Compounds for modulating UNC13A expression

Abstract

Oligomeric compounds and pharmaceutical compositions are provided for increasing the amount or activity of UNC13A RNA in a cell or animal and / or decreasing the amount of UNC13A RNA containing cryptic exons in a cell or animal, and in certain cases, increasing the amount of UNC13A protein in a cell or animal. Such oligomeric compounds and pharmaceutical compositions are useful for treating neurodegenerative diseases, such as amyotrophic lateral sclerosis and frontotemporal dementia.

Description

[Technical field]

[0001] Sequence Listing This application is filed with an electronic sequence listing, which is provided in a file named BIOL0426WOSEQ_ST25.txt, created on May 20, 2022, and is 196 KB in size. The information in the electronic sequence listing is incorporated herein by reference in its entirety.

[0002] Provided are oligomeric agents, oligomeric compounds, antisense agents, and pharmaceutical compositions for increasing the amount or activity of UNC13A RNA in a cell or animal, and / or decreasing the amount of UNC13A RNA containing cryptic exons in a cell or animal, and in certain cases, increasing the amount of UNC13A protein in a cell or animal. Such oligomeric agents, oligomeric compounds, antisense agents, and pharmaceutical compositions are useful for treating neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). [Background technology]

[0003] The UNC13A gene encodes UNC13A, a member of the UNC13 protein family, which is involved in calcium-induced synaptic vesicle release (Dittman, JS, 2019, Curr. Opin. Neurobiol. 57, 17-25). Mutations in UNC13A are associated with neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) (Diekstra, FP, et al., 2014, Ann. Neurol. 76:120-133).

[0004] ALS (also known as Lou Gehrig's disease) is a disorder characterized by selective degeneration of upper and lower motor neurons (Rowland, N. Engl. J. Med. 2001, 344, 1688-1700). ALS is a progressive, devastating neurodegenerative disease that affects as many as 30,000 Americans at any one time. Progressive degeneration of motor neurons in ALS ultimately leads to the death of the patient. As motor neurons die, the brain loses its ability to initiate and control muscle movement. Voluntary muscle movement is progressively affected, and patients in the later stages of the disease can become totally paralyzed.

[0005] FTD refers to a group of disorders caused by the progressive loss of nerve cells in the frontal or temporal lobes of the brain. The nerve cell damage caused by FTD leads to loss of function in the frontal or temporal lobes, which variably results in deterioration of behavior and personality, speech disorders, or changes in muscle or motor function.

[0006] Both ALS and FTD are neurodegenerative diseases associated with TDP-43 proteinopathy. TDP-43 suppresses the inclusion of cryptic exons that cause nonsense-mediated decay of RNA, and loss of TDP-43 increases the amount of cryptic exon-containing RNA, leading to nonsense-mediated decay of the transcript. In both ALS and FTD, depletion of the RNA-binding protein TDP-43 from the nuclei of neurons in the brain and spinal cord reduces the expression of genes containing cryptic exons and leads to cell death (Ling, P. et al., 2015, Science 349, 650-655; Humphrey, et al., 2017, BMC Medical Genomics 10, 38).

[0007] The UNC13A gene contains a cryptic exon that promotes nonsense-mediated decay. When TDP-43 levels are depleted, the transcript contains the cryptic exon, resulting in insufficient expression of the UNC13A protein. Single nucleotide polymorphisms (SNPs) in UNC13A associated with ALS and FTD are associated with an increased risk of cryptic exons in the UNC13A transcript (Brown, AL., et al., 2021, bioRxiv, doi.org / 10.1101 / 2021.04.02.438170, Ma., XR, et al., 2021, bioRxiv, doi.org / 10.1101 / 2021.04.02.438213 (also published in Ma., XR, et al., 2022, Nature 603, 124-130)).

[0008] Currently, there are no acceptable options for treating ALS, FTD, and other neurodegenerative diseases. It is therefore an object of the present invention to provide oligomeric agents, oligomeric compounds, antisense agents, and pharmaceutical compositions for treating such diseases. Summary of the Invention

[0009] The oligomeric agents, oligomeric compounds, antisense agents, and pharmaceutical compositions of certain embodiments described herein are useful for increasing the expression of UNC13A in cells or animals. In certain embodiments, the oligomeric agents, oligomeric compounds, antisense agents, and pharmaceutical compositions increase the RNA or protein levels of UNC13A in cells or animals. In certain embodiments, the oligomeric agents, oligomeric compounds, antisense agents, and pharmaceutical compositions reduce the amount of UNC13A RNA containing cryptic exons in cells or animals. In certain embodiments, the animal is a subject with a neurodegenerative disease, and in certain embodiments, the subject has ALS or FTD. In some embodiments, the subject has ALS. In some embodiments, the subject has FTD.

[0010] Also provided is a method useful for improving at least one symptom of neurodegenerative disease. In certain embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). In certain embodiments, the symptom comprises motor dysfunction, muscle weakness, muscle wasting, synaptic dysfunction, fatigue, difficulty in speaking, difficulty in swallowing, shortness of breath, cognitive dysfunction, or shortened life span. In certain embodiments, the improvement of such symptoms results in improved motor function, improved muscle strength, increased muscle mass, improved speech, improved swallowing, improved breathing, improved synaptic function, improved cognition, or extended life span. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] It should be understood that both the general description above and the detailed description below are exemplary and explanatory only and are not limiting. As used herein, the singular includes the plural unless specifically stated otherwise. As used herein, the term "or" means "and / or" unless specifically stated otherwise. Furthermore, the term "including" and other forms such as "includes" and "included" are not limiting unless specifically stated otherwise. Additionally, terms such as "element" or "component" include elements and components that include one unit and elements and components that include two or more subunits, unless specifically stated otherwise.

[0012] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. Any document or portion of a document cited in this application, including but not limited to patents, patent applications, articles, books, and treatises, is expressly incorporated by reference in its entirety, as well as the portion of that document discussed herein.

[0013] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, medicinal chemistry, and pharmaceutical chemistry described herein are those well known and widely used in the art. Where permitted, all patents, applications, published applications, and other publications, and other data referred to throughout this disclosure are incorporated herein by reference in their entirety.

[0014] Unless otherwise indicated, the following terms have the following meanings.

[0015] As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside that includes a 2'-β-D-deoxyribosyl sugar moiety that has the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).

[0016] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-MOE sugar moiety" means a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety has the β-D-ribosyl configuration. "MOE" means O-methoxyethyl.

[0017] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0018] As used herein, "2'-NMA" refers to a -O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of a ribosyl sugar moiety. A "2'-NMA sugar moiety" is a sugar moiety having a 2'-O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, the 2'-NMA sugar moiety is in the β-D configuration. "NMA" refers to ON-methylacetamide.

[0019] As used herein, "2'-NMA nucleoside" means a nucleoside that includes a 2'-NMA sugar moiety.

[0020] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0021] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0022] As used herein, "2'-F" refers to a 2'-fluoro group in place of the 2'-OH group of a ribosyl sugar moiety. A "2'-F sugar moiety" or "2'-fluoro ribosyl sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, 2'-F has a β-D ribosyl stereochemical configuration.

[0023] As used herein, "2'-F nucleoside" means a nucleoside that includes a 2'-F sugar moiety.

[0024] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent other than H or OH.

[0025] As used herein, "3' target site" refers to the 3'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide hybridizes to the target nucleic acid.

[0026] As used herein, "5' target site" refers to the 5'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide hybridizes to the target nucleic acid.

[0027] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0028] As used herein, "abasic sugar moiety" means the sugar portion of a nucleoside that is not bound to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0029] As used herein, "administration" or "administering" means giving a pharmaceutical agent or composition to an animal.

[0030] As used herein, "improvement" in relation to treatment means that at least one symptom or characteristic is improved compared to the same symptom or characteristic when not treated.In certain embodiments, improvement is a decrease in the severity or frequency of a symptom or characteristic, or a delay in the onset or slowing down the progression of the severity or frequency of a symptom or characteristic.The progression or severity of an indicator can be determined by subjective or objective measures, which are known to those skilled in the art.

[0031] As used herein, "animal" means a human or non-human animal.

[0032] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed by a bridge connecting two of the atoms of the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

[0033] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0034] As used herein, "chirally enriched population" refers to a plurality of molecules of the same molecular formula, in which the number or percentage of molecules in the population that have the same specific chiral center in the same specific stereochemical configuration is greater than the number or percentage of molecules in the population that would be expected to have the specific chiral center in the specific stereochemical configuration if the specific chiral center were stereorandom. A chirally enriched population of molecules that has multiple chiral centers in each molecule can include one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds that include modified oligonucleotides.

[0035] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties similar to cerebrospinal fluid (e.g., osmolality, pH, and / or electrolytes) and is biocompatible with CSF.

[0036] As used herein, "cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal or human.

[0037] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with each other when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of the other nucleic acid are aligned in the opposite direction. A "complementary region" in reference to a region of an oligonucleotide means that at least 70% of the nucleobases of the region and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with each other when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of the other nucleic acid are aligned in the opposite direction. A "complementary nucleobase" refers to a nucleobase that is capable of forming a hydrogen bond with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Although certain modified nucleobases that pair with natural nucleobases or other modified nucleobases are known in the art, these particular modified nucleobases are not considered as complementary nucleobases as defined herein unless otherwise specified.For example, inosine can pair with adenosine, cytosine, or uracil, but is not considered to be complementary thereto.In complementary oligonucleotides and / or complementary nucleic acids, the nucleobases of each nucleoside do not need to be complementary.Rather, some mismatches are allowed.As used herein, "fully complementary" or "100% complementary" in relation to oligonucleotides means that an oligonucleotide is complementary to another oligonucleotide, i.e., the nucleic acid of each nucleoside of that oligonucleotide.

[0038] As used herein, a "cryptic exon" or "nonsense-mediated decay (NMD) exon" is an exon or pseudoexon that can activate the nonsense-mediated decay (NMD) pathway when included in an mRNA transcript.

[0039] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0040] As used herein, "conjugate linker" means a bond or a group of atoms that contains at least one bond that connects a conjugate moiety to an oligonucleotide.

[0041] As used herein, "conjugate moiety" means a grouping of atoms that modifies one or more properties of a molecule compared to the same molecule without the conjugate moiety, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0042] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar moiety" or "cEt sugar moiety" means a β-D ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and in which the methyl group of the bridge is in the S configuration.

[0043] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0044] As used herein, "contiguous" in reference to oligonucleotides refers to nucleosides, nucleobases, sugar moieties or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" refers to nucleobases that are immediately adjacent to each other in a sequence.

[0045] As used herein, "diluent" refers to an ingredient in a composition that has no pharmacological activity but is pharmacologic necessary or desirable. For example, the diluent in an injection composition may be a liquid (e.g., aCSF, PBS, or saline).

[0046] As used herein, "double stranded" with respect to a region or oligonucleotide refers to a double strand formed by hybridization of complementary strands of a nucleic acid (including, but not limited to, an oligonucleotide) with each other. In certain embodiments, the two strands of a double stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that fold back on itself (e.g., a hairpin structure).

[0047] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric agent- or compound-mediated reduction in the amount or activity of the target nucleic acid.

[0048] As used herein, "internucleoside bond" refers to the covalent bond between adjacent internucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond."Phosphorothioate internucleoside bond" or "PS internucleoside bond" refers to the modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0049] As used herein, "inverted nucleoside" means a nucleotide having 3'-3' and / or 5'-5' internucleoside linkages as depicted herein.

[0050] As used herein, "inverted sugar moiety" means the sugar moiety of an inverted nucleoside having 3'-3' and / or 5'-5' internucleoside linkages or an abasic sugar moiety.

[0051] As used herein, "linked nucleosides" are nucleosides that are linked in contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0052] As used herein, "linker nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Although the linker nucleoside is contiguous with the oligonucleotide of an oligomeric compound, it is not considered to be part of the oligonucleotide moiety.

[0053] As used herein, "mismatch" or "non-complementary" means that the nucleobases of a first nucleic acid sequence are not complementary to the corresponding nucleobases of a second nucleic acid sequence (i.e., the target nucleic acid) when the two nucleic acid sequences are aligned in opposite orientations.

[0054] As used herein, a "motif" refers to a pattern of unmodified and / or modified sugar moieties, nucleobases and / or internucleoside linkages in an oligonucleotide.

[0055] As used herein, "modified nucleoside" means a nucleoside that includes a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

[0056] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that contains a modification (e.g., substitution) that does not form a bridge between two atoms of the sugar to form a second ring.

[0057] As used herein, "nucleobase" refers to unmodified or modified nucleobase. Nucleobase is a heterocyclic moiety. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U) or guanine (G). As used herein, "modified nucleobase" is an atomic group other than unmodified A, T, C, U or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the above five unmodified nucleobases.

[0058] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide, independent of any modification of the sugar or internucleoside linkages.

[0059] As used herein, "nucleoside" means a compound or fragment of a compound that includes a nucleobase and a sugar moiety, each of which independently is unmodified or modified.

[0060] As used herein, "oligomeric agent" refers to an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or can be a double-stranded oligomer formed by two complementary oligomeric compounds.

[0061] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional structural units, such as a conjugate group or a terminal group. An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0062] The term "double-stranded oligomer" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.

[0063] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside bonds, in which each nucleoside and internucleoside bond may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.

[0064] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administration to an animal. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0065] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects to the compound.

[0066] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition shows activity in a free uptake assay in a particular cell line.

[0067] As used herein, "prodrug" refers to a therapeutic agent whose first form when outside the body is converted to a second form within an animal or its cells. Typically, the conversion of the prodrug within the animal is prompted by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals within the cells or tissues and / or by physiological conditions. In certain embodiments, the first form of the prodrug is less active than the second form.

[0068] As used herein, "single-stranded" refers to a nucleic acid (including, but not limited to, an oligonucleotide) that is unpaired and not part of a double strand. A single-stranded compound can hybridize with a complementary nucleic acid to form a duplex, at which point it is no longer single-stranded.

[0069] As used herein, "stabilizing phosphate group" refers to a 5'-chemical moiety that stabilizes the 5'-phosphate portion of the 5'-terminal nucleoside of an oligonucleotide under biological conditions compared to the stability of the unmodified 5'-phosphate of the unmodified nucleoside. Such stabilization of the 5'-phosphate group includes, but is not limited to, resistance to removal by phosphatases. Stabilizing phosphate groups include, but are not limited to, 5'-vinyl phosphonate and 5'-cyclopropyl phosphonate.

[0070] As used herein, "standard cell assay" refers to the assay described in Example 2 or Example 3, and reasonable variations thereof.

[0071] As used herein, "stereorandom chiral center" in reference to a population of molecules with the same molecular formula refers to a chiral center whose stereochemical configuration is random. For example, in a population of molecules that contain stereorandom chiral centers, the number of molecules with stereorandom chiral centers in the (S) configuration may be, but is not necessarily, the same as the number of molecules with stereorandom chiral centers in the (R) configuration. The stereochemical configuration of a chiral center is considered random when it results from a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0072] As used herein, "subject" means a human or non-human animal. In certain embodiments, the subject is a human.

[0073] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H) deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3' and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or a sugar surrogate moiety.

[0074] As used herein, "sugar surrogate moiety" refers to a modified sugar moiety, other than a furanosyl moiety, that can link a nucleobase to another group in an oligonucleotide, such as an internucleoside linkage, a conjugate group or a terminal group. Modified nucleosides that contain sugar surrogate moieties can be introduced at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids.

[0075] As used herein, "symptom or trait" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is obvious to the subject or to a medical professional who tests or examines the subject. In certain embodiments, the trait is obvious upon invasive diagnostic testing (including but not limited to postmortem testing).

[0076] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid upon which an oligomeric compound is designed to act. Target RNA refers to an RNA transcript, and includes pre-mRNA and mature mRNA, unless otherwise specified.

[0077] As used herein, "target region" means that portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0078] As used herein, "terminal group" means a chemical group or group of atoms that is covalently attached to the end of an oligonucleotide.

[0079] As used herein, "treating" refers to improving a disease or condition in a subject by administering an oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent described herein. In certain embodiments, treating a subject improves symptoms compared to the same symptoms in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of symptoms, delays the onset of symptoms, delays the progression of symptoms, or delays the severity or frequency of symptoms.

[0080] As used herein, "RNA" means RNA transcript, and includes pre-mRNA and mature mRNA, unless otherwise specified.

[0081] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from the hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of the antisense compound. In certain embodiments, antisense activity is the modulation of splicing of a target pre-mRNA.

[0082] As used herein, "antisense agent" means an antisense compound and optionally one or more additional features, such as a sense compound.

[0083] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0084] As used herein, "sense compound" means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0085] As used herein, "antisense oligonucleotide" refers to an oligonucleotide (including the oligonucleotide portion of an antisense compound) capable of hybridizing to a target nucleic acid and exhibiting at least one antisense activity. Antisense oligonucleotides include, but are not limited to, splice regulator oligonucleotides, antisense RNAi oligonucleotides, and antisense RNase H oligonucleotides.

[0086] As used herein, "sense oligonucleotide" means an oligonucleotide (which contains the oligonucleotide portion of a sense compound) that is capable of hybridizing to an antisense oligonucleotide.

[0087] As used herein, "cell targeting moiety" means a conjugate group or a portion of a conjugate group capable of binding to a specific cell type(s).

[0088] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Although not limited to a specific mechanism, the most common hybridization mechanism involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding between complementary nucleic acid bases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0089] As used herein, "RNAi agent" refers to an antisense agent that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA (including microRNA mimics). RNAi agents may include conjugate groups and / or end groups. In certain embodiments, RNAi agents regulate the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H.

[0090] As used herein, "RNase H agent" refers to an antisense agent that acts through RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H agent is single stranded. In certain embodiments, the RNase H agent is double stranded. RNase H compounds may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act primarily through RISC / Ago2.

[0091] Specific Embodiments Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 80% complementary to a portion of an equal length of an UNC13A nucleic acid, and the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0092] Embodiment 2. 2. The oligomeric compound of embodiment 1, wherein the UNC13A nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0093] Embodiment 3. 3. The oligomeric compound of embodiment 1 or embodiment 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of nucleobases 48,128 to 48,151, nucleobases 48,432 to 48,465, or nucleobases 48,466 to 48,561 of SEQ ID NO:1.

[0094] Embodiment 4. The oligomeric compound of any of embodiments 1 to 3, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of the UNC13A nucleic acid.

[0095] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 21 to 332, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0096] Embodiment 6. The oligomeric compound according to embodiment 5, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 21-332.

[0097] Embodiment 7. The oligomeric compound according to embodiment 5, wherein the modified oligonucleotide has a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 21 to 332.

[0098] Embodiment 8. SEQ ID NO: 290, 291, 293, or 294, SEQ ID NO: 85 to 101, or SEQ ID NO: 21-30, 32-41, 43-52, 54-60, 62-66, or 326-332 8. The oligomeric compound according to any one of embodiments 5 to 7, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of any of the nucleobase sequences listed above.

[0099] EMBODIMENT 9. The oligomeric compound of any of embodiments 5 to 8, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of the UNC13A nucleic acid, the UNC13A nucleic acid having the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0100] EMBODIMENT 10. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, 48,128 to 48,151 of SEQ ID NO: 1; 48,432 to 48,465 of SEQ ID NO:1, or 48,466 to 48,561 of SEQ ID NO:1 The oligomeric compound, wherein the nucleobase sequence of said modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases complementary to:

[0101] Embodiment 11. The modified oligonucleotides are 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 11. The oligomeric compound according to any one of embodiments 1 to 10, comprising 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

[0102] Embodiment 12. The oligomeric compound according to any of the preceding embodiments, wherein said modified oligonucleotide consists of 18 linked nucleosides.

[0103] Embodiment 13. 13. The oligomeric compound according to any of the preceding embodiments, wherein at least one nucleoside of said modified oligonucleotide comprises a modified sugar moiety.

[0104] Embodiment 14. The oligomeric compound of embodiment 13, wherein said modified sugar moiety comprises a bicyclic sugar moiety.

[0105] EMBODIMENT 15. The oligomeric compound of embodiment 14, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0106] EMBODIMENT 16. The oligomeric compound of embodiment 13, wherein said modified sugar moiety comprises a non-bicyclic modified sugar moiety.

[0107] EMBODIMENT 17. The oligomeric compound of embodiment 16, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, a 2'-NMA sugar moiety, or a 2'-F sugar moiety.

[0108] EMBODIMENT 18. 18. The oligomeric compound according to any of the preceding embodiments, wherein at least one nucleoside of said modified oligonucleotide compound comprises a sugar surrogate moiety.

[0109] EMBODIMENT 19. The oligomeric compound according to any of embodiments 13 to 18, wherein each nucleoside of said modified oligonucleotide comprises a modified sugar moiety.

[0110] EMBODIMENT 20. 20. The oligomeric compound of embodiment 19, wherein each modified sugar moiety is a 2'-MOE sugar moiety.

[0111] EMBODIMENT 21. The oligomeric compound of embodiment 19, wherein each modified sugar moiety is a 2'-NMA sugar moiety.

[0112] EMBODIMENT 22. 22. The oligomeric compound according to any of the preceding embodiments, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.

[0113] EMBODIMENT 23. 23. The oligomeric compound according to embodiment 22, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0114] EMBODIMENT 24. The oligomeric compound according to embodiment 22 or embodiment 23, wherein each internucleoside linkage is a modified internucleoside linkage.

[0115] 25. 25. The oligomeric compound according to embodiment 24, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0116] 26. The oligomeric compound according to any of embodiments 22-23, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage.

[0117] EMBODIMENT 27. 27. The oligomeric compound of any of embodiments 1-24 or 26, wherein each internucleoside linkage of said modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0118] 28. 28. The oligomeric compound according to any of embodiments 1-23 or 26-27, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or 17 internucleoside linkages of said modified oligonucleotide are phosphorothioate internucleoside linkages.

[0119] 29. 29. The oligomeric compound according to any of the preceding embodiments, wherein said modified oligonucleotide comprises at least one modified nucleobase.

[0120] EMBODIMENT 30. 30. The oligomeric compound according to embodiment 29, wherein said modified nucleobase is 5-methylcytosine.

[0121] EMBODIMENT 31. The oligomeric compound according to embodiment 30, wherein each cytosine is a 5-methylcytosine.

[0122] EMBODIMENT 32. 32. The oligomeric compound according to any one of embodiments 1 to 31, consisting of said modified oligonucleotide.

[0123] EMBODIMENT 33. The oligomeric compound according to any one of embodiments 1 to 32, wherein said modified oligonucleotide is a pharma- ceutically acceptable salt thereof.

[0124] EMBODIMENT 34. The oligomeric compound according to embodiment 33, which is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0125] EMBODIMENT 35. 32. The oligomeric compound according to any one of the preceding embodiments, wherein said oligomeric compound comprises a conjugate group.

[0126] EMBODIMENT 36. 36. The oligomeric compound according to embodiment 35, wherein said conjugate group comprises a conjugate linker and a conjugate moiety.

[0127] 37. 37. The oligomeric compound according to embodiment 36, wherein said conjugate linker consists of a single bond.

[0128] 38. The oligomeric compound according to embodiment 36 or embodiment 37, wherein said conjugate linker is cleavable.

[0129] 39. The oligomeric compound according to any of embodiments 36-38, wherein said conjugate linker comprises from 1 to 3 linker nucleosides.

[0130] EMBODIMENT 40. The oligomeric compound according to any of embodiments 36 to 38, wherein said conjugate linker does not comprise any linker nucleosides.

[0131] EMBODIMENT 41. The oligomeric compound according to any of embodiments 35 to 40, wherein said conjugate group is attached to said modified oligonucleotide at the 5' end of said modified oligonucleotide.

[0132] EMBODIMENT 42. The oligomeric compound according to any of embodiments 35 to 40, wherein said conjugate group is attached to said modified oligonucleotide at the 3' end of said modified oligonucleotide.

[0133] EMBODIMENT 43. 43. The oligomeric compound of any one of the preceding embodiments, wherein the oligomeric compound comprises a terminal group.

[0134] EMBODIMENT 44. 44. The oligomeric compound of embodiment 43, wherein said terminal group is an abasic sugar moiety.

[0135] EMBODIMENT 45. The oligomeric compound according to any one of the preceding embodiments, wherein said oligomeric compound is a single-stranded oligomeric compound.

[0136] EMBODIMENT 46. 46. ​​A chirally enriched population of oligomeric compounds according to any one of embodiments 1 to 45, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0137] EMBODIMENT 47. 47. The chirally enriched population of embodiment 46, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage that is in the (Sp) or (Rp) configuration.

[0138] 48. 47. The chirally enriched population of embodiment 46, wherein the population is enriched for modified oligonucleotides in which each of said phosphorothioate internucleoside linkages is of an independently selected particular stereochemical configuration.

[0139] 49. 47. The chirally enriched population of embodiment 46, wherein modified oligonucleotides in which one particular phosphorothioate internucleoside linkage has an (Rp) configuration and each of the remaining phosphorothioate internucleoside linkages has an (Sp) configuration are enriched in the population.

[0140] EMBODIMENT 50. 47. The chirally enriched population of embodiment 46, wherein modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5'→3' direction in the Sp, Sp, and Rp configurations are enriched in the population.

[0141] EMBODIMENT 51. 46. ​​The population of oligomeric compounds according to any of the preceding embodiments, wherein all of the phosphorothioate internucleoside linkages of said modified oligonucleotides are stereorandom.

[0142] EMBODIMENT 52. A double-stranded oligomer comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is the oligomeric compound according to any one of embodiments 1 to 45.

[0143] EMBODIMENT 53. 53. The double-stranded oligomer of embodiment 52, wherein the second modified oligonucleotide consists of 8 to 80 linked nucleosides, and wherein the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0144] EMBODIMENT 54. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound described in any one of embodiments 1 to 45, or a double-stranded oligomer described in embodiment 52 or embodiment 53.

[0145] EMBODIMENT 55. The antisense agent of embodiment 54, wherein the antisense agent is a splice regulator capable of regulating splicing of an UNC13A nucleic acid.

[0146] EMBODIMENT 56. The antisense agent of embodiment 54 or embodiment 55, wherein the antisense agent comprises a conjugate group, the conjugate group comprising a cell targeting moiety.

[0147] EMBODIMENT 57. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 45, a population according to any one of embodiments 46 to 51, a double-stranded oligomer according to embodiment 52 or embodiment 53, or an antisense agent according to any one of embodiments 54 to 56, and a pharma- ceutically acceptable diluent or carrier.

[0148] EMBODIMENT 58. The pharmaceutical composition of embodiment 57, wherein the pharma- ceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0149] EMBODIMENT 59. The pharmaceutical composition of embodiment 58, wherein said pharmaceutical composition consists essentially of said oligomeric compound, said population, said double-stranded oligomer, or said antisense agent, and phosphate buffered saline or artificial cerebrospinal fluid.

[0150] 60. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 1-45, a population according to any one of embodiments 46-51, a double-stranded oligomer according to embodiment 52 or embodiment 53, an antisense agent according to any one of embodiments 54-56, or a pharmaceutical composition according to any one of embodiments 57-59.

[0151] 61. A method for treating a disease associated with UNC13A, the method comprising administering a therapeutically effective amount of an oligomeric compound described in any one of embodiments 1 to 45, a population described in any one of embodiments 46 to 51, a double-stranded oligomer described in embodiment 52 or embodiment 53, an antisense agent described in any one of embodiments 54 to 56, or a pharmaceutical composition described in any one of embodiments 57 to 59 to a subject having a disease associated with UNC13A or at risk of developing the disease, thereby treating the disease associated with UNC13A.

[0152] 62. The method of embodiment 61, wherein the disease associated with UNC13A is a neurodegenerative disease.

[0153] 63. The method of embodiment 62, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

[0154] 64. The method of embodiment 63, wherein at least one symptom of the neurodegenerative disease is ameliorated.

[0155] 65. The method of embodiment 64, wherein the at least one symptom is motor dysfunction, muscle weakness, muscle wasting, synaptic dysfunction, fatigue, difficulty speaking, difficulty swallowing, shortness of breath, cognitive dysfunction, shortened life span, or a combination thereof.

[0156] 66. The method of embodiment 65, wherein administering the oligomeric compound of any of embodiments 1-45, the population of any of embodiments 46-51, the double-stranded oligomer of embodiment 52 or embodiment 53, the antisense agent of any of embodiments 54-56, or the pharmaceutical composition of any of embodiments 57-59 results in improved motor function, improved muscle strength, increased muscle mass, improved speech, improved swallowing, improved breathing, improved synaptic function, improved cognition, or increased longevity.

[0157] 67. The method of any one of embodiments 60 to 66, wherein the subject is a human.

[0158] 68. A method for increasing expression of UNC13A in a cell, the method comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 45, a population according to any one of embodiments 46 to 51, a double-stranded oligomer according to embodiment 52 or embodiment 53, an antisense agent according to any one of embodiments 54 to 56, or a pharmaceutical composition according to any one of embodiments 57 to 59.

[0159] 69. A method for reducing the amount of cryptic exon-containing UNC13A RNA in a cell, the method comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 45, a population according to any one of embodiments 46 to 51, a double-stranded oligomer according to embodiment 52 or embodiment 53, an antisense agent according to any one of embodiments 54 to 56, or a pharmaceutical composition according to any one of embodiments 57 to 59.

[0160] EMBODIMENT 70. 70. The method of embodiment 69, wherein the cryptic exon is located between exon 20 and exon 21 of UNC13A.

[0161] EMBODIMENT 71. 71. The method of embodiment 70, wherein the cryptic exon is selected from CE-1, CE-2, and CE-3.

[0162] EMBODIMENT 72. The method of any of embodiments 68-71, wherein the cell is a neuron or a glial cell, and optionally, the cell is an astrocyte or a microglial cell.

[0163] EMBODIMENT 73. 73. The method of any one of embodiments 68 to 72, wherein the cell is a human cell.

[0164] 74. Use of an oligomeric compound according to any one of embodiments 1 to 45, a population according to any one of embodiments 46 to 51, a double-stranded oligomer according to embodiment 52 or embodiment 53, an antisense agent according to any one of embodiments 54 to 56, or a pharmaceutical composition according to any one of embodiments 57 to 59 for treating a disease associated with UNC13A.

[0165] 75. Use of an oligomeric compound according to any one of embodiments 1 to 45, a population according to any one of embodiments 46 to 51, a double-stranded oligomer according to embodiment 52 or embodiment 53, an antisense agent according to any one of embodiments 54 to 56, or a pharmaceutical composition according to any one of embodiments 57 to 59 in the manufacture of a medicament for treating a disease associated with UNC13A.

[0166] 76. The use according to embodiment 74 or embodiment 75, wherein the disease associated with UNC13A is a neurodegenerative disease.

[0167] EMBODIMENT 77. The use of embodiment 76, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

[0168] Certain Oligomeric Agents and Compounds Certain embodiments provide oligomeric agents that target UNC13A nucleic acid.In certain embodiments, UNC13A nucleic acid has the sequence shown in SEQ ID NO:1 (the complementary strand of the cleavage strand from nucleoside 17598001 to 17691000 of GENBANK Accession No. NC_000019.10) or SEQ ID NO:2 (GENBANK Accession No. NM_001080421.2), each of which is incorporated by reference in its entirety.In certain embodiments, the oligomeric agent is a single-stranded oligomeric compound.In certain embodiments, the oligomeric agent is a double-stranded oligomer.

[0169] Certain embodiments provide oligomeric compounds comprising modified oligonucleotides consisting of 8 to 80 linked nucleosides, the nucleobase sequence of the modified oligonucleotide being at least 80% complementary to an equal length portion of the UNC13A nucleic acid, the modified oligonucleotide having at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the UNC13A nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the UNC13A nucleic acid.

[0170] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is selected from the group consisting of nucleobases 48104-48121, 48106-48123, 48108-48125, 48110-48127, 48112-48129, 48114-48131, 48116-48133, 48118-48135, 48120-48137, 48122-48139, 48124-48141, 48126-48143, 48128-48145, 48130-48147, 48132-48149, 48134-48151, 48136-48153, 48138-48149, 48139-48151, 48136-48153, 48138-48149, 48139-48152, 48139-48160, 48139-48170, 48139-48181, 48139-48190, 48140-48191, 48140-48192, 48140-48193, 48140-48194, 48140-48195, 48140-48196, 48140-48197, 48140-48199, 48151-48198, 48151-48199, 48152-48199, 48155, 48140~48157, 48142~48159, 48144~48161, 48146~48163, 48148~48165, 48150~48167, 48152~48169, 48154~48171, 48156~48173, 48158~48175 , 48160~48177, 48162~48179, 48164~48181, 48166~48183, 48168~48185, 48170~48187, 48172~48189, 48174~48191, 48176~48193, 48178~48195, 4818 0~48197, 48182~48199, 48184~48201, 48186~48203, 48188~48205, 48190~48207, 48192~48209, 48194~48211, 48196~48213, 48198~48215, 48200~482 17, 48202~48219, 48204~48221, 48206~48223, 48208~48225, 48210~48227, 48212~48229, 48214~48231, 48216~48233, 48218~48235, 48220~48237, 48 222~48239, 48224~48241, 48226~48243, 48228~48245, 48230~48247, 48232~48249, 48234~48251, 48236~48253, 48238~48255, 48240~48257, 48242~4 8259, 48244~48261, 48246~48263, 48248~48265, 48250~48267, 48252~48269, 48254~48271, 48256~48273, 48258~48275, 48260~48277, 48262~48279,48264~48281、48266~48283、48268~48285、48270~48287、48272~48289、48274~48291、48276~48293、48278~48295、48280~48297、48282~48299、48284~48301、48286~48303、48288~48305、48290~48307、48292~48309、48294~48311、48296~48313、48298~48315、48300~48317、48302~48319、48304~48321、48306~48323、48308~48325、48310~48327、48312~48329、48314~48331、48316~48333、48318~48335、48320~48337、48322~48339、48324~48341、48326~48343、48328~48345、48330~48347、48332~48349、48334~48351、48336~48353、48338~48355、48340~48357、48342~48359、48344~48361、48346~48363、48348~48365、48350~48367、48352~48369、48354~48371、48356~48373、48358~48375、48360~48377、48362~48379、48364~48381、48366~48383、48368~48385、48370~48387、48372~48389、48374~48391、48376~48393、48378~48395、48380~48397、48382~48399、48384~48401、48385~48402、48386~48403、48387~48404、48388~48405、48389~48406、48390~48407、48391~48408、48392~48409、48393~48410、48394~48411、48395~48412、48396~48413、48397~48414、48398~48415、48399~48416、48400~48417、48401~48418、48402~48419、48403~48420、48404~48421、48405~48422、48406~48423、48407~48424、48408~48425、48409~48426、48410~48427、48411~48428、48412~48429、48413~48430、48414~48431、48415~48432、48416~48433、48417~48434、48418~48435、48419~48436、48420~48437、48421~48438、48422~48439、48423~48440、48424~48441、48425~48442、48426~48443、48427~48444、48428~48445、48429~48446、48430~48447、48431~48448、48432~48449、48433~48450、48434~48451、48435~48452、48436~48453、48437~48454、48438~48455、48439~48456、48440~48457、48441~48458、48442~48459、48443~48460、48444~48461、48445~48462、48446~48463、48447~48464、48448~48465、48449~48466、48450~48467、48451~48468、48452~48469、48453~48470、48454~48471、48455~48472、48456~48473、48457~48474、48458~48475、48459~48476、48460~48477、48461~48478、48462~48479、48463~48480、48464~48481、48465~48482、48466~48483、48467~48484、48468~48485、48469~48486、48470~48487、48471~48488、48472~48489、48473~48490、48474~48491、48475~48492、48476~48493、48477~48494、48478~48495、48479~48496、48480~48497、48481~48498、48482~48499、48483~48500、48484~48501、48486~48503、48488~48505、48490~48507、48492~48509、48494~48511、48496~48513, 48498~48515, 48500~48517, 48502~48519, 48504~48521, 48506~48523, 48508~48525, 48510~48527, 48512~48529, 48514~48531, 48516~48533, 48518~48535, 48520~48537, 48522~48539, 48524~48541, 48526~48543, 48528~48545, 48530~48547, 48532~48549, 48534~48551, 48536~48553, 48538~48555, 48540~48557, 48542~48559, 48544~48561, 48546~48563, 48548~48565, 48550~48567, 48552~48569, 48554~48571, 48556~48573, 48558~48575, 48560~48577, 48562~48579, 4 8564~48581, 48566~48583, 48568~48585, 48570~48587, 48572~48589, 48574~48591, 48576~48593, 48578~48595, 48580~48597, 48582~48599, 48584~48601, 48586~48603, 48588~48605, 48590~48607, 48592~48609, 48594~48611, 48596~48613, 48 598-48615, 48600-48617, 48602-48619, 48604-48621, 48606-48623, 48608-48625, 48610-48627, 48612-48629, 48614-48631, 48616-48633, 48618-48635, 48620-48637, 48622-48639, 48624-48641, 48626-48643 are at least 80% complementary to equal length portions of the nucleic acid sequences of the UNC13A nucleic acid. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of equal length portions of the UNC13A nucleic acid.

[0171] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs:21-332.

[0172] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs:21-332.

[0173] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, the modified oligonucleotide having a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs:21-332.

[0174] In any of the oligomeric compounds provided herein, the nucleobase sequence of the modified oligonucleotide may be at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the UNC13A nucleic acid, the UNC13A nucleic acid having the nucleobase sequence of SEQ ID NO: 1 or 2.

[0175] In any of the oligomeric compounds provided herein, the modified oligonucleotides may be 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 16-40, 16-50, 16-60, 16-70, 16-80, 16-90, 16-110, 16-120, 16-130, 16-140, 16-150, 16-160, 16-170, 16-20, 16-25, 16-30, 16-50, 16-180, 16-20, 16-30, 16-50, 16-190, 16-210, 16-220, 16-230, 16-240, 16-250, 16-310, 16-320, 16-330, 16-340, 16-350, 16-410, 16-420, 16-430, 16-440, 16-450, 16-510, 16-520, 16-530, 16-640, 16-650, 16 30, 16-50, 17-20, 17-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0176] In certain embodiments, the modified oligonucleotide comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, and no more than 50 linked nucleotides. In certain embodiments, the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.

[0177] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide may comprise a modified sugar moiety. In certain embodiments, the modified sugar moiety comprises a bicyclic sugar moiety (such as a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-). In certain embodiments, the modified sugar moiety comprises a non-bicyclic modified sugar moiety (such as a 2'-MOE sugar moiety or a 2'-OMe sugar moiety). In certain embodiments, the modified sugar moiety comprises a 2'-ON-alkylacetamide sugar moiety (such as a 2'-ON-methylacetamide sugar moiety).

[0178] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide compound may contain a sugar surrogate moiety.

[0179] In any of the oligomeric compounds provided herein, at least one internucleoside bond of the modified oligonucleotide may include a modified internucleoside bond (such as a phosphorothioate internucleoside bond). In certain embodiments, each internucleoside bond of the modified oligonucleotide may be a modified internucleoside bond, or each internucleoside bond of the modified oligonucleotide may be a phosphorothioate internucleoside bond. In certain embodiments, at least one internucleoside bond of the modified oligonucleotide may be a phosphodiester internucleoside bond. In certain embodiments, each internucleoside bond of the modified oligonucleotide may be independently selected from a phosphodiester internucleoside bond or a phosphorothioate internucleoside bond. In certain embodiments, at least two, at least three, at least four, at least five, or at least six internucleoside bonds of the modified oligonucleotide may be a phosphodiester internucleoside bond. In certain embodiments, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide can be phosphorothioate internucleoside linkages.

[0180] In any of the oligomeric compounds provided herein, at least one nucleobase of the modified oligonucleotide can be a modified nucleobase, such as 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

[0181] Specific double-stranded oligomers Certain embodiments are directed to a double-stranded oligomer comprising a first oligomeric compound and a second oligomeric compound.

[0182] In certain embodiments, the double-stranded oligomer comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide is selected from the group consisting of nucleic acid bases 48104 to 48121, 48106 to 48123, 48108 to 48125, 48110 to 48127, 48112 to 48129, 48114 to 48131, 48116 to 48133, 48118 to 48135, 48120 to 48137, 48122 to 48139, 48124 to 48141, 48126 to 48143, 48128 to 48145, 48130 to 481 47, 48132~48149, 48134~48151, 48136~48153, 48138~48155, 48140~48157, 48142~48159, 48144~48161, 48146~48163, 48148~48165, 48150~48167, 4 8152~48169, 48154~48171, 48156~48173, 48158~48175, 48160~48177, 48162~48179, 48164~48181, 48166~48183, 48168~48185, 48170~48187, 48172~ 48189, 48174~48191, 48176~48193, 48178~48195, 48180~48197, 48182~48199, 48184~48201, 48186~48203, 48188~48205, 48190~48207, 48192~4820 9, 48194~48211, 48196~48213, 48198~48215, 48200~48217, 48202~48219, 48204~48221, 48206~48223, 48208~48225, 48210~48227, 48212~48229, 482 14~48231, 48216~48233, 48218~48235, 48220~48237, 48222~48239, 48224~48241, 48226~48243, 48228~48245, 48230~48247, 48232~48249, 48234~4 8251, 48236~48253, 48238~48255, 48240~48257, 48242~48259, 48244~48261, 48246~48263, 48248~48265, 48250~48267, 48252~48269, 48254~48271,48256~48273、48258~48275、48260~48277、48262~48279、48264~48281、48266~48283、48268~48285、48270~48287、48272~48289、48274~48291、48276~48293、48278~48295、48280~48297、48282~48299、48284~48301、48286~48303、48288~48305、48290~48307、48292~48309、48294~48311、48296~48313、48298~48315、48300~48317、48302~48319、48304~48321、48306~48323、48308~48325、48310~48327、48312~48329、48314~48331、48316~48333、48318~48335、48320~48337、48322~48339、48324~48341、48326~48343、48328~48345、48330~48347、48332~48349、48334~48351、48336~48353、48338~48355、48340~48357、48342~48359、48344~48361、48346~48363、48348~48365、48350~48367、48352~48369、48354~48371、48356~48373、48358~48375、48360~48377、48362~48379、48364~48381、48366~48383、48368~48385、48370~48387、48372~48389、48374~48391、48376~48393、48378~48395、48380~48397、48382~48399、48384~48401、48385~48402、48386~48403、48387~48404、48388~48405、48389~48406、48390~48407、48391~48408、48392~48409、48393~48410、48394~48411、48395~48412、48396~48413、48397~48414、48398~48415、48399~48416、48400~48417、48401~48418、48402~48419、48403~48420、48404~48421、48405~48422、48406~48423、48407~48424、48408~48425、48409~48426、48410~48427、48411~48428、48412~48429、48413~48430、48414~48431、48415~48432、48416~48433、48417~48434、48418~48435、48419~48436、48420~48437、48421~48438、48422~48439、48423~48440、48424~48441、48425~48442、48426~48443、48427~48444、48428~48445、48429~48446、48430~48447、48431~48448、48432~48449、48433~48450、48434~48451、48435~48452、48436~48453、48437~48454、48438~48455、48439~48456、48440~48457、48441~48458、48442~48459、48443~48460、48444~48461、48445~48462、48446~48463、48447~48464、48448~48465、48449~48466、48450~48467、48451~48468、48452~48469、48453~48470、48454~48471、48455~48472、48456~48473、48457~48474、48458~48475、48459~48476、48460~48477、48461~48478、48462~48479、48463~48480、48464~48481、48465~48482、48466~48483、48467~48484、48468~48485、48469~48486、48470~48487、48471~48488、48472~48489、48473~48490、48474~48491、48475~48492、48476~48493、48477~48494、48478~48495、48479~48496、48480~48497、48481~48498、48482~48499、48483~48500、48484~48501、48486~48503、48488~48505, 48490~48507, 48492~48509, 48494~48511, 48496~48513, 48498~48515, 48500~48517, 48502~48519, 48504~48521, 48506~48523, 48508~48525, 48510~48527, 48512~48529, 48514~48531, 48516~48533, 48518~48535, 48520~48537, 48522~48539, 4852 4~48541, 48526~48543, 48528~48545, 48530~48547, 48532~48549, 48534~48551, 48536~48553, 48538~48555, 48540~48557, 48542~48559, 48544~48561, 48546~48563, 48548~48565, 48550~48567, 48552~48569, 48554~48571, 48556~48573, 48558~48575, 48560~48 577, 48562~48579, 48564~48581, 48566~48583, 48568~48585, 48570~48587, 48572~48589, 48574~48591, 48576~48593, 48578~48595, 48580~48597, 48582~48599, 48584~48601, 48586~48603, 48588~48605, 48590~48607, 48592~48609, 48594~48611, 48596~48613, a first oligomeric compound which is at least 80% complementary to an equal length portion of 48598-48615, 48600-48617, 48602-48619, 48604-48621, 48606-48623, 48608-48625, 48610-48627, 48612-48629, 48614-48631, 48616-48633, 48618-48635, 48620-48637, 48622-48639, 48624-48641, 48626-48643; a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to a portion of equal length of the first modified oligonucleotide; In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the UNC13A nucleic acid.

[0183] In certain embodiments, the double-stranded oligomer comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 21 to 332, and each thymine is replaced by uracil; a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to a portion of equal length of the first modified oligonucleotide; In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the UNC13A nucleic acid.

[0184] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0185] In certain embodiments, the double-stranded oligomer comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide comprises any of the nucleic acid base sequences of SEQ ID NOs: 21 to 332, and each thymine is replaced by uracil; a second oligomeric compound comprising a second modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to a portion of equal length of the first modified oligonucleotide; Includes.

[0186] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0187] In any of the double-stranded oligomers described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, bicyclic sugar moieties (such as a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-) and non-bicyclic sugar moieties (such as a 2'-MOE sugar moiety, a 2'-F sugar moiety, a 2'-OMe sugar moiety, or a 2'-NMA sugar moiety). In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

[0188] In any of the double-stranded oligomers described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a sugar surrogate moiety. Examples of suitable sugar surrogate moieties include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and non-bridged nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate moiety, which may be a GNA.

[0189] In any of the double-stranded oligomers described herein, at least one internucleoside bond of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified internucleoside bond. In certain embodiments, the modified internucleoside bond is a phosphorothioate internucleoside bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the first modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the second modified oligonucleotide comprises a phosphorothioate bond.

[0190] In any of the double-stranded oligomers described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage.

[0191] In any of the double-stranded oligomers described herein, each internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can be independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0192] In any of the double-stranded oligomers described herein, at least one nucleobase of the first modified oligonucleotide and / or the second modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

[0193] In any of the double-stranded oligomers described herein, the first modified oligonucleotide may include a stabilizing phosphate group attached to the 5' position of the 5'-most nucleoside. In certain embodiments, the stabilizing phosphate group includes cyclopropylphosphonate or (E)-vinylphosphonate.

[0194] In any of the double-stranded oligomers described herein, the first modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5' end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3' end of the first modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, a conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, or a C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0195] In any of the double-stranded oligomers described herein, the second modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3' end of the second modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, a conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, or a C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0196] In certain embodiments, the antisense agent comprises an antisense compound, and the antisense compound comprises an oligomeric compound or a double-stranded oligomer as described herein.In certain embodiments, the antisense agent (which may comprise an oligomeric compound or a double-stranded oligomer as described herein) is an RNAi agent that can regulate the amount of UNC13A nucleic acid through the activation of RISC / Ago2.

[0197] Certain embodiments provide an oligomer agent comprising two or more double-stranded oligomers. In certain embodiments, the oligomer agent may comprise two or more of any of the double-stranded oligomers described herein. In certain embodiments, the oligomer agent comprises two or more of the same double-stranded oligomer, which may be any of the double-stranded oligomers described herein. In certain embodiments, the two or more double-stranded oligomers are linked together. In certain embodiments, the two or more double-stranded oligomers are linked together by a covalent bond. In certain embodiments, the second modified oligonucleotides of the two or more double-stranded oligomers are linked together by a covalent bond. In certain embodiments, the second modified oligonucleotides of the two or more double-stranded oligomers are linked together by a covalent bond at their 3' ends. In certain embodiments, the two or more double-stranded oligomers are linked together by a covalent bond via a glycol linker (such as a tetraethylene glycol linker). Certain such compounds are described, for example, in Alterman, et al., Nature Biotech., 37:844-894, 2019.

[0198] I. Specific Oligonucleotides In certain embodiments, the present invention provides an oligomeric compound comprising an oligonucleotide consisting of linked nucleosides. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or a modified oligonucleotide. The modified oligonucleotide comprises at least one modification to unmodified RNA or unmodified DNA. That is, the modified oligonucleotide comprises at least one modified nucleoside (a nucleoside comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside bond. In the following, certain modified nucleosides and modified internucleoside bonds suitable for use in modified oligonucleotides are described.

[0199] A. Certain Modified Nucleosides A modified nucleoside comprises a modified sugar moiety, a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising a modified sugar moiety and / or a modified nucleobase as described below can be incorporated into a modified oligonucleotide.

[0200] 1. Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate moiety. Such sugar surrogate moieties may contain one or more substitutions that correspond to the substitutions of other types of modified sugar moieties.

[0201] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position on the furanosyl, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"), and 2'-ON-alkylacetamides (e.g., 2'-ON-methylacetamide ("NMA"), 2'-ON-dimethylacetamide, 2'-ON-ethylacetamide, or 2'-ON-propylacetamide). See, e.g., US 6,147,200, Prakash et al., 2003, Org. Lett., 5,403-6. Shown below is a "2'-ON-methylacetamide nucleoside", i.e., a "2'-NMA nucleoside":

[0202] [ka]

[0203] In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n )(In the formula, each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 2'-O(CH2)2ON(CH3)2 ("DMAOE"), 2'-O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and 2'-substituents as described in US 6,531,584 to Cook et al., US 5,859,221 to Cook et al., and US 6,005,087 to Cook et al. Certain embodiments of these 2'-substituents can be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3' position. Examples of suitable substituents at the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 4' position. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and groups such as those described in WO 2015 / 106128 to Manoharan et al. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, ethyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety comprises two or more non-bridging sugar substituents, such as a 2'-F-5'-methyl sugar moiety, as well as modified sugar moieties and modified nucleosides described in WO 2008 / 101157 to Migawa et al. and US 2013 / 0203836 to Rajeev et al.

[0204] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R m )(R n ))(In the formula, each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 alkyl, e.g., OCH2C(=O)-N(H)CH3 ("NMA").

[0205] In certain embodiments, non-bicyclic modified nucleosides that are 2'-substituted nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 ("DMAOE"), O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").

[0206] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3, and OCH2C(=O)-N(H)CH3.

[0207] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric configurations in addition to the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2' position compared to the 2'-deoxyfuranosyl sugar moiety. Thus, there are a total of 16 possible isomeric configurations for such sugar moieties. 2'-modified sugar moieties described herein have a β-D-ribosyl isomeric configuration unless otherwise specified.

[0208] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 4' position. Examples of suitable substituents at the 4' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO2015 / 106128.

[0209] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3' position. Examples of suitable substituents at the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy) and alkyl (e.g., methyl, ethyl).

[0210] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 5' position. Examples of suitable substituents at the 5' position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy (e.g., methoxy), and alkyl (e.g., methyl (R or S), ethyl).

[0211] In naturally occurring nucleic acids, sugars are linked to each other 3'→5'. In certain embodiments, oligonucleotides contain one or more nucleosides or sugar moieties linked at alternative positions (e.g., 2' position, inverted 5'→3'). For example, when the linkage is to the 2' position, the 2'-substituent can be at the 3' position instead.

[0212] Certain modified sugar moieties include substitutions that bridge two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides that include such bicyclic sugar moieties are referred to as bicyclic nucleosides (BNAs), bridged nucleotides, or conformationally constrained nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383 and PCT Publication No. WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., US Pat. No. 7,399,845; Bhat et al., US Pat. No. 7,569,825; and the like). ,686, Swayze et al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., US 7,696,345, and Allerson et al., US 8,124,745), al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US Pat. No. 8,278,426), 4'-C(R a Rb )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2' (wherein each R, R a and R b are independently H, a protecting group or C1-C 12 alkyl) (see, for example, US Pat. No. 7,427,672 to Imanishi et al.).

[0213] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1 or 2; n is 1, 2, 3 or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl or a protecting group.

[0214] Further bicyclic sugar moieties are known in the art, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., Chem. Commun., 1998, 4, 455-456; al., J.Org.Chem.,1998,63,10035-10039, Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379, Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561, Braasch et al. al.,Chem.Biol.,2001,8,1-7,Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243, US7,053,207 by Wengel et al., US6,268,490 by Imanishi et al., US6,770,748 by Imanishi et al., USRE44,779 by Imanishi et al., US6,794,499 by Wengel et al., US6,670,461 by Wengel et al., US7,034,133 by Wengel et al., US8,080,644 by Wengel et al., US8,034,90 by Wengel et al. 9, US8,153,365 to Wengel et al., US7,572,582 to Wengel et al., US6,525,191 to Ramasamy et al., WO2004 / 106356 to Torsten et al., WO1999 / 014226 to Wengel et al., WO2007 / 134181 to Seth et al., US7,547,684 to Seth et al., US7,666,854 to Seth et al., US8,088,746 to Seth et al., US7,750,131 to Seth et al., U.See US 8,030,467 to Seth et al., US 8,268,980 to Seth et al., US 8,546,556 to Seth et al., US 8,530,640 to Seth et al., US 9,012,421 to Migawa et al., US 8,501,805 to Seth et al., US 2008 / 0039618 to Allerson et al., and US 2015 / 0191727 to Migawa et al. In certain embodiments, the bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, LNA nucleosides (described herein) may be in the α-L or β-D configuration.

[0215] [ka]

[0216] The α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of bridged nucleic acids to siRNAs has been shown to improve siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. Where positions of a given bicyclic nucleoside (eg, LNA or cEt) are specified in exemplary embodiments of the present invention, they are in the β-D configuration unless otherwise specified.

[0217] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, a 5'-substituted sugar and a 4'-2' bridging sugar).

[0218] In certain embodiments, the modified sugar moiety is a sugar surrogate moiety. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur atom, a carbon atom, or a nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogate moieties include a 4'-sulfur atom and a substituent at the 2' position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or a substituent at the 5' position.

[0219] In certain embodiments, the sugar surrogate moiety comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate moiety comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA,

[0220] [ka]

[0221] ("F-HNA", see e.g., US 8,088,904 to Swayze et al., US 8,440,803 to Swayze et al., US 8,796,437 to Swayze et al., and US 9,005,906 to Swayze et al. F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides that include additional modified THP compounds having the formula:

[0222] [ka]

[0223] wherein, independently, for each of the modified THP nucleosides: Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, where X is O, S or NJ1, and J1, J2 and J3 are each independently H or C1-C6 alkyl.

[0224] In certain embodiments, modified THP nucleosides are provided in the above formula, where q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided in the above formula, where one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0225] In certain embodiments, the sugar surrogate moiety comprises a ring having 6 or more atoms and 2 or more heteroatoms.For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510, and US 5,698,685 to Summerton et al., US 5,166,315 to Summerton et al., US 5,185,444 to Summerton et al., and US 5,034,506 to Summerton et al.).As used herein, the term "morpholino" refers to a sugar surrogate moiety having the following structure:

[0226] [ka]

[0227] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents from the morpholino structures shown above. Such sugar surrogate moieties are referred to herein as "modified morpholinos."

[0228] In certain embodiments, the sugar surrogate moiety comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogate moieties include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in WO 2011 / 133876 to Manoharan et al. In certain embodiments, the sugar surrogate moiety comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogate moieties include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082, 5,714,331, and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0229] In certain embodiments, the sugar surrogate moiety is a "non-bridged" sugar structure of a UNA (non-bridged nucleic acid) nucleoside. UNAs are non-bridged acyclic nucleic acids in which any sugar linkages have been removed to form a non-bridged sugar surrogate moiety. Representative U.S. published applications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, each of which is incorporated herein by reference in its entirety.

[0230] In certain embodiments, the sugar surrogate moiety is glycerol, as found in the GNA (glycol nucleic acid) nucleosides shown below. (S)-GNA

[0231] [ka]

[0232] In the formula, Bx represents any nucleic acid base.

[0233] Many other bicyclic, tricyclic sugar and sugar surrogate moieties that can be used in modified nucleosides are known in the art.

[0234] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleosides that comprise unmodified nucleobases.In certain embodiments, modified oligonucleotides comprise one or more nucleosides that comprise modified nucleobases.In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise nucleobases (referred to as abasic nucleosides).In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides that comprise hypoxanthine nucleobases).

[0235] In certain embodiments, the modified nucleobase is selected from a 5-substituted pyrimidine, a 6-azapyrimidine, an alkyl substituted pyrimidine, an alkynyl substituted pyrimidine, an alkyl substituted purine, an N-2 substituted purine, an N-6 substituted purine, and an O-6 substituted purine. In certain embodiments, modified nucleobases include 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-azapurine and others. Selected from 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G clamp).Modified nucleobases may also include those in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.Further nucleobases include those disclosed in US 3,687,808 to Merigan et al., The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0236] Publications teaching the preparation of certain of the above modified nucleobases, as well as other modified nucleobases, include US 2003 / 0158403 to Manoharan et al., US 2003 / 0175906 to Manoharan et al., US 4,845,205 to Dinh et al., US 5,130,302 to Spielvogel et al., US 5,134,066 to Rogers et al., US 5,134,066 to Bischofberger et al. US5,175,273, US5,367,066 by Urdea et al., US5,432,272 by Benner et al., US5,434,257 by Matteucci et al., US5,457,187 by Gmeiner et al., US5,459,255 by Cook et al., US5,484,908 by Froehler et al., US5,502,177 by Matteucci et al., and US5,525,711 by Hawkins et al. , US5,552,540 by Haralambidis et al., US5,587,469 by Cook et al., US5,594,121 by Froehler et al., US5,596,091 by Switzer et al., US5,614,617 by Cook et al., US5,645,985 by Froehler et al., US5,681,941 by Cook et al., US5,811,534 by Cook et al., US5,750 by Cook et al. US 5,948,903 to Cook et al., US 5,587,470 to Cook et al., US 5,457,191 to Cook et al., US 5,763,588 to Matteucci et al., US 5,830,653 to Froehler et al., US 5,808,027 to Cook et al., US 6,166,199 to Cook et al., and US 6,005,096 to Matteucci et al.

[0237] 3. Specific modified internucleoside linkages The naturally occurring internucleoside bond of RNA and DNA is a 3'→5' phosphodiester bond. In certain embodiments, the nucleosides of a modified oligonucleotide may be linked together using one or more modified internucleoside bonds. Two main types of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative internucleoside bonds that contain phosphorus include, but are not limited to, phosphodiester bonds ("P=O") (also referred to as unmodified or natural bonds), phosphotriesters, methylphosphonates, phosphoramidates and phosphorothioates ("P=S"), and phosphate esters, including phosphorodithioates ("HS-P=S"). Representative phosphorus-free internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-) and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of the oligonucleotide compared to natural phosphate linkages. In certain embodiments, internucleoside linkages with chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing or phosphorus-free internucleoside linkages are well known to those of skill in the art.

[0238] In certain embodiments, the modified internucleoside linkage is any of those described in WO / 2021 / 030778, which is incorporated herein by reference. In certain embodiments, the modified internucleoside linkage has the formula:

[0239] [ka]

[0240] Including, wherein, independently for each internucleoside linkage group of the modified oligonucleotide: X is selected from O or S; R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; T is selected from SO2R2, C(=O)R3, and P(=O)R4R5; R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl, substituted C1-C6 alkynyl, and a conjugate group; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and a conjugate group; R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0241] In certain embodiments, the modified internucleoside linkage has the formula:

[0242] [ka]

[0243] The mesyl phosphoramidate linker has the formula:

[0244] In certain embodiments, the mesyl phosphoramidate internucleoside linkage may contain a chiral center. In certain embodiments, modified oligonucleotides containing (Rp) and / or (Sp) mesyl phosphoramidates each include one or more of the following formulae, where "B" represents a nucleobase:

[0245] [ka]

[0246] Representative internucleoside linkages with chiral centers include, but are not limited to, alkyl phosphonates, mesyl phosphoramidates, and phosphorothioates. Modified oligonucleotides that contain internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides that contain stereorandom internucleoside linkages, or as a population of modified oligonucleotides that contain phosphorothioates or other chiral center-containing linkages of specific stereochemical configuration. In certain embodiments, a population of modified oligonucleotides contains phosphorothioate internucleoside linkages, in which all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, a population of modified oligonucleotides contains mesyl phosphoramidate internucleoside linkages, in which all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be made using a synthesis method in which the stereochemical configuration of each phosphorothioate or mesyl phosphoramidate linkage is randomly selected. However, each individual phosphorothioate or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides that contain one or more specific phosphorothioate internucleoside bonds or mesyl phosphoramidate internucleoside bonds that are independently selected in a specific stereochemical configuration. In certain embodiments, the specific phosphorothioate or mesyl phosphoramidate bond of the specific configuration is present in at least 65% of the molecules in the population. In certain embodiments, the specific phosphorothioate or mesyl phosphoramidate bond of the specific configuration is present in at least 70% of the molecules in the population. In certain embodiments, the specific phosphorothioate or mesyl phosphoramidate bond of the specific configuration is present in at least 80% of the molecules in the population. In certain embodiments, the specific phosphorothioate or mesyl phosphoramidate bond of the specific configuration is present in at least 90% of the molecules in the population.In certain embodiments, the specific phosphorothioate or mesyl phosphoramidate bond of the specific configuration is present in at least 99% of the molecules in the population. Such chirally enriched modified oligonucleotide population can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125,8307 (2003), Wan et al. Nuc. Acid. Res. 42,13456 (2014) and WO2017 / 015555. In certain embodiments, the modified oligonucleotide population is enriched in modified oligonucleotides that have at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Sp) configuration. In certain embodiments, the modified oligonucleotide population is enriched in modified oligonucleotides that have at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) phosphorothioates and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase:

[0247] [ka]

[0248] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be of a specific stereochemical configuration.

[0249] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research, YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages that contain mixed component moieties of N, O, S, and CH2.

[0250] In certain embodiments, the modified oligonucleotide comprises the inverted nucleoside shown below:

[0251] [ka]

[0252] Contains one or more of In the formula, each Bx independently represents any nucleobase.

[0253] In certain embodiments, the inverted nucleoside is located at the end (i.e., the last nucleoside on one end of the oligonucleotide), and therefore there is only one internucleoside bond as shown above. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to one or both ends of the oligonucleotide.

[0254] In certain embodiments, such groups do not include nucleobases and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is located at a terminal position (i.e., is attached to the last nucleoside on one end of the oligonucleotide), and thus there is only one internucleoside bond as described above. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to one or both ends of the oligonucleotide.

[0255] In certain embodiments, the nucleic acids may be linked via a 2'→5' linkage rather than the standard 3'→5' linkage. Such a linkage is shown below:

[0256] [ka]

[0257] In the formula, each Bx represents any nucleobase.

[0258] B. Specific motifs In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides that comprise modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides that comprise modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified, unmodified and differently modified sugar moieties, nucleobases and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motifs, nucleobase motifs and / or internucleoside linkage motifs (as used herein, nucleobase motifs describe modifications to nucleobases independent of the sequence of the nucleobases).

[0259] 1. Specific glycomotifs In certain embodiments, an oligonucleotide comprises one or more modified and / or unmodified sugar moieties arranged in a defined pattern or sugar motif along the oligonucleotide or region thereof, which in certain cases includes, but is not limited to, any of the modified sugar moieties discussed herein.

[0260] In certain embodiments, the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides that comprise a modified sugar moiety. In certain embodiments, the modified sugar moiety is independently selected from a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate moiety. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate moiety is selected from a morpholino, a modified morpholino, THP, and F-HNA.

[0261] In certain embodiments, each nucleoside of a modified oligonucleotide comprises a modified sugar moiety (a "fully modified oligonucleotide"). In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate moiety. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate moiety is selected from a morpholino, a modified morpholino, THP, and F-HNA. In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises the same modified sugar moiety (a "uniformly modified sugar motif"). In certain embodiments, the uniformly modified sugar motif has a nucleoside length of 7-20. In certain embodiments, each nucleoside of a uniformly modified sugar motif comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate moiety. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, and a 2'-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate moiety is selected from a morpholino, a modified morpholino, THP, and F-HNA. In certain embodiments, a modified oligonucleotide having at least one fully modified sugar motif may also comprise at least one, at least two, at least three, or at least four 2'-deoxyribonucleosides.

[0262] In certain embodiments, modified oligonucleotides have a sugar motif selected from 5'→3':eeeeeeeeeeeeeeeeeeee, where each "e" represents a 2'-MOE sugar moiety.

[0263] 2. Specific nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0264] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 5' end of the oligonucleotide.

[0265] 3. Specific internucleoside binding motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or region thereof. In certain embodiments, each internucleoside linkage is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0266] In certain embodiments, modified oligonucleotides contain at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 phosphodiester internucleoside linkages. In certain embodiments, modified oligonucleotides contain at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide contains at least one, at least two, at least three, at least four, or at least five phosphodiester internucleoside linkages, with the remaining internucleoside linkages being phosphorothioate internucleoside linkages.

[0267] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3'):ssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage.

[0268] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif that comprises one or more mesyl phosphoramidate linkages.In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motifs described herein are replaced with mesyl phosphoramidate linkages.

[0269] C. A specific length It is possible to increase or decrease the length of the oligonucleotide without losing activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides ranging from 13 to 25 nucleobases in length for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce targeted cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, oligonucleotides of 13 nucleobases (including those with 1 or 3 mismatches) were used to induce targeted cleavage of the target.

[0270] In certain embodiments, oligonucleotides (including modified oligonucleotides) can be any of a variety of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, where X≦Y. For example, in certain embodiments, the oligonucleotides may be 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13 ...3-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 12-31, 12-32, 6 pieces, 13~17 pieces, 13~18 pieces, 13~19 pieces, 13~20 pieces, 13~21 pieces, 13~22 pieces, 13~23 pieces, 13~24 pieces, 13~25 pieces, 13~26 pieces, 13~27 pieces, 13~2 8 pieces, 13~29 pieces, 13~30 pieces, 14~15 pieces, 14~16 pieces, 14~17 pieces, 14~18 pieces, 14~19 pieces, 14~20 pieces, 14~21 pieces, 14~22 pieces, 14~23 pieces, 14~24 pieces, 14~25 pieces, 14~26 pieces, 14~27 pieces, 14~28 pieces, 14~29 pieces, 14~30 pieces, 15~16 pieces, 15~17 pieces, 15~18 pieces, 15~19 pieces, 15~20 pieces, 15~21 pieces pieces, 15~22 pieces, 15~23 pieces, 15~24 pieces, 15~25 pieces, 15~26 pieces, 15~27 pieces, 15~28 pieces, 15~29 pieces, 15~30 pieces, 16~17 pieces, 16~18 pieces, 16~19 pieces , 16~20 pieces, 16~21 pieces, 16~22 pieces, 16~23 pieces, 16~24 pieces, 16~25 pieces, 16~26 pieces, 16~27 pieces, 16~28 pieces, 16~29 pieces, 16~30 pieces, 17~18 pieces , 17~19 pieces, 17~20 pieces, 17~21 pieces, 17~22 pieces, 17~23 pieces, 17~24 pieces, 17~25 pieces, 17~26 pieces, 17~27 pieces, 17~28 pieces, 17~29 pieces, 17~30 pieces,18~19 pieces, 18~20 pieces, 18~21 pieces, 18~22 pieces, 18~23 pieces, 18~24 pieces, 18~25 pieces, 18~26 pieces, 18~27 pieces, 18~28 pieces, 18~29 pieces, 18~30 pieces, 19~20 pieces, 19~21 pieces, 19~22 pieces, 19~23 pieces, 19~24 pieces, 19~25 pieces, 19~26 pieces, 19~29 pieces, 19~28 pieces, 19~29 pieces, 19~30 pieces, 20~21 pieces, 20~22 pieces, 20~23 pieces, 20~24 pieces, 20~25 pieces, 20~26 pieces, 20~27 pieces, 20~28 pieces, 20~29 pieces, 20~30 pieces, 21~22 pieces, 21~23 pieces, 21~24 pieces, 21~25 pieces, 21~26 pieces, 21~27 pieces, 21~28 pieces, 21~29 pieces, 21~30 pieces, 22~23 pieces, 22~24 pieces, 22~25 pieces, 22~26 pieces, 22~27 pieces, 22~28 pieces, 22~29 pieces, 22~30 pieces, 23~24 pieces, 23~25 pieces, 23~26 pieces, 23~27 pieces, 23~28 pieces, 23~29 pieces, 23~30 pieces, 24~25 pieces, 24~26 pieces, 24~27 pieces, It consists of 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0271] In certain embodiments, the oligonucleotide consists of 16 linked nucleosides. In certain embodiments, the oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the oligonucleotide consists of 20 linked nucleosides.

[0272] D. Certain Modified Oligonucleotides In certain embodiments, the above-mentioned modifications (sugar, nucleobase, internucleoside bond) are introduced into modified oligonucleotide.In certain embodiments, modified oligonucleotide is characterized by its modification motif and overall length.In certain embodiments, each of these parameters is independent of each other.Unless otherwise indicated, all modified parts are independent of nucleobase sequence.

[0273] E. Specific Populations of Modified Oligonucleotides A modified oligonucleotide population, in which all modified oligonucleotides in the modified oligonucleotide population have the same molecular formula, can be a stereorandom population or a chirally enriched population. In a stereorandom population, all chiral centers of all modified oligonucleotides are stereorandom. In a chirally enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage of a specific stereochemical configuration.

[0274] F. Nucleotide sequence In certain embodiments, an oligonucleotide (unmodified or modified) is further described by its nucleobase sequence. In certain embodiments, an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or a specified control nucleic acid (such as a target nucleic acid). In certain such embodiments, a region of the oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or a specified control nucleic acid (such as a target nucleic acid). In certain embodiments, a region or the entire length of the oligonucleotide has a nucleobase sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to a second oligonucleotide or nucleic acid (such as a target nucleic acid).

[0275] II. Certain Oligomeric Compounds In certain embodiments, the present invention provides an oligomeric compound consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group may be attached to either or both termini of the oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both termini of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3' and / or 5' termini of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached to the 5' terminus of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0276] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0277] A. Specific Conjugation Groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups, which in certain embodiments modify one or more properties of the oligonucleotide to which it is attached, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0278] In certain embodiments, one or more sugar moieties may be attached to the modified oligonucleotide to optimize one or more properties of the modified oligonucleotide. In certain embodiments, the sugar moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide may be replaced with another moiety, such as a non-sugar (preferably cyclic) carrier with a sugar ligand attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose-replacement modified subunit (RRMS), where the RRMS is a modified sugar moiety. The cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom (e.g., nitrogen, oxygen, sulfur). The cyclic carrier may be a monocyclic ring system or may contain two or more rings (e.g., fused rings). The cyclic carrier may be a fully saturated ring system or may contain one or more double bonds.

[0279] In certain embodiments, the conjugate group confers a new property on the oligonucleotide to which it is attached (eg, a fluorophore or reporter group that allows for detection of the oligonucleotide). Specific conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), adamantane acetic acid, palmityl moieties (Mishra et al., Biochim. Biophys.Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g. WO2014 / 179620).

[0280] In certain embodiments, a conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0281] In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, or a C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0282] In certain embodiments, the conjugating group is a lipid having the structure:

[0283] [ka]

[0284] 1. Conjugate part Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0285] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetic agents, antibacterial agents, or antibiotic agents.

[0286] 2. Conjugate Linker The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a chemical single bond (i.e., the conjugate moiety is directly attached to the oligonucleotide via a single bond). In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside or amino acid units.

[0287] In certain embodiments, the conjugate linker comprises a pyrrolidine.

[0288] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from an alkyl group, an amino group, an oxo group, an amide group, and an ether group. In certain embodiments, the conjugate linker comprises a group selected from an alkyl group and an amide group. In certain embodiments, the conjugate linker comprises a group selected from an alkyl group and an ether group. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0289] In certain embodiments, the conjugate linker is a bifunctional linking moiety, including the conjugate linkers described above, such as bifunctional linking moieties known in the art to be useful for linking conjugate moieties to compounds, such as oligonucleotides provided by the present invention. In general, bifunctional linking moieties contain at least two functional groups, one of which is selected to react with a specific site on the compound, and the other is selected to react with the conjugate moiety. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophilic groups that react with nucleophilic groups, and nucleophilic groups that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0290] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 A non-limiting list of preferred substituents thereof include, but are not limited to, alkynyl, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0291] In certain embodiments, the conjugate linker comprises 1-10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desired that the linker nucleosides are cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0292] In the present specification, linker nucleosides are not considered to be part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a predetermined number or range of linked nucleosides and / or having a predetermined percentage complementarity with a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker nucleosides, the linker nucleosides are not included in the length of the oligonucleotide and are not used to determine the percentage complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group comprising 1 to 10 linker nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is 31 or more. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and may not comprise a conjugate group. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker nucleoside.

[0293] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are taken up more by certain types of cells, and once the oligomeric compounds are taken up, it is desirable to cleave the conjugate group to release the unconjugated oligonucleotide, i.e., the parent oligonucleotide. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or five or more cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved in a cell or an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0294] In certain embodiments, the cleavable linking moiety is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable linking moiety is one or both esters of phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate ester or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0295] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to either the 3'-terminal nucleoside or the 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugated linker or conjugated moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0296] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula:

[0297] [ka]

[0298] having In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0.

[0299] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0300] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to a branching group. In certain embodiments, the cell targeting moiety targets a neuron. In certain embodiments, the cell targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See, for example, WO2011 / 131693, WO2014 / 064257.

[0301] In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for the transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, the conjugate group described herein comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof may be any known in the art, including, but not limited to, those described in WO1991 / 004753, WO2013 / 103800, WO2014 / 144060, WO2016 / 081643, WO2016 / 179257, WO2016 / 207240, WO2017 / 221883, WO2018 / 129384, WO2018 / 124121, WO2019 / 151539, WO2020 / 132584, WO2020 / 028864, US7,208,174, US9,034,329, and US10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is a F(ab')2, Fab, Fab', Fv, or scFv.

[0302] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the protein or peptide capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO2019 / 140050, WO2020 / 037150, WO2020 / 124032, and US10,138,483.

[0303] In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the aptamer capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO2013 / 163303, WO2019 / 033051, and WO2020 / 245198.

[0304] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one type of receptor on the target cell. In certain embodiments, each ligand has affinity for at least one type of receptor on the surface of mammalian hepatocytes. In certain embodiments, each ligand has affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate.

[0305] In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula:

[0306] [ka]

[0307] having In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0.

[0308] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0309] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently bonded to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently bonded to the branching group.

[0310] B. Specific End Groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. The stabilized 5'-phosphate includes, but is not limited to, a 5'-phosphonate, which includes, but is not limited to, a 5'-vinyl phosphonate. In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain such embodiments, the 2'-linked group is an abasic sugar moiety.

[0311] III. Antisense Activity In certain embodiments, oligomeric compounds and double-stranded oligomers can hybridize with target nucleic acid to produce at least one antisense activity, and such oligomeric compounds and double-stranded oligomers are antisense compounds. In certain embodiments, an antisense compound has antisense activity when it regulates or increases the amount or activity of target nucleic acid by 10%, 20%, 25%, 30%, 40%, 50% or more in standard cell assay. In certain embodiments, an antisense compound has antisense activity when it regulates or reduces the amount of hidden exon-containing target nucleic acid by 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in standard cell assay. In certain embodiments, an antisense compound selectively acts on one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to provide one or more desired antisense activities, and that does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in a manner that would result in significant undesirable antisense activity.

[0312] In certain antisense activities, when an antisense compound hybridizes to a target nucleic acid, it recruits a protein that cleaves the target nucleic acid. For example, certain antisense compounds mediate RNase H cleavage of the target nucleic acid. RNase H is an intracellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides are tolerated.

[0313] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), and finally cuts target nucleic acid.For example, certain antisense compound is cleaved target nucleic acid by Argonaute.The antisense compound that is incorporated into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0314] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not recruit a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid alters the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid inhibits the binding interaction of the target nucleic acid with a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid alters the translation of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid reduces the amount of RNA that contains a cryptic exon. In certain such embodiments, hybridization of an antisense compound to a target nucleic acid results in the elimination of a cryptic exon. In certain embodiments, hybridization of an antisense compound to a target nucleic acid increases the amount of RNA in which the cryptic exon has been eliminated. In certain embodiments, hybridization of an antisense compound to a target nucleic acid increases the amount or activity of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid increases the amount of total target RNA. In certain embodiments, hybridization of an antisense compound complementary to a target nucleic acid results in altered splicing that results in the elimination of an exon in the mRNA.

[0315] Antisense activity may be observed directly or indirectly, in certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a phenotypic change in a cell or animal.

[0316] IV. Specific Target Nucleic Acids In certain embodiments, the oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent comprises or consists of an oligonucleotide that includes a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNAs and pre-mRNAs that include intronic, exonic, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from long non-coding RNAs, short non-coding RNAs, and intronic RNA molecules.

[0317] A. Complementarity / Mismatch with Target Nucleic Acid and Double-Stranded Complementarity In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85% or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100%, i.e., fully complementary to the target nucleic acid. In certain embodiments, the fully complementary region is 6-20 nucleobases long, 10-18 nucleobases long or 18-20 nucleobases long.

[0318] It is possible to introduce mismatched bases without abolishing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) showed that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA can reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-, 28-, and 42-nucleobase oligonucleotides, each consisting of two or three tandem oligonucleotide sequences, to block the translation of human DHFR in a rabbit reticulocyte assay. Only each of the three 14-nucleobase oligonucleotides was able to inhibit translation. However, the levels were more modest than for the 28- or 42-nucleobase oligonucleotides.

[0319] In certain embodiments, oligonucleotide comprises one or more nucleobases that are mismatched with target nucleic acid.In certain embodiments, the antisense activity against target is reduced by such mismatch, but the activity against non-target is reduced by a larger amount.Therefore, in certain embodiments, the selectivity of oligonucleotide is improved.

[0320] B.UNC13A In certain embodiments, the oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent comprises or consists of an oligonucleotide that comprises a region complementary to a target nucleic acid, and the target nucleic acid is an UNC13A nucleic acid. In certain embodiments, the UNC13A nucleic acid has a sequence as shown in SEQ ID NO: 1 (the complementary strand of the truncated strand from nucleosides 17598001 to 17691000 of GENBANK Accession No. NC_000019.10) or SEQ ID NO: 2 (GENBANK Accession No. NM_001080421.2). In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 increases the amount of UNC13A RNA, and in certain embodiments, increases the amount of UNC13A protein. In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 modulates splicing of UNC13A RNA. In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 reduces the amount of UNC13A RNA that contains cryptic exons. In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 increases the amount of UNC13A RNA that excludes cryptic exons. In certain embodiments, the cryptic exon is located in UNC13A intron 20 (i.e., the intron between exon 20 and exon 21 of UNC13A). In certain embodiments, the cryptic exon is CE20x (referred to as "CE" or "CE-1" or "cryptic exon 1"). In certain embodiments, the cryptic exon has a start site at position 48,460 of SEQ ID NO:1 and a stop site at position 48,587 of SEQ ID NO:1.In certain embodiments, the nucleic acid base length of CE20x is 128, and CE20x corresponds to chromosomal coordinate GRCh38:19:17642413:17642541:-1 (Ma, XR, et al., 2021, bioRxiv, doi.org / 10.1101 / 2021.04.02.438213). In certain embodiments, CE20x has the nucleobase sequence CTGCCTGGGTTTCCTGGAAAGAACTCTTATCCCCAGGAACTAGTTTGTTGAATAAATGCTGGTGAATGAATGAATGATTGAACAGATGAATGAGTGATGAGTAGATAAAAGGATGGATGGAGAGATGG (SEQ ID NO: 3; Ma, XR, et al., 2021, bioRxiv, doi.org / 10.1101 / 2021.04.02.438213; Brown, AL., et al., 2021, bioRxiv, doi.org / 10.1101 / 2021.04.02.438170). In certain embodiments, the cryptic exon has a start site at position 48,410 of SEQ ID NO:1 and a stop site at position 48,587 of SEQ ID NO:1. In certain embodiments, the cryptic exon is located in UNC13A intron 20, has a length of 178 nucleobases, and corresponds to chromosomal coordinates GRCh38:19:17642413:17642591:-1 (Ma, XR, et al., 2021, bioRxiv, doi.org / 10.1101 / 2021.04.02.438213) (referred to as "CE-2" or "cryptic exon 2"). In certain embodiments, CE-2 has the nucleobase sequence CCCTAACCACTCAGGATTGGGCCGTTTGTGTCTGGGTATGTCTCTTCCAGCTGCCTGGGTTTCCTGGAAAGAACTCTTATCCCCAGGAACTAGTTTGTTGAATAAATGCTGGTGAATGAATGAATGATTGAACAGATGAATGAGTGATGAGTAGATAAAAGGATGGATGGAGAGATGG (SEQ ID NO: 4). In a particular embodiment, the cryptic exon has a start site at position 48,157 of SEQ ID NO:1 and a stop site at position 48,587 of SEQ ID NO:1.In certain embodiments, the cryptic exon is located in UNC13A intron 20, has a length of 431 nucleobases, and corresponds to chromosomal coordinates GRCh38:19:17642413:17642844:-1 (Ma, XR, et al., 2021, bioRxiv, doi.org / 10.1101 / 2021.04.02.438213) (referred to as "CE-3" or "cryptic exon 3"). In certain embodiments, CE-3 has the nucleobase sequence GTGAGGGTCATTGCTCGGCCCCTCCCATGCCACTTCCACTCACCATTCCTGCCTGCCCAGCTCTTCCTCTTTCTGGCCACACCATCCACACTCTCCTGGCCCTCTGAGACTGCCCGCCATGCCATTCCCTTTACCTGGAAAACTCCTCCCTATCCATCAAAGTCCAGATTCAGGGTCACCTCCTCTGGGAAGCCCACCTTGGCCTCCAGGTTGACTCTCACTACTCATCATCAGGTTCTTCCTTCTATTCCAGCCCTAACCACTCAGGATTGGGCCGTTTGTGTCTGGGTATGTCTCTTCCAGCTGCCTGGGTTTCCTGGAAAGAACTCTTATCCCCAGAACTAGTTTGTTGAATAAATGCTGGTGAATGAATGAATGATTGAACAGATGAATGAGTGATGAGTAGATAAAAGGATGGATGGAGAGATGG (SEQ ID NO:5).

[0321] In certain embodiments, an oligomeric agent, oligomeric compound, or antisense agent is comprised of a modified oligonucleotide.In certain embodiments, an oligomeric agent, oligomeric compound, or antisense agent is comprised of a modified oligonucleotide and a conjugate group.

[0322] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric agent, oligomeric compound, or antisense agent comprises or consists of an oligonucleotide that includes a region that is complementary to a target nucleic acid, which is expressed in pharmacologically relevant tissues, hi certain embodiments, the pharmacologically relevant tissues are cells and tissues that make up the central nervous system (CNS), including but not limited to the spinal cord, cortex (including but not limited to the motor cortex, frontal cortex, and temporal cortex), hippocampus, medulla, and pons.

[0323] V. Specific hotspot areas 1. Nucleic acid bases 48,128 to 48,151 of SEQ ID NO:1 In certain embodiments, nucleobases 48,128-48,151 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense agent is complementary to a portion of nucleobases 48,128-48,151 of SEQ ID NO:1. In certain embodiments, the nucleobase length of the oligomeric compound or antisense agent is 18. In certain embodiments, each nucleoside of the oligomeric compound or antisense agent comprises a 2'-MOE sugar moiety. In certain embodiments, all of the internucleoside linkages of the oligomeric compound or antisense agent are phosphorothioate internucleoside linkages.

[0324] The nucleobase sequences of SEQ ID NOs: 290, 291, 293, and 294 are complementary to nucleobases 48,128 to 48,151 of SEQ ID NO: 1. The nucleobase sequences of the oligomeric compounds or antisense agents of compound numbers 1616310, 1616311, 1616313, and 1616314 are complementary to nucleobases 48,128 to 48,151 of SEQ ID NO: 1.

[0325] In certain embodiments, oligomeric compounds or antisense agents complementary to a portion of nucleobases 48,128-48,151 of SEQ ID NO:1 reduce UNC13A RNA containing CE-1 by at least 69% in a standard cell assay when measured with human primer probe set RTS54362 (designed to specifically recognize cryptic exon 1, thereby measuring RNA containing cryptic exon 1). In certain embodiments, oligomeric compounds or antisense agents complementary to a portion of nucleobases 48,128-48,151 of SEQ ID NO:1 reduce UNC13A RNA containing CE-1 by an average of 78.8% in a standard cell assay when measured with human primer probe set RTS54362.

[0326] 2. Nucleic acid bases 48,432 to 48,465 of SEQ ID NO:1 In certain embodiments, nucleobases 48,432-48,465 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense agent is complementary to a portion of nucleobases 48,432-48,465 of SEQ ID NO:1. In certain embodiments, the nucleobase length of the oligomeric compound or antisense agent is 18. In certain embodiments, each nucleoside of the oligomeric compound or antisense agent comprises a 2'-MOE sugar moiety. In certain embodiments, all of the internucleoside linkages of the oligomeric compound or antisense agent are phosphorothioate internucleoside linkages.

[0327] The nucleobase sequences of SEQ ID NOs: 85-101 are complementary to nucleobases 48,432-48,465 of SEQ ID NO: 1. The nucleobase sequences of the oligomeric compounds or antisense agents of compound numbers 1616105-1616121 are complementary to nucleobases 48,432-48,465 of SEQ ID NO: 1.

[0328] In certain embodiments, an oligomeric compound or antisense agent complementary to a portion of nucleobases 48,432-48,465 of SEQ ID NO:1 reduces UNC13A RNA that contains CE-1, CE-2, and / or CE-3 by at least 52% in a standard cell assay when measured with human primer probe set RTS54363 (designed to recognize all three cryptic exons, thereby measuring RNA that contains any of the three cryptic exons between exon 20 and exon 21 of UNC13A (full coverage of cryptic exons)). In certain embodiments, an oligomeric compound or antisense agent complementary to a portion of nucleobases 48,432-48,465 of SEQ ID NO:1 reduces UNC13A RNA that contains CE-1, CE-2, and / or CE-3 by an average of 65.4% in a standard cell assay when measured with human primer probe set RTS54363.

[0329] 3. Nucleic acid bases 48,466 to 48,561 of SEQ ID NO:1 In certain embodiments, nucleobases 48,466-48,561 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense agent is complementary to a portion of nucleobases 48,466-48,561 of SEQ ID NO:1. In certain embodiments, the nucleobase length of the oligomeric compound or antisense agent is 18. In certain embodiments, each nucleoside of the oligomeric compound or antisense agent comprises a 2'-MOE sugar moiety. In certain embodiments, all internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate internucleoside linkages.

[0330] The nucleic acid base sequences of SEQ ID NOs: 21-30, 32-41, 43-52, 54-60, 62-66, and 326-332 are complementary to nucleic acid bases 48,466-48,561 of SEQ ID NO: 1. The nucleic acid base sequences of the oligomeric compounds or antisense agents of compound numbers 1616041-1616050, 1616052-1616061, 1616063-1616072, 1616074-1616080, 1616082-1616086, and 1616346-1616352 are complementary to nucleic acid bases 48,466-48,561 of SEQ ID NO: 1.

[0331] In certain embodiments, an oligomeric compound or antisense agent complementary to a portion of nucleobases 48,466-48,561 of SEQ ID NO:1 reduces UNC13A RNA that includes CE-1, CE-2, and / or CE-3 by at least 46% in a standard cell assay when measured using human primer probe set RTS54363. In certain embodiments, an oligomeric compound or antisense agent complementary to a portion of nucleobases 48,466-48,561 of SEQ ID NO:1 reduces UNC13A RNA that includes CE-1, CE-2, and / or CE-3 by an average of 75.9% in a standard cell assay when measured using human primer probe set RTS54363.

[0332] VI. SPECIFIC METHODS AND USES Certain embodiments provided herein relate to a method for increasing the amount or activity of UNC13A RNA or reducing the amount of UNC13A RNA containing cryptic exons, which may be useful for treating diseases associated with UNC13A. Examples of diseases treatable with oligomeric compounds, modified oligonucleotides, double-stranded oligomers, and antisense agents include neurodegenerative diseases. In certain embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

[0333] In certain embodiments, the method comprises administering to the subject an oligomeric compound, a modified oligonucleotide, a double-stranded oligomer, or an antisense agent, all of which have a nucleic acid base sequence complementary to UNC13A nucleic acid.In certain embodiments, the subject has a neurodegenerative disease.In certain embodiments, the subject has amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

[0334] In certain embodiments, the method of treating a disease associated with UNC13A comprises administering to a subject an oligomeric compound, a modified oligonucleotide, a double-stranded oligomer, or an antisense agent, all of which have a nucleobase sequence complementary to UNC13A nucleic acid. In certain embodiments, the subject has a disease associated with UNC13A or is at risk of developing it. In certain embodiments, the subject has a neurodegenerative disease. In certain embodiments, the subject has amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). In certain embodiments, at least one symptom of the neurodegenerative disease is improved. In certain embodiments, the symptom is motor dysfunction, muscle weakness, muscle wasting, synaptic dysfunction, fatigue, difficulty speaking, difficulty swallowing, shortness of breath, cognitive dysfunction, shortened life span, or a combination thereof.

[0335] In certain embodiments, the method of increasing expression of UNC13A nucleic acid (e.g., RNA) in a cell comprises contacting the cell with an oligomeric compound, a modified oligonucleotide, a double-stranded oligomer, or an antisense agent, all of which have a nucleobase sequence complementary to the UNC13A nucleic acid. In certain embodiments, the cell is a neuron or a glial cell. In certain embodiments, the cell is an astrocyte or a microglial cell. In certain embodiments, the cell is a human cell.

[0336] In certain embodiments, the method for reducing the amount of UNC13A containing cryptic exons in a cell comprises contacting the cell with an oligomeric compound, a modified oligonucleotide, a double-stranded oligomer, or an antisense agent, all of which have a nucleobase sequence complementary to UNC13A nucleic acid.In certain embodiments, the cell is a neuron or a glial cell.In certain embodiments, the cell is an astrocyte or a microglial cell.In certain embodiments, the cell is a human cell.

[0337] Certain embodiments relate to oligomeric compounds, modified oligonucleotides, double-stranded oligomers, or antisense agents for use in treating diseases associated with UNC13A or for use in manufacturing medicaments for treating diseases associated with UNC13A, all of which have a nucleobase sequence complementary to UNC13A nucleic acid.In certain embodiments, the disease associated with UNC13A is a neurodegenerative disease.In certain embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

[0338] In any of the methods or uses described herein, the oligomeric agent, oligomeric compound, modified oligonucleotide, double-stranded oligomer, or antisense agent may be any described herein.

[0339] VII. Certain Pharmaceutical Compositions In certain embodiments, pharmaceutical compositions comprising one or more oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents are described herein. In certain embodiments, each of the one or more oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents comprises a modified oligonucleotide. In certain embodiments, each of the one or more oligomeric agents, oligomeric compounds, or antisense agents consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises, consists essentially of, or consists of sterile saline and one or more oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises, consists essentially of, or consists of one or more oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises, consists essentially of, or consists of one or more oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises, consists essentially of, or consists of one or more oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.

[0340] In certain embodiments, the pharmaceutical composition comprises an oligomeric agent, an oligomeric compound, a double-stranded oligomer, an antisense agent, or a modified oligonucleotide, and PBS. In certain embodiments, the pharmaceutical composition consists of an oligomeric agent, an oligomeric compound, a double-stranded oligomer, an antisense agent, or a modified oligonucleotide, and PBS. In certain embodiments, the pharmaceutical composition consists essentially of an oligomeric agent, an oligomeric compound, a double-stranded oligomer, an antisense agent, or a modified oligonucleotide, and PBS. In certain embodiments, the PBS is of pharmaceutical grade.

[0341] In certain embodiments, the pharmaceutical composition comprises an oligomeric agent, an oligomeric compound, a double-stranded oligomer, an antisense agent, or a modified oligonucleotide, and an artificial cerebrospinal fluid (aCSF). In certain embodiments, the pharmaceutical composition consists of an oligomeric agent, an oligomeric compound, a double-stranded oligomer, an antisense agent, or a modified oligonucleotide, and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of an oligomeric agent, an oligomeric compound, a double-stranded oligomer, an antisense agent, or a modified oligonucleotide, and an artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is of pharmaceutical grade.

[0342] In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to about 7.1-7.3 or about 7.2 with appropriate pH adjusting agents (e.g., acids (such as hydrochloric acid) and alkalis (such as sodium hydroxide)).

[0343] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0344] In certain embodiments, the oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent may be admixed with pharma- ceutically acceptable active and / or inactive substances to prepare a pharmaceutical composition or formulation. The composition and method for formulating the pharmaceutical composition will depend on a number of criteria, including, but not limited to, the route of administration, the extent of the disease, or the dosage to be administered.

[0345] In certain embodiments, pharmaceutical compositions comprising oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents include any pharmaceutically acceptable salts of such oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents, esters of such oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents comprising one or more modified oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to animals, including humans. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts of oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, the prodrug comprises one or more conjugate groups attached to the modified oligonucleotide, where the conjugate groups are cleaved by endogenous nucleases in the body.

[0346] In certain embodiments, the oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is lyophilized and isolated as a sodium salt. In certain embodiments, the sodium salt of the oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of the oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is mixed with aCSF.

[0347] Lipid moieties have been used in nucleic acid therapeutics in a variety of ways. In certain such methods, nucleic acids (such as oligomeric agents, oligomeric compounds, double-stranded oligomers, or antisense agents) are introduced into preformed liposomes or lipoplexes made with a mixture of cationic and neutral lipids. In certain methods, DNA complexes are formed with monocationic or polycationic lipids in the absence of neutral lipids. In certain embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent to certain cells or tissues. In certain embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent to adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent to muscle tissue. In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including pharmaceutical compositions that include hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0348] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a given tissue or cell type, for example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0349] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% (w / v) benzyl alcohol, 8% (w / v) of the non-polar surfactant Polysorbate 80™, and 65% (w / v) of polyethylene glycol 300 in absolute ethanol. The ratios of such a co-solvent system may be varied considerably without significantly altering its solubility and toxicity characteristics. Furthermore, the composition of the co-solvent components may be changed, for example, other surfactants may be used instead of Polysorbate 80™, the proportion of polyethylene glycol may be changed, polyethylene glycol may be replaced by other biocompatible polymers, such as polyvinylpyrrolidone, and dextrose may be replaced by other sugars or polysaccharides.

[0350] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or act as ingredient preservatives). In certain embodiments, suspension injections are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are supplied in unit dosage form, for example, in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles, and may include formulatory agents such as suspending agents, stabilizing agents, and / or dispersing agents. Particular solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents, as well as fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.

[0351] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be depicted or described in protonated (free acid) form or ionized and cationic (salt) form, but aqueous solutions of such compounds are in equilibrium between such forms. For example, the phosphate bonds of an oligonucleotide in aqueous solution are in equilibrium between free acid form, anionic form, and salt form. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, oligonucleotides in solution exist in a collection of forms at multiple positions all in equilibrium. The term "oligonucleotide" is intended to include all such forms. In the depicted structures, one form is necessarily shown. However, unless otherwise indicated, such drawings are intended to include the corresponding forms as above. As used herein, when a structure showing the free acid of a compound is followed by the term "or a salt thereof" or "or a pharma- ceutically acceptable salt thereof", all such forms, which may be fully or partially protonated / deprotonated / associated with a cation, are expressly included. In certain embodiments, one or more specific cations are specified. The cations may include, but are not limited to, sodium, potassium, calcium, or magnesium.

[0352] In certain embodiments, the modified oligonucleotide, oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is present in a sodium aqueous solution. In certain embodiments, the modified oligonucleotide, oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is present in a potassium aqueous solution. In certain embodiments, the modified oligonucleotide, oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is present in a calcium aqueous solution. In certain embodiments, the modified oligonucleotide, oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is present in a magnesium aqueous solution. In certain embodiments, the modified oligonucleotide, oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is present in PBS. In certain embodiments, the modified oligonucleotide, oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is present in aCSF. In certain embodiments, the modified oligonucleotide, oligomeric agent, oligomeric compound, double-stranded oligomer, or antisense agent is present in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to the desired pH.

[0353] Non-Limiting Disclosure and Incorporation by Reference Each of the publications and patent applications cited herein is incorporated by reference in its entirety.

[0354] While certain compounds and compositions described herein are specifically described according to certain embodiments, the following examples serve only to illustrate, and are not intended to limit, the compounds described herein. Each of the references, GenBank accession numbers, ENSEMBL identifiers, etc., set forth in this application are hereby incorporated by reference in their entirety.

[0355] Although the sequence listing accompanying this application presents each sequence as either "RNA" or "DNA" as appropriate, in practice these sequences may be modified by any combination of chemical modifications. Those skilled in the art will readily recognize that the above designations of "RNA" or "DNA" to describe modified oligonucleotides are optional in certain cases. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (wherein one of the 2'-H of the DNA is replaced with a 2'-OH) or an RNA with a modified base (wherein the uracil of the RNA is replaced with a thymine (methylated uracil)). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to include nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to those with modified nucleobases. By way of further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" includes any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including compounds that contain RNA bases (such as a compound having the sequence "AUCGAUCG"), compounds that have some DNA bases and some RNA bases, such as "AUCGATCG", and compounds that have the sequence "AT m CGAUCG” (in the formula, m C represents a cytosine base containing a methyl group at the 5-position).

[0356] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers, resulting in enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, as in sugar anomers, or as (D) or (L), as in amino acids. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the compound depicted. Compounds provided herein that are depicted or described as having no defined stereochemistry include all possible isomers, including their stereorandom and optically pure forms, unless otherwise indicated. Similarly, tautomers of the compounds are included, unless otherwise indicated. Compounds described herein are intended to include the corresponding salt forms, unless otherwise indicated.

[0357] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds described herein that contain hydrogen atoms include 1 The isotopic substitutions contained in the compounds herein include all possible cases where each of the H hydrogen atoms is replaced by deuterium. 1 H 2 H or 3 Substitution with H, 12 C 13 C or 14 Substitution to C, 14 N 15 Substitution for N, 16 O 17 O or 18 Substitution with O, and 32 S 33 S, 34 S, 35 S or 36In certain embodiments, non-radioactive isotope substitution can provide oligomeric compounds with new properties that are beneficial when used as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make the compound suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0358] The following examples are illustrative of the specific embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are shown, the inventors intend the general application of those specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif reasonably encompasses additional oligonucleotides having the same motif or similar motifs.Also, for example, when a specific high affinity modification is found at a specific position, other high affinity modifications at the same position are considered to be suitable, unless otherwise indicated.

[0359] Example 1: Design of MOE uniformly modified oligonucleotides with uniform phosphorothioate internucleoside linkages complementary to human UNC13A nucleic acid Modified oligonucleotides were designed that are complementary to human UNC13A nucleic acid. The modified oligonucleotides in the table below are MOE uniformly modified oligonucleotides uniformly having phosphorothioate internucleoside linkages. The nucleoside length of these modified oligonucleotides is 18. The sugar motif of these modified oligonucleotides is (5'→3'):eeeeeeeeeeeeeeeeee, where each "e" represents a 2'-MOE sugar moiety. The internucleoside linkage motif of these modified oligonucleotides is (5'→3'):ssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. The "start site" in the table below indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "end site" in the table below indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide set forth in the table below is 100% complementary to SEQ ID NO:1 (the complement of the truncated strand from nucleosides 17598001 to 17691000 of GENBANK Accession No. NC_000019.10), SEQ ID NO:2 (GENBANK Accession No. NM_001080421.2), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0360] [Table 1-1]

[0361] [Table 1-2]

[0362] [Table 1-3]

[0363] [Table 1-4]

[0364] [Table 1-5]

[0365] [Table 1-6]

[0366] [Table 1-7]

[0367] [Table 1-8]

[0368] [Table 1-9]

[0369] Example 2: In vitro effect of a single dose of MOE uniformly modified oligonucleotides with uniform phosphorothioate internucleoside linkages on human UNC13A RNA Modified oligonucleotides complementary to human UNC13A nucleic acid (as described above) are tested for their single dose effect in vitro on UNC13A RNA in cultured cells expressing UNC13A.

[0370] Cultured cells are treated with modified oligonucleotides and RNA is extracted for quantitative real-time RTPCR analysis of UNC13A RNA. Primer probe set A is used to determine the amount of UNC13A RNA that contains the CE20x cryptic exon. Primer probe B is used to determine the amount of UNC13A RNA that excludes the CE20x cryptic exon. Primer probe set C is used to determine the amount of total UNC13A.

[0371] Modified oligonucleotides have been shown to reduce the amount of UNC13A RNA that contains CE20x. Modified oligonucleotides have been shown to increase the amount of UNC13A RNA that is devoid of CE20x. Modified oligonucleotides have been shown to increase the amount of total UNC13A RNA.

[0372] Example 3: Activity of modified oligonucleotides complementary to human UNC13A RNA Modified oligonucleotides complementary to human UNC13A RNA were tested for their single dose effect on UNC13A RNA in vitro. The modified oligonucleotides were tested in a series of experiments having the following culture conditions:

[0373] Prior to treatment with modified oligonucleotides, cultured SH-SY5Y cells were treated with 100 μM cycloheximide for 24 hours. SH-SY5Y cells were then treated with modified oligonucleotides at a concentration of 7,000 nM by electroporation at a density of 100,000 cells / well and seeded back into cycloheximide-containing medium. After approximately 24 hours of treatment, total RNA was isolated from the cells and UNC13A RNA levels were measured by quantitative real-time RTPCR.

[0374] UNCA13A RNA levels were measured using human primer probe set RTS54362 (designed to specifically recognize cryptic exon 1, thereby measuring RNA containing cryptic exon 1) (forward sequence GTACAACCTGGACAAGCGAACT (represented herein as SEQ ID NO: 6), reverse sequence GGAAACCCAGGCAGCTCAT (represented herein as SEQ ID NO: 7), probe sequence ATCAAAGGCGAGGAGAAGGTGGC (represented herein as SEQ ID NO: 8)) (shown in the table below).

[0375] UNCA13A RNA levels were also measured using human primer probe set RTS54363 (designed to recognize all three cryptic exons, and therefore measure RNA containing any of the three cryptic exons between exons 20 and 21 of UNC13A (complete coverage of cryptic exons)) (forward sequence TGGATGGAGAGATGGAACCT (represented herein as SEQ ID NO: 9); reverse sequence GGGCTGTCTCATCGTAGTAAAC (represented herein as SEQ ID NO: 10); probe sequence TTGGCATCTGGGATCTTCACGACC (represented herein as SEQ ID NO: 11)) (shown in the table below).

[0376] UNCA13A RNA levels were also measured with human primer probe set RTS54365 (designed to specifically detect complete elimination of the cryptic exons ("exclusion transcript"), thus measuring RNA that does not include cryptic exons 1, 2, and 3 between exons 20 and 21 of UNC13A) (forward sequence CACCTGTCTGCATGAGAACCT (represented herein as SEQ ID NO: 12), reverse sequence CATGGCAAACTCGTCCACAATC (represented herein as SEQ ID NO: 13), probe sequence TAAACCTTCCAGGCATCGTCACCC (represented herein as SEQ ID NO: 14)) (shown in the table below). Because RTS54365 recognizes significantly more intrinsic expression of transcripts in which all three cryptic exons have been excluded ("exclusion transcripts") than transcripts by RTS54362 or RTS54363 ("included transcripts"), it is expected that the levels of the excluded transcripts will remain unchanged or increase slightly even when the levels of the included transcripts are reduced.

[0377] UNC13A RNA levels were normalized to total RNA content measured by RIBOGREEN®. The table below shows the reduction in UNC13A RNA as a percentage of the amount of UNC13A RNA in untreated control cells (%UTC). Values ​​marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays can be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region.

[0378] [Table 2-1]

[0379] [Table 2-2]

[0380] [Table 2-3]

[0381] [Table 3-1]

[0382] [Table 3-2]

[0383] [Table 3-3]

[0384] [Table 4-1]

[0385] [Table 4-2]

[0386]

Table 4-3

[0387]

Table 5-1

[0388]

Table 5-2

[0389]

Table 5-3

Claims

1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to a portion of equal length of the UNC13A nucleic acid, and the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. (a) The UNC13A nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2; and / or (b) The nucleobase sequence of the modified oligonucleotide is at least 80% complementary to a portion of equal length of nucleobases 48,128 to 48,151, 48,432 to 48,465, or 48,466 to 48,561 of SEQ ID NO: 1; and / or (c) The nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to a portion of equal length of the UNC13A nucleic acid; The oligomeric compound according to claim 1.

3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of 48,128 to 48,151 of SEQ ID NO: 1; complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of 48,432 to 48,465 of SEQ ID NO: 1; or complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of 48,466 to 48,561 of SEQ ID NO: 1; The oligomeric compound as described above.

4. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide contains at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 21 to 332, and the modified oligonucleotide contains at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

5. (a) (i) The nucleobase sequence of the modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 21 to 332; or (ii) The modified oligonucleotide has a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 21 to 332; and / or (b) The modified oligonucleotide is SEQ ID NO: 290, 291, 293, or 294; SEQ ID NOs: 85 to 101; or SEQ ID NOs: 21 to 30, 32 to 41, 43 to 52, 54 to 60, 62 to 66, or 326 to 332; having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of any of the nucleobase sequences; and / or (c) The nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to a portion of equal length of the UNC13A nucleic acid, and the UNC13A nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2; The oligomeric compound according to claim 4.

6. (a) The modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides; and / or (b) The modified oligonucleotide consists of 18 linked nucleosides; and / or (c) At least one nucleoside of the modified oligonucleotide contains a modified sugar moiety, optionally (i) The modified sugar moiety includes a bicyclic sugar moiety, and optionally, the bicyclic sugar moiety contains a 2'-4' bridge selected from -O-CH ２ - and -O-CH(CH ３ )-; or (ii) the modified sugar moiety includes an acyclic modified sugar moiety, optionally, the acyclic modified sugar moiety is a 2'-MOE sugar moiety, 2'-OMe sugar moiety, 2'-NMA sugar moiety, or 2'-F sugar moiety; and / or (d) at least one nucleoside of the modified oligonucleotide compound includes a sugar replacement moiety; and / or (e) each nucleoside of the modified oligonucleotide includes a modified sugar moiety, optionally, each modified sugar moiety is a 2'-MOE sugar moiety or 2'-NMA sugar moiety; and / or (f) the modified oligonucleotide includes at least one modified internucleoside linkage, optionally, the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage; and / or (g) at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage; and / or (h) each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage; and / or (i) at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or 17 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages; and / or (j) the modified oligonucleotide includes at least one modified nucleobase, optionally, the modified nucleobase is 5-methylcytosine, and further optionally, each cytosine is 5-methylcytosine; and / or (k) the modified oligonucleotide is its pharmaceutically acceptable salt, optionally, the pharmaceutically acceptable salt includes one or more cations selected from sodium, potassium, calcium, and magnesium; and / or (l) the oligomeric compound includes a terminal group, optionally, the terminal group is a deglycosylated sugar moiety; and / or (m) the oligomeric compound is a single-stranded oligomeric compound; The oligomeric compound according to any one of claims 1 to 5.

7. The oligomeric compound according to any one of claims 1 to 5, wherein each internucleoside bond is a modified internucleoside bond, and optionally, each internucleoside bond is a phosphorothioate internucleoside bond.

8. The oligomeric compound according to any one of claims 6(a) to (f) or 6(h) to (m), wherein each internucleoside bond is a modified internucleoside bond, and optionally, each internucleoside bond is a phosphorothioate internucleoside bond.

9. The oligomeric compound according to any one of claims 1 to 5, which consists of a modified oligonucleotide.

10. The oligomeric compound according to claim 6, which consists of a modified oligonucleotide.

11. The oligomeric compound according to claim 7, which consists of a modified oligonucleotide.

12. The oligomeric compound according to claim 8, which consists of a modified oligonucleotide.

13. The oligomeric compound comprises a conjugate group, and optionally, (a) the conjugate group comprises a conjugate linker and a conjugate moiety, and optionally, the conjugate linker (i) consists of a single bond; and / or (ii) is cleavable; and / or (iii) contains 1 to 3 linker nucleosides; or (b) the conjugate linker does not contain any linker nucleosides; and / or (c) the conjugate group is attached to the modified oligonucleotide at the 5'-end or the 3'-end of the modified oligonucleotide; The oligomeric compound according to any one of claims 1 to 5.

14. The oligomeric compound comprises a conjugate group, and optionally, (a) the conjugate group comprises a conjugate linker and a conjugate moiety, and optionally, the conjugate linker (i) consists of a single bond; and / or (ii) is cleavable; and / or (iii) contains 1 to 3 linker nucleosides; or (b) the conjugate linker does not contain any linker nucleosides; and / or (c) the conjugate group is attached to the modified oligonucleotide at the 5'-end or the 3'-end of the modified oligonucleotide; The oligomeric compound according to claim 6.

15. The oligomeric compound comprises a conjugate group, optionally, (a) the conjugate group comprises a conjugate linker and a conjugate moiety, and optionally, the conjugate linker (i) consists of a single bond; and / or (ii) is cleavable; and / or (iii) contains 1 to 3 linker nucleosides; or (b) the conjugate linker does not contain any linker nucleosides; and / or (c) the conjugate group is attached to the modified oligonucleotide at the 5'-end or the 3'-end of the modified oligonucleotide; The oligomeric compound according to claim 7.

16. The oligomeric compound comprises a conjugate group, optionally, (a) the conjugate group comprises a conjugate linker and a conjugate moiety, and optionally, the conjugate linker (i) consists of a single bond; and / or (ii) is cleavable; and / or (iii) contains 1 to 3 linker nucleosides; or (b) the conjugate linker does not contain any linker nucleosides; and / or (c) the conjugate group is attached to the modified oligonucleotide at the 5'-end or the 3'-end of the modified oligonucleotide; The oligomeric compound according to claim 8.

17. A population of oligomeric compounds according to any one of claims 1 to 5, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

18. A double-stranded oligomer comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound according to any one of claims 1 to 5, and optionally, the second modified oligonucleotide consists of 8 to 80 linked nucleosides and the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to a portion of equal length of the first modified oligonucleotide.

19. An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound according to any one of claims 1 to 5 or the double-stranded oligomer according to claim 18, and optionally, the antisense agent is a splicing regulator capable of regulating the splicing of UNC13A nucleic acid, and / or the antisense agent comprises a conjugate group, and the conjugate group comprises a cell targeting moiety, said antisense agent.

20. A pharmaceutical composition comprising the oligomeric compound according to any one of claims 1 to 5, the population according to claim 17, the double-stranded oligomer according to claim 18, or the antisense agent according to claim 19, and a pharmaceutically acceptable diluent or carrier, and optionally, the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid, and further optionally, the pharmaceutical composition consists essentially of the oligomeric compound, the population, the double-stranded oligomer, or the antisense agent, and phosphate buffered saline or artificial cerebrospinal fluid, said pharmaceutical composition.

21. A pharmaceutical composition for use in treatment, optionally for use in the treatment of a disease associated with UNC13A, comprising the oligomeric compound according to any one of claims 1 to 5, the population according to claim 17, the double-stranded oligomer according to claim 18, or the antisense agent according to claim 19.

22. The pharmaceutical composition according to claim 20 for use in treatment, optionally for use in the treatment of a disease associated with UNC13A.

23. The disease associated with UNC13A is a neurodegenerative disease, and optionally, (a) the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD), and further optionally, at least one symptom of the neurodegenerative disease is improved; and further optionally, the at least one symptom is motor dysfunction, muscle weakness, muscle wasting, synaptic dysfunction, fatigue, dysphonia, dysphagia, shortness of breath, cognitive dysfunction, shortened lifespan, or a combination thereof; and further optionally, Administering the oligomeric compound, the population, the double-stranded oligomer, the antisense agent, or the pharmaceutical composition results in improvement of motor function, improvement of muscle strength, increase in muscle mass, improvement of speech, improvement of swallowing, improvement of respiration, improvement of synaptic function, improvement of cognition, or extension of lifespan; and / or b) the subject is a human; The pharmaceutical composition according to claim 21.

24. The disease associated with UNC13A is a neurodegenerative disease, optionally a) the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD), and further optionally at least one symptom of the neurodegenerative disease is improved; and further optionally the at least one symptom is motor dysfunction, muscle weakness, muscle wasting, synaptic dysfunction, fatigue, speech difficulty, swallowing difficulty, shortness of breath, cognitive dysfunction, shortening of lifespan, or a combination thereof; and further optionally Administering the oligomeric compound, the population, the double-stranded oligomer, the antisense agent, or the pharmaceutical composition results in improvement of motor function, improvement of muscle strength, increase in muscle mass, improvement of speech, improvement of swallowing, improvement of respiration, improvement of synaptic function, improvement of cognition, or extension of lifespan; and / or b) the subject is a human; The pharmaceutical composition according to claim 22.

Images