Nucleic acids encoding KLK2-GPI fusion proteins, recombinant cells, and uses thereof

Abstract

The present invention relates to recombinant nucleic acid constructs encoding kallikrein-2 fusion proteins, which comprise a first nucleotide sequence encoding kallikrein-2 (KLK2) and a second nucleotide sequence encoding a glycosylphosphatidylinositol (GPI) attachment sequence, the GPI attachment sequence-encoding nucleotide sequence being located 3' to the KLK2-encoding nucleotide sequence. Also disclosed are vectors, cellular preparations, and methods of their use.

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Provisional Patent Application No. 63 / 209,019, filed June 10, 2021, the entire contents of which are incorporated herein by reference.

[0002] (Sequence Listing) This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on April 21, 2022, is named JBI6578WOPCT1_SL.txt and is 33,873 bytes in size.

[0003] FIELD OF THEINVENTION The present invention relates to nucleic acid constructs encoding kallikrein-2 fusion proteins, as well as vectors, cellular preparations and methods of use thereof. [Background technology]

[0004] The human kallikrein (KLK) family consists of 15 serine proteases with diverse biological functions and tissue distribution (Thorek et al., Thromb. Haemost. 110(30):4840-92 (2013)). Kallikrein-2 (KLK2) is highly and selectively expressed in normal prostate, primary prostate cancer, and metastatic castration-resistant prostate cancer. Kallikrein-2 expression is regulated by androgens and closely correlates with androgen receptor expression. Its tissue specificity makes kallikrein-2 an attractive target for targeted therapy in prostate cancer. However, KLK2 (also called hK2, UniProt P20151) is a secreted protein in its catalytic activity and is often attached to the prostate tumor cell surface via an unknown mechanism. KLK2 is highly and selectively expressed in normal prostate, primary prostate cancer, and metastatic castration-resistant prostate cancer, making KLK2 an attractive target for targeted therapy in prostate cancer. There are limited commercially available prostate tumor cells that express endogenous KLK2 on the cell surface. VCaP and LNCaP prostate tumor cell lines express detectable cell surface KLK2, albeit at very low levels compared to primary tumor cells. The lack of suitable tumor cell lines makes it difficult to identify and validate potential therapeutic agents that intervene in the KLK2 pathway.

[0005] In the past, attempts have been made to overexpress KLK2 in the KLK2-negative prostate tumor cell lines DU145 and PC3, as well as many other cell lines. However, all of these attempts failed to produce tumor cell lines with KLK2 surface expression, since the KLK2 protein was either expressed intracellularly or secreted into the extracellular matrix (e.g., CHO-K1, HEK293, NS0, LnCap). Summary of the Invention

[0006] The present invention is directed to overcoming these and other deficiencies in the art.

[0007] A first aspect of the present disclosure relates to a recombinant nucleic acid construct encoding a kallikrein-2 fusion protein, the recombinant nucleic acid construct comprising a first nucleotide sequence encoding kallikrein-2 (KLK2) and a second nucleotide sequence encoding a glycosylphophatidylinositol (GPI) attachment sequence, the second nucleotide sequence encoding the GPI attachment sequence being located 3' to the first nucleotide sequence encoding kallikrein-2.

[0008] Another aspect of the disclosure is directed to a preparation of cells, wherein the cells of the preparation express a recombinant kallikrein-2 fusion protein on the surface thereof, the fusion protein comprising a kallikrein-2 polypeptide sequence, a portion of a glycosylphosphatidylinositol (GPI) attachment sequence linked to the C-terminus of the kallikrein-2 polypeptide sequence, and a GPI anchor domain bound to the GPI attachment sequence portion.

[0009] A further aspect of the present disclosure is directed to a non-human animal comprising a cell expressing on its surface a recombinant kallikrein-2 fusion protein comprising a kallikrein-2 polypeptide sequence, a portion of a glycosylphosphatidylinositol (GPI) attachment sequence linked to the C-terminus of the kallikrein-2 polypeptide sequence, and a GPI anchor domain bound to the GPI attachment sequence portion.

[0010] A further aspect of the present disclosure is directed to a method of identifying an agent that binds to kallikrein-2, the method including providing a preparation of cells according to the present disclosure, administering a candidate agent to the preparation of cells, and determining whether the candidate agent binds to kallikrein-2 based on the administering.

[0011] Another aspect of the present disclosure is directed to a method of identifying an agent that binds to kallikrein-2, the method including providing a non-human animal according to the present disclosure, administering a candidate agent to the non-human animal, and determining whether the candidate agent binds to kallikrein-2 based on the administering.

[0012] The present disclosure includes a method for engineering the surface expression of kallikrein-2 in cells by creating a kallikrein-2 fusion protein with the glycosylphosphatidylinositol (GPI) attachment sequence of human placental alkaline phosphatase (PLAP). Expression of the protein in transfected cells is driven by the EF1α promoter, and the kallikrein-2 fusion protein is anchored to the cell membrane by the GPI anchor domain linked to the GPI attachment sequence. The method is useful for achieving surface expression in cells that do not express kallikrein-2 or overexpression in cells that express endogenous kallikrein-2. Previous methods of expressing kallikrein-2 have failed to present KLK2 on the cell surface, resulting in only intracellular or extracellular expression, or no expression at all. Cells with engineered KLK2 on their surface have utility for screening and identifying KLK2 therapeutics (e.g., cell therapy products, CD3-redirecting antibodies, antibody-dependent cellular cytotoxicity (ADCC)-mediating antibodies, etc.) in release assays or in in vitro or in vivo experimental systems. [Brief description of the drawings]

[0013] [Figure 1] 1 is a histogram showing KLK2 surface expression in DU145 cells transduced with the KLK2-GPI fusion construct described herein ("KLK2_GPI"). Cells were stained with isotype control or anti-KLK2 clone KL2B1 directly conjugated to PE. [Figure 2A]1 is a graph showing binding of hIgG1 isotype control Ab or anti-KLK2 specific Ab to VCaP. [Figure 2B] 1 is a graph showing binding of hIgG1 isotype control Ab or anti-KLK2 specific Ab to DU145 parental cells. [Figure 2C] FIG. 13 is a graph showing binding of hIgG1 isotype control Ab or anti-KLK2 specific Ab to DU145 / KLK2_GPI tumor cells. [Figure 3A] 1 is a graph showing binding of hIgG1 isotype control Ab or anti-KLK2 specific Ab to PC3 parental cells. [Figure 3B] 1 is a graph showing binding of hIgG1 isotype control Ab or anti-KLK2 specific Ab to PC3 / KLK2_GPI. [Figure 3C] FIG. 13 is a graph showing binding of hIgG1 isotype control Ab or anti-KLK2 specific Ab to PC3 / PSMA / KLK2_GPI tumor cells. [Figure 4A] Figure 1 shows antibody-dependent cellular cytotoxicity (ADCC) against VCaP. PB-NK cells were co-cultured with tumor cells at an E:T ratio of 3:1. The number of viable tumor target cells was counted after 66 hours using an IncuCyte. The number of viable tumor targets remaining at the end of the assay was normalized to tumor-only wells to generate % viable tumor targets. [Figure 4B] Figure 1 shows antibody-dependent cellular cytotoxicity (ADCC) against DU145 parental cells. PB-NK cells were co-cultured with tumor cells at an E:T ratio of 3:1. The number of viable tumor target cells was counted after 66 hours using an IncuCyte. The number of viable tumor targets remaining at the end of the assay was normalized to tumor-only wells to generate % viable tumor targets. [Figure 4C]Graph showing antibody-dependent cellular cytotoxicity (ADCC) against DU145 / KLK2_GPI tumor cells. PB-NK cells were co-cultured with tumor cells at an E:T ratio of 3:1. The number of viable tumor target cells was counted after 66 hours using an IncuCyte. The number of viable tumor targets remaining at the end of the assay was normalized to tumor-only wells to generate % viable tumor targets. [Figure 5A] Graph showing ADCC against PC3 parental cells. PB-NK cells were co-cultured with tumor cells at an effector:tumor (E:T) ratio of 3:1 in the presence of anti-KLK2 or isotype control antibodies. The number of viable tumor target cells was counted after 66 hours using an IncuCyte. The number of viable tumor targets remaining at the end of the assay was normalized to tumor-only wells to generate % viable tumor targets. [Figure 5B] Graph showing ADCC against PC3 / PSMA / KLK2_GPI tumor cells. PB-NK cells were co-cultured with tumor cells at an effector:tumor (E:T) ratio of 3:1 in the presence of anti-KLK2 or isotype control antibodies. The number of viable tumor target cells was counted after 66 hours using an IncuCyte. The number of viable tumor targets remaining at the end of the assay was normalized to tumor-only wells to generate % viable tumor targets. [Figure 6] Figure 1 shows the cytotoxicity of KLK2xCD3 bispecific antibodies against VCaP, LnCap / KLK2, or DU145 / KLK2_GPI tumor cells. Primary T cells were co-cultured with tumor cells at an E:T ratio of 3:1 in the presence of anti-KLK2 or isotype control antibodies. Increasing concentrations of KLK2xCD3 bispecific Ab were mixed with tumor cells and T cells. The number of viable tumor target cells was counted after 72 hours using an IncuCyte. The number of viable tumor targets remaining at the end of the assay was normalized to tumor-only wells to generate % tumor lysis. [Figure 7A]1 is a graph showing CAR-T mediated cytotoxicity against VCaP. Untransduced (UTD) T cells or KLK2 CAR transduced T cells were co-cultured with tumor cells at an E:T ratio of 0.25:1. The number of viable tumor target cells was counted every 24 hours starting at time 0 using an IncuCyte. The number of viable tumor targets remaining at each time point was normalized to tumor only wells to generate % tumor viable tumor targets. [Figure 7B] 1 shows a graph depicting CAR-T-mediated cytotoxicity against parental DU145. Untransduced (UTD) T cells or KLK2 CAR-transduced T cells were co-cultured with tumor cells at an E:T ratio of 0.25:1. The number of viable tumor target cells was counted every 24 hours starting at time 0 using an IncuCyte. The number of viable tumor targets remaining at each time point was normalized to tumor-only wells to generate % tumor viable tumor targets. [Figure 7C] 1 shows a graph depicting CAR-T-mediated cytotoxicity against DU145 / KLK2_GPI tumor cells. Untransduced (UTD) T cells or KLK2 CAR-transduced T cells were co-cultured with tumor cells at an E:T ratio of 0.25:1. The number of viable tumor target cells was counted every 24 hours starting at time 0 using an IncuCyte. The number of viable tumor targets remaining at each time point was normalized against tumor-only wells to generate % tumor viable tumor targets. [Figure 8A] 8A is a graph showing the application of DU145 / KLK2_GPI and PC3 / PSMA / KLK2_GPI tumor cells in vivo. FIG. 8B is a graph showing the growth kinetics of DU145 / KLK2_GPI and PC3 / PSMA / KLK2_GPI. 10×106 DU145 / KLK2_GPI tumor cells or 0.5×106 PC3 / PSMA / KLK2_GPI tumor cells were implanted on day 0. Tumors were measured with a caliper every 3 or 4 days. [Figure 8B]8B is a graph showing the application of DU145 / KLK2_GPI and PC3 / PSMA / KLK2_GPI tumor cells in vivo. FIG. 8B is a graph showing the efficacy of anti-KLK 2 CAR T cells in DU145 / KLK2_GPI tumor model. 10×106 KLK2 CAR T cells were injected 11 days after tumor implantation. Tumors were measured with calipers every 3 or 4 days. KLK2 CAR T cells inhibited tumor progression and caused complete tumor regression. [Figure 9A] 1 is a graph showing how DU145+KLK2 cells can be used to screen CAR designs. A panel of CAR designs (CAR-a to CAR-bb) were transduced into NK-101 cells. All of these designs contained the same scFv binding domain specific for KLK2, followed by the CD8α hinge region and a variety of different signaling domain modules. [Figure 9B] 1 is a graph showing how DU145+KLK2 cells can be used to screen CAR designs. A panel of CAR designs (CAR-a to CAR-bb) were transduced into NK-101 cells. All of these designs contained the same scFv binding domain specific for KLK2, followed by the CD8α hinge region and a variety of different signaling domain modules. [Figure 9C] 1 is a graph showing how DU145+KLK2 cells can be used to screen CAR designs. A panel of CAR designs (CAR-a to CAR-bb) were transduced into NK-101 cells. All of these designs contained the same scFv binding domain specific for KLK2, followed by the CD8α hinge region and a variety of different signaling domain modules. [Figure 10A] 1 is a histogram demonstrating KLK2 surface expression in LnCap cells transduced with the KLK2-GPI fusion construct ("KLK2_GPI") described herein. Cells were stained with isotype control or anti-KLK2 clone KL2B1 directly conjugated to PE. [Figure 10B]1 is a histogram demonstrating KLK2 surface expression in LnCap cells transduced with the KLK2-GPI fusion construct ("KLK2_GPI") described herein. Cells were stained with isotype control or anti-KLK2 clone KL2B1 directly conjugated to PE. [Figure 10C] Graph showing KLK2 CAR-NK mediated cytotoxicity against LnCap parental (non-transduced) cells or LnCap+KLK2 target cells co-cultured at various E:T ratios. The number of viable tumor target cells was counted every 4 hours starting at time 0 using IncuCyte. The number of viable tumor targets remaining at each time point was normalized to tumor only wells to generate the % viable tumor targets remaining. The AUC of the % viable tumor target curve over 166 hours was determined for each E:T ratio and plotted as a dose-response curve. Natural or non-CAR specific killing can be determined from LnCap parental cells, while KLK2 CAR specific killing can be evaluated in LnCap+KLK2 target cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] A first aspect of the present disclosure is directed to a recombinant nucleic acid construct encoding a kallikrein-2 fusion protein, the recombinant nucleic acid construct comprising a first nucleotide sequence encoding kallikrein-2 (KLK2) or a fragment thereof and a second nucleotide sequence encoding a glycosylphosphatidylinositol (GPI) attachment sequence, the second nucleotide sequence encoding the GPI attachment sequence being located 3' to the first nucleotide sequence encoding kallikrein-2.

[0015] The first nucleotide sequence of the recombinant construct encoding kallikrein-2 can encode a mammalian kallikrein-2 polypeptide sequence, such as a human, murine, bovine, canine, feline, ovine, porcine, ursine, or simian kallikrein-2 polypeptide sequence.

[0016] In any embodiment, the first nucleotide sequence encoding kallikrein-2 of the recombinant construct encodes human kallikrein-2 (hKLK2). As described herein, human kallikrein-2 ("hKLK2" or "hK2") is a prostate cancer-specific kallikrein (see, e.g., Obiezu et al., "Human Tissue Kallikrein Gene Family: Applications in Cancer," Cancer Letters 224(1):1-22 (2005) and Nasser et al., "Human Tissue Kallikreins: Blood Levels and Response to Radiotherapy in Intermediate Risk Prostate Cancer," Radiother. Oncol. 124(3):427-432 (2017), which are incorporated by reference in their entireties).

[0017] In any embodiment, the first nucleotide sequence encodes a human kallikrein-2 comprising an amino acid sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO:4, or a functional fragment thereof.

[0018] [ka]

[0019] In any embodiment, the first nucleotide sequence encodes a human kallikrein-2 comprising the amino acid sequence of SEQ ID NO:4, or a functional fragment thereof.

[0020] In any embodiment, the first nucleotide sequence encoding kallikrein-2 comprises a nucleotide sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleotide sequence of SEQ ID NO:1, or any portion thereof.

[0021] [ka]

[0022] The nucleotide sequence encoding the signal sequence of kallikrein-2 is double underlined in SEQ ID NO: 1. Thus, in any embodiment, the nucleotide sequence encoding kallikrein-2 comprises the nucleotide sequence of SEQ ID NO: 1. In any embodiment, the nucleotide sequence encoding kallikrein-2 comprises the nucleotide sequence of SEQ ID NO: 1 without the signal sequence. In any embodiment, the nucleotide sequence encoding kallikrein-2 comprises a portion or fragment of the nucleotide sequence of SEQ ID NO: 1.

[0023] Glycosylphosphatidylinositol (GPI) is a complex glycolipid that functions as a membrane anchor for many cell surface proteins and is ubiquitous in eukaryotes. As described herein, the C-terminus of a GPI-anchored protein is linked to a GPI-anchored domain via a phosphoethanolamine bridge. The GPI-anchored domain contains a highly conserved core glycan structure that includes mannose(α1-2)mannose(α1-6)mannose(α1-4)glucosamine(α1-6)myo-inositol (Paulick & Bertozzi, "The Glycosylphosphatidylinositol Anchor: A Complex Membrane-Anchoring Structure for Proteins," Biochemistry 47(27):6991-7000 (2008), which is incorporated herein by reference in its entirety). The phospholipid tail attaches the GPI anchor to the cell membrane. The core glycan can be modified with a variety of side chains including, for example, phosphoethanolamine groups, mannose, galactose, sialic acid, or other sugars.

[0024] As used herein, the term "glycosylphosphatidylinositol attachment sequence" or "GPI attachment sequence" refers to an amino acid sequence that signals the covalent modification of a polypeptide sequence with a GPI anchor. In any embodiment, the GPI attachment sequence comprises a stretch of hydrophobic amino acids that is post-translationally cleaved and replaced with a GPI anchor via a transamidation reaction (see, e.g., Kinoshita, T., "Glycosylphosphatidylinositol (GPI) Anchors: Biochemistry and Cell Biology: Introduction to a Thematic Review Series," J. Lipid Res. 57(1):4-5 (2016), which is incorporated herein by reference in its entirety).

[0025] The recombinant nucleic acid constructs encoding the kallikrein-2 fusion proteins described herein include a second nucleotide sequence encoding a GPI attachment sequence, the nucleotide sequence encoding the GPI attachment sequence being located 3' to the kallikrein-2-encoding nucleotide sequence. Suitable GPI attachment sequences include, but are not limited to, attachment sequences found in known GPI-anchored proteins. For example, the GPI attachment sequence can be the GPI attachment sequence of alkaline phosphatase, the GPI attachment sequence of 5'-nucleotidase, the GPI attachment sequence of acetylcholinesterase, the GPI attachment sequence of dipeptidase, the GPI attachment sequence of LFA-3 (CD58), the GPI attachment sequence of neural cell adhesion molecule (NCAM), the GPI attachment sequence of decay accelerating factor (DAF; CD55), the GPI attachment sequence of CD59, the GPI attachment sequence of Thy-1 (CD90), the GPI attachment sequence of CD14, the GPI attachment sequence of carcinoembryonic antigen (CEA), the GPI attachment sequence of CD16β, and the GPI attachment sequence of folate binding protein (Paulick et al., "The Glycosylphosphatidylinositol Anchor: A Complex Membrane-Anchoring Structure for Proteins," Biochemistry, 1999, 144:1111-1111, and 1111-1111). 47(27):6991-7000 (2008), which is incorporated herein by reference in its entirety. Table 1 provides various exemplary GPI attachment sequences that can be encoded by the second nucleotide sequence of the recombinant constructs described herein.

[0026] [Table 1] *See, e.g., Varki A, Cummings RD, Esko JD, et al., editors. Essentials of Glycobiology [Internet]. 3rd edition. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 2015-2017. doi:10.1101 / glycobiology.3e.012 and Galian et al., "Efficient Glycosylphosphatidylinositol (GPI) Modification of Membrane Proteins Requires a C-Terminal Anchoring Signal of Marginal Hydrophobicity," J. Biol. Chem. 287(20):16399-16409 (2012), which are incorporated by reference in their entireties. ** The bolded amino acids are the GPI attachment site (the sequence to the right of the space is cleaved from the protein upon anchor addition).

[0027] In any embodiment, the second nucleotide sequence of the recombinant construct encodes a GPI attachment sequence comprising an amino acid sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of the amino acid sequences of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20.

[0028] Other known human GPI anchor domain proteins from which the GPI attachment sequence may be derived include melanotransferrin, CD109, cadherin 13 isoform 1 preprotein, reticulon 4 receptor-like 1 precursor, carbonic anhydrase 4 preprotein, neurotrimin isoform 1 precursor, mesothelin isoform 2 preprotein, CD48 antigen isoform 1 precursor, sperm acrosome membrane-associated protein 4 precursor, human reversion-inducing cysteine-rich protein with Kazal motif isoform 1 precursor, carcinoembryonic antigen-related cell adhesion molecule 8 precursor, and the like. precursor, UL16 binding protein 2 preproprotein, lymphocyte function associated antigen 3 isoform, human decoy receptor, carboxypeptidase M precursor, ecto-ADP-ribosyltransferase 3 isoform a precursor, GDNF family receptor alpha-4 isoform b precursor, GDNF family receptor alpha-3 preproprotein, brevican core protein isoform 1 precursor, semaphorin-7A isoform 1 preproprotein, CD177 antigen precursor, oligodendrocyte-myelin glycoprotein precursor, CD160 antigen precursor, and intelectin-1 precursor (see, e.g., Pierleoni et al., "R-PredGPI:A GPI Anchor Predictor," BMC Bioinformatics 9:392 (2008), which is incorporated by reference in its entirety). Thus, the second nucleotide sequence of the recombinant construct described herein can encode a GPI attachment sequence derived from any one of the aforementioned GPI anchor domain proteins.

[0029] In any embodiment, the second nucleotide sequence encoding a GPI attachment sequence encodes a GPI attachment sequence derived from an alkaline phosphatase, hi any embodiment, the second nucleotide sequence encoding a GPI attachment sequence encodes a GPI attachment sequence derived from a human alkaline phosphatase, e.g., placental alkaline phosphatase, germ cell alkaline phosphatase, intestinal-type alkaline phosphatase, or tissue non-specific alkaline phosphatase.

[0030] In any embodiment, the second nucleotide sequence of the recombinant construct encodes a human placental alkaline phosphatase GPI attachment sequence comprising an amino acid sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO:5, or a fragment thereof.

[0031] [ka]

[0032] In any embodiment, the second nucleotide sequence of the recombinant construct encodes the human placental alkaline phosphatase GPI attachment sequence of SEQ ID NO:5, or a fragment thereof.

[0033] In any embodiment, the nucleotide sequence encoding the GPI attachment sequence is derived from human placental alkaline phosphatase. For example, the GPI attachment sequence can be derived from human placental alkaline phosphatase (see, e.g., GenBank Accession Nos. AAA51706.1, AAA51708.1, or AAA51709.1). In any embodiment, the nucleotide sequence encoding the human placental alkaline phosphatase GPI attachment sequence comprises a nucleotide sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleotide sequence of SEQ ID NO:2. ACCACTGATGCTGCCCATCCTGGAAGGTCTGTGGTGCCTGCCTTGCTGCCTCTGCTGGCTGGCACTCTGCTGCTGCTGGAGACTGCCACTGCTCCC (SEQ ID NO: 2)

[0034] In any embodiment, the first nucleotide sequence and the second nucleotide sequence of the construct encode a kallikrein-2 fusion protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO:6, as follows:

[0035] [ka] (The signal sequence of KLK2 is double underlined; the PLAP GPI attachment sequence is bold; the cleavage site is bold underlined). In any embodiment, the first nucleotide sequence and the second nucleotide sequence of the construct encode a kallikrein-2 fusion protein comprising an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:6. In any embodiment, the first nucleotide sequence and the second nucleotide sequence of the construct encode the amino acid sequence of SEQ ID NO:6.

[0036] In any embodiment, the first nucleotide sequence and the second nucleotide sequence of the recombinant nucleic acid construct comprise a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleotide sequence of SEQ ID NO:3, as follows:

[0037] [ka] (The sequence encoding the KLK2 signal sequence is double underlined; the sequence encoding the PLAP GPI attachment sequence is bold; the stop codon is italicized.) In any embodiment, the recombinant nucleic acid construct comprises a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of SEQ ID NO:3. In any embodiment, the recombinant nucleic acid construct comprises the nucleotide sequence of SEQ ID NO:3.

[0038] The recombinant nucleic acid construct of the present disclosure is a nucleic acid molecule that contains a combination of two or more genetic elements that do not occur together in nature. Each recombinant nucleic acid construct may be in the form of linear DNA, circular DNA, i.e., may be placed in a vector (e.g., bacterial vector, viral vector, plasmid vector) or may contain a non-naturally occurring nucleotide sequence that may be integrated into a genome. Thus, the nucleic acid construct of the present disclosure may further comprise a promoter nucleotide sequence located 5' to the KLK2-encoding nucleotide sequence. A promoter is a DNA sequence that contains a binding site for RNA polymerase and initiates the transcription of a downstream nucleic acid sequence. Thus, in any embodiment, the nucleic acid construct described herein comprises a promoter nucleotide sequence.

[0039] A promoter can be a constitutively active promoter (i.e., a promoter that is constitutively active or in an "on" state), an inducible promoter (i.e., a promoter whose active or inactive state is controlled by an external stimulus, e.g., a particular temperature, compound, or the presence of a protein), a spatially restricted promoter (i.e., a transcriptional control element, enhancer, etc.) (e.g., a tissue-specific promoter, a cell type-specific promoter, etc.), or a temporally restricted promoter (i.e., the promoter is in an "on" or "off" state during particular stages of a biological process).

[0040] Suitable promoters can be derived from viruses, and therefore can be referred to as viral promoters, or can be derived from any organism, including prokaryotes or eukaryotes.Suitable promoters can be used to drive expression by any RNA polymerase (e.g., RNA polymerase I, RNA polymerase II, RNA polymerase III).Promoters can be viral promoters. Exemplary promoters include the SV40 early promoter, the mouse mammary tumor virus long terminal repeat (LTR) promoter; the adenovirus major late promoter (Ad MLP); the herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), the rous sarcoma virus (RSV) promoter, the human U6 small nuclear promoter (U6) (Miyagishi et al., "U6 Promoter-Driven siRNAs with Four Uridine 3'Overhangs Efficiently Suppress Targeted Gene Expression in Mammalian Cells," Nat. Biotechnol, 20:497-500 (2002), which is incorporated herein by reference in its entirety), an enhanced U6 promoter (e.g., Xia et al., "An Enhanced U6 Promoter for Synthesis of Short Hairpin RNA," Nucleic Acids Res. 31(17):e100 (2003), which is incorporated herein by reference in its entirety), human H1 promoter ("H1"), and the like.In any embodiment, the promoter is a phage promoter, for example, a T7 promoter engineered for expression in mammalian cells.

[0041] In any embodiment, the promoter is a eukaryotic RNA polymerase promoter or its derivative. Exemplary RNA polymerase II promoters include, but are not limited to, cytomegalovirus ("CMV") promoter, phosphoglycerate kinase-1 ("PGK-1") promoter, and elongation factor 1 alpha ("EF1α") promoter. In yet another embodiment, the promoter is a eukaryotic RNA polymerase III promoter selected from the group consisting of U6, H1, 56, 7SK, and derivatives thereof.

[0042] The RNA polymerase promoter may be of mammalian origin. Suitable mammalian promoters are well known in the art and include, but are not limited to, human promoters, murine promoters, bovine promoters, canine promoters, feline promoters, ovine promoters, porcine promoters, ursine promoters, and simian promoters.

[0043] In some embodiments, the promoter nucleotide sequence is an elongation factor 1 alpha (EF1α) promoter nucleotide sequence. An exemplary EF1α promoter nucleotide sequence is provided below as SEQ ID NO: 21. Alternatively, suitable promoter nucleotide sequences are provided below in Table 2.

[0044] [Table 2-1]

[0045] [Table 2-2]

[0046] [Table 2-3]

[0047] Some embodiments of the present disclosure relate to a vector comprising a recombinant nucleic acid construct as described herein (i.e., a recombinant nucleic acid construct encoding a kallikrein-2 fusion protein, the construct comprising a nucleotide sequence encoding kallikrein-2 (KLK2) and a nucleotide sequence encoding a glycosylphosphatidylinositol (GPI) attachment sequence, the GPI attachment sequence-encoding nucleotide sequence being located 3' to the KLK2-encoding nucleotide sequence). As used herein, the term vector refers to any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., that is capable of replicating and transferring genetic sequences between cells when associated with the appropriate control elements. Thus, the term includes cloning and expression vectors, as well as viral vectors. Thus, in some embodiments, the recombinant nucleic acid construct may be inserted into an expression system or vector in the proper sense (5' to 3') orientation and correct reading frame. The vector may contain elements necessary for transcription and / or translation of the kallikrein-2 fusion protein as disclosed herein.

[0048] In one embodiment, the vector is a plasmid. Many vectors suitable for containing the recombinant nucleic acid constructs disclosed herein are known to those skilled in the art, and many are commercially available. For example, the following vectors are provided: For eukaryotic cells: pcDNA3.1(+), Tornado (Litke & Jaffrey, "Highly Efficient Expression of Circular RNA Aptamer in Cells Using Autocatalytic Transcripts", Nat. Biotechnol. 37(6):667-675(2019), which is incorporated herein by reference in its entirety), pXT1, pSG5 (Stratagene), pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). However, any other vector may be used as long as it is compatible with the cell.

[0049] In another embodiment, the vector is a viral vector. The viral vector may be selected from any vector suitable for introducing the recombinant nucleic acid constructs described herein into a cell by any means to facilitate expression of the recombinant nucleic acid construct. Suitable viral vectors include vaccinia virus; poliovirus; adenovirus (see, e.g., International Publication Nos. WO 94 / 12649 to Gregory et al., WO 93 / 03769 to Crystal et al., WO 93 / 19191 to Haddada et al., WO 94 / 28938 to Wilson et al., WO 95 / 11984 to Gregory, and WO 95 / 00655 to Graham, which are incorporated by reference in their entireties); adeno-associated virus (see, e.g., Flannery et al., "Efficient Photoreceptor-Targeted Gene Expression In Vivo by Recombinant Adeno-Associated Virus," PNAS 94:6916-6921 (1997); Bennett et al., "Real-Time, Noninvasive In Vivo Assessment of Adeno-Associated Virus," PNAS 94:6916-6921 (1997)); Invest. Fluorescence Photography,” Hum.Gene.Ther.10:641-648(1999);Ali et al., "Gene Transfer Into the Mouse Retina Mediated by an Adeno-Associated Viral Vector," Hum.Mol.Genet.5:591-594 (1996); Samulski et al., "Helper-Free Stocks of Recombinant Adeno-Associated Viruses: Normal Integration Does not Require Viral Gene Mendelson et al., “Expression and Rescue of a Nonselected Marker from an Integrated AAV Vector,” Virol. 166:154-165 (1988); and Flotte et al., “Stable In Vivo Expression of the Cystic Fibrosis Transmembrane Conductance Regulator With an Adeno-Associated Virus Vector,” PNAS 90:10613-10617 (1993), which are incorporated by reference in their entireties herein); SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al.See, "Stable and Efficient Gene Transfer into the Retina Using an HIV-Based Lentiviral Vector," PNAS 94:10319-10323 (1997), which is incorporated herein by reference in its entirety); retroviral vectors, including, but not limited to, viral vectors based on murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus. Thus, in some embodiments, the viral vector is selected from the group consisting of adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, vaccinia vectors, retroviral vectors, and herpes simplex viral vectors.

[0050] An exemplary viral vector containing the KLK2-GPI recombinant construct has the sequence of SEQ ID NO:7, as follows:

[0051] Another aspect of the present disclosure pertains to a kallikrein-2 fusion protein encoded by a recombinant nucleic acid construct described herein or a vector comprising a recombinant nucleic acid construct according to the present disclosure.

[0052] Thus, in any embodiment, a kallikrein-2 fusion protein according to the present disclosure comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO:6, as follows:

[0053] [ka] (The signal sequence of KLK2 is double underlined; the PLAP GPI attachment sequence is in bold; the cleavage site is in bold underlined). In any embodiment, a kallikrein-2 fusion protein disclosed herein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:6. In some embodiments, a kallikrein-2 fusion protein comprises the amino acid sequence of SEQ ID NO:6.

[0054] As described above, a glycosylphosphatidylinositol (GPI) attachment sequence comprises a stretch of hydrophobic amino acids that is post-translationally cleaved and replaced with a GPI anchor via a transamidation reaction (see, e.g., Kinoshita, T., "Glycosylphosphatidylinositol (GPI) Anchors: Biochemistry and Cell Biology: Introduction to a Thematic Review Series," J. Lipid Res. 57(1):4-5 (2016), which is incorporated by reference in its entirety). Thus, in any embodiment, the GPI attachment sequence described herein comprises a cleavage site. According to such embodiments, a kallikrein-2 fusion protein according to the present disclosure does not comprise amino acid residues after the cleavage site. For example, in some embodiments, a kallikrein-2 fusion protein does not comprise amino acid residues 267-295 of SEQ ID NO: 6 when expressed in vivo.

[0055] In some embodiments, a kallikrein fusion protein of a protein of the disclosure does not include an amino-terminal signal sequence of the kallikrein portion of the fusion protein. Thus, in some embodiments, the kallikrein fusion protein does not include amino acid residues 1-17 of SEQ ID NO:6.

[0056] In any embodiment, the kallikrein-2 fusion protein comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO: 7. For example, the kallikrein-2 fusion protein can have an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 7. In any embodiment, the kallikrein-2 fusion protein has the amino acid sequence of SEQ ID NO: 7.

[0057] Another aspect of the disclosure relates to a preparation of cells, wherein the cells of the preparation have been modified to express a recombinant kallikrein-2 fusion construct described herein. The cells of the preparation have been modified to express on their surface a recombinant kallikrein-2 fusion protein, the kallikrein-2 fusion protein comprising a kallikrein-2 polypeptide sequence, a portion of a glycosylphosphatidylinositol (GPI) attachment sequence linked to the C-terminus of the kallikrein-2 polypeptide sequence, and a GPI anchor domain bound to the GPI attachment sequence portion.

[0058] As described in detail above, the kallikrein-2 portion of the fusion protein can include any mammalian kallikrein-2 polypeptide sequence, e.g., human, murine, bovine, canine, feline, ovine, porcine, ursine, or simian kallikrein-2 polypeptide sequence. In any embodiment, the kallikrein-2 portion of the fusion protein comprises a human kallikrein-2 protein or a polypeptide fragment thereof. For example, the human kallikrein-2 polypeptide sequence can have an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO:4 or amino acid residues 18-263 of SEQ ID NO:4.

[0059] A portion of the GPI attachment sequence may be derived from a GPI attachment sequence of a known GPI anchor domain protein. Exemplary GPI anchor domain proteins and GPI attachment sequences are provided above. In any embodiment, a portion of the GPI attachment sequence is derived from an alkaline phosphatase, such as human placental alkaline phosphatase.

[0060] In any embodiment, the portion of the GPI attachment sequence is a portion of the amino acid sequence of SEQ ID NO:5 or is an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO:5. In any embodiment, the GPI attachment sequence portion of the kallikrein-2 fusion proteins described herein comprises amino acid residues 1-3 of SEQ ID NO:5.

[0061] In any embodiment, the preparation of cells is engineered to express a recombinant kallikrein-2 fusion protein having an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO:6 or the amino acid sequence of SEQ ID NO:7. For example, the cells of the preparation may express on their surface a kallikrein-2 fusion protein comprising the amino acid sequence of SEQ ID NO:6 or an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:7.

[0062] In other embodiments, the cell preparation expresses or is modified with a recombinant kallikrein-2 fusion protein having the sequence of SEQ ID NO:6 or the amino acid sequence of SEQ ID NO:7 on its surface.

[0063] The expressed kallikrein-2 fusion protein further comprises a GPI anchor domain that is linked to the GPI attachment sequence via a GPI transamidase reaction that occurs post-translationally in vivo. The linked GPI anchor domain comprises a core glycan structure of ethanolamine-PO-6Manα1-2Manα1-6Manα1-4GlcNα1-6myo-inositol-1-PO-lipid.

[0064] As described above, the cells of the preparation can express the kallikrein-2 fusion protein from a recombinant nucleic acid construct according to the present disclosure (eg, a linear construct) or a vector comprising a recombinant nucleic acid construct according to the present disclosure.

[0065] The recombinant nucleic acid constructs and / or vectors described herein can be introduced into cells via transformation, particularly transduction, conjugation, lipofection, protoplast fusion, mobilization, particle bombardment, microinjection, transfection, or electroporation. In any embodiment, the cells of the preparation are stably transduced with a nucleic acid construct according to the present disclosure or a vector according to the present disclosure. In any embodiment, the cells of the preparation contain a recombinant nucleic acid construct stably integrated into the genome.

[0066] In any embodiment, the cells of the preparation are mammalian cells. Suitable mammalian cells include, but are not limited to, rodent cells (i.e., mouse cells or rat cells), rabbit cells, guinea pig cells, cat cells, dog cells, pig cells, horse cells, cow cells, sheep cells, monkey cells, non-human primate cells, or human cells. In any embodiment, the cells of the preparation are human cells.

[0067] Suitable preparations of cells comprising a recombinant nucleic acid construct or vector described herein include primary cells, immortalized or transformed embryonic, fetal, or adult cells at any stage of their lineage, e.g., totipotent, pluripotent, multipotent, or differentiated cells. Further suitable preparations of cells include cells from cell lines.

[0068] In any embodiment, the cells of the preparation are prostate cells, for example primary prostate cells, primary prostate cancer cells, prostate cancer cell lines, or non-tumor prostate cell lines.

[0069] Suitable exemplary non-tumor prostate cell lines include, but are not limited to, pRNS-1-1, RWPE-1, BPH1, and PIN cell lines (Cunningham & You, "In Vitro and In Vivo Model Systems Used in Prostate Cancer Research," J. Biol. Methods 2(1):e17 (2015), which is incorporated by reference in its entirety. RWPE-1 cells were immortalized with human papilloma virus (HPV) 18, then isolated and expanded for 6-7 weeks, are positive for AR / PSA mRNA / protein, and are androgen sensitive. BPH1 cells were isolated from BPH tissue obtained by transurethral resection from patients undergoing a procedure for urinary tract obstruction consistent with benign prostatic hypertrophy or hyperplasia (BPH). BPH1 cells were immortalized with SV40 large T antigen, and were AR / PSA negative and WT. They are p53 positive. Prostatic intraepithelial neoplasia (PIN) cells were isolated from patients with PIN and immortalized with HPV 18.

[0070] In any embodiment, the prostate cell is a hormone-naive prostate cancer (PCa) cell line. Suitable hormone-naive PCa cell lines include, but are not limited to, RWPE-2, LNCaP, LAPC-4, LAPC-9, VCaP, MDA PCa 2a / 2b, and LuCaP (Cunningham & You, "In Vitro and In Vivo Model Systems Used in Prostate Cancer Research," J.Biol.Methods 2(1):e17 (2015), which is incorporated herein by reference in its entirety). LNCaP cells were originally isolated from human metastatic prostate adenocarcinoma found in lymph nodes and are androgen-responsive for AR and PSA mRNA / protein expression. VCaP cells were originally isolated in 2001 as a result of spinal metastatic lesions. VCaP cells are positive for androgen sensitivity with wild-type AR mRNA / protein, and express PSA mRNA / protein, prostatic acid phosphatase (PAP), retinoblastoma (Rb), and p53 (with A248W mutation). The MDA PCa 2a / 2b cell line was derived from a single patient with spinal metastases during late stage disease, is androgen sensitive, tumorigenic in mice, expresses AR mRNA / protein, and expresses PSA mRNA / protein.

[0071] In any embodiment, the prostate cancer cell line is a castration-resistant cell line.Suitable castration-resistant cell lines include, but are not limited to, C4-2, C4-2B, 22Rv1, ARCaP (MDA PCa 1), PC3 and DU145 cell lines (Cunningham & You, "In Vitro and In Vivo Model Systems Used in Prostate Cancer Research," J.Biol.Methods 2(1):e17 (2015), which is incorporated herein by reference in its entirety).PC3 cells are isolated from spinal metastatic prostate tumors, are hormone-independent, do not express androgen receptor (AR) or PSA mRNA / protein, and express abnormal p53 with a C deletion at codon 138, causing a nonsense codon at 169 (causing loss of heterozygosity). DU145 cells are derived from a brain metastasis, are hormone-independent, do not express androgen receptor (AR) mRNA / protein or PSA mRNA / protein, and contain a heterozygous P223L / V274F p53 expression pattern.

[0072] In any embodiment, the cells of the preparation do not express endogenous KLK2, i.e., the cells express only the kallikrein-2 fusion proteins described herein. In any embodiment, the cells of the preparation express endogenous KLK2 and express the kallikrein-2 fusion proteins described herein.

[0073] A further aspect of the present disclosure is directed to a non-human animal comprising cells expressing a recombinant kallikrein-2 fusion protein on its surface, the recombinant fusion protein comprising a kallikrein-2 polypeptide sequence, a portion of a glycosylphosphatidylinositol (GPI) attachment sequence linked to the C-terminus of the kallikrein-2 polypeptide sequence, and a GPI anchor domain bound to the GPI attachment sequence portion.

[0074] In one embodiment, cells expressing recombinant kallikrein-2 fusion proteins are implanted into a non-human animal. In one embodiment, cells expressing recombinant kallikrein-2 fusion proteins are implanted into a rodent. In one embodiment, cells expressing recombinant kallikrein-2 fusion proteins are implanted into a mouse. In one embodiment, human cells expressing recombinant kallikrein-2 fusion proteins are implanted into an immunocompromised rodent, e.g., an immunocompromised mouse. In one embodiment, mouse cells expressing recombinant kallikrein-2 fusion proteins are implanted into a syngeneic mouse.

[0075] In another embodiment, a recombinant nucleic acid construct encoding a kallikrein-2 fusion protein is stably integrated into the genome of a non-human animal to produce a transgenic non-human animal capable of expressing the kallikrein-2 fusion protein on the surface of all or specific subtypes of the cells of the non-human animal described herein.

[0076] The recombinant nucleic acid construct encoding the kallikrein-2 fusion protein as described above can be integrated into the genome of a non-human animal by any standard method known to those skilled in the art. Any of a variety of techniques known in the art can be used to introduce the transgene into the animal to generate a line of transgenic animals (see, for example, Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratory, 1986); Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratory, 1994), and U.S. Patent Nos. 5,602,299 to Lazzarini; 5,175,384 to Krimpenfort; 6,066,778 to Ginsburg; and 6,037,521 to Sato et al., which are incorporated herein by reference in their entirety). Such techniques include pronuclear microinjection (U.S. Pat. No. 4,873,191 to Wagner et al., which is incorporated herein by reference in its entirety), retrovirus-mediated gene transfer into the germ line (Van der Putten et al. Proc. Natl. Acad. Sci. USA 82:6148-6152 (1985), which is incorporated herein by reference in its entirety); gene targeting in embryonic stem cells (Thompson et al., Cell 56:313-321 (1989), which is incorporated herein by reference in its entirety); electroporation of embryos (Lo et al., Mol. Cell. Biol. 3:1803-1814 (1983), which is incorporated herein by reference in its entirety); and sperm-mediated gene transfer (Lavitrano et al., Cell 57:717-723 (1989), which is incorporated herein by reference in its entirety.

[0077] In any embodiment, embryonic cells at various developmental stages can be used to introduce transgenes to generate transgenic animals. Different methods are used depending on the developmental stage of embryonic cells. Zygotes are good targets for microinjection, and methods for microinjecting zygotes are well known (see U.S. Pat. No. 4,873,191 to Wagner et al., which is incorporated herein by reference in its entirety). Using zygotes as targets for gene introduction has a great advantage in that in most cases, the injected DNA will be integrated into the host genome before the first cleavage (see Brinster et al., Proc. Natl. Acad. Sci. USA 82:4438-4442 (1985), which is incorporated herein by reference in its entirety). As a result, all cells of the transgenic non-human animal will carry the integrated transgene.

[0078] The transgenic animals of the present invention can also be produced by introducing the targeting vector into embryonic stem (ES) cells. ES cells are obtained by culturing preimplantation embryos in vitro under appropriate conditions (Evans et al., Nature 292:154-156 (1981); Bradley et al., Nature 309:255-258 (1984); Gossler et al., Proc. Natl. Acad. Sci. USA 83:9065-9069 (1986); Robertson et al., Nature 322:445-448 (1986), which are incorporated herein by reference in their entirety). Transgenes can be efficiently introduced into ES cells by DNA transfection using various methods known in the art, including electroporation, calcium phosphate co-precipitation, protoplast or spheroplast fusion, lipofection, and DEAE-dextran mediated transfection. Transgenes can also be introduced into ES cells by retrovirus-mediated transduction or microinjection. Such transfected ES cells can then colonize the embryo after introduction into the blastocoel of the blastocyst stage embryo and contribute to the germline of the resulting chimeric animal (reviewed in Jaenisch, Science 240:1468-1474 (1988), which is incorporated herein by reference in its entirety). Prior to introduction of the transfected ES cells into the blastocoel, the transfected ES cells can be subjected to various selection protocols to enrich for ES cells that have incorporated the transgene, if the transgene provides a means for such selection.

[0079] Furthermore, retroviral infection can also be used to introduce transgenes into non-human animals. Developing non-human embryos can be cultured in vitro until the blastocyst stage. During this time, dividing cells can be targeted for retroviral infection (Janenich, Proc. Natl. Acad. Sci. USA 73:1260-1264 (1976), which is incorporated herein by reference in its entirety). The viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al., Proc. Natl. Acad. Sci. USA 82:6927-6931 (1985); Van der Putten et al. Proc. Natl. Acad. Sci. USA 82:6148-6152 (1985)). Transfection can be easily and efficiently obtained by culturing dividing cells on a monolayer of virus-producing cells. Alternatively, infection can be performed at a later stage. Additional means of using retroviruses or retroviral vectors to generate transgenic animals known in the art include microinjection of retroviral particles or mitomycin C-treated cells producing retrovirus into the perivitelline space of fertilized eggs or early embryos (WO 90 / 08832 to Onions, which is incorporated herein by reference in its entirety).

[0080] In any embodiment, the transgenic non-human animal expresses the kallikrein-2 fusion protein on all surfaces of the cells. In any embodiment, the transgenic non-human animal expresses the kallikrein-2 fusion protein in some, but not all, of its cells. That is, the expression of the fusion protein is controlled by a cell-specific promoter and / or enhancer element located upstream of the transgene. In one embodiment, the transgenic non-human animal expresses the kallikrein-2 fusion protein only in prostate cells. According to this embodiment of the present disclosure, a prostate cell-specific promoter sequence is operably linked to a recombinant nucleic acid construct encoding the kallikrein-2 fusion protein. Suitable prostate-specific promoters include, but are not limited to, the prostate-specific antigen (PSA) promoter, the probasin promoter, the prostate-specific membrane antigen (PSMA), and the mouse mammary tumor virus (MMTV LTR) promoter. Expression constructs or cloning constructs suitable for driving transgene expression in transgenic animals are well known in the art. Other components of the expression construct include a strong polyadenylation site, appropriate restriction endonuclease sites, and an intron to ensure that the transcript is spliced.

[0081] The recombinant nucleic acid construct encoding the kallikrein-2 fusion protein can be inserted into any non-human animal. Preferably, the animal is a rodent, and more preferably, the animal is a mouse. Suitable strains of mice commonly used in the generation of transgenic models include, but are not limited to, CD-1® Nude mice, NU / NU mice, BALB / C Nude mice, BALB / C mice, NIH-III mice, SCID® mice, outbred SCID® mice, SCID Beige mice, C3H mice, C57BL / 6 mice, DBA / 2 mice, FVB mice, CB17 mice, 129 mice, SJL mice, B6C3F1 mice, BDF1 mice, CDF1 mice, CB6F1 mice, CF-1 mice, Swiss Webster mice, SKH1 mice, PGP mice, and B6SJL mice.

[0082] In any embodiment, a recombinant nucleic acid construct encoding a kallikrein-2 fusion protein is introduced into a non-murine mammal, such as a sheep, goat, pig, dog, cat, monkey, chimpanzee, hamster, rabbit, cow, and guinea pig (see, e.g., Kim et al., "Development of a Positive Method for Male Stem-cell Mediated Gene-transfer in Mouse and Pig," Mol. Reprod. Dev. 46(4):515-526 (1997); Houdebine, "The Production of Pharmaceutical Proteins from the Milk of Transgenic Animals," Reprod. Nutr. Dev. 35(6):609-617 (1995); Petters, "Transgenic Livestock as Genetic Models of Human Disease," Reprod. Fertil. Dev. 6(5):643-645 (1994); Schnieke et al., "Human Factor IX Transgenic Sheep Produced by Transfer of See, "Nuclei from Transfected Fetal Fibroblasts," Science 278(5346):2130-2133 (1997); Amoah & Gelaye, "Biotechnology Advances in Goat Reproduction," J. Animal Science 75(2):578-585 (1997), which are incorporated by reference in their entireties.

[0083] The transgenic animals are screened and evaluated to select transgenic animals that have a phenotype in which the kallikrein-2 fusion protein is specifically expressed in all cells or a subset of cells, such as prostate cells. Initial screening can be performed, for example, using Southern blot analysis or PCR techniques, and the animal cells are analyzed to confirm that the integration of the transgene has occurred. The level of transgene mRNA expression in the cells of the transgenic animals can also be evaluated using techniques including, but not limited to, Northern blot analysis, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR) of tissue samples obtained from the animals. In addition, the surface expression of the kallikrein-2 fusion protein can be evaluated by flow cytometry using human-specific anti-kallikrein-2 antibodies described herein (e.g., antibodies KL2B1, KL2B53, and KL2B30).

[0084] Another aspect of the present disclosure is directed to a method for identifying a kallikrein-2 targeted therapeutic agent. In any embodiment, the therapeutic kallikrein-2 targeting agent is a targeting agent that binds to kallikrein-2 and causes a therapeutic endpoint (e.g., induces cell death). In any embodiment, the therapeutic kallikrein-2 targeting agent is a targeting agent that directly binds to kallikrein-2 or otherwise interacts with kallikrein-2 to modulate the expression, activity, or function of kallikrein-2. In any embodiment, the therapeutic kallikrein-2 targeting agent is a targeting agent that binds to kallikrein-2 or otherwise interacts with kallikrein-2 to deliver an active agent to cells that express kallikrein-2 on their surface. In any embodiment, a therapeutic kallikrein-2 targeting agent is a targeting agent that simultaneously binds to kallikrein-2 and to immune cells (e.g., T lymphocytes, natural killer cells, macrophages, iPSC-derived T cells, or iPSC-derived NK cells) and mediates immune cell killing of cells that express kallikrein-2 on their surface.

[0085] According to this aspect of the disclosure, a method of identifying a kallikrein-2 targeting agent includes providing a preparation of cells as described herein, wherein the cells of the preparation express on their surface a kallikrein-2 fusion protein (e.g., a fusion protein comprising a kallikrein-2 polypeptide sequence, a portion of a glycosylphosphatidylinositol (GPI) attachment sequence linked to the C-terminus of the kallikrein-2 polypeptide sequence, and a GPI anchor domain attached to the GPI attachment sequence portion). The method further includes administering a candidate kallikrein-2 targeting agent to the preparation of cells and determining, based on the administration, whether the candidate agent binds to kallikrein-2 or otherwise alters the expression, function, or activity of kallikrein-2.

[0086] In any embodiment, the method further comprises providing a second preparation of cells, the cells of the second preparation not being modified to express a kallikrein-2 fusion protein as described herein. A comparison of the endpoints utilized to determine whether the candidate agent binds to kallikrein-2 or otherwise modifies the function, expression or activity of kallikrein-2 between the cell preparation modified to express the kallikrein-2 fusion protein and the cell preparation not expressing the kallikrein-2 fusion protein (i.e., the control cell preparation) demonstrates the kallikrein-2 antigen specificity of the candidate agent. In any embodiment, the second cell preparation is isogenic to the cell preparation modified to express the kallikrein-2 fusion protein.

[0087] Suitable preparations of cells for use in the methods described herein are described in detail above.In any embodiment, the preparation of cells is a preparation of cancer cells.In any embodiment, the preparation of cells is a preparation of prostate cancer (PCa) cells.

[0088] Alternatively, the method includes providing a non-human animal comprising cells expressing a recombinant kallikrein-2 fusion protein on its surface. As described above, the kallikrein-2 fusion protein of the non-human animal comprises a kallikrein-2 polypeptide sequence, a portion of a glycosylphosphatidylinositol (GPI) attachment sequence linked to the C-terminus of the kallikrein-2 polypeptide sequence, and a GPI anchor domain bound to the GPI attachment sequence portion. The method further includes administering a candidate kallikrein-2 targeted therapeutic agent to the non-human animal and determining whether the candidate agent binds to kallikrein-2 based on the administration. The candidate kallikrein-2 therapeutic agent can be administered to the non-human animal using any suitable means, for example, parenteral, topical, oral, intravenous, subcutaneous, intraperitoneal, intranasal, or intratumoral administration means.

[0089] In any embodiment, the method further comprises providing a second non-human animal that does not comprise cells modified to express a kallikrein-2 fusion protein as described herein. A comparison of the endpoints utilized to determine whether a candidate agent binds to kallikrein-2 or otherwise modifies the function, expression or activity of kallikrein-2 between the non-human animal that comprises the cell preparation modified to express a kallikrein-2 fusion protein and the non-human animal lacking such modified cells demonstrates the kallikrein-2 antigen specificity of the candidate agent. In any embodiment, the second non-human animal is isogenic to the non-human animal that comprises the cells modified to express a kallikrein-2 fusion protein.

[0090] Suitable non-human animals according to the present disclosure are described in more detail above.

[0091] According to these methods, the candidate agent is any candidate kallikrein-2 targeted therapeutic. Suitable candidate targeted therapeutic agents include, but are not limited to, any chemical or pharmaceutical entity (e.g., small molecule kallikrein-2 binding agents), biological kallikrein-2 binding molecules (e.g., kallikrein-2 binding peptides, anti-kallikrein-2 antibodies, antibody fragments, monobodies, etc.), kallikrein-2 chimeric antigen receptor (CAR) T or NK cell therapy.

[0092] In any embodiment, the candidate kallikrein-2 targeting agent comprises a detectable label (e.g., the agent can be directly or indirectly detectable). In some cases, the candidate kallikrein-2 targeting agent is directly labeled (e.g., the agent can include a directly detectable adduct, such as a fluorescent adduct). In some cases, the candidate agent is indirectly labeled (e.g., the agent can include an indirectly detectable adduct, such as biotin).

[0093] In any embodiment, determining whether a candidate kallikrein-2 targeting agent binds to or otherwise interacts with a kallikrein-2 fusion protein can be accomplished by measuring the amount of candidate agent bound to cells expressing the kallikrein-2 fusion protein. Measuring the amount of candidate agent bound to cells expressing the kallikrein-2 fusion protein can provide a qualitative or quantitative result. In any embodiment, the measurement can be performed using flow cytometry, ELISA, or any other method that can quantitatively measure the amount of candidate agent present or bound to cells expressing the kallikrein-2 fusion protein. The amount (level) of bound candidate agent can be expressed in any unit relevant to the particular assay (e.g., fluorescence units, e.g., mean fluorescence intensity (MFI)), or can be expressed as an absolute value with a defined unit (e.g., number of molecules (e.g., number of moles), number of protein molecules, concentration of agent, etc.). Furthermore, the quantitatively measured amount (level) can be compared to a reference amount to derive a normalized value that represents the normalized measured amount.

[0094] In any embodiment, determining whether a candidate agent is a kallikrein-2 targeted therapeutic or otherwise interacts with a kallikrein-2 fusion protein can be accomplished by measuring a downstream therapeutic endpoint, such as antibody-dependent cellular cytotoxicity or complement-dependent cytotoxicity. Methods for measuring cytotoxicity, cell death, and / or cell viability are well known to those of skill in the art.

[0095] The following examples are provided to further illustrate some of the embodiments disclosed herein. These examples are intended to be illustrative and not limiting of the embodiments of the present disclosure. Likewise, the present invention is not limited to any particular preferred embodiment described herein. Indeed, many modifications and variations of the present invention may be apparent to those skilled in the art upon reading this specification, and such variations may be made without departing from the spirit or scope of the present invention. Therefore, the present invention is limited only by the appended claims, and the full scope of equivalents to which these claims are entitled. EXAMPLES

[0096] Example 1 - Cell surface expression of kallikrein-2 fusion proteins The huKLK2_GPI gene was successfully cloned into the pCDH Neo vector at the 5'XbaI and 3'BamHI restriction sites (SEQ ID NO: 7). The sequence of the scaled-up plasmid DNA was confirmed. Lentivirus was produced in HEK293TN cells and transduced into DU145 cells in complete medium (EMEM+10%FBS+1xMEM-NEAA+1xSodium Pyruvate) containing Transdux™. Cells transduced with the KLK2-GPI gene were selected in 1mg / mL Geneticin and analyzed for KLK2 surface expression by flow cytometry. Surface expression of KLK2 was assessed using the KL2B1 antibody (Janssen) conjugated with phycoerythrin. Surface expression was also assessed with a KLK2 antibody obtained from R&D Systems (human kallikrein 2 antibody; clone 426723; R&D Systems; catalog number MAB4104), followed by a secondary goat anti-mouse detection antibody conjugated to phycoerythrin (Southern Biotech; catalog number 1030-09). Expression of KLK2-GPI was detected on the cell surface of transduced cells by both the Janssen antibody (Figure 1 and Table 3) and the R&D Systems antibody.

[0097] [Table 3]

[0098] Example 2 - Evaluation of DU145 / KLK2_GPI and PC3 / KLK2_GPI cell lines GPI-anchored KLK2 was engineered into DU145 or PC3 prostate tumor cell lines as described in Example 1 above. KLK2 surface expression was confirmed by flow cytometry using aKLK2-specific antibody (Ab) (clone KL2B1, KL2B30, or KL2B53) (Figures 2A-C). KL2B1, KL2B30, and KL2B53 recognize different epitopes on the KLK2 protein and show different binding affinities to VCaP cells (Figure 2A). In contrast, these Abs did not recognize parental DU145 or PC3 tumor cells that did not express KLK2 (Figures 2B and 3A). Expression of GPI-anchored KLK2 resulted in the binding of these Abs to engineered DU145 / KLK2_GPI and PC3 / KLK2_GPI tumor cells (Figures 2C and 3B). Co-expression of KLK2_GPI and PSMA was also possible, generating cell lines positive for both KLK2 and PSMA, useful for validation of dual-targeting therapeutic strategies (Figure 3C).

[0099] Three different therapeutic modalities were evaluated in DU145 / KLK2_GPI and PC3 / KLK2_GPI cell lines - (1) aKLK2 antibody-dependent cellular cytotoxicity (ADCC), (2) KLK2×CD3 bispecific antibody, and (3) aKLK2 CAR-T cells.

[0100] aKLK2-mediated ADCC assay For aKLK2-mediated ADCC assays, healthy donor peripheral blood NK cells (PB-NK) were co-cultured with VCaP, DU145, or PC3 prostate tumor cells with or without KLK2 expression (Figures 4A-C and 5A-B). The VCaP tumor cell line is the only tumor line that expresses endogenous KLK2 on the cell surface. These tumor cells can be lysed by PB-NK when aKLK2 antibody is present on either hIgG1 Fc or low-fucosylated Fc (LF) (Figure 4A). Isotype control (hIgG1 iso) or aKLK2 on silent Fc (aKLK2 silent) were unable to mediate ADCC against VCaP cells. The results in Figures 4A-C further demonstrate that aKLK2 on hIgG1 Fc or LF mediated ADCC in a dose-dependent manner against DU145 / KLK2_GPI, but not against DU145 parental cells that do not express KLK2. The hypofucosylated aKLK2 (aKLK2 LF) Ab was more potent than the same antibody against VCaP or wild-type human IgG1 Fc (aKLK2 hIgG1) against DU145 / KLK2_GPI, indicating that LF Ab enhances ADCC compared to normal fucose hIgG1. The isotype control (hIgG1 iso) or aKLK2 on silent Fc (aKLK2 silent) failed to mediate ADCC against DU145 / KLK2_GPI tumor cells. Similar results were observed in PC3 / KLK2_GPI prostate tumor cells (Figures 5A-B). These findings demonstrate the KLK2 antigen-directed killing of tumor targets and the utility of isogenic cell line pairs. Because multiple attempts to knock out KLK2 in VCaP tumor cells have failed, the use of new isogenic cell line pairs is important to demonstrate KLK2 antigen-specific responses with KLK2-targeted therapeutics.

[0101] KLK2×CD3 bispecific Ab-mediated killing assay For KLK2×CD3 bispecific Ab-mediated killing assay, healthy donor peripheral blood T cells were co-cultured with VCaP, LnCap / KLK2, or DU145 / KLK2_GPI tumor cells (FIG. 6). KLK2×CD3 bispecific Ab induced dose-dependent lysis of all three target cells, with the highest sensitivity for endogenously expressed VCaP cells. Although killing against DU145 / KLK2_GPI tumor cells was not as potent as VCaP, the maximum level of killing was similar between the two cell lines, indicating that KLK2 anchored via GPI was recognized by the bispecific Ab. Maximum killing against LnCap / KLK2 was significantly lower, potentially due to the relatively low expression level of KLK2 presented on LnCap compared to VCaP and DU145 / KLK2_GPI. KLK2 expression in LnCap / KLK2 cell line is not GPI anchored. This further demonstrates that GPI-anchored KLK2 is a useful tool for expressing KLK2 at high levels on the cell surface.

[0102] CAR-T Functionality Assessment For CAR-T functionality evaluation, healthy donor T cells were transduced with KLK2 CAR and co-cultured with VCaP, parental DU145, or DU145 / KLK2_GPI (Figure 7A-7C). Untransduced T cells (UTD) killed VCaP cells at a moderate level due to allorecognition, whereas KLK2 CAR-T killed VCaP cells more effectively than untransduced T cells, demonstrating CAR-mediated cytotoxicity (Figure 7A). Furthermore, KLK2 CAR-T showed KLK2-specific cell lysis against DU145 / KLK2_GPI but not against parental DU145 tumor cells (Figure 7B and Figure 7C). Again, these findings indicate that GPI-anchored KLK2-expressing prostate cell lines are important tools for demonstrating KLK2 specificity. It also further emphasizes the importance of syngeneic tumor cells for demonstrating KLK2 antigen-specific responses with KLK2-targeted therapeutics.

[0103] DU145+KLK2 cells can be used to screen CAR designs.

[0104] NK-101 cells stably expressing each design were sorted using an antibody against the binding domain of the CAR such that the population of CAR-expressing cells ranged from 86-99% purity. These effector NK-101+CAR cells were co-cultured with DU145 target tumor cells either expressing (Figure 9A) or not expressing (Figure 9B) KLK2 at an E:T ratio of 0.5:1. The number of viable tumor target cells remaining in each well was counted every 2 hours over a period of 5 days using an IncuCyte and normalized to tumor-only wells to generate % viable tumor target cells. To determine the amount of spontaneous killing not mediated by the CAR, DU145 parental cells not expressing KLK2 were also tested. CAR-specific cytotoxicity was calculated using the formula: CAR-specific cytotoxicity = (AUC DU145親 )-(AUC DU145+KLK2 ) and plotted as in (Figure 9C). Controls also included non-transduced NK-101 cells and NK-101 cells expressing a non-specific CAR (NS CAR-c) that did not bind to KLK2 or anything else on the target cells.

[0105] While preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the art that various modifications, additions, substitutions, and the like, can be made therein without departing from the spirit of the invention, and therefore are considered to be within the scope of the invention as defined in the following claims.

Claims

1. A recombinant nucleic acid construct encoding a kallikrein-2 fusion protein, said construct comprising: a first nucleotide sequence encoding kallikrein-2 (KLK2) or a fragment thereof; a second nucleotide sequence encoding a glycosylphosphatidylinositol (GPI) attachment sequence, said second nucleotide sequence encoding said GPI attachment sequence being located 3' to said first nucleotide sequence encoding kallikrein-2; and a recombinant nucleic acid construct comprising the same.

2. a) The kallikrein-2 is human kallikrein-2; b) The first nucleotide sequence encodes a kallikrein-2 comprising the amino acid sequence of SEQ ID NO: 4 or a fragment thereof; c) The first nucleotide sequence encoding kallikrein-2 comprises the nucleotide sequence of SEQ ID NO: 1 or a fragment thereof; or d) The GPI attachment sequence is derived from alkaline phosphatase and optionally (I) the GPI attachment sequence is derived from human placental alkaline phosphatase; or (II) the second nucleotide sequence encodes a GPI attachment sequence comprising the amino acid sequence of SEQ ID NO: 5 or a fragment thereof, for example, the second nucleotide sequence encoding said GPI attachment sequence comprises the nucleotide sequence of SEQ ID NO:

2. The construct according to claim 1.

3. a) The first nucleotide sequence and the second nucleotide sequence of said construct encode a kallikrein-2 fusion protein comprising the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 7; b) The first nucleotide sequence and the second nucleotide sequence of said construct comprise nucleotide sequences having at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 3, and optionally said construct comprises the nucleotide sequence of SEQ ID NO: 3; and / or c) Further comprising a promoter nucleotide sequence located 5' to said first nucleotide sequence encoding kallikrein-2, and optionally said promoter nucleotide sequence is a mammalian promoter sequence, for example, said promoter nucleotide sequence is an EF1α promoter nucleotide sequence. The construct according to claim 1.

4. ​ A vector comprising the construct according to claim 1, optionally, the vector is a viral vector, for example, the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, a vaccinia vector, a retroviral vector, and a herpes simplex virus vector.

5. A cell comprising the recombinant construct according to any one of claims 1 to 3 or the vector according to claim 4.

6. A kallikrein-2 fusion protein encoded by the construct according to any one of claims 1 to 3 or the vector according to claim 4.

7. The kallikrein-2 fusion protein according to claim 6, wherein the fusion protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:

6.

8. A preparation of cells, wherein the cells of the preparation are modified to express a recombinant kallikrein-2 fusion protein on the surface, and the fusion protein is a kallikrein-2 polypeptide sequence, a part of a glycosylphosphatidylinositol (GPI) attachment sequence linked to the C-terminus of the kallikrein-2 polypeptide sequence, a GPI anchor domain bound to a part of the GPI attachment sequence, and comprises.

9. a) The kallikrein-2 polypeptide sequence is a human kallikrein-2 polypeptide sequence, b) The kallikrein-2 polypeptide sequence comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 4 or a fragment thereof, and optionally the kallikrein-2 polypeptide sequence comprises the amino acid sequence of SEQ ID NO: 4 or a fragment thereof. The preparation according to claim 8.

10. a) A part of the GPI attachment sequence is derived from alkaline phosphatase, b) A part of the GPI attachment sequence is derived from human placental alkaline phosphatase, c) A part of the GPI attachment sequence comprises a part of the amino acid sequence of SEQ ID NO: 5, d) The kallikrein-2 fusion protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 7, and optionally the kallikrein-2 fusion protein comprises the amino acid sequence of SEQ ID NO:

7. e) The cells of the preparation express the kallikrein-2 fusion protein derived from the recombinant construct according to any one of claims 1 to 3 or the vector according to claim 4, and optionally the cells of the preparation contain the recombinant construct stably integrated into the genome. f) The cells of the preparation are mammalian cells. g) The cells of the preparation are human cells or rodent cells, and optionally the rodent cells are mouse cells. h) The cells are prostate cells, and optionally the prostate cells are prostate cancer cells. i) The cells of the preparation do not express endogenous kallikrein-2, and / or j) The preparation of cells is a cell line. The preparation according to claim 8.

11. A non-human animal comprising the preparation of cells according to claim 8.

12. A non-human animal comprising cells expressing a recombinant kallikrein-2 fusion protein on the surface, wherein the fusion protein comprises a kallikrein-2 polypeptide sequence, a part of a glycosylphosphatidylinositol (GPI) attachment sequence linked to the C-terminus of the kallikrein-2 polypeptide sequence, and a GPI anchor domain bound to a part of the GPI attachment sequence. A non-human animal comprising the above.

13. a) The cells of the non-human animal are transduced with the recombinant construct according to any one of claims 1 to 3 or the vector according to claim 4. b) The recombinant construct according to any one of claims 1 to 3 is stably integrated into the genome of the non-human animal, and / or c) The non-human animal is a rodent, and optionally the rodent is a mouse. The non-human animal according to claim 12.

14. A method for identifying an agent that binds to kallikrein-2, the method comprising a) providing the preparation of cells according to claim 8, administering a candidate agent to the preparation of cells, and determining whether the candidate agent binds to kallikrein-2 based on the administering, and optionally the preparation of cells is a preparation of cancer cells, for example, the preparation of cells is a preparation of prostate cancer cells. Or b) providing the non-human animal according to claim 11, administering a candidate agent to the non-human animal, and determining whether the candidate agent binds to kallikrein-2 based on the administering. A method comprising the above.

15. a) The candidate agent is a candidate kallikrein-2 inhibitor, b) The candidate agent is an anti-kallikrein-2 antibody, and / or c) The candidate agent is a kallikrein-2 chimeric antigen receptor (CAR), The method according to claim 14.

Images