RNAi agents for inhibiting expression of mucin 5AC (MUC5AC), compositions thereof, and methods of use

Abstract

RNAi agents, compositions comprising RNAi agents, and methods for inhibiting mucin 5AC (MUC5AC) gene are described. The MUC5AC RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of MUC5AC gene. Pharmaceutical compositions comprising one or more MUC5AC RNAi agents, and optionally one or more additional therapeutic agents, are also described. The in vivo delivery of the described MUC5AC RNAi agents to lung epithelial cells results in the inhibition of MUC5AC gene expression and the reduction of MUC5AC production, which can provide therapeutic benefits to subjects, including human subjects, for the treatment of various diseases, including mucosal obstructive pulmonary diseases such as severe asthma and various cancers.

Description

[Technical field]

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 194,370, filed May 28, 2021, the contents of which are incorporated by reference in their entirety herein.

[0002] Sequence Listing This application contains a Sequence Listing which has been submitted in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy is entitled SEQLIST_30659.txt and is 460kb in size.

[0003] The present disclosure relates to RNA interference (RNAi) agents, e.g., double-stranded RNAi agents, compositions comprising MUC5AC RNAi agents, and methods of use thereof, for inhibiting mucin 5AC ("MUC5AC") gene expression. [Background technology]

[0004] MUC5AC is a transcriptionally regulated secretory mucin expressed in the airway epithelium of the lung and other mucosal tissues (e.g., gastrointestinal, urogenital, ocular, and otic) (Lillehoj et al, Int Rev Cell Mol Biol, 2013). In the airways, MUC5AC and MUC5B are the major gel-forming mucins. MUC5B is constitutively expressed and is required for mucociliary clearance (Roy et al., Nature 2014). Normal subjects have relatively high expression of MUC5B relative to MUC5AC in the trachea and proximal airways, with this ratio increasing further in the distal airways, and little expression of MUC5AC is detectable in the distal and terminal bronchioles (Okuda et al., AJRCCM 2019). Typically expressed at low levels in the airways, MUC5AC expression can be strongly induced by external stress stimuli such as proinflammatory mediators (e.g., type 2 cytokines: IL-4, IL-9, IL-17, IL-23, and IL-13), harmful inhalants (cigarette smoke, acrolein, toxic gases, etc.), viral infections, and allergens. The resulting mucus hypersecretion and excessive concentration is understood to be a common pathogenic mechanism associated with airway obstruction in severe asthma and other mucosal obstructive lung diseases such as cystic fibrosis (CF), chronic obstructive pulmonary disease (COPD), non-CF bronchiectasis (NCFB), and primary ciliary dyskinesia (PCD) (Boucher, NEJM 2019). In asthma, COPD, and NCFB patients, excessive expression and secretion of MUC5AC leads to narrowing of the airway lumen, airway obstruction, and exacerbations (Dunican et al., JCI 2017; Bonser et al., JCI 2016; Kesimer et al., NEJM 2017; Ramsey et al., AJRCCM 2019). Genome-wide association studies (GWAS) have identified novel MUC5AC alleles associated with increased MUC5AC expression and with patients with moderate to severe asthma (Shrine et al., Lancet Respir Med 2019).Experimental evidence from MUC5AC-deficient mice demonstrated that MUC5AC-mediated airway obstruction is a major cause of airway hyperresponsiveness to allergens, independent of inflammation and bronchoconstriction (Evans et al, Nat Commun, 2015). Current standard of care for severe asthma and other mucosal obstructive lung diseases includes bronchodilators and anti-inflammatory therapeutics (such as corticosteroids and biologics), but currently available treatments do not directly address pathogenic mucin overexpression and hypersecretion. Alternative approaches that directly treat mucus hypersecretion and obstruction are needed.

[0005] Increased MUC5AC expression has also been observed in malignant tumors, such as lung adenocarcinoma, pancreatic cancer, salivary gland cancer, breast cancer, cholangiocarcinoma, ovarian cancer, and other tumors (Krishn et al., Carcinogenesis 2018), and has been linked to tumor cell migration and invasiveness. Loss-of-function mutations in MUC5AC and other mucin genes are significantly underexpressed in tumor cells, suggesting that overexpression of mucins may protect tumors from recognition by immune cells (Gorlov et al., Cancer Genetics 2019). Tumor MUC5AC overexpression is associated with progression and poor survival in patients with lung adenocarcinoma (Bauer et al., JCI Insight 2018). Overexpression of MUC5AC has also been associated with many other conditions, including allergic rhinitis, chronic sinusitis, otitis media, Barrett's esophagus, pancreatitis, and inflammatory bowel disease (Krishn et al., Carcinogenesis 2018). Summary of the Invention

[0006] There is a need for novel RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers, or triggers), e.g., double-stranded RNAi agents, that can selectively and efficiently inhibit the expression of the MUC5AC gene, including for use as therapeutics or medicines.Furthermore, there is a need for novel MUC5AC-specific RNAi agent compositions for the treatment of diseases or disorders associated with mucus hypersecretion and obstruction (referred to herein as "muco-obstructive" pulmonary diseases and disorders), e.g., cystic fibrosis (CF), chronic obstructive pulmonary disease (COPD), non-cystic fibrosis bronchiectasis (NCFB), primary ciliary dyskinesia (PCD), and asthma, and / or diseases or disorders that may be at least partially mediated by reduced MUC5AC gene expression and / or MUC5AC protein levels.

[0007] The nucleotide sequences and chemical modifications of the MUC5AC RNAi agents disclosed herein, and their combination with certain specific targeting ligands suitable for selectively and efficiently delivering the MUC5AC RNAi agents in vivo, are distinct from those known in the art. The MUC5AC RNAi agents disclosed herein provide highly potent and efficient inhibition of expression of the MUC5AC gene and have sequences suitable for use as therapeutic agents for the treatment of diseases and disorders.

[0008] In general, the disclosure features MUC5AC gene-specific RNAi agents, compositions comprising MUC5AC RNAi agents, and methods of inhibiting expression of the MUC5AC gene in vitro and / or in vivo using the MUC5AC RNAi agents and compositions comprising the MUC5AC RNAi agents described herein. The MUC5AC RNAi agents described herein can selectively and efficiently reduce expression of the MUC5AC gene, thereby reducing expression of the MUC5AC protein, which can result in therapeutic benefits, such as, for example, reduced mucosal obstruction in the lungs.

[0009] The described MUC5AC RNAi agents can be used in methods for therapeutic treatment (including preventative or prophylactic treatment) of conditions and diseases including, but not limited to, mucosal obstructive pulmonary diseases (such as asthma, CF, COPD, NCFB, PCD), allergic bronchopulmonary aspergillosis, interstitial lung disease, cancer (such as lung adenocarcinoma, pancreatic cancer, salivary gland cancer, breast cancer, cholangiocarcinoma, ovarian cancer, and other tumors), respiratory infections (such as respiratory syncytial virus, influenza, rhinovirus), otitis media, inflammatory bowel disease, cholelithiasis, allergic rhinitis, chronic sinusitis, and nasal polyposis.

[0010] In one aspect, the disclosure features an RNAi agent for inhibiting expression of the MUC5AC gene, the RNAi agent including a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and the antisense strand can be partially, substantially, or fully complementary to one another. The length of the RNAi agent sense strand described herein can each be 15-49 nucleotides in length. The length of the RNAi agent antisense strand described herein can each be 18-49 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 18-26 nucleotides in length. The sense strand and the antisense strand can be the same length or different lengths. In some embodiments, the sense strand and the antisense strand are independently 21-26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21-24 nucleotides in length. In some embodiments, the sense strand and the antisense strand are both 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein inhibit expression of one or more MUC5AC gene variants in vivo and / or in vitro when delivered to a cell expressing MUC5AC.

[0011] The MUC5AC RNAi agents disclosed herein target the human MUC5AC gene (see, e.g., SEQ ID NO: 1). In some embodiments, the MUC5AC RNAi agents disclosed herein target a portion of the MUC5AC gene having a sequence of any of the sequences disclosed in Table 1.

[0012] In another aspect, the disclosure features compositions (including pharmaceutical compositions) that include one or more of the disclosed MUC5AC RNAi agents that can selectively and efficiently reduce expression of the MUC5AC gene. Compositions that include one or more MUC5AC RNAi agents described herein can be administered to a subject, such as a human or animal subject, for treatment (including prophylactic treatment or inhibition) of symptoms and diseases associated with MUC5AC gene expression and / or MUC5AC protein levels.

[0013] Examples of MUC5AC RNAi agent sense and antisense strands that can be used in MUC5AC RNAi agents are provided in Table 3, Table 4, Table 5, Table 6, and Table 7. Examples of MUC5AC RNAi agent duplexes are provided in Table 8A, Table 8B, Table 8C, Table 9, Table 10A, Table 10B, and Table 11. Examples of 19 nucleotide core stretch sequences that may consist of or be included in the sense and antisense strands of certain MUC5AC RNAi agents disclosed herein are provided in Table 2.

[0014] In another aspect, the present disclosure features a method for delivering MUC5AC RNAi agent to epithelial cells of a subject, such as a mammal, in vivo.Compositions for use in such methods are also described herein.In some embodiments, the present disclosure provides a method for delivering MUC5AC RNAi agent to lung cells (epithelial cells, macrophages, smooth muscle, endothelial cells) of a subject in vivo.In some embodiments, the subject is a human subject.

[0015] The methods disclosed herein include administering one or more MUC5AC RNAi agents to a subject, e.g., a human or animal subject, by any suitable means known in the art. The pharmaceutical compositions disclosed herein that include one or more MUC5AC RNAi agents can be administered in a number of ways, depending on whether local or systemic treatment is desired. Administration can be, for example, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implantable device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (such as dry powder inhalation or aerosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal aspiration administration.

[0016] In some embodiments, the MUC5AC RNAi agents described herein desirably inhibit expression of the MUC5AC gene in pulmonary epithelium and are administered by inhalation (e.g., by an inhalation device such as a metered dose inhaler, or by a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler).

[0017] One or more MUC5AC RNAi agents can be delivered to a target cell or tissue using any oligonucleotide delivery technique known in the art. In some embodiments, the MUC5AC RNAi agent is delivered to a cell or tissue by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group can include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote cell-extracellular matrix (ECM) adhesion. In particular, integrin alpha-v-beta-6 (αvβ6) is an epithelial-specific integrin known to be a receptor for ECM proteins and TGF-beta latency-associated peptide (LAP) and is expressed in a variety of cells and tissues. Integrin αvβ6 is known to be highly upregulated in injured lung epithelium. In some embodiments, the MUC5AC RNAi agent described herein is linked to an integrin targeting ligand that has affinity for integrin αvβ6. As referred to herein, an "αvβ6 integrin targeting ligand" is a compound that has affinity for integrin αvβ6, which can be utilized as a ligand to facilitate targeting and delivery of an RNAi agent that binds to a desired cell and / or tissue (i.e., a cell expressing integrin αvβ6). In some embodiments, multiple αvβ6 integrin targeting ligands or a collection of αvβ6 integrin targeting ligands are linked to a MUC5AC RNAi agent. In some embodiments, the MUC5AC RNAi agent-αvβ6 integrin targeting ligand conjugate is selectively internalized by lung epithelial cells, either by receptor-mediated endocytosis or other means.

[0018] Examples of targeting groups useful for delivering MUC5AC RNAi agents, including αvβ6 integrin targeting ligands, are disclosed, for example, in International Patent Application Publication No. WO2018 / 085415 and International Patent Application Publication No. WO2019 / 089765, the contents of each of which are incorporated by reference herein in their entirety.

[0019] The targeting group can be linked to the 3' or 5' end of the sense or antisense strand of the MUC5AC RNAi agent. In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is attached to the 5' end of the sense strand. In some embodiments, the targeting group is linked internally to a nucleotide of the sense and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0020] In another aspect, the disclosure features a composition that includes one or more MUC5AC RNAi agents having a duplex structure disclosed in Table 8A, Table 8B, Table 8C, Table 9, Table 10A, Table 10B, and Table 11.

[0021] The use of MUC5AC RNAi agents provides a method for therapeutic treatment (including prophylactic treatment) of diseases or disorders in which a decrease in MUC5AC gene expression and / or a decrease in MUC5AC protein levels can provide a therapeutic benefit. The MUC5AC RNAi agents disclosed herein can be used to treat a variety of diseases, including mucosal obstructive pulmonary diseases (such as asthma, CF, COPD, NCFB, PCD, etc.), allergic bronchopulmonary aspergillosis, interstitial lung disease, cancer (such as lung adenocarcinoma, pancreatic cancer, salivary gland cancer, breast cancer, cholangiocarcinoma, ovarian cancer, and other tumors), respiratory infections (such as respiratory syncytial virus, influenza, rhinovirus, etc.), otitis media, inflammatory bowel disease, cholelithiasis, allergic rhinitis, chronic sinusitis, and nasal polyposis. In some embodiments, the MUC5AC RNAi agents disclosed herein can be used to treat mucosal obstructive pulmonary diseases, such as severe asthma or COPD. The MUC5AC RNAi agents can also be used to treat, for example, a variety of cancers. Such methods of treatment include administering a MUC5AC RNAi agent to a human or animal having elevated or enhanced MUC5AC gene expression and / or MUC5AC protein levels above desirable levels.

[0022] One aspect described herein is a method for producing a cellular membrane comprising: (i) an antisense strand having a length of 18 to 49 nucleotides, the antisense strand comprising a nucleotide sequence at least partially complementary to a corresponding stretch of consecutive nucleotides of the MUC5AC gene transcript (SEQ ID NO: 1); and (ii) a sense strand that comprises a nucleotide sequence that is at least partially complementary to the antisense strand; wherein the RNAi agent sense strand is optionally further linked to a targeting ligand, and the RNAi agent is capable of inhibiting expression of the MUC5AC gene.

[0023] Another aspect described herein is a method for producing a method for treating a cancer cell comprising the steps of: (i) an antisense strand that comprises at least 17 contiguous nucleotides that differ from any one of the sequences provided in Table 3 by 0 or 1 nucleotide; and (ii) a sense strand that comprises a nucleotide sequence that is at least partially complementary to the antisense strand; wherein the RNAi agent sense strand is optionally further linked to a targeting ligand, and the RNAi agent is capable of inhibiting expression of the MUC5AC gene.

[0024] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525). In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5'→3') UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525), wherein SEQ ID NO: 1525 is located at positions 1-21 (5'→3') of the antisense strand.

[0025] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5'→3')cPrpusUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1127), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage; and the sense strand is at least substantially complementary to the antisense strand. As one of ordinary skill in the art will clearly understand, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 3A-3J, which show all internucleoside linkages). In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'-3')cPrpusUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1127), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage; and the sense strand is at least substantially complementary to the antisense strand.

[0026] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5'→3')usUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1065), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; s represents a phosphorothioate linkage; and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'-3')usUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1065), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage; and the sense strand is at least substantially complementary to the antisense strand.

[0027] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UUCUUGUUCAGGCAAAUCAGC (SEQ ID NO: 1535). In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5'→3') UUCUUGUUCAGGCAAAUCAGC (SEQ ID NO: 1535), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UUCUUGUUCAGGCAAAUCAGC (SEQ ID NO: 1535), wherein SEQ ID NO: 1535 is located at positions 1-21 (5'→3') of the antisense strand.

[0028] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usUfscsuuguucagGfcAfaAfucagsc (SEQ ID NO: 1166), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively, Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively, and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As one of skill in the art will clearly understand, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 3A-3J, which show all internucleoside linkages). In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'-3')usUfscsuuguucagGfcAfaAfucagsc (SEQ ID NO: 1166), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; s represents a phosphorothioate linkage; and the sense strand is at least substantially complementary to the antisense strand.

[0029] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5'→3')cPrpuUfcuuguucagGfcAfaAfucagsc (SEQ ID NO: 1191), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage; and the sense strand is at least substantially complementary to the antisense strand. As one of ordinary skill in the art will clearly understand, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 3A-3J, which show all internucleoside linkages). In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'-3')cPrpuUfcuuguucagGfcAfaAfucagsc (SEQ ID NO: 1191), where a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage; and the sense strand is at least substantially complementary to the antisense strand.

[0030] In some embodiments, a MUC5AC RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525); or UUCUUGUUCAGGCAAAUCAGC (sequence number 1535) and an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following:

[0031] In some embodiments, the MUC5AC RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525); or UUCUUGUUCAGGCAAAUCAGC (sequence number 1535) and the MUC5AC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, wherein all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides, and the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

[0032] In some embodiments, a MUC5AC RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525); or UUCUUGUUCAGGCAAAUCAGC (sequence number 1535) and the MUC5AC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, wherein all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides, the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, the sense strand also comprises a targeting ligand covalently attached to the 5' end, the targeting ligand comprising a compound having affinity for an integrin receptor, and each antisense strand sequence is located at positions 1-21 of the antisense strand.

[0033] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5' to 3') pair: UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525) and GCUGUUCUGCGACUACUACAA (SEQ ID NO: 1617); or UUCUUGUUCAGGCAAAUCAGC (SEQ ID NO: 1535) and GCUGAUUUGCCUGAACAAGAA (SEQ ID NO: 1632) or all or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides.

[0034] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5' to 3') pair: UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525) and GCUGUUCUGCGACUACUACAA (SEQ ID NO: 1617); or UUCUUGUUCAGGCAAAUCAGC (SEQ ID NO: 1535) and GCUGAUUUGCCUGAACAAGAA (SEQ ID NO: 1632) or wherein all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides, and the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5' end, and the targeting ligand comprises a compound having affinity for an integrin receptor.

[0035] In some embodiments, a MUC5AC RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): cPrpusUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1127); usUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1065); usUfscsuuguucagGfcAfaAfucagsc(SEQ ID NO:1166); cPrpuUfcuuguucagGfcAfaAfucagsc (SEQ ID NO: 1191) wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage; and the MUC5AC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, and wherein all or substantially all of the nucleotides of the sense strand are modified nucleotides.

[0036] In some embodiments, a MUC5AC RNAi agent disclosed herein has the following nucleotide sequence (5'→3'): cPrpusUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1127); usUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1065); usUfscsuuguucagGfcAfaAfucagsc(SEQ ID NO:1166); cPrpuUfcuuguucagGfcAfaAfucagsc (SEQ ID NO: 1191) and the MUC5AC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, wherein all or substantially all of the nucleotides of the sense strand are modified nucleotides, wherein all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides, wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and wherein the sense strand also comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

[0037] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises the following nucleotide sequence pair (5'→3'): cPrpusUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1127) and gscuguucuGfCfGfacuacuacaa (SEQ ID NO: 1265); usUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1065) and gscuguucuGfCfGfacuacuacaa (SEQ ID NO: 1265); usUfscsuuguucagGfcAfaAfucagsc (SEQ ID NO: 1166) and gscugauUfuGfcCfugaacaagaa (SEQ ID NO: 1315); and cPrpuUfcuuguucagGfcAfaAfucagsc (SEQ ID NO: 1191) and gscugauUfuGfcCfugaacaagaa (SEQ ID NO: 1315) wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage; and the sense strand also comprises a targeting ligand having affinity for an integrin receptor, the targeting ligand being optionally attached at the 5' end of the sense strand.

[0038] In some embodiments, the MUC5AC RNAi agents disclosed herein have the following sequence pair (5'-3'): cPrpusUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1127) and Tri-SM6.1-avb6-(TA14)gscuguucuGfCfGfacuacuacaas(invAb) (SEQ ID NO: 1491); usUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1065) and Tri-SM6.1-avb6-(TA14)gscuguucuGfCfGfacuacuacaas(invAb) (SEQ ID NO: 1491); usUfscsuuguucagGfcAfaAfucagsc (SEQ ID NO: 1166) and Tri-SM6.1-avb6-(TA14)gscugauUfuGfcCfugaacaagaas(invAb) (SEQ ID NO: 1513); cPrpuUfcuuguucagGfcAfaAfucagsc (SEQ ID NO: 1191) and Tri-SM6.1-avb6-(TA14)gscugauUfuGfcCfugaacaagaas(invAb) (SEQ ID NO: 1513); wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; Tri-SM6.1-αvβ6-(TA14) represents a tridentate αvβ6 epithelial cell targeting ligand having the chemical structure shown in FIG. 1; (invAb) represents an inverted abasic deoxyribonucleotide (see also Table 11); and s represents a phosphorothioate linkage.

[0039] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises the sequence (5' to 3'): UUGUAGUAGUCGCAGAACA (SEQ ID NO:79); and UUCUUGUUCAGGCAAAUCA (SEQ ID NO: 83) The antisense strand comprises a nucleobase sequence which differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of:

[0040] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises the sequence (5' to 3'): UUGUAGUAGUCGCAGAACA (SEQ ID NO:79); and UUCUUGUUCAGGCAAAUCA (SEQ ID NO: 83) and an antisense strand comprising a nucleobase sequence which differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of:

[0041] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises the sequence (5' to 3'): UUGUAGUAGUCGCAGAACA (SEQ ID NO:79); and UUCUUGUUCAGGCAAAUCA (SEQ ID NO: 83) and an antisense strand comprising a nucleobase sequence which differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of:

[0042] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises the sequence (5' to 3'): UUGUAGUAGUCGCAGAACA (SEQ ID NO: 79) and UGUUCUGCGACUACUACAA (SEQ ID NO:568); or UUCUUGUUCAGGCAAAUCA (SEQ ID NO: 83) and UGAUUUGCCUGAACAAGAA (SEQ ID NO:572) The nucleotide sequence pair includes an antisense strand and a sense strand, each of which comprises a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence pair selected from the group consisting of:

[0043] In some embodiments, a MUC5AC RNAi agent disclosed herein comprises the sequence (5' to 3'): UUGUAGUAGUCGCAGAACA (SEQ ID NO: 79) and UGUUCUGCGACUACUACAA (SEQ ID NO:568); or UUCUUGUUCAGGCAAAUCA (SEQ ID NO: 83) and UGAUUUGCCUGAACAAGAA (SEQ ID NO:572) and an antisense strand and a sense strand, each of which comprises a nucleobase sequence which differs by 0 or 1 nucleobase from a nucleotide sequence pair selected from the group consisting of:

[0044] definition As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which can be independently modified or unmodified.

[0045] As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of degrading or inhibiting (e.g., under suitable conditions) translation of a targeted messenger RNA (mRNA) transcript in a sequence-specific manner. As used herein, an RNAi agent may act through the RNA interference mechanism (i.e., inducing RNA interference by interacting with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells) or by any alternative mechanism of action or pathway. Although RNAi agents, as the term is used herein, are believed to act primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein are composed of a sense strand and an antisense strand and include, but are not limited to, small (or short) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of an RNAi agent described herein is at least partially complementary to the mRNA being targeted (i.e., MUC5AC mRNA). The RNAi agent can include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0046] As used herein, the terms "silence," "reduce," "inhibit," "downregulate," or "knock down" when referring to expression of a given gene, mean that expression of the gene, as measured by the level of RNA transcribed from the gene, or the level of a polypeptide, protein, or protein subunit translated from the mRNA, in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is decreased when the cell, group of cells, tissue, organ, or subject is treated with an RNAi agent as described herein, as compared to a second cell, group of cells, tissue, organ, or subject that has not been so treated or has not been so treated.

[0047] As used herein, the terms "sequence" and "nucleotide sequence" refer to a sequence or order of nucleic acid bases or nucleotides written as a series of letters using standard nomenclature. Unless otherwise indicated, a nucleotide sequence is written from left to right in the 5' to 3' direction.

[0048] As used herein, "base", "nucleotide base" or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of nucleotides, including the major purine bases adenine and guanine, and the major pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases (see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P.ed.Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds that include modified nucleobases) is known in the art.

[0049] As used herein, the term "nucleotide" has the same meaning as commonly understood in the art. Thus, as used herein, the term "nucleotide" refers to a glycoside that includes a sugar moiety, a base moiety, and a covalently attached group (linking group) such as a phosphate or phosphorothioate internucleoside linking group, and includes naturally occurring nucleotides such as DNA or RNA, as well as non-natural nucleotides that include modified sugar and / or base moieties, also referred to herein as nucleotide analogs or modified nucleotides. A single nucleotide may be referred to herein as a monomer or unit.

[0050] As used herein, unless otherwise indicated, the term "complementary" when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent's sense strand or a targeting mRNA) associated with a second nucleobase or nucleotide sequence (e.g., an RNAi agent's antisense strand or a single-stranded antisense oligonucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) with an oligonucleotide comprising the second nucleotide sequence under certain standard conditions to form a duplex or double helix structure. A person skilled in the art will be able to select the most appropriate set of conditions for the hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimetics, so long as at least the above hybridization requirements are met. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and are identical to A for purposes of determining identity or complementarity.

[0051] As used herein, "perfectly complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0052] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 70% but not all of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0053] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0054] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to matching nucleobases or nucleotides between a sense strand and an antisense strand of an RNAi agent or between an antisense strand of an RNAi agent and a sense strand of MUC5AC mRNA.

[0055] As used herein, the term "substantially identical" or "substantial identity" as applied to a nucleic acid sequence means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% or more sequence identity compared to a reference sequence, e.g., at least 90%, at least 95%, or at least 99% identity. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is determined by determining the number of positions where the same type of nucleobase is present in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those disclosed herein.

[0056] As used herein, the terms "treat", "treatment" and the like refer to methods or steps taken to reduce or alleviate the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" may include prevention, management, prophylactic treatment, and / or suppression or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0057] As used herein, the phrase "introduce into cell" refers to RNAi agent, and means that RNAi agent is functionally delivered to cell.The phrase "functionally delivered" means that RNAi agent is delivered to cell in such a manner that it can have expected biological activity, for example, sequence-specific inhibition of gene expression.

[0058] Unless otherwise specified, as used herein [ka] The use of the symbol means that any group may be attached thereto, according to the scope of the invention described herein.

[0059] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers." Stereoisomers that are not mirror images of one another are termed "diastereoisomers," and stereoisomers that are non-superimposable mirror images are termed "enantiomers," or may also be termed optical isomers. A carbon atom bonded to four non-identical substituents is termed a "chiral center."

[0060] As used herein, unless a structure is specifically identified otherwise as having a particular configuration, for each structure in which asymmetric centers exist and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including optically pure isomers and racemates. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as single stereoisomers.

[0061] When used in the claims of this application, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. When used in the claims of this application, the phrase "consisting essentially of" limits the claim to certain materials or steps and that do not materially affect the basic and novel characteristics of the claimed invention.

[0062] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Thus, as used herein, the structures disclosed herein contemplate that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. As will be readily understood by those skilled in the art, the disclosure herein is intended to cover the disclosed compounds and compositions regardless of the state of protonation based on the environment (e.g., pH). Similarly, it should also be understood that the compounds described herein that have labile protons or basic atoms represent the salt forms of the corresponding compounds. The compounds described herein may be in the form of free acids, free bases, or salts. It should be understood that pharma- ceutically acceptable salts of the compounds described herein are within the scope of the present invention.

[0063] As used herein, the term "linked" or "bonded" when referring to a connection between two compounds or molecules means that the two compounds or molecules are joined by a covalent bond. Unless otherwise indicated, the terms "linked" and "bonded" as used herein may refer to a connection between a first compound and a second compound with or without an intervening atom or group of atoms.

[0064] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless the context clearly dictates otherwise.

[0065] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Methods and materials similar or equivalent to those described herein can be used to carry out or test the present invention, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will prevail. In addition, the materials, methods, and examples are merely illustrative and are not intended to be limiting.

[0066] When a value is explicitly stated, it should be understood that values ​​that are approximately the same quantity or amount as the stated value are also within the scope of the disclosure. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the disclosure. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any disclosed element is disclosed as having multiple alternatives, examples of the disclosure in which each alternative is excluded, either alone or in any combination with other alternatives, are also disclosed herein. More than one disclosed element may have such an exclusion, and all combinations of elements with such exclusions are disclosed herein.

[0067] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief description of the drawings]

[0068] [Figure 1] Representation of the chemical structure of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM6.1-αvβ6-(TA14). [Diagram 2] FIG. 1: Chemical structure of the peptide αvβ6 epithelial cell targeting ligand, referred to herein as αvβ6-pep1. [Figure 3-1]The following abbreviations are used in Figures 3A-3J: a, c, g, i, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; o is a phosphodiester bond; s is a phosphorothioate bond; invAb is an inverted abasic residue (see, e.g., Table 11); cPrpu is a 5'-cyclopropylphosphonate-2'-O-methyluridine modified nucleotide (see, e.g., Table 11); Tri-SM6.1-αvβ6-(TA14) is a tridentate αvβ6 epithelial cell targeting ligand having the structure shown in Figure 1; (TriAlk14) is a linking group shown in Table 11 that is suitable for subsequent coupling to a targeting ligand (see also Example 1 herein). Figure 3A: Schematic diagram of the modified sense and antisense strands of a MUC5AC RNAi agent conjugate having the structure of AC000437 (see, e.g., Tables 9, 10, and 11) with a tridentate αvβ6 epithelial cell targeting ligand linked at the 5' end of the sense strand. Figure 3B: Schematic diagram of the modified sense and antisense strands of a MUC5AC RNAi agent conjugate having the structure of AC000480 (see, e.g., Tables 9, 10, and 11) with a tridentate αvβ6 epithelial cell targeting ligand linked at the 5' end of the sense strand. Figure 3C: Schematic diagram of the modified sense and antisense strands of a MUC5AC RNAi agent conjugate having the structure of AC000482 (see, e.g., Tables 9, 10, and 11) with a tridentate αvβ6 epithelial cell targeting ligand linked at the 5' end of the sense strand. [Figure 3-2]The following abbreviations are used in Figures 3A-3J: a, c, g, i, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; o is a phosphodiester bond; s is a phosphorothioate bond; invAb is an inverted abasic residue (see, e.g., Table 11); cPrpu is a 5'-cyclopropylphosphonate-2'-O-methyluridine modified nucleotide (see, e.g., Table 11); Tri-SM6.1-αvβ6-(TA14) is a tridentate αvβ6 epithelial cell targeting ligand having the structure shown in Figure 1; (TriAlk14) is a linking group shown in Table 11 that is suitable for subsequent coupling to a targeting ligand (see also Example 1 herein). Figure 3D: Schematic of modified sense and antisense strands of a MUC5AC RNAi agent conjugate having the structure of AC001305 (see, e.g., Tables 9, 10, and 11) with a tridentate αvβ6 epithelial cell targeting ligand linked at the 5' end of the sense strand. Figure 3E: Schematic of modified sense and antisense strands of a MUC5AC RNAi agent conjugate having the structure of AC001306 (see, e.g., Tables 9, 10, and 11) with a tridentate αvβ6 epithelial cell targeting ligand linked at the 5' end of the sense strand. [Figure 3-3]The following abbreviations are used in Figures 3A-3J: a, c, g, i, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; o is a phosphodiester bond; s is a phosphorothioate bond; invAb is an inverted abasic residue (see, e.g., Table 11); cPrpu is a 5'-cyclopropylphosphonate-2'-O-methyluridine modified nucleotide (see, e.g., Table 11); Tri-SM6.1-αvβ6-(TA14) is a tridentate αvβ6 epithelial cell targeting ligand having the structure shown in Figure 1; (TriAlk14) is a linking group shown in Table 11 that is suitable for subsequent coupling to a targeting ligand (see also Example 1 herein). Figure 3F: Schematic of modified sense and antisense strands of a MUC5AC RNAi agent duplex having the structure of AD08089 (see, e.g., Tables 8 and 10) with a (TriAlk14) linker at the 5' end of the sense strand. Figure 3G: Schematic of modified sense and antisense strands of a MUC5AC RNAi agent duplex having the structure of AD08174 (see, e.g., Tables 8 and 10) with a (TriAlk14) linker at the 5' end of the sense strand. Figure 3H: Schematic of modified sense and antisense strands of a MUC5AC RNAi agent duplex having the structure of AD08173 (see, e.g., Tables 8 and 10) with a (TriAlk14) linker at the 5' end of the sense strand. [Diagram 3-4]The following abbreviations are used in Figures 3A-3J: a, c, g, i, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; o is a phosphodiester bond; s is a phosphorothioate bond; invAb is an inverted abasic residue (see, e.g., Table 11); cPrpu is a 5'-cyclopropylphosphonate-2'-O-methyluridine modified nucleotide (see, e.g., Table 11); Tri-SM6.1-αvβ6-(TA14) is a tridentate αvβ6 epithelial cell targeting ligand having the structure shown in Figure 1; (TriAlk14) is a linking group shown in Table 11 that is suitable for subsequent coupling to a targeting ligand (see also Example 1 herein). Figure 3I: Schematic of modified sense and antisense strands of a MUC5AC RNAi agent duplex (see, e.g., Tables 8 and 10) having the structure of AD09240, with a (TriAlk14) linker at the 5' end of the sense strand. Figure 3J: Schematic of modified sense and antisense strands of a MUC5AC RNAi agent duplex (see, e.g., Tables 8 and 10) having the structure of AD09241, with a (TriAlk14) linker at the 5' end of the sense strand.

[0069] Detailed Description of the Invention RNAi agents Described herein are RNAi agents (referred to herein as MUC5AC RNAi agents or MUC5AC RNAi triggers) for inhibiting expression of the MUC5AC gene. Each MUC5AC RNAi agent disclosed herein includes a sense strand and an antisense strand. The sense strand can be 15-49 nucleotides in length. The antisense strand can be 18-49 nucleotides in length. The sense strand and the antisense strand can be the same length or different lengths. In some embodiments, the sense strand and the antisense strand are each independently 18-27 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21-26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each 21-24 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 nucleotides in length. In some embodiments, the RNAi agent antisense strands are each independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the RNAi agent sense strands are each independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The sense and antisense strands are annealed to form a duplex, and in some embodiments, the double-stranded RNAi agent has a duplex length of about 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0070] Examples of nucleotide sequences used to form MUC5AC RNAi agents are provided in Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, and Table 11. Examples of RNAi agent duplexes include the sense and antisense strand sequences of Table 2, Table 3, Table 4, Table 5, Table 6, and Table 7, and are shown in Table 8A, Table 8B, Table 8C, Table 9, Table 10A, Table 10B, and Table 11.

[0071] In some embodiments, the region of complete, substantial, or partial complementarity between the sense strand and the antisense strand is 15-26 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., this region can be 0, 1, 2, 3, or 4 nucleotides away from the 5' end of the antisense strand that is not completely, substantially, or partially complementary).

[0072] The sense strand of the MUC5AC RNAi agent described herein comprises at least 15 contiguous nucleotides having at least 85% identity to a core stretch sequence of the same number of nucleotides in MUC5AC mRNA (also referred to herein as "core stretch" or "core sequence"). In some embodiments, the sense strand core stretch sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the antisense strand core stretch sequence, and thus the sense strand core stretch sequence is typically fully identical or at least about 85% identical to a nucleotide sequence of the same length present in the MUC5AC mRNA target (e.g., sometimes referred to as a target sequence). In some embodiments, the sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length. In some embodiments, the sense strand core stretch is 17 nucleotides in length. In some embodiments, the sense strand core stretch is 19 nucleotides in length.

[0073] The antisense strand of the MUC5AC RNAi agent described herein comprises at least 18 consecutive nucleotides having at least 85% complementarity to a core stretch of the same number of nucleotides in MUC5AC mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core stretch is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the MUC5AC mRNA target (e.g., a target sequence). In some embodiments, the antisense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides long. In some embodiments, the antisense strand core stretch is 19 nucleotides long. In some embodiments, the antisense strand core stretch is 17 nucleotides long. In some embodiments, the antisense strand core stretch is 21 nucleotides long. The sense strand core stretch sequence may be the same length as the corresponding antisense core stretch sequence, or may be of a different length.

[0074] The sense and antisense strands of the MUC5AC RNAi agent anneal to form a duplex. The sense and antisense strands of the MUC5AC RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense strand core stretch sequence. In some embodiments the sense strand core stretch sequence comprises at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% or 100% complementary to a corresponding 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotide sequence of the antisense strand core stretch sequence (i.e. the sense and antisense core stretch sequences of a MUC5AC RNAi agent have a region of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 nucleotides that are at least 85% base paired or 100% base paired).

[0075] In some embodiments, the antisense strand of a MUC5AC RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2, Table 3, or Table 11 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of a MUC5AC RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, Table 7, or Table 11 by 0, 1, 2, or 3 nucleotides.

[0076] In some embodiments, the sense strand and / or the antisense strand may optionally and independently comprise an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, 5' end, or both of the core stretch sequence. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding sequence in MUC5AC mRNA. The additional nucleotides of the sense strand, if present, may or may not be identical to the corresponding sequence in MUC5AC mRNA. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the additional nucleotides (if present) of the corresponding sense strand.

[0077] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extended nucleotides on the sense strand may or may not be complementary to any of the nucleotides of the core stretch sequence or the extended nucleotides in the corresponding antisense strand. Conversely, the extended nucleotides on the antisense strand may or may not be complementary to any of the nucleotides of the core stretch sequence or the extended nucleotides in the corresponding sense strand. In some embodiments, both the sense and antisense strands of the RNAi agent comprise a 3' extension and a 5' extension. In some embodiments, one or more 3' extended nucleotides of one strand are base-paired with one or more 5' extended nucleotides of the other strand. In other embodiments, one or more 3' extended nucleotides of one strand are not base-paired with one or more 5' extended nucleotides of the other strand. In some embodiments, the MUC5AC RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extension nucleotides are unpaired and form an overhang. As used herein, "overhang" refers to a stretch or extension of one or more unpaired nucleotides located at either end of the sense strand or the antisense strand that does not form part of the hybridized or double-stranded portion of the RNAi agent disclosed herein.

[0078] In some embodiments, a MUC5AC RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, a MUC5AC RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises nucleotides that are complementary to the corresponding MUC5AC mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprises nucleotides that are not complementary to the corresponding MUC5AC mRNA sequence.

[0079] In some embodiments, the MUC5AC RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide that corresponds to or is identical to a nucleotide in the MUC5AC mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5' to 3').

[0080] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, a MUC5AC RNAi agent comprises a sense strand having a 5' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises a nucleotide that corresponds to or is identical to a nucleotide in the MUC5AC mRNA sequence.

[0081] Examples of sequences used to form a MUC5AC RNAi agent are provided in Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, and Table 11. In some embodiments, the antisense strand of the MUC5AC RNAi agent comprises any of the sequences in Table 2, Table 3, or Table 11. In certain embodiments, the antisense strand of the MUC5AC RNAi agent comprises or consists of any one of the modified sequences in Table 3. In some embodiments, the antisense strand of the MUC5AC RNAi agent comprises 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 nucleotide sequences (5' to 3') of any of the sequences in Table 2, Table 3, or Table 11. In some embodiments, the sense strand of the MUC5AC RNAi agent comprises any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 7. In some embodiments, the sense strand of a MUC5AC RNAi agent comprises nucleotides 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 (5' to 3') of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 7. In certain embodiments, the sense strand of a MUC5AC RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4, Table 5, Table 6, Table 7, or Table 11.

[0082] In some embodiments, the sense strand and the antisense strand of an RNAi agent described herein comprise the same number of nucleotides. In some embodiments, the sense strand and the antisense strand of an RNAi agent described herein comprise a different number of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of the RNAi agent form a blunt end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of the RNAi agent form a blunt end. In some embodiments, both ends of the RNAi agent form a blunt end. In some embodiments, neither end of the RNAi agent is blunt. As used herein, "blunt end" refers to an end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0083] In some embodiments, the sense strand 5' end and the antisense strand 3' end of the RNAi agent form a frayed end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, frayed end refers to the ends of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or on the antisense strand and form a 3' or 5' overhang. In some embodiments, the RNAi agent comprises a blunt end and a frayed end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a frayed end and a 5' overhanging end, a frayed end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two frayed ends, or two blunt ends. Typically, the overhangs, if present, are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0084] The MUC5AC RNAi agent disclosed herein may also be comprised of one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the MUC5AC RNAi agent are modified nucleotides. The MUC5AC RNAi agent disclosed herein may further comprise one or more modified internucleoside linkages, such as one or more phosphorothioate or phosphorodithioate linkages. In some embodiments, the MUC5AC RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, the 2' modified nucleotides are combined using modified internucleoside linkages.

[0085] In some embodiments, the MUC5AC RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the MUC5AC RNAi agent is prepared as a pharma-ceutically acceptable salt. In some embodiments, the MUC5AC RNAi agent is prepared as a pharma-ceutically acceptable sodium salt. Such forms, as are known in the art, are within the scope of the invention disclosed herein.

[0086] Modified Nucleotides Modified nucleotides, when used in various oligonucleotide constructs, can maintain the activity of the compounds in cells, while also increasing the serum stability of these compounds, and can also minimize the potential for activating interferon activity in humans upon administration of the oligonucleotide construct.

[0087] In some embodiments, a MUC5AC RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%), or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimetics, abasic nucleotides, 2' modified nucleotides, inverted nucleotides, modified nucleobase-containing nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimetics (non-locked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me, 2'-fluoro nucleotides, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, vinyl phosphonate-containing nucleotides, and cyclopropyl phosphonate-containing nucleotides. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the 5-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to as 2'-methoxy nucleotides), 2'-fluoro nucleotides (also referred to herein as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (also referred to as 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, two or more modifications can be incorporated into a single MUC5AC RNAi agent or even into that single nucleotide. The sense and antisense strands of a MUC5AC RNAi agent can be synthesized and / or modified by methods known in the art. Modifications at one nucleotide are independent of modifications at another nucleotide.

[0088] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) derivatives of adenine and guanine and other alkyl derivatives, 2-thiouracil, 2-thiocytosine ... Examples of uracil include uracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0089] In some embodiments, the 5' and / or 3' end of the antisense strand can contain an abasic residue (Ab), which may also be referred to as an "abasic site" or "abasic nucleotide". An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1-position of the sugar moiety (see, e.g., U.S. Pat. No. 5,998,203). In some embodiments, the abasic residue can be located internally in the nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand can contain one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0090] In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent that has 4 or less (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand that are ribonucleotides (i.e., unmodified). As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand that has 2 or less (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides. As used herein, an antisense sense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand that has 2 or less (i.e., 0, 1, or 2) nucleotides in the antisense strand that are unmodified ribonucleotides. In some embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides. The chemical structures of certain modified nucleotides are shown in Table 12 herein.

[0091] Modified Internucleoside Linkages In some embodiments, one or more nucleotides of a MUC5AC RNAi agent are linked by a non-standard linkage or backbone (ie, a modified internucleoside linkage or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein by a lower case "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidates, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkylphosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates having inverted polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside bond or modified backbone lacks a phosphorus atom. Modified internucleoside bonds lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl intersugar bonds, mixed heteroatom and alkyl or cycloalkyl intersugar bonds, or one or more short chain heteroatom or heterocyclic intersugar bonds. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH2 elements.

[0092] In some embodiments, the sense strand of a MUC5AC RNAi agent can include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of a MUC5AC RNAi agent can include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense and antisense strands can independently include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of a MUC5AC RNAi agent can include 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of a MUC5AC RNAi agent can include 1, 2, 3, or 4 phosphorothioate linkages, or both the sense and antisense strands can independently include 1, 2, 3, or 4 phosphorothioate linkages.

[0093] In some embodiments, the sense strand of the MUC5AC RNAi agent comprises at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, the sense strand does not comprise phosphorothioate internucleoside linkages between nucleotides, but does comprise one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends and the optionally present inverted abasic residue end cap. In some embodiments, the targeting ligand is attached to the sense strand via a phosphorothioate linkage.

[0094] In some embodiments, the antisense strand of the MUC5AC RNAi agent comprises four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the MUC5AC RNAi agent comprises at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0095] Capping residues or moieties In some embodiments, the sense strand may include one or more capping residues or moieties (sometimes referred to in the art as "caps," "terminal caps," or "capping residues"). As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the nucleotide sequence of an RNAi agent disclosed herein. Capping residues can provide certain beneficial properties to the RNAi agent in some cases, such as protection against exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table 12) (see, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art and include, for example, inverted abasic residues, as well as terminal C3H7 (propyl), C6H 13 (hexyl), or C 12 H 25(dodecyl) group. In some embodiments, the capping residue is present at the 5'-end, the 3'-end, or both the 5'-end and the 3'-end of the sense strand. In some embodiments, the 5'-end and / or the 3'-end of the sense strand may include two or more inverted abasic deoxyribose moieties as capping residues.

[0096] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the end of the sense strand of the RNAi agent allows for enhanced activity or other desired properties of the RNAi agent.

[0097] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues may be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues may be linked via phosphate, phosphorothioate (e.g., shown herein as (invAb)), or other internucleoside linkages. In some embodiments, the inclusion of one or more inverted abasic residues at or near the end of the sense strand of the RNAi agent may allow for enhanced activity or other desired properties of the RNAi agent. In some embodiments, the inverted abasic (deoxyribose) residues may be replaced with inverted ribitol (abasic ribose) residues. In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence may include an inverted abasic residue. The chemical structure of an inverted abasic deoxyribose residue is shown in Table 12 below.

[0098] MUC5AC RNAi agents The MUC5AC RNAi agents disclosed herein are designed to target a specific position of the MUC5AC gene (e.g., SEQ ID NO: 1 (NM_001304359.2)). As defined herein, the antisense strand sequence is designed to target the MUC5AC gene at a given position on the gene when the 5'-terminal nucleobase of the antisense strand is aligned to a position 19 nucleotides downstream (towards the 3' end) from the position on the gene when base-pairing with the gene. For example, as illustrated in Tables 1 and 2 herein, an antisense strand sequence designed to target the MUC5AC gene at position 3535 requires that the 5'-terminal nucleobase of the antisense strand is aligned to position 3553 of the MUC5AC gene when base-pairing with the gene.

[0099] As provided herein, MUC5AC RNAi agents do not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene, provided there is at least 85% complementarity between the antisense strand and the gene (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) over a core stretch sequence of at least 16 contiguous nucleotides. For example, in the case of a MUC5AC RNAi agent disclosed herein designed to target position 3535 of the MUC5AC gene, the 5'-terminal nucleobase of the antisense strand of the MUC5AC RNAi agent should align with position 3553 of the gene, but need not be complementary to position 3553 of the MUC5AC gene, provided there is at least 85% complementarity between the antisense strand and the gene (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) over a core stretch sequence of at least 16 contiguous nucleotides. In particular, as demonstrated by the various examples disclosed herein, the specific site of binding of the gene by the antisense strand of a MUC5AC RNAi agent (e.g., whether the MUC5AC RNAi agent is designed to target the MUC5AC gene at position 3535, 4993, 15051, or other position) is an important factor in the level of inhibition achieved by the MUC5AC RNAi agent (see also Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0100] In some embodiments, a MUC5AC RNAi agent disclosed herein targets the MUC5AC gene at or near the location of a MUC5AC sequence shown in Table 1. In some embodiments, the antisense strand of a MUC5AC RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to a target MUC5AC 19mer sequence disclosed in Table 1. [Table 1-1] [Table 1-2]

[0101] Homo sapiens mucin 5AC, oligomeric mucus / gel forming (MUC5AC) gene transcript, GenBankNM_001304359.2 (SEQ ID NO: 1) (17,448 bases): 1 ctcagaggct gctgagggac agggcactct tccccgccgt ccacacaatg agtgttggcc 61 ggaggaagct ggccctgctc tgggccctgg ctctcgctct ggcctgcacc cggcatacag 121 gccatgccca ggatggctcc tccgaatcca gctacaagca ccaccctgcc ctctctccta 181 tcgcccgggg gcccagcggg gtcccgctcc gtggggcgac tgtcttccca tctctgagga 241 ccatccctgt ggtacgagcc tccaacccgg cgcacaacgg gcgggtgtgc agcacctggg 301 gcagcttcca ctacaagacc ttcgacggcg acgtcttccg cttccccggc ctctgcaact 361 acgtgttctc cgagcactgc ggtgccgcct acgaggattt taacatccag ctacgccgca 421 gccaggagtc agcggccccc acgctgagca gggtcctcat gaaggtggat ggcgtggtca 481 tccagctgac caagggctcc gtcctggtca acggccaccc ggtcctgctg cccttcagcc 541 agtctggggt cctcattcag cagagcagca gctacaccaa ggtggaggcc aggctgggcc 601 ttgtcctcat gtggaaccac gatgacagcc tgctgctgga gctggacacc aaatacgcca 661 acaagacctg tgggctctgt ggggacttca acgggatgcc cgtggtcagc gagctcctct 721 cccacaacac caagctgaca cccatggaat tcgggaacct gcagaagatg gacgacccca 781 cggaccagtg tcaggaccct gtccctgaac ccccgaggaa ctgctccact ggctttggca 841 tctgtgagga gctcctgcac ggccagctgt tctctggctg cgtggccctg gtggacgtcg 901 gcagctacct ggaggcttgc aggcaagacc tctgcttctg tgaagacacc gacctgctca 961 gctgcgtctg ccacaccctt gccgagtact cccggcagtg cacccatgca ggggggttgc 1021 cccaggactg gcggggccct gacttctgcc cccagaagtg ccccaacaac atgcagtacc 1081 acgagtgccg ctccccctgc gcagacacct gctccaacca ggagcactcc cgggcctgtg 1141 aggaccactg tgtggccggc tgcttctgcc ctgaggggac ggtgcttgac gacatcggcc 1201 agaccggctg tgtccctgtg tcaaagtgtg cctgcgtcta caacggggct gcctatgccc 1261 caggggccac ctactccaca gactgcacca actgcacctg ctccggaggc cggtggagct 1321 gccaggaggt tccatgcccg ggtacctgct ctgtgcttgg aggtgcccac ttctcaacgt 1381 ttgacgggaa gcaatacacg gtgcacggcg actgcagcta tgtgctgacc aagccctgtg 1441 acagcagtgc cttcactgta ctggctgagc tgcgcaggtg cgggctgacg gacagcgaga 1501 cctgcctgaa gagcgtgaca ctgagcctgg atggggcgca gacggtggtg gtgatcaagg 1561 ccagtgggga agtgttcctg aaccagatct acacccagct gcccatctct gcagccaacg 1621 tcaccatctt cagaccctca accttcttca tcatcgccca gaccagcctg ggcctgcagc 1681 tgaacctgca gctggtgccc accatgcagc tgttcatgca gctggcgccc aagctccgtg 1741 ggcagacctg cggtctctgt gggaacttca acagcatcca ggccgatgac ttccggaccc 1801 tcagtggggt ggtggaggcc accgctgcgg ccttcttcaa caccttcaag acccaggccg 1861 cctgccccaa catcaggaac agcttcgagg acccctgctc tctgagcgtg gagaatgaga 1921 agtatgctca gcactggtgc tcgcagctga ccgatgccga cggccccttc ggccggtgcc 1981 atgctgccgt gaagccggga acctactact cgaactgcat gtttgacacc tgcaactgtg 2041 agcggagcga ggactgcctg tgcgccgcgc tgtcctccta cgtgcacgcc tgtgccgcca 2101 agggcgtgca gctcggcggc tggagggacg gcgtctgcac gaagcctatg accacttgcc 2161 ccaagtcaat gacgtaccac taccatgtca gcacctgcca gcccacctgc cgctccctga 2221 gcgaggggga catcacctgc agtgttggct tcatccccgt ggatggctgc atctgtccca 2281 agggcacctt cctggacgac acgggcaagt gtgtgcaggc cagcaactgt ccctgctacc 2341 acagaggctc catgatcccc aatggggagt cggtgcacga cagcggggct atctgcacct 2401 gcacacatgg gaagctgagc tgcatcggag gccaagcccc cgccccagtg tgtgctgcgc 2461 ccatggtgtt ctttgactgc cgaaatgcca cgcccgggga cacaggggct ggctgtcaga 2521 agagctgcca cacactggac atgacctgtt acagccccca gtgtgtgcct ggctgcgtgt 2581 gccccgacgg gctggtggcg gacggcgagg gcggctgcat cactgcggag gactgcccct 2641 gcgtgcacaa tgaggccagc taccgggccg gccagaccat ccgggtgggc tgcaacacct 2701 gcacctgtga cagcaggatg tggcggtgca cagatgaccc ctgcctggcc acctgcgccg 2761 tgtacgggga cggccactac ctcaccttcg acggacagag ctacagcttc aacggagact 2821 gcgagtacac gctggtgcag aaccactgtg gcgggaaaga cagcacccag gactcctttc 2881 gtgttgtcac cgagaacgtc ccctgcggca ccacagggac cacctgctcc aaggccatca 2941 agattttcct ggggggcttc gagctgaagc taagccatgg gaaggtggag gtgatcggga 3001 cggacgagag ccaggaggtg ccatacacca tccggcagat gggcatctac ctggtggtgg 3061 acaccgacat tggcctggtg ctgctgtggg acaagaagac cagcatcttc atcaacctca 3121 gccccgagtt caagggcagg gtctgcggcc tgtgtgggaa cttcgacgac atcgccgtta 3181 atgactttgc cacgcggagc cggtctgtgg tgggggacgt gctggagttt gggaacagct 3241 ggaagctctc cccctcctgc ccagatgccc tggcgcccaa ggacccctgc acggccaacc 3301 ccttccgcaa gtcctgggcc cagaagcagt gcagcatcct ccacggcccc accttcgccg 3361 cctgccacgc acacgtggag ccggccaggt actacgaggc ctgcgtgaac gacgcgtgcg 3421 cctgcgactc cgggggtgac tgcgagtgct tctgcacggc tgtggccgcc tacgcccagg 3481 cctgccatga agtaggcctg tgtgtgtcct ggcggacccc gagcatctgc cctctgttct 3541 gcgactacta caaccccgaa ggccagtgcg agtggcacta ccagccctgc ggggtgccct 3601 gcctgcgcac ctgccggaac ccccgtggag actgcctgcg ggacgtccgg ggcctggaag 3661 gctgctaccc caagtgccca ccagaggctc ccatctttga tgaggacaag atgcagtgtg 3721 tggccacctg cccaaccccg cctctgccac cacggtgcca cgtccatggg aagtcctacc 3781 ggccaggtgc agtggtgccc tcggacaaga actgccagtc ctgcctttgt acggagcgcg 3841 gcgtggagtg cacctacaaa gctgaggcct gtgtctgcac ctacaatgga cagcgcttcc 3901 acccagggga cgtcatctac cacacgacgg atggcacggg tggctgcatc tccgcccgct 3961 gcggggccaa cggcaccatt gagaggaggg tctacccctg cagccccacc acccctgtcc 4021 ccccaaccac cttctccttc tccacacccc cgcttgtcgt gagctccacg cacaccccca 4081 gcaatggccc aagcagcgcg cacacaggcc ctccgagcag cgcctggccc accacagcag 4141 gcacttctcc caggacgagg ctgcccacag cctctgcctc actgccgccg gtctgtgggg 4201 aaaagtgcct gtggtcgcca tggatggatg tcagccgccc tggacggggc acggacagcg 4261 gtgacttcga cacactggag aacctccgcg cccatgggta ccgggtgtgc gaatcaccca 4321 ggtcggtgga gtgccgagct gaggacgccc ccggagtgcc gctccgagcc ctggggcagc 4381 gtgtgcagtg cagcccggat gtggggctga cctgtcgtaa cagggagcag gcatcggggc 4441 tctgctacaa ctaccagatc agggtccagt gctgcacgcc cctaccctgc tccacctcta 4501 gcagtccagc ccagaccact cctccaacta cctccaagac cactgaaacc cgggcctcag 4561 gctcctcagc tcccagcagc acacctggca ccgtgtctct ctctacagcc aggacgacac 4621 ctgccccagg taccgctacc tctgtcaaaa aaactttctc aactcccagc cctccgccag 4681 tgccggcaac atcaacatca tccatgtcga ccacggcccc ggggacctct gtggtctcca 4741 gcaagcccac ccccacggag cccagcacat cctcctgcct gcaggagctt tgcacctgga 4801 ccgagtggat cgatggcagc taccctgctc ctggaataaa tggtggagat tttgacacat 4861 ttcaaaattt gagagacgaa ggatacacat tctgtgaaag tcctcgaagc gtgcagtgcc 4921 gggcagagag cttccccaac acgccgctgg cagacctggg gcaggacgtc atctgcagcc 4981 acacagaggg gctgatttgc ctgaacaaga accagctccc acccatctgc tacaactatg 5041 agatccgcat ccagtgttgc gagacggtga acgtgtgcag agacatcacc agactgccaa 5101 agaccgtcgc aacgacacgg ccgactccac atccaaccgg agctcagacc cagaccacct 5161 tcaccacaca catgccctcg gcctccacag agcaacccac ggcaacctcc aggggtgggc 5221 ccacagcaac cagcgtcaca cagggcaccc acaccacact agtcaccaga aactgtcatc 5281 cccggtgcac ctggacaaag tggttcgacg tggacttccc gtcccccgga ccccatggtg 5341 gagacaagga aacctacaac aacatcatca ggagtgggga aaaaatctgc cgccgacctg 5401 aggagatcac caggctccag tgccgagcca agagccaccc agaggtgagc atcgaacacc 5461 tgggccaggt ggtgcagtgc agccgggag agggcctggt gtgccggac caggaccagc 5521 agggaccctt caagatgtgc ctcaactacg aggtgcgtgt gctctgctgc gagaccccca 5581 gaggctgcca catgacctcc acacctggct ccacctctag cagtccagcc cagaccactc 5641 cttcaacaac ctccaagacc actgaaaccc aggcctcagg ctcctcagcc cccagcagca 5701 cacctggcac cgtgtctctc tctacagcca ggacgacacc tgccccaggt accgctacct 5761 ctgtcaaaaa aactttctca actcccagcc ctccgccagt gccggcaaca tcaacatcat 5821 ccatgtcgac cacggccccg gggacctctg tggtctccag caagcccacc cccacggagc 5881 ccagcacatc ctcctgcctg caggagcttt gcacctggac cgagtggatt gatggcagct 5941 accctgctcc tggaataat ggtggagatt ttgacacatt tcaaaatttg agagacgaag 6001 gatacacatt ctgtgaaagt cctcgaagcg tgcagtgccg ggcagagagc ttccccaaca 6061 cgccgctggc agacctgggg caggacgtca tctgcagcca cacagagggg ctgatttgcc 6121 tgaacaagaa ccagctccca cccatctgct acaactatga gatccgcatc cagtgttgcg 6181 agacggtgaa cgtgtgcaga gacatcacca gaccgccaaa gaccgtcgca acgacacggc 6241 cgactccaca tccaaccgga gctcagaccc agaccacctt caccacacac atgccctcgg 6301 cctccacaga gcaacccacg gcaacctcca ggggtgggcc cacagcaacc agcgtcacac 6361 agggcaccca caccacacca gtcaccagaa actgtcatcc ccggtgcacc tggacaacgt 6421 ggttcgacgt ggacttcccg tcccccggac cccatggtgg agacaaggaa acctacaaca 6481 acatcatcag gagtggggaa aaaatctgcc gccgacctga ggagatcacc aggctccagt 6541 gccgagccaa gagccaccca gaggtgagca tcgaacacct gggccaggtg gtgcagtgca 6601 gccgggaaga gggcctggtg tgccggaacc aggaccagca gggacccttc aagatgtgcc 6661 tcaactacga ggtgcgtgtg ctctgctgcg agacccccaa aggctgcccc gtgacctcca 6721 cacctgtgac agctcctagc acccctagtg ggagagccac cagcccaact cagagcacct 6781 cctcttggca gaaatccagg acaaccactt tggtgacaac cagcacaacc tccactccac 6841 agaccagtac aacctatgcc catacaacca gcacaacctc tgctcctaca gccagaacaa 6901 cctctgctcc tacaaccaga acaacctctg cctctccagc cagcacaacc tctggtcctg 6961 gaaatactcc cagccctgtt cctaccacca gcacaatctc tgctcctaca actagcataa 7021 cctctgcccc tacaaccagc acaacctctg cccctacaag cagcacaacc tctggtcctg 7081 gaactactcc cagccctgtt cctaccacca gcataacctc tgcccctaca accagcacaa 7141 cctctgctcc tacaaccagc acaacctctg cccgtacaag cagcacaacc tctgccacta 7201 ccaccagcag aatctctggt cctgaaacta ctcccagccc tgttcctacc accagcacaa 7261 cctctgccac tacaaccagc acaacctcag ctcctacaac cagcacaacc tctgccccta 7321 caagcagcac aacctccagt ccacagacca gcacaacctc ggctcctaca accagcacaa 7381 cttctggtcc tggaactacc ccaagccctg ttcccacgac cagcacaacc tctgccccta 7441 caacaagaac aacttctgct cctaaaagca gcacaacctc tgccgctaca accagcacaa 7501 cctctggtcc tgaaactact cctagacctg ttcctaccac cagcacaacc tcttctccta 7561 caaccagcac aacctctgct cctacaacca gcacaacctc tgcttctaca accagcacaa 7621 cctctggtgc tggaactact cccagccctg ttcccaccac cagcacaacc tctgctccta 7681 caaccagcac aacctctgcc cctataagca gcacaacctc tgccactaca accagcacaa 7741 cctctggtcc tggaactact cccagccctg ttcctaccac gagcacaacc tctgctccta 7801 caaccagcac aacctctggt cctggaacta ctcccagtgc tgttcccacc accagcataa 7861 cctctgcacc tacaaccagc acaaactctg cccctataag cagcacaacc tctgccacta 7921 caaccagcag aatctctggt cctgaaacta ctcccagccc tgttcctacc gccagcacaa 7981 cctctgcttc tacaactagc acaacctctg gtcctggaac tactcccagc cctgttccta 8041 ccaccagcac aatctctgtt cctaccacca gcacaacttc tgcttctaca accagcacaa 8101 cctctgcttc tacaaccagc acaacctctg gtcctggaac tactcccagc cctgttccca 8161 ccaccagcac aacctctgct cccacaacaa gcacaacctc tgcccctaca accagcacaa 8221 tctcggcccc aacaaccagc acaacctctg ccactacaac cagcacgacc tctgctccta 8281 cacccagaag aacctcagcc cctacaacca gcacaatctc tgcctctacc accagcacaa 8341 cctctgcgac tacaaccagc acaacctctg ctactacaac cagcacaatc tctgccccta 8401 caaccagcac aactttgtct cctacaacca gcacaacctc tactactata accagcacaa 8461 cttctgcccc tataagcagc acaacttcca caccacagac cagcacaact tcggctccta 8521 caaccagcac aacttctggt cctggaacta cttcaagccc tgttcccacc accagcacaa 8581 cctctgcccc tacaaccagc acaacctctg cccctacaac cagaacaacc tctgtcccta 8641 caagcagcac aacctccact gctacaacca gcacaacctc tggccctgga actactccca 8701 gccctgttcc caccaccagt acaacctctg ctcctacaac cagaacaacc tctgctccta 8761 caaccagcac aacctctgcc cctacaacca gcacaacctc tgcccctaca agcagcacaa 8821 cctcagctac tacaaccagc acaatctctg ttcctacaac cagcacaact tctgttcctg 8881 gaactactcc cagccctgtt cctaccacca gcacaatctc tgttcctacc accagcacaa 8941 cttctgcttc tacaaccagc acaacctctg gtcctggaac tactcccagc cctgttccca 9001 ccaccagcac aacctctgct cccacaacaa gcacaacctc tgcccctaca accagcacaa 9061 tctcggcccc aacaaccagc acaccctctg cccctacaac cagcacaacc ttagctccta 9121 caaccagcac aacctctgcc cctacaacca gcacaacctc tacccctaca agcagcacaa 9181 cctcctctcc acagaccagc acaacctcgg cttctaccac cagcataact tctggtcctg 9241 gaactacccc aagccctgtt cccaccacca gcacaacctc tgctcctaca accagcacaa 9301 cctctgccgc tacaaccagc acaatctcgg ccccaacaac cagcacaacg tctgctccta 9361 caaccagcac aacctctgcc tctacagcca gcaaaacctc tggtcttgga actactccca 9421 gccctattcc taccaccagc acaacctctc ctcctacaac cagcacaact tctgcctcta 9481 cagccagcaa aacctctggt cctggaacca ctcccagccc tgttcccacc accagcacaa 9541 tctttgctcc tagaaccagc accacttctg cctctacaac cagcacaacc cctggtcctg 9601 gaaccactcc cagccccgtt cccaccacca gcacagcctc tgtttcaaag accagcacaa 9661 gccatgtttc catatccaag acaacccact cccaaccagt caccagagac tgtcatctcc 9721 ggtgcacctg gaccaagtgg tttgacatag acttcccatc ccctggaccc cacggcgggg 9781 acaaggaaac ctacaacaac atcatcagga gtggggaaaa aatctgccgc cgacctgagg 9841 agatcaccag gctccagtgc cgagccgaga gccacccgga ggtgagcatt gaacacctgg 9901 gccaggtggt gcagtgcagc cgtgaagagg gcctggtgtg ccggaaccag gaccagcagg 9961 gacccttcaa gatgtgcctc aactacgagg tgcgtgtgct ctgctgcgag acccctaaag 10021 gttgccccgt gacctccaca cctgtgacag ctcctagcac ccctagtggg agagccacca 10081 gcccaactca gagcacttcc tcttggcaga aatccaggac aaccactttg gtgacaacca 10141 gcacaacctc cactccacag accagcacaa cctctgctcc tacaaccagc acaacctctg 10201 ctcccacaac cagcacaact tctgccccta caaccagcac aacctccact ccacagacca 10261 gcatatcctc tgcccctaca agcagcacaa cctcggctcc tacaagcagc acaatctctg 10321 ctcgtacaac cagcataatc tctgccccta caaccagcac aacctcttcc cctacaacca 10381 gcacaacctc tgctactaca accagcacaa cctctgcccc tacaagcagc acaacctcca 10441 ctccacagac cagcaaaacc tcagctgcta caagcagcac aacctccggt tctggaacta 10501 ctcccagccc tgttaccacc accagcacag cctctgtttc aaagaccagc acaagccatg 10561 tttctgtatc caagacaacc cactcccaac cagtcaccag agactgtcat ccccggtgca 10621 cctggaccaa atggtttgat gtggactttc catcccctgg accccacggt ggggacaagg 10681 aaacctacaa caacatcatc aggagtgggg aaaaaatctg ccgccgacct gaggagatca 10741 ccaggctcca gtgccgagcc aagagccacc cggaggtgag catcgaacac ctgggccagg 10801 tggtgcagtg cagccgcgaa gagggcctgg tgtgccggaa ccaggaccag cagggaccct 10861 tcaagatgtg cctcaactac gaggtgcgtg tgctttgctg cgagaccccc aaaggctgcc 10921 ccgtgacctc cacatctgtg acagctccta gcacccctag tgggagagcc accagcccaa 10981 ctcagagcac ctcctcttgg cagaaatcca ggacaaccac tttggtgaca agcagcataa 11041 cctccactac acagaccagc acaacctctg cccctacaac tagcacaacc cctgcttcta 11101 tacccagcac aacctctgcc ccaacaacca gcacaacctc tgctcccaca acgagcacaa 11161 cttctgcccc tacaaccagc acaacctcca ctccacagac caccacatcc tctgccccta 11221 caagcagcac aacctcggct cctaccacca gcacaatctc tgcccctaca accagcacaa 11281 tctctgcccc tacaaccagc acaacctctg ctcccacagc cagcacaacg tcagctccta 11341 cgagcacttc ctcggctcct acaaccaaca caacctctgc ccctacaact agcactacct 11401 ctgctcccat aaccagcaca atctctgccc ctacaaccag cacaacctcc actccacaga 11461 ccagcacaat ctcttcccct acaaccagca caacctccac tccgcagacc agcacaacct 11521 cttcccctac aactagcaca acctcagctc ctacaaccag cacaacttct gcccctacaa 11581 ccagcacaac ctccactcca cagaccagca tatcctctgc ccctacaagc agcacaacct 11641 ctgctcctac agccagcaca atctctgccc ctacaaccag cacaacctct ttccatacaa 11701 ccagcacaac ctctccccct acaagcagca caagctccac tccacagacc agcaaaacct 11761 cagctgctac aagcagcaca acctccggtt ctggaactac tcccagcccc gttcccacca 11821 ccagcacagc ctctgtttca aagaccagca caagccatgt ttctgtatcc aagacaaccc 11881 actcccaacc agtcaccaga gactgtcatc cccggtgcac ctggaccag tggtttgacg 11941 tggactttcc atcccctgga ccccacggtg gggacaagga aacctacaac aacatcatca 12001 ggagtgggga aaaaatctgc cgccgacctg aggagatcac caggctccag tgccgagccg 12061 agagccaccc ggaggtgagc atcgaacacc tgggccaggt ggtgcagtgc agccgggag 12121 agggcctggt gtgccggac caggaccagc agggaccctt caagatgtgc ctcaactacg 12181 aggtgcgtgt gctctgctgc gagaccccca aaggctgccc cgtgacctcc acacctgtga 12241 cagctcctag cacccctagt gggagagcca ccagcccaac tcagagcact tcctcttggc 12301 agaaatccag gacaaccact ttggtgacaa ccagcacaac ctccactcca cagaccagca 12361 caacctctgc ccctacaacc agcacaatcc ctgcttctac acccagcaca acctctgccc 12421 ctacaaccag cacaacctct gcccctacaa ccagcacgac ctcagctcct acacacagaa 12481 cgacttctgg tcctacaacc agcacaacct tggctcctac aaccagcaca acctctgctc 12541 caacaaccag cacaaactct gctcctacaa ccagcacaat ctctgcctct acaaccagca 12601 caatctctgc ccctacaacc agcacaatct cttcccctac aagcagcaca acctccactc 12661 cacagaccag caaaacctca gctgctacaa gcagcacaac ctccggttct ggaactactc 12721 caagccctgt tcccaccacc agcacaacct ctgcctctac aaccagcaca acttctgctc 12781 ctacaaccag cacaacctct ggtcctggaa ctactccaag ccctgttccc agcaccagta 12841 caacctctgc tgctacaacc agcacaacct ctgctcctac aaccagaaca acatctgctc 12901 ctacaagcag catgacctct ggtcctggaa ctactcccag ccctgttccc accaccagca 12961 caacctctgc tcctacaact agcacaacct ctggtcctgg aactactccc agccctgttc 13021 ccaccaccag cacaacctct gctcctataa ccagcacaac ctctggtcct ggaagtactc 13081 ccagccctgt tcccaccacc agcacaacct ctgctcctac aaccagcaca acctctgcct 13141 ctacagccag cacaacctct ggtcctggaa ctactcccag ccctgttccc accaccagca 13201 caacctctgc tcctacaacc agaacaacct ctgcctctac agccagcaca acctctggtc 13261 ctggaagtac tcccagccct gttcccacca ccagcacaac ctctgctcct acaaccagaa 13321 caacccctgc ctctacagcc agcacaacct ctggtcctgg aactactccc agccctgttc 13381 ccaccacaag cacaacctct gcttctacaa ccagcacaat ctctctccct acaaccagca 13441 caacctctgc tcctataacc agcatgacct ctggtcctgg aactactccc agccctgttc 13501 ccaccaccag cacaacctct gctcctacaa ccagcacaac ctctgcctct acagccagca 13561 caacctctgg tcctggaact actcccagcc ctgttcccac caccagcaca acctctgctc 13621 ctacaaccag cacaacctct gcctctacag ccagcacaac ctctggtcct ggaacttctc 13681 tcagccctgt tcccaccacg agcacaacct ctgctcctac aactagcaca acctctggtc 13741 ctggaactac tcccagccct gttcccacca ccagcacaac ctctgctcct acaaccagca 13801 cgacctctgg tcctggaact actcccagcc ccgttcccac caccagcaca acccctgttt 13861 caaagaccag cacaagccat ctttctgtat ccaagacaac ccactcccaa ccagtcacca 13921 gtgactgtca tcctctgtgc gcctggacaa agtggttcga cgtggacttc ccatcccctg 13981 gaccccacgg cggggacaag gaaacctaca acaacatcat caggagtggg gaaaaaatct 14041 gccgccgacc tgaggagatc accaggctcc agtgccgagc cgagagccac ccggaggtga 14101 acattgaaca cctgggtcag gtggtgcagt gcagccgtga agagggcctg gtgtgccgga 14161 accaggacca gcagggaccc ttcaagatgt gcctcaacta cgaggtgcgc gtgctctgct 14221 gcgagacccc cagaggctgc ccggtgacct ctgtgacccc atatgggact tctcctacca 14281 atgctctgta tccttccctg tctacttcca tggtatccgc ctccgtggca tccacctctg 14341 tggcatccag ctctgtggca tccagctctg tggcttactc cacccaaacc tgcttctgca 14401 acgtggctga ccggctctac cctgcaggat ccaccatata ccgccacaga gacctcgctg 14461 gccattgcta ttatgccctg tgtagccagg actgccaagt ggtcagaggg gttgacagtg 14521 actgtccgtc caccacgctg cctcctgccc cagccacgtc cccttcaata tccacctccg 14581 agcccgtcac tgagctggga tgcccaaatg cggttcccc cagaaagaaa ggtgagacct 14641 gggccacacc caactgctcc gaggccacct gtgagggcaa caacgtcatc tccctgcgcc 14701 cgcgcacgtg cccgagggtg gagaagccca cttgtgccaa cggctacccg gctgtgaagg 14761 tggctgacca agatggctgc tgccatcact accagtgcca gtgtgtgtgc agcggctggg 14821 gtgaccccca ctacatcacc ttcgacggca cctactacac cttcctggac aactgcacgt 14881 acgtgctggt gcagcagatt gtgcccgtgt atggccactt ccgcgtgctc gtcgacaact 14941 acttctgcgg tgcggaggac gggctctcct gcccgaggtc catcatcctg gagtaccacc 15001 aggaccgcgt ggtgctgacc cgcaagccag tccacggggt gatgacaaac gagatcatct 15061 tcaacaacaa ggtggtcagc cccggcttcc ggaaaaacgg catcgtggtc tcgcgcatcg 15121 gcgtcaagat gtacgcgacc atcccggagc tgggagtcca ggtcatgttc tccggcctca 15181 tcttctccgt ggaggtgccc ttcagcaagt ttgccaacaa caccgagggc cagtgcggca 15241 cttgcaccaa cgacaggaag gatgagtgcc gcacgcctag ggggacggtg gtcgcttcct 15301 gctccgagat gtccggcctc tggaacgtga gcatacccga ccagccagcc tgccaccggc 15361 ctcacccgac gcccaccacg gtcgggccca ccacagttgg gtctaccacg gtcgggccca 15421 ccacagttgg gtctaccacg gtcgggccca ccacaccgcc tgctccgtgc ctgccatcac 15481 ccatctgcca gctgattctg agcaaggtct ttgagccgtg ccacactgtg atccccccac 15541 tgctgttcta tgagggctgc gtctttgacc ggtgccacat gacggacctg gatgtggtgt 15601 gctccagcct ggagctgtac gcggcactct gtgcgtccca cgacatctgc atcgattgga 15661 gaggccggac cggccacatg tgcccattca cctgcccagc cgacaaggtg taccagccct 15721 gcggcccgag caacccctcc tactgctacg ggaatgacag cgccagcctc ggggctctgc 15781 cggaggccgg ccccatcacc gaaggctgct tctgtccgga gggcatgacc ctcttcagca 15841 ccagtgccca agtctgcgtg cccacgggct gccccaggtg tctggggccc cacggagagc 15901 cggtgaaggt gggccacacc gtcggcatgg actgccagga gtgcacgtgt gaggcggcca 15961 cgtggacgct gacctgccga cccaagctct gcccgctgcc ccctgcctgc cccctgcccg 16021 gcttcgtgcc tgtgcctgca gccccacagg ccggccagtg ctgcccccag tacagctgcg 16081 cctgcaacac cagccgctgc cccgcgcccg tgggctgtcc tgagggcgcc cgcgcgatcc 16141 cgacctacca ggagggggcc tgctgcccag tccaaaactg cagctggaca gtgtgcagca 16201 tcaacgggac cctgtaccag cccggcgccg tggtctcctc gagcctgtgc gaaacctgca 16261 ggtgtgagct gccgggtggc cccccatcgg acgcgtttgt ggtcagctgt gagacccaga 16321 tctgcaacac acactgccct gtgggcttcg agtaccagga gcagagcggg cagtgctgtg 16381 gcacctgtgt gcaggtcgcc tgtgtcacca acaccagcaa gagccccgcc cacctcttct 16441 accccggcga gacctggtca gacgcaggga accactgtgt gacccaccag tgtgagaagc 16501 accaggatgg gctcgtggtg gtcaccacga agaaggcgtg ccccccgctc agctgttctc 16561 tggacgaggc ccgcatgagc aaggacggct gctgccgctt ctgcccgccg cccccgcccc 16621 cgtaccagaa ccagtcgacc tgtgctgtgt accataggag cctgatcatc cagcagcagg 16681 gctgcagctc ctcggagccc gtgcgcctgg cttactgccg ggggaactgt ggggacagct 16741 cttccatgta ctcgctcgag ggcaacacgg tggagcacag gtgccagtgc tgccaggagc 16801 tgcggacctc gctgaggaat gtgaccctgc actgcaccga cggctccagc cgggccttca 16861 gctacaccga ggtggaagag tgcggctgca tgggccggcg gtgccctgcg ccgggcgaca 16921 cccagcactc ggaggaggcg gaacccgagc ccagccagga ggcagagagt gggagctggg 16981 agagaggcgt cccagtgtcc cccatgcact gaccagcact gccgccctcc tgacctccaa 17041 ggagaacctc ccatatgtcc tctgagctcg gcttccaagg ccagtggaac ttgtgcccct 17101 gtccaggcgg ctgcagcttt gaacacactg tccacgcccg ctttcttgtg gagggtgtgg 17161 gctatgggtc acctgctgcc tggaggaggg gcccttaccc accccgcctg cagccacctc 17221 tcaggaccag ccccggggct ggccgagctc ctctggccat gcatccagcc tgctgttctg 17281 gggacgtgag catcacctga gggtctcagg aatgacgctt ggacatggtg atcagctgcc 17341 tggtggctgc aggaggaaga acctcactcc tacctcagcc ctcagcctgc gctcccctcc 17401 tcagtacacg gccaatctgt tgcataaata cacttgagca ttttgcaa

[0102] In some embodiments, a MUC5AC RNAi agent comprises an antisense strand, and position 19 (5'→3') of the antisense strand can base pair to position 1 of a 19mer target sequence disclosed in Table 1. In some embodiments, a MUC5AC agent comprises an antisense strand, and position 1 (5'→3') of the antisense strand can base pair to position 19 of a 19mer target sequence disclosed in Table 1.

[0103] In some embodiments, a MUC5AC agent comprises an antisense strand, and position 2 (5'→3') of the antisense strand can base pair with position 18 of a 19mer target sequence disclosed in Table 1. In some embodiments, a MUC5AC agent comprises an antisense strand, and positions 2-18 of the antisense strand (3'←5') can base pair with each of the respective complementary bases located at positions 18-2 of a 19mer target sequence disclosed in Table 1.

[0104] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5'->3'-end) can be fully complementary to the MUC5AC gene, or can be non-complementary to the MUC5AC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3'-end) is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3'-end) forms an A:U or U:A base pair with the sense strand.

[0105] In some embodiments, the antisense strand of the MUC5AC RNAi agent comprises 2-18 or 2-19 nucleotides (5' to 3' end) of any of the antisense strand sequences in Table 2, Table 3, or Table 11. In some embodiments, the sense strand of the MUC5AC RNAi agent comprises 1-17, 1-18, or 2-18 nucleotides (5' to 3' end) of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 7.

[0106] In some embodiments, a MUC5AC RNAi agent is comprised of (i) an antisense strand that comprises 1-18, 1-19, or 2-19 nucleotides (5' to 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand that comprises 2-19, 1-19, 1-18, or 2-18 nucleotides (5' to 3' end) of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 7.

[0107] In some embodiments, a MUC5AC RNAi agent comprises a core 19mer nucleotide sequence as shown in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13]

[0108] The sense and antisense strands of a MUC5AC RNAi agent that comprises or consists of a nucleotide sequence in Table 2 can be modified or unmodified nucleotides. In some embodiments, a MUC5AC RNAi agent having a sense and antisense strand sequence that comprises or consists of any of the nucleotide sequences in Table 2 is all or substantially all modified nucleotides.

[0109] In some embodiments, the antisense strand of a MUC5AC RNAi agent disclosed herein comprises at least 15 contiguous nucleotides that differ from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of a MUC5AC RNAi agent disclosed herein comprises at least 15 contiguous nucleotides that differ from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0110] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases, including those found in both modified and unmodified nucleotides. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleobase as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a different nucleobase than the N nucleotide at the corresponding position on the other strand.

[0111] Particular modified MUC5AC RNAi agent sense strands and antisense strands are provided in Tables 3, 4, 5, 6, 7, and 11. Particular modified MUC5AC RNAi agent antisense strands and their underlying unmodified nucleobase sequences are set forth in Table 3. Particular modified MUC5AC RNAi agent sense strands and their underlying unmodified nucleobase sequences are set forth in Tables 4, 5, and 6. In forming a MUC5AC RNAi agent, each nucleotide in each of the underlying sequences listed in Tables 3, 4, 5, 6, and 7, and Table 2, above, can be a modified nucleotide.

[0112] The MUC5AC RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, Table 6, Table 7, or Table 11 can hybridize to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 11, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides.

[0113] In some embodiments, the antisense strand of a MUC5AC RNAi agent comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0114] In some embodiments, a MUC5AC RNAi agent comprises a nucleotide sequence of any of Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, or Table 11.

[0115] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are shown in Tables 4, 5, and 6.

[0116] As used in Tables 3, 4, 5, 6, 7, and 11, the following notations are used to denote modified nucleotides, targeting groups, and linking groups: A = adenosine 3'-phosphate C=Cytidine-3'-phosphate G=guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate t=2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dT = 2'-deoxythymidine-3'-phosphate A UNA = 2',3'-seco-adenosine-3'-phosphate A UNAS = 2',3'-seco-adenosine-3'-phosphorothioate C UNA = 2',3'-seco-cytidine-3'-phosphate C UNAS = 2',3'-seco-cytidine-3'-phosphorothioate G UNA = 2',3'-seco-guanosine-3'-phosphate G UNA = 2',3'-seco-guanosine-3'-phosphorothioate U UNA = 2',3'-seco-uridine-3'-phosphate U UNAS = 2',3'-seco-uridine-3'-phosphorothioate a_2N=See Table 12 a_2Ns = See Table 12 (invAb) = inverted abasic deoxyribonucleotide-5'-phosphate, see Table 12 (invAb)s = inverted abasic deoxyribonucleotide-5'-phosphorothioate, see Table 12 s = phosphorothioate bond p = terminal phosphate (synthetic) vpdN = vinylphosphonate deoxyribonucleotide cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 12) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphorothioate (see Table 12) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 12) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphorothioate (see Table 12) (Alk-SS-C6) = See Table 12 (C6-SS-Alk) = See Table 12 (C6-SS-C6) = See Table 12 (6-SS-6) = See Table 12 (C6-SS-Alk-Me) = See Table 12 (NH2-C6) = See Table 12 (TriAlk14) = See Table 12 (TriAlk14)s = See Table 12 -C6- = See Table 12 -C6s- = See Table 12 -L6-C6-=See Table 12 -L6-C6s-=See Table 12 -Alk-cyHex- = See Table 12 -Alk-cyHexs- = See Table 12 (TA14) = See Table 12 (Structure of (TriAlk14) after binding) (TA14)s = See Table 12 (structure of (TriAlk14)s after binding)

[0117] As one of skill in the art will readily appreciate, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s"), the nucleotide monomers, when present in an oligonucleotide, are linked to one another by a 5'-3'-phosphodiester linkage. As one of skill in the art will clearly appreciate, the inclusion of a phosphorothioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides. Furthermore, one of skill in the art will readily appreciate that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at each 3' position of the given monomer in place of a phosphate moiety ex vivo. Furthermore, in the embodiments disclosed herein, when viewing each strand 5'→3', an inverted abasic residue is inserted such that the 3' position of the deoxyribose is linked at the 3' end of the preceding monomer of each strand (see, e.g., Table 12). Additionally, as one of skill in the art will readily understand and appreciate, the chemical structures of phosphorothioates shown herein typically show an anion on the sulfur atom, and the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., when the sulfur atom bears a double bond and the anion is on the oxygen atom). Unless otherwise indicated herein, such understanding of one of skill in the art will be used when describing the MUC5AC RNAi agents and compositions of MUC5AC RNAi agents disclosed herein.

[0118] Specific examples of targeting groups and linking groups for use in the MUC5AC RNAi agents disclosed herein are included in the chemical structures provided below in Table 12. Each sense and / or antisense strand disclosed herein can have any targeting group or linking group listed herein attached to the 5' and / or 3' end of the sequence, as well as other targeting groups or linking groups attached to the 5' and / or 3' end of the sequence. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] ** For the constructs in Table 4 above, a capping moiety, such as (InvAb) or s(InvAb), or a conjugate, is typically located at the 3' end of each modified sense strand sequence shown (see, for example, Table 5 below). [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 6] [Table 7]

[0119] The MUC5AC RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, Table 6, or Table 7 can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides.

[0120] As shown in Table 5 above, certain exemplary MUC5AC RNAi agent nucleotide sequences are shown to further comprise a reactive linking group at one or both of the 5' and 3' ends of the sense strand. For example, many of the MUC5AC RNAi agent sense strand sequences shown in Table 5 above have a (TriAlk14) linking group at the 5' end of the nucleotide sequence. In certain embodiments, other linking groups such as (NH2-C6) linking groups or (6-SS-6) or (C6-SS-C6) linking groups may also or instead be present. Such reactive linking groups are positioned to facilitate the linking of targeting ligands, targeting groups, and / or PK / PD modulators to the MUC5AC RNAi agents disclosed herein. Ligation or conjugation reactions are well known in the art and result in the formation of a covalent bond between two molecules or reactants. Conjugation reactions suitable for use within the scope of the present invention include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, reverse solicited Diels-Alder cycloaddition reactions, oxime ligation, and copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.

[0121] In some embodiments, targeting ligands, such as the integrin targeting ligands shown in the Examples and Figures disclosed herein, can be synthesized as activated esters, such as tetrafluorophenyl (TFP) esters, which can be substituted with a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to a MUC5AC RNAi agent disclosed herein. In some embodiments, the targeting ligands are synthesized as azides, which can be attached to a propargyl (e.g., TriAlk14) or DBCO group, for example, via copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.

[0122] Additionally, the nucleotide sequence can be synthesized with a dT nucleotide at the 3' end of the sense strand followed by a (3'→5') linker (such as C6-SS-C6). In some embodiments, the linker can facilitate attachment to additional moieties, such as a PK / PD modulator or one or more targeting ligands. The disulfide bond of C6-SS-C6 can then be reduced to remove the dT from the molecule, which can then facilitate attachment of the desired PK / PD modulator. Thus, the terminal dT nucleotide is not part of the fully conjugated construct.

[0123] In some embodiments, the antisense strand of a MUC5AC RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 3 or Table 11 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of a MUC5AC RNAi agent disclosed herein differs from any of the sense strand sequences in Table 4, Table 5, Table 6, Table 7, or Table 11 by 0, 1, 2, or 3 nucleotides.

[0124] In some embodiments, the antisense strand of a MUC5AC RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the antisense strand of a MUC5AC RNAi agent comprises the nucleotide sequence of 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 (5' to 3' end) of any of the sequences in Table 2, Table 3, or Table 11. In certain embodiments, the antisense strand of a MUC5AC RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 3 or Table 11.

[0125] In some embodiments, the sense strand of a MUC5AC RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the sense strand of a MUC5AC RNAi agent comprises the nucleotide sequence of 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2, Table 4, Table 5, Table 6, Table 7, or Table 11 (5' to 3' end). In certain embodiments, the sense strand of a MUC5AC RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 3 or Table 11.

[0126] In the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5' to 3' end) can be fully complementary to the MUC5AC gene or can be non-complementary to the MUC5AC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3' end) is U, A, or dT (or modified forms of U, A, or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3' end) forms an A:U or U:A base pair with the sense strand.

[0127] In some embodiments, the antisense strand of the MUC5AC RNAi agent comprises 2-18 or 2-19 nucleotides (5' to 3' end) of any of the antisense strand sequences in Table 2, Table 3, or Table 11. In some embodiments, the sense strand of the MUC5AC RNAi agent comprises 1-17 or 1-18 nucleotides (5' to 3' end) of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, Table 7, or Table 11.

[0128] In some embodiments, a MUC5AC RNAi agent comprises (i) an antisense strand comprising a sequence of 2 to 18 or 2 to 19 nucleotides (5' to 3' end) of any of the antisense strand sequences in Table 2, Table 3, or Table 11, and (ii) a sense strand sequence comprising a sequence of 1 to 17 or 1 to 18 nucleotides (5' to 3' end) of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, Table 7, or Table 11.

[0129] A sense strand comprising a sequence listed in Table 2 or Table 4 can hybridize to any antisense strand comprising a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides. In some embodiments, a MUC5AC RNAi agent has a sense strand consisting of any of the modified sequences in Table 4, Table 5, Table 6, Table 7, or Table 11, and an antisense strand consisting of any of the modified sequences in Table 3 or Table 11. Certain representative sequence pairs are exemplified by the duplex ID numbers shown in Tables 8A, 8B, 8C, 9, 10A, and 10B.

[0130] In some embodiments, the MUC5AC RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID numbers presented herein. In some embodiments, the MUC5AC RNAi agent consists of any of the duplex ID numbers presented herein. In some embodiments, the MUC5AC RNAi agent comprises the sense strand and antisense strand nucleotide sequence of any of the duplex ID numbers presented herein. In some embodiments, the MUC5AC RNAi agent comprises the sense strand and antisense strand nucleotide sequence of any of the duplex ID numbers presented herein and a targeting group, linking group, and / or other non-nucleotide group, which is covalently attached (i.e., conjugated) to the sense strand or antisense strand. In some embodiments, the MUC5AC RNAi agent comprises the sense strand and antisense strand modified nucleotide sequence of any of the duplex ID numbers presented herein. In some embodiments, a MUC5AC RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any of the duplex ID numbers presented herein and a targeting group, linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently attached to the sense strand or the antisense strand.

[0131] In some embodiments, a MUC5AC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 8A, Table 8B, Table 8C, Table 9, Table 10A, Table 10B, or Table 11, and comprises a targeting group. In some embodiments, a MUC5AC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 8A, Table 8B, Table 8C, Table 9, Table 10A, Table 10B, or Table 11, and comprises one or more αvβ6 integrin targeting ligands.

[0132] In some embodiments, a MUC5AC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 8A, Table 8B, Table 8C, Table 9, Table 10A, Table 10B, or Table 11, and comprises a targeting group that is an integrin targeting ligand. In some embodiments, a MUC5AC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 8A, Table 8B, Table 8C, Table 9, Table 10A, Table 10B, or Table 11, and comprises one or more αvβ6 integrin targeting ligands or a group of αvβ6 integrin targeting ligands (e.g., tridentate αvβ6 integrin targeting ligands).

[0133] In some embodiments, a MUC5AC RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Tables 8A, 8B, 8C, 9, 10A, 10B, and 11.

[0134] In some embodiments, a MUC5AC RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 8A, Table 8B, Table 8C, Table 9, Table 10A, Table 10B, and Table 11, and comprises an integrin targeting ligand.

[0135] In some embodiments, a MUC5AC RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Table 8A, Table 8B, Table 8C, Table 9, Table 10A, Table 10B, and Table 11.

[0136] [Table 8-1] [Table 8-2] [Table 8-3]

Table 8-4

[0137]

Table 9-1

Table 9-2

Table 9-3

Table 9-4

[0138]

Table 10-1

Table 10-2

[0139]

Table 11-1

Table 11-2

[0140]

Table 12-1

Table 12-2

[0141]

Table 13-1

Table 13-2

[0142] [Table 14-1] [Table 14-2] [Table 14-3] [Table 14-4]

[0143] In some embodiments, the MUC5AC RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the MUC5AC RNAi agent is prepared or provided as a pharma- ceutically acceptable salt. In some embodiments, the MUC5AC RNAi agent is prepared or provided as a pharma- ceutically acceptable sodium or potassium salt. The RNAi agents described herein inhibit or knock down expression of one or more MUC5AC genes in vivo and / or in vitro when delivered to a cell expressing the MUC5AC gene.

[0144] Targeting Groups, Linking Groups, Pharmacokinetic / Pharmacodynamic (PK / PD) Modulators, and Delivery Vehicles In some embodiments, the MUC5AC RNAi agent comprises or is attached to one or more non-nucleotide groups, including but not limited to a targeting group, a linking group, a pharmacokinetic / pharmacodynamic (PK / PD) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or binding of the RNAi agent. The non-nucleotide group can be covalently attached to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the MUC5AC RNAi agent comprises a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the MUC5AC RNAi agent. The non-nucleotide group can be linked to the RNAi agent directly or indirectly via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0145] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or the conjugate to which it is attached, improving cell- or tissue-specific distribution and cell-specific uptake of the conjugate, hi some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0146] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugates or the RNAi agents to which they are attached, improving the cell-specific (including organ-specific in some cases) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi agents. Targeting groups can be monovalent, bivalent, trivalent, tetravalent, or have higher valency with respect to the target to which it is directed. Exemplary targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics with affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker, or one, two, or three abasic and / or ribitol (abasic ribose) residues, which in some cases can function as linkers.

[0147] A targeting group, with or without a linker, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, and Table 11. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, and Table 11.

[0148] The MUC5AC RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends, which can then be used to attach targeting moieties using methods typical in the art.

[0149] For example, in some embodiments, the MUC5AC RNAi agent disclosed herein can be synthesized with an NH2-C6 group at the 5' end of the sense strand of the RNAi agent. The terminal amino group can then be reacted to form a conjugate with a group that includes, for example, an αvβ6 integrin targeting ligand. In some embodiments, the MUC5AC RNAi agent disclosed herein can be synthesized with one or more alkyne groups at the 5' end of the sense strand of the RNAi agent. The terminal alkyne group can then be reacted to form a conjugate with a group that includes, for example, an αvβ6 integrin targeting ligand.

[0150] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of an αvβ6 integrin targeting ligand facilitates cell-specific targeting to cells that have αvβ6 on their surface, and the binding of the integrin targeting ligand can facilitate the entry of a therapeutic agent, such as an RNAi agent, to which it is attached, into cells, such as epithelial cells, including lung epithelial cells and renal epithelial cells. The integrin targeting ligand can be monomeric or monovalent (e.g., with a single integrin targeting moiety) or multimeric or multivalent (e.g., with multiple integrin targeting moieties). The targeting group can be attached to the 3'-end and / or 5'-end of the RNAi oligonucleotide using methods known in the art. The preparation of targeting groups, such as αvβ6 integrin targeting ligands, is described, for example, in International Patent Application Publication No. WO2018 / 085415 and International Patent Application Publication No. WO2019 / 089765, the contents of each of which are incorporated herein in their entirety.

[0151] In some embodiments, targeting group is linked to MUC5AC RNAi agent without using additional linker. In some embodiments, targeting group is designed to have linker that is easily presented to facilitate linking to MUC5AC RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, two or more RNAi agents can be linked to each targeting group using the same linker. In some embodiments, when two or more RNAi agents are included in the composition, two or more RNAi agents are linked to each targeting group using different linkers.

[0152] In some embodiments, a linking group is attached to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be attached to the 3'-end and / or 5'-end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the sense strand of the RNAi agent. In some embodiments, the linking group is attached to the 5'-end or 3'-end of the RNAi agent sense strand. In some embodiments, the linking group is attached to the 5'-end of the RNAi agent sense strand. Examples of linking groups include, but are not limited to, C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6), as well as alkynes, alkyl groups, abasic residues / nucleotides, amino acids, trialkyne functionalized groups, ribitol, and / or PEG groups. Examples of specific linking groups are shown in Table 12.

[0153] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group, a pharmacokinetic modulator, or a delivery polymer) or segment of interest through one or more covalent bonds. Labile linkages include labile bonds. Linkages can optionally include a spacer that increases the distance between the two attached atoms. Spacers can add additional flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which can include one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the above list is not meant to limit the scope of the description. In some embodiments, the MUC5AC RNAi agent is linked to a polyethylene glycol (PEG) moiety or a hydrophobic group having 12 or more carbon atoms, such as a cholesterol or palmitoyl group.

[0154] In some embodiments, the MUC5AC RNAi agent is linked to one or more pharmacokinetic / pharmacodynamic (PK / PD) modulators. The PK / PD modulators can increase the circulation time of the attached drug and / or increase the activity of the RNAi agent by improving cell receptor binding, improving cellular uptake, and / or other means. A variety of PK / PD modulators suitable for use with RNAi agents are known in the art. In some embodiments, the PK / PD modulator can be a cholesterol or cholesteryl derivative, or in some circumstances, the PK / PD modulator can be comprised of an alkyl group, an alkenyl group, an alkynyl group, an aryl group, an aralkyl group, an aralkenyl group, or an aralkynyl group, each of which may be linear, branched, cyclic, and / or substituted or unsubstituted. In some embodiments, the attachment position of these moieties is at the 5' or 3' end of the sense strand, at the 2' position of the ribose ring of any given nucleotide of the sense strand, and / or attached to a phosphate or phosphorothioate backbone at any position in the sense strand.

[0155] Any of the nucleotide sequences of a MUC5AC RNAi agent listed in Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, and Table 11, whether modified or unmodified, can include a 3' and / or 5' targeting group, linking group, and / or PK / PD modulator. Alternatively, any of the nucleotide sequences of a MUC5AC RNAi agent listed in Table 3, Table 4, Table 5, Table 6, Table 7, and Table 11 or described elsewhere herein that include a 3' or 5' targeting group, linking group, and / or PK / PD modulator can include no 3' or 5' targeting group, linking group, or PK / PD modulator, or can include a different 3' or 5' targeting group, linking group, or pharmacokinetic modulator, including those listed in Table 12. Any of the MUC5AC RNAi agent duplexes listed in Tables 8A, 8B, 8C, 9, 10A, 10B, and 11, whether modified or unmodified, can further include a targeting group or linking group, including but not limited to those shown in Table 11, which can be attached to the 3' or 5' end of either the sense or antisense strand of the MUC5AC RNAi agent duplex.

[0156] Examples of specific modified nucleotides, capping moieties, and linking groups are provided in Table 12. [Table 15-1] [ka] indicates a connection point. [Table 15-2] [Table 15-3] [Table 15-4] [Table 15-5]

[0157] Alternatively, other linking groups known in the art may be used. In many cases, linking groups are commercially available or are incorporated into commercially available nucleotide phosphoramidites (see, for example, International Patent Application Publication No. WO2019 / 161213, which is incorporated herein by reference in its entirety).

[0158] In some embodiments, a MUC5AC RNAi agent is delivered without being linked to a targeting ligand or a pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as "naked" or "naked RNAi agent").

[0159] In some embodiments, the MUC5AC RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate in vivo delivery of the MUC5AC RNAi agent to a selected cell or tissue, e.g., an epithelial cell in an organism. In some embodiments, the MUC5AC RNAi agent is conjugated to a targeting group that includes an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. In some embodiments, the targeting group includes one or more αvβ6 integrin targeting ligands.

[0160] In some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves the delivery of an RNAi agent to a cell or tissue. A delivery vehicle can include or consist of, but is not limited to, a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

[0161] In some embodiments, the RNAi agent can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art for nucleic acid delivery. The RNAi agent can also be chemically bound to targeting groups, lipids (including but not limited to cholesteryl and cholesteryl derivatives), encapsulated in nanoparticles, liposomes, micelles, bound to polymers or DPCs, by iontophoresis, or by incorporation into other delivery vehicles or systems available in the art, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or protein vectors (see, for example, WO2000 / 053722, WO2008 / 022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, each of which is incorporated herein by reference). In some embodiments, the RNAi agent can be conjugated to an antibody that has affinity for pulmonary epithelial cells. In some embodiments, the RNAi agent can be linked to a targeting ligand that has affinity for pulmonary epithelial cells or a receptor present on pulmonary epithelial cells.

[0162] Pharmaceutical Compositions and Formulations The MUC5AC RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medicaments"). In some embodiments, the pharmaceutical compositions comprise at least one MUC5AC RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting expression of MUC5AC mRNA in a target cell, cell group, tissue, or organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from a reduction in the level of the target mRNA or an inhibition of expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from a reduction in the level of the target mRNA or an inhibition of expression of the target gene. In one embodiment, the method comprises administering to the subject to be treated a MUC5AC RNAi agent linked to a targeting ligand as described herein. In some embodiments, one or more pharma- ceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition comprising the MUC5AC RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0163] Pharmaceutical compositions comprising MUC5AC RNAi agents and methods disclosed herein include administering to a subject a therapeutically effective amount of a MUC5AC RNAi agent described herein, thereby inhibiting expression of MUC5AC mRNA in the subject, thereby reducing the level of target mRNA in a cell, a group of cells, a group of cells, a tissue, an organ, or a subject. In some embodiments, the subject has previously been identified or diagnosed as having a disease or disorder that may be at least partially mediated by decreased MUC5AC expression. In some embodiments, the subject has previously been diagnosed as having one or more mucosal obstructive pulmonary diseases, such as asthma, CF, COPD, NCFB, PCD, etc. In some embodiments, the mucosal obstructive pulmonary disease is severe asthma.

[0164] In some embodiments, the subject has previously been diagnosed with interstitial pneumonia, cancer (such as lung adenocarcinoma, pancreatic cancer, salivary gland cancer, breast cancer, bile duct cancer, ovarian cancer, and other tumors), respiratory infection (such as respiratory syncytial virus, influenza, and rhinovirus), otitis media, inflammatory bowel disease, cholelithiasis, allergic rhinitis, chronic sinusitis, or nasal polyposis.

[0165] The present disclosure also includes pharmaceutical compositions for delivering MUC5AC RNAi agents to lung epithelial cells in vivo.Such pharmaceutical compositions can include, for example, MUC5AC RNAi agents bound to targeting groups that include integrin targeting ligands.In some embodiments, integrin targeting ligands are comprised of αvβ6 integrin ligands.

[0166] In some embodiments, the described pharmaceutical compositions comprising a MUC5AC RNAi agent are used to treat or manage a clinical condition in a subject that would benefit from inhibition of expression of MUC5AC. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed MUC5AC RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0167] In some embodiments, the described MUC5AC RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent can be another MUC5AC RNAi agent (e.g., a MUC5AC RNAi agent that targets a different sequence within the MUC5AC gene). In some embodiments, the second therapeutic agent can be an RNAi agent that targets the MUC5AC gene. The additional therapeutic agent can also be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. The MUC5AC RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.

[0168] The described pharmaceutical compositions comprising a MUC5AC RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduced or inhibited expression of MUC5AC mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising a MUC5AC RNAi agent to thereby treat the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more MUC5AC RNAi agents to thereby prevent or inhibit at least one symptom.

[0169] In some embodiments, one or more of the described MUC5AC RNAi agents are administered to a mammal in a pharma- ceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0170] The route of administration is the route by which the MUC5AC RNAi agent comes into contact with the body. In general, methods of administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The MUC5AC RNAi agent disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, in some embodiments, the pharmaceutical composition described herein is administered by inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the pharmaceutical composition can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, intraocularly, or intraperitoneally, or topically.

[0171] Pharmaceutical compositions comprising the MUC5AC RNAi agents described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery techniques known in the art. In general, any suitable art-recognized method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or parenteral routes including subcutaneous, intravenous, intraperitoneal, or intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered by inhalation, intranasal administration, oropharyngeal aspiration, or intratracheal administration. For example, in some embodiments, it is desired that the MUC5AC RNAi agents described herein inhibit expression of the MUC5AC gene in pulmonary epithelium, for which purpose administration by inhalation (e.g., by an inhalation device such as a metered dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) is particularly suitable and advantageous.

[0172] In some embodiments, the pharmaceutical compositions described herein include one or more pharma- ceutical acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0173] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharma- ceutically acceptable excipients. A pharma-ceutically acceptable excipient (excipient) is a substance other than an active pharmaceutical ingredient (API, therapeutic product, e.g., MUC5AC RNAi agent) that is intentionally included in a drug delivery system. An excipient does not exert a therapeutic effect at the intended dose, or is not intended to exert a therapeutic effect. An excipient can function to a) aid in the processing of the drug delivery system during manufacture, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) aid in product identification, and / or d) enhance any characteristic of the overall safety, efficacy of the API delivery during storage or use. A pharma-ceutically acceptable excipient may or may not be an inert substance.

[0174] Excipients include, but are not limited to, absorption enhancers, anti-adherents, antifoaming agents, antioxidants, linking agents, buffers, carriers, coating agents, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water repellents, and wetting agents.

[0175] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium, including water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0176] Sterile injectable solution can be prepared by incorporating the active compound in the required amount in a suitable solvent with one or a combination of the above-listed components as required, followed by filtration sterilization.Generally, dispersion is prepared by incorporating the active compound in a sterile vehicle that contains a basic dispersion medium and the other components listed above.For the preparation of sterile powder for preparing sterile injectable solution, the preparation method includes vacuum drying and freeze-drying, which produces a powder of active ingredient and any additional desired ingredient from the solution that has been previously sterile-filtered.

[0177] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to administer the drug for both intra-articular and ophthalmic administration.

[0178] The formulation suitable for inhalation administration can be prepared by incorporating the desired amount of active compound into a suitable solvent, followed by sterile filtration.In general, the formulation for inhalation administration is a sterile solution at physiological pH and has low viscosity (<5cP).Salts may be added to the formulation to balance tonicity.In some cases, surfactants or co-solvents can be added to increase the solubility of the active compound and improve aerosol properties.In some cases, excipients can be added to control viscosity to ensure the size and distribution of nebulized droplets.

[0179] In some embodiments, pharmaceutical formulations comprising a MUC5AC RNAi agent disclosed herein suitable for inhaled administration can be prepared in water for injection (sterile water), isotonic saline (0.9% saline), or aqueous sodium phosphate buffer (e.g., a MUC5A CRNAi agent formulated in 0.5 mM sodium phosphate monobasic, 0.5 mM sodium phosphate disodium in water).

[0180] The active compound can be prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.The method of preparing such formulations will be clear to those skilled in the art.Liposomal suspensions can also be used as pharma-ceutically acceptable carriers.These can be prepared according to the method known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0181] MUC5AC RNAi agent can be formulated in a dosage unit form in the composition for ease of administration and uniformity of dosage.Dosage unit form refers to a physically separate unit suitable as a unitary dosage for a subject to be treated, each unit containing a predetermined amount of active compound calculated to produce a desired therapeutic effect in association with a required pharmaceutical carrier.The specification of the dosage unit form of the present disclosure is determined by and directly depends on the inherent characteristics of the active compound and the therapeutic effect to be achieved, as well as the limitations inherent in the technical field of compounding such active compound for the treatment of individuals.

[0182] The pharmaceutical composition may contain other additional components that are commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). It is contemplated that cells, tissues, or isolated organs that express or contain the RNAi agent defined herein may be used as a "pharmaceutical composition". As used herein, "pharmacologically effective amount", "therapeutically effective amount", or simply "effective amount" refers to the amount of RNAi agent to produce a pharmacological, therapeutic, or preventive result.

[0183] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another MUC5AC RNAi agent (e.g., a MUC5AC RNAi agent that targets a different sequence within the MUC5AC target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0184] In some embodiments, compositions are described herein that include a combination or cocktail of at least two MUC5AC RNAi agents with different sequences. In some embodiments, two or more MUC5AC RNAi agents are each separately and independently linked to a targeting group. In some embodiments, two or more MUC5AC RNAi agents are each linked to a targeting group that includes or consists of an integrin targeting ligand. In some embodiments, two or more MUC5AC RNAi agents are each linked to a targeting group that includes or consists of an αvβ6 integrin targeting ligand.

[0185] Described herein are compositions for delivering MUC5AC RNAi agents to lung epithelial cells.Furthermore, described herein generally are compositions for delivering MUC5AC RNAi agents in vivo to cells, including renal epithelial cells and / or GI or genital tract epithelial cells and / or ocular surface epithelial cells.

[0186] In general, an effective amount of a MUC5AC RNAi agent disclosed herein is within the range of a pulmonary deposition dose of about 0.0001 to about 20 mg per kg of body weight, for example, within the range of a pulmonary deposition dose of about 0.001 to about 5 mg per kg of body weight. In some embodiments, an effective amount of a MUC5AC RNAi agent is within the range of a pulmonary deposition dose of about 0.01 mg to about 3.0 mg per kg of body weight. In some embodiments, an effective amount of a MUC5AC RNAi agent is within the range of a pulmonary deposition dose of about 0.03 mg to about 2.0 mg per kg of body weight. In some embodiments, an effective amount of a MUC5AC RNAi agent is within the range of a pulmonary deposition dose of about 0.01 to about 1.0 mg per kg of body weight. In some embodiments, an effective amount of a MUC5AC RNAi agent is within the range of a pulmonary deposition dose of about 0.25 to about 1.0 mg per kg of body weight. In some embodiments, the effective amount of the MUC5AC RNAi agent is within the range of about 0.25 mg / kg body weight of lung deposited dose. In some embodiments, the effective amount of the MUC5AC RNAi agent is within the range of about 0.50 mg / kg body weight of lung deposited dose. In some embodiments, the effective amount of the MUC5AC RNAi agent is within the range of about 1.0 mg / kg body weight of lung deposited dose. Calculation of lung deposited dose (PDD) is performed according to methods known in the art (see Wolff RK, Dorato MA, Toxicologic Testing of Inhaled Pharmaceutical Aerosols, Crit Rev Toxicol., 1993; 23(4):343-369; Tepper et al., International J. Toxicology, 2016, vol. 35(4):376-392). An equivalent and alternatively acceptable dose calculation method well known in the art, particularly for human subjects, is to determine the respirable delivered dose (RDD). RDD refers to the amount of drug contained in droplets of a suitable size for penetration into the lungs. In general, effective amounts of MUC5AC RNAi agents disclosed herein are in the range of about 0.001 to about 5 mg respirable delivered dose (RDD) per kg of body weight.

[0187] For clinical applications, the amount of MUC5AC RNAi agent that needs to be loaded into a selected delivery device (such as a nebulizer) to produce such an RDD in a human subject depends on the delivery device used (see, e.g., Hatley RHM, Byrne SM, Variability in delivered dose and respirable delivered dose from nebulizers: are current regulatory testing guidelines sufficient to produce meaningful information?, Med Devices, 2017, 10:17-28). For some less efficient nebulizers, for example, the RDD is about 15%-25% of the dose loaded into the nebulizer. For other more efficient devices, for example, the RDD is about 50%, about 60%, or even more than 60% of the dose loaded into the nebulizer. In some embodiments, a fixed dose of, for example, about 5 mg, about 10 μm, about 20 mg, about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 250 mg, or about 300 mg of MUC5AC RNAi agent can be loaded into each selected device, resulting in an RDD of about 0.001 to about 5 mg / kg body weight per dose. The amount desired or required to be administered will also depend on variables such as the patient's overall health, the relative bioavailability of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. It should also be understood that the initial dose administered can be increased beyond the upper levels listed above to rapidly achieve the desired blood or tissue levels, or the initial dose may be less than optimal. In various embodiments, the dose may be administered daily, weekly, biweekly, every three weeks, monthly, quarterly (i.e., once every three months), or once every six months. In various embodiments, doses may be administered at other intervals falling within the ranges provided above.

[0188] For the treatment of a disease or to form a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein comprising a MUC5AC RNAi agent can be combined with an excipient or a second therapeutic agent or treatment, including, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer.

[0189] The described MUC5AC RNAi agents, when added to pharma- ceutically acceptable excipients or auxiliaries, can be packaged in kits, containers, packs, or dispensers. The pharmaceutical compositions described herein can be packaged in dry powder or aerosol inhalers, other metered dose inhalers, nebulizers, pre-filled syringes, or vials.

[0190] Methods of Treatment and Inhibition of MUC5AC Expression The MUC5AC RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from reduced and / or inhibited expression of MUC5AC mRNA and / or reduced levels of MUC5AC receptor.

[0191] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having a disease or disorder that would benefit from a reduction in MUC5AC receptors, including, but not limited to, mucosal obstructive pulmonary disease (such as asthma, CF, COPD, NCFB, PCD, etc.), allergic bronchopulmonary aspergillosis, interstitial lung disease, cancer (such as lung adenocarcinoma, pancreatic cancer, salivary gland cancer, breast cancer, cholangiocarcinoma, ovarian cancer, and other tumors), respiratory infections (such as respiratory syncytial virus, influenza, rhinovirus, etc.), otitis media, inflammatory bowel disease, cholelithiasis, allergic rhinitis, chronic sinusitis, and nasal polyposis. In some embodiments, the pulmonary disease is severe asthma. Treating a subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more MUC5AC RNAi agents described herein. The subject can be a human, a patient, or a human patient. The subject can be an adult, an adolescent, a child, or an infant. Administration of the pharmaceutical compositions described herein can be to humans or animals.

[0192] Increased membrane MUC5AC activity is known to promote mucosal obstruction tissue. In some embodiments, the described MUC5AC RNAi agents are used to treat at least one symptom in a subject that is at least partially mediated by reduced MUC5AC levels. The subject is administered a therapeutically effective amount of any one or more of the described MUC5AC RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting at least one symptom.

[0193] In certain embodiments, the disclosure provides methods for treating a disease, disorder, condition, or pathological condition mediated at least in part by MUC5AC gene expression in a patient in need of treatment, comprising administering to the patient any of the MUC5AC RNAi agents described herein.

[0194] In some embodiments, the MUC5AC RNAi agent is used to treat or manage a clinical condition or pathological condition in a subject, the clinical condition or pathological condition being at least partially mediated by a decrease in MUC5AC expression. The subject is administered a therapeutically effective amount of one or more of the MUC5AC RNAi agents or MUC5AC RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising a MUC5AC RNAi agent described herein to the subject to be treated.

[0195] In a further aspect, the disclosure features a method for treating (including prophylactic or preventative treatment) a disease or condition that can be addressed by reducing MUC5AC receptor levels, comprising administering to a subject in need thereof a MUC5AC RNAi agent that includes an antisense strand that includes a sequence of any of Table 2, Table 3, or Table 11. Compositions for use in such methods are also described herein.

[0196] The described MUC5AC RNAi agents and / or compositions comprising the MUC5AC RNAi agents can be used in methods for the therapeutic treatment of diseases or conditions caused by enhanced or elevated MUC5AC protein or MUC5AC gene expression. Such methods include administering a MUC5AC RNAi agent described herein to a subject, e.g., a human or animal subject.

[0197] In another aspect, the disclosure provides a method for treating (including prophylactic treatment) a pathological condition (such as a symptom or disease) mediated at least in part by MUC5AC expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2, Table 3, or Table 11.

[0198] In some embodiments, disclosed herein are methods for inhibiting expression of the MUC5AC gene, comprising administering to a cell an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2, Table 3, or Table 11.

[0199] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) a pathological condition mediated at least in part by MUC5AC expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 2, Table 4, Table 5, Table 6, Table 7, or Table 11.

[0200] In some embodiments, disclosed herein are methods for inhibiting expression of the MUC5AC gene, comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 2, Table 4, Table 5, Table 6, Table 7, or Table 11.

[0201] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) a pathological condition mediated at least in part by MUC5AC expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 4, Table 5, Table 6, Table 7, or Table 11, and an antisense strand comprising any of the sequences in Table 3 or Table 11.

[0202] In some embodiments, disclosed herein are methods for inhibiting expression of the MUC5AC gene, comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 4, Table 5, Table 6, Table 7, or Table 11, and an antisense strand comprising any of the sequences in Table 3 or Table 11.

[0203] In some embodiments, disclosed herein are methods of inhibiting expression of the MUC5AC gene, comprising administering to a subject a MUC5AC RNAi agent comprising a sense strand consisting of a nucleobase sequence of any of the sequences in Table 4, Table 5, Table 6, Table 7, or Table 11, and an antisense strand consisting of a nucleobase sequence of any of the sequences in Table 3 or Table 11. In other embodiments, disclosed herein are methods of inhibiting expression of the MUC5AC gene, comprising administering to a subject a MUC5AC RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, Table 7, or Table 11, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3 or Table 11.

[0204] In some embodiments, disclosed herein are methods for inhibiting expression of the MUC5AC gene in a cell, the method comprising administering one or more MUC5AC RNAi agents comprising one of the duplex structures shown in Tables 8A, 8B, 8C, 9, 10A, 10B, and 11.

[0205] In some embodiments, the amount or quantity of MUC5AC protein and / or MUC5AC mRNA in certain lung epithelial cells of a subject to which a described MUC5AC RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% compared to the subject before the MUC5AC RNAi agent is administered or a subject not receiving the MUC5AC RNAi agent. In some embodiments, MUC5AC protein levels in certain epithelial cells of a subject to which a described MUC5AC RNAi agent is administered are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% compared to the subject prior to administration of the MUC5AC RNAi agent or a subject not receiving the MUC5AC RNAi agent. Gene expression levels, protein levels, and / or mRNA levels in a subject may be reduced in cells, cell populations, and / or tissues of the subject. In some embodiments, MUC5AC mRNA levels in certain epithelial cells in a subject administered a described MUC5AC RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before the MUC5AC RNAi agent was administered or compared to a subject not receiving the MUC5AC RNAi agent.

[0206] The reduction of MUC5AC mRNA and MUC5AC protein levels can be assessed by any method known in the art. Reduction or reduction of MUC5AC mRNA and / or MUC5AC protein levels are collectively referred to herein as reduction, reduction, or inhibition of MUC5AC gene expression. The examples provided herein illustrate known methods for assessing inhibition of MUC5AC.

[0207] Cells, tissues, organs, and non-human organisms Contemplated are cells, tissues, organs, and non-human organisms that contain at least one of the MUC5AC RNAi agents described herein. The cells, tissues, organs, or non-human organisms are produced by delivering the RNAi agent to the cells, tissues, organs, or non-human organisms.

[0208] Additional Exemplary Embodiments Certain additional exemplary embodiments of the disclosed technology are provided herein, which are merely illustrative and do not limit the scope of the disclosure or the claims appended hereto.

[0209] Embodiment 1. An RNAi agent for inhibiting expression of the mucin 5AC gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides that differ from any one of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; and a sense strand comprising a nucleotide sequence at least partially complementary to the antisense strand; 2. An RNAi agent comprising:

[0210] Embodiment 2. The RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.

[0211] Embodiment 3. The RNAi agent of embodiment 1 or 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region having at least 85% complementarity with the antisense strand over the 17 contiguous nucleotides.

[0212] Embodiment 4. The RNAi agent of any one of embodiments 1 to 3, wherein at least one nucleotide of said RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

[0213] Embodiment 5. The RNAi agent of any one of embodiments 1 to 4, wherein all or substantially all of the nucleotides are modified nucleotides.

[0214] Embodiment 6. The RNAi agent of embodiment 4 or 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

[0215] Embodiment 7. The RNAi agent of embodiment 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

[0216] Embodiment 8. The RNAi agent of any one of embodiments 1 to 7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 3 or Table 11.

[0217] Embodiment 9. The RNAi agent of any one of embodiments 1 to 8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sense strand sequences provided in Table 4 or Table 11.

[0218] Embodiment 10. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 3 or Table 11, and the sense strand comprises the nucleotide sequence of any one of the modified sense strand sequences provided in Table 4 or Table 11.

[0219] Embodiment 11. The RNAi agent according to any one of embodiments 1 to 10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

[0220] Embodiment 12. The RNAi agent of embodiment 11, wherein the sense strand and the antisense strand are 18 nucleotides and 27 nucleotides in length, respectively.

[0221] Embodiment 13 The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are 18 nucleotides and 24 nucleotides in length, respectively.

[0222] Embodiment 14 The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

[0223] Embodiment 15 The RNAi agent of embodiment 14, wherein the RNAi agent has two blunt ends.

[0224] Embodiment 16. The RNAi agent of any one of embodiments 1 to 15, wherein the sense strand comprises one or two terminal caps.

[0225] Embodiment 17. The RNAi agent of any one of embodiments 1 to 16, wherein the sense strand comprises one or two inverted abasic residues.

[0226] Embodiment 18. The RNAi agent of embodiment 1, wherein the RNAi agent consists of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 8A, Table 8B, Table 8C, Table 9, Table 10A, or Table 10B.

[0227] Embodiment 19. The RNAi agent of embodiment 18, wherein all or substantially all of the nucleotides are modified nucleotides.

[0228] Embodiment 20. The antisense strand has the following nucleotide sequence (5'→3'): UUGUAGUAGUCGCAGAACA (SEQ ID NO:79); or UUCUUGUUCAGGCAAAUCA (SEQ ID NO: 83) The RNAi agent of embodiment 1, which consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of:

[0229] Embodiment 21. The antisense strand has the following nucleotide sequence (5'→3'): UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525); or UUCUUGUUCAGGCAAAUCAGC (sequence number 1535) The RNAi agent of embodiment 1, which consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of:

[0230] Embodiment 22. The sense strand has the following nucleotide sequence (5'→3'): UGUUCUGCGACUACUACAA (SEQ ID NO:568); or UGAUUUGCCUGAACAAGAA (SEQ ID NO:572) The RNAi agent of embodiment 1, which consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of:

[0231] Embodiment 23 The RNAi agent of embodiment 20, 21, or 22, wherein all or substantially all of the nucleotides are modified nucleotides.

[0232] Embodiment 24. The antisense strand has the following nucleotide sequence (5' to 3'): cPrpusUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1127); usUfsgsUfaGfuAfgUfcGfcAfgAfaCfaGfsc (SEQ ID NO: 1065); usUfscsuuguucagGfcAfaAfucagsc (SEQ ID NO: 1166); or cPrpuUfcuuguucagGfcAfaAfucagsc (SEQ ID NO: 1191); or consisting essentially of a modified nucleotide sequence which differs by 0 or 1 nucleotide from any one of 2'-O-methyluridine; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage; and all or substantially all of the nucleotides on the sense strand are modified nucleotides.

[0233] Embodiment 25. The sense strand has the following nucleotide sequence (5'→3'): gscuguucuGfCfGfacuacuacaa (SEQ ID NO: 1265); or gscugauUfuGfcCfugaacaagaa (SEQ ID NO: 1315); or consisting essentially of a modified nucleotide sequence which differs by 0 or 1 nucleotide from any one of 2. The RNAi agent of embodiment 1, wherein a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; and s represents a phosphorothioate linkage; and all or substantially all of the nucleotides on the antisense strand are modified nucleotides.

[0234] Embodiment 26 The RNAi agent of any one of embodiments 20 to 25, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both.

[0235] Embodiment 27 The RNAi agent of any one of embodiments 1 to 26, wherein the RNAi agent is linked to a targeting ligand.

[0236] Embodiment 28 The RNAi agent of embodiment 27, wherein the targeting ligand has affinity for a cellular receptor expressed on epithelial cells.

[0237] Embodiment 29 The RNAi agent of embodiment 28, wherein the targeting ligand comprises an integrin targeting ligand.

[0238] Embodiment 30 The RNAi agent of embodiment 29, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.

[0239] Embodiment 31. The targeting ligand has the following structure: [ka] or a pharma- ceutically acceptable salt thereof, or [ka] or a pharma- ceutically acceptable salt thereof, [ka] indicates a point of attachment to the RNAi agent.

[0240] Embodiment 32. The RNAi agent has the following structure: [ka] or a pharma- ceutically acceptable salt thereof; [ka] The RNAi agent according to any one of embodiments 27 to 30, wherein:

[0241] Embodiment 33. The targeting ligand has the following structure: [ka] or a pharma- ceutically acceptable salt thereof; [ka] represents a point of attachment to the RNAi agent:

[0242] Embodiment 34 The RNAi agent of any one of embodiments 27 to 33, wherein the targeting ligand is attached to the sense strand.

[0243] Embodiment 35 The RNAi agent of embodiment 34, wherein the targeting ligand is attached to the 5' end of the sense strand.

[0244] Embodiment 36. A composition comprising an RNAi agent according to any one of embodiments 1 to 35, further comprising a pharma- ceutically acceptable excipient.

[0245] Embodiment 37 The composition of embodiment 36, further comprising a second RNAi agent capable of inhibiting expression of the mucin 5AC gene.

[0246] Embodiment 38. The composition of embodiment 36 or 37, further comprising one or more additional therapeutic agents.

[0247] Embodiment 39. The composition of any one of embodiments 36 to 38, which is formulated for administration by inhalation.

[0248] Embodiment 40. The composition of embodiment 39, delivered by a metered dose inhaler, a jet nebulizer, a vibrating mesh nebulizer, or a soft mist inhaler.

[0249] Embodiment 41 The composition of any one of embodiments 36 to 40, wherein the RNAi agent is a sodium salt.

[0250] Embodiment 42. The composition of any one of embodiments 36 to 41, wherein the pharma- ceutically acceptable excipient is water for injection.

[0251] Embodiment 43. The composition of any one of embodiments 36 to 42, wherein the pharma- ceutically acceptable excipient is isotonic saline.

[0252] Embodiment 44. A method for inhibiting expression of the MUC5AC gene in a cell, comprising introducing into the cell an effective amount of an RNAi agent according to any one of embodiments 1 to 35 or a composition according to any one of embodiments 36 to 43.

[0253] Embodiment 45 The method of embodiment 44, wherein the cell is in a subject.

[0254] Embodiment 46 The method of embodiment 45, wherein the subject is a human subject.

[0255] Embodiment 47. The method of any one of embodiments 44 to 46, wherein after administration of the RNAi agent, the mucin 5AC gene expression is inhibited by at least about 30%.

[0256] Embodiment 48. A method for treating one or more conditions or diseases associated with MUC5AC protein levels, comprising administering to a human subject in need thereof a therapeutically effective amount of a composition described in any one of embodiments 36 to 43.

[0257] Embodiment 49. The method of embodiment 48, wherein the disease is a mucosal obstructive pulmonary disease.

[0258] Embodiment 50. The method of embodiment 49, wherein the mucosal obstructive pulmonary disease is asthma (including severe asthma), cystic fibrosis (CF), bronchiectasis (NCFB), or chronic obstructive pulmonary disease (COPD).

[0259] Embodiment 51. The method of embodiment 50, wherein the disease is asthma (including severe asthma).

[0260] Embodiment 52 The method of embodiment 48, wherein the disease is cancer.

[0261] Embodiment 53. The method of embodiment 52, wherein the cancer is lung adenocarcinoma, pancreatic cancer, salivary gland cancer, breast cancer, cholangiocarcinoma, or ovarian cancer.

[0262] Embodiment 54. The method of any one of embodiments 44-53, wherein the RNAi agent is administered at a lung deposited dose (PDD) of about 0.01 mg / kg to about 5.0 mg / kg of body weight of the subject.

[0263] Embodiment 55. The method of any one of embodiments 44-53, wherein the RNAi agent is administered at a lung deposited dose (PDD) of about 0.1 mg / kg to about 2.0 mg / kg of body weight of the subject.

[0264] Embodiment 56. The method of any one of embodiments 44-53, wherein the RNAi agent is administered at an inhaled delivered dose (RDD) of about 0.01 mg to about 5.0 mg per kg of body weight of the subject.

[0265] Embodiment 57. The method of any one of embodiments 44-53, wherein the RNAi agent is administered at an inhaled delivered dose (RDD) of about 0.1 mg to about 2.0 mg per kg of body weight of the subject.

[0266] Embodiment 58 The method of any one of embodiments 44 to 57, wherein the RNAi agent is administered in two or more doses.

[0267] Embodiment 59. Use of an RNAi agent according to any one of embodiments 1 to 35 for the treatment of a disease, disorder or condition mediated at least in part by mucin 5AC protein levels.

[0268] Embodiment 60. Use of a composition according to any one of embodiments 36 to 43 for the treatment of a disease, disorder or condition mediated at least in part by mucin 5AC gene expression.

[0269] Embodiment 61. Use of a composition according to any one of embodiments 36 to 43 for the manufacture of a medicament for the treatment of a disease, disorder or condition mediated at least in part by mucin 5AC gene expression.

[0270] Embodiment 62. The use according to any one of embodiments 59 to 61, wherein the disease is asthma (including severe asthma).

[0271] Embodiment 63. A method for producing an RNAi agent according to any one of embodiments 1 to 35, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.

[0272] Embodiment 64 The method of embodiment 63, wherein the sense strand comprises a targeting ligand.

[0273] Embodiment 65 The method of embodiment 64, comprising attaching a targeting ligand to the sense strand.

[0274] Embodiment 66. An RNAi agent for inhibiting the expression of the mucin 5AC gene, comprising: an antisense strand comprising at least 15 contiguous nucleotides that differ from any one of the sequences provided in Table 2, Table 3, or Table 11 by 0, 1, 2, or 3 nucleotides; and a sense strand that comprises a nucleotide sequence that is at least partially complementary to the antisense strand 2. An RNAi agent comprising:

[0275] Embodiment 67. An RNAi agent for inhibiting expression of the mucin 5AC (MUC5AC) gene, comprising: an antisense strand comprising at least 15 consecutive nucleotides that differ from any one of the sequences disclosed in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides; and a sense strand that comprises a nucleotide sequence that is at least partially complementary to the antisense strand 2. An RNAi agent comprising:

[0276] Embodiment 68. An RNAi agent for inhibiting expression of the mucin 5AC (MUC5AC) gene, comprising: a sense strand comprising at least 15 consecutive nucleotides that differ from the same length stretch of nucleotides of SEQ ID NO:1 by 0, 1, 2, or 3 nucleotides; and an antisense strand comprising a nucleotide sequence that is at least partially complementary to the sense strand 2. An RNAi agent comprising:

[0277] Embodiment 69. An inhibitor of the MUC5AC gene comprising an antisense nucleotide sequence having at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any of the target nucleotide sequences in Table 1 that are complementary to the target nucleotide sequences.

[0278] Embodiment 70. An RNAi agent comprising: (i) an antisense strand comprising a nucleotide sequence having at least 15 contiguous nucleotides that differ from any of the nucleotide sequences of Table 2, Table 3, or Table 11 by 0, 1, 2, or 3 nucleotides; and (ii) a sense strand that is at least partially complementary to the antisense strand.

[0279] Embodiment 71. An RNAi agent comprising: (i) an antisense strand that comprises, consists of, or consists essentially of a nucleotide sequence from any of the antisense strand nucleotide sequences in Table 2, Table 3, or Table 11, and (ii) a sense strand that comprises, consists of, or consists essentially of a nucleotide sequence from any of the sense strand nucleotide sequences in Table 2, Table 4, Table 5, Table 6, Table 7, or Table 11.

[0280] Embodiment 72. An RNAi agent comprising an antisense strand and a sense strand that anneal to form a duplex, wherein the duplex has the structure of any of the duplexes listed in Table 8A, Table 8B, Table 8C, Table 9, Table 10, or Table 11.

[0281] Embodiment 73. An RNAi agent for inhibiting the expression of the mucin 5AC gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides that differ from any one of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; and a sense strand that comprises a nucleotide sequence that is at least partially complementary to the antisense strand Including, Optionally, the RNAi agent, wherein all or substantially all of the nucleotides of the sense and antisense strands are modified nucleotides, and the sense strand is optionally linked to a targeting ligand.

[0282] The embodiments and features provided above are illustrated by the following non-limiting examples. Example 1

[0283] Example 1. Synthesis of MUC5AC RNAi Agents

[0284] MUC5AC RNAi agent duplexes disclosed herein were synthesized as follows.

[0285] A. Synthesis. The sense and antisense strands of MUC5AC RNAi agents were synthesized according to the solid-phase phosphoramidite technique used for oligonucleotide synthesis. Depending on the scale, MerMade96E® (Bioautomation), MerMadel2® (Bioautomation), or OP Pilot100 (GE Healthcare) were used. Synthesis was performed on a solid support made of controlled pore glass (CPG, 500A or 600A, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used included the following: (5'-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-)N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(Acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5'-O-dimethoxytrityl-N 2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidite had the same protecting groups as the 2'-O-methyl RNA amidite. The 5'-dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia). Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite) was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N6-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl))-(N,N-diisopropylamino) phosphoramidite. The linkers used were: 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. TFA Aminolink phosphoramidites were also purchased commercially (Thermo Fisher). Linker L6 was purchased from BroadPharm as propargyl-PEG5-NHS (catalog no. BP-20907) and coupled to the NH2-C6 group from the Aminolink phosphoramidite using standard coupling conditions to form -L6-C6-.To form the linker-Alk-cyHex-, the linker Alk-cyHex was also purchased commercially from Lumiprobe as a propargyl-containing compound phosphoramidite compound (alkyne phosphoramidite, 5' end). In each case, the phosphorothioate bond was introduced as specified using the conditions described herein. Cyclopropylphosphonate phosphoramidite was synthesized according to International Patent Application Publication No. WO2017 / 214112 (Altenhofer et.al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811(2021)).

[0286] Trialkine-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) were used as activator solutions. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0287] Alternatively, the trialkyne moiety was introduced post-synthetically (see section E below). For this route, the sense strand was functionalized with 5'- and / or 3'-terminal nucleotides containing primary amines. TFA Aminolink phosphoramidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) were used as activator solutions. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0288] B. Cleavage and deprotection of support-bound oligomers. After completion of solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% methylamine in water and 28%-31% ammonium hydroxide solution (Aldrich) for 1.5 h at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0289] C. Purification. Crude oligomers were purified by anion exchange HPLC using a TSKgel SuperQ-5PW 13 mm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA (pH 9.0) and contained 20% acetonitrile, and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled and then subjected to size exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 microparticles with a running buffer of 100 mM ammonium bicarbonate (pH 6.7) and 20% acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into the appropriate buffer or solvent system by tangential flow filtration.

[0290] D. Annealing. Complementary strands were mixed to form RNAi agents by mixing equimolar RNA solutions (sense and antisense) in 1x PBS (phosphate buffered saline, 1x, Corning, Cellgro). Some RNAi reagents were lyophilized and stored at -15 to -25°C. The concentration of the duplex was determined by measuring the absorbance of the solution in 1c PBS with a UV-Vis spectrometer. The absorbance of the solution at 260 nm was then multiplied by a conversion factor (0.050 mg / (mL-cm)) and a dilution factor to determine the concentration of the duplex.

[0291] E. Attachment of a Trialkine Linker. In some embodiments, the trialkine linker is attached to the sense strand of the RNAi agent on the resin as a phosphoramidite (see Example 1G for synthesis of an exemplary trialkine linker phosphoramidite, and see Example 1A for attachment of the phosphoramidite). In other embodiments, the trialkine linker may be attached to the sense strand after cleavage from the resin, as described below: either before or after annealing, in some embodiments, a 5' or 3' amine-functionalized sense strand is attached to the trialkine linker. Examples of trialkine linker structures that can be used to form the constructs disclosed herein are as follows: [ka] To attach the trialkyne linker to the annealed duplex, the amine-functionalized duplex was dissolved in 90% DMSO / 10% HO at approximately 50-70 mg / mL. 40 equivalents of triethylamine were added, followed by 3 equivalents of trialkyne-PNP. Once complete, the conjugate was precipitated twice in a solvent system of 1x phosphate buffered saline / acetonitrile (1:14 ratio) and dried.

[0292] F. Synthesis of Targeting Ligand SM6.1 ((S)-3-(4-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphthalen-1-yl)phenyl)-3-(2-(4-((4-methylpyridin-2-yl)amino)butanamido)acetamido)propanoic acid) [ka]

[0293] Compound 5 (tert-butyl (4-methylpyridin-2-yl)carbamate) (0.501 g, 2.406 mmol, 1 equiv) was dissolved in DMF (17 mL). To the mixture was added NaH (0.116 mg, 3.01 mmol, 1.25 equiv, 60% dispersion in oil). The mixture was stirred for 10 min before compound 20 (ethyl 4-bromobutyrate (0.745 g, 3.82 mmol, 0.547 mL)) (Sigma 167118) was added. After 3 h, the reaction was quenched with ethanol (18 mL) and concentrated. The concentrate was dissolved in DCM (50 mL), washed with saturated aqueous NaCl (1×50 mL), dried over Na2SO4, filtered, and concentrated. The product was purified on a silica column with a gradient of 0–5% methanol in DCM. [ka]

[0294] Compound 21 (0.80 g, 2.378 mmol) was dissolved in 100 mL of acetone:0.1 M NaOH [1:1]. The reaction was monitored by TLC (5% ethyl acetate in hexanes). The organics were concentrated to remove and the residue was acidified to pH 3-4 with 0.3 M citric acid (40 mL). The product was extracted with DCM (3 x 75 mL). The organics were pooled, dried over Na2SO4, filtered and concentrated. The product was used without further purification. [ka]

[0295] To a solution of compound 22 (1.1 g, 3.95 mmol, 1 equiv.), compound 45 (595 mg, 4.74 mmol, 1.2 equiv.) and TBTU (1.52 g, 4.74 mmol, 1.2 equiv.) in anhydrous DMF (10 mL) was added diisopropylethylamine (2.06 mL, 11.85 mmol, 3 equiv.) at 0° C. The reaction mixture was warmed to room temperature and stirred for 3 h. The reaction was quenched by saturated NaHCO3 solution (10 mL). The aqueous phase was extracted with ethyl acetate (3×10 mL) and the organic phases were combined, dried over anhydrous Na2SO4 and concentrated. The products were separated by CombiFlash® using silica gel as stationary phase. LC-MS: calculated [M+H] + 366.20, actual value 367. [ka]

[0296] To a solution of compound 61 (2 g, 8.96 mmol, 1 eq.) and compound 62 (2.13 mL, 17.93 mmol, 2 eq.) in anhydrous DMF (10 mL) was added K2CO3 (2.48 g, 17.93 mmol, 2 eq.) at 0° C. The reaction mixture was warmed to room temperature and stirred overnight. The reaction was quenched with water (10 mL). The aqueous phase was extracted with ethyl acetate (3×10 mL) and the organic phases were combined, dried over anhydrous Na2SO4 and concentrated. The products were separated by CombiFlash® using silica gel as stationary phase. [ka]

[0297] To a solution of compound 60 (1.77 g, 4.84 mmol, 1 equiv.) in THF (5 mL) and H2O (5 mL) was added lithium hydroxide monohydrate (0.61 g, 14.53 mmol, 3 equiv.) in portions at 0 °C. The reaction mixture was allowed to warm to room temperature. After stirring at room temperature for 3 h, the reaction mixture was acidified to pH 3.0 with HCl (6N). The aqueous phase was extracted with ethyl acetate (3 x 20 mL) and the organic layers were combined, dried over Na2SO4 and concentrated. LC-MS: calculated [M+H] +352.18, actual value 352. [ka]

[0298] To a solution of compound 63 (1.88 g, 6.0 mmol, 1.0 equiv) in anhydrous THF (20 mL) was added n-BuLi (3.6 mL, 9.0 mmol, 1.5 equiv) in hexanes dropwise at -78 °C. The reaction was maintained at -78 °C for an additional 1 h. Triisopropyl borate (2.08 mL, 9.0 mmol, 1.5 equiv) was then added to the mixture at -78 °C. The reaction was then warmed to room temperature and stirred for an additional 1 h. The reaction was quenched with saturated NH4Cl solution (20 mL) and the pH was adjusted to 3. The aqueous phase was extracted with EtOAc (3 x 20 mL) and the organic phases were combined, dried over Na2SO4, and concentrated. [ka]

[0299] Compound 12 (300 mg, 0.837 mmol, 1.0 equiv), compound 65 (349 mg, 1.256 mmol, 1.5 equiv), XPhos PdG2 (13 mg, 0.0167 mmol, 0.02 equiv), and K3PO4 (355 mg, 1.675 mmol, 2.0 equiv) were mixed in a round bottom flask. The flask was sealed with a screw cap septum, then evacuated and backfilled with nitrogen (this process was repeated a total of three times). THF (8 mL) and water (2 mL) were then added via syringe. Nitrogen was bubbled through the mixture for 20 min, and the reaction was maintained at room temperature overnight. The reaction was quenched with water (10 mL) and the aqueous phase was extracted with ethyl acetate (3 x 10 mL). The organic phase was dried over Na2SO4, concentrated and purified by CombiFlash® using silica gel as stationary phase and eluted with 15% EtOAc in hexane. LC-MS: calculated [M+H] + 512.24, actual value 512.56. [ka]

[0300] Compound 66 (858 mg, 1.677 mmol, 1.0 equiv) was cooled by ice bath. HCl in dioxane (8.4 mL, 33.54 mmol, 20 equiv) was added to the flask. The reaction was allowed to warm to room temperature and stirred for an additional hour. The solvent was removed by rotary evaporation and the product was used directly without further purification. LC-MS: Calculated [M+H] + 412.18, actual value 412.46. [ka]

[0301] To a solution of compound 64 (500 mg, 1.423 mmol, 1 equiv.), compound 67 (669 mg, 1.494 mmol, 1.05 equiv.), and TBTU (548 mg, 0.492 mmol, 1.2 equiv.) in anhydrous DMF (15 mL) was added diisopropylethylamine (0.744 mL, 4.268 mmol, 3 equiv.) at 0° C. The reaction mixture was warmed to room temperature and stirred for an additional hour. The reaction was quenched with saturated aqueous NaHCO3 (10 mL) and the product was extracted with ethyl acetate (3×20 mL). The organic phases were combined, dried over Na2SO4, and concentrated. The product was purified by CombiFlash® using silica gel as stationary phase and eluted with 3-4% methanol in DCM. The yield was 96.23%. LC-MS: calculated [M+H] + 745.35, actual value 746.08. [ka]

[0302] To a solution of compound 68 (1.02 g, 1.369 mmol, 1 equiv) in ethyl acetate (10 mL) was added 10% Pd / C (0.15 g, 50% H2O) at room temperature. The reaction mixture was warmed to room temperature and the reaction was monitored by LC-MS. The reaction was kept at room temperature overnight. The solid was filtered through Celite® and the solvent was removed by rotary evaporation. The product was used directly without further purification. LC-MS: [M+H]+ 655.31, actual value 655.87. [ka]

[0303] To a solution of compound 69 (100 mg, 0.152 mmol, 1 equiv.) and azido-PEG5-OTs (128 mg, 0.305 mmol, 2 equiv.) in anhydrous DMF (2 mL) was added K2CO3 (42 mg, 0.305 mmol, 2 equiv.) at 0° C. The reaction mixture was stirred at 80° C. for 6 h. The reaction was quenched with saturated NaHCO3 solution and the aqueous layer was extracted with ethyl acetate (3×10 mL). The organic phases were combined, dried over Na2SO4 and concentrated. LC-MS: calculated [M+H]+ 900.40, found 901.46. [ka]

[0304] To a solution of compound 72 (59 mg, 0.0656 mmol, 1.0 equiv) in THF (2 mL) and water (2 mL) was added lithium hydroxide (5 mg, 0.197 mmol, 3.0 equiv) at room temperature. The mixture was stirred for another 1 h at room temperature. The pH was adjusted to 3.0 with HCl (6N) and the aqueous phase was extracted with EtOAc (3×10 mL). The organic phases were combined, dried over Na2SO4 and concentrated. TFA (0.5 mL) and DCM (0.5 mL) were added to the residue and the mixture was stirred for another 3 h at room temperature. The solvent was removed by rotary evaporation. LC-MS: calculated [M+H] + 786.37, actual value 786.95.

[0305] G. Synthesis of TriAlk14

[0306] TriAlk14 and (TriAlk14)s shown in Table 12 above may be synthesized using the synthetic routes shown below: Compound 14 may be added to the sense strand as a phosphoramidite using standard oligonucleotide synthesis techniques, or compound 22 may be attached to an amine-containing sense strand in an amide coupling reaction. [ka]

[0307] To a 3 L jacketed reactor was added 500 mL of DCM and 4 (75.0 g, 0.16 mol). The reaction was cooled to an internal temperature of 0° C. and TBTU (170.0 g, 0.53 mol) was added. The suspension was then treated dropwise with amine 5 (75.5 g, 0.53 mol) while keeping the internal temperature below 5° C. The reaction was then treated slowly with DIPEA (72.3 g, 0.56 mol) while keeping the internal temperature below 5° C. After the addition was complete, the reaction was allowed to warm to 23° C. over 1 h and stirred for 3 h. A 10% kicker charge of all three reagents was added and stirred for an additional 3 h. The reaction was deemed complete when less than 1% of 4 remained. The reaction mixture was washed with saturated ammonium chloride solution (2×500 mL) and once with saturated sodium bicarbonate solution (500 mL). The organic layer was then dried over sodium sulfate and concentrated to an oil. The crude oil weighed 188 g and contained 72% 6 by QNMR. The crude oil was used in the next step. 46 H 60 N4O 11 Calculated mass = 845.0 m / z, observed mass [M+H] = 846.0. [ka]

[0308] 121.2 g of the crude oil (86.0 g, 0.10 mol) containing 72 wt% of compound 6 was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20 v / v%) while keeping the internal temperature below 23 °C. The formation of dibenzofulvene (DBF) versus consumption of Fmoc-amine 6 was monitored by HPLC method 1 (Figure 2) and the reaction was complete within 10 h. Glutaric anhydride (12.8 g, 0.11 mol) was added to this solution and the intermediate amine 7 was converted to compound 8 within 2 h. Upon completion, the DMF and TEA were removed under reduced pressure at 30 °C to give 100 g of crude oil. Due to the high solubility of compound 7 in water, an aqueous workup could not be used and chromatography was the only method to remove DBF, TMU, and glutaric anhydride. The crude oil (75 g) was purified in three portions on a Teledyne ISCO Combi-flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-20% methanol / DCM over 30 min to give 42 g of compound 8 (54% yield over three steps). 36 H 55 N4O 12 Calculated mass for = 736.4 m / z. Found mass [M+H] = 737.0. [ka]

[0309] Compound 8 (42.0 g, 0.057 mol) was co-stripped with 10 volumes of acetonitrile prior to use to remove any residual methanol from the chromatography solvent. The oil was redissolved in DMF (210 mL) and cooled to 0° C. The solution was treated with 4-nitrophenol (8.7 g, 0.063 mol) followed by EDC hydrochloride (12.0 g, 0.063 mol) and was found to reach completion within 10 hours. The solution was cooled to 0° C. and 10 volumes of ethyl acetate were added, followed by 10 volumes of saturated ammonium chloride solution, while maintaining the internal temperature below 15° C. The layers were separated and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes of ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to an oil. The crude oil (55 g) was purified in three portions on a Teledyne ISCO Combi-Flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-10% methanol / DCM over 30 min to give 22 g of pure 9 (compound 22) (50% yield). 42 H 59 N5O 14 Calculated mass = 857.4 m / z, measured mass [M+H] = 858.0. [ka]

[0310] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-1-hexanol (7.36 g, 6.28 mmol) in dichloromethane (3 volumes) was treated dropwise with triethylamine (11.56 g, 111.4 mmol). The reaction was monitored by observing the disappearance of compound 9 by HPLC method 1 and was found to be complete in 10 min. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to an oil. The crude oil was purified on a Teledyne ISCO Combi-flash® purification system using a 330 g silica column. 4-Nitrophenol was eluted with 100% ethyl acetate and 10 was flushed from the column using 20% ​​methanol / DCM to give a colorless oil (39 g, 81% yield). C 42 H 69 N5O 12 Calculated mass = 836.0 m / z. Measured mass [M+H] = 837.0. [ka]

[0311] Alcohol 10 was co-stripped twice with 10 volumes of acetonitrile to remove any residual methanol from the chromatography solvent and once more with dry dichloromethane (KF<60 ppm) to remove traces of water. Alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes of dry dichloromethane (KF<50 ppm) and treated with diisopropylammonium tetrazolide (188 mg, 1.1 mmol). The solution was cooled to 0°C and treated dropwise with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphoramidite (1.00 g, 3.3 mmol). The solution was removed from the ice bath and stirred at 20°C. The reaction was found to be complete within 3-6 h. The reaction mixture was cooled to 0°C and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate / brine, then allowed to warm to ambient temperature over 1 min and stirred at 20°C for an additional 3 min. The biphasic mixture was transferred to a separatory funnel and 10 volumes of dichloromethane were added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze the unreacted diphosphorus reagent. The organic layer was dried over sodium sulfate and concentrated to an oil to give 3.08 g of compound 14, 94% by weight. 51 H 86 N7O 13 Calculated mass of P = 1035.6 m / z, observed mass [M+H] = 1036.

[0312] H. Conjugation of the targeting ligand. Conjugate the 5' or 3' tridentate alkyne-functionalized sense strand to the targeting ligand either before or after annealing. The following example describes conjugation of the targeting ligand to the annealed duplex. Prepare stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M copper(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and 2 M sodium ascorbate solutions in deionized water. Make a 75 mg / mL solution of the targeting ligand in DMSO. Add 25 μL of 1 M Hepes (pH 8.5) buffer to the 1.5 mL centrifuge tube containing the trialkyne-functionalized duplex (3 mg, 75 μL, 40 mg / mL in deionized water, approximately 15,000 g / mol). After vortexing, add 35 μL of DMSO and vortex the solution. The targeting ligand was added to the reaction (6 equiv. / duplex, 2 equiv. / alkyne, ~15 μL) and the solution was vortexed. The pH was checked using pH paper to ensure it was approximately pH 8. In a separate 1.5 mL centrifuge tube, 50 μL of 0.5 M THPTA was mixed with 10 μL of 0.5 M Cu(II)SO4·5H2O, vortexed, and incubated at room temperature for 5 min. After 5 min, THPTA / Cu solution (7.2 μL, 6 equiv., 5:1 THPTA:Cu) was added to the reaction vial and vortexed. Immediately after, 2 M ascorbate (5 μL, 50 equiv. per duplex, 16.7 per alkyne) was added to the reaction vial and vortexed. Once the reaction was complete (typically complete in 0.5-1 h), the reaction was immediately purified by non-denaturing anion exchange chromatography.

[0313] Example 2. In vitro testing of MUC5AC RNAi agents Certain chemically modified candidate sequence duplexes shown in Table 8C above (having antisense strand sequences shown in Table 3, and sense strand nucleotides and terminal cap portions shown in Table 6) were tested in vitro. MUC5AC RNAi agents were prepared according to the procedures described in Example 1.

[0314] Evaluation of MUC5AC RNAi agents in vitro was performed by transfection of A549 cells, a human lung epithelial cell line. Cells were plated at approximately 7,500 cells per well in a 96-well format and transfected with each RNAi agent duplex shown in Table 12 at three concentrations (10 nM, 1 nM, and 0.1 nM) using LipoFectami RNAiMax (Thermo Fisher) transfection reagent. The relative expression of each MUC5AC RNAi agent was determined by qRT-PCR by comparing the expression levels of MUC5AC mRNA to an endogenous control, as shown in Table 12, and normalized to untreated A549 cells (AACT analysis).

[0315] Table 12 below lists the number of AD duplexes for the sequences examined, with the position of the gene targeted by that particular RNAi agent in parentheses. Thus, for example, for duplex ID AD08101, the average relative expression at 1 nM of 0.377 indicates 62.3% MUC5AC gene knockdown, and the average relative expression at 0.1 nM indicates 53.0% (0.470) inhibition normalized to untreated wells (sham controls).

[0316] [Table 16-1] [Table 16-2]

[0317] Example 3. In vitro testing of MUC5AC RNAi agents Certain chemically modified candidate sequence duplexes shown in Table 8C above (having antisense strand sequences shown in Table 3, and sense strand nucleotides and terminal cap moieties shown in Table 6) were tested in vitro. MUC5AC RNAi agents were prepared according to the procedures described in Example 1.

[0318] Evaluation of MUC5AC RNAi agents in vitro was performed by transfection of A549 cells, a human lung epithelial cell line. Cells were plated at approximately 7,500 cells per well in a 96-well format and transfected with each RNAi agent duplex shown in Table 12 at three concentrations (10 nM, 1 nM, and 0.1 nM) using LipoFectami RNAi Max (ThermoFisher) transfection reagent. The relative expression of each MUC5AC RNAi agent was determined by qRT-PCR by comparing the expression levels of MUC5AC mRNA to an endogenous control, as shown in Table 12, and normalized to untreated A549 cells (AACT analysis).

[0319] Table 12 below lists the number of AD duplexes for the sequences examined, with the position of the gene targeted by that particular RNAi agent in parentheses. Thus, for example, for duplex IDAD08101, the average relative expression at 1 nM of 0.377 indicates 62.3% MUC5AC gene knockdown, and the average relative expression at 0.1 nM indicates 53.0% (0.470) inhibition normalized to untreated wells (sham control).

[0320] [Table 17-1] [Table 17-2]

[0321] Example 4. House dust mite (HDM)-induced allergic asthma model To study the in vivo properties of specific MUC5AC RNAi agents, a house dust mite (HDM)-induced allergic asthma mouse model was used. To induce mouse Muc5ac expression, female Balb / c mice (6-8 weeks old) were intranasally administered 50 μg of commercially obtained house dust mite protein in 25 μL of isotonic saline using a pipette for 5 consecutive days. 72 h after the fifth daily administration, mice were euthanized and whole lungs were harvested for mRNA expression analysis. We show that there is an approximately 100-fold increase in the relative expression of mouse Muc5ac mRNA in HDM-challenged mice compared to unchallenged naive mice.

[0322] Example 5. In vivo intratracheal administration of MUC5AC RNAi agents in HDM models The HDM-induced allergic asthma mouse model was used as described above in Example 4. Table 15 below shows the treatment groups.

[0323] [Table 18]

[0324] As shown above in Table 15, mice in Group 1 were not treated throughout. For mice in Groups 3, 5, 6, 7, and 8, female Balb / c mice were administered a single 50 microliter dose via a microspray device (Penn Century, Philadelphia, Pa.) suitable for intratracheal (IT) administration of 5.0 mg / kg of each MUC5AC RNAi agent formulated in isotonic saline or isotonic saline as described in Table 15 on study days 1, 3, 5, and 8.

[0325] As shown in Table 15, each MUC5AC RNAi agent (groups 6, 7, and 8) was conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see FIG. 1).

[0326] The chemically modified sequences of MUC5AC RNAi agents AD07720 and AD07719 (groups 7 and 8) are shown in Table 7B (showing the duplexes), Table 3 (showing the respective antisense strands), and Table 5 (showing the respective sense strands with the linker but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)).

[0327] AD07022 has a mouse-specific sequence that has no homology to the human MUC5AC gene and was chemically modified as follows. Tri-SM6.1-αvβ6-AD07022 Modified sense strand (5'→3'): Tri-SM6.1-αvβ6-(TA14)cscauacagCfAfGfuacaguuacas(invAb) (SEQ ID NO: 1714) Modified antisense strand (5'→3'): cPrpusGfsusAfaCfuGfuAfcUfgCfuGfuAfuGfsg (SEQ ID NO: 1713)

[0328] On each of days 8-12, mice in Groups 2-8 were administered a single dose of 25 microliters of isotonic saline (Groups 2 and 3) or 50 micrograms of house dust mites formulated in isotonic saline (referred to as HDM in Table 15) intranasally (IN) using a pipette.

[0329] Mice were sacrificed on study day 15 and total RNA was isolated from both lungs after collection and homogenization. Mouse Muc5ac mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0330] [Table 19] Data was normalized to the non-treated group (group 1). As shown in the data in Table 16 above, the HDM mouse model performed as expected in terms of promoting increased MUC5AC expression after exposure to HDM. The data shows that groups 7 and 8, each of which has a nucleotide sequence targeting position 1921 of the MUC5AC gene and has homology with both human and mouse gene transcripts, caused very minimal reduction in MUC5AC protein compared to groups 4 and 5 HDM model mice without RNAi agents, indicating only minimal inhibition of these specific RNAi agents. Alternatively, the mouse-specific RNAi agent AD07022 (group 6) showed a significant reduction in Muc5ac mouse mRNA levels (only 13.444) compared to groups administered HDM without MUC5AC RNAi agents.

[0331] Example 6. In vivo intratracheal administration of MUC5AC RNAi agents in HDM models The HDM-induced allergic asthma mouse model was used as described above in Example 4. Table 17 below shows the treatment groups.

[0332] [Table 20]

[0333] For mice in groups 1-10, on study days 1, 3, 5, and 8, female Balb / c mice were administered a single 50 microliter dose via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration of 5.0 mg / kg of each MUC5AC RNAi agent formulated in isotonic saline or isotonic saline as described in Table 17. For mice in group 11, the MUC5AC RNAi agent was administered only on days 1 and 8.

[0334] Each MUC5AC RNAi agent (Groups 3-11) was conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see FIG. 1) at the 5' end of the sense strand of the MUC5AC RNAi agent, as shown in Table 17. The chemically modified sequences of MUC5AC RNAi agents AD08083, AD08084, AD08085, AD08086, AD08087, AD08088, and AD08089 (Groups 4-10) are shown in Table 7B (showing the duplex), Table 3 (showing the respective antisense strands), and Table 5 (showing the respective sense strands with the linker but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)).

[0335] AD07022 has a mouse-specific sequence that has no homology to the human MUC5AC gene and was chemically modified as described in Example 5 above.

[0336] On each of days 8-12, mice were administered a single dose of 25 microliters of isotonic saline (Group 2) or 50 micrograms of house dust mites formulated in isotonic saline (referred to as HDM in Table 17) intranasally (IN) using a pipette.

[0337] Mice were sacrificed on day 15 of the study and total RNA was isolated from both lungs after collection and homogenization. Mouse Muc5ac mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0338] [Table 21]

[0339] Data was normalized to the group that received only IT and IN saline (Group 1). As shown in the data in Table 18 above, the HDM mouse model performed as expected in promoting increased MUC5AC expression after exposure to HDM. The data shows that Groups 7 and 8 (both of which have a nucleotide sequence targeting position 9729 of the MUC5AC gene and have homology to both human and mouse gene transcripts) caused only a moderate decrease in MUC5AC protein compared to Group 2 HDM model mice without an RNAi agent, indicating only a moderate amount of inhibition for these particular RNAi agents. Alternatively, the remaining MUC5AC RNAi agents tested (Groups 4-6 targeting gene position 5029, and Groups 9 and 10 targeting gene position 15052) each showed greater inhibition compared to Group 2, as did the mouse-specific MUC5AC RNAi agent AD07022 (Group 6).

[0340] Example 7. In vivo intratracheal administration of MUC5AC RNAi agents in rats The HDM-induced allergic asthma mouse model described above in Example 4 was used. Table 19 below shows the specific dose groups included in the study:

[0341] [Table 22]

[0342] For mice in Groups 1-5, on study days 1, 3, 5, and 8, female Balb / c mice were administered a single 50 microliter dose via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration of 5.0 mg / kg of each MUC5AC RNAi agent formulated in isotonic saline or isotonic saline as described in Table 19.

[0343] As shown in Table 19, each MUC5AC RNAi agent (Groups 3-5) was conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see FIG. 1) at the 5' end of the sense strand. The chemically modified sequences of MUC5AC RNAi agents AD08173 and AD08174 (Groups 4 and 5) are shown in Table 7B (showing the duplex), Table 3 (showing the respective antisense strands), and Table 5 (showing the respective sense strands with linker but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)). Each MUC5AC RNAi agent with a sequence targeting position 3535 has a mismatch at what is understood to be a critical position from the mouse gene, and therefore, given the mismatches, the MUC5AC RNAi agents are expected to show little or no inhibitory activity.

[0344] AD07022 has a mouse-specific sequence that has no homology to the human MUC5AC gene and was chemically modified as described in Example 5 above.

[0345] On each of days 8-12, mice were administered a single dose of 25 microliters of isotonic saline (Group 1 only) or 50 micrograms of house dust mites formulated in isotonic saline (referred to as HDM in Table 19) intranasally (IN) using a pipette.

[0346] Mice were sacrificed on day 15 of the study and total RNA was isolated from both lungs after collection and homogenization. Mouse Muc5ac mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0347] [Table 23]

[0348] Data was normalized to the group that received only IT and IN saline (Group 1). As mentioned above, given the nature of the mismatch with the mouse gene for the MUC5AC RNAi agent (targeting position 3535 of the human gene) in Groups 4 and 5, minimal inhibition is expected. As shown in the data in Table 20 above, the HDM mouse model performed as expected in promoting increased MUC5AC expression after exposure to HDM as shown in Groups 1 and 2. Unexpectedly, the MUC5AC RNAi agent targeting position 3535 still showed a moderate level of inhibition despite the mismatch with the mouse gene, indicating that MUC5AC RNAi agents targeting this position may be viable as human treatment candidates.

[0349] Example 8. In vivo intratracheal administration of MUC5AC RNAi agents in HDM models The HDM-induced allergic asthma mouse model described in Example 4 above was used. Table 17 below shows the treatment groups:

[0350] [Table 24]

[0351] Female Balb / c mice were administered a single 50 microliter dose via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration of MUC5AC RNAi agents formulated in isotonic saline or isotonic saline at the dates and concentrations listed in Table 21 above.

[0352] Each MUC5AC RNAi agent (Groups 3-11) was conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand (see FIG. 1) at the 5' end of the sense strand, as shown in Table 21. The chemically modified sequence of MUC5AC RNAi agent AD08089 is shown in Table 7B (showing the duplex), Table 3 (showing the respective antisense strand), and Table 5 (showing the respective sense strand with the linker but without the tridentate small molecule αvβ6 epithelial cell targeting ligand).

[0353] AD07022 has a mouse-specific sequence that has no homology to the human MUC5AC gene and was chemically modified as described in Example 5 above.

[0354] On each of days 7-11, mice were administered a single dose of 25 microliters of isotonic saline (Group 1) or 50 micrograms of house dust mites formulated in isotonic saline (referred to as HDM in Table 21) intranasally (IN) using a pipette.

[0355] Mice were sacrificed on study day 14 and total RNA was isolated from both lungs after collection and homogenization. Mouse Muc5ac mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0356] [Table 25]

[0357] Data was normalized to the group that received IT and IN saline only (Group 1). As shown in the data in Table 22 above, the HDM mouse model performed as expected in promoting increased MUC5AC expression after exposure to HDM. The data show that AD08089, which has a nucleotide sequence targeting position 15052 of the MUC5AC gene and has homology to both human and mouse gene transcripts, significantly inhibited MUC5AC and was generally comparable to the highly active mouse-specific MUC5AC RNAi agent AD07022.

[0358] Example 9. In vivo inhalation aerosol administration of MUC5AC RNAi agents in cynomolgus monkeys On study day 1, male cynomolgus monkeys were administered a single dose of 1 mg / kg lung deposited dose (PDD) of MUC5AC RNAi agents AC001305 or AC001306 on each of days 1, 8, and 15. Aerosols were delivered to restrained, anesthetized monkeys with endotracheal intubation using a vibrating mesh nebulizer (Aeroneb Solo). Intubated animals were connected to a ventilator used to control minute ventilation. Test article aerosols were generated by an Aeroneb Solo mesh nebulizer connected in-line with the exposure system. Exposure times were determined from aerosol testing to determine the efficiency of the system by placing a filter at the end of the endotracheal tube and collecting aerosols over the course of exposure. MUC5AC RNAi agents were conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (see Figure 1) and formulated in isotonic saline. The chemically modified sequences of MUC5AC RNAi agents AC001305 and AC001306 are shown in Table 11. The antisense strand sequence of AC001305 is also shown in Table 3 as AM12165, and the antisense strand sequence of AC001306 is also shown in Table 3 as AM12166, both of which target position 4993 of the MUC5AC gene.

[0359] The treatment groups were as described in Table 23 below:

[0360] [Table 26]

[0361] Two monkeys were dosed per group. Monkeys were sacrificed on study day 22 and total RNA was isolated from lung samples after collection and homogenization. The data in Table 24 below show mRNA expression sampled from the distal left caudal lobe. Cynomolgus MUC5AC mRNA expression was quantified by probe-based quantitative PCR, normalized to cynomolgus β-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0362] [Table 27]

[0363] [Table 28]

[0364] [Table 29] As reported above in Tables 24A, 24B, and 24C, MUC5AC RNAi agents

[0365] Example 10. Aerosol administration of MUC5AC RNAi agents in sheep Sheep exposed to inhaled Ascaris antigen exhibited responses typical of allergic asthma, including acute phase responses (AR), late phase responses (LR), and airway hyperresponsiveness (AHR), as shown by Abraham et.al. (Am Rev Respir Dis., 1983), and this model has been shown to respond well to standard treatments (Caniga, et.al., J Inflamm., 2013). Thus, this model can be used to determine the effect of ovine Muc5ac (sMuc5ac) mRNA silencing on airway mechanics and AHR upon treatment with MUC5AC RNAi agents. Delivery of test articles to intubated sheep, following challenge with Ascaris suum antigen, pulmonary resistance (R L Assessment of airway mechanics to detect changes in pulmonary circulation, and AHR assessment by performing cumulative concentration-response curves to inhaled carbachol were performed according to published procedures (Abraham et. al., J Clin Invest., 1994).

[0366] Two Toxocara susceptible sheep with a pre-established response to Toxocara suum were administered AC000480 at a level of 1 mg / kg lung-deposited dose on days 1, 8, and 15. The chemical structure of AC000480 is shown, for example, in Table 11 and is designed to target position 3535 of the MUC5AC gene. L The value after 1×PBS (PC 400 AHR was assessed by determining the cumulative carbachol concentration (in expiratory units, BU) that increased the R by 400% over the 22nd day. On day 22, sheep were challenged with Ascaris suum extract and the R was increased by 8 hours after challenge. L On day 23, AHR was assessed again in the same manner as on day 21. To monitor the duration of effect, sheep were challenged again with A. suum extract on day 51 and AHR was assessed on separate days 50 and 52.

[0367] [Table 30]

[0368] [Table 31]

[0369] As shown in Table 25, treatment with AC000480 attenuated AR and LR upon challenge on day 22. For example, untreated sheep had a reduced AR and LR at 6.5 hours compared to baseline. L At challenge on day 22, sheep treated with AC000480 showed a mean LR increase of 126% compared to baseline at 6.5 hours. L Furthermore, 24 hours after challenge on day 22, PC 400 Both AC000480-treated sheep showed no signs of Ascaris-induced airway hyperresponsiveness, as indicated by a comparable number of carbachol exhalation units required to produce PCs after Ascaris challenge. In contrast, in a control study without AC000480 treatment, sheep showed no PCs after Ascaris challenge. 400Approximately half the amount of carbachol respiratory units was required to induce airway hyperresponsiveness.

[0370] No further doses were administered after day 15 and sheep returned to baseline airway mechanics and AHR on day 51 post-T. worm challenge.

[0371] Example 11. Aerosol administration of MUC5AC RNAi agents in sheep The sheep model of allergic asthmatic airway inflammation described above in Example 10 was used. Three Toxocara susceptible sheep with previously established responses to Toxocara suum challenge were administered AC000482 at a level of 1 mg / kg lung-deposited dose on days 1, 8, and 15. The chemical structure of AC000482 is shown, for example, in Table 11 and is designed to target position 3535 of the MUC5AC gene. On day 21, R L The value after 1×PBS (PC 400 AHR was assessed by determining the cumulative carbachol concentration (in expiratory units, BU) that increased the R by 400% over the 22nd day. On day 22, sheep were challenged with Ascaris suum extract, which increased the R by 8 hours after challenge. L On day 23, AHR was assessed again as on day 21.

[0372] [Table 32]

[0373] [Table 33]

[0374] As shown in Table 27, treatment with AC000482 resulted in minimal attenuation of AR but robust attenuation of LR upon challenge on day 22. For example, untreated sheep showed a significant reduction in AR at 6.5 hours compared to baseline. L At day 22 challenge, sheep treated with AC000482 showed a mean LR increase of 121% compared to baseline at 6.5 hours. LFurthermore, 24 hours after challenge on day 22, PC 400 All sheep treated with AC000482 showed no signs of Ascaris-induced airway hyperresponsiveness, as indicated by a comparable number of carbachol exhalation units required to produce PCs after Ascaris challenge. In contrast, in a control study not treated with AC000482, sheep showed no PCs after Ascaris challenge. 400 Approximately half the amount of carbachol respiratory units was required to induce airway hyperresponsiveness.

[0375] Example 12. Aerosol administration of MUC5AC RNAi agents in sheep The sheep model of allergic asthmatic airway inflammation described above in Example 10 was used. Six Ascaris susceptible sheep, with a previously established response to Ascaris suum challenge, were administered either AC000482 at a 0.5 mg / kg lung-deposited dose level (n=3) or AC000482 at a 0.25 mg / kg lung-deposited dose level on days 1, 8, and 15. On day 21, R L The value after 1×PBS (PC 400 AHR was assessed by measuring the cumulative carbachol concentration (expiratory units, BU) that increased the RHR by 400% over the 22nd day. On day 22, sheep were challenged with Ascaris suum extract and RHR was increased by 8 hours after administration. L On day 23, AHR was assessed again as on day 21.

[0376] [Table 34]

[0377] [Table 35]

[0378] [Table 36]

[0379] [Table 37]

[0380] As shown in Table 29, treatment with AC000482 at the 0.5 mg / kg dose level resulted in minimal attenuation of AR but robust attenuation of LR upon challenge on day 22. For example, untreated sheep showed a significant decrease in AR at 6.5 hours compared to baseline. L At challenge on day 22, sheep treated with AC000482 showed a mean LR increase of 125% compared to baseline by 6.5 hours. L Furthermore, 24 hours after challenge on day 22, PC 400 All sheep treated with AC000482 showed no signs of Ascaris-induced airway hyperresponsiveness, as indicated by similar numbers of carbachol respiratory units required to generate PC400 after Ascaris challenge. In contrast, in a control study without AC000482 treatment, sheep required approximately half the amount of carbachol respiratory units to induce post-Ascaris challenge PC400 and showed airway hyperresponsiveness.

[0381] As shown in Table 30, treatment with AC000482 at the 0.25 mg / kg dose level resulted in minimal attenuation of AR but robust attenuation of LR upon challenge on day 22. For example, untreated sheep showed a significant reduction in AR at 6.5 hours compared to baseline. L At baseline, sheep treated with AC000482 at challenge day 22 showed a mean LR increase of 122% compared to baseline of 6.5 hours. L Furthermore, 24 hours after challenge on day 22, PC 400 All sheep treated with AC000482 showed no signs of Ascaris-induced airway hyperresponsiveness, as indicated by a similar number of carbachol exhalation units required to produce PCs after Ascaris challenge. In contrast, in a control study not treated with AC000482, sheep showed no PCs after Ascaris challenge. 400 Approximately half the amount of carbachol respiratory units was required to induce airway hyperresponsiveness.

[0382] Taken together, the results demonstrate a dose-responsive effect of AC000482 treatment on airway mechanics following Ascaris challenge. The results show that even at the lowest dose of AC000482, the effect on late responses remains great enough to block airway hyperresponsiveness 24 hours after challenge.

[0383] Example 13. Aerosol administration of MUC5AC RNAi agents in sheep The sheep model of allergic asthmatic airway inflammation described in Example 10 above was used. Six Ascaris susceptible sheep, with a pre-established response to Ascaris suum challenge, were administered either AC000480 at a lung-deposited dose level of 1.0 mg / kg or a negative control siRNA conjugate (which contains the same targeting ligand but is unable to load into the RISC complex and therefore unable to mediate RNA interference gene silencing) at a lung-deposited dose of 1.0 mg / kg on days 1, 8 and 15. On day 21, R L The value after 1×PBS (PC 400 AHR was assessed by measuring the cumulative carbachol concentration (expiratory units, BU) that increased the RHR by 400% over the 22nd day. On day 22, sheep were challenged with Ascaris suum extract and RHR was increased by 8 hours after challenge. L AHR was monitored on day 23 and again assessed as on day 21. Sheep receiving AC000480 had a dose-dependent attenuation of allergen-induced late responses and airway hyperresponsiveness, whereas similar exposure to a negative control conjugate did not attenuate allergen-induced changes in airway mechanics.

[0384] Other embodiments Although the present invention has been described in conjunction with its detailed description, it should be understood that the above description is for illustrative purposes only and is not intended to limit the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. An RNAi agent for inhibiting the expression of the mucin 5AC gene, comprising: an antisense strand comprising at least 17 consecutive nucleotides that differ from the nucleotide sequence of UUGUAGUAGUCGCAGAACCA (SEQ ID NO: 79) by 0 or 1 nucleotide, and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand The RNAi agent.

2. The RNAi agent according to claim 1, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

3. The modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2',3'-seconucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxy nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3'-O-methyl nucleotide. The RNAi agent according to claim 2.

4. The RNAi agent according to claim 1, wherein the sense strand comprises the nucleotide sequence of any one of the modified sense strand sequences provided in Table 4 or Table 11.

5. The RNAi agent according to claim 1, wherein the sense strand comprises one or two inverted abasic residues.

6. The RNAi agent according to claim 1, wherein the RNAi agent consists of a sense strand and an antisense strand that form a double strand having the structure of any one of the double strands in Table 8A, Table 8B, Table 8C, Table 9, Table 10A, or Table 10B.

7. The antisense strand has the following nucleotide sequence (5'→3'): The RNAi agent according to claim 1, consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from UUGUAGUAGUCGCAGAACAGC (SEQ ID NO: 1525) by 0 or 1 nucleotide.

8. The sense strand has the following nucleotide sequence (5'→3'): The RNAi agent according to claim 1, which consists of, consists essentially of, or contains a nucleotide sequence that differs from UGUUCUGCGACUACUACAA (SEQ ID NO: 568) by 0 or 1 nucleotide.

9. The antisense strand contains, consists of, or consists essentially of a modified nucleotide sequence that differs from the following nucleotide sequence (5'→3'): cPrpusUfsgsUfaGfuAf gUfcGfcAf gAf aCf aGf sc (SEQ ID NO: 1127); or usUfsgsUfaGfuAf gUfcGfcAf gAf aCf aGf sc (SEQ ID NO: 1065); wherein a, c, g, and u each represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively, Af, Cf, Gf, and Uf each represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively, cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine, s represents a phosphorothioate bond, and all or substantially all of the nucleotides on the sense strand are modified nucleotides. The RNAi agent according to claim 1.

10. The sense strand contains, consists of, or consists essentially of a modified nucleotide sequence that differs from the following nucleotide sequence (5'→3'): gs cuguu c uGf Cf Gf a cuac uacaa (SEQ ID NO: 1265) by 0 or 1 nucleotide, wherein a, c, g, and u each represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively, Af, Cf, Gf, and Uf each represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively, s represents a phosphorothioate bond, and all or substantially all of the nucleotides on the antisense strand are modified nucleotides. The RNAi agent according to claim 1.

11. The RNAi agent according to claim 1, wherein the RNAi agent is linked to a targeting ligand.

12. ​ The RNAi agent according to claim 11, wherein the targeting ligand has an affinity for a cell receptor expressed on epithelial cells.

13. The RNAi agent according to claim 12, wherein the targeting ligand comprises an integrin targeting ligand.

14. The RNAi agent according to claim 13, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.

15. The targeting ligand has the following structure: 【Chemical 1】 or a pharmaceutically acceptable salt thereof, or 【Chemical 2】 or comprises a pharmaceutically acceptable salt thereof, [Chemical Formula 3] which indicates a binding site to the RNAi agent, for the RNAi agent according to claim 14.

16. The RNAi agent has the following structure: 【Chemical Formula 4】 or binds to a targeting ligand having a pharmaceutically acceptable salt thereof, [Chemical Formula 5] which indicates a binding site to the RNAi agent, for the RNAi agent according to claim 11.

17. The RNAi agent according to claim 11, wherein the targeting ligand is bound to the 5' end of the sense strand.

18. A composition comprising the RNAi agent according to any one of claims 1 to 17, further comprising a pharmaceutically acceptable excipient.

19. A method for inhibiting the expression of the MUC5AC gene in a cell, comprising introducing an effective amount of the RNAi agent according to any one of claims 1 to 17 into the cell.

20. Use of the RNAi agent according to any one of claims 1 to 17 in the treatment of a disease, disorder, or condition that is at least partially mediated by the mucin 5AC protein level.

21. The RNAi agent according to claim 20, wherein the disease is a mucosal obstructive lung disease.

22. The RNAi agent according to claim 21, wherein the mucosal obstructive lung disease is asthma (including severe asthma), cystic fibrosis (CF), bronchiectasis (NCFB), or chronic obstructive pulmonary disease (COPD).

23. The RNAi agent according to claim 20, wherein the disease is cancer.

24. The RNAi agent according to claim 23, wherein the cancer is lung adenocarcinoma, pancreatic cancer, salivary gland cancer, breast cancer, cholangiocarcinoma, or ovarian cancer.

25. The RNAi agent according to claim 20, wherein the RNAi agent is administered at a pulmonary deposition dose (PDD) of about 0.01 mg to about 5.0 mg per kg of body weight of the subject.

26. The RNAi agent according to claim 20, wherein the RNAi agent is administered at an inhalation delivery dose (RDD) of about 0.01 mg to about 5.0 mg per kg of body weight of the subject.

27. Use of the composition according to claim 18 in the treatment of a disease, disorder, or condition that is at least partially mediated by mucin 5AC gene expression.

28. Use of the composition according to claim 18 in the manufacture of a medicament for the treatment of a disease, disorder, or condition that is at least partially mediated by mucin 5AC gene expression.

29. Use according to claim 27, wherein the disease is asthma (including severe asthma).

30. Use according to claim 28, wherein the disease is asthma (including severe asthma).

31. A method for producing the RNAi agent according to any one of claims 1 to 17, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.

Images