Engineered Guide RNAs and Polynucleotides

JP2024520429A5Pending Publication Date: 2025-07-23SHAPE THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023572805
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-01-27
Filing Date
2022-05-23
Publication Date
2025-07-23

AI Technical Summary

Technical Problem

There is a need for highly effective RNA editing payloads that maximize on-target RNA editing while minimizing off-target editing, particularly for genetic diseases, and payloads that facilitate protein knockdown.

Method used

Engineered guide RNAs with specific structural features, such as bulges, loops, and mismatches, are designed to hybridize with target RNAs, enhancing the specificity and efficiency of RNA editing by ADAR enzymes, allowing for targeted editing of adenosines in regions like translation initiation sites, splice sites, and polyA signal sequences.

Benefits of technology

The engineered guide RNAs achieve significant on-target RNA editing with reduced off-target effects, leading to effective mRNA and protein knockdown, particularly in conditions like facioscapulohumeral muscular dystrophy (FSHD), by utilizing ADAR enzymes to convert adenosines to inosines, thereby inhibiting translation and degrading target mRNA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Disclosed herein are engineered guide RNAs and compositions comprising the same for treating a disease or condition in a subject. Also disclosed herein are methods of treating a disease or condition in a subject by administering the engineered guide RNA or pharmaceutical composition described herein.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] cross reference This application claims priority under 35 U.S.C. § 119 from provisional application serial number 63 / 192,818, filed May 25, 2021, provisional application serial number 63 / 216,175, filed June 29, 2021, provisional application serial number 63 / 277,665, filed November 10, 2021, and provisional application serial number 63 / 303,662, filed January 27, 2022, the disclosures of which are incorporated herein by reference in their entireties.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on May 19, 2022, is named 199235-733601_SL.txt and is 508,120 bytes in size. [Background technology]

[0003] Payloads that mediate RNA editing can be a viable therapy for genetic diseases. However, there is a need for highly effective payloads that can maximize on-target RNA editing while minimizing off-target RNA editing. In addition, there is also a need for payloads that can facilitate RNA editing for protein knockdown. Summary of the Invention

[0004] Disclosed herein are compositions comprising an engineered guide RNA or an engineered polynucleotide encoding the engineered guide RNA. In some embodiments, the engineered guide RNA can form a guide-target RNA backbone with the sequence of the DUX4 target RNA upon hybridization to the sequence of the DUX4 target RNA; the formation of the guide-target RNA backbone substantially forms one or more structural features selected from the group consisting of a bulge, an internal loop, a hairpin, and a mismatch formed by a base in the engineered guide RNA against a G, C, or U in the DUX4 target RNA; the structural feature may not be present in the engineered guide RNA prior to hybridization of the engineered guide RNA to the DUX4 target RNA; upon hybridization of the engineered guide RNA to the sequence of the DUX4 target RNA, the engineered guide RNA can facilitate RNA editing of one or more target adenosines in the sequence of the DUX4 target RNA by an RNA editing entity. In some embodiments, the sequence of the DUX4 target RNA can include a translation initiation site, a polyA signal sequence, a splice site, or any combination thereof. In some embodiments, the sequence of the DUX4 target RNA can include a polyA signal sequence. In some embodiments, the one or more features can further include a mismatch formed by a base in the engineered guide RNA relative to an A in the DUX4 target RNA. In some embodiments, the DUX4 can be DUX4-FL. In some embodiments, the sequence of the DUX4 target RNA can include a polyA signal sequence. In some embodiments, the polyA signal sequence can be in DUX4-FL. In some embodiments, the polyA signal sequence can include ATTAAA. In some embodiments, any A in the ATTAAA polyA signal sequence can be a target adenosine. In some embodiments, position 0 of ATTAAA can be the target adenosine, and position 0 is the first A at the 5' end of ATTAAA. In some embodiments, the one or more structural features can include a first 6 / 6 symmetric internal loop at a position selected from the group consisting of -3, -4, -5, -6, -7, -8, -9, -10, and -11 relative to position 0 of ATTAAA.In some embodiments, the first 6 / 6 symmetric internal loop may be at position -5 relative to position 0. In some embodiments, the one or more structural features may further comprise a second 6 / 6 symmetric internal loop at position 33 relative to position 0. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1054. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1054. In some embodiments, the first 6 / 6 symmetric internal loop is at position -6 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 42 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 977. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 977. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 934. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 934. In some embodiments, the one or more structural features may further include at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 3 / 3 symmetric bulge at position 49 relative to position 0, a 3 / 3 symmetric bulge at position 62 relative to position 0, a 3 / 3 symmetric bulge at position 75 relative to position 0, and any combination thereof.In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1575. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1575. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 5 / 5 internal loop at position 47 relative to position 0, a 5 / 5 internal loop at position 60 relative to position 0, a 5 / 5 internal loop at position 73 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1573. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1573. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 5 / 5 internal loop at position 45 relative to position 0, a 5 / 5 internal loop at position 56 relative to position 0, a 5 / 5 internal loop at position 67 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1569. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1569. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 3 / 3 symmetric bulge at position 45 relative to position 0, a 3 / 3 symmetric bulge at position 54 relative to position 0, a 3 / 3 symmetric bulge at position 63 relative to position 0, a 3 / 3 symmetric bulge at position 72 relative to position 0, and any combination thereof.In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1567. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1567. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 4 / 4 symmetric bulge at position 55 relative to position 0, a 4 / 4 symmetric bulge at position 75 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1588. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1588. In some embodiments, the first 6 / 6 symmetric internal loop is at position -9 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 0, a second 6 / 6 symmetric internal loop at position 40 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 593. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 593. In some embodiments, position 3 of ATTAAA is a targeted adenosine, and position 3 is the second A from the 5' end of ATTAAA. In some embodiments, the one or more structural features may comprise a first 6 / 6 symmetric internal loop at a position selected from the group consisting of 22, 21, 20, -2, -4, -5, -6, -7, -8, -9, and -10 relative to position 0 of ATTAAA. In some embodiments, the first 6 / 6 symmetric internal loop is at position 20 relative to position 0. In some embodiments, the one or more structural features may further comprise an A / C mismatch at position 3 relative to position 0.In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 8. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 8. In some embodiments, the first 6 / 6 symmetric internal loop is at position -5 relative to position 0. In some embodiments, the one or more structural features may further comprise a second 6 / 6 symmetric internal loop at position 33 relative to position 0. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1054. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1054. In some embodiments, the first 6 / 6 symmetric internal loop is at position -6 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 42 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 977. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 977. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 5 / 5 symmetric internal loop at position 45 relative to position 0, a 5 / 5 symmetric internal loop at position 56 relative to position 0, a 5 / 5 symmetric internal loop at position 67 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1569. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1569.In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 3 / 3 symmetric bulge at position 45 relative to position 0, a 3 / 3 symmetric bulge at position 54 relative to position 0, a 3 / 3 symmetric bulge at position 63 relative to position 0, a 3 / 3 symmetric bulge at position 72 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1567. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1567. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 5 / 5 symmetric internal loop at position 47 relative to position 0, a 5 / 5 symmetric internal loop at position 60 relative to position 0, a 5 / 5 symmetric internal loop at position 73 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1573. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1573. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 4 / 4 symmetric bulge at position 55 relative to position 0, a 4 / 4 symmetric bulge at position 75 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1588. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1588. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 3 / 3 symmetric bulge at position 49 relative to position 0, a 3 / 3 symmetric bulge at position 62 relative to position 0, a 3 / 3 symmetric bulge at position 75 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1575. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1575.In some embodiments, the first 6 / 6 symmetric internal loop is at position -9 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 0, a second 6 / 6 symmetric internal loop at position 40 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 593. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 593. In some embodiments, the one or more structural features may comprise a first 2 / 2 symmetric bulge at a position selected from the group consisting of -3, -5, and -7 relative to position 0 of ATTAAA. In some embodiments, the first 2 / 2 symmetric bulge is at position -5 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of a 2 / 2 symmetric bulge at position 26 relative to position 0, a 2 / 2 symmetric bulge at position 42 relative to position 0, a 2 / 2 symmetric bulge at position 58 relative to position 0, a 2 / 2 symmetric bulge at position 74 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1545. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1545. In some embodiments, position 4 of ATTAAA is a targeted adenosine, and position 4 is the third A from the 5' end of ATTAAA. In some embodiments, the one or more structural features may include a first 6 / 6 symmetric internal loop at a position selected from the group consisting of 33, -1, -2, -3, -4, -5, -6, -7, -8, -9, -11, and -12 relative to position 0 of ATTAAA. In some embodiments, the first 6 / 6 symmetric internal loop is at position -1 relative to position 0.

[0005] In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 4 relative to position 0, a second 6 / 6 symmetric internal loop at position 32 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1463. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1463. In some embodiments, the first 6 / 6 symmetric internal loop is at position -3 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 4 relative to position 0, a second 6 / 6 symmetric internal loop at position 36 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1294. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1294. In some embodiments, the first 6 / 6 symmetric internal loop is at position -5 relative to position 0. In some embodiments, the one or more structural features may further comprise a second 6 / 6 symmetric internal loop at position 33 relative to position 0. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1054. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1054. In some embodiments, the first 6 / 6 symmetric internal loop is at position -6 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:934.In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 934. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 5 / 5 symmetric internal loop at position 47 relative to position 0, a 5 / 5 symmetric internal loop at position 60 relative to position 0, a 5 / 5 symmetric internal loop at position 73 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1573. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1573. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 3 / 3 symmetric bulge at position 49 relative to position 0, a 3 / 3 symmetric bulge at position 62 relative to position 0, a 3 / 3 symmetric bulge at position 75 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1575. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1575. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 3 / 3 symmetric bulge at position 45 relative to position 0, a 3 / 3 symmetric bulge at position 54 relative to position 0, a 3 / 3 symmetric bulge at position 63 relative to position 0, a 3 / 3 symmetric bulge at position 72 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1567.In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1567. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 5 / 5 symmetric internal loop at position 45 relative to position 0, a 5 / 5 symmetric internal loop at position 56 relative to position 0, a 5 / 5 symmetric internal loop at position 67 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1569. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1569. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 4 / 4 symmetric bulge at position 55 relative to position 0, a 4 / 4 symmetric bulge at position 75 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1588. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1588. In some embodiments, the first 6 / 6 symmetric internal loop is at position -9 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 0, a second 6 / 6 symmetric internal loop at position 40 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 593. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 593. In some embodiments, position 5 of ATTAAA is the target adenosine, and position 5 is the fourth A from the 5' end of ATTAAA.In some embodiments, the one or more structural features may comprise a first 6 / 6 symmetric internal loop at a position selected from the group consisting of 33, 23, -1, -2, -3, -4, -5, -6, -7, -8, -9, -10, and -12 relative to position 0 of ATTAAA. In some embodiments, the first 6 / 6 symmetric internal loop is at position -1 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 4 relative to position 0, a second 6 / 6 symmetric internal loop at position 32 relative to position 0, and combinations thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1463. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1463. In some embodiments, the first 6 / 6 symmetric internal loop is at position -5 relative to position 0. In some embodiments, the one or more structural features may further comprise a second 6 / 6 symmetric internal loop at position 33 relative to position 0. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1054. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1054. In some embodiments, the first 6 / 6 symmetric internal loop is at position -6 relative to position 0. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 3 / 3 symmetric bulge at position 49 relative to position 0, a 3 / 3 symmetric bulge at position 62 relative to position 0, a 3 / 3 symmetric bulge at position 75 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1575. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1575.In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 3 / 3 symmetric bulge at position 45 relative to position 0, a 3 / 3 symmetric bulge at position 54 relative to position 0, a 3 / 3 symmetric bulge at position 63 relative to position 0, a 3 / 3 symmetric bulge at position 72 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1567. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1567. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 5 / 5 symmetric internal loop at position 47 relative to position 0, a 5 / 5 symmetric internal loop at position 60 relative to position 0, a 5 / 5 symmetric internal loop at position 73 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1573. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1573. In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 5 / 5 symmetric internal loop at position 45 relative to position 0, a 5 / 5 symmetric internal loop at position 56 relative to position 0, a 5 / 5 symmetric internal loop at position 67 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1569. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1569.In some embodiments, the one or more structural features may further comprise at least one structural feature selected from the group consisting of an A / C mismatch at position 3 relative to position 0, a second 6 / 6 symmetric internal loop at position 33 relative to position 0, a 4 / 4 symmetric bulge at position 55 relative to position 0, a 4 / 4 symmetric bulge at position 75 relative to position 0, and any combination thereof. In some embodiments, the engineered guide. The RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1588. In some embodiments, the engineered guide RNA may comprise SEQ ID NO: 1588. In some embodiments, the method may further comprise editing at any A in ATTAAA. In some embodiments, the one or more structural features comprise a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 8. In some embodiments, the one or more structural features may comprise a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 593. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed three nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 934. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed three nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 977. In some embodiments, the one or more structural features may include a 1 nucleotide mismatch formed 3 nucleotides downstream (3') from target A and a 6 nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1054. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed three nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1294. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed three nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1463. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed three nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1545. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed three nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1567. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1569. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed three nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1573. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed three nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1575. In some embodiments, the one or more structural features may include a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some embodiments, the engineered guide RNA may have at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 1588. In some embodiments, the one or more structural features may include a first 6 / 6 symmetric internal loop and at least one additional structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop, a 5 / 5 symmetric internal loop, a 4 / 4 symmetric bulge, a 3 / 3 symmetric bulge, and a 2 / 2 symmetric bulge. In some embodiments, the guide-target RNA backbone may further comprise an A / C mismatch, wherein a cytosine of the A / C mismatch is present opposite one or more target adenosines in the engineered guide RNA; the one or more structural features include a first 6 / 6 symmetric internal loop located at positions −4 to −8 relative to the A / C mismatch; and a second 6 / 6 symmetric internal loop located at positions +31 to +35 relative to the A / C mismatch.

[0006] In some embodiments, the guide-target RNA backbone may further comprise an A / C mismatch, where a cytosine of the A / C mismatch is present in the engineered guide RNA opposite one or more target adenosines; the one or more structural features may include a first 6 / 6 symmetric internal loop at position -6 relative to the A / C mismatch; and a second 6 / 6 symmetric internal loop at position +33 relative to the A / C mismatch. In some embodiments, the first 6 / 6 symmetric internal loop may comprise the sequence GGAACU on the engineered guide RNA side and the sequence UUCAGA on the target RNA side. In some embodiments, the second 6 / 6 symmetric internal loop may comprise the sequence CUGACC on the engineered guide RNA side and the sequence AGAUUU on the target RNA side. In some embodiments, the one or more structural features may include a first 6 / 6 symmetric internal loop and a second 6 / 6 symmetric internal loop, where each A in the target RNA is base-paired with a U in the engineered guide RNA. In some embodiments, the one or more structural features may include a bulge. In some embodiments, the bulge may be a symmetric bulge. In some embodiments, the one or more structural features may include a bulge. In some embodiments, the bulge may be an asymmetric bulge. In some embodiments, the one or more structural features may include an internal loop, and the internal loop is a symmetric internal loop. In some embodiments, the one or more structural features may include an internal loop. In some embodiments, the internal loop may be an asymmetric internal loop. In some embodiments, the one or more structural features may include a mismatch formed by a base in the engineered guide RNA relative to a G, C, or U in the DUX4 target RNA. In some embodiments, the RNA editing entity may include ADAR1, ADAR2, ADAR3, or any combination thereof. In some embodiments, RNA editing of one or more target adenosines may include hyper-editing. In some embodiments, hyper-editing may include editing of multiple A's in the poly-A signal sequence of the DUX4 target RNA. In some embodiments, the internal loop of the engineered guide RNA may include any nucleotide in any positional order.In some embodiments, no nucleotides in any positional order are complementary to their counterparts in the DUX4 target RNA. In some embodiments, the engineered guide RNA or the engineered polynucleotide encoding the engineered guide RNA may be circular. In some embodiments, the engineered guide RNA or the engineered polynucleotide encoding the engineered guide RNA may comprise a U7 hairpin sequence, an SmOPT sequence, or a combination thereof, where optionally the U7 hairpin sequence may comprise SEQ ID NO: 1591 or 1593 and the SmOPT sequence may comprise SEQ ID NO: 1595. In some embodiments, the DUX4 target RNA may comprise a DUX4 pre-mRNA transcript. In some embodiments, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the DUX4 pre-mRNA transcripts may have at least one edit in the polyA signal sequence. In some embodiments, at least 80% of DUX4 pre-mRNA transcripts may have at least one edit in the polyA signal sequence. In some embodiments, editing one or more adenosines may facilitate mRNA knockdown. In some embodiments, mRNA knockdown may include knockdown of DUX4 mRNA. In some embodiments, mRNA knockdown may include a reduction of at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% in mRNA levels after RNA editing compared to mRNA levels before RNA editing. In some embodiments, mRNA knockdown may be at least 50% of mRNA levels compared to mRNA levels before RNA editing. In some embodiments, mRNA knockdown may be at least 70% of mRNA levels compared to mRNA levels before RNA editing. In some embodiments, editing one or more adenosines may facilitate protein knockdown. In some embodiments, protein knockdown may include knockdown of DUX4.In some embodiments, protein knockdown may include knockdown of a protein downstream of DUX4. In some embodiments, the protein downstream of DUX4 may include SLC34A2, LEUTX, ZSCAN4, PRAMEF12, TRIM43, DEFB103, or MBD3L2, or any combination thereof. In some embodiments, protein knockdown may include at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% reduction in protein level after RNA editing compared to the protein level before RNA editing. In some embodiments, protein knockdown may include at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% reduction in protein level in ADAR-expressing cells compared to cells containing non-functional ADAR genes. In some embodiments, protein knockdown may include ADAR-dependent protein knockdown. In some embodiments, ADAR-dependent protein knockdown may include a reduction in protein levels by at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% compared to protein levels before RNA editing. In some embodiments, the engineered guide RNA is an in vitro transcribed (IVT) engineered guide RNA. In some embodiments, the composition may comprise an engineered polynucleotide. In some embodiments, the engineered polynucleotide may be contained within or on a vector. In some embodiments, the vector may be a viral vector. In some embodiments, the engineered polynucleotide may be encapsidated in a viral vector. In some embodiments, the viral vector may be an adeno-associated viral (AAV) vector or a derivative thereof. In some embodiments, the vector may be a non-viral vector.In some embodiments, the non-viral vector may be a lipid nanoparticle (LNP), liposome, or polymer nanoparticle. In some embodiments, the engineered polynucleotide may be a DNA polynucleotide encoding an engineered guide RNA. In some embodiments, the engineered guide RNA may comprise at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs: 2-1589. In some embodiments, the engineered guide RNA may comprise the sequence of any one of SEQ ID NOs: 2-1589.

[0007] Also described herein are pharmaceutical compositions comprising: a) any of the compositions described above; and b) a pharmaceutically acceptable excipient, carrier, or diluent.

[0008] Also described herein are methods of treating a disease or condition in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of any of the above-described compositions or pharmaceutical compositions described above.

[0009] In some embodiments, the disease or condition may include facioscapulohumeral muscular dystrophy (FSHD). In some embodiments, the FSHD may include FSHD type I. In some embodiments, the FSHD may include FSHD type II. In some embodiments, administering may include parenteral administration, intravenous administration, subcutaneous administration, intrathecal administration, intraperitoneal administration, intramuscular administration, intravascular administration, injection administration, topical administration, oral administration, inhalation administration, intraduodenal administration, rectal administration, or a combination thereof. In some embodiments, administering may be oral administration. In some embodiments, administering may include systemic administration.

[0010] Also described herein are methods for editing DUX4 RNA. In some embodiments, the method can include contacting DUX4 RNA with any one of the above-described compositions and an RNA editing entity, thereby editing the DUX4 RNA. In some embodiments, the editing can include editing at any A position in the polyA tail of the DUX4 RNA. In some embodiments, the DUX4 RNA can include a DUX4 pre-mRNA transcript. In some embodiments, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the DUX4 pre-mRNA transcripts have at least one edit in the polyA signal sequence. In some embodiments, editing the DUX4 RNA can facilitate protein knockdown. In some embodiments, the protein knockdown can include knockdown of DUX4.

[0011] Also described herein are the aforementioned compositions and the aforementioned pharmaceutical compositions for use as medicines. In some embodiments, the aforementioned compositions or the aforementioned pharmaceutical compositions may be for use in treating facioscapulohumeral muscular dystrophy (FSHD). In some embodiments, FSHD may include FSHD type I. In some embodiments, FSHD may include FSHD type II.

[0012] Incorporation by Reference

[0013] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0014] The novel features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which exemplary principles of the present disclosure are utilized, and the accompanying drawings. [Brief explanation of the drawings]

[0015] [Figure 1] 1 shows a schematic of the dual homeobox 4 (DUX4) target, highlighting sites that can be targeted by engineered guide RNAs of the present disclosure. [Figure 2] 1 shows a schematic diagram of the DMPK target, highlighting the sites that can be targeted by the engineered guide RNAs of the present disclosure. [Figure 3] 1 shows a schematic diagram of PMP22 targets, highlighting sites that can be targeted by engineered guide RNAs of the present disclosure. [Figure 4] 1 shows a schematic diagram of the SOD1 target, highlighting sites that can be targeted by engineered guide RNAs of the present disclosure. [Figure 5-1] 1 shows a legend for various exemplary structural features present in the guide-target RNA backbone formed upon hybridization of a potential guide RNA of the present disclosure to a target RNA. Exemplary structural features shown include an 8 / 7 asymmetric loop (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (24 nucleotides on the target RNA side base-paired to 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). This figure discloses SEQ ID NOs: 1602 and 1603, respectively, in order of appearance. [Figure 5-2] Same as above. [Figure 6]1 is a plot showing the sequence similarity of engineered DUX4-targeting guide RNA sequences of the present disclosure to standard guide RNA designs on the x-axis and the fraction edited by the ADAR2 enzyme on the y-axis. These data highlight the diverse sequence space represented by the engineered DUX4-targeting guide RNA sequences of the present disclosure, which have a variety of different structural features that induce sequence diversity and exhibit high on-target editing efficiency. [Figure 7] Schematic diagram of luciferase and GFP reporter constructs designed to determine changes in expression of reporters fused to mutated DUX4-FL polyA site adenosines. [Figure 8A] 1 shows the viability and transfection efficiency of LHCN cells after transfection with a luciferase reporter. [Figure 8B] The mCherry median fluorescence intensity (MFI) of luciferase reporter transfected LHCN cells is shown. [Figure 8C] Luciferase signals normalized to mCherry MFI for luciferase constructs carrying mutant or wild-type DUX4-FL polyA site adenosines are shown. [Figure 9A] 1 shows the viability and transfection efficiency of LHCN cells after transfection with a GFP reporter. [Figure 9B] The median mCherry fluorescence intensity (MFI) of GFP reporter-transfected LHCN cells is shown. [Figure 9C] Shown are GFP MFI signals normalized to mCherry MFI for GFP constructs carrying mutant or wild-type DUX4-FL polyA site adenosines. [Figure 10-1] Figure 1 shows editing of an integrated DUX4-luciferase reporter in HEK cells using different guide RNAs. [Figure 10-2] Same as above. [Figure 10-3] Same as above. [Figure 11-1] 1 shows editing of an integrated DUX4-luciferase reporter in ADAR1 / 2 (1 and 2) knockout HEK cells using different guide RNAs. [Figure 11-2] Same as above. [Figure 11-3] Same as above. DETAILED DESCRIPTION OF THE INVENTION

[0016] RNA editing RNA editing can refer to the process by which RNA can be enzymatically modified after synthesis with specific nucleosides. RNA editing can include any one of the following: insertion, deletion, or substitution of nucleotide(s). Examples of RNA editing include chemical modification, such as pseudouridylation (isomerization of uridine residues) and deamination (removal of amine from cytidine to generate uridine, or editing C to U, adenosine to inosine, or A to I). RNA editing can be used to introduce mutations, correct missense mutations, or edit the coding or non-coding region of RNA to inhibit RNA translation and cause protein knockdown.

[0017] Described herein are engineered guide RNAs that facilitate RNA editing by an RNA editing entity (e.g., an adenosine deaminase acting on RNA (ADAR)) or a biologically active fragment thereof. In some examples, the ADAR may be an enzyme that catalyzes the chemical conversion of adenosine to inosine in RNA. Because the properties of inosine mimic those of guanosine (inosine will form two hydrogen bonds with, for example, cytosine), inosine can be recognized as guanosine by the translational cellular machinery. Therefore, "adenosine-to-inosine (A to I) RNA editing" effectively changes the primary sequence of the RNA target. Typically, ADAR enzymes share a common domain structure, including a variable number of amino-terminal dsRNA-binding domains (dsRBDs) and a single carboxy-terminal catalytic deaminase domain. Human ADARs possess two or three dsRBDs. Evidence suggests that ADARs can form homodimers as well as heterodimers with other ADARs when bound to double-stranded RNA, although it is currently unclear whether dimerization is necessary for editing to occur. The engineered guide RNAs disclosed herein can facilitate RNA editing by any one or any combination of the three identified human ADAR genes (ADAR1-3). ADARs have a typical modular domain organization, containing at least two copies of a dsRNA-binding domain (dsRBD; ADAR1 has three dsRBDs; ADAR2 and ADAR3 each have two dsRBDs) in their N-terminal region, followed by a C-terminal deaminase domain. The engineered guide RNAs disclosed herein facilitate RNA editing by endogenous ADAR enzymes. In some embodiments, exogenous ADARs can be delivered together with the engineered guide RNAs disclosed herein.

[0018] In some embodiments, the present disclosure provides engineered guide RNAs that facilitate editing at specific regions in target RNAs (e.g., mRNAs or pre-mRNAs). For example, the engineered guide RNAs disclosed herein may target the coding sequence of an RNA. The target region in the coding sequence of an RNA may be the translation initiation site (TIS). The engineered guide RNAs disclosed herein may target a non-coding sequence of an RNA, such as a polyadenylation (polyA) signal sequence in the 3'UTR. The engineered guide RNAs disclosed herein may target a splice site. In some cases, the splice site may be present in the pre-mRNA (before processing to remove introns).

[0019] In some embodiments, the present disclosure provides engineered guide RNAs that facilitate editing at multiple adenosines. The hydrolytic deamination of multiple adenosines in RNA can be referred to as hyperediting. In some cases, hyperediting can occur in cis (e.g., at an Alu element) or trans (e.g., in a target RNA by an engineered guide RNA). In some cases, hyperediting can include editing at the polyA signal sequence of a DUX4-FL target RNA. In some cases, hyperediting can introduce editing at at least two or more nucleotides in a target RNA of interest. In some cases, hyper-editing may introduce at least or up to about 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, or at least or up to about 100 edits in a region of the target RNA. In one embodiment, hyper-editing may occur in an untranslated region, a translated region, a 3'UTR, a 5'UTR, or any combination thereof.

[0020] TIS. In some embodiments, the engineered guide RNA of the present disclosure targets the adenosine in translation initiation site (TIS).Engineered guide RNA facilitates the ADAR-mediated RNA editing of TIS (AUG) to GUG.This leads to the inhibition of RNA translation, thereby leading to protein knockdown.

[0021] Splice site. In some embodiments, the engineered guide RNA of the present disclosure targets adenosine at the splice site. The engineered guide RNA facilitates ADAR-mediated RNA editing of A at the splice site. This can result in mistranslation and / or cleavage of the protein encoded by the pre-mRNA molecule, thereby resulting in protein knockdown.

[0022] PolyA signal sequence. In some embodiments, the engineered guide RNA of the present disclosure targets one or more adenosines in a polyA signal sequence. In some embodiments, the engineered guide RNA facilitates ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence, thereby interfering with RNA processing and causing target mRNA degradation and, thereby, protein knockdown. In some embodiments, the target may have one or more polyA signal sequences. In these examples, one or more engineered guide RNAs of the present disclosure (different in their respective sequences) may be multiplexed to target one or more adenosines in a polyA signal sequence. In both cases, the engineered guide RNA of the present disclosure facilitates ADAR-mediated RNA editing of adenosines to inosines (which are read as guanosines by the cellular machinery) in the polyA signal sequence, resulting in protein knockdown.

[0023] Engineered guide RNAs Disclosed herein are engineered guide RNAs and engineered polynucleotides encoding the same for site-specific selective editing of target RNAs via RNA editing entities or biologically active fragments thereof. The engineered guide RNAs of the present disclosure may comprise potential structures such that, when the engineered guide RNA hybridizes to a target RNA to form a guide-target RNA backbone, at least a portion of the potential structures appear as at least a portion of the structural features described herein.

[0024] The engineered guide RNA described herein comprises a targeting domain that is complementary to the target RNA described herein.In this way, the guide RNA can be engineered to site-specifically / selectively target and hybridize to a specific target RNA, thereby facilitating the editing of a specific nucleotide in the target RNA via an RNA editing entity or its biologically active fragment.The targeting domain can include a nucleotide that, when the guide RNA hybridizes to the target RNA, faces the base that is edited by the RNA editing entity or its biologically active fragment, and is positioned so that it does not base-pair with the edited base or does not base-pair sufficiently with the edited base.This mismatch can help the RNA editing entity localize the editing to the desired base of the target RNA.However, in some cases, in addition to the desired editing, there may be some degree of, and in some cases, significant, off-target editing.

[0025] Hybridization of the targeting domain of the guide RNA and the target RNA generates specific secondary structures in the guide-target RNA backbone that emerge upon hybridization, referred to herein as "cryptic structures." When present, these cryptic structures result in the structural features described herein, including mismatches, bulges, internal loops, and hairpins. Without wishing to be bound by theory, the presence of the structural features described herein generated by hybridization of the guide RNA and the target RNA configures the guide RNA to facilitate specific or selective targeted editing of the target RNA via an RNA editing entity or a biologically active fragment thereof. Furthermore, structural features in combination with the mismatches described above typically facilitate increased editing of target adenosines, less off-target editing, or both, compared to constructs containing mismatches alone or constructs with perfect complementarity to the target RNA. Thus, rational design of cryptic structures in engineered guide RNAs of the present disclosure to generate specific structural features in the guide-target RNA backbone can be a powerful tool for promoting target RNA editing with high specificity, selectivity, and robust activity. FIG. 5 shows a target RNA backbone with exemplary structural features.

[0026] Provided herein are engineered guides and polynucleotides encoding them; as well as compositions comprising the engineered guide RNA or the polynucleotides. As used herein, the term "engineered" with respect to a guide RNA or a polynucleotide encoding it refers to a non-naturally occurring guide RNA or a polynucleotide encoding it. For example, the present disclosure provides an engineered polynucleotide encoding an engineered guide RNA. In some embodiments, the engineered guide comprises RNA. In some embodiments, the engineered guide comprises DNA. In some examples, the engineered guide comprises modified or unmodified RNA bases. In some embodiments, the engineered guide comprises modified or unmodified DNA bases. In some examples, the engineered guide comprises both DNA and RNA bases.

[0027] In some examples, the engineered guides provided herein include engineered guides that can be configured to hybridize to a target RNA molecule to form, at least in part, a guide-target RNA backbone with at least a portion of the target RNA molecule, the guide-target RNA backbone comprising at least one structural feature, and the guide-target RNA backbone recruits an RNA editing entity and facilitates chemical modification of bases of nucleotides in the target RNA molecule by the RNA editing entity.

[0028] In some examples, the target RNA of the engineered guide RNA of the present disclosure can be pre-mRNA or mRNA.In some embodiments, the engineered guide RNA of the present disclosure hybridizes to the sequence of the target RNA.In some embodiments, a portion of the engineered guide RNA (e.g., targeting domain) hybridizes to the sequence of the target RNA.The portion of the engineered guide RNA that hybridizes to the target RNA is sufficiently complementary to the sequence of the target RNA for hybridization to occur.

[0029] A. Targeting Domains The engineered guide RNA disclosed herein can be engineered in any suitable way for RNA editing.In some examples, engineered guide RNA usually comprises at least a targeting sequence that hybridizes with the region of target RNA molecule.Targeting sequence can also be referred to as "targeting domain" or "targeting region".

[0030] In some cases, the targeting domain of the engineered guide allows the engineered guide to target an RNA sequence via base pairing, for example, Watson-Crick base pairing. In some examples, the targeting sequence can be located at either the N-terminus or C-terminus of the engineered guide. In some cases, the targeting sequence can be located at both ends. The targeting sequence can be of any length. In some cases, the targeting sequence is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 0, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 5, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122 , 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or up to about 200 nucleotides.In some cases, the targeting sequence is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122 1, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 , 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122 The length of the engineered guide RNA may be 2, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or 200 nucleotides or less. In some examples, the engineered guide RNA comprises a targeting sequence that may be about 60 to about 500, about 60 to about 200, about 75 to about 100, about 80 to about 200, about 90 to about 120, or about 95 to about 115 nucleotides in length. In some examples, the engineered guide RNA comprises a targeting sequence that may be about 100 nucleotides in length.

[0031] In some cases, the targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity with the target RNA. In some cases, the targeting sequence comprises less than 100% complementarity with the target RNA sequence. For example, the targeting sequence and the region of the target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0032] B. Engineered guide RNAs with recruitment domains In some examples, the engineered guide RNA of interest comprises a recruitment domain that recruits an RNA editing entity (e.g., an ADAR), and in some examples, the recruitment domain is formed and exists in the absence of binding to the target RNA. A "recruitment domain" may be referred to herein as a "recruitment sequence" or "recruitment region." In some examples, the engineered guide of interest may be configured to facilitate editing of nucleotide bases of a polynucleotide in a region of the target RNA, regulated expression of a polypeptide encoded by the target RNA, or both. In some cases, the engineered guide may be configured to facilitate editing of nucleotides or polynucleotide bases in a region of the RNA by a target RNA editing entity. To facilitate editing, the engineered guide RNA of the present disclosure may recruit an RNA editing entity. Various RNA editing entity recruitment domains may be utilized. In some examples, the recruitment domain comprises glutamate ionotropic receptor AMPA-type subunit 2 (GluR2), APOBEC, or Alu.

[0033] In some instances, multiple recruitment domains can be included in the engineered guide of the present disclosure. In instances where a recruitment domain is present, the recruitment domain can be used to position the RNA editing entity to effectively react with the target RNA of interest after the targeting sequence, for example, the antisense sequence, hybridizes to the target RNA. In some instances, the recruitment domain can allow the RNA editing entity to bind temporarily to the engineered guide. In some instances, the recruitment domain can allow the RNA editing entity to bind permanently to the engineered guide. The recruitment domain can be of any length. In some cases, the recruitment domain can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, up to about 80 nucleotides in length. In some cases, the recruitment domain can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 80 nucleotides in length or less. In some cases, the recruitment domain can be about 45 nucleotides in length. In some cases, at least a portion of the recruitment domain comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of the recruitment domain comprises about 45 nucleotides to about 60 nucleotides.

[0034] In one embodiment, the recruitment domain comprises a GluR2 sequence or a functional fragment thereof. In some cases, the GluR2 sequence can be recognized by an RNA editing entity, such as an ADAR, or a biologically active fragment thereof. In some embodiments, the GluR2 sequence can be a non-naturally occurring sequence. In some cases, the GluR2 sequence can be modified, for example, for improved recruitment. In some embodiments, the GluR2 sequence can include a portion of a naturally occurring GluR2 sequence and a synthetic sequence.

[0035] In some examples, the recruitment domain comprises a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity and / or length to the GluR2 sequence, or GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 1). In some cases, the recruitment domain may comprise at least about 80% sequence identity to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 1. In some examples, the recruitment domain may comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence identity and / or length to SEQ ID NO: 1.

[0036] Additional RNA editing entity recruitment domains are also contemplated. In one embodiment, the recruitment domain comprises an apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) domain. In some cases, the APOBEC domain may comprise a non-naturally occurring sequence or a naturally occurring sequence. In some embodiments, the sequence encoding the APOBEC domain may comprise a modified portion. In some cases, the sequence encoding the APOBEC domain may comprise a portion of the sequence encoding a naturally occurring APOBEC domain. In another embodiment, the recruitment domain may be from an Alu domain.

[0037] A number of recruitment domains can be found in the engineered guides of the present disclosure. In some instances, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruitment domains can be included in an engineered guide. The recruitment domain can be located anywhere in the subject guide. In some cases, the recruitment domain can be at the N-terminus, middle, or C-terminus of the polynucleotide. The recruitment domain can be upstream or downstream of the targeting sequence. In some cases, the recruitment domain is adjacent to the targeting sequence of the subject guide. The recruitment sequence can contain all ribonucleotides or deoxyribonucleotides, although recruitment domains containing both ribonucleotides and deoxyribonucleotides may not be excluded in some cases.

[0038] C. Engineered guide RNAs with potential structures In some examples, the engineered guide disclosed herein useful for facilitating the editing of target RNA by an RNA editing entity can be an engineered potential guide RNA. "Engineered potential guide RNA" refers to an engineered guide RNA that includes a potential structure. "Potential structure" refers to a structural feature that is substantially formed by hybridization of the guide RNA to the target RNA. For example, the sequence of the guide RNA provides one or more structural features, but these structural features are substantially formed only by hybridization to the target RNA, and thus, one or more potential structural features appear as structural features upon hybridization to the target RNA. Hybridization of the guide RNA to the target RNA forms the structural feature, thereby unmasking the potential structure provided in the guide RNA.

[0039] A double-stranded RNA (dsRNA) substrate is formed by hybridization of an engineered guide RNA of the present disclosure to the target RNA. The resulting dsRNA substrate is also referred to herein as a "guide-target RNA backbone."

[0040] Figure 5 shows a legend for various exemplary structural features present in the guide-target RNA backbone formed upon hybridization of a potential guide RNA of the present disclosure to a target RNA. Exemplary structural features shown include an 8 / 7 asymmetric loop (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (24 nucleotides on the target RNA side base-paired to 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). Unless otherwise noted, the number of participating nucleotides in a given structural feature is shown as the nucleotides on the target RNA side relative to the nucleotides on the guide RNA side. This legend also provides a means for positional annotation of each figure. For example, the edited target nucleotide is designated as position 0. Positions downstream (3') of the edited target nucleotide are counted in +1 increments. Positions upstream (5') of the edited target nucleotide are counted in -1 increments. Thus, an exemplary 2 / 2 symmetric bulge in this legend is at positions +12 to +13 in the guide-target RNA backbone. Similarly, a 2 / 3 asymmetric bulge in this legend is at positions -36 to -37 in the guide-target RNA backbone. As used herein, positional annotations are provided with respect to the edited target nucleotide and with respect to the target RNA side of the guide-target RNA backbone. As used herein, when a single position is annotated, the structural feature extends from that position away from position 0 (the edited target nucleotide). For example, if a potential guide RNA is annotated herein as forming a 2 / 3 asymmetric bulge at position -36, then the 2 / 3 asymmetric bulge forms at positions -36 to -37 relative to the edited target nucleotide (position 0) on the target RNA side of the guide-target RNA backbone.As another example, if a potential guide RNA is annotated herein as forming a 2 / 2 symmetric bulge at position +12, then the 2 / 2 symmetric bulge forms at positions +12 to +13 relative to the edited target nucleotide (position 0) on the target RNA side of the guide-target RNA backbone.

[0041] In some examples, the engineered guides disclosed herein lack a recruitment region, and recruitment of the RNA editing entity can be achieved by structural features of the guide-target RNA backbone formed by hybridization of the engineered guide RNA and the target RNA. In some examples, the engineered guide does not contain structural features that recruit RNA editing entities (e.g., ADARs) when present in aqueous solution and not bound to a target RNA molecule. Upon hybridization to the target RNA, the engineered guide RNA forms one or more structural features with the target RNA molecule that recruit RNA editing entities (e.g., ADARs).

[0042] In the absence of a recruitment sequence, the engineered guide RNA may still be able to associate with a target RNA editing entity (e.g., an ADAR) to facilitate editing of the target RNA and / or regulate the expression of a polypeptide encoded by the target RNA. This may be achieved through structural features formed in the guide-target RNA backbone formed by hybridization of the engineered guide RNA and the target RNA. The structural features may include any one of a mismatch, a symmetric bulge, an asymmetric bulge, a symmetric internal loop, an asymmetric internal loop, a hairpin, a wobble base pair, or any combination thereof.

[0043] Described herein are structural features that may be present in the guide-target RNA scaffolds of the present disclosure. Examples of features include mismatches, bulges (symmetric or asymmetric), internal loops (symmetric or asymmetric internal loops), or hairpins (recruiting or non-recruiting hairpins). Engineered guide RNAs of the present disclosure may have 1 to 50 features. Engineered guide RNAs of the present disclosure may have 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, 40 to 45, 45 to 50, 5 to 20, 1 to 3, 4 to 5, 2 to 10, 20 to 40, 10 to 40, 20 to 50, 30 to 50, 4 to 7, or 8 to 10 features. In some embodiments, structural features (e.g., mismatches, bulges, internal loops) can be formed from potential structures in the engineered potential guide RNA upon hybridization of the engineered potential guide RNA to the target RNA and thereby forming a guide-target RNA backbone. In some embodiments, the structural feature is not formed from a potential structure, but instead is a preformed structure (e.g., a GluR2 recruitment hairpin or a hairpin from U7 snRNA).

[0044] The guide-target RNA backbone is formed by hybridization of the engineered guide RNA of the present disclosure to the target RNA. As disclosed herein, a mismatch refers to a single nucleotide in the guide RNA that is not paired with an opposing single nucleotide in the target RNA within the guide-target RNA backbone. A mismatch can include any two single nucleotides that do not base-pair. If the number of involved nucleotides on the guide RNA and target RNA sides exceeds one, the resulting structure is no longer considered a mismatch, but rather a bulge or internal loop, depending on the size of the structural feature. In some embodiments, the mismatch in the guide RNA is with a G, C, or U in the DUX4 target RNA. For example, a G in the DUX4 target RNA can be mismatched with a G, A, or U in the guide RNA. In another example, a C in the DUX4 target RNA can be mismatched with a C, A, or U in the guide RNA. In another example, a U in the DUX4 target RNA can be mismatched with a U, G, or C in the guide RNA. In some embodiments, the mismatch in the guide RNA is with an A in the DUX4 target RNA. For example, an A in a DUX4 target RNA may be mismatched with an A, G, or C in the guide RNA. In some embodiments, the mismatch is an A / C mismatch. An A / C mismatch may include a C in an engineered guide RNA of the present disclosure opposite an A in the target RNA. An A / C mismatch may include an A in an engineered guide RNA of the present disclosure opposite a C in the target RNA. A G / G mismatch may include a G in an engineered guide RNA of the present disclosure opposite a G in the target RNA. In some embodiments, a guide RNA of the present disclosure may not have an A / C mismatch, and each A in the target RNA is base-paired with a U in the engineered guide RNA.

[0045] In some embodiments, a mismatch located 5' of the editing site can facilitate base flipping of the edited target A. The mismatch can also help confer sequence specificity. Thus, the mismatch can be a structural feature formed from the potential structure provided by the engineered potential guide RNA.

[0046] In another embodiment, the structural feature comprises a wobble base. A wobble base pair refers to two bases that weakly base pair. For example, a wobble base pair of the present disclosure may refer to a G paired with a U. Thus, a wobble base pair may be a structural feature formed from a potential structure provided by an engineered potential guide RNA.

[0047] In some cases, the structural feature may be a hairpin. As disclosed herein, a hairpin includes an RNA duplex in which a portion of a single-stranded RNA strand folds back on itself to form an RNA duplex. The portion of the single-stranded RNA strand folds back on itself due to nucleotide sequences that base-pair with each other and are separated by an intervening sequence that does not base-pair with itself, thereby forming a paired portion and an intervening loop portion that does not base-pair with itself. A hairpin can have an overall duplex length of 10 to 500 nucleotides. The loop portion of a hairpin can be 3 to 15 nucleotides long. A hairpin can be present in any of the engineered guide RNAs disclosed herein. An engineered guide RNA disclosed herein can have 1 to 10 hairpins. In some embodiments, an engineered guide RNA disclosed herein has one hairpin. In some embodiments, an engineered guide RNA disclosed herein has two hairpins. As disclosed herein, a hairpin can include a recruitment hairpin or a non-recruitment hairpin. The hairpin can be located anywhere within the engineered guide RNA of the present disclosure. In some embodiments, one or more hairpins are at or near the 3' end of the engineered guide RNA of the present disclosure, at or near the 5' end of the engineered guide RNA of the present disclosure, within or near the targeting domain of the engineered guide RNA of the present disclosure, or any combination thereof.

[0048] In some aspects, the structural feature comprises a non-recruiting hairpin. As disclosed herein, the non-recruiting hairpin does not have the oncolytic function of recruiting an RNA editing entity. In some instances, the non-recruiting hairpin does not recruit an RNA editing entity. In some instances, the non-recruiting hairpin has a dissociation constant for binding to an RNA editing entity under physiological conditions insufficient for binding. For example, the non-recruiting hairpin has a dissociation constant for binding an RNA editing entity at 25°C greater than about 1 mM, 10 mM, 100 mM, or 1 M, as determined in an in vitro assay. The non-recruiting hairpin may exhibit functionality that improves localization of the engineered guide RNA to the target RNA. In some embodiments, the non-recruiting hairpin improves retention. In some embodiments, the non-recruiting hairpin comprises a hairpin from U7 snRNA. Thus, non-recruiting hairpins, such as the hairpin from U7 snRNA, are not structural features formed by potential structures provided in engineered potential guide RNAs, but rather are preformed structural features that may be present in constructs that include engineered guide RNA constructs.

[0049] Hairpins of the present disclosure can be of any length, hi one embodiment, hairpins can be from about 10 to 500 or more nucleotides. In some cases, the hairpin may be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 3, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261,262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500 or more nucleotides.10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10-90, 10-100, 10-110, 10-120, 10-130, 10-140, 10-150, 10-160, 10-170, 10-180, 10-190, 10-200, 10-210, 10-220, 10-230, 10-240, 10-250, 10-260, 10-270, 10- It may contain 280, 10 to 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to 370, 10 to 380, 10 to 390, 10 to 400, 10 to 410, 10 to 420, 10 to 430, 10 to 440, 10 to 450, 10 to 460, 10 to 470, 10 to 480, 10 to 490, or 10 to 500 nucleotides.

[0050] The guide-target RNA backbone is formed by hybridization of the engineered guide RNA of the present disclosure to the target RNA. As disclosed herein, a bulge refers to a structure formed substantially solely by the formation of the guide-target RNA backbone, in which consecutive nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts in the opposing strand. The nucleotides in the bulge of the guide RNA can include any nucleotides in any order, as long as they are not complementary to their positional counterparts on the target RNA. The bulge can alter the secondary or tertiary structure of the guide-target RNA backbone. The bulge can independently have 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA backbone and 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA backbone, or the bulge can independently have 0 to 4 nucleotides on the target RNA side of the guide-target RNA backbone and 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA backbone. However, as used herein, a bulge refers to a structure in which a single participating nucleotide of an engineered guide RNA and a single participating nucleotide of a target RNA do not base-pair; a single participating nucleotide of an engineered guide RNA and a single participating nucleotide of a target RNA that do not base-pair is referred to herein as a mismatch. Furthermore, if the number of participating nucleotides on either the guide RNA or the target RNA exceeds four, the resulting structure is no longer considered a bulge, but rather an internal loop. In some embodiments, a guide-target RNA scaffold of the present disclosure has two bulges. In some embodiments, a guide-target RNA scaffold of the present disclosure has three bulges. In some embodiments, a guide-target RNA scaffold of the present disclosure has four bulges. Thus, a bulge can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0051] In some embodiments, the presence of a bulge in the guide-target RNA backbone can position or assist in the positioning of ADARs to selectively edit the target A in the target RNA and reduce off-target editing of non-target A(s) in the target RNA. In some embodiments, the presence of a bulge in the guide-target RNA backbone can recruit or assist in the recruitment of additional ADARs. The bulge in the guide-target RNA backbone disclosed herein can recruit other proteins, for example, other RNA editing entities. In some embodiments, the bulge located 5' of the editing site can facilitate base flipping of the target A to be edited. The bulge can also help impart sequence specificity to the target RNA to be edited compared to other A(s) present in the target RNA. For example, the bulge can assist in direct ADAR editing by constraining it in an orientation that results in selective editing of the target A.

[0052] The guide-target RNA backbone is formed by hybridization of the engineered guide RNA of the present disclosure to the target RNA. The bulge can be symmetric or asymmetric. A symmetric bulge is formed when the same number of nucleotides are present on each side of the bulge. For example, a symmetric bulge in a guide-target RNA backbone of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA backbone. A symmetric bulge of the present disclosure can be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and two nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric bulge of the present disclosure can be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and three nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric bulge of the present disclosure can be formed by four nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and four nucleotides on the target RNA side of the guide-target RNA backbone. Thus, a symmetric bulge can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0053] The guide-target RNA backbone is formed by hybridization of the engineered guide RNA of the present disclosure to the target RNA. The bulge can be a symmetric bulge or an asymmetric bulge. An asymmetric bulge is formed when there are different numbers of nucleotides on each side of the bulge. For example, an asymmetric bulge in a guide-target RNA backbone of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA backbone. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and 1 nucleotide on the target RNA side of the guide-target RNA backbone. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA backbone and 1 nucleotide on the engineered guide RNA side of the guide-target RNA backbone. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and 2 nucleotides on the target RNA side of the guide-target RNA backbone. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA backbone and 2 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and 3 nucleotides on the target RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the target RNA side of the guide-target RNA backbone and 3 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and 4 nucleotides on the target RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the target RNA side of the guide-target RNA backbone and 4 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA backbone and 2 nucleotides on the target RNA side of the guide-target RNA backbone.The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA backbone and two nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA backbone and three nucleotides on the target RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA backbone and three nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA backbone and four nucleotides on the target RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA backbone and four nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA backbone and three nucleotides on the target RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure can be formed by two nucleotides on the target RNA side of the guide-target RNA backbone and three nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure can be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA backbone and four nucleotides on the target RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure can be formed by two nucleotides on the target RNA side of the guide-target RNA backbone and four nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure can be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA backbone and four nucleotides on the target RNA side of the guide-target RNA backbone. The asymmetric bulge of the present disclosure can be formed by three nucleotides on the target RNA side of the guide-target RNA backbone and four nucleotides on the engineered guide RNA side of the guide-target RNA backbone. Thus, the asymmetric bulge can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0054] In some cases, the structural feature may be an internal loop. As disclosed herein, an internal loop refers to a structure formed substantially solely by the formation of a guide-target RNA backbone, in which the nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts in the opposing strand, and one side of the internal loop on either the target RNA side or the engineered guide RNA side of the guide-target RNA backbone has five or more nucleotides. The nucleotides in the internal loop of the guide RNA may contain any nucleotides in any order, as long as they are not complementary to their positional counterparts on the target RNA. If the number of participating nucleotides on both the guide RNA side and the target RNA side is reduced to less than five, the resulting structure is no longer considered an internal loop, but rather a bulge or mismatch, depending on the size of the structural feature. The internal loop may be a symmetric internal loop or an asymmetric internal loop. An internal loop located near the editing site may be useful for base flipping of target A in the target RNA being edited.

[0055] One side of the internal loop on either the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold can be formed by 5 to 150 nucleotides, and one side of the internal loop can be formed by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides, or any number of nucleotides in between. One side of the internal loop may be formed by 5 nucleotides. One side of the internal loop may be formed by 10 nucleotides. One side of the internal loop may be formed by 15 nucleotides. One side of the internal loop may be formed by 20 nucleotides. One side of the internal loop may be formed by 25 nucleotides. One side of the internal loop may be formed by 30 nucleotides. One side of the internal loop may be formed by 35 nucleotides. One side of the internal loop may be formed by 40 nucleotides. One side of the internal loop may be formed by 45 nucleotides. One side of the internal loop may be formed by 50 nucleotides. One side of the internal loop may be formed by 55 nucleotides. One side of the internal loop may be formed by 60 nucleotides. One side of the internal loop may be formed by 65 nucleotides. One side of the internal loop may be formed by 70 nucleotides. One side of the internal loop may be formed by 75 nucleotides. One side of the internal loop may be formed by 80 nucleotides. One side of the internal loop may be formed by 85 nucleotides. One side of the internal loop may be formed by 90 nucleotides. One side of the internal loop may be formed by 95 nucleotides. One side of the internal loop may be formed by 100 nucleotides. One side of the internal loop may be formed by 110 nucleotides. One side of the internal loop may be formed by 120 nucleotides.One side of the internal loop may be formed by 130 nucleotides. One side of the internal loop may be formed by 140 nucleotides. One side of the internal loop may be formed by 150 nucleotides. One side of the internal loop may be formed by 200 nucleotides. One side of the internal loop may be formed by 250 nucleotides. One side of the internal loop may be formed by 300 nucleotides. One side of the internal loop may be formed by 350 nucleotides. One side of the internal loop may be formed by 400 nucleotides. One side of the internal loop may be formed by 450 nucleotides. One side of the internal loop may be formed by 500 nucleotides. One side of the internal loop may be formed by 600 nucleotides. One side of the internal loop may be formed by 700 nucleotides. One side of the internal loop may be formed by 800 nucleotides. One side of the internal loop may be formed by 900 nucleotides. One side of the internal loop can be formed by 1000 nucleotides, and thus the internal loop can be a structural feature formed from the potential structure provided by the engineered potential guide RNA.

[0056] The internal loop may be a symmetric internal loop or an asymmetric internal loop. A symmetric internal loop is formed when the same number of nucleotides are present on each side of the internal loop. For example, a symmetric internal loop in a guide-target RNA scaffold of the present disclosure may have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 9 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 10 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 10 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 11 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 11 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 12 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 12 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 13 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 13 nucleotides on the target RNA side of the guide-target RNA backbone.A symmetric internal loop of the present disclosure can be formed by 14 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 14 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 15 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 15 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 20 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 20 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 30 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 30 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 40 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 40 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 50 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 50 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 60 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 60 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 70 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 70 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 80 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 80 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 90 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 90 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 100 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 100 nucleotides on the target RNA side of the guide-target RNA backbone.A symmetric internal loop of the present disclosure can be formed by 110 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 110 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 120 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 120 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 130 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 130 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 140 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 140 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 150 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 150 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 200 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 200 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 250 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 250 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 300 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 300 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 350 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 350 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 400 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 400 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 450 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 450 nucleotides on the target RNA side of the guide-target RNA backbone.A symmetric internal loop of the present disclosure can be formed by 500 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 500 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 600 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 600 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 700 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 700 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 800 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 800 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 900 nucleotides on the engineered guide RNA side of the guide-target RNA backbone target and 900 nucleotides on the target RNA side of the guide-target RNA backbone. A symmetric internal loop of the present disclosure can be formed by 1000 nucleotides of the guide-target RNA backbone target on the engineered guide RNA side and 1000 nucleotides of the guide-target RNA backbone on the target RNA side. Thus, a symmetric internal loop can be a structural feature formed from potential structures provided by potential engineered guide RNAs.

[0057] In some embodiments, the symmetric internal loop can be located upstream (5') of target A (position 0), downstream (3') of target A, or both. In some embodiments, when referring to the position of a structural feature, a "-" or a negative integer indicates a nucleotide upstream (5') of target A or a particular position (e.g., position 0ATTAAA), and a positive integer indicates a nucleotide downstream (3') of target A or a particular position. In some examples, a first symmetric internal loop can be downstream of target A, and a second symmetric internal loop can be upstream of target A. In some cases, the symmetric internal loop can be at positions -1 to -25, -2 to -10, -4 to -8, -5 to -7, -2 to -15, -4 to -20, -8 to -15, or -10 to -22 relative to target A. In some cases, the symmetric internal loop may be located at position -25, -24, -23, -22, -21, -20, -19, -18, -17, -16, -15, -14, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, or -1 relative to target A. In some cases, the symmetric internal loop may be located at position +1 to +60, +10 to +50, +10 to +40, +20 to +50, +20 to +40, +25 to +45, +31 to +35, +10 to +20, +15 to +30, +25 to +45, or +45 to +60 relative to target A. In some cases, the symmetric internal loop is located at the following positions relative to target A: 1, +2, +3, +4, +5, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +16, +17, +18, +19, +20, +21, +22, +23, +24, +25, +26, +27, +28, +29 , +30, +31, +32, +33, +34, +35, +36, +37, +38, +39, +40, +41, +42, +43, +44, +45, +46, +47, +48, ​​+49, +50, +51, +52, +53, +54, +55, +56, +57, +58, +59, or +60.In some cases, the first symmetric internal loop is within about 80 bp, 70 bp, 60 bp, 50 bp, 40 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, or 5 bp of the 5' end of the guide RNA, and the second symmetric internal loop is within about 80 bp, 70 bp, 60 bp, 50 bp, 40 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, or 5 bp of the 3' end of the guide RNA.

[0058] Asymmetric internal loops are formed when there are different numbers of nucleotides on each side of the internal loop. For example, an asymmetric internal loop in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold.

[0059] The asymmetric internal loop of the present disclosure can be formed by 5 to 150 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and 5 to 150 nucleotides on the target RNA side of the guide-target RNA backbone, where the number of nucleotides differs from the number of nucleotides on the engineered side of the guide-target RNA backbone target. The asymmetric internal loop of the present disclosure can be formed by 5 to 1,000 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and 5 to 1,000 nucleotides on the target RNA side of the guide-target RNA backbone, where the number of nucleotides differs from the number of nucleotides on the engineered side of the guide-target RNA backbone target. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and 6 nucleotides on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 6 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and 7 nucleotides on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 7 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and an 8-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 8 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA backbone.The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 9 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and a 10-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and a 7-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the target ... engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and a 8-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA backbone and 8 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA backbone and 9 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA backbone and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA backbone and 10 nucleotides on the engineered guide RNA side of the guide-target RNA backbone.The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA backbone and an 8-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA backbone and an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA backbone and a 9-nucleotide internal loop on the target ...10-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA backbone and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA backbone and a 10-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA backbone and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the target RNA side of the guide-target RNA backbone and a 9-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA backbone and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the target RNA side of the guide-target RNA backbone and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by an 9-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA backbone and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA backbone.The asymmetric internal loop of the present disclosure may be formed by 9 nucleotides on the target RNA side of the guide-target RNA backbone and 10 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 50 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 100 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 150 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 200 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 300 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 400 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 500 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA backbone and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA backbone and 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA backbone and 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone.The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA backbone and 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA backbone and 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA backbone and 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA backbone and 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA backbone and 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA backbone and 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA backbone and 100 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA backbone and 150 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA backbone and 200 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA backbone and 300 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA backbone and 400 nucleotides on the engineered guide RNA side of the guide-target RNA backbone.The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA backbone and 500 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA backbone and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA backbone and 50 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA backbone and 50 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA backbone and 50 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA backbone and 50 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA backbone and 50 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA backbone and 50 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA backbone and 50 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA backbone and 150 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA backbone and 200 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA backbone and 300 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA backbone and 400 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA backbone and 500 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA backbone and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA backbone.The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA backbone and 100 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA backbone and 100 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA backbone and 100 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA backbone and 100 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA backbone and 100 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA backbone and 100 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA backbone and 200 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA backbone and 300 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA backbone and 400 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA backbone and 500 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA backbone and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA backbone.The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA backbone and 150 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA backbone and 5 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA backbone and 150 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA backbone and 150 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA backbone and 300 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA backbone and 400 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA backbone and 500 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA backbone and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA backbone and 200 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA backbone and 200 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA backbone and 200 nucleotides on the engineered guide RNA side of the guide-target RNA backbone.The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA backbone and 200 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA backbone and 400 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA backbone and 500 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA backbone and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA backbone and 300 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA backbone and 300 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA backbone and 300 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA backbone and 500 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA backbone and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA backbone and 400 nucleotides on the engineered guide RNA side of the guide-target RNA backbone. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA backbone and 400 nucleotides on the engineered guide RNA side of the guide-target RNA backbone.The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides of the guide-target RNA backbone on the target RNA side and 1000 nucleotides of the guide-target RNA backbone on the engineered guide RNA side. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides of the guide-target RNA backbone on the target RNA side and 500 nucleotides of the guide-target RNA backbone on the engineered guide RNA side. Thus, the asymmetric internal loop can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0060] As disclosed herein, a "base-paired (bp) region" refers to a region of a guide-target RNA backbone in which a base in the guide RNA is paired with an opposing base in the target RNA. A base-paired region can extend from at or near one end of the guide-target RNA backbone to at or near the other end of the guide-target RNA backbone. A base-paired region can extend between two structural features. A base-paired region can extend from at or near one end of the guide-target RNA backbone to at or near a structural feature. A base-paired region can extend from a structural feature to the other end of the guide-target RNA backbone. In some embodiments, the base-paired region is from 1 bp to 100 bp, from 1 bp to 90 bp, from 1 bp to 80 bp, from 1 bp to 70 bp, from 1 bp to 60 bp, from 1 bp to 50 bp, from 1 bp to 45 bp, from 1 bp to 40 bp, from 1 bp to 35 bp, from 1 bp to 30 bp, from 1 bp to 25 bp, from 1 bp to 20 bp, from 1 bp to 15 bp, from 1 bp to 10 bp, from 1 bp to 5 bp, from 5 bp to 10 bp, from 5 bp to 20 bp, from 10 bp to 20 bp, from 10 bp to 50 bp, from 5 bp to 50 bp, at least 1 bp, at least 2 bp, at least 3 bp p, at least 4 bp, at least 5 bp, at least 6 bp, at least 7 bp, at least 8 bp, at least 9 bp, at least 10 bp, at least 12 bp, at least 14 bp, at least 16 bp, at least 18 bp, at least 20 bp, at least 25 bp, at least 30 bp, at least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at least 60 bp, at least 70 bp, at least 80 bp, at least 90 bp, at least 100 bp.

[0061] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 8, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to a target DUX4 RNA includes a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 8, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0062] In some cases, the structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 1-nucleotide mismatch formed 5 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 10, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 1-nucleotide mismatch formed 5 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 10, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 1-nucleotide mismatch formed 5 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0063] In some cases, the structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 1-nucleotide mismatch formed 5 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 21 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 14, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 1-nucleotide mismatch formed 5 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 21 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 14, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 1-nucleotide mismatch formed 5 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 21 nucleotides downstream (3') from target A.

[0064] In some cases, the structural feature formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 21 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 15, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 21 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 15, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 21 nucleotides downstream (3') from target A.

[0065] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a single nucleotide mismatch formed three nucleotides downstream (5') from target A and a six-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 17, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a single nucleotide mismatch formed three nucleotides downstream (5') from target A and a six-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 17, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 1-nucleotide mismatch formed 3 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A.

[0066] In some cases, the structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 1-nucleotide mismatch formed 5 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 23 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 24, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 1-nucleotide mismatch formed 5 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 23 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 24, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 1-nucleotide mismatch formed 5 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 23 nucleotides downstream (3') from target A.

[0067] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a single nucleotide mismatch formed three nucleotides downstream (5') from target A and a six-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 72, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a single nucleotide mismatch formed three nucleotides downstream (5') from target A and a six-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 72, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 1-nucleotide mismatch formed 3 nucleotides downstream (5') from target A and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A.

[0068] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 12 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 195, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 12 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 195, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 12 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A.

[0069] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 252, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 252, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0070] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 28 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 291, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 28 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 291, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 28 nucleotides downstream (3') from target A.

[0071] In some cases, structural features formed by hybridization of an engineered guide RNA of the disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 41 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 352, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 41 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 352, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 41 nucleotides downstream (3') from target A.

[0072] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 356, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 356, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0073] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 358, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 358, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0074] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 365, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 365, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A.

[0075] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 375, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 375, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0076] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 23 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 392, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 23 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 392, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 11 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 23 nucleotides downstream (3') from target A.

[0077] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 394, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 394, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A.

[0078] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 27 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 408, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 27 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 408, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 27 nucleotides downstream (3') from target A.

[0079] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 482, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 482, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0080] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 486, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 486, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0081] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 43 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 487, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 43 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 487, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 43 nucleotides downstream (3') from target A.

[0082] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 494, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 494, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 10 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A.

[0083] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 502, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 502, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0084] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 505, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 505, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0085] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 512, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 512, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A.

[0086] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 566, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 566, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A.

[0087] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 593, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 593, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A.

[0088] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 594, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 594, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A.

[0089] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 606, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 606, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 9 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0090] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 625, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 625, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0091] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 635, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 635, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A.

[0092] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 642, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 642, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A.

[0093] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 679, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 679, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A.

[0094] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 680, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 680, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A.

[0095] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 35 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 694, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 35 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 694, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 35 nucleotides downstream (3') from target A.

[0096] In some cases, structural features formed by hybridization of an engineered guide RNA of the disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 727, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 727, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0097] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 737, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 737, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 8 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A.

[0098] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 747, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 747, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0099] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 748, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 748, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0100] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 757, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 757, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A.

[0101] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 25 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 769, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 25 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 769, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 25 nucleotides downstream (3') from target A.

[0102] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 806, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 806, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A.

[0103] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 810, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 810, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A.

[0104] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 815, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 815, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A.

[0105] In some cases, structural features formed by hybridization of an engineered guide RNA of the disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 851, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 851, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 7 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0106] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 871, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 871, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0107] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 873, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 873, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0108] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 874, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 874, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 20 nucleotides downstream (3') from target A.

[0109] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 21 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 880, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 21 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 880, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 21 nucleotides downstream (3') from target A.

[0110] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 884, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 884, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A.

[0111] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 892, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 892, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A.

[0112] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 27 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 906, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 27 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 906, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 27 nucleotides downstream (3') from target A.

[0113] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 930, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 930, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A.

[0114] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 934, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 934, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A.

[0115] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 935, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 935, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A.

[0116] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 937, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 937, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A.

[0117] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 35 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 944, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 35 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 944, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 35 nucleotides downstream (3') from target A.

[0118] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 967, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 967, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 40 nucleotides downstream (3') from target A.

[0119] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 976, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 976, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0120] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 977, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 977, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0121] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 985, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 985, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A.

[0122] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1002, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1002, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A.

[0123] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1008, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1008, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A.

[0124] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1051, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1051, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A.

[0125] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1054, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1054, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A.

[0126] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1058, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1058, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A.

[0127] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1059, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1059, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 34 nucleotides downstream (3') from target A.

[0128] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1066, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1066, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A.

[0129] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 43 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1098, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 43 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1098, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 43 nucleotides downstream (3') from target A.

[0130] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1103, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1103, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A.

[0131] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1104, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1104, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 5 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 44 nucleotides downstream (3') from target A.

[0132] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1116, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1116, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 22 nucleotides downstream (3') from target A.

[0133] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 23 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1117, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 23 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1117, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 23 nucleotides downstream (3') from target A.

[0134] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1163, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1163, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A.

[0135] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1168, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1168, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A.

[0136] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1183, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1183, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A.

[0137] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1185, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1185, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A.

[0138] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 38 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1193, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 38 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1193, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 38 nucleotides downstream (3') from target A.

[0139] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1211, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1211, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0140] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1212, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1212, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 4 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0141] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1236, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1236, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed at target A, and a 6-nucleotide internal symmetric loop formed 24 nucleotides downstream (3') from target A.

[0142] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1293, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1293, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A.

[0143] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1294, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1294, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A.

[0144] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1296, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1296, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 3 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 36 nucleotides downstream (3') from target A.

[0145] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 2 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1374, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 2 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1374, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 2 nucleotides upstream (5') from target A and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A.

[0146] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 2 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 37 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1391, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 2 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 37 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1391, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 2 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 37 nucleotides downstream (3') from target A.

[0147] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 2 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1411, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 2 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1411, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 2 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 5 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 42 nucleotides downstream (3') from target A.

[0148] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed one nucleotide upstream (5') from target A, a 1-nucleotide mismatch formed four nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1463, and the guide-target RNA backbone formed by hybridization of said engineered guide RNA to a target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed one nucleotide upstream (5') from target A, a 1-nucleotide mismatch formed four nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1463, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA comprises a 6-nucleotide internal symmetric loop formed 1 nucleotide upstream (5') from target A, a 1-nucleotide mismatch formed 4 nucleotides downstream (3') from target A, and a 6-nucleotide internal symmetric loop formed 32 nucleotides downstream (3') from target A.

[0149] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 2-nucleotide symmetrical bulge formed 7 nucleotides upstream (5') from target A, a 2-nucleotide symmetrical bulge formed 6 nucleotides downstream (3') from target A, a 2-nucleotide symmetrical bulge formed 20 nucleotides downstream (3') from target A, a 2-nucleotide symmetrical bulge formed 34 nucleotides downstream (3') from target A, a 2-nucleotide symmetrical bulge formed 48 nucleotides downstream (3') from target A, a 2-nucleotide symmetrical bulge formed 62 nucleotides downstream (3') from target A, and a 2-nucleotide symmetrical bulge formed 76 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1538, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 2-nucleotide symmetric bulge formed 7 nucleotides upstream (5') from target A, a 2-nucleotide symmetric bulge formed 6 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 20 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 34 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 48 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 62 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 76 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1538, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 2-nucleotide symmetric bulge formed 7 nucleotides upstream (5') from target A, a 2-nucleotide symmetric bulge formed 6 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 20 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 34 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 48 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 62 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 76 nucleotides downstream (3') from target A.

[0150] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a three-nucleotide symmetrical bulge formed 6 nucleotides upstream (5') from target A, a three-nucleotide symmetrical bulge formed 7 nucleotides downstream (3') from target A, a three-nucleotide symmetrical bulge formed 22 nucleotides downstream (3') from target A, a three-nucleotide symmetrical bulge formed 37 nucleotides downstream (3') from target A, a three-nucleotide symmetrical bulge formed 52 nucleotides downstream (3') from target A, and a three-nucleotide symmetrical bulge formed 67 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1539, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a three-nucleotide symmetric bulge formed 6 nucleotides upstream (5') from target A, a three-nucleotide symmetric bulge formed 7 nucleotides downstream (3') from target A, a three-nucleotide symmetric bulge formed 22 nucleotides downstream (3') from target A, a three-nucleotide symmetric bulge formed 37 nucleotides downstream (3') from target A, a three-nucleotide symmetric bulge formed 52 nucleotides downstream (3') from target A, and a three-nucleotide symmetric bulge formed 67 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1539, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 3-nucleotide symmetric bulge formed 6 nucleotides upstream (5') from target A, a 3-nucleotide symmetric bulge formed 7 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 22 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 37 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 52 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 67 nucleotides downstream (3') from target A.

[0151] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a two-nucleotide symmetrical bulge formed 5 nucleotides upstream (5') from target A, a two-nucleotide symmetrical bulge formed 10 nucleotides downstream (3') from target A, a two-nucleotide symmetrical bulge formed 26 nucleotides downstream (3') from target A, a two-nucleotide symmetrical bulge formed 42 nucleotides downstream (3') from target A, a two-nucleotide symmetrical bulge formed 58 nucleotides downstream (3') from target A, and a two-nucleotide symmetrical bulge formed 74 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1545, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 2-nucleotide symmetric bulge formed 5 nucleotides upstream (5') from target A, a 2-nucleotide symmetric bulge formed 10 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 26 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 42 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 58 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 74 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1545, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 2-nucleotide symmetric bulge formed 5 nucleotides upstream (5') from target A, a 2-nucleotide symmetric bulge formed 10 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 26 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 42 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 58 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 74 nucleotides downstream (3') from target A.

[0152] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a two-nucleotide symmetrical bulge formed 3 nucleotides upstream (5') from target A, a two-nucleotide symmetrical bulge formed 14 nucleotides downstream (3') from target A, a two-nucleotide symmetrical bulge formed 32 nucleotides downstream (3') from target A, a two-nucleotide symmetrical bulge formed 50 nucleotides downstream (3') from target A, and a two-nucleotide symmetrical bulge formed 68 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1552, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a two-nucleotide symmetric bulge formed 3 nucleotides upstream (5') from target A, a two-nucleotide symmetric bulge formed 14 nucleotides downstream (3') from target A, a two-nucleotide symmetric bulge formed 32 nucleotides downstream (3') from target A, a two-nucleotide symmetric bulge formed 50 nucleotides downstream (3') from target A, and a two-nucleotide symmetric bulge formed 68 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1552, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 2-nucleotide symmetric bulge formed 3 nucleotides upstream (5') from target A, a 2-nucleotide symmetric bulge formed 14 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 32 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 50 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 68 nucleotides downstream (3') from target A.

[0153] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 45 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 53 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 61 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 69 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 77 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1566, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 45 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 53 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 61 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 69 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 77 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1566, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 45 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 53 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 61 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 69 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 77 nucleotides downstream (3') from target A.

[0154] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 45 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 54 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 63 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 72 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1567, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 45 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 54 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 63 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 72 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1567, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 45 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 54 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 63 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 72 nucleotides downstream (3') from target A.

[0155] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 45 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 55 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 65 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 75 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1568, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 45 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 55 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 65 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 75 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1568, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 45 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 55 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 65 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 75 nucleotides downstream (3') from target A.

[0156] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 45 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 56 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 67 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1569, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 45 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 56 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 67 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1569, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 45 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 56 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 67 nucleotides downstream (3') from target A.

[0157] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 47 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 57 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 67 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 77 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1570, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 47 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 57 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 67 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 77 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1570, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 47 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 57 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 67 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 77 nucleotides downstream (3') from target A.

[0158] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 47 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 58 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 69 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1571, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 47 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 58 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 69 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1571, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 47 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 58 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 69 nucleotides downstream (3') from target A.

[0159] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 47 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 59 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 71 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1572, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 47 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 59 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 71 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1572, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 47 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 59 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 71 nucleotides downstream (3') from target A.

[0160] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 47 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 60 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 73 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1573, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 47 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 60 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 73 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1573, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 47 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 60 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 73 nucleotides downstream (3') from target A.

[0161] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 49 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 61 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 73 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1574, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 49 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 61 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 73 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1574, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 49 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 61 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 73 nucleotides downstream (3') from target A.

[0162] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 49 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 62 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 75 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1575, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 49 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 62 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 75 nucleotides downstream (3') from target A.In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1575, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 49 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 62 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 75 nucleotides downstream (3') from target A.

[0163] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 49 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 63 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1576, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 49 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 63 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1576, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 49 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 63 nucleotides downstream (3') from target A.

[0164] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 49 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 64 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1577, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 49 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 64 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1577, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 49 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 64 nucleotides downstream (3') from target A.

[0165] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 51 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 65 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1578, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 51 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 65 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1578, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 2-nucleotide symmetric bulge formed 51 nucleotides downstream (3') from target A, and a 2-nucleotide symmetric bulge formed 65 nucleotides downstream (3') from target A.

[0166] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 51 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 66 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1579, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 51 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 66 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1579, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 3-nucleotide symmetric bulge formed 51 nucleotides downstream (3') from target A, and a 3-nucleotide symmetric bulge formed 66 nucleotides downstream (3') from target A.

[0167] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 51 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 67 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has at least 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to a guide RNA comprising SEQ ID NO: 1580, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 51 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 67 nucleotides downstream (3') from target A. In some cases, an engineered guide RNA of the present disclosure for a target DUX4 RNA has the sequence of SEQ ID NO: 1580, and the guide-target RNA backbone formed by hybridization of the engineered guide RNA to the target DUX4 RNA includes a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 4-nucleotide symmetric bulge formed 51 nucleotides downstream (3') from target A, and a 4-nucleotide symmetric bulge formed 67 nucleotides downstream (3') from target A.

[0168] In some cases, structural features formed by hybridization of an engineered guide RNA of the present disclosure to a target DUX4 RNA include a 6-nucleotide internal symmetric loop formed 6 nucleotides upstream (5') from target A, a 1-nucleotide mismatch formed 3 nucleotides downstream (3') from target A, a 6-nucleotide internal symmetric loop formed 33 nucleotides downstream (3') from target A, a 5-nucleotide internal symmetric loop formed 51 nucleotides downstream (3') from target A, and a 5-nucleotide internal symmetric loop formed 68 nucleotides downstream (3') from target A. In some cases, an ...

Claims

**Claim 1** A composition comprising an engineered guide RNA or an engineered polynucleotide encoding the engineered guide RNA, a) the engineered guide RNA forms a guide-target RNA backbone with the sequence of the DUX4-FL target RNA by hybridization to the sequence of the DUX4-FL target RNA, wherein the sequence of the DUX4-FL target RNA contains a polyA signal sequence; b) the guide-target RNA backbone comprises two or more structural features selected from the group consisting of bulges, internal loops, hairpins, wobble base pairs, and mismatches; c) the two or more structural features do not exist within the engineered guide RNA prior to the hybridization of the engineered guide RNA to the DUX4-FL target RNA; and d) the engineered guide RNA is 80 to 200 nucleotides in length, the composition. **Claim 2** The composition according to claim 1, wherein the hybridization of the engineered guide RNA to the sequence of the DUX4-FL target RNA promotes RNA editing of one or more target adenosines in the polyA signal sequence of the DUX4-FL by an RNA editing entity. **Claim 3** The composition according to claim 1, wherein one of the two or more structural features comprises a mismatch formed by a base in the engineered guide RNA against an A in the DUX4-FL target RNA. **Claim 4** The composition according to claim 1, wherein the polyA signal sequence comprises ATAAAA, and any A of the ATAAAA polyA sequence is at position 0 of the DUX4-FL target RNA. **Claim 5** The composition according to claim 4, wherein position 0 of the DUX4-FL target RNA is the first A at the 5'-end of ATAAAA. **Claim 6** The composition according to claim 5, wherein one of the two or more structural features comprises a first 6 / 6 symmetric internal loop at a position selected from the group consisting of -5, -6, -8, -11, and -22 relative to position 0 of the DUX4-FL target RNA. **Claim 7** Of the two or more structural features, one feature further comprises a second 6 / 6 symmetric internal loop at a position selected from the group consisting of positions 27, 35, 36, 42, and 44 relative to position 0 of the DUX4-FL target RNA, the composition according to claim 6.

8. The two or more structural features include a first 6 / 6 symmetric internal loop at position -5, a second internal loop at position 44, and a mismatch at position 0, the composition according to claim 6.

9. The two or more structural features include a first 6 / 6 symmetric internal loop at position -6, a second internal loop at position 27, and a mismatch at position 0, the composition according to claim 6.

10. The two or more structural features further comprise wobble base pairs, the composition according to claim 9.

11. The two or more structural features include a first 6 / 6 symmetric internal loop at position -22, a second internal loop at position 36, a 4 / 4 symmetric bulge, and wobble base pairs, the composition according to claim 6.

12. The two or more structural features include a first 6 / 6 symmetric internal loop at position -22, two 4 / 4 symmetric bulges, and wobble base pairs, the composition according to claim 6.

13. The two or more structural features include a first 6 / 6 symmetric internal loop at position -8, a second internal loop at position 35, and a mismatch at position 3, the composition according to claim 6.

14. The two or more structural features include a first 6 / 6 symmetric internal loop at position -8, a second internal loop at position 44, and a mismatch at position 0, the composition according to claim 6.

15. The two or more structural features include a first 6 / 6 symmetric internal loop at position -11, a second internal loop at position 42, and a mismatch at position 4, the composition according to claim 6.

16. The DUX4-FL target RNA comprises a pre-mRNA transcript of DUX4-FL, the composition according to claim 1.

17. Hybridization of the engineered guide RNA to the DUX4-FL target RNA promotes knockdown of DUX4 mRNA or protein, or mRNA or protein downstream of DUX4, or any combination thereof, the composition according to claim 1.

18. The composition according to claim 17, wherein the mRNA or protein downstream of the DUX4 is encoded by a gene selected from the group consisting of SLC34A2, LEUTX, ZSCAN4, PRAMEF12, TRIM43, DEFB103, MBD3L2, and any combination thereof.

19. The composition according to claim 17, wherein knockdown of the DUX4 mRNA or protein, or the mRNA or protein downstream of DUX4, or any combination thereof, comprises a reduction of at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% at the mRNA level or protein level.

20. The composition according to claim 1, comprising an engineered polynucleotide encoding the engineered guide RNA, wherein the engineered polynucleotide encoding the engineered guide RNA is encapsidated in a viral vector.

21. The composition according to claim 20, wherein the viral vector is an AAV vector.

22. A pharmaceutical composition comprising the engineered guide RNA of claim 1 or an engineered polynucleotide encoding the engineered guide RNA of claim 1, and a pharmaceutically acceptable excipient, carrier, or diluent.

23. A method of treating facioscapulohumeral muscular dystrophy (FSHD) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition according to claim 22.

24. The pharmaceutical composition according to claim 23, wherein the facioscapulohumeral muscular dystrophy is type I facioscapulohumeral muscular dystrophy (FSHD1) or type II facioscapulohumeral muscular dystrophy (FSHD2).