binding fragment thereof; and a second ceDNA vector comprising at least one nucleic acid sequence between adjacent inverted terminal repeats (ITRs), the at least one nucleic acid sequence encoding a light chain (LC) of an antibody or an antigen-binding fragment thereof, wherein the first ceDNA vector encoding the HC and the second ceDNA vector encoding the LC are present in a molar ratio of 1:3 to 3:1 (HC:LC).

2. 2. The ceDNA vector composition of claim 1, wherein the first ceDNA vector encoding the HC and the second ceDNA vector encoding the LC are present in a molar ratio of 1.5:1 (HC:LC).

3. 2. The ceDNA vector composition of claim 1, wherein the first ceDNA vector encoding the HC and the second ceDNA vector encoding the LC are present in a molar ratio of 1:1 to 2.5:1 (HC:LC).

4. 2. The ceDNA vector composition of claim 1, wherein the first ceDNA vector encoding the HC and the second ceDNA vector encoding the LC are present in a molar ratio of 1.5:1 to 2.5:1 (HC:LC).

5. 2. The ceDNA vector composition of claim 1, wherein the first ceDNA vector encoding the HC and the second ceDNA vector encoding the LC are present in a molar ratio of about 2.0:1 (HC:LC).

6. 2. The ceDNA vector composition of claim 1, wherein the first ceDNA vector encoding the HC and the second ceDNA vector encoding the LC are present in a molar ratio of about 2.5:1 (HC:LC).

7. 2. The ceDNA vector composition of claim 1, wherein the first ceDNA vector and the second ceDNA vector together express at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 μg / mL of antibody comprising a HC and a LC.

8. The ceDNA vector composition of claim 1, wherein each ceDNA vector comprises a promoter sequence linked to at least one nucleic acid sequence.

9. The ceDNA vector composition of claim 1, wherein each ceDNA vector contains at least one polyA sequence.

10. The ceDNA vector composition of claim 1, wherein each ceDNA vector comprises a 5'UTR and / or an intron sequence.

11. The ceDNA vector composition of claim 1, wherein each ceDNA vector comprises a 3'UTR sequence.

12. A ceDNA vector composition as described in claim 1, wherein each ceDNA vector contains an enhancer sequence.

13. The ceDNA vector composition of claim 1, wherein at least one of the adjacent ITRs in each ceDNA vector comprises a functional terminal separation site and a Rep binding site.

14. The ceDNA vector composition of claim 1, wherein one or both of the adjacent ITRs in each ceDNA vector are derived from a virus selected from the group consisting of parvovirus, dependovirus, and adeno-associated virus (AAV).

15. The ceDNA vector composition of claim 1, wherein the adjacent ITRs in each ceDNA vector are symmetric or asymmetric with respect to each other.

16. A ceDNA vector composition as described in Claim 15, wherein the adjacent ITRs in each ceDNA vector are symmetrical or substantially symmetrical to each other.

17. The ceDNA vector composition described in Claim 15, wherein the adjacent ITRs in each ceDNA vector are asymmetric with respect to each other.

18. A ceDNA vector composition as described in claim 1, wherein one of the adjacent ITRs in each ceDNA vector is a wild-type ITR or both of the adjacent ITRs in each ceDNA vector are wild-type ITRs.

19. The ceDNA vector composition of claim 1, wherein the adjacent ITRs in each ceDNA vector are derived from different viral serotypes.

20. The ceDNA vector composition described in claim 1, wherein the adjacent ITRs in each ceDNA vector are selected from the group consisting of any pair of viral serotypes shown in Table 2.

21. The ceDNA vector composition of claim 1, wherein one or both of the adjacent ITRs in each ceDNA vector comprises a sequence selected from the group consisting of sequences shown in Table 3.

22. The ceDNA vector composition of claim 1, wherein at least one of the flanking ITRs in each ceDNA vector is altered from the wild-type AAV ITR sequence by a deletion, addition, or substitution that affects the overall three-dimensional conformation of the ITR.

23. The ceDNA vector composition of claim 1, wherein one or both of the adjacent ITRs in each ceDNA vector are derived from an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12.

24. The ceDNA vector composition of claim 1, wherein one or both of the adjacent ITRs in each ceDNA vector are synthetic.

25. The ceDNA vector composition of claim 1, wherein one of the adjacent ITRs in each ceDNA vector is not a wild-type ITR or both of the adjacent ITRs in each ceDNA vector are not wild-type ITRs.

26. One or both of the flanking ITRs in each ceDNA vector are modified by deletion, insertion, and / or substitution in at least one of the ITR regions selected from the group consisting of A, A', B, B', C, C', D, and D' regions; one or both of the flanking ITRs in each ceDNA vector have been modified by deletion, insertion, and / or substitution, resulting in the loss of all or part of the stem-loop structure formed by the B and B' regions; one or both of the flanking ITRs in each ceDNA vector have been modified by deletion, insertion, and / or substitution, resulting in the loss of all or part of the stem-loop structure formed by the C and C' regions; one or both of the flanking ITRs in each ceDNA vector are modified by deletion, insertion, and / or substitution resulting in the deletion of all or part of the stem-loop structure formed by the B and B' regions and / or all or part of the stem-loop structure formed by the C and C' regions; one or both of the flanking ITRs in each ceDNA vector comprises a single stem-loop structure in a region that, in the wild-type ITR, comprises a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C' regions; one or both of the flanking ITRs in each ceDNA vector comprises a single stem and two loops in a region that comprises, in the wild-type ITR, a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C' regions; or 2. The ceDNA vector composition of claim 1, wherein one or both of the flanking ITRs in each ceDNA vector comprises a single stem and a single loop in a region that, in the wild-type ITR, comprises a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C' regions.

27. 27. The ceDNA composition of claim 26, wherein the deletion, insertion and / or substitution results in the deletion of all or part of the stem-loop structure formed by the A, A', B, B', C and / or C' regions.

28. The ceDNA vector composition of claim 1, wherein both of the adjacent ITRs in each ceDNA vector are modified in a manner that results in overall three-dimensional symmetry when the adjacent ITRs are inverted relative to each other.

29. The ceDNA vector composition of claim 1 , wherein the vector composition is encapsulated in a lipid nanoparticle (LNP).

30. A capsid-free closed-ended DNA (ceDNA) vector comprising a nucleic acid sequence that is at least 85% identical to a sequence selected from the group consisting of SEQ ID NO:406, SEQ ID NO:407 and SEQ ID NO:

408.

31. A capsid-free closed-ended DNA (ceDNA) vector comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO:406, SEQ ID NO:407 and SEQ ID NO:

408.

32. A method for expressing an antibody or an antigen-binding fragment thereof in a cell in vitro, comprising contacting the cell with the ceDNA vector composition described in claim 1.

33. A pharmaceutical composition for use in a method for expressing an antibody or antigen-binding fragment thereof in a cell, the pharmaceutical composition comprising a ceDNA vector composition described in claim 1, the method comprising contacting the cell with the ceDNA vector composition.

34. The pharmaceutical composition of claim 33, wherein the cell is in vivo.

35. 34. The pharmaceutical composition of claim 33, wherein the at least one nucleic acid sequence is codon optimized for expression in the cell.

36. 13. A pharmaceutical composition for use in the treatment of a bacterial, viral, parasitic or fungal infection, comprising the ceDNA vector composition of claim 1, or a ceDNA vector comprising a nucleic acid sequence selected from the group consisting of the sequences shown in Table 7.

37. 13. A pharmaceutical composition for use in the treatment of cancer, comprising the ceDNA vector composition of claim 1 or a ceDNA vector comprising a nucleic acid sequence selected from the group consisting of the sequences shown in Table 7.

38. 13. A pharmaceutical composition for use in the treatment of an autoimmune disease or disorder, comprising the ceDNA vector composition of claim 1 or a ceDNA vector comprising a nucleic acid sequence selected from the group consisting of the sequences shown in Table 7.

39. 13. A pharmaceutical composition for use in the prevention of a bacterial, viral, parasitic or fungal infection in a subject, comprising the ceDNA vector composition of claim 1 or a ceDNA vector comprising a nucleic acid sequence selected from the group consisting of the sequences shown in Table 7.

40. A pharmaceutical composition for use in the prevention of cancer, comprising the ceDNA vector composition of claim 1 or a ceDNA vector comprising a nucleic acid sequence selected from the group consisting of the sequences shown in Table 7.

41. 13. A pharmaceutical composition for use in preventing an autoimmune disease in a subject, comprising the ceDNA vector composition of claim 1 or a ceDNA vector comprising a nucleic acid sequence selected from the group consisting of the sequences shown in Table 7.

42. The pharmaceutical composition of claim 36, wherein the antibody or antigen-binding fragment thereof encoded by the first and second ceDNA vectors or the ceDNA vector composition and expressed in the liver of the subject has a higher binding affinity for FcγRIIIa compared to its counterpart produced from a mammalian cell line expressing a fucosyltransferase.

43. 37. The pharmaceutical composition of claim 36, wherein the first and second ceDNA vectors or the ceDNA vector composition are administered by a route of administration selected from the group consisting of intravenous, subcutaneous, intratumoral and intramuscular injection.

44. The pharmaceutical composition of claim 36, further comprising an immunomodulatory agent.

45. 10. A pharmaceutical composition comprising the ceDNA vector composition of claim 1 or a ceDNA vector comprising a nucleic acid sequence selected from the group consisting of the sequences shown in Table 7.

46. 38. The pharmaceutical composition of claim 37, further comprising one or more additional therapeutic agents.

47. 13. A composition comprising the ceDNA vector composition of claim 1 or a ceDNA vector comprising a nucleic acid sequence selected from the group consisting of the sequences shown in Table 7, and a lipid.

48. 48. The composition of claim 47, wherein the lipid is a lipid nanoparticle (LNP).

49. A kit comprising the ceDNA vector composition of claim 1, the pharmaceutical composition of claim 45, or the composition of claim 47, and instructions for use.

Images