Engineered bibinding antibodies and uses thereof

Abstract

Described herein is an engineered bi-binding antibody that binds IL-13 and TSLP and its uses.Uses include the treatment of allergic conditions and respiratory conditions.Also described herein is a library that includes engineered bi-binding antibodies, as well as a method for producing engineered bi-binding antibodies, and the functional and biochemical characterization of the antibodies.

Description

[Technical field]

[0001] SEQUENCE LISTING STATEMENT This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on May 25, 2022, is named P-605548-PC.txt and is 14.8 kilobytes in size.

[0002] The present disclosure relates generally to a dual binding antibody that binds IL-13 and TSLP. In one embodiment, the antibody may be used to treat an allergic or respiratory condition. [Background technology]

[0003] IL-13 is a 12.3 kDa class I cytokine monomeric protein. It has a four alpha-helix bundle core topology typical of class I short helical cytokines and is structurally similar to its closely related cytokine IL-4, with low sequence identity but high structural identity. Together with IL-4, IL-13 has been shown to control immunoglobulin class switching to IgE in B cells and is involved in mast cell recruitment. IL-13 is a CD4 + It is secreted by Th2 cells, as well as type 2 innate lymphoid cells ILC2. It has been shown that IL-13 can induce the production of (TGF-β) and induces gene expression of MUC5AC and production of mucin in bronchial epithelial cells. IL-13 can also enhance contraction in smooth bronchial muscle cells. IL-13 binds to the IL-4Ra / IL-13Ra1 heterodimer complex, and upon binding, induces JAK signal transducer and STAT6-dependent signaling cascades, which then induce Th2 helper T cell differentiation, polarization of macrophages to the M2 "alternatively activated" phenotype, epithelial mucus production, smooth muscle contractility, and chemokine release.

[0004] IL-13 has been shown to be involved in defense against parasites, and in a knockout IL-13 mouse model, clearance of T. braziliensis was significantly delayed, and expulsion of T. muris was completely inhibited, despite an intact Th2-type response. Further studies showed that IL-13 is a double-edged sword: on the one hand, it plays an important role in defense against parasites, but IL-13 functions in the context of immune system dysregulation are also known.

[0005] IL-13 has been implicated in the pathogenesis of human asthma, as elevated levels of IL-13 mRNA and protein have been detected in the lungs of asthmatic patients, which correlate with the severity of the disease. Furthermore, human IL-13 gene polymorphisms leading to elevated IL-13 levels have been identified and are associated with asthma and atopy, and elevated IL-13 levels have been detected in the lungs of asthmatic patients.

[0006] Although IL-13 and IL-4 share similar receptors and signaling pathways, IL-13 has a distinct role in asthma that is independent of IL-4. In mouse models, administration of IL-13 alone has been shown to be sufficient to induce eosinophil-derived inflammation and mucus cell hyperplasia. Furthermore, specific blockade of IL-13, but not IL-4, is sufficient to reverse airway hyperresponsiveness and mucus production in mouse models. Furthermore, polymorphisms in the human IL-13 locus are known to be associated with increased susceptibility to asthma.

[0007] Therefore, specific inhibition of IL-13 signaling may have a positive therapeutic effect on asthmatics, or patients with other known allergic or respiratory conditions.

[0008] Thymic stromal lymphopoietin (TSLP) is a cytokine that signals through a heterodimeric receptor composed of the IL-7Rα subunit and TSLP-R, unique components with homology to the common gamma receptor-like chain. TSLP is expressed by epithelial cells of the thymus, lung, skin, intestine, and tonsils, as well as airway smooth muscle cells, lung fibroblasts, and stromal cells. These cells produce TSLP in response to proinflammatory stimuli, and TSLP leads to allergic inflammatory responses through its activity on a number of innate immune cells, including dendritic cells. TSLP can also promote the proliferation and differentiation of naive T cells into Th2 cells that express high levels of IL-4, IL-5, and IL-13. High levels of TSLP expression have been found in asthmatic lung epithelial cells and chronic atopic dermatitis lesions, suggesting a role for TSLP in allergic inflammation. Recent evidence also links TSLP to Th17 cell differentiation and Th17-derived inflammatory processes. Chronic allergic (atopic) asthma is often characterized by Th2-type inflammation, whereas nonallergic asthmatic inflammation is predominantly neutrophilic with a mixed Th1 and Th17 cytokine environment. Antagonists to TSLP are expected to be useful in treating inflammatory conditions.

[0009] Thus, there remains an unmet need for compositions and methods for the treatment of diseases and conditions induced by IL-13 and TSLP activation, such as allergic and respiratory conditions, including, but not limited to, asthma. Summary of the Invention

[0010] In one embodiment, the disclosure provides an isolated dual-binding antibody comprising three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3), wherein the CDRs have the sequences of SEQ ID NOs: 149-154. In another embodiment, the dual-binding antibody comprises a heavy chain variable domain (VH) and a light chain variable domain (VL) having the amino acid sequences of SEQ ID NOs: 155 and 156, or SEQ ID NOs: 157 and 158.

[0011] In one aspect, an isolated dual binding antibody is disclosed herein, wherein HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350, and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 359, 360, and 361, respectively.

[0012] In another embodiment, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 356 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 364, 360 and 371, respectively.

[0013] In another embodiment, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 362, 360 and 384, respectively.

[0014] In another embodiment, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 364, 360 and 384, respectively.

[0015] In another embodiment, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences shown in Table 9 or Table 5.

[0016] In one aspect, disclosed herein is an isolated dual binding antibody, the dual binding antibody comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, the VH domain comprising a set of complementarity determining regions (CDRs), HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 set forth as I HX1 YDGSNK (SEQ ID NO: 142), where HX1 is any amino acid, and the amino acid sequence of HCDR3 is AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acid), or the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, and the amino acid sequence of LCDR1 is described as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are any amino acid), the amino acid sequence of LCDR2 is described as DD LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCDR3 is described as QVWD LX5 LX6 SD LX7. VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acid), or comprises an antigen-binding domain portion of an antibody comprising a combination of (a) and (b).

[0017] In a related embodiment, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, and the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, HX11 is A, and HX12 is H. is selected from the group consisting of I, L, and M, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.

[0018] In further related embodiments of the isolated bibinding antibody, HX1 is W, HX2 is selected from the group consisting of A and S, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX12 is selected from the group consisting of I and L, LX1 is L, LX2 is I, LX3 is L, LX4 is selected from the group consisting of S and G, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.

[0019] In yet another related embodiment of the isolated bibinding antibody, the isolated bibinding antibody comprises the CDRs, HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, and LX7 is G, or HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, and LX7 is H; or HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, and LX7 is G.

[0020] In another related embodiment of the isolated bibinding antibody, the VH domain comprises the amino acid sequence set forth in SEQ ID NO:1, with at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), or a combination of a VH domain described in (a) and a VL domain described in (b), the total number of variant positions in the VH domain, the VL domain, or the combination thereof of the dual binding antibody is at least two.

[0021] In a further related embodiment, the at least one variant amino acid in the VH domain comprises a variant at position 106 (IMGT position 112) of SEQ ID NO: 1. In another further related embodiment, the amino acid sequence of the VH domain is selected from the sequences set forth in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In yet another further related embodiment, the at least one amino acid variant in the VL domain comprises a variant amino acid in a CDR region. In yet another further related embodiment, the variant amino acid in the VL domain comprises a variant at any of positions 26, 27, 31, or 96, or a combination thereof (IMGT position 27, 28, 38, or 115, or a combination thereof) of SEQ ID NO: 2. In another further related embodiment, there are at least two variants in the VL domain, and a second variant comprises a variant amino acid in a framework region. In yet another further related embodiment, the variant amino acid in the framework region comprises a variant at position 56 or 77 of SEQ ID NO:2, or a combination thereof (IMGT position 70 or 94, or a combination thereof).

[0022] In another related embodiment, the amino acid sequence of the VL domain is selected from the sequences set forth in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In yet another related embodiment, the amino acid sequence of the VH domain-VL domain pair is selected from the paired sequences set forth in SEQ ID NOs:4 and 3, SEQ ID NOs:6 and 5, SEQ ID NOs:8 and 7, SEQ ID NOs:10 and 9, SEQ ID NOs:12 and 11, SEQ ID NOs:14 and 13, SEQ ID NOs:16 and 15, SEQ ID NOs:18 and 17, SEQ ID NOs:20 and 19, SEQ ID NOs:22 and 21, SEQ ID NOs:24 and 23, SEQ ID NOs:26 and 25, SEQ ID NOs:28 and 27, SEQ ID NOs:30 and 29, SEQ ID NOs:32 and 31, SEQ ID NOs:34 and 33, SEQ ID NOs:36 and 35, SEQ ID NOs:38 and 37, SEQ ID NOs:40 and 39, SEQ ID NOs:42 and 41, SEQ ID NOs:44 and 43, SEQ ID NOs:46 and 45, SEQ ID NOs:48 and 47, SEQ ID NOs:50 and 49, SEQ ID NOs:52 and 51, and SEQ ID NOs:54 and 53.

[0023] In another embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 209 and 210.

[0024] In another embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 219 and 220.

[0025] In another embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 249 and 250.

[0026] In another embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 337 and 338.

[0027] In another embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences shown in Table 1 or Table 10.

[0028] In another related embodiment, the bibinding antibody comprises an IgG, Fv, scFv, Fab, F(ab')2, minibody, diabody, or triabody. In a further related embodiment, the IgG comprises an IgG1, IgG2, IgG3, or IgG4. In yet another related embodiment, the IgG comprises a mutant IgG that cannot bind to an antibody-dependent cellular cytotoxicity component.

[0029] In one aspect, disclosed herein is a composition comprising an isolated bibinding antibody and a pharma- ceutically acceptable carrier.

[0030] In one aspect, disclosed herein is a nucleic acid construct comprising a nucleic acid sequence encoding a dual binding antibody, said antibody comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, said VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth as I HX1 YDGSNK (SEQ ID NO: 142), where HX1 is any amino acid, and the amino acid sequence of HCDR3 is AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acid), or the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, and the amino acid sequence of LCDR1 is described as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are any amino acid), the amino acid sequence of LCDR2 is described as DD LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCDR3 is described as QVWD LX5 LX6 SD LX7. VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acid), or comprises an antigen-binding domain portion of an antibody comprising a combination of (a) and (b).

[0031] In a related aspect of the nucleic acid, the encoded amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, and the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, and HX11 is A. , HX12 is selected from the group consisting of I, L, and M, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.

[0032] In a related aspect of the nucleic acid, the encoded amino acid for HX1 is W, HX2 is selected from the group consisting of A and S, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX12 is selected from the group consisting of I and L, LX1 is L, LX2 is I, LX3 is L, LX4 is selected from the group consisting of S and G, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G. Further related embodiments are where the encoded amino acids for HX1 are W, HX2 are A, HX6 are E, HX7 are L, HX8 are T, HX9 are A, HX12 are I, LX4 are S, and LX7 are G, or HX1 is W, HX2 are A, HX6 are M, HX7 are L, HX8 are V, HX9 are A, HX12 are L, LX4 are S, and LX7 are H, or HX1 is W, HX2 are S, HX6 are E, HX7 are W, HX8 are V, HX9 are H, HX12 are L, LX4 are G, and LX7 is G.

[0033] In a related embodiment of the nucleic acid construct, the VH domain comprises the amino acid sequence set forth in SEQ ID NO:1 with at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), or a combination of a VH domain set forth in (a) and a VL domain set forth in (b), wherein the total number of variant positions in the encoded VH domain, encoded VL domain, or combination thereof is at least 2. In a further related embodiment, the sequence comprises two nucleic acid sequences, one encoding a variant dual binding antibody VH domain and one encoding a variant dual binding antibody VL domain. In a further related embodiment, the nucleic acid sequence encoding the VH domain is selected from the sequences set forth in SEQ ID NOs: 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 105, and 107. In another further related embodiment, the nucleic acid sequence encoding the VL domain is selected from the sequences set forth in SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, and 108.In yet another further related embodiment, the nucleic acid sequence encoding the dual antibody VH domain-VL domain pair is selected from the paired sequences set forth in SEQ ID NOs:57 and 58, SEQ ID NOs:59 and 60, SEQ ID NOs:61 and 62, SEQ ID NOs:63 and 64, SEQ ID NOs:65 and 66, SEQ ID NOs:67 and 68, SEQ ID NOs:69 and 70, SEQ ID NOs:71 and 72, SEQ ID NOs:73 and 74, SEQ ID NOs:75 and 76, SEQ ID NOs:77 and 78, SEQ ID NOs:79 and 80, SEQ ID NOs:81 and 82, SEQ ID NOs:83 and 84, SEQ ID NOs:85 and 86, SEQ ID NOs:87 and 88, SEQ ID NOs:89 and 90, SEQ ID NOs:91 and 92, SEQ ID NOs:93 and 94, SEQ ID NOs:95 and 96, SEQ ID NOs:97 and 98, SEQ ID NOs:99 and 100, SEQ ID NOs:101 and 102, SEQ ID NOs:103 and 104, SEQ ID NOs:105 and 106, and SEQ ID NOs:107 and 108.

[0034] In related embodiments of the nucleic acid construct, the antibody comprises an IgG, Fv, scFv, Fab, F(ab')2, minibody, diabody, or triabody. In further related embodiments, the IgG comprises a mutant IgG that is unable to bind to an antibody-dependent cellular cytotoxicity component.

[0035] In another related aspect, the nucleic acid construct further comprises a control sequence operably linked to the nucleic acid sequence.

[0036] In one aspect, disclosed herein is an expression vector comprising a nucleic acid construct encoding a dual binding antibody, the antibody comprising an antigen-binding domain portion of the antibody comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain.

[0037] In one aspect, disclosed herein is a host cell comprising an expression vector comprising a nucleic acid construct encoding a dual binding antibody, the antibody comprising an antibody antigen-binding domain portion comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain.

[0038] In one aspect, disclosed herein is a composition comprising a nucleic acid construct encoding a dual binding antibody and a pharma- ceutically acceptable carrier, the antibody comprising an antigen-binding domain portion of the antibody comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain.

[0039] In one aspect, disclosed herein is a method for producing a dual binding antibody comprising an antibody antigen binding domain portion comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, the method comprising culturing a host cell comprising an expression vector comprising a nucleic acid construct encoding a dual binding antibody, expressing the nucleic acid construct from the vector, the antibody comprising an antibody antigen binding domain portion comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, and isolating the dual binding antibody.

[0040] In one aspect, disclosed herein is a library of immunoglobulins or fragments thereof comprising an antigen binding domain portion of an antibody comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, said VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth as I HX1 YDGSNK (SEQ ID NO: 142), where HX1 is any amino acid, and the amino acid sequence of HCDR3 is AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acid), or the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, and the amino acid sequence of LCDR1 is described as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are any amino acid), the amino acid sequence of LCDR2 is described as DD LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCDR3 is described as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acid).

[0041] In a related embodiment of the library, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, and HX11 is A; HX12 is selected from the group consisting of I, L, and M, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.

[0042] In further related embodiments of the library, HX1 is W, HX2 is selected from the group consisting of A and S, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX12 is selected from the group consisting of I and L, LX1 is L, LX2 is I, LX3 is L, LX4 is selected from the group consisting of S and G, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.

[0043] In another further related embodiment of the library, HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, LX7 is G, HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, LX7 is H, or HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, and LX7 is G. In yet another further related embodiment of the library, the library comprises VH domains comprising the amino acid sequence set forth in SEQ ID NO:1, having at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or combinations thereof), 26, 27, 31, 51, 56, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 2 having at least one amino acid variant at any of positions 109, 110, 115, 120, 122, 124, 126, 127, 128, 130, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 300, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 35

[0044] In another related embodiment of the library, the immunoglobulins comprise an IgG, Fv, scFv, Fab, F(ab')2, minibody, diabody, or triabody.

[0045] In another related embodiment of the library, the IgG comprises a mutant IgG that is unable to bind to an antibody-dependent cellular cytotoxicity component.

[0046] In one aspect, disclosed herein is a method of treating a subject suffering from a disease or condition, including an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract; scleroderma; or a tumor or cancer, including Hodgkin's lymphoma, comprising administering to the subject an isolated bibinding antibody disclosed herein.

[0047] In a related embodiment of the method of treating a subject, the allergic or respiratory condition is asthma, allergic asthma, non-allergic asthma, severe asthma, mild asthma, chronic obstructive pulmonary disease (COPD), conditions involving airway inflammation including eosinophilia, fibrosis and excess mucus production, cystic fibrosis, allergic lung disease, airway hyperresponsiveness, goblet cell metaplasia, mucus hypersecretion, airway remodeling, pulmonary fibrosis, atopic diseases including atopic dermatitis, urticaria, eczema, allergic enterogastritis, and allergic rhinitis, or combinations thereof, or the inflammatory and / or autoimmune condition comprises inflammatory bowel disease (IBD) and liver conditions including cirrhosis or fibrosis, or combinations thereof. [Brief description of the drawings]

[0048] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication and any color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0049] The subject matter of engineered dual-binding antibodies is particularly pointed out and distinctly claimed in the concluding portion of this specification, however, these dual-binding antibodies, both as to their production and methods of use, together with their objects, features, and advantages, may best be understood by reference to the following detailed description when read in conjunction with the accompanying drawings.

[0050] [Figure 1A]1A and 1B show template antibody heavy chain (SEQ ID NO: 1) (FIG. 1A) and light chain (SEQ ID NO: 2) amino acid sequences (FIG. 1B), respectively, showing framework (FR) and complementarity determining region (CDR) regions. For the heavy (H) chain, the different regions are labeled FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4, and in some embodiments, referred to as HFR1, HCDR1, HFR2, HCDR2, HFR3, HCDR3, and HFR4. For the light (L) chain, the different regions are labeled FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4, and in some embodiments, referred to as LFR1, LCDR1, LFR2, LCDR2, LFR3, LCDR3, and LFR4. Below the template amino acid sequence, variant amino acids of the engineered dual binding clones are displayed and aligned within the CDR and FR regions. [Figure 1B] Same as above.

[0051] [Figure 2A] Figures 2A and 2B show bar graphs depicting binding of re-epitope antibodies displayed on yeast to recombinant human IL-13 (rh-IL-13) (Figure 2A) or recombinant human TSLP (rhTSLP) (Figure 2B). Figure 2A shows binding of isolated yeast surface-displayed anti-IL13 clones to 10 nM rh-IL-13. Figure 2B shows binding of isolated yeast surface-displayed anti-TSLP clones to 10 nM rhTSLP. Data were normalized to the yeast surface expression levels of each clone and to the anti-hIL-13 and anti-hTSLP mean fluorescence intensity (MFI) binding signals of positive control yeast clones. [Figure 2B] Same as above.

[0052] [Figure 3A]Figures 3A-3F show size exclusion chromatography (SEC) scans of human standard IgG1 (Figure 3A), BDG33.003 (Figure 3B), BDG33.004 (Figure 3C), BDG33.005 (Figure 3D), BDG33.023 (Figure 3E), and BDG33.025 (Figure 3F). Purified IgG was analyzed on a GE Superdex® 200 10 / 300 Increase (column volume (CV) = 25 mL) in PBS buffer at 0.5 mL / min. In the antibody scans shown in Figures 3B-3D, the leading peak corresponds to one characteristic of large aggregates (0.36 CV) and a second peak with a retention of approximately 13.2 mL (0.528 CV) is characteristic of normal human IgG. The area under the curve (AUC) peak ratios are approximately 23% misfolded and 77% folded IgG fractions, respectively. For the antibody scans shown in Figures 3E-3F, the leading peak corresponds to that characteristic of large diameter aggregates (0.36 CV), while the second peak with a retention of approximately 13.8 mL (0.55 CV) is characteristic of normal human IgG. The area under the curve (AUC) peak ratios are 97.3% folded and 2.8% misfolded for BDG33.023 (Figure 3E), and 98.5% folded and 1.5% misfolded for BDG33.025 (Figure 3F). [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above. [Figure 3E] Same as above. [Figure 3F] Same as above.

[0053] [Figure 4A]Figures 4A and 4B show differential scanning fluorimetry (DSF) analysis of the melting points of the indicated IgGs BDG33.023 (Figure 4A) and BDG33.025 (Figure 4B). The light grey dashed line in the top graph indicates the T-onset and the grey dashed lines indicate Tm1 and Tm2. The bottom graph is the first derivative of the measurements. Figure 4A: DSF of BDG33.023 T-onset of 64.2°C and first transition point at 67.7°C. Figure 4B: DSF of BDG33.025 T-onset of 56.4°C, first transition point at 60.9°C and second transition point at 67.4°C. [Figure 4B] Same as above.

[0054] [Figure 5A] Figures 5A-5F show surface plasmon resonance (SPR) analysis of antibodies binding to human IL-13, cynomolgus IL-13, and human TSLP. Representative SPR sonograms of BDG33.003 and BDG33.004 binding to IL-13 are shown in Figures 5A-5D. Recombinant human IL-13 (rh-IL-13) was tested at 800 nM in two-fold dilutions (Figures 5A-5B). Recombinant cynomolgus IL-13 (rc-IL-13) was tested at 200 nM in two-fold dilutions (Figures 5C-5D). Representative SPR sensorgrams of BDG33.003 and BDG33.004 binding to human TSLP (h-TSLP) are shown in Figures 5E and 5F. hTSLP served as the analyte at concentrations between 3.2 nM and 0.2 nM in two-fold dilutions (Figures 5E-F). Representative SPR sensorgrams of BDG33.023 and BDG33.025 binding to human IL-13 (h-IL-13) are shown in Figures 5G and 5H. hIL-13 served as the analyte at concentrations ranging from 20 nM to 0.6 nM in two-fold dilutions (Figures 5G-5H). [Figure 5B] Same as above. [Figure 5C] Same as above. [Figure 5D] Same as above. [Figure 5E] Same as above. [Figure 5F] Same as above. [Figure 5G] Same as above. [Figure 5H]Same as above.

[0055] [Figure 6A] Figures 6A-6E show ELISA EC50 binding of BDG33.023 and BDG33.025 to human TSLP, giant cell monkey (cynomolgus) TSLP, or giant cell monkey (cynomolgus) IL-13. Binding of BDG33.023 (filled circles) and BDG33.025 (filled squares) to human TSLP (Figure 6A-human TSLP). Binding of BDG33.023 to cynomolgus TSLP (Figure 6B-33.023 cynomolgus TSLP). Binding of BDG33.025 to cynomolgus TSLP (Figure 6C-33.025 cynomolgus TSLP). Binding of BDG33.023 to cynomolgus IL-13 (Figure 6D-33.023 cynomolgus IL-13). Binding of BDG33.025 to cynomolgus IL-13 (Figure 6E-33.025 cynomolgus IL-13). [Figure 6B] Same as above. [Figure 6C] Same as above. [Figure 6D] Same as above. [Figure 6E] Same as above.

[0056] [Figure 7A]Figures 7A-7D show competitive binding assays of antibodies to hTSLP or hIL-13. Figure 7A: The indicated antibodies (anti-TSLP control, anti-IL-13 control, BDG33.023, BDG33.025) were preincubated with increasing levels of hIL-13 and added to plates precoated with hIL-13. Binding of BDG33.023 and BDG33.025 to plate-bound hIL-13 was inhibited as soluble hIL-13 concentrations increased. Figure 7B: The indicated antibodies (anti-TSLP control, anti-IL-13 control, BDG33.023, BDG33.025) were preincubated with increasing levels of hTSLP and added to plates precoated with hTSLP. Binding of BDG33.023 and BDG33.025 to plate-bound hTSLP was inhibited as soluble hTSLP concentrations increased. Figure 7C: Antibodies (anti-TSLP control, anti-IL-13 control, BDG33.023, BDG33.025) were preincubated with increasing levels of hTSLP and added to plates precoated with hIL-13. BDG33.023 binding to IL-13 was inhibited as soluble hTSLP concentrations increased. Figure 7D: The indicated antibodies (anti-TSLP control, anti-IL-13 control, BDG33.023, BDG33.025) were preincubated with increasing levels of hIL-13 and added to plates precoated with hTSLP. BDG33.023 binding to plate-bound hTSLP was inhibited as soluble hIL-13 concentrations increased. Anti-TSLP and anti-IL-13 control antibodies showed binding only to and competed with their respective ligands. [Figure 7B] Same as above. [Figure 7C] Same as above. [Figure 7D] Same as above.

[0057] [Figure 8]Figure 8 shows the results of an ELISA specificity study comparing non-specific and specific binding of BDG330.23 and BDG33.025. ELISA plates were coated with hIL-13, hTSLP, and the irrelevant cytokines IL-2, IL-17, and IL-4. The BSA binding signal represents the assay background level.

[0058] [Figure 9] 9 shows the results of an IC50 inhibition assay measuring IgG-specific blocking of hTSLP binding to TSLP receptor (TSLP-R)-coated ELISA plates. The X-axis represents the concentration of competitors. Competitors: TSLP-R (closed circles) resulting in an IC50 of 3 nM, BGD33.023 (closed triangles) resulting in an IC50 of 0.41 nM.

[0059] [Figure 10] FIG. 10 shows a schematic of the HEK-Blue IL-13 system downstream signaling.

[0060] [Figure 11A]Figures 11A-11D show hIL-13 pSTAT6 signaling inhibition data. Results are based on stimulation of the IL-13 activation pathway in HEK-Blue cells by recombinant rh-IL-13 and inhibition of this stimulation by the indicated IgGs. HEK-Blue IL-13 cells (50,000 cells / well) were incubated with rh-IL-13 at various concentrations (0 nM-8 nM). IL-13 downstream signaling was quantified with QUANTI-Blue (Figure 11A) after 24 hours of incubation. hIL-13 downstream inhibition on HEK-BLUE IL-13 cells by engineered dual-conjugated antibodies was analyzed as follows: rh-IL-13 (0.4 nM) was incubated with the indicated antibodies at a range of antibody concentrations from 0 nM to 750 nM. The antibodies assayed were BDG33.002 (positive control), BDG33.003 (clone C2), and BDG33.006 (negative control), respectively (Figure 11B). Clones BDG33.023 and BDG33.025 were assayed at antibody concentration ranges from 0 nM to 100 nM (Figures 11C and 11D show 33.023 IL-13 pSTAT6 inhibition, and 33.025 IL-13 pSTAT6 inhibition, respectively). After incubation, the hIL-13 / IgG mixture was added to the cells and secreted placental alkaline phosphatase (SEAP) activity was quantified using QUANTI-Blue after 24 hours of incubation. Data shown are the average of triplicate experiments and error bars represent standard deviation. [Figure 11B] Same as above. [Figure 11C] Same as above. [Figure 11D] Same as above.

[0061] [Figure 12A]Figures 12A-12C show TSLP signaling pathway inhibition data. Inhibition of TSLP-dependent pSTAT5 signaling activation pathway and activation by BDG 33.023 in human leukemia MUTZ5 cells. Figure 12A shows flow cytometry analysis of MUTZ 5 CD127 (IL-7a) receptor and TSLP-R receptor expression as follows: unstained cells (panel a), cells stained for CD127+ (approximately 36% of the total cell population was labeled) (panel b), cells stained for TSLP-R+ (approximately 96% of the total cell population was labeled) (panel c), and cells stained for both TSLP-R+ and CD127+ (approximately 41% of the total cell population was labeled) (panel d) (Figure 12A). Figure 12B shows MUTZ5 pSTAT5 activation. EC50 of hTSLPphosphor-STAT5 (pSTAT5) activation in MUTZ5 cells. Percentage of positive cells represents pSTAT5 positive cells as a percentage of the parent population. Figure 12C shows inhibition of MUTZ5 pSTAT5 activation. IC50 of BDG33.023 inhibition of TSLP-dependent pSTAT5 activation in MUTZ5 cells. TSLP was preincubated with 0.48 pM to 500 pM BDG33.023 for 30 min and added to MUTZ5 cells. Positive cells represent the pSTAT5 positive population as a percentage of the parent population (Figure 12C). [Figure 12B] Same as above. [Figure 12C] Same as above.

[0062] [Figure 13] Figure 13 shows the retention time and calculated pI of some of the dual binding antibodies disclosed herein. The IgG marker retention time was 4.77 minutes.

[0063] [Figure 14A]Figures 14A-14C show several competitive ELISAs of dual-binding antibodies and 33.001 (tezepelumab) against TSLP. ELISA plates were coated with 50 ng / well of 33.001 overnight at 4°C. Dual-binding antibodies were diluted two-fold and pre-incubated with a constant concentration of 7 nM of TSLP-HIS for 1 h at room temperature. After blocking and washing steps, dual-binding antibody-TSLP mixtures were applied to the plates, incubated for 10 min, washed again, and then incubated with anti-HIS for 30 min. The results show that all tested dual-binding antibodies exhibited similar IC50s. [Figure 14B] Same as above. [Figure 14C] Same as above.

[0064] [Figure 15] 15 shows the results of nanoscale differential scanning fluorimetry (nanoDSF) analysis of some of the dual binding antibodies disclosed herein. The lambda chain Tm threshold was >65°C and the T-onset was >60°C.

[0065] [Figure 16A] 16A-16F show the results of SPR (surface plasmon resonance) analysis of some of the dual binding antibodies disclosed herein for human IL-13 and TSLP. [Figure 16B] Same as above. [Figure 16C] Same as above. [Figure 16D] Same as above. [Figure 16E] Same as above. [Figure 16F] Same as above.

[0066] [Figure 17A]Figures 17A and B show size exclusion chromatography (SEC) scans (Figure 17A) and nanoscale differential scanning fluorimetry (DSF) analysis of melting points (Figure 17B) for antibody BDG38.074. A representative analysis of melting points of the indicated IgGs was analyzed in duplicate. The light grey dashed line indicates T-onset, and the grey dashed lines indicate Tm1 and Tm2. Figure 17B shows the first derivative of the measurements. The DSF values ​​are summarized in Figure 15. [Figure 17B] Same as above.

[0067] [Figure 18A] Figures 18A-18D show the binding affinity of representative clone BDG38.74. Figure 18A shows the binding affinity of antibody BDG38.074 to IL-13. The results show that antibody BDG38.074 binds to human IL-13 with double-digit picomolar affinity. Figure 18B shows the binding affinity of antibody BDG38.074 to human TSLP. The results show that antibody BDG38.074 binds to human TSLP with double-digit picomolar affinity. Figure 18C shows the binding affinity of antibody BDG38.074 to cynomolgus IL-13. Figure 18D shows the binding affinity of antibody BDG38.074 to cynomolgus TSLP. [Figure 18B] Same as above. [Figure 18C] Same as above. [Figure 18D] Same as above.

[0068] [Figure 19A] Figures 19A and 19B show size exclusion chromatography (SEC) scans (Figure 19A) and nanoscale differential scanning fluorimetry (DSF) analysis of melting points (Figure 19B) for antibody BDG38.079. Representative DSF analysis (analyzed in duplicate) of melting points of the indicated IgGs is shown. The light grey dashed line indicates T-onset and the grey dashed lines indicate Tm1 and Tm2. Figure 19B is a graph of the first derivative of the measurements. The DSF values ​​are summarized in Figure 15. [Figure 19B] Same as above.

[0069] [Figure 20A] Figures 20A-20D show IL-13 and TSLP binding of representative clone BDG38.079. Figure 20A shows the binding affinity of antibody BDG38.079 to human IL-13. The results show that antibody BDG38.079 binds to human IL-13 with double-digit picomolar affinity. Figure 20B shows the binding affinity of antibody BDG38.079 to human TSLP. The results show that antibody BDG38.079 binds to human TSLP with single-digit picomolar affinity. Figure 20C shows the binding affinity of antibody BDG38.079 to cynomolgus IL-13. Figure 20D shows the binding affinity of antibody BDG38.079 to cynomolgus TSLP. [Figure 20B] Same as above. [Figure 20C] Same as above. [Figure 20D] Same as above.

[0070] [Figure 21A] Figures 21A and 21B show SPR (surface plasmon resonance) analysis of antibodies BDG38.074 and BDG38.079 for human or cynomolgus IL-13 or TSLP. [Figure 21B] Same as above.

[0071] [Figure 22]FIG. 22 shows that antibodies BDG38.074 and BDG38.079 inhibit IL-13 function in HEK reporter cell lines with double-digit picomolar affinity. hIL-13 pSTAT6 signaling inhibition data. Results are based on stimulation of the IL-13 activation pathway in HEK-Blue cells by recombinant rh-IL-13 and inhibition of this stimulation by the indicated IgGs. rh-IL-13 (0.4 nM) was incubated with the indicated antibodies at antibody concentrations ranging from 0 nM to 100 nM. After incubation, the hIL-13 / IgG mixture was added to the cells and secreted embryonic alkaline phosphatase (SEAP) activity was quantified with QUANTI-Blue after 24 hours of incubation. Data shown are the average of triplicate experiments and error bars represent standard deviation. Antibodies assayed were tralokinumab, BDG38.074, and BDG38.079, respectively.

[0072] [Figure 23] Figure 23 shows that antibodies BDG38.074 and BDG38.079 show similar functional inhibition to the anti-TSLP benchmark in the MUTZ-5 cell line. MUTZ5 cells were stimulated with human TSLP (hTSLP) and phosphorylated STAT5 (pSTAT5) staining was assessed by phospho-flow cytometry.

[0073] [Figure 24A]Figures 24A and 24B show the inhibition results of a representative clone. Figure 24A shows that antibodies BDG38.074 and BDG38.079 show similar inhibition of CD23 expression as the anti-IL-13 benchmark (tralokinumab). The IC50 of antibody inhibition of IL-13 was determined by measuring CD23 expression levels in monocytes. At the end of 48 hours of incubation of cells with different concentrations of antibodies, monocytes were detached from the bottom of the well and stained with CD3 (Bio Legend, CAT:300450), CD14 (Bio Legend, CAT:301814), CD19 (Bio Legend, CAT:302212), and CD23 (Bio Legend, CAT:338506) antibodies. The CD23 percentage of the CD14+ population was measured using a CytoFLEX flow cytometer (Beckman Coulter). Figure 24B shows that antibodies BDG38.074 and BDG38.079 inhibit TARC expression similar to the anti-TSLP benchmark (tezepelumab). The IC50 of antibody inhibition of hTSLP was determined by TARC inhibition. TARC levels were determined using the TARC DUOSET ELISA kit DY364 (R&D systems) according to the kit's instructions. The ELISA plate was read at 450 nm. Values ​​were analyzed using a standard sample curve. [Figure 24B] Same as above.

[0074] [Figure 25A] Figures 25A and 25B show size exclusion chromatography (SEC) scans (Figure 25A) and nanoscale differential scanning fluorimetry (DSF) analysis of melting points (Figure 25B) for antibody BDG38.094. Representative DSF analysis (analyzed in duplicate) of melting points of the indicated IgGs is shown. The light grey dashed line in the top graph indicates T-onset, and the grey dashed lines indicate Tm1 and Tm2. Figure 25B shows the first derivative of the measurements. The DSF values ​​are summarized in Table 11. [Figure 25B] Same as above.

[0075] [Figure 26A]Figures 26A-26D show the binding affinity of representative clones. Figure 26A shows the binding affinity of antibody BDG38.094 to human IL-13. Figure 26B shows the binding affinity of antibody BDG38.094 to human TSLP. Figure 26C shows the binding affinity of antibody BDG38.094 to cynomolgus IL-13. Figure 26B shows the binding affinity of antibody BDG38.094 to cynomolgus TSLP. [Figure 26B] Same as above. [Figure 26C] Same as above. [Figure 26D] Same as above.

[0076] [Figure 27A] Figures 27A and 27B show size exclusion chromatography (SEC) scans (Figure 27A) and nanoscale differential scanning fluorimetry (DSF) analysis of melting points (Figure 27B) for antibody BDG38.138. Representative DSF analysis (analyzed in duplicate) of melting points of the indicated IgGs is shown. The light grey dashed line in the top graph indicates T-onset, and the grey dashed lines indicate Tm1 and Tm2. Figure 27B shows the first derivative of the measurements. The DSF values ​​are summarized in Table 11. [Figure 27B] Same as above.

[0077] [Figure 28A] Figures 28A-28D show the binding affinity of representative clones. Figure 28A shows the binding affinity of antibody BDG38.138 to human IL-13. Figure 28B shows the binding affinity of antibody BDG38.138 to human TSLP. Figure 28C shows the binding affinity of antibody BDG38.138 to cynomolgus IL-13. Figure 28D shows the binding affinity of antibody BDG38.138 to cynomolgus TSLP. [Figure 28B] Same as above. [Figure 28C] Same as above. [Figure 28D] Same as above. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0078] In the following detailed description, numerous specific details are described to provide a complete understanding of the engineered dual-binding antibodies disclosed herein, including descriptions of their heavy and light chain variable regions. However, those skilled in the art will understand that the preparation and use of dual-binding antibodies may be carried out without these specific details in certain cases. In other cases, well-known methods, procedures, and components have not been described in detail so as not to obscure the disclosure provided herein.

[0079] Antigen binding sequences are conventionally located within the heavy and light chain variable region sequences of an antibody. These heavy and light chain variable regions may be engineered in certain cases to create new binding sites, for example, to create antibodies or fragments thereof that bind to different antigens or epitopes of different antigens. In some embodiments, engineering the sequence of the heavy chain variable region or the sequence of the light chain variable region, or both, as described herein, creates new binding sites for epitopes while maintaining the functionality of the antibody. In one embodiment, 21 specific sites within the heavy and light chain variable regions have been identified, and in certain embodiments, the presence of variant amino acids at these sites creates engineered dual binding antibodies or fragments thereof. In some embodiments, the 21 possible variant sites provide a unique platform for engineering dual binding antibodies or fragments thereof.

[0080] Disclosed herein are engineered bi-binding antibodies or fragments thereof in which either the heavy chain variable region or the light chain variable region, or both, are mutated to contain variant amino acids. In some embodiments, these engineered bi-binding antibodies may be identified and selected from libraries generated to contain variant amino acid residues at specific sites within the variable heavy chain region or the variable light chain region, or both. In some embodiments, these engineered bi-binding antibodies may be generated by specifically mutating target amino acid sites within the variable heavy chain region or the variable light chain region, or both. In some embodiments, these engineered bi-binding antibodies may be used in therapeutic methods to treat subjects suffering from allergic or respiratory conditions.

[0081] Engineered dual-binding antibodies As used herein, the term "dual binding antibody" refers to an antibody that has two binding specificities. In certain embodiments, the dual binding antibodies disclosed herein bind to IL-13 and TSLP.

[0082] In some embodiments, the disclosure provides isolated dual-binding antibodies comprising three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3) (see, e.g., Tables 8 and 9). In some embodiments, the CDRs have the sequences of SEQ ID NOs: 149-154. In some embodiments, the dual-binding antibodies comprise a heavy chain variable domain (VH) and a light chain variable domain (VL) having the amino acid sequences of SEQ ID NOs: 155 and 156, or SEQ ID NOs: 157 and 158.

[0083] In one embodiment, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 359, 360 and 361, respectively.

[0084] In another embodiment, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 356 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 364, 360 and 371, respectively.

[0085] In another embodiment, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 362, 360 and 384, respectively.

[0086] In another embodiment, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 364, 360 and 384, respectively.

[0087] In another embodiment, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences shown in Table 9 or Table 5.

[0088] In some embodiments, disclosed herein is an isolated bibinding antibody comprising three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3), (i) HCDR1 comprises the amino acid sequence of SEQ ID NO: 349 or 355, or the amino acid sequence of SEQ ID NO: 149 or SEQ ID NO: 136; (ii) HCDR2 comprises any one of the amino acid sequences of SEQ ID NOs: 350, 352, 354, and 356, or the amino acid sequence of SEQ ID NO: 150, or the sequence set forth as I HX1 YDGSNK (SEQ ID NO: 142), where HX1 is any amino acid; (iii) HCDR3 comprises one of the amino acid sequences of SEQ ID NOs: 351, 353, 357, and 358, or the amino acid sequence of SEQ ID NO: 151 or the sequence set forth as AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143), where HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acid; (iv) LCDR1 comprises one of the amino acid sequences of SEQ ID NOs: 359, 362, 364, 366, 369, and 375, or the amino acid sequence of SEQ ID NO: 152, or the sequence set forth as LX1, LX2, GSK LX3 V (SEQ ID NO: 144), wherein LX1, LX2, and LX3 are any amino acid; (v) LCDR2 comprises the amino acid sequence of SEQ ID NO: 360 or 367, or the amino acid sequence of SEQ ID NO: 153, or the sequence set forth as DD LX4 (SEQ ID NO: 145), where LX4 is any amino acid; (vi) LCDR3 comprises one of the amino acid sequences of SEQ ID NO: 361, 363, 365, 368, 370 to 374, 376 to 407, or the amino acid sequence of SEQ ID NO: 154, or a sequence set forth as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acid).

[0089] In some embodiments, an isolated bibinding antibody is disclosed herein, HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 359, 360 and 361, respectively; or HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 356 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 364, 360 and 371, respectively; or HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 362, 360 and 384, respectively; or HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 364, 360 and 384, respectively.

[0090] In some embodiments, an isolated dual binding antibody is disclosed herein, wherein HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences shown in Table 9 or Table 5.

[0091] In some embodiments, an isolated bibinding antibody is disclosed herein, wherein HX1 is W or S, HX2 is A or S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, Q, M, L, or V, HX7 is L, W, or Y, HX8 is V or T, HX9 is H, A, or S, HX10 is E, HX11 is A, and HX12 is I, L, or M; LX1 is N, L, or I, LX2 is L or I, LX3 is S or L, LX4 is S or G, LX5 is S or T, LX6 is S or G, and LX7 is H or G.

[0092] In some embodiments, an isolated bibinding antibody is disclosed herein, wherein HX1 is W, HX2 is A or S, HX6 is E or M, HX7 is L or W, HX8 is V or T, HX9 is H or A, HX12 is I or L, LX1 is L, LX2 is I, LX3 is L, LX4 is S or G, LX5 is S, LX6 is S, and LX7 is H or G.

[0093] In some embodiments, an isolated bibinding antibody is disclosed herein, (a) HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S and LX7 is G; or (b) HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S and LX7 is H; or (c) HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, and LX7 is G.

[0094] In some embodiments, disclosed herein is an isolated dual binding antibody comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 with at least one amino acid variant at any position, or a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 with at least one amino acid variant at any position, or a combination thereof, wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least two. In some embodiments, disclosed herein is an isolated dual binding antibody comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, wherein at least two amino acid variants are present within the heavy chain variable region or the light chain variable region, or a combination thereof. Disclosed herein in some embodiments is an isolated dual binding antibody comprising a heavy chain variable region and any light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 with at least two amino acid variants at any position. Disclosed herein in some embodiments is an isolated dual binding antibody comprising a light chain variable region and any heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 with at least two amino acid variants at any position.

[0095] As used herein, the term "heavy chain variable region" may be used interchangeably with the term "VH domain" or "VH", all having the same meaning and quality. As used herein, the term "light chain variable region" may be used interchangeably with the term "VL domain" or "VL", all having the same meaning and quality.

[0096] In certain embodiments, the specific variant VH and / or VL domains described herein can be used to screen a library of complementary variable regions to identify VH / VL, respectively, with desirable properties, such as increased affinity for antigen. Such methods are described, for example, in Portolano et al., J.Immunol.(1993)150:880-887, Clarkson et al., Nature(1991)352:624-628 Fischer et al.,(2015)Exploiting light chains for the scalable generation and platform purification of native human bispecific IgG.Nature Communications volume 6,Article number:6113.

[0097] Other methods may be used to mix and match VH and VL domains to identify Fab or F'(ab)2 with the desired dual binding activity. For example, Klimka et al., British Journal of Cancer (2000) 83:252-260, describes a screening process using a mouse VL and a human VH library with CDR3 and FR4 retained from the mouse VH. After obtaining antibodies, the VH was screened against a human VL library to obtain antibodies that bound to the antigen. Beiboer et al., J. Mol. Biol. (2000) 296:833-849, describes a screening process using an entire mouse heavy chain and human light chain library. After obtaining antibodies, one VL was combined with a human VH library with the mouse CDR3 retained. Antibodies that can bind to the antigen were obtained. Rader et al., PNAS (1998) 95:8910-8915, describes a process similar to that of Beiboer et al., supra.

[0098] The techniques described herein are per se known in the art, however, one of ordinary skill in the art will be able to use such techniques to obtain antigen-binding fragments of antibodies according to some embodiments of the present disclosure described herein, using routine methodology in the art.

[0099] Those skilled in the art will understand that a dual binding antibody, in its broadest sense, encompasses antibodies that specifically bind to antigenic determinants of IL-13 and TSLP. Those skilled in the art will further understand that the specificity of binding to IL-13 or TSLP reflects that the binding is selective for the antigen and can be distinguished from undesired or non-specific interactions. In certain embodiments, a dual binding antibody comprises one or more antibody fragments.

[0100] In some embodiments, the antigenic determinant comprises an IL-13 or TSLP epitope. The term "epitope" includes, in certain embodiments, a polypeptide determinant capable of specific binding to an anti-IL-13 or anti-TSLP binding domain. An epitope is a region of an antigen that is bound by an antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment of an antibody comprises a heavy chain variable region, a light chain variable region, or a combination thereof, as described herein.

[0101] In certain embodiments, epitopic determinants include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl or sulfonyl, and in certain embodiments may have specific three-dimensional structural characteristics, and / or specific charge characteristics. In certain embodiments, a dual binding antibody is said to specifically bind an IL-13 or TSLP epitope if it preferentially recognizes IL-13 or TSLP in a complex mixture of proteins and / or macromolecules. Dual binding antibodies have an equilibrium dissociation constant of ≦10 -5 , 10 -6 , or 10 -7 M. In some embodiments, the equilibrium dissociation constant is ≦10 -8 M or 10 -9 In some further embodiments, the equilibrium dissociation constant is ≦10 -10 M, 10 -11 M, or 10 -12 In some embodiments, the equilibrium dissociation constant is ≦10 -5 M~10 -12 It may be in the range of M.

[0102] The antibody binding domain may be a fragment of an antibody, or a genetically engineered product of one or more fragments of an antibody, which fragment is involved in specific binding to an antigen. "Specific binding" means that the binding is selective for the antigen of interest, for example, in the embodiments described herein, for IL-13 or TSLP, and can be distinguished from undesired or non-specific interactions. As used herein, the term "dual binding antibody" may, in certain embodiments, encompass the complete immunoglobulin structure, a fragment thereof, or a domain thereof.

[0103] Examples of antibody binding domains include, but are not limited to, complementarity determining regions (CDRs), variable regions (Fvs), VH domains, light chain variable regions (VLs), heavy chains, light chains, single chain variable regions (scFvs), and Fab fragments. Those skilled in the art will appreciate that scFvs are not actually fragments of antibodies, but are instead fusion polypeptides that include the variable heavy (VH) and variable light (VL) regions of an immunoglobulin linked by a short linker peptide, for example, but not limited to, 10 to about 25 amino acids. Those skilled in the art will also appreciate that the term "Fab" with respect to antibodies generally encompasses the portion of an antibody that consists of a single light chain (both variable and constant regions) linked by disulfide bonds to the variable region and first constant region of a single heavy chain.

[0104] In some embodiments, antibodies include whole antibody molecules, including monoclonal antibodies, polyclonal antibodies, and multispecific (e.g., bispecific) antibodies. In some embodiments, antibodies include antibody fragments that retain binding specificity, including, but not limited to, variable heavy (VH) fragments, variable light (VL) fragments, Fab fragments, F(ab')2 fragments, scFv fragments, Fv fragments, minibodies, diabodies, triabodies, and tetrabodies (see, e.g., Hudson and Souriau, Nature Med. 9:129-134 (2003), incorporated herein by reference in its entirety). Also included are humanized antibodies, primatized antibodies, and chimeric antibodies.

[0105] As used herein, in some embodiments, the term "antibody" may be used interchangeably with the term "immunoglobulin" and have all the same properties and meanings. Similarly, as used herein, in some embodiments, the term "antibody or fragment thereof" may be used interchangeably with the term "immunoglobulin or fragment thereof" and have all the same properties and meanings. Thus, one of skill in the art will understand that in some embodiments, "antibody or fragment thereof" or "immunoglobulin or fragment thereof" may encompass IgG immunoglobulins or fragments thereof or structures thereof including, but not limited to, IgG, scFv fragments, Fab fragments, F(ab')2 fragments, Fv fragments, minibodies, diabodies, triabodies, and tetrabodies.

[0106] Those skilled in the art will recognize that a "heavy chain variable region" or "VH" with respect to an antibody encompasses a fragment of a heavy chain containing the three CDRs interposed between adjacent segments known as framework (FR) regions, which are more highly conserved than the CDRs and form a scaffold to support the CDRs. In certain embodiments, the term "heavy chain variable region" or "VH" may be used interchangeably with "VH domain."

[0107] Those skilled in the art will recognize that a "light chain variable region" or "VL" with respect to an antibody encompasses a fragment of a light chain comprising the three CDRs interposed between framework (FR) regions. In certain embodiments, the term "light chain variable region" or "VL" may be used interchangeably with "VL domain."

[0108] Numerous amino acid sequences for HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3, and VH and VL regions for dual binding antibodies that bind IL-13 and TSLP are disclosed herein. A discussion of some embodiments of representative sequences disclosed herein is provided below. Figure 1A shows the template VH domain amino acid sequence set forth in SEQ ID NO:1, and the locations of the three heavy chain (H) CDR regions (HCDR1, HCDR2, HCDR3) and the four FR regions (HFR1, HFR2, HFR3, HFR4), while Figure 1B shows the template VL domain amino acid sequence set forth in SEQ ID NO:2, and the locations of the three light chain (L) CDR regions (LCDR1, LCDR2, LCDR3) and the four FR regions (LFR1, LFR2, LFR3, LFR4). The amino acid residues containing the variant residues present in each of the CDR regions and each of the FR regions of the re-epitope clones are unambiguously identified by comparing the linear schematic representation of the template VH or template VL sequence with the numbering and amino acid sequences provided below (Figures 1A and 1B).

[0109] In some embodiments, the isolated dual binding antibody comprises an antigen binding domain portion of an antibody comprising a VH domain and a VL domain, the VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth as I HX1 YDGSNK (SEQ ID NO: 142) (wherein HX1 is any amino acid), and the amino acid sequence of HCDR3 is set forth as AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids). One of skill in the art will recognize the 12 unique sites within the VH domain presented in FIG. 1A where variant amino acids may be found, identified herein as HX, which in certain embodiments may encompass the presence of variant amino acids within the template sequence of the heavy chain.

[0110] In some embodiments, the VH domain of the dual binding antibody comprises HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 142), and HCDR3 (SEQ ID NO: 143), and the VH domain comprises a variant amino acid at at least one of HX1, HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12.

[0111] In some embodiments, the VH domain of the dual binding antibody comprises HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is selected from the group consisting of W and S), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I, L, and M). In certain embodiments, the isolated dual binding antibody comprises variant amino acids comprising CDR1 (SEQ ID NO: 136), CDR2 (SEQ ID NO: 137) (wherein HX1 is W), CDR3 (SEQ ID NO: 138) (wherein HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, and HX12 is selected from the group of I and L).

[0112] In some embodiments, the dual binding antibody has HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W, and HCDR3 (SEQ ID NO: 138), HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, and HX12 is I); or HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), HCDR3 (SEQ ID NO: 138) (wherein HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, and HX12 is I). HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A and HX12 is L; or a VH domain comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A and HX12 is L).

[0113] Engineered antibody clones with variants in the VH domain described above are shown in FIG. 1A.

[0114] In some embodiments, the isolated dual binding antibody comprises an antigen binding domain portion of an antibody comprising a VH domain and a VL domain, and in some such embodiments, the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, and the amino acid sequence of LCDR1 is set forth as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are any amino acid), the amino acid sequence of LCDR2 is set forth as DD LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCDR3 is set forth as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acid). One of skill in the art will recognize seven unique sites within the VL domain presented in FIG. 1B, and variant amino acids may be found within the CDRs, identified herein as LX, which in certain embodiments may encompass the presence of variant amino acids within the template sequence of the light chain.

[0115] In some embodiments, the variant amino acid in the light chain may be in one of the framework regions, hi some embodiments, the variant amino acid in the VL domain is in the LFR3 region.

[0116] In some embodiments, the VL domain of the dual binding antibody comprises an LCDR, wherein the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G. In certain embodiments, the isolated dual binding antibody comprises variant amino acids, LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is selected from the group consisting of S and G), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G).

[0117] In some embodiments, the dual binding antibody comprises LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G); or LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is H), or a VL domain comprising LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is G), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G).

[0118] An engineered antibody clone with variants in the VL domain described above is shown in FIG. 1B.

[0119] In some embodiments, disclosed herein is an isolated antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL are set forth in SEQ ID NOs: 209 and 210, SEQ ID NOs: 219 and 220, SEQ ID NOs: 249 and 250, SEQ ID NOs: 337 and 338, SEQ ID NOs: 155 and 156, SEQ ID NOs: 157 and 158, SEQ ID NOs: 4 and 3, SEQ ID NOs: 6 and 5, SEQ ID NOs: 8 and 7, SEQ ID NOs: 10 and 9, SEQ ID NOs: 12 and 11, SEQ ID NOs: 14 and 13, SEQ ID NOs: 16 and 15, SEQ ID NO: 18 and 17, SEQ ID NOs:20 and 19, SEQ ID NOs:22 and 21, SEQ ID NOs:24 and 23, SEQ ID NOs:26 and 25, SEQ ID NOs:28 and 27, SEQ ID NOs:30 and 29, SEQ ID NOs:32 and 31, SEQ ID NOs:34 and 33, SEQ ID NOs:36 and 35, SEQ ID NOs:38 and 37, SEQ ID NOs:40 and 39, SEQ ID NOs:42 and 41, SEQ ID NOs:44 and 43, SEQ ID NOs:46 and 45, SEQ ID NOs:48 and 47, SEQ ID NOs:50 and 49, SEQ ID NOs:52 and 51, or SEQ ID NOs:54 and 53.

[0120] In some embodiments, disclosed herein is an isolated antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), the antibody being selected from the group consisting of SEQ ID NOs:209 and 210, SEQ ID NOs:219 and 220, SEQ ID NOs:249 and 250, SEQ ID NOs:337 and 338, SEQ ID NOs:155 and 156, SEQ ID NOs:157 and 158, SEQ ID NOs:4 and 3, SEQ ID NOs:6 and 5, SEQ ID NOs:8 and 7, SEQ ID NOs:10 and 9, SEQ ID NOs:12 and 11, SEQ ID NOs:14 and 13, SEQ ID NOs:16 and 15, SEQ ID NOs:18 and 17, SEQ ID NOs:20 and 19, SEQ ID NOs:22 and 21, SEQ ID NOs:23 and 22, SEQ ID NOs:24 and 23, SEQ ID NOs:25 and 24, SEQ ID NOs:26 and 25, SEQ ID NOs:27 and 26, SEQ ID NOs:28 and 27, SEQ ID NOs:29 and 30, SEQ ID NOs:31 and 32, SEQ ID NOs:33 and 33, SEQ ID NOs:34 and 34, SEQ ID NOs:35 and 36, SEQ ID NOs:37 and 37 The present invention includes sequences that are at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to any of the sequences set forth in sequence numbers 24 and 23, SEQ ID NOs:26 and 25, SEQ ID NOs:28 and 27, SEQ ID NOs:30 and 29, SEQ ID NOs:32 and 31, SEQ ID NOs:34 and 33, SEQ ID NOs:36 and 35, SEQ ID NOs:38 and 37, SEQ ID NOs:40 and 39, SEQ ID NOs:42 and 41, SEQ ID NOs:44 and 43, SEQ ID NOs:46 and 45, SEQ ID NOs:48 and 47, SEQ ID NOs:50 and 49, SEQ ID NOs:52 and 51, or SEQ ID NOs:54 and 53.

[0121] In some embodiments, disclosed herein are isolated antibodies comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise an amino acid sequence set forth in Table 10 or Table 1. In some embodiments, disclosed herein are isolated antibodies comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the antibody comprises a sequence that is at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to a sequence set forth in Table 10 or Table 1.

[0122] In some embodiments, an isolated antibody is disclosed herein comprising a heavy chain variable domain (VH) and a light chain variable domain (VL): (a) the VH domain comprises the amino acid sequence set forth in SEQ ID NO:1 with an amino acid variant at two or more of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof); (b) the VL domain comprises the amino acid sequence set forth in SEQ ID NO:2 having an amino acid variant at two or more of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof).

[0123] In one embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 209 and 210.

[0124] In another embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 219 and 220.

[0125] In another embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 249 and 250.

[0126] In another embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 337 and 338.

[0127] In another embodiment, the isolated dual binding antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences shown in Table 1 or Table 10.

[0128] In another embodiment, the isolated dual binding antibodies disclosed herein comprise VH and VL sequences that are at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH and VL sequences disclosed herein.

[0129] In some embodiments, the isolated dual binding antibody comprises an antigen-binding domain portion of an antibody comprising a VH domain and a VL domain that comprise a combination of a VH domain HCDR and a VL domain LCDR as described above. For example, but not limited to, in certain embodiments, a VH domain comprises a set of CDRs, HCDR1, HCDR2 and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth as I HX1 YDGSNK (SEQ ID NO: 142) (wherein HX1 is any amino acid), the amino acid sequence of HCDR3 is set forth as AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acid), and said VL domain comprises a set of CDRs, LCDR1, LCDR2 and LCDR3, wherein the amino acid sequence of LCDR1 is set forth as LX1, LX2, GSK LX3 The amino acid sequence of LCDR1 is set forth as DD LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCDR3 is set forth as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acid).

[0130] In some embodiments, the VH domain comprises a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, and the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, and HX11 is H. X11 is A, HX12 is selected from the group consisting of I, L, and M, the VL domain comprises a set of CDRs, HCDR1, HCDR2, and HCDR3, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.

[0131] In certain embodiments, the isolated dual binding antibody comprises a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is W, the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, and HX9 is , H and A, HX10 is E, HX11 is A, and HX12 is selected from the group of I and L, and comprises a VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, wherein the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is L, LX2 is I, LX3 is L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.

[0132] In some embodiments, the dual binding antibody comprises a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, and a VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, the amino acid sequences of each CDR being set forth in Figures 1A and 1B for the clones set forth in Figures 1A and 1B, for example, but not limited to, Clone C2: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), HCDR3 (SEQ ID NO: 138) (wherein HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, and HX12 is I), LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G), Clone C6: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), HCDR3 (SEQ ID NO: 138) (wherein HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A, and HX12 is L), LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is H); or Clone C9: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), HCDR3 (SEQ ID NO: 138) (wherein HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, and HX12 is L), LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is G), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G).

[0133] In some embodiments, the dual binding antibody comprises a set of HCDRs and any VL domain disclosed herein. In some embodiments, the dual binding antibody comprises a set of LCDRs and any VH domain disclosed herein. In some embodiments, the dual binding antibody comprises a paired set of HCDR-LCDRs disclosed herein.

[0134] In certain embodiments, the dual binding antibody can be encoded by nucleic acid constructs, comprising a VH domain that comprises the HCDR described herein.In certain embodiments, the dual binding antibody can be encoded by nucleic acid constructs, comprising a VL domain that comprises the LCDR described herein.In certain embodiments, the dual binding antibody can be encoded by nucleic acid constructs, comprising a VH domain that comprises the HCDR and a VL domain that comprises the HCDR described herein.

[0135] In certain embodiments, the dual binding antibody can be encoded by nucleic acid constructs, comprising a VH domain that comprises the HCDR described herein.In certain embodiments, the dual binding antibody can be encoded by nucleic acid constructs, comprising a VL domain that comprises the LCDR described herein.In certain embodiments, the dual binding antibody can be encoded by nucleic acid constructs, comprising a VH domain that comprises the HCDR and a VL domain that comprises the HCDR described herein.

[0136] In certain embodiments, the dual binding antibody comprising the VH domain comprising the HCDR described herein can be included in an immunoglobulin library.In certain embodiments, the dual binding antibody comprising the VL domain comprising the LCDR described herein can be included in an immunoglobulin library.In certain embodiments, the dual binding antibody comprising the VH domain comprising the HCDR and the VL domain comprising the HCDR described herein can be included in an immunoglobulin library.

[0137] In certain embodiments, the dual-binding antibody comprising a VH domain comprising an HCDR as described herein can be produced by expressing a nucleic acid construct comprising a nucleic acid sequence encoding an HCDR from a host cell and isolating the antibody.In certain embodiments, the dual-binding antibody comprising a VL domain comprising an LCDR as described herein can be produced by expressing a nucleic acid construct comprising a nucleic acid sequence encoding an LCDR from a host cell and isolating the antibody.In certain embodiments, the dual-binding antibody comprising a VH domain comprising an HCDR and a VL domain comprising an HCDR as described herein can be produced by expressing a nucleic acid construct comprising a nucleic acid sequence encoding an HCDR from a host cell and isolating the antibody.

[0138] In certain embodiments, a biconjugate antibody comprising a VH domain comprising an HCDR as described herein may be administered in a method of treating a subject in need thereof, the subject suffering from a disease or condition comprising an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma. In certain embodiments, a biconjugate antibody comprising a VL domain comprising an LCDR as described herein may be administered in a method of treating a subject in need thereof, the subject suffering from a disease or condition comprising an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma. In certain embodiments, a biconjugate antibody comprising a VH domain comprising an HCDR and a VL domain comprising an LCDR as described herein may be administered in a method of treating a subject in need thereof, the subject suffering from a disease or condition comprising an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma.

[0139] In some embodiments, an antibody comprising the heavy chain variable region amino acid sequence set forth in SEQ ID NO:1 or the light chain variable region amino acid sequence set forth in SEQ ID NO:2, or a combination thereof, does not bind to an IL-13 epitope. Thus, the dual binding antibodies described herein are engineered to include a binding region not previously present in the antibody. In other words, dual binding antibodies include "re-epitope" antibodies. As used throughout, the terms "engineered" and "re-epitope" may be used interchangeably in certain embodiments, all with the same quality and meaning. In some embodiments, a "re-epitope" antibody comprises improved binding compared to an available antibody. In some embodiments, a "re-epitope" antibody comprises improved binding and dissociation constants (K) compared to a parent antibody. on and K. off ). In some embodiments, the "re-epitope" antibody comprises improved stability compared to the parent antibody. In certain embodiments, the incorporation of variant amino acid residues into at least two of the unique set of 21 variant sites within the CDRs and FRs of the VH and VL domains described herein results in a "re-epitope" dual binding antibody that comprises improved characteristics compared to the parent antibody. These re-epitope antibodies may provide advantageous characteristics.

[0140] Those skilled in the art will recognize that "Fv" in reference to an antibody encompasses the minimum fragment of an antibody that produces a complete antigen-binding site. The Fv fragment consists of the variable region of a single light chain (VL) bound to the variable region of a single heavy chain (VH).

[0141] Those skilled in the art will recognize that "single chain Fv antibody" or "scFv" with respect to an antibody encompasses engineered antibodies consisting of a VL domain and a VH domain linked together directly or via a peptide linker sequence. Those skilled in the art will understand that the linker may, in some embodiments, comprise a linear amino acid sequence. In some embodiments, the linear amino acid sequence ("linker") comprises an enzyme cleavage site and may, in certain embodiments, be referred to as a "cleavable linker" or "linker" or "cleavable peptide". In some embodiments, the linker may be a cleavable linker. In some embodiments, the linker may be a non-cleavable linker. In some embodiments, the linker sequence is set forth in SEQ ID NO: 147 (GGGGSGGGGSGGGGS; SEQ ID NO: 147).

[0142] In some embodiments, the peptide linker sequence contains, for example, Gly, Asn, or Ser residues in various combinations. Other near neutral amino acids, such as Thr and Ala, can also be included in the linker sequence.

[0143] Other amino acid sequences that may be usefully employed as linkers include those described in Maratea et al., Gene 40:39 46 (1985); Murphy et al., Proc. Natl. Acad. Sci. USA 83:8258 8262 (1986), U.S. Patent No. 4,935,233, U.S. Patent No. 4,751,180, Chaudhary et al., 1990, Proc. Natl. Acad. Sci. USA 87:1066-1070; Bird et al., 1988, Science 242:423-426, which are incorporated herein in their entireties.

[0144] In some embodiments, the coding sequences for the VH and VL domains of a dual binding antibody or fragment thereof can be fused directly without any linking amino acids or by using a constructed flexible polylinker.

[0145] The peptide linker is designed in certain embodiments to allow correct interaction between the two beta sheets that form the variable region of the single chain antibody. Any suitable linker can be used to achieve the indirect bond, including but not limited to peptide linkers, polymer linkers, and chemical linkers. In certain embodiments, the covalent bond is an indirect bond through a peptide linker.

[0146] In some embodiments, the antibody comprises a mutant immunoglobulin. Examples of mutant immunoglobulins include, but are not limited to, IgG that does not bind antibody-dependent cellular cytotoxicity (ADCC) components. 234 A / L 235 IgG containing the A(LALA) mutation cannot bind to Fc receptors (see Xu D, Alegre ML, Varga SS, Rothermel AL, Collins AM, Pulito VL, et al. In vitro characterization of five humanized OKT3 effector function variant antibodies. Cell Immunol. (2000) 200:16-26.10.1006 / cimm.2000.1617). In some embodiments, the bibody comprises 234 A / L 235 A (LALA) mutation, where the numbering of mutations is based on the EU numbering convention used for the constant region (see Xu D, Alegre ML, Varga SS, Rothermel AL, Collins AM, Pulito VL, et al.. In vitro characterization of five humanized OKT3 effector function variant antibodies. Cell Immunol. (2000) 200:16-26.10.1006 / cimm.2000.1617).

[0147] In some embodiments, the mutant IgG comprises an IgG1 and the Fc region is engineered. In some embodiments, the mutant IgG comprises an IgG2 and the Fc region is engineered. In some embodiments, the mutant IgG comprises an IgG3 and the Fc region is engineered. In some embodiments, the mutant IgG comprises an IgG4 and the Fc region is engineered. In certain embodiments, mutations in the Fc region of the antibody abolish immune effector functions of the antibody.

[0148] In some embodiments, the isolated bibinding antibody comprises an IgG, Fv, scFv, Fab, F(ab')2, minibody, bispecific antibody, or triabody. In some embodiments, the isolated bibinding antibody comprises an IgG, wherein the IgG is an IgG1, IgG2, IgG3, or IgG4.

[0149] In some embodiments, the isolated bibinding antibody comprises a mutated IgG, wherein the mutated IgG is incapable of binding to an antibody-dependent cellular cytotoxicity component.

[0150] In some embodiments, the dual binding antibodies described herein comprise an IgG immunoglobulin. In some embodiments, the dual binding antibodies described herein comprise an IgG1 immunoglobulin, an IgG2 immunoglobulin, an IgG3 immunoglobulin, or an IgG4 immunoglobulin. In some embodiments, the dual binding antibodies comprise an IgG1 immunoglobulin. In some embodiments, the dual binding antibodies comprise an IgG2 immunoglobulin. In some embodiments, the dual binding antibodies comprise an IgG3 immunoglobulin. In some embodiments, the dual binding antibodies comprise an IgG4 immunoglobulin. In some embodiments, the dual binding antibodies comprise an IgG1 immunoglobulin or an IgG4 immunoglobulin.

[0151] In some embodiments, the dual binding antibodies described herein comprise a Fab immunoglobulin fragment. In some embodiments, the dual binding antibodies described herein comprise a F(ab')2 immunoglobulin fragment. In some embodiments, the dual binding antibodies described herein comprise an Fv immunoglobulin construct. In some embodiments, the dual binding antibodies described herein comprise an scF immunoglobulin construct. In some embodiments, the dual binding antibodies described herein comprise a minibody immunoglobulin construct comprising a pair of single chain Fv fragments linked via a CH3 domain.

[0152] In some embodiments, the dual binding antibodies described herein comprise diabody immunoglobulin constructs. In some embodiments, the diabody immunoglobulin constructs comprise heavy chain variable (VH) and light chain variable (VL) regions linked by a small peptide linker. In some embodiments, the diabody immunoglobulin constructs comprise single chain (Fv)2 in which two scFv fragments are covalently linked to each other. In some embodiments, the dual binding antibodies described herein comprise diabody immunoglobulin constructs comprising three scFv fragments covalently linked to each other. Diabodies have been shown in the art to have dissociation constants up to 40 times lower than the corresponding scFvs, meaning that they have much higher affinity for their targets. As a result, the use of diabodies in the methods of use described below may result in much lower dosing of diabodies or triabodies than IgGs that contain the same VH and VL domains.

[0153] In some embodiments, the dual binding antibody comprises a linker or multiple linkers between the binding components, for example, but not limited to, between the VH and VL in an scFv, minibody, diabody, triabody, or tetrabody. In some embodiments, the dual binding antibody does not comprise a linker or multiple linkers between the binding components, for example, but not limited to, between the VH and VL in an scFv, minibody, diabody, triabody, or tetrabody. In some embodiments, the linker may comprise a single amino acid. In some embodiments, the linker comprises any linker known in the art. In some embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 147.

[0154] Those skilled in the art will understand that the term "variant" encompasses polypeptides that differ from the specifically recited polypeptide sequences, e.g., the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, by single or multiple amino acid insertions, deletions, and / or substitutions, e.g., generated using recombinant DNA technology. Variants of the antigen-binding molecules disclosed herein include antigen-binding molecules in which one or several of the amino acid residues are modified by at least one substitution, addition, and / or deletion such that antigen-binding affinity is newly generated in the antigen-binding molecule.

[0155] The dual binding portions of the antibodies described herein comprise an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region (VH and VL, respectively), wherein the amino acid sequence set forth in SEQ ID NO:1 comprises the VH template and the amino acid sequence set forth in SEQ ID NO:2 comprises the VL template, and wherein the dual binding regions comprise at least two variants within the VH template sequence, or at least two variants within the VL template sequence, or a combination thereof.

[0156] Those skilled in the art will understand that an "isolated bibinding antibody" in certain embodiments includes an antibody that is (1) free of at least some other proteins that would typically be found in nature or during its synthesis, (2) essentially free of other non-identical binding antibodies from the same source, (3) that can be recombinantly expressed by a cell, (4) that is separated from at least about 50 percent of the polynucleotides, lipids, carbohydrates, or other materials with which it is associated during synthesis, or (5) that does not occur in nature, or a combination thereof. Such an isolated antibody may be encoded by genomic DNA, cDNA, mRNA, or other RNA, may be of synthetic origin, or any combination thereof. In certain embodiments, an isolated antibody is substantially free of proteins or polypeptides or other contaminants that would interfere with its use (therapeutic, diagnostic, prophylactic, research, or other). As used throughout, the terms "bibinding antibody" and "bibinding antibody" may be used interchangeably, all with the same meaning and qualities.

[0157] In some embodiments, a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof); Disclosed herein is an isolated dual binding antibody comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:2, or a combination of a variant heavy chain variable region and a variant light chain variable region, having at least one amino acid variant at position (i.e., 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least two.

[0158] IMGT® is the international ImMunoGeneTics Information system® (see Nucleic Acids Res. 2015 Jan;43(Database issue):D413-22. doi:10.1093 / nar / gku1056. Epub 2014 Nov 5 Free article. PMID:25378316 LIGM:441 and Dev Comp Immunol. 2003 Jan;27(1):55-77). IMGT is a unique numbering system for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains (Lefranc MP1, Pommie C, Ruiz M, Giudicelli V, Foulquier E, Truong L, Thouvenin-Contet V, Lefranc G. Dev Comp Immunol 27:55-77. (2003)). IMGT® provides a uniform numbering system for IG and TcR variable domain sequences based on aligning five or more IG and TcR variable region sequences, taking into account and combining the Kabat definitions of FRs and CDRs, structural data, and Chothia characterization of hypervariable loops. IMGT is considered a universal numbering scheme for antibodies known in the art.

[0159] In describing variant amino acid positions present in the VH and VL domains, in some embodiments, the IMGT numbering is used. In some embodiments, the variant amino acid positions are presented as specific positions within a given sequence, for example, but not limited to, SEQ ID NO:1 and SEQ ID NO:2. In some embodiments, the variant amino acid positions are identified by both a specific position within a given SEQ ID NO sequence and the IMGT numbering system. Those skilled in the art will recognize that the actual amino acid position number of the amino acid identified by the position number relative to the SEQ ID NO may differ from the IMGT numbering system, but the identified residues are identical. For example, but not limited to, the amino acid residue at position 106 of SEQ ID NO:1 is the same residue identified at position 112 by the IMGT numbering system. Those skilled in the art will recognize that the same amino acid residue may be identified as having different positions depending on which system is used, but the position and identity of the amino acid residue within the consecutive amino acid sequence is clear.

[0160] In some embodiments, disclosed herein is an isolated dual binding antibody comprising a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO:1 with at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof, according to the IMGT numbering of heavy chain variable region variant positions), and a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO:2, optionally wherein the amino acid sequence of SEQ ID NO:2 comprises at least one variant amino acid, wherein the total number of variant positions in the heavy chain variable region, light chain variable region, or a combination thereof is at least two. Disclosed herein in some embodiments is an isolated dual binding antibody comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:1, and any light chain variable region, having at least two amino acid variants at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof, according to the IMGT numbering of heavy chain variable region variant positions).

[0161] Many light chain variable region amino acid sequences are themselves known in the art. One skilled in the art could use such known sequences in conjunction with the heavy chain variable regions described herein to analyze the double binding using routine methodologies and techniques well known in the art (see, for example, but not limited to, Example 1 below).

[0162] In some embodiments, disclosed herein is an isolated dual binding antibody comprising a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO:2 with at least one amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering of light chain variable region variant positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof), and a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO:1, optionally wherein the amino acid sequence of SEQ ID NO:1 comprises at least one variant amino acid, wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or a combination thereof is at least two. In some embodiments, disclosed herein is an isolated dual binding antibody comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:2, and any heavy chain variable region, having at least two amino acid variants at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering of light chain variable region variant positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof).

[0163] Many heavy chain variable region amino acid sequences are themselves known in the art. One skilled in the art could use such known sequences in conjunction with the light chain variable regions described herein to analyze the double binding using routine methodologies and techniques well known in the art (see, for example, but not limited to, Example 1 below).

[0164] In some embodiments, a VH domain described herein comprises an amino acid sequence set forth in SEQ ID NO:1 with at least one amino acid variant at any position. In some embodiments, a VH comprising an amino acid sequence set forth in SEQ ID NO:1 comprises at least two amino acid variants at any position. In some embodiments, a VH comprising an amino acid sequence set forth in SEQ ID NO:1 comprises at least 1-10 amino acid variants at any position. In some embodiments, a VH comprising an amino acid sequence set forth in SEQ ID NO:1 comprises 1-5 amino acid variants at any position. In some embodiments, a VH comprising an amino acid sequence set forth in SEQ ID NO:1 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid variants at any position.

[0165] In some embodiments, a VL domain described herein comprises an amino acid sequence set forth in SEQ ID NO:2 with at least one amino acid variant at any position. In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises at least two amino acid variants at any position. In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises at least 1-10 amino acid variants at any position. In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises 1-5 amino acid variants at any position. In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid variants at any position.

[0166] In some embodiments, the VH domains and VL domains described herein comprising the amino acid sequences set forth in SEQ ID NO:1 and SEQ ID NO:2 respectfully have a combined number of variant positions of at least 2. In some embodiments, the VH domains and VL domains described herein comprising the amino acid sequences set forth in SEQ ID NO:1 and SEQ ID NO:2 respectfully have a combined number of variant positions of 2 to 20. In some embodiments, the VH domains and VL domains described herein comprising the amino acid sequences set forth in SEQ ID NO:1 and SEQ ID NO:2 respectfully have a combined number of variant positions of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, the VH domains and VL domains described herein comprising the amino acid sequences set forth in SEQ ID NO:1 and SEQ ID NO:2 respectfully have a combined number of variant positions of more than 20.

[0167] In certain embodiments, the dual antibody binding regions described herein each comprise a set of heavy and light chain CDRs interposed between a set of heavy and light chain framework regions (FRs) that provide support for the CDRs and define the spatial relationship of the CDRs to each other. As used herein, the term "CDR set" refers to the three hypervariable regions of the heavy or light chain variable region. Proceeding from the N-terminus of the heavy or light chain polypeptide, these regions are designated as "CDR1", "CDR2", and "CDR3", respectively. Thus, the antigen binding site comprises six CDRs, including the sets of CDRs from each of the heavy and light chain variable regions. Crystallographic analysis of several antigen-antibody complexes has shown that the amino acid residues of the CDRs make extensive contacts with the bound antigen, with the most extensive antigen contacts being with the heavy chain CDR3. Thus, the CDR regions are primarily responsible for the specificity of the antigen binding site.

[0168] As used herein, the term "FR set" refers to four adjacent amino acid sequences that form the CDRs of a CDR set of a heavy or light chain variable region. Although some FR residues may contact the bound antigen, FRs are primarily involved in folding the variable region into the antigen binding site, particularly the FR residues immediately adjacent to the CDRs. Within the FRs, certain amino acid residues and certain structural features are highly conserved. In this regard, all variable region sequences contain an internal disulfide loop of about 90 amino acid residues. When the variable region folds into the binding site, the CDRs are presented as protruding loop motifs that form the antigen binding surface. It is generally recognized that there are conserved structural regions of FRs that influence the folded shape of the CDR loops into certain "canonical" structures, regardless of the exact CDR amino acid sequence. In addition, certain FR residues are known to participate in non-covalent interdomain contacts that stabilize the interaction of antibody heavy and light chains.

[0169] In some embodiments, at least one variant in the VH comprises a variant amino acid in a CDR region. In some embodiments, at least one variant in the VL comprises a variant amino acid in a CDR region. In some embodiments, at least one variant in the VH comprises a variant amino acid in a FR region. In some embodiments, at least one variant in the VL comprises a variant amino acid in a FR region. In some embodiments, at least two variants in the VH comprise variant amino acids in a CDR region, a FR region, or both. In some embodiments, at least two variants in the VL comprise variant amino acids in a CDR region, a FR region, or both. In some embodiments, a variant position in a VH comprises a variant in at least one CDR and at least one FR region. In some embodiments, a variant position in a VL comprises a variant in at least one CDR and at least one FR region.

[0170] In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 52 (IMGT position 57). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 99 (IMGT position 107). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 100 (IMGT position 108). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 101 (IMGT position 109). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 102 (IMGT position 110). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 103 (IMGT position 111). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 104 (IMGT position 111A). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 105 (IMGT position 112A). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 106 (IMGT position 112). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 107 (IMGT position 113). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 108 (IMGT position 114). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 111 (IMGT position 117).

[0171] In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 52 (IMGT position 57) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 99 (IMGT position 107) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 100 (IMGT position 108) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 101 (IMGT position 109) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 102 (IMGT position 110) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 103 (IMGT position 111) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 104 (IMGT position 111A) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 105 (IMGT position 112A) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 106 (IMGT position 112) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 107 (IMGT position 113) and 1-3 additional variant amino acids. In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 108 (IMGT position 114) and 1-3 additional variant amino acids.In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at position 111 (IMGT position 117) and from 1 to 3 additional variant amino acids.

[0172] In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at positions 105 and 106 (IMGT positions 112A and 112). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at positions 106 and 111 (IMGT positions 112 and 117). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at positions 103 and 106 (IMGT positions 111 and 112). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at positions 104 and 106 (IMGT positions 111A and 112). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises an amino acid variant at positions 104, 106 and 111 (IMGT positions 111A, 112 and 117). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises amino acid variants at positions 105, 106 and 111 (IMGT positions 112A, 112 and 117). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises amino acid variants at positions 103, 106 and 111 (IMGT positions 111, 112 and 117). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises amino acid variants at positions 99, 104 and 111 (IMGT positions 107, 111A and 117). In some embodiments, a VH comprising the amino acid sequence set forth in SEQ ID NO:1 comprises amino acid variants at positions 52, 99, 104 and 111 (IMGT positions 57, 107, 111A and 117).

[0173] In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering of light chain variable region variant positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 26 (IMGT position 27). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 27 (IMGT position 28). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 31 (IMGT position 38). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 51 (IMGT position 65). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 56 (IMGT position 70). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 77 (IMGT position 94). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 92 (IMGT position 109). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 93 (IMGT position 110). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 96 (IMGT position 115).

[0174] In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 26 (IMGT position 27) and 1-7 additional variant amino acids. In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 27 (IMGT position 28) and 1-7 additional variant amino acids. In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 31 (IMGT position 38) and 1-7 additional variant amino acids. In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 51 (IMGT position 65) and 1-7 additional variant amino acids. In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 56 (IMGT position 70) and 1-7 additional variant amino acids. In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 77 (IMGT position 94) and 1-7 additional variant amino acids. In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 92 (IMGT position 109) and 1-7 additional variant amino acids. In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 93 (IMGT position 110) and 1-7 additional variant amino acids. In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at position 96 (IMGT position 115) and 1-7 additional variant amino acids.

[0175] In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 56, 77, and 96 (IMGT positions 27, 28, 38, 70, 94, and 115). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 56, 77, 92, and 96 (IMGT positions 27, 28, 38, 70, 94, 109, and 115). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 31, 56, and 77 (IMGT positions 27, 38, 70, and 94). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 56, and 77 (IMGT positions 27, 28, 38, 70, and 94). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 56, 77, and 92 (IMGT positions 27, 28, 38, 70, 94, and 109). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 51, 56, 77, and 92 (IMGT positions 27, 28, 38, 65, 70, 94, and 109). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 31, 56, 77, 92, and 96 (IMGT positions 27, 38, 70, 94, 109, and 115). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 31, 77, and 92 (IMGT positions 27, 38, 94, and 109). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 56, 77, and 93 (IMGT positions 27, 28, 38, 70, 94, and 110). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 56, 77, 93, and 96 (IMGT positions 27, 28, 38, 70, 94, 110, and 115).In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 51, 77, 93, and 96 (IMGT positions 27, 28, 38, 65, 94, 110, and 115). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 56, 77, 93, and 96 (IMGT positions 27, 28, 38, 70, 94, 110, and 115). In some embodiments, a VL comprising the amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 27, 31, 56, 77, and 96 (IMGT positions 28, 38, 70, 94, and 115). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 27, 31, 56, 77, 92, and 96 (IMGT positions 28, 38, 70, 94, 109, and 115). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, 51, 77, and 96 (IMGT positions 27, 28, 38, 65, 94, and 115). In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises amino acid variants at positions 26, 27, 31, or 96 (IMGT positions 27, 28, 38, and 115), or any combination thereof.

[0176] In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises an amino acid variant at a position in the framework region of any of positions 56 or 77, or a combination thereof (IMGT position 70 or 94, or a combination thereof) of SEQ ID NO:2. In some embodiments, a VL comprising an amino acid sequence set forth in SEQ ID NO:2 comprises at least one amino acid variant at a position in the framework region of any of positions 56 or 77, or a combination thereof (IMGT position 70 or 94, or a combination thereof) of SEQ ID NO:2, wherein the variant amino acid at position 56 comprises leucine, alanine, arginine, lysine, aspartic acid, glycine, or glutamic acid, and / or the variant amino acid at position 77 comprises valine.

[0177] In some embodiments, disclosed herein is an isolated dual binding antibody comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:1 with at least one amino acid variant at any of positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117 (IMGT), or a combination thereof, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:2 with at least one amino acid variant at any of positions 27, 28, 38, 65, 70, 94, 109, 110, or 115 (IMGT), or a combination thereof, wherein the total number of variant positions in the dual binding antibody is at least two.

[0178] In some embodiments, the isolated dual binding antibody comprises a variant VH or variant VL, or a combination thereof, having a variant amino acid at a position other than (IMGT) 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117 in the heavy chain variable region and / or (IMGT) 27, 28, 38, 65, 70, 94, 109, 110, or 115 in the light chain variable region.

[0179] In some embodiments, at least one amino acid variant in the VH comprises a variant amino acid in a CDR region. In some embodiments, at least one amino acid variant in the VH comprises a variant amino acid in the CDR1 region. In some embodiments, at least one amino acid variant in the VH comprises a variant amino acid in the CDR2 region. In some embodiments, at least one amino acid variant in the VH comprises a variant amino acid in the CDR3. In some embodiments, at least two amino acid variants in the VH comprise variant amino acids in two different CDR regions. In some embodiments, at least two amino acid variants in the VH comprise variant amino acids in the same CDR region. In some embodiments, at least two amino acid variants in the VH comprise variant amino acids in the same CDR1 region. In some embodiments, at least two amino acid variants in the VH comprise variant amino acids in the same CDR2 region. In some embodiments, at least two amino acid variants in the VH comprise variant amino acids in the same CDR3 region. In some embodiments, at least two amino acid variants in the VH comprise variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least two amino acid variants in the VH comprise variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least two amino acid variants in the VH comprise variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in the VH comprise variant amino acids in a single CDR region. In some embodiments, at least three amino acid variants in the VH comprise variant amino acids in the CDR1 region. In some embodiments, at least three amino acid variants in the VH comprise variant amino acids in the CDR2 region. In some embodiments, at least three amino acid variants in the VH comprise variant amino acids in the CDR3 region. In some embodiments, at least three amino acid variants in the VH comprise variant amino acids in the CDR1 and CDR2 regions.In some embodiments, at least three amino acid variants in the VH comprise variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least three amino acid variants in the VH comprise variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in the VH comprise variant amino acids in the CDR1, CDR2, and CDR3 regions. In some embodiments, at least four amino acid variants in the VH comprise variant amino acids in a single CDR region. In some embodiments, at least four amino acid variants in the VH comprise variant amino acids in the CDR1 region. In some embodiments, at least four amino acid variants in the VH comprise variant amino acids in the CDR2 region. In some embodiments, at least four amino acid variants in the VH comprise variant amino acids in the CDR3 region. In some embodiments, at least four amino acid variants in the VH comprise variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least four amino acid variants in the VH comprise variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least four amino acid variants in the VH comprise variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least four amino acid variants in the VH comprise variant amino acids in the CDR1, CDR2, and CDR3 regions. In some embodiments, when five or more amino acid variants are present in the VH, the variant position comprises a variant amino acid in a single CDR region. In some embodiments, when five or more amino acid variants are present in the VH, the variant position comprises an amino acid in the CDR1 region. In some embodiments, when five or more amino acid variants are present in the VH, the variant position comprises a variant amino acid in the CDR2 region. In some embodiments, when five or more amino acid variants are present in the VH, the variant position comprises a variant amino acid in the CDR3 region.In some embodiments, when there are five or more amino acid variants in the VH, the variant positions include variant amino acids in the CDR1 and CDR2 regions. In some embodiments, when there are five or more amino acid variants in the VH, the variant positions include variant amino acids in the CDR1 and CDR3 regions. In some embodiments, when there are five or more amino acid variants in the VH, the variant positions include variant amino acids in the CDR2 and CDR3 regions. In some embodiments, when there are five or more amino acid variants in the VH, the variant positions include variant amino acids in the CDR1, CDR2, and CDR3 regions.

[0180] In some embodiments, at least one amino acid variant in the VL comprises a variant amino acid in a CDR region. In some embodiments, at least one amino acid variant in the VL comprises a variant amino acid in the CDR1 region. In some embodiments, at least one amino acid variant in the VL comprises a variant amino acid in the CDR2 region. In some embodiments, at least one amino acid variant in the VL comprises a variant amino acid in the CDR3. In some embodiments, at least two amino acid variants in the VL comprise variant amino acids in two different CDR regions. In some embodiments, at least two amino acid variants in the VL comprise variant amino acids in the same CDR region. In some embodiments, at least two amino acid variants in the VL comprise variant amino acids in the same CDR1 region. In some embodiments, at least two amino acid variants in the VL comprise variant amino acids in the same CDR2 region. In some embodiments, at least two amino acid variants in the VL comprise variant amino acids in the same CDR3 region. In some embodiments, at least two amino acid variants in the VL comprise variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least two amino acid variants in the VL comprise variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least two amino acid variants in the VL comprise variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in the VL comprise variant amino acids in a single CDR region. In some embodiments, at least three amino acid variants in the VL comprise variant amino acids in the CDR1 region. In some embodiments, at least three amino acid variants in the VL comprise variant amino acids in the CDR2 region. In some embodiments, at least three amino acid variants in the VL comprise variant amino acids in the CDR3 region. In some embodiments, at least three amino acid variants in the VL comprise variant amino acids in the CDR1 and CDR2 regions.In some embodiments, at least three amino acid variants in the VL comprise variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least three amino acid variants in the VL comprise variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in the VL comprise variant amino acids in the CDR1, CDR2, and CDR3 regions. In some embodiments, at least four amino acid variants in the VL comprise variant amino acids in a single CDR region. In some embodiments, at least four amino acid variants in the VL comprise variant amino acids in the CDR1 region. In some embodiments, at least four amino acid variants in the VL comprise variant amino acids in the CDR2 region. In some embodiments, at least four amino acid variants in the VL comprise variant amino acids in the CDR3 region. In some embodiments, at least four amino acid variants in the VL comprise variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least four amino acid variants in the VL comprise variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least four amino acid variants in the VL comprise variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least four amino acid variants in the VL comprise variant amino acids in the CDR1, CDR2, and CDR3 regions. In some embodiments, when five amino acid variants are present in the VL, the variant position comprises a variant amino acid in a single CDR region. In some embodiments, when five amino acid variants are present in the VL, the variant position comprises an amino acid in the CDR1 region. In some embodiments, when five amino acid variants are present in the VL, the variant position comprises a variant amino acid in the CDR2 region. In some embodiments, when five amino acid variants are present in the VL, the variant position comprises a variant amino acid in the CDR3 region. In some embodiments, when five amino acid variants are present in the VL, the variant position comprises a variant amino acid in the CDR1 and CDR2 regions.In some embodiments, when there are five amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR1 region and the CDR3 region. In some embodiments, when there are five amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR2 region and the CDR3 region. In some embodiments, when there are five amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR1 region, the CDR2 region, and the CDR3 region. In some embodiments, when there are six amino acid variants in the VL, the variant position comprises a variant amino acid in a single CDR region. In some embodiments, when there are six amino acid variants in the VL, the variant position comprises an amino acid in the CDR1 region. In some embodiments, when there are six amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR2 region. In some embodiments, when there are six amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR3 region. In some embodiments, when there are six amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR1 region and the CDR2 region. In some embodiments, when there are six amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR1 region and the CDR3 region. In some embodiments, when there are six amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR2 region and the CDR3 region. In some embodiments, when there are six amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR1 region, the CDR2 region, and the CDR3 region. In some embodiments, when there are seven or more amino acid variants in the VL, the variant position comprises a variant amino acid in a single CDR region. In some embodiments, when there are seven or more amino acid variants in the VL, the variant position comprises an amino acid in the CDR1 region. In some embodiments, when there are seven or more amino acid variants in the VL, the variant position comprises a variant amino acid in the CDR2 region.In some embodiments, when seven or more amino acid variants are present in the VL, the variant position comprises a variant amino acid in the CDR3 region. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position comprises a variant amino acid in the CDR1 region and the CDR2 region. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position comprises a variant amino acid in the CDR1 region and the CDR3 region. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position comprises a variant amino acid in the CDR2 region and the CDR3 region. In some embodiments, when seven or more amino acid variants are present in the VL, the variant position comprises a variant amino acid in the CDR1 region, the CDR2 region, and the CDR3 region.

[0181] In some embodiments, the amino acid variants include substitutions of one amino acid residue for another. In some embodiments, the amino acid variants include substitutions of a hydrophobic residue for a non-hydrophobic residue. In some embodiments, the amino acid variants include substitutions of a charged residue for an uncharged residue. In some embodiments, the amino acid variants include neutral substitutions, where the substituted amino acid has similar properties. In some embodiments, the amino acid variants include substitutions of an aromatic residue for a non-aromatic residue. In some embodiments, natural aromatic amino acids, such as Trp, Tyr and Phe, are replaced with synthetic non-natural acids, such as phenylglycine, TIC, naphthyleranine (Nol), ring methylated derivatives of Phe, halogenated derivatives of Phe or o-methyl-Tyr. In some embodiments, the variant substitutions include substituting modified amino acids or non-amino acid monomers (e.g., fatty acids, complex carbohydrates, etc.). One skilled in the art will understand that the selection of the amino acid residue at each variant position may affect the 3D structure of the VH, VL, and / or combinations thereof in certain embodiments, but the selection of the amino acid residue at each variant position is considered independently.

[0182] In some embodiments, "amino acid" or "amino acid residue" or "residue" is understood to include the 20 naturally occurring, coded amino acid residues and those amino acids that are frequently post-translationally modified in vivo, including, for example, hydroxyproline, phosphoserine, and phosphothreonine, as well as other uncommon amino acids, including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodosmosine, nor-valine, nor-leucine, and ornithine. In some embodiments, "amino acid" includes both D- and L-amino acids. In some embodiments, the amino acid variant substitutions are D-amino acids. In some embodiments, the amino acid variant substitutions are L-amino acids. In some embodiments, the variant residues include naturally occurring amino acids. In some embodiments, the variant residues include naturally occurring, coded amino acid residues. In some embodiments, the variant residues include naturally occurring, non-coded amino acid residues. In some embodiments, the variant residues include non-naturally occurring amino acids.

[0183] In some embodiments, the variant residue comprises a non-naturally occurring, non-proteinogenic amino acid.

[0184] In some embodiments, the amino acid sequence of the VH domain of the dual binding antibody is selected from, but not limited to, any of the sequences set forth in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region comprising an amino acid sequence set forth in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, and any variable light chain region. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 4, and any variable light chain region. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:8. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:10. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:12. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:14. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:16. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:18. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:20. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and an optional variable light chain region comprising the amino acid sequence set forth in SEQ ID NO: 22. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and an optional variable light chain region comprising the amino acid sequence set forth in SEQ ID NO: 24.In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:26. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:28. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:30. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:32. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:34. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:36. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:38. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO:40. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO: 42. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO: 44. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO: 46. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO: 48. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO: 50. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO: 52. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region and any variable light chain region comprising the amino acid sequence set forth in SEQ ID NO: 54.

[0185] In some embodiments, the amino acid sequence of the VH domain of the dual binding antibody is one of those set forth in Table 1 or Table 10. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region comprising one of the amino acid sequences set forth in Table 1 or Table 10, and an optional variable light chain region.

[0186] In some embodiments, the amino acid sequence of the VL domain of the dual binding antibody is selected from, but not limited to, the sequences set forth in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising an amino acid sequence set forth in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 3, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:5, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:7, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:9, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:11, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:13, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:15, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:17, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:19, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region, and an optional variable heavy chain region, comprising the amino acid sequence set forth in SEQ ID NO: 21. In some embodiments, the isolated dual binding antibody comprises a light chain variable region, and an optional variable heavy chain region, comprising the amino acid sequence set forth in SEQ ID NO: 23.In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:25, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:27, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:29, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:31, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:33, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:35, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:37, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:39, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 42, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 43, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 45, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 47, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 49, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 51, and any variable heavy chain region. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 53, and any variable heavy chain region.

[0187] In some embodiments, the amino acid sequence of the VL domain of the dual binding antibody is one of those listed in Table 1 or Table 10. In some embodiments, the isolated dual binding antibody comprises a light chain variable region comprising one of the amino acid sequences listed in Table 1 or Table 10, and an optional variable heavy chain region.

[0188] Those skilled in the art will recognize that when a VH or VL domain comprising a known amino acid sequence is paired with a VL or VH domain, respectively, to comprise an antigen-binding region, such pairing may be analyzed for binding properties using methods well known in the art (see, e.g., the disclosure herein and the Examples below).

[0189] In some embodiments, the amino acid sequences of the heavy chain variable region-light chain variable region pairs are selected from, but not limited to, the pair sequences set forth in SEQ ID NOs: 4 and 3, SEQ ID NOs: 6 and 5, SEQ ID NOs: 8 and 7, SEQ ID NOs: 10 and 9, SEQ ID NOs: 12 and 11, SEQ ID NOs: 14 and 13, SEQ ID NOs: 16 and 15, SEQ ID NOs: 18 and 17, SEQ ID NOs: 20 and 19, SEQ ID NOs: 22 and 21, SEQ ID NOs: 24 and 23, SEQ ID NOs: 26 and 25, SEQ ID NOs: 28 and 27, SEQ ID NOs: 30 and 29, SEQ ID NOs: 32 and 31, SEQ ID NOs: 34 and 33, SEQ ID NOs: 36 and 35, SEQ ID NOs: 38 and 37, SEQ ID NOs: 40 and 39, SEQ ID NOs: 42 and 41, SEQ ID NOs: 44 and 43, SEQ ID NOs: 46 and 45, SEQ ID NOs: 48 and 47, SEQ ID NOs: 50 and 49, SEQ ID NOs: 52 and 51, and SEQ ID NOs: 54 and 53. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 4 and 3. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 6 and 5. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 8 and 7. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 10 and 9. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 12 and 11. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 14 and 13. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 16 and 15. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 18 and 17. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs:20 and 19.In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 22 and 21. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 24 and 23. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 26 and 25. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 28 and 27. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 30 and 29. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 32 and 31. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 34 and 33. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 36 and 35. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 38 and 37. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 40 and 39. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 42 and 41. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 44 and 43. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 46 and 45. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair sequences set forth in SEQ ID NOs: 48 and 47. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs:50 and 49.In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 52 and 51. In some embodiments, the isolated dual binding antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 54 and 53.

[0190] In some embodiments, the amino acid sequence of the heavy chain variable region-light chain variable region pair is selected from the paired sequences set forth in any one of the following: SEQ ID NOs: 209 and 210, SEQ ID NOs: 211 and 212, SEQ ID NOs: 213 and 214, SEQ ID NOs: 215 and 216, SEQ ID NOs: 217 and 218, SEQ ID NOs: 219 and 220, SEQ ID NOs: 221 and 222, SEQ ID NOs: 223 and 224, SEQ ID NOs: 225 and 226, SEQ ID NOs: 227 and 228, SEQ ID NOs: 229 and 230, SEQ ID NOs: 231 and 232, SEQ ID NOs: 233 and 234, SEQ ID NO: 235, and 236, SEQ ID NO:237 and 238, SEQ ID NO:239 and 240, SEQ ID NO:241 and 242, SEQ ID NO:243 and 244, SEQ ID NO:245 and 246, SEQ ID NO:247 and 248, SEQ ID NO:249 and 250, SEQ ID NO:251 and 252, SEQ ID NO:253 and 254, SEQ ID NO:255 and 256, SEQ ID NO:257 and 258, SEQ ID NO:259 and 260, SEQ ID NO:261 and 262, SEQ ID NO:263 and 264, SEQ ID NO:265 and 266, SEQ ID NO:267 and 268, SEQ ID NO:269 and 270, SEQ ID NO:2 71 and 272, SEQ ID NOs: 273 and 274, SEQ ID NOs: 275 and 276, SEQ ID NOs: 277 and 278, SEQ ID NOs: 279 and 280, SEQ ID NOs: 281 and 282, SEQ ID NOs: 283 and 284, SEQ ID NOs: 285 and 286, SEQ ID NOs: 287 and 288, SEQ ID NOs: 289 and 290, SEQ ID NOs: 291 and 292, SEQ ID NOs: 293 and 294, SEQ ID NOs: 295 and 296, SEQ ID NOs: 297 and 298, SEQ ID NOs: 299 and 300, SEQ ID NOs: 301 and 302, SEQ ID NOs: 303 and 304, SEQ ID NOs: 305 and 306, SEQ ID NOs: Nos. 307 and 308, SEQ ID NOs. 309 and 310, SEQ ID NOs. 311 and 312, SEQ ID NOs. 313 and 314, SEQ ID NOs. 315 and 316, SEQ ID NOs. 317 and 318, SEQ ID NOs. 319 and 320, SEQ ID NOs. 321 and 322, SEQ ID NOs. 323 and 324, SEQ ID NOs. 325 and 326, SEQ ID NOs. 327 and 328, SEQ ID NOs. 329 and 330, SEQ ID NOs. 331 and 332, SEQ ID NOs. 333 and 334, SEQ ID NOs. 335 and 336, SEQ ID NOs. 337 and 338, SEQ ID NOs. 339 and 340, SEQ ID NOs. 341 and 342,SEQ ID NOs: 343 and 344, SEQ ID NOs: 345 and 346, SEQ ID NOs: 347 and 348.

[0191] In some embodiments, the amino acid sequences of the scFv fragments include, but are not limited to, pairs of sequences set forth in any of the following pairs: SEQ ID NOs: 4 and 3, SEQ ID NOs: 6 and 5, SEQ ID NOs: 8 and 7, SEQ ID NOs: 10 and 9, SEQ ID NOs: 12 and 11, SEQ ID NOs: 14 and 13, SEQ ID NOs: 16 and 15, SEQ ID NOs: 18 and 17, SEQ ID NOs: 20 and 19, SEQ ID NOs: 22 and 21, SEQ ID NOs: 24 and 23, SEQ ID NOs: 26 and 25, SEQ ID NOs: 28 and 27, SEQ ID NOs: 30 and 29, SEQ ID NOs: 32 and 31, SEQ ID NOs: 34 and 33, SEQ ID NOs: 36 and 35, SEQ ID NOs: 38 and 37, SEQ ID NOs: 40 and 39, SEQ ID NOs: 42 and 41, SEQ ID NOs: 44 and 43, SEQ ID NOs: 46 and 45, SEQ ID NOs: 48 and 47, SEQ ID NOs: 50 and 49, SEQ ID NOs: 52 and 51, and SEQ ID NOs: 54 and 53.

[0192] Nucleotide sequences encoding engineered "re-epitope" VH domains, VL domains, or both VH and VL domains, as well as vectors and host cells containing these nucleotide sequences The present disclosure provides dual binding antibodies comprising a VH domain, a VL domain, or both a VH domain and a VL domain, which comprise variant amino acid sequences compared to the template VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively. As described in detail above, in some embodiments, the dual binding antibodies comprise a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, with at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof). or a combination of a heavy chain variable region as set forth in (a) and a light chain variable region as set forth in (b), wherein the total number of variant positions in the encoded heavy chain variable region, the encoded light chain variable region, or a combination thereof is at least two.

[0193] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated dual binding antibody comprising an antibody antigen binding domain portion comprising a VH domain and a VL domain, wherein the VH domain comprises a set of CDRs, HCDR1, HCDR2, and HCDR3 disclosed herein. In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated dual binding antibody comprising an antibody antigen binding domain portion comprising a VH domain and a VL domain, wherein the VH domain comprises a set of CDRs, HCDR1, HCDR2, and HCDR3 disclosed in Table 8 or Table 4. In some embodiments, the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth as I HX1 YDGSNK (SEQ ID NO: 142) (wherein HX1 is any amino acid), and the amino acid sequence of HCDR3 is set forth as AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids).

[0194] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a dual binding antibody VH domain comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 142), and HCDR3 (SEQ ID NO: 143), wherein the VH domain comprises a variant amino acid at at least one of HX1, HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12.

[0195] In some embodiments, the nucleic acid construct comprising the nucleic acid sequence encodes a VH domain of a dual binding antibody comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is selected from the group consisting of W and S), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I, L, and M). In certain embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a dual binding antibody comprising variant amino acids including HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, and HX12 is selected from the group of I and L).

[0196] In some embodiments, the nucleic acid construct comprising the nucleic acid sequence comprises HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, and HX12 is I), or HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, and HX12 is I). HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A and HX12 is L), or a VH domain comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A and HX12 is L).

[0197] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated dual binding antibody comprising an antigen-binding domain portion of an antibody comprising a VH domain and a VL domain, and in some embodiments, the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, and the amino acid sequence of LCDR1 is set forth as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are any amino acid), the amino acid sequence of LCDR2 is set forth as DD LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCDR3 is set forth as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acid).

[0198] In some embodiments, the nucleic acid construct comprising the nucleic acid sequence encodes a VL domain of a dual binding antibody comprising an LCDR. In some embodiments, the nucleic acid construct comprising the nucleic acid sequence encodes an isolated dual binding antibody comprising an antigen binding domain portion of an antibody comprising a VH domain and a VL domain, the VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3 disclosed in Table 9 or Table 5. In some embodiments, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G. In certain embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated dual binding antibody comprising variant amino acids LCDR1 (SEQ ID NO: 139) (LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is selected from the group consisting of S and G), LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G).

[0199] In some embodiments, the nucleic acid construct comprising the nucleic acid sequence comprises LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G); and LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S and LX7 is H), or a VL domain dual link antibody comprising LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is G), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S and LX7 is G).

[0200] In some embodiments, the nucleic acid construct comprising the nucleic acid sequence encodes an isolated dual-binding antibody comprising an antibody antigen-binding domain portion comprising a VH domain and a VL domain comprising a combination of the above VH domain HCDR and VL domain LCDR. For example, but not limited to, in certain embodiments, the nucleic acid construct comprising the nucleic acid sequence encodes a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 being set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 being set forth as I HX1 YDGSNK (SEQ ID NO: 142) (wherein HX1 is any amino acid), and the amino acid sequence of HCDR3 being AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 FD HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acid), the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is set forth as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are any amino acid), the amino acid sequence of LCDR2 is set forth as DD LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCD3 is set forth as QVWD LX5 LX6 SD LX7 VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acid).

[0201] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, and the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, and HX1 is selected from the group consisting of H, A, S, and HX2 is selected from the group consisting of H, A, S, and ...1 is selected from 0 is E, HX11 is A, HX12 is selected from the group consisting of I, L, and M, the VL domain comprises a set of CDRs, HCDR1, HCDR2, and HCDR3, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.

[0202] In certain embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated dual binding antibody comprising a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is W, the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, and HX8 is selected from the group consisting of V and T. HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, and HX12 is selected from the group of I and L; and comprises a VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, wherein the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is L, LX2 is I, LX3 is L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.

[0203] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a re-epitope dual binding antibody comprising a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, and a VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, wherein the amino acid sequences of each CDR are set forth in Figures 1A and 1B for the clones depicted in Figures 1A and 1B, such as, but not limited to,

[0204] Clone C2: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), HCDR3 (SEQ ID NO: 138) (wherein HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, and HX12 is I), LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G),

[0205] Clone C6: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), HCDR3 (SEQ ID NO: 138) (wherein HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A, and HX12 is L), LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is H); or

[0206] Clone C9: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), HCDR3 (SEQ ID NO: 138) (wherein HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, and HX12 is L), LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is G), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G).

[0207] In certain embodiments, the nucleic acid construct comprises a single nucleic acid sequence. In certain embodiments, the nucleic acid construct comprises two nucleic acid sequences. In certain embodiments, the nucleic acid construct comprises a single nucleic acid sequence, and the VH domain and the VL domain are encoded by a nucleic acid sequence. In certain embodiments, the nucleic acid construct comprises two nucleic acid sequences, and the VH domain is encoded by one nucleic acid sequence and the VL domain is encoded by another nucleic acid sequence.

[0208] As described herein, the disclosure provides polynucleotide sequences encoding the variant VH, VL, or both the VH and VL domains described herein. In certain embodiments, the template VH domain is encoded by the nucleotide sequence set forth in SEQ ID NO:55, and the template VL domain is encoded by the nucleotide sequence set forth in SEQ ID NO:56.

[0209] In some embodiments, disclosed herein is a nucleic acid construct comprising a nucleic acid sequence encoding a dual binding antibody, the antibody comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 with at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof); or a combination of a heavy chain variable region as set forth in (a) and a light chain variable region as set forth in (b), wherein the total number of variant positions in the encoded heavy chain variable region, the encoded light chain variable region, or a combination thereof is at least two.

[0210] In some embodiments, the nucleotide construct sequence comprises two nucleic acid sequences, one encoding a variant heavy chain variable region and one encoding a variant light chain variable region, in some embodiments, the nucleotide sequence or sequences encoding the dual binding antibody heavy chain variable region, light chain variable region, or both, are optimized for mammalian transcription and translation.

[0211] The present disclosure further provides, in certain embodiments, an isolated nucleic acid construct encoding the nucleic acid sequence described herein. Exemplary polynucleotide sequences encoding variant VH and VL domains are provided in Table 2 below. Exemplary nucleic acid constructs comprising a nucleic acid sequence encoding variant VH domain linked to VL domain are provided in Table 3 below.

[0212] Nucleic acid includes DNA and RNA. These and related embodiments may include polynucleotides encoding dual binding antibodies as described herein. As used herein, the term "isolated polynucleotide" refers to a polynucleotide of genomic, cDNA, or synthetic origin, or any combination thereof, and depending on its origin, an isolated polynucleotide is (1) not associated with all or part of the polynucleotides with which it is found in nature, (2) linked to a polynucleotide that is not linked in nature, or (3) not naturally occurring as part of a longer sequence.

[0213] Those of skill in the art will understand that the terms "polynucleotide" and "nucleic acid sequence" may, in some embodiments, be used interchangeably, all with the same meaning and qualities.

[0214] In some embodiments, the isolated nucleic acid sequences disclosed herein encode a VH domain comprising a set of HCDRs as disclosed throughout and in FIG. 1A, a VL domain comprising a set of LCDRs as disclosed throughout and in FIG. 1B, a VH domain comprising a set of HCDRs, and a VL domain, VL domain or VL domain, or a VH domain and a VL domain, of a dual binding antibody as described in detail herein throughout.

[0215] As used herein, the term "polynucleotide" encompasses single-stranded or double-stranded nucleic acid polymers. In certain embodiments, the nucleotides that comprise a polynucleotide can be ribonucleotides or deoxyribonucleotides, or modified forms of either type of nucleotide. Such modifications include base modifications such as bromouridine, ribose modifications such as arabinoside and 2',3'-dideoxyribose, and internucleotide linkage modifications such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselerothioate, phosphoroanilothioate, phosphoranilanate, and phosphoroamidate. The term "polynucleotide" specifically includes single-stranded and double-stranded forms of DNA.

[0216] The term "naturally occurring nucleotides" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" includes nucleotides with modified or substituted sugar groups, etc. The term "oligonucleotide linkages" includes oligonucleotide linkages such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselerothioate, phosphoroanilothioate, phosphoranilanate, and phosphoroamidate. See, e.g., LaPlanche et al., 1986, Nucl. Acids Res., 14:9081; Stec et al., 1984, J. Am. Chem. Soc., 106:6077; Stein et al., 1988, Nucl. Acids Res., 16:3209; Zon et al., 1991, Anti-Cancer Drug Design, 6:539; Zon et al., 1991, OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH, pp. 87-108 (F. Eckstein, Ed.), Oxford University Press, Oxford England; Stec et al., U.S. Pat. No. 5,151,510; Uhlmann and Peyman, 1990, Chemical Reviews, 90:543, the disclosures of which are incorporated herein by reference for any purpose. The oligonucleotide may contain a detectable label that allows for detection of the oligonucleotide or its hybridization.

[0217] In other related embodiments, a polynucleotide variant can have substantial identity to a polynucleotide template sequence, but the template sequence does not encode a dual binding antibody, or a fragment thereof, or a domain thereof.

[0218] In some embodiments, the polynucleotide variants contain one or more substitutions, additions, deletions, and / or insertions such that the binding affinity of the binding domain encoded by the variant polynucleotide binds to an epitope in a novel manner as compared to the unmodified template specifically described herein.

[0219] In some embodiments, the nucleic acid sequence encodes a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:1, with at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or combinations thereof). In some embodiments, the nucleic acid sequence encodes a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:1, with at least two amino acid variants at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or combinations thereof). In some embodiments, the nucleic acid sequence encodes a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:1, having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid variants at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or combinations thereof).

[0220] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a heavy chain variable region comprising a sequence selected from the sequences set forth in SEQ ID NOs: 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 105, and 107. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 57. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 59. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 61. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 63. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 65. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 67. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 69. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:71. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:73. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:75. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:77. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:79. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:81. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:83. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:85. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:87. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:89. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:91.In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:93. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:95. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:97. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:99. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:101. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:105. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO:107.

[0221] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a dual binding antibody heavy chain variable region sequence set forth in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In some embodiments, the nucleic acid sequence encodes a dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 4. In some embodiments, the nucleic acid sequence encodes a dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 6. In some embodiments, the nucleic acid sequence encodes a dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 8. In some embodiments, the nucleic acid sequence encodes a dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 10. In some embodiments, the nucleic acid sequence encodes a dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 12. In some embodiments, the nucleic acid sequence encodes a dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 14. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 16. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 18. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 20. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 22. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 24. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 26. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 28. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 30. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 32. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 34. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO: 36.In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO:38. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO:40. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO:42. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO:44. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO:46. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO:48. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO:50. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO:52. In some embodiments, the nucleic acid sequence encodes the dual binding antibody heavy chain variable region sequence set forth in SEQ ID NO:54.

[0222] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a dual binding antibody heavy chain variable region sequence set forth in Table 10 or Table 1, e.g., VH is set forth in SEQ ID NOs: 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263 , 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345 and 347. In another embodiment, the nucleic acid construct comprises a nucleic acid sequence encoding a VH that is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to a VH sequence disclosed herein.

[0223] In some embodiments, the nucleic acid sequence encodes a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:2 with at least one amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT position 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combination thereof). In some embodiments, the nucleic acid sequence encodes a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:2 with at least one amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT position 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combination thereof). In some embodiments, the nucleic acid sequence encodes a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:2 with at least one amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof).

[0224] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a light chain variable region comprising a sequence selected from the sequences set forth in SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, and 108. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 58. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 60. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 62. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 64. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 66. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 68. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:70. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:72. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:74. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:76. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:78. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:80. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:82. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:84. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:86. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:88. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:90. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:92.In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:94. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:96. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:98. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:100. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:102. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:104. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:106. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO:108.

[0225] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a dual binding antibody light chain variable region sequence set forth in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments, the nucleic acid sequence encodes a dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 3. In some embodiments, the nucleic acid sequence encodes a dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleic acid sequence encodes a dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 7. In some embodiments, the nucleic acid sequence encodes a dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 9. In some embodiments, the nucleic acid sequence encodes a dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 11. In some embodiments, the nucleic acid sequence encodes a dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 13. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 15. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 17. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 19. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 21. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 23. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 25. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 27. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 29. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 31. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 33. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 35.In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 37. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 39. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 41. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 43. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 45. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 47. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 49. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 51. In some embodiments, the nucleic acid sequence encodes the dual binding antibody light chain variable region sequence set forth in SEQ ID NO: 53.

[0226] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a dual binding antibody light chain variable region sequence set forth in Table 10 or Table 1, e.g., VL is set forth in SEQ ID NOs: 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, , 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346 and 348. In another embodiment, the nucleic acid construct comprises a nucleic acid sequence encoding a VL that is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to a VL sequence disclosed herein.

[0227] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a dual linked antibody heavy chain variable region-light chain variable region pair, the nucleic acid sequence being selected from the paired sequences set forth in SEQ ID NOs:57 and 58, SEQ ID NOs:59 and 60, SEQ ID NOs:61 and 62, SEQ ID NOs:63 and 64, SEQ ID NOs:65 and 66, SEQ ID NOs:67 and 68, SEQ ID NOs:69 and 70, SEQ ID NOs:71 and 72, SEQ ID NOs:73 and 74, SEQ ID NOs:75 and 76, SEQ ID NOs:77 and 78, SEQ ID NOs:79 and 80, SEQ ID NOs:81 and 82, SEQ ID NOs:83 and 84, SEQ ID NOs:85 and 86, SEQ ID NOs:87 and 88, SEQ ID NOs:89 and 90, SEQ ID NOs:91 and 92, SEQ ID NOs:93 and 94, SEQ ID NOs:95 and 96, SEQ ID NOs:97 and 98, SEQ ID NOs:99 and 100, SEQ ID NOs:101 and 102, SEQ ID NOs:103 and 104, SEQ ID NOs:105 and 106, and SEQ ID NOs:107 and 108.

[0228] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a dual binding antibody heavy chain variable region-light chain variable region pair shown in Table 10 or Table 1, for example, the VH and VL pair can be one of the following: SEQ ID NOs: 209 and 210, SEQ ID NOs: 211 and 212, SEQ ID NOs: 213 and 214, SEQ ID NOs: 215 and 216, SEQ ID NOs: 217 and 218, SEQ ID NOs: 219 and 220, SEQ ID NOs: 221 and 222, SEQ ID NOs: 223 and 224, SEQ ID NOs: 225 and 226, SEQ ID NOs: 227 and 228, SEQ ID NOs: 229 and 230, SEQ ID NOs: 231 and 232, SEQ ID NOs: 233 and 234, SEQ ID NOs: 235 and 236, SEQ ID NOs: 237 and 238, SEQ ID NOs: 239 and 240, SEQ ID NOs: 241 and 242, SEQ ID NOs: 243 and 244, SEQ ID NOs: 245 and 246, SEQ ID NOs: 247 and 248, SEQ ID NOs: 249 and 250, SEQ ID NOs: 251 and 252, SEQ ID NOs: 253 and 254, SEQ ID NOs: 255 and 256, SEQ ID NOs: 257 and 259, SEQ ID NOs: 258 and 259, SEQ ID NOs: 259 and 260, SEQ ID NOs: 261 and 262, SEQ ID NOs: 1 and 232, SEQ ID NO:233 and 234, SEQ ID NO:235 and 236, SEQ ID NO:237 and 238, SEQ ID NO:239 and 240, SEQ ID NO:241 and 242, SEQ ID NO:243 and 244, SEQ ID NO:245 and 246, SEQ ID NO:247 and 248, SEQ ID NO:249 and 250, SEQ ID NO:251 and 252, SEQ ID NO:253 and 254, SEQ ID NO:255 and 256, SEQ ID NO:257 and 258, SEQ ID NO:259 and 260, SEQ ID NO:261 and 262, SEQ ID NO:263 and 264, SEQ ID NO:265 and 266, SEQ ID NO: 267 and 268, SEQ ID NOs: 269 and 270, SEQ ID NOs: 271 and 272, SEQ ID NOs: 273 and 274, SEQ ID NOs: 275 and 276, SEQ ID NOs: 277 and 278, SEQ ID NOs: 279 and 280, SEQ ID NOs: 281 and 282, SEQ ID NOs: 283 and 284, SEQ ID NOs: 285 and 286, SEQ ID NOs: 287 and 288, SEQ ID NOs: 289 and 290, SEQ ID NOs: 291 and 292, SEQ ID NOs: 293 and 294, SEQ ID NOs: 295 and 296, SEQ ID NOs: 297 and 298, SEQ ID NOs: 299 and 300, SEQ ID NOs: 301 and 302, SEQ ID NOs: Nos. 303 and 304, SEQ ID NOs. 305 and 306, SEQ ID NOs. 307 and 308, SEQ ID NOs. 309 and 310, SEQ ID NOs. 311 and 312, SEQ ID NOs. 313 and 314, SEQ ID NOs. 315 and 316, SEQ ID NOs. 317 and 318, SEQ ID NOs. 319 and 320, SEQ ID NOs. 321 and 322, SEQ ID NOs. 323 and 324, SEQ ID NOs. 325 and 326, SEQ ID NOs. 327 and 328, SEQ ID NOs. 329 and 330, SEQ ID NOs. 331 and 332, SEQ ID NOs. 333 and 334, SEQ ID NOs. 335 and 336, SEQ ID NOs. 337 and 338,SEQ ID NOs: 339 and 340, SEQ ID NOs: 341 and 342, SEQ ID NOs: 343 and 344, SEQ ID NOs: 345 and 346, SEQ ID NOs: 347 and 348. In another embodiment, the VH and VL pairs are at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH and VL sequences disclosed herein.

[0229] Those skilled in the art will understand that in some embodiments, the sequence encoding the VH domain and the sequence encoding the VL domain are linked by a sequence encoding a linker sequence. In some embodiments, the nucleic acid sequence encodes a polypeptide linker. ggcggtggtggtagcggaggcggaggatcaggtggaggcggcagt (SEQ ID NO: 148).

[0230] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a dual-binding antibody heavy chain variable region-light chain variable region scFv, and the nucleic acid sequence is selected from the sequences set forth in SEQ ID NOs: 109 to 135.

[0231] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encoding a dual antibody described herein encodes an IgG immunoglobulin. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes an IgG1 immunoglobulin, an IgG2 immunoglobulin, an IgG3 immunoglobulin, or an IgG4 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes an IgG1 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes an IgG2 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes an IgG3 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes an IgG4 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes an IgG1 immunoglobulin or an IgG4 immunoglobulin.

[0232] In some embodiments, the nucleic acid sequence encoding the dual antibody encodes a Fab immunoglobulin fragment. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes a F(ab')2 immunoglobulin fragment. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes an Fv immunoglobulin. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes an scFv immunoglobulin. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes a minibody immunoglobulin construct comprising a pair of single chain Fv fragments linked via a CH3 domain.

[0233] In some embodiments, the nucleic acid sequence encoding the dual antibody encodes a diabody immunoglobulin. In some embodiments, the diabody immunoglobulin construct comprises a heavy chain variable (VH) and a light chain variable (VL) region linked by a small peptide linker. In some embodiments, the diabody immunoglobulin construct comprises a single chain (Fv)2 in which two scFv fragments are covalently linked to each other. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes a diabody immunoglobulin construct comprising three scFv fragments covalently linked to each other.

[0234] In some embodiments, the isolated polynucleotide construct encodes an isolated dual binding antibody disclosed herein.

[0235] In some embodiments, the nucleic acid sequence encoding the dual antibody encodes a mutant immunoglobulin. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes a mutant IgG that is unable to bind to an antibody-dependent cellular cytotoxicity component. In some embodiments, the nucleic acid sequence encoding the dual antibody encodes a mutant IgG1 ... 234 A / L 235 In some embodiments, the nucleic acid sequence encoding the dual antibody encodes an IgG containing the L A (LALA) mutation. 234 A / L 235It encodes an IgG1 containing the A(LALA) mutation.

[0236] In some embodiments, mutagenesis approaches such as site-directed mutagenesis, as disclosed herein, may be used to prepare variant VH, VL, or VH and VL nucleic acid sequences encoding variant VH, VL, or VH and VL amino acid sequences. The template VH and VL nucleic acid sequences of SEQ ID NOs: 55 and 56, respectively, encode the template amino acid sequences of SEQ ID NOs: 1 and 2, respectively. In some embodiments, the dual binding antibody comprises a variant VH domain, a variant VL domain, or both, encoded by a variant VH, VL, or VH and VL nucleotide sequence, which comprises the nucleotide template sequences of SEQ ID NOs: 55 and 56, respectively, of site-directed mutagenesis. By this approach, specific modifications in a polypeptide sequence can be made via mutagenesis of the base polynucleotide encoding the polypeptide sequence. These techniques provide a simple approach to prepare and test sequence variants, for example, but not limited to, by introducing one or more nucleotide sequence changes into a polynucleotide, taking into account the desired amino acid variant sites, as detailed above.

[0237] Site-directed mutagenesis allows for the production of variants through the use of specific oligonucleotide sequences that encode the DNA sequence of the desired mutation, as well as a sufficient number of flanking nucleotides, providing primer sequences of sufficient size and sequence complexity to form stable duplexes on either side of the deletion junction across. Mutations may be employed in selected polynucleotide sequences to improve, alter, reduce, modify, or otherwise change the properties of the polynucleotide itself, and / or to change the properties, activity, composition, stability, or primary sequence of the encoded polypeptide.

[0238] In certain embodiments, mutagenesis of polynucleotide sequences encoding component portions of dual binding antibodies (VH domain, VL domain, or combination thereof) disclosed herein is contemplated to alter the binding properties of the encoded template VH or VL, or both, such that the resulting antibody comprises dual binding affinity. The technique of site-directed mutagenesis is well known in the art and is widely used to generate variants of both polypeptides and polynucleotides. For example, site-directed mutagenesis is often used to alter specific portions of DNA molecules. In such embodiments, primers are used that typically contain a length of about 14 to about 25 nucleotides or so, and about 5 to about 10 residues on either side of the junction of the sequence are altered.

[0239] As understood by those skilled in the art, site-directed mutagenesis techniques have often utilized phage vectors that exist in both single-stranded and double-stranded forms.Typical vectors useful for site-directed mutagenesis include vectors such as M13 phage.These phages are readily available commercially, and their use is generally well known to those skilled in the art.Double-stranded plasmids are also routinely used in site-directed mutagenesis, which eliminates the step of transferring the gene of interest from the plasmid to the phage.

[0240] Generally, site-directed mutagenesis according to the present invention is carried out by first obtaining a single-stranded vector or by melting and separating the two strands of a double-stranded vector that contains within its sequence a DNA sequence encoding a desired peptide. An oligonucleotide primer carrying the desired mutated sequence is then prepared, generally synthetically. This primer is then annealed with the single-stranded vector and subjected to a DNA polymerizing enzyme, such as E. coli polymerase I Klenow fragment, to complete the synthesis of a mutation-bearing strand. Thus, a heteroduplex is formed, with one strand encoding the original non-mutated sequence and the second strand carrying the desired mutation. This heteroduplex vector is then used to transform an appropriate cell, such as an E. coli cell, and clones are selected that contain a recombinant vector carrying the mutated sequence arrangement.

[0241] The preparation of sequence variants of selected peptide-encoding DNA segments using site-directed mutagenesis provides a means of producing potentially useful species, but is not intended to be limiting, as there are other methods by which sequence variants of peptides and the DNA sequences encoding them can be obtained. In some embodiments, methods for preparing libraries include those known in the art, such as, but not limited to, those described in U.S. Pat. No. 9,889,423, which are incorporated herein in their entirety. In some embodiments, methods for designing sequence variants in libraries include designing variant sequences on a computer, and then synthesizing the sequences by methods that include both chemical and biochemical processes.

[0242] As used herein, the term "oligonucleotide-directed mutagenesis procedure" encompasses template-dependent processes and vector-mediated amplification, which results in an increase in the concentration of a particular nucleic acid molecule relative to its initial concentration, or an increase in the concentration of a detectable signal, such as amplification. As used herein, the term "oligonucleotide-directed mutagenesis procedure" encompasses processes involving template-dependent extension of a primer molecule. The term "template-dependent process" encompasses nucleic acid synthesis of an RNA or DNA molecule, where the sequence of the newly synthesized strand of nucleic acid is determined by well-known rules of complementary base pairing (see, e.g., Watson, 1987). Typically, vector-mediated methods involve the introduction of a nucleic acid fragment into a DNA or RNA vector, clonal amplification of the vector, and recovery of the amplified nucleic acid fragment. An example of such methodology is provided by U.S. Pat. No. 4,237,224, which is specifically incorporated herein by reference in its entirety.

[0243] Another approach to the production of polypeptide VH and VL variants can use iterative sequence recombination, as described in U.S. Patent No. 5,837,458. In this approach, repeated cycles of recombination and screening or selection are performed to "evolve" individual polynucleotide variants, e.g., with increased binding affinity. Certain embodiments also provide constructs in the form of plasmids, vectors, transcription or expression cassettes that include at least one polynucleotide described herein.

[0244] In certain embodiments, the above polynucleotides encoding the amino acid VH, VL, or VH and VL variants, e.g., VH, VL, or VH and VL variant polynucleotides, fragments, and hybridization sequences, are included in a dual binding antibody.

[0245] The polynucleotides described herein, or fragments thereof, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, etc., so that their total length may vary considerably, regardless of the length of the coding sequence itself. Thus, it is contemplated that nucleic acid fragments of almost any length may be used, with the total length being preferably limited by the ease of preparation and use in the intended recombinant DNA protocol. For example, exemplary polynucleotide segments of total length of about 10,000, about 5000, about 3000, about 2,000, about 1,000, about 500, about 200, about 100, about 50 base pairs, etc. (including all intermediate lengths) are contemplated to be useful.

[0246] In certain embodiments, the isolated polynucleotide is inserted into a vector, hi some embodiments, the vector comprises an expression vector comprising the polynucleotide construct disclosed herein.

[0247] As used herein, the term "vector" encompasses a vehicle into which a polynucleotide encoding a protein can be covalently inserted to effect expression of the protein and / or cloning of the polynucleotide. An isolated polynucleotide can be inserted into a vector using any suitable method known in the art, for example, but not limited to, a vector can be digested with an appropriate restriction enzyme and then ligated to the isolated polynucleotide having matching restriction enzyme ends.

[0248] Examples of suitable vectors include, but are not limited to, plasmids, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs) or P1-derived artificial chromosomes (PACs), bacteriophages such as lambda phage or M13 phage, and animal viruses. Examples of animal virus categories useful as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex viruses), poxviruses, baculoviruses, papilloma viruses, and papova viruses (e.g., SV40).

[0249] For expression of the dual antibody or its components, a vector may be introduced into a host cell to allow expression of the polypeptide in the host cell. The expression vector may contain various elements for controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection markers, and signal sequences. These elements may be appropriately selected by those skilled in the art. In some embodiments, these elements may be considered "regulatory elements".

[0250] Those skilled in the art will understand that the term "regulatory sequences" may encompass polynucleotide sequences that may affect the expression, processing or subcellular localization of coding sequences to which they are ligated or operably linked. The nature of such regulatory sequences may depend on the host organism. In certain embodiments, prokaryotic transcriptional regulatory sequences may include promoters, ribosomal binding sites, and transcription termination sequences. In other particular embodiments, eukaryotic transcriptional regulatory sequences may include promoters that include one or more recognition sites for transcription factors, transcriptional enhancer sequences, transcription termination sequences, and polyadenylation sequences. In certain embodiments, "regulatory sequences" may include leader sequences and / or fusion partner sequences.

[0251] In some embodiments, for example and without limitation, a promoter sequence may be selected to promote transcription of a polynucleotide in a vector. Suitable promoter sequences include, but are not limited to, T7 promoter, T3 promoter, SP6 promoter, beta-actin promoter, EF1a promoter, CMV promoter, and SV40 promoter. An enhancer sequence may be selected to enhance transcription of a polynucleotide. A selection marker may be selected to allow host cells inserted with the vector to be selected from host cells that are not, for example, a selection marker may be a gene that confers antibiotic resistance. A signal sequence may be selected to allow the expressed polypeptide to be transported outside the host cell.

[0252] The vector may also contain materials that aid in its entry into a cell, including, but not limited to, a viral particle, a liposome, or a protein coating. In some embodiments, a host cell comprises an expression vector disclosed herein.

[0253] In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VH domain, a VL domain, a combined VH-VL domain, which may be present in a dual antibody or components thereof, such as, but not limited to, a Fab element, a F(ab')2 element, a scFv, an Fv, a minibody, a diabody, or a triabody, as described above. Dual binding domains and components thereof are described in detail above.

[0254] In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VH domain. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VL domain. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VH and a VL domain. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding two VH and a VL domain. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding three VH and a VL domains.

[0255] In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VH domain component of a dual antibody. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VL domain component of a dual antibody. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding the VH and VL domain components of a dual antibody.

[0256] In some embodiments, an expression vector comprises an isolated nucleic acid sequence encoding a VH domain component of a dual IgG antibody or fragment thereof. In some embodiments, an expression vector comprises an isolated nucleic acid sequence encoding a VL domain component of a dual IgG antibody or fragment thereof. In some embodiments, an expression vector comprises an isolated nucleic acid sequence encoding the VH and VL domain components of a dual IgG antibody or fragment thereof.

[0257] In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VH domain component of an scFv. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VL domain component of an scFv. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding the VH and VL domain components of an scFv.

[0258] Dual binding antibodies are described in detail above. Those skilled in the art will certainly understand the scope of components that can be encoded by the isolated nucleic acids described herein, using their knowledge in the art and the specific details newly described herein.

[0259] For cloning polynucleotides, vectors may be introduced into host cells (isolated host cells) to allow the vector to replicate itself, thereby amplifying copies of the polynucleotides contained therein. Cloning vectors generally include, but are not limited to, a replication origin, a promoter sequence, a transcription initiation sequence, an enhancer sequence, and a selection marker. These elements can be appropriately selected by those skilled in the art. For example, a replication origin can be selected to promote the autonomous replication of vectors in host cells.

[0260] In certain embodiments, the present disclosure provides an isolated host cell containing a vector provided herein. The host cell containing the vector may be useful for expressing or cloning the polynucleotide contained in the vector.

[0261] In some embodiments, the recombinant host cell comprises one or more constructs described above. The nucleic acid encodes any CDR or set of CDRs or VH or VL domain or antibody antigen binding site or antibody molecule, such as, but not limited to, IgG, Fv, scFv, Fab, F(ab')2, minibody, diabody, or triabody. In some embodiments, methods of producing the encoded product are disclosed herein, the methods comprising expression from the encoding nucleic acid construct. Expression may in some embodiments be achieved by culturing a recombinant host cell containing the nucleic acid construct under suitable conditions. After production by expression, the VH or VL domain, or VH-VL pair, or antibody may be isolated and / or purified using any suitable technique and then used as desired, for example, in the therapeutic methods described herein.

[0262] In some embodiments, dual binding antibody, VH domains and / or VL domains encoding nucleic acid molecules and vectors according to the invention may be prepared and isolated and / or purified in a substantially pure or homogeneous form.

[0263] In some embodiments, systems for cloning and expression of polypeptides in a variety of different host cells are well known. Suitable host cells can include, but are not limited to, prokaryotic cells, fungal cells, yeast cells, or higher eukaryotic cells, such as insect cells or mammalian cells.

[0264] Suitable prokaryotic cells for this purpose include, but are not limited to, eubacteria such as gram-negative or gram-positive organisms, e.g., Enterobacteriaceae, such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacillus, such as Bacillus subtilis and Bacillus licheniformis, Pseudomonas, such as Pseudomonas aeruginosa, and Streptomyces.

[0265] The expression of antibodies and antigen-binding fragments in prokaryotic cells such as E. coli is well established in the art. For review, see, for example, Pluckthun, A. Bio / Technology 9:545-551 (1991). Expression in eukaryotic cells in culture is also available to those skilled in the art as an option for producing antibodies or antigen-binding fragments thereof, see, for example, Ref, ME (1993) Curr. Opinion Biotech. 4:573-576, Trill JJ et al. (1995) Curr. Opinion Biotech 6:553-560.

[0266] Suitable fungal cells for this purpose include, but are not limited to, filamentous fungi and yeast. Illustrative examples of fungal cells include Saccharomyces cerevisiae, common baker's yeast, Schizosaccharomyces pombe, such as K. lactis, K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 24,179), K. lactis ... Kluyveromyces hosts such as Kluyveromyces spp. (ATCC 56,500), Kluyveromyces drosophilarum (ATCC 36,906), Kluyveromyces thermotolerans, and Kluyveromyces marxianus, Yarrowia spp. (EP 402,226), Pichia pastoris (EP 402,226), and pastoris (EP 183,070), Candida, Schwanniomyces such as Trichoderma reesia (EP 244,234), Neurospora crassa, Schwanniomyces occidentalis, as well as filamentous fungi such as Neurospora, Penicillium, Trypocladium, and Aspergillus hosts such as A. nidulans and A. niger.

[0267] Higher eukaryotic cells, particularly cells derived from multicellular organisms, can be used to express the glycosylated VH and VL domains provided herein. Suitable higher eukaryotic cells include, but are not limited to, invertebrate and insect cells, as well as vertebrate cells. Examples of invertebrate cells include plant and insect cells. Numerous baculovirus strains and mutants have been identified, as well as corresponding insect host cells that are permissive for hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fly), and Bombyx mori. Various virus strains for transfection are publicly available, such as the K-1 variant of Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV, and such viruses can be used as described herein, particularly for transfection of Spodoptera frugiperda cells. Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can also be utilized as hosts. Mammalian cell lines available in the art for expression of heterologous polypeptides include Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney cells, NS0 mouse melanoma cells, YB2 / 0 rat myeloma cells, human embryonic kidney cells, human embryonic retina cells, and many others.Non-limiting examples of vertebrate cells include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651), human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)), baby hamster kidney cells (BHK, ATCC CCL 10), Chinese hamster ovary cells / -DHFR (CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)), ExpiCHO-S™ cells (ThermoFisher Scientific Catalog No. A29133), mouse Sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)), monkey kidney cells (CV1 ATCC CCL 70), African green monkey kidney cells (VERO-76, ATCC CRK-1587), human cervical carcinoma cells (HELA, ATCC CCL 2), canine kidney cells (MDCK, ATCC CCL 34), Buffalo rat hepatocytes (BRL 3A, ATCC CRL 1442), human lung cells (W138, ATCC CCL 75), human hepatocytes (Hep G2, HB 8065), mouse mammary tumor (MMT 060562, ATCC CCL51), TRI cells (Mather et al., Annals NYAcad. Sci. 383:44-68 (1982)), MRC 5 cells, FS4 cells, and mammalian host cell lines such as human hepatoma line (Hep G2).

[0268] In some embodiments, the expression vector comprises the nucleic acid construct described herein. A suitable vector can be selected or constructed to contain suitable control sequences, including promoter sequences, terminator sequences, polyadenylation sequences, enhancer sequences, marker genes, and other sequences as needed. The control sequences can be operably linked to the nucleic acid sequences contained within the nucleic acid construct. The vector can be a plasmid, for example, a phage, or a phagemid as needed. For further details, see, for example, Molecular Cloning: a Laboratory Manual: 3rd edition, Sambrook and Russell, 2001, Cold Spring Harbor Laboratory Press. Many known techniques and protocols for the manipulation of nucleic acids, for example in the preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1988, Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley & Sons, 4.sup.th edition 1999. The disclosures of Sambrook et al. and Ausubel et al. (both) are incorporated herein by reference.

[0269] Vectors can be introduced into host cells using any suitable method known in the art, including, but not limited to, DEAE-dextran mediated delivery, calcium phosphate precipitation, cationic lipid mediated delivery, liposome mediated transfection, electroporation, microprojectile bombardment, receptor mediated gene delivery, polylysine, histones, chitosan, and peptide mediated delivery. Standard methods for transfection and transformation of cells for expression of a vector of interest are well known in the art.

[0270] In some embodiments, a host cell containing the nucleic acid disclosed herein is provided herein. Such a host cell may be in vitro and may be cultured. Such a host cell may be in vivo. The in vivo presence of the host cell may allow intracellular expression of the bibinding antibody described herein as an "intrabody" or intracellular antibody. Intrabodies may be used for gene therapy.

[0271] In certain embodiments, the host cell comprises a first vector encoding a first polypeptide, e.g., a VH domain, and a second vector encoding a second polypeptide, e.g., a VL domain. In certain embodiments, the host cell comprises a vector encoding a first polypeptide, e.g., a VH domain, and a second polypeptide, e.g., a VL domain.

[0272] In certain embodiments, the host cell comprises a first vector encoding a variant VH domain and a second vector encoding a variant VL domain, hi certain embodiments, the host cell comprises a single vector encoding the variant VH domain and the variant VL domain.

[0273] In some embodiments, the isolated cell comprises an isolated nucleic acid sequence disclosed herein. In some embodiments, the isolated cell comprises two isolated nucleic acid sequences disclosed herein, one nucleic acid encoding a variant VH domain and another nucleic acid encoding a variant VL domain. In some embodiments, the isolated cell comprises a single isolated nucleic acid sequence disclosed herein that encodes a variant VH domain and a variant VL domain.

[0274] In certain embodiments, the first vector and the second vector may or may not be introduced at the same time. In certain embodiments, the first vector and the second vector may be introduced together into the host cell. In certain embodiments, the first vector may be introduced into the host cell first, and then the second vector may be introduced. In certain embodiments, the first vector may be introduced into the host cell, and then a stable cell line expressing the first polypeptide may be established, and then the second vector may be introduced into the stable cell line.

[0275] In certain embodiments, the host cell comprises a vector encoding at least one variant VH domain and at least one variant VL comprised within a dual binding antibody.

[0276] Following introduction, expression from the nucleic acid may be caused or permitted, for example, by culturing a host cell under conditions for expression of the gene. In certain embodiments, the present disclosure provides a method of expressing a polypeptide provided herein, comprising culturing a host cell containing a vector under conditions in which a polynucleotide inserted within the vector is expressed.

[0277] In some embodiments, the nucleic acid is integrated into the genome (e.g., chromosome) of the host cell. Integration can be facilitated by including sequences that facilitate recombination with the genome, according to standard techniques. In some embodiments, the nucleic acid construct is not integrated into the genome, and the vector is episomal.

[0278] In some embodiments, disclosed herein is a method comprising using the above construct in an expression system to express a dual binding antibody or fragment thereof as described herein above.

[0279] Suitable conditions for expression of a polynucleotide include, but are not limited to, a suitable culture medium, a suitable density of host cells in the culture medium, the presence of necessary nutrients, the presence of cofactors, suitable temperature and humidity, and the absence of microbial contaminants. Those skilled in the art can select suitable conditions for the purpose of expression.

[0280] Methods for synthesizing engineered re-epitope biantibodies In some embodiments, the method for producing a dual-binding antibody is described herein, comprising a VH domain comprising HCDR as described herein.In some embodiments, the method for producing a dual-binding antibody is described herein, comprising a VL domain comprising LCDR as described herein.In some embodiments, the method for producing a dual-binding antibody is described herein, comprising a VH domain comprising HCDR as described herein and a VL domain comprising LCDR as described herein.

[0281] In some embodiments, the amino acid sequence set forth in SEQ ID NO:1 has at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof); A method for producing a dual binding antibody heavy chain variable region comprising a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:2, or (c) a combination of a heavy chain variable region as set forth in (a) and a light chain variable region as set forth in (b), with an amino acid variant of at least two in the heavy chain variable region, the light chain variable region, or the combination of variant positions of the dual binding antibody, comprises culturing a cell or a plurality of cells comprising nucleic acid sequences encoding at least the VH and VL of the dual binding antibody, a polypeptide comprising variant VH and variant VL domains is expressed and isolated, and the isolated variant VH and variant VL domains form heterodimers. As disclosed in detail herein, the isolated nucleic acid sequences encoding the variant VH and variant VL domains may be contained within a vector, the same vector or different vectors being used. In some embodiments, each variant VH and variant VL domain may be expressed from a different host cell, and dimer formation occurs after isolation or purification of the constituent variant VH and variant VL domains. In some embodiments, the variant VH domain and the variant VL domain may be expressed from the same host cell and dimerization occurs during culture or after isolation or purification of the constituent variant VH domain and variant VL domain.

[0282] One of skill in the art will understand that producing a dual binding antibody involves synthesizing amino acid polypeptide building blocks that include a VH domain, a VL domain, or both. In some embodiments, the synthesis begins with a nucleic acid construct as described in detail herein. The terms "producing" and "synthesizing" may be used interchangeably in some embodiments, all with the same quality and meaning.

[0283] In some embodiments, synthesizing the dual binding antibody comprises synthesizing an IgG heavy chain comprising a variant VH domain, synthesizing an IgG light chain comprising a variant VL domain, or both. In some embodiments, synthesizing the dual binding antibody comprises synthesizing an IgG heavy chain comprising a variant VH domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing an IgG light chain comprising a variant VL domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing both an IgG heavy chain comprising a variant VH domain and an IgG light chain comprising a variant VL domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing a Fab comprising a fragment of an IgG heavy chain comprising a variant VH domain and a fragment of an IgG light chain comprising a variant VL domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing a F(ab')2 comprising a fragment of an IgG heavy chain comprising a variant VH domain and a fragment of an IgG light chain comprising a variant VL domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing an Fv comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing an scFv comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing a minibody comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing a diabody comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing a triabody comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing a variant VH domain. In some embodiments, synthesizing the dual binding antibody comprises synthesizing a variant VL domain.

[0284] In certain embodiments, the polypeptides expressed in a host cell can form dimers, thereby producing a bibinding antibody or binding component thereof.

[0285] In some embodiments, the method of synthesizing a dual binding antibody comprises mutating a nucleic acid sequence encoding a template heavy chain variable region that does not include a dual binding VH domain to generate a variant VH domain that may include a dual binding VH domain. In some embodiments, the method of synthesizing a dual binding antibody comprises mutating a nucleic acid sequence encoding a template light chain variable region that does not include a dual binding VL domain to generate a variant VL domain that may include a dual binding VL domain. In some embodiments, the method of synthesizing a dual binding antibody comprises mutating a nucleic acid sequence encoding a template heavy chain variable region that does not include a dual binding VH domain to generate a variant VH domain that may include a dual binding VH domain, and mutating a nucleic acid sequence encoding a template light chain variable region that does not include a dual binding VL domain to generate a variant VL domain that may include a dual binding VL domain, the variant VH and VL domains comprising the dual variable regions of an antibody. Methods of mutating nucleic acid sequences are described in detail above and are illustrated below in the Examples.

[0286] In some embodiments, the template nucleic acid sequence encoding the template heavy chain variable region is set forth in SEQ ID NO: 55. In some embodiments, the template nucleic acid sequence encoding the template light chain variable region is set forth in SEQ ID NO: 56. As described throughout, the template VH and VL sequences do not include a dual binding region.

[0287] In some embodiments, the method of synthesizing a dual binding antibody comprises introducing at least two variant sites into the VH and VL domains. In some embodiments, the method of synthesizing a dual binding antibody comprises introducing at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 variant sites into the VH and VL domains. The variant sites may be distributed between the VH and VL domains. In some embodiments, the variant site is in the CDR region of the VH domain. In some embodiments, the variant site is in the CDR region of the VL domain. In some embodiments, the variant site is in the FR region of the VH domain. In some embodiments, the variant site is in the FR region of the VL domain. In some embodiments, the variant site is in the CDR and / or FR region of the VH domain. In some embodiments, the variant site is in the CDR and / or FR region of the VL domain. In some embodiments, the variant sites are in the CDR and / or FR regions of the VH domain and in the CDR and / or FR regions of the VL domain.

[0288] In certain embodiments, the complex of the variant VH domain and the variant VL domain may be formed in a host cell. For example, the heterodimer of the variant VH domain and the variant VL domain may be formed in a host cell using related enzymes and / or cofactors. In certain embodiments, the complex of the variant VH domain polypeptide and the variant VL domain polypeptide may be secreted outside the cell. In certain embodiments, the variant VH domain and the variant VL domain may be secreted from the host cell and form a heterodimer outside the host cell.

[0289] In certain embodiments, the variant VH domain and the variant VL domain can be expressed separately and dimerized under suitable conditions. For example, the variant VH domain and the variant VL domain can be combined in a suitable buffer, allowing the variant VH domain and the variant VL domain to dimerize through suitable interactions, such as hydrophobic interactions. As another example, the variant VH domain and the variant VL domain can be combined in a suitable buffer containing enzymes and / or cofactors that can promote the dimerization of the variant VH domain and the variant VL domain. As another example, the variant VH domain and the variant VL domain can be combined in a suitable vehicle, allowing them to react with each other in the presence of suitable reagents and / or catalysts.

[0290] In certain embodiments, the variant VH domain and variant VL domain can be included in a longer polypeptide sequence, including, but not limited to, a constant region, a hinge region, a linker region, an Fc region, or a disulfide bond region, or any combination thereof. A constant domain is an immunoglobulin folding unit of the constant part of an immunoglobulin molecule, also called the domain of the constant region (e.g., CH1, CH2, CH3, CH4, Ck, Cl). In some embodiments, the longer polypeptide can include multiple copies of the variant VH domain, variant VL domain, or both, including, but not limited to, when the bibinding antibody includes a diabody or a triabody.

[0291] In certain embodiments, the variant VH domain and variant VL domain are generated by DNA synthesis and PCR, and translation of the generated nucleotide sequence. In certain embodiments, the generated sequence can be subcloned into an expression vector. In certain embodiments, the generated sequence can be subcloned into two expression vectors. In certain embodiments, the expression vector is a plasmid. In certain embodiments, the variant VH domain and variant VL domain are constructed on an IgG template, which does not have dual binding capacity.

[0292] In certain embodiments, transient expression is carried out by co-transfecting an expression vector encoding a variant VH domain and a variant VL domain, or by transfecting an expression vector encoding both into suitable cells.Those skilled in the art will understand that there are many transfection methods and protocols that can be used for this purpose.In certain embodiments, transfection or co-transfection is carried out using the PEI method.

[0293] The expressed polypeptides comprising variant VH and VL domains and / or polypeptide complexes can be collected using any suitable method. The variant VH and VL domains and / or polypeptide complexes can be expressed intracellularly, in the periplasmic space, or secreted outside the cell into the medium. If the polypeptides comprising variant VH and VL domains and / or polypeptide complexes are expressed intracellularly, the host cells containing the polypeptides comprising variant VH and VL domains and / or polypeptide complexes can be lysed, and the polypeptides and / or polypeptide complexes can be isolated from the lysate by removing unwanted debris by centrifugation or ultrafiltration. If the polypeptides and / or polypeptide complexes comprising variant VH and variant VL domains are secreted into the periplasmic space of E. coli, the cell paste may be thawed for about 30 minutes in the presence of agents such as sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonyl fluoride (PMSF), and cell debris may be removed by centrifugation (Carter et al., BioTechnology 10:163-167 (1992)). If the polypeptides and / or polypeptide complexes comprising variant VH and variant VL domains are secreted into the medium, the cell culture supernatant may be collected and concentrated using a commercially available protein concentration filter, e.g., an Amincon or Millipore Pellicon ultrafiltration unit. Protease inhibitors and / or antibiotics may be included in the collection and concentration steps to inhibit proteolysis and / or growth of contaminating microorganisms.

[0294] The expressed polypeptides and / or polypeptide complexes comprising the variant VH domains and the variant VL domains can be further purified by appropriate methods such as affinity chromatography, hydroxylapatite chromatography, size exclusion chromatography, gel electrophoresis, dialysis, ion exchange fractionation on ion exchange columns, ethanol precipitation, reversed phase HPLC, chromatography on silica, chromatography on heparin sepharose, chromatography on anion or cation exchange resins (such as polyaspartic acid columns), isoelectric focusing, SDS-PAGE, and ammonium sulfate precipitation (for reviews see Bonner, PL, Protein purification, published by Taylor & Francis, 2007; Janson, JC, et al, Protein purification: principles, high resolution methods and applications, published by Wiley-VCH, 1998).

[0295] In certain embodiments, polypeptides comprising variant VH domains and variant VL domains and / or polypeptide dimeric complexes can be purified by affinity chromatography. In certain embodiments, protein A chromatography or protein A / G (fusion protein of protein A and protein G) chromatography can be useful for purifying polypeptides and / or polypeptide complexes comprising components derived from antibody CH2 domains and / or CH3 domains (Lindmark et al., J.Immunol.Meth.62:1-13 (1983)); Zettlit, KA, Antibody Engineering, Part V, 531-535, 2010). In certain embodiments, the dual binding antibodies disclosed herein do not bind to protein A. In certain embodiments, protein G chromatography can be useful for purifying polypeptides and / or polypeptide complexes comprising IgGγ3 heavy chains (Guss et al., EMBO J.5:1567 1575 (1986)). In certain embodiments, protein L chromatography may be useful for purification of polypeptides and / or polypeptide complexes that contain a K light chain (Sudhir, P., Antigen engineering protocols, Chapter 26, Humana Press, 1995; Nilson, BHK et al, J. Biol. Chem., 267, 2234-2239 (1992)). The matrix to which the affinity ligand is attached is most often agarose, although other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. If the antibody contains a CH3 domain, Bakerbond ABX resin (JT Baker, Phillipsburg, NJ) is useful for purification.

[0296] Following any preliminary purification steps, the mixture containing the dual-bound antibody and contaminants may be subjected to low pH hydrophobic interaction chromatography using an elution buffer at a pH of about 2.5 to 4.5, preferably performed at a low salt concentration (e.g., about 0 to 0.25 M salt).

[0297] In certain embodiments, the polypeptides comprising variant VH and variant VL domains and / or polypeptide dimeric complexes may be purified by affinity chromatography and size-exclusion chromatography (SEC). Those skilled in the art will appreciate that there are numerous methods and protocols suitable for this purpose. In certain embodiments, protein purification by affinity chromatography and SEC is performed using an AKTA genuine instrument (GE Lifesciences). In certain embodiments, affinity capture of dual-binding antibodies is achieved by passing the collected supernatant through a column of CaptureSelect™ CH1-XL affinity matrix (Thermo Scientific). After washing the column with PBS, the protein is eluted with 0.1 M glycine, pH 2.5, and immediately neutralized with 1 / 6 volume of 1 M Tris-HCl, pH 8.0. The affinity-purified protein is then concentrated to 5-10 mg / ml using an Amicon 30 kD concentrator (Merck Millipore) and subjected to SEC purification on a Superdex® 200 column (GE Lifesciences) equilibrated with PBS. Protein fractions are then collected and analyzed using SDS-PAGE and HPLC-SEC.

[0298] Binding of the synthesized dual binding immunoglobulins to the epitope can be analyzed using methods well known in the art, including ELISA analysis, SPR analysis, DSF analysis, and cell-based binding assays, as described herein.

[0299] In some embodiments, a heavy chain variable region comprising a template amino acid sequence set forth in SEQ ID NO:1, the template comprising at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or combinations thereof); and a template set forth in SEQ ID NO:2. A method for synthesizing a dual-binding antibody comprising a light chain variable region comprising an amino acid sequence, said template comprising at least one amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof), wherein the total number of variant positions in said heavy chain variable region, said light chain variable region, or combinations thereof is at least two, comprises the steps of: (a) mutating the template heavy chain variable region, the template light chain variable region, or both; (i) mutating the template heavy chain variable region comprises mutating a template heavy chain variable region set forth in SEQ ID NO:1, wherein the selected template variable chain does not contain a double binding region; (ii) mutating the template light chain variable region comprises mutating a template light chain variable region set forth in SEQ ID NO:2, wherein the selected template variable chain does not contain a double binding region; (iii) mutating both the template heavy chain variable region and the template light chain variable region comprises mutating a template heavy chain variable region set forth in SEQ ID NO:1 and mutating a template light chain variable region set forth in SEQ ID NO:2, wherein both selected template variable chains do not contain a double binding region, and wherein said mutating comprises mutating at least two residues in the template heavy chain variable region, the template light chain variable region, or a combination thereof; (b) synthesizing a mutated template variant heavy chain variable chain and a mutated template variant light chain variable chain; (c) forming the mutated template variant heavy chain variable chain and the mutated template variant light chain variable chain into a human antibody format; and (d) screening the human antibodies of (c) for binding to the dual antigen; This results in the production of a bibinding antibody.

[0300] As described herein and exemplified below, in some embodiments, the synthesized antibody comprises an IgG immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG1 immunoglobulin, an IgG2 immunoglobulin, an IgG3 immunoglobulin, or an IgG4 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG1 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG2 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG3 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG4 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG1 immunoglobulin or an IgG4 immunoglobulin.

[0301] In some embodiments, the synthesized antibody comprises a Fab immunoglobulin fragment. In some embodiments, the synthesized antibody comprises a F(ab')2 immunoglobulin fragment. In some embodiments, the synthesized antibody comprises an Fv immunoglobulin construct, in some embodiments, the synthesized antibody comprises an scFv immunoglobulin construct, in some embodiments, the synthesized antibody comprises a minibody immunoglobulin construct comprising a pair of single chain Fv fragments linked via a CH3 domain.

[0302] In some embodiments, the composite antibody comprises a diabody immunoglobulin construct. In some embodiments, the composite antibody comprises a diabody immunoglobulin construct comprising three scFv fragments covalently linked to one another. In some embodiments, the composite antibody comprises a triabody.

[0303] In some embodiments, the synthesized antibody comprises a mutant IgG that is unable to bind to an antibody-dependent cellular cytotoxicity component. In some embodiments, the synthesized antibody comprises a mutant IgG1 that is unable to bind to an antibody-dependent cellular cytotoxicity component. In some embodiments, the synthesized antibody comprises a mutant IgG4 that is unable to bind to an antibody-dependent cellular cytotoxicity component.

[0304] Immunoglobulin Library In certain embodiments, disclosed herein are libraries of immunoglobulins or fragments thereof comprising variant VH domains, variant VL domains, or variant VH and variant VL domains as described in detail herein (see Examples below). Libraries of immunoglobulins or fragments thereof comprising variant VH domains, variant VL domains, or variant VH and variant VL domains may in some embodiments be screened for dual binding antibodies, fragments thereof, or components thereof.

[0305] In some embodiments, the library of immunoglobulins or fragments thereof comprises a library of variable heavy chain domains. In some embodiments, the library of immunoglobulins or fragments thereof comprises a library of variable light chain domains. In some embodiments, the library of immunoglobulins or fragments thereof comprises a library of variable heavy chain domains and variable light chain domains.

[0306] In some embodiments, a method of generating a library of dual antigen-binding immunoglobulin variable heavy chain regions to screen for binding to an epitope comprises: (a) selecting a VH template antigen binding molecule set forth in SEQ ID NO:1, wherein the selected template does not specifically bind to the epitope; (b) selecting at least one residue position for mutation from 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111 in the template SEQ ID NO:1, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof); and (c) selecting at least one variant residue for substitution at the at least one residue position selected in (b), such that a library containing a plurality of variants of the template VH is generated. In some embodiments, a method for generating a library of dual antigen-binding immunoglobulin variable light chain regions to screen for binding to an epitope comprises: (a) selecting a VL template antigen binding molecule set forth in SEQ ID NO:2, wherein the selected template does not specifically bind to the epitope; (b) selecting at least one residue position for mutation from 26, 27, 31, 51, 56, 77, 92, 93, or 96 in the template SEQ ID NO:2, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof); and (c) selecting at least one variant residue for substitution at the at least one residue position selected in (b), such that a library containing a plurality of variants of the template VL is generated.

[0307] In some embodiments, a method for generating a library of dual antigen-binding immunoglobulins comprising a variable heavy chain region and a variable light chain region for screening for binding to an epitope comprises: (a) selecting a VH template antigen-binding molecule set forth in SEQ ID NO: 1, wherein the selected template does not specifically bind to the epitope; (b) selecting a VL template antigen-binding molecule set forth in SEQ ID NO: 2, wherein the selected template does not specifically bind to the epitope; (c) selecting for mutation at least one residue from positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111 in the template SEQ ID NO: 1, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof). (d) selecting for mutation at least one residue from positions 26, 27, 31, 51, 56, 77, 92, 93, or 96 in the template SEQ ID NO:2, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof); and (e) selecting at least one variant residue for substitution at the at least one residue position selected in (c) or selecting at least one variant residue for substitution at the at least one residue position selected in (d) such that the total number of variant residues in each possible dual binding immunoglobulin is at least two, and such that a library is generated containing a plurality of variants of the template VH and variants of the template VL.

[0308] In some embodiments, the method of constructing the library can be found in the Examples. In some embodiments, the generated libraries described herein can be used to identify immunoglobulins that bind to dual targets. In some embodiments, the generated libraries described herein can be used to identify immunoglobulins that bind to specific epitopes.

[0309] In some embodiments, the use of a protein library comprising immunoglobulins comprising variant VH, variant VL, or variant VH and variant VL as described in detail herein provides a method for identifying immunoglobulins that bind to dual targets. In some embodiments, the use of a protein library comprising immunoglobulins comprising variant VH, variant VL, or variant VH and variant VL as described in detail herein provides a method for identifying immunoglobulins that bind to specific epitopes.

[0310] In some embodiments, the protein library comprising immunoglobulins comprising variant VH and variant VL comprises a library of antibody molecules. In some embodiments, the protein library comprising immunoglobulins comprising variant VH and variant VL comprises a library of IgG molecules. In some embodiments, the protein library comprising immunoglobulins comprising variant VH and variant VL comprises a library of IgG1, IgG2, IgG3, or IgG4 molecules. In some embodiments, the IgG molecules are mutant IgG molecules that cannot bind to antibody-dependent cellular cytotoxicity components.

[0311] In some embodiments, the protein library comprising immunoglobulins comprising variant VH and variant VL comprises a library of Fab or F(ab')2 molecules. In some embodiments, the protein library comprising immunoglobulins comprising variant VH and variant VL comprises a library of Fv molecules, scFv molecules, minibody molecules, diabody molecules, or triabody molecules.

[0312] In some embodiments, existing immunoglobulin VH and VL templates can be modified to introduce variant amino acids at specific positions to generate dual antigen-binding sites in the variant VH and VL domains, and a protein library of variant VH and VL domains comprises at least 10, 100, 1,000, 10,000, 100,000, or 1,000,000 variant VH, variant VL, or variant VH and variant VL, having at least two variant positions. In some embodiments, a protein library of variant VH and variant VL domains comprises between 1,000 and 1,000,000 variant VH domains, variant VL domains, or variant VH and variant VL domains, having at least two variant positions. In some embodiments, the protein library of variant VH and variant VL domains comprises between 10,000 and 1,000,000 variant VH domains, variant VL domains, or variant VH domains and variant VL domains having at least two variant positions.

[0313] In some embodiments, the protein library of variant VH and variant VL domains comprises between 1,000 and 1,000,000 variant VH domains, variant VL domains, or variant VH domains and variant VL domains having at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions. In some embodiments, the protein library of variant VH and variant VL domains comprises between 10,000 and 1,000,000 variant VH domains, variant VL domains, or variant VH domains and variant VL domains having at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions.

[0314] In some embodiments, the protein library of variant VH domains and variant VL domains has at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions, 10 6 ~10 14 In some embodiments, the protein library of variant VH domains and variant VL domains comprises at least 10 variant VH domains, variant VL domains, or variant VH domains and variant VL domains. In some embodiments, the protein library of variant VH domains and variant VL domains comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions. 6 ~10 14 The variant VH domain, the variant VL domain, or the variant VH domain and the variant VL domain.

[0315] The library is then screened for binding to one or more antigens. After molecular characterization for desired properties, the selected antibody domains or regions, such as but not limited to, the VH or VL domain, or both, are cloned into an immunoglobulin molecule by genetic engineering techniques, resulting in replacement of the corresponding regions. Alternatively, only the DNA encoding the VH or VL, or both regions, or the DNA encoding the variant amino acids, may be exchanged to obtain an immunoglobulin with additional binding sites for the molecule. In some embodiments, the choice of immunoglobulin molecule into which the variant region is cloned may be selected from IgG, Fv, scFv, Fab, F(ab')2, minibody, diabody, or triabody. In some embodiments, the IgG is IgG1, IgG2, IgG3, or IgG4. In some embodiments, the IgG comprises a variant IgG that cannot bind to an antibody-dependent cellular cytotoxicity component.

[0316] In some embodiments, the expressed CDRs are as described above for HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3, with certain positions comprising variant amino acids, as detailed above, and shown in Figures 1A and 1B.

[0317] Sites for mutation are described above and in certain embodiments include positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof, in the template SEQ ID NO: 1 (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or combinations thereof), and positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof, in the template SEQ ID NO: 2 (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof). In some embodiments, additional sites within the VH template or the VL template may be mutated.

[0318] In certain embodiments, the method of generating a library further comprises synthesizing template variants (VH, VL, or both VH and VL) from the nucleic acid construct, as described in detail above, to generate the library.

[0319] The result of generating the above library is (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:1 with at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof); or (c) a library of immunoglobulins comprising a heavy chain variable region as set forth in (a) and a light chain variable region as set forth in (b), each of which has at least one amino acid variant at any of IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or any combination thereof, wherein the total number of variant positions in the heavy chain variable region, light chain variable region, or combination thereof is at least two.

[0320] Mammalian cell expression systems have been described above. These expression systems offer a number of potential advantages for therapeutic antibody production, including the ability to simultaneously select for key manufacturing-related properties such as high levels of expression and stability while presenting functional glycosylated IgG on the cell surface, to generate libraries of potential bibinding immunoglobulins.

[0321] In some embodiments, the library of immunoglobulins comprises IgG molecules, Fab molecules, F(ab')2 molecules, FV molecules, VH molecules, VL molecules, scFv molecules, diabodies, minibodies, or triabodies. In some embodiments, the IgG molecules comprise IgG1, IgG2, IgG3, or IgG4. In some embodiments, the IgG comprises a mutant IgG that is unable to bind to an antibody-dependent cellular cytotoxicity component. In some embodiments, the IgG1 comprises a mutant IgG1 that is unable to bind to an antibody-dependent cellular cytotoxicity component.

[0322] In some embodiments, disclosed herein are methods adapted to screen libraries comprising antigen molecules or portions thereof to select for dual binding molecules having desirable properties (e.g., binding affinity, stability, etc.). In some embodiments, the portion of the antigen comprises at least one IL-13 antigenic epitope. In some embodiments, disclosed herein are dual binding molecules isolated from the library after such screening.

[0323] In some embodiments, methods of screening libraries of immunoglobulins as described for dual binding molecules are disclosed herein, comprising: (a) screening a library comprising antigen molecules or fragments thereof to identify dual binding molecules that bind to an epitope of interest; (b) screening the binding agents identified in step (a) to determine which residues are variant and which variant residues are enriched in the binding immunoglobulin; (c) using the information from step (b) to synthesize an optimized library of variants of the dual binding agent; and (d) repeating steps (a)-(c) using the optimized library. In some embodiments, methods of screening libraries of immunoglobulins as described for dual binding molecules are disclosed herein, comprising: (a) screening a library containing an epitope of interest to identify dual binding molecules that bind to the epitope of interest; (b) screening the binding agents identified in step (a) to determine which residues are variant and which variant residues are enriched in the binding immunoglobulin; (c) using the information from step (b) to synthesize an optimized library of variants of the dual binding agent; and (d) repeating steps (a)-(c) using the optimized library.

[0324] According to some embodiments, the specific binding of the variant immunoglobulin to an antigen molecule is determined by a binding assay selected from the group consisting of immunological assays, including, but not limited to, enzyme-linked immunosorbent assay (ELISA), surface plasmon resonance assay, saturation transfer difference nuclear magnetic resonance spectroscopy, transferred NOE (trNOE) nuclear magnetic resonance spectroscopy, competition assay, tissue binding assay, live cell binding assay, and cell extract assay.

[0325] Binding assays can be performed using a variety of methods known in the art, including, but not limited to, FRET (fluorescence resonance energy transfer) and BRET (bioluminescence resonance energy transfer) based assays AlphaScreen™ (amplified luminescence proximity homogeneous assay), scintillation proximity assays, ELISA (enzyme-linked immunosorbent assay), SPR (surface plasmon resonance, also known as BIACORE®), isothermal titration calorimetry, differential scanning calorimetry, gel electrophoresis, and chromatography, including gel filtration. These and other methods may utilize some fusion partner or label.

[0326] The variant immunoglobulins, in some embodiments, are conjugated to a label selected from the group consisting of organic molecules, enzyme labels, radioactive labels, colored labels, fluorescent labels, chromogenic labels, luminescent labels, haptens, digoxigenin, biotin, metal complexes, metals, colloidal gold, and mixtures thereof. Conjugation to a label may, in certain embodiments, allow for simple detection of the conjugate in, for example, binding assays (e.g., ELISA) and binding studies.

[0327] Composition used In some embodiments, pharmaceutical compositions are described herein that include the biconjugate antibodies described herein that provide therapeutic agents. In some embodiments, pharmaceutical compositions are described herein that include biconjugate antibodies that include therapeutic agents that include mutant IgGs that cannot bind to antibody-dependent cellular cytotoxicity components. In some embodiments, pharmaceutical compositions are described herein that include biconjugate antibodies that have therapeutic properties for allergic or respiratory conditions.

[0328] In some embodiments, the pharmaceutical composition comprises a variant VH, a variant VL, or a dual binding antibody comprising a variant VH and a variant VL, and a pharma- ceutically acceptable carrier. The amino acid sequences of variant VH and variant VL domains, and pairs thereof, are described in detail above (see, for example, but not limited to, Table 1).

[0329] In certain embodiments, a composition comprises any of the isolated bibinding antibodies disclosed herein and a pharma- ceutically acceptable carrier.

[0330] In one embodiment, the pharmaceutical composition comprises a dual-binding antibody having HCDR1, HCDR2 and HCDR3 comprising the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprising the amino acid sequences of SEQ ID NOs: 359, 360 and 361, respectively.

[0331] In another embodiment, the pharmaceutical composition comprises a dual-binding antibody having HCDR1, HCDR2 and HCDR3 comprising the amino acid sequences of SEQ ID NOs: 349, 356 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprising the amino acid sequences of SEQ ID NOs: 364, 360 and 371, respectively.

[0332] In another embodiment, the pharmaceutical composition comprises a dual-binding antibody having HCDR1, HCDR2 and HCDR3 comprising the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprising the amino acid sequences of SEQ ID NOs: 362, 360 and 384, respectively.

[0333] In another embodiment, the pharmaceutical composition comprises a dual-binding antibody having HCDR1, HCDR2 and HCDR3 comprising the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprising the amino acid sequences of SEQ ID NOs: 364, 360 and 384, respectively.

[0334] In another embodiment, the pharmaceutical composition comprises a dual-binding antibody having HCDR1, HCDR2 and HCDR3 comprising the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2 and LCDR3 comprising the amino acid sequences shown in Table 9 or Table 5.

[0335] In another embodiment, the pharmaceutical composition comprises a dual binding antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 209 and 210.

[0336] In another embodiment, the pharmaceutical composition comprises a dual binding antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 219 and 220.

[0337] In another embodiment, the pharmaceutical composition comprises a dual binding antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 249 and 250.

[0338] In another embodiment, the pharmaceutical composition comprises a dual binding antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences of SEQ ID NOs: 337 and 338.

[0339] In another embodiment, the pharmaceutical composition comprises a dual binding antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL comprise the amino acid sequences shown in Table 10 or Table 1.

[0340] In another embodiment, the pharmaceutical composition comprises a dual binding antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH and VL are at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH and VL sequences disclosed herein.

[0341] In some embodiments, a pharmaceutical composition comprising a dual binding antibody comprises any of the dual antibodies described herein comprising a variant VH, a variant VL, or a variant VH and a variant VL. In some embodiments, a pharmaceutical composition comprising a dual binding antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:1 with at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof), 26, 27, 31, 51, 56, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, or a combination of a heavy chain variable region as set forth in (a) and a light chain variable region as set forth in (b), wherein the total number of variant positions in the heavy chain variable region, light chain variable region, or combination thereof is at least two.

[0342] Those of skill in the art will recognize that in some embodiments, the term "bibinding antibody" may be used interchangeably with the term "drug" or "pharmaceutical agent," all of the same meaning and qualities. In some embodiments, drugs that include bibinding antibodies include pharmaceutical compositions.

[0343] In some embodiments, compositions comprising the bibinding antibodies described herein, as well as the administration of such compositions in various therapeutic settings, are described herein.

[0344] Administration of the bibinding antibodies described herein in pure form or in a suitable pharmaceutical composition can be via any of the accepted modes of administration of drugs to perform similar utilities. Pharmaceutical compositions can be prepared by combining the bibinding antibodies or bibinding antibody-containing compositions with suitable physiologically acceptable carriers, diluents, or excipients, and can be formulated into solid, semi-solid, liquid, or gaseous preparations, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres, and aerosols. In addition, other pharmacoactive ingredients such as salts, buffers, and stabilizers and / or suitable excipients may, but need not, be present in the composition. Administration can be achieved by a variety of different routes, including oral, parenteral, nasal, intravenous, intradermal, subcutaneous, or topical. In some embodiments, the mode of administration depends on the nature of the condition to be treated or prevented. An amount that reduces, inhibits, prevents, or delays the progression and / or metastasis of cancer after administration is considered effective. Those of skill in the art will understand that the term "physiologically acceptable carrier, diluent or excipient" may, in some embodiments, be used interchangeably with the term "pharmaceutical acceptable carrier," all of the same meaning and qualities.

[0345] In some embodiments, the pharmaceutical compositions described herein comprise a nucleotide sequence encoding a dual binding antibody. In some embodiments, the nucleotide sequence encoding a dual binding antibody disclosed herein comprises a single linear nucleotide sequence. In some embodiments, the nucleotide sequence encoding a dual binding antibody disclosed herein comprises two linear nucleotide sequences. In some embodiments, the nucleotide sequence encoding a dual binding antibody disclosed herein comprises two nucleotide sequences present on the same vector. In some embodiments, the nucleotide sequence encoding a dual binding antibody disclosed herein comprises two nucleotide sequences present on different vectors.

[0346] In some embodiments, the nucleotide sequence comprises a variant VH domain or a variant VL domain, or a combination thereof. In some embodiments, the same nucleotide sequence comprises a variant VH domain or a variant VL domain, or a combination thereof. In some embodiments, different nucleotide sequences encode a variant VH domain or a variant VL domain, or a combination thereof. In some embodiments, one nucleotide sequence encodes a variant VH domain and another nucleotide sequence encodes a variant VL domain. In some embodiments, one nucleotide sequence encodes a variant VH domain and another nucleotide sequence encodes a variant VL domain with a linker sequence between them, which allows the variant VH domain and the variant VL domain to be heterodimerized, as described in Duperret EK et al., Cancer Res, Oct. 4 (doi:10.1158 / 0008-5472.CAN-18-1429).

[0347] In some embodiments, the method of treating an allergic condition or a respiratory condition, or a combination thereof, in a subject includes the step of: (a) a variant VH domain comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof); and (b) a variant VH domain comprising the amino acid sequence set forth in SEQ ID NO: 1, 2, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof), wherein the method treats an allergic condition or a respiratory condition, or a combination thereof, compared to a subject not administered the pharmaceutical composition.

[0348] In some embodiments, a method of treating an allergic or respiratory condition, or a combination thereof in a subject comprises administering to a subject in need thereof a pharmaceutical composition comprising a bibinding antibody comprising a variant VH domain comprising an amino acid sequence set forth in SEQ ID NO:1 having at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), wherein the method treats the allergic or respiratory condition, or a combination thereof, compared to a subject not administered the pharmaceutical composition.

[0349] In some embodiments, a method of treating an allergic or respiratory condition, or a combination thereof, in a subject comprises administering to a subject in need thereof a pharmaceutical composition comprising a bibinding antibody comprising a variant VL domain comprising the amino acid sequence set forth in SEQ ID NO:2 having at least one amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof), wherein the method treats the allergic or respiratory condition, or a combination thereof, compared to a subject not administered the pharmaceutical composition.

[0350] How to use In some embodiments, a method of treating a subject suffering from a disease or condition is disclosed herein, the method comprising administering to the subject a composition comprising an isolated biconjugate antibody disclosed herein. In some embodiments, the disease or condition is an allergic or respiratory condition, an inflammatory or autoimmune condition, or a tumor or cancer. In some embodiments, the disease or condition is asthma, allergic asthma, non-allergic asthma, severe asthma, mild asthma, chronic obstructive pulmonary disease (COPD), conditions involving airway inflammation, cystic fibrosis, allergic lung disease, airway hyperresponsiveness, goblet cell metaplasia, mucus hypersecretion, airway remodeling, pulmonary fibrosis, atopic dermatitis, urticaria, eczema, allergic enterogastritis, allergic rhinitis, inflammatory bowel disease, liver cirrhosis or fibrosis, or a combination thereof.

[0351] In some embodiments, a method of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, or any combination thereof in a subject comprises administering a pharmaceutical composition comprising a biconjugate antibody or a pharmaceutical composition thereof, wherein the biconjugate antibody comprises a heavy chain variable region comprising an HCDR (HCDR1, HCDR2, HCDR3 as described in detail herein, see e.g., Table 8 or Table 4). In some embodiments, a method of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, or any combination thereof in a subject comprises administering a pharmaceutical composition comprising a biconjugate antibody or a pharmaceutical composition thereof, wherein the biconjugate antibody comprises a light chain variable region comprising an LCDR (LCDR1, LCDR2, LCDR3 as described in detail herein, see e.g., Table 9 or Table 5). In some embodiments, a method for treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, or any combination thereof in a subject comprises administering a pharmaceutical composition comprising a biconjugate antibody or a pharmaceutical composition thereof, the biconjugate antibody comprising a heavy chain variable region comprising an HCDR (HCDR1, HCDR2, HCDR3) and an LCDR (LCDR1, LCDR2, LCDR3 as described in detail herein).

[0352] In certain embodiments, a method of treating a subject suffering from a disease or condition comprises administering a dual binding antibody comprising three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3); HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 359, 360 and 361, respectively; or HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 356 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 364, 360 and 371, respectively; or HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 365, 366 and 372, respectively. and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 362, 360 and 384, respectively, or HCDR1, HCDR2 and HCDR3 comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, respectively, and LCDR1, LCDR2 and LCDR3 comprise the amino acid sequences of SEQ ID NOs: 364, 360 and 384, respectively, or the CDRs have the sequences of SEQ ID NOs: 149-154.

[0353] In some embodiments, a method for treating a subject suffering from a disease or condition comprises administering a dual-binding antibody comprising three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3), wherein HCDR1, HCDR2, and HCDR3 comprise the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 comprise the amino acid sequences shown in Table 9 or Table 5.

[0354] In some embodiments, a method of treating a subject suffering from a disease or condition comprises administering a dual binding antibody comprising a VH and a VL having the sequences of SEQ ID NOs: 209 and 210, SEQ ID NOs: 219 and 220, SEQ ID NOs: 249 and 250, SEQ ID NOs: 337 and 338, SEQ ID NOs: 155 and 156, SEQ ID NOs: 157 and 158. In some embodiments, a method of treating a subject suffering from a disease or condition comprises administering a dual binding antibody comprising a VH domain and a VL domain having the sequences set out in Table 10 or Table 1.

[0355] In some embodiments, a method for treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, or any combination thereof in a subject, includes a pharmaceutical composition comprising a bibinding antibody or a pharmaceutical composition thereof, the bibinding antibody comprising: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:1 having at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof); or a combination of a heavy chain variable region as set forth in (a) and a light chain variable region as set forth in (b), having at least one amino acid variant at any of positions 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least two, to a subject in need thereof, wherein the method treats an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, in the subject compared to a subject not administered the bibinding antibody, or pharmaceutical composition thereof.

[0356] In some embodiments, the method of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, or any combination thereof in a subject comprises a pharmaceutical composition comprising a bibinding antibody or a pharmaceutical composition thereof, the bibinding antibody being at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112B, 112C, 112D, 112E, 112F, 112G, 112H, 112I, 112J, 112K, 112J ... , 113, 114, or 117, or a combination thereof, wherein the total number of variant positions in the heavy chain variable region is at least two, wherein the method treats an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, in the subject compared to a subject not administered the bibinding antibody, or pharmaceutical composition thereof.

[0357] In some embodiments, a method of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, a tumor or cancer, including scleroderma, or Hodgkin's lymphoma, or any combination thereof in a subject comprises administering to a subject in need thereof a pharmaceutical composition comprising a biconjugate antibody or pharmaceutical composition thereof, the biconjugate antibody comprising a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO:2 having at least one amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof), wherein the total number of variant positions in the light chain variable region is at least two, wherein the method treats an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, in the subject compared to a subject not administered the biconjugate antibody or pharmaceutical composition thereof.

[0358] In some embodiments, the method of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, or any combination thereof in a subject includes a pharmaceutical composition comprising a bibinding antibody or a pharmaceutical composition thereof, the bibinding antibody comprising (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or any combination thereof); and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:2 having at least one amino acid variant at any of positions 7, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination is at least two, to a subject in need thereof, wherein the method treats an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, in the subject compared to a subject not administered the bibinding antibody, or pharmaceutical composition thereof.

[0359] In some embodiments of the methods of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, the amino acid sequence of the variant VH domain is selected from, but not limited to, any of the sequences set forth in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In some embodiments of the methods of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, the bibinding antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in, but not limited to, SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, as well as any variable light chain region. In some embodiments of the methods disclosed herein, the amino acid sequence of the variant VH domain comprises a sequence that is at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to a sequence set forth in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54.

[0360] In some embodiments of the methods disclosed herein, the VH domain of the dual binding antibody is selected from the group consisting of SEQ ID NOs: 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 335, 337, 3, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345 and 347. In another embodiment, the VH domain is at least 80%, 85%, 90%, 95%, 98% or 99% identical to a VH sequence disclosed herein.

[0361] One of skill in the art will appreciate that percent sequence identity can be determined using any of a number of publicly available software applications, such as, but not limited to, the BlastP software from the National Center for Biotechnology Information (NCBI) using default parameters.

[0362] In some embodiments of the methods of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, the amino acid sequence of the variant light chain variable region (VL) is selected from, but not limited to, any of the sequences set forth in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments of the methods of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, the bibinding antibody comprises a light chain variable region comprising the amino acid sequence set forth in, but not limited to, SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, as well as any of the variable heavy chain regions. In some embodiments of the methods disclosed herein, the amino acid sequence of the variant VH domain comprises a sequence that is at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to a sequence set forth in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, and any variable heavy chain regions.

[0363] In some embodiments of the methods disclosed herein, the VL domain of the dual binding antibody is selected from the group consisting of SEQ ID NOs: 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 4, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346 and 348. In another embodiment, the VL domain is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to a VL sequence disclosed herein.

[0364] In some embodiments of the methods of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, the amino acid sequence of the variant VH domain is selected from, but is not limited to, a sequence set forth in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, and the amino acid sequence of the variant light chain variable region (VH) is selected from, but is not limited to, a sequence set forth in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments of the methods of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal tract, scleroderma, or a tumor or cancer, including Hodgkin's lymphoma, the amino acid sequence of the heavy chain variable region-light chain variable region pair is selected from the pair sequences set forth in, but not limited to, SEQ ID NOs: 4 and 3, SEQ ID NOs: 6 and 5, SEQ ID NOs: 8 and 7, SEQ ID NOs: 10 and 9, SEQ ID NOs: 12 and 11, SEQ ID NOs: 14 and 13, SEQ ID NOs: 16 and 15, SEQ ID NOs: 18 and 17, SEQ ID NOs: 20 and 19, SEQ ID NOs: 22 and 21, SEQ ID NOs: 24 and 23, SEQ ID NOs: 26 and 25, SEQ ID NOs: 28 and 27, SEQ ID NOs: 30 and 29, SEQ ID NOs: 32 and 31, SEQ ID NOs: 34 and 33, SEQ ID NOs: 36 and 35, SEQ ID NOs: 38 and 37, SEQ ID NOs: 40 and 39, SEQ ID NOs: 42 and 41, SEQ ID NOs: 44 and 43, SEQ ID NOs: 46 and 45, SEQ ID NOs: 48 and 47, SEQ ID NOs: 50 and 49, SEQ ID NOs: 52 and 51, and SEQ ID NOs: 54 and 53. In some embodiments, the amino acid sequence of the VH-VL pair is selected from the paired sequences set forth in any of the following: SEQ ID NOs: 209 and 210, SEQ ID NOs: 211 and 212, SEQ ID NOs: 213 and 214, SEQ ID NOs: 215 and 216, SEQ ID NOs: 217 and 218, SEQ ID NOs: 219 and 220, SEQ ID NOs: 221 and 222, SEQ ID NOs: 223 and 224, SEQ ID NOs: 225 and 226, SEQ ID NOs: 227 and 228, SEQ ID NOs: 229 and 230,SEQ ID NOs: 231 and 232, SEQ ID NOs: 233 and 234, SEQ ID NOs: 235 and 236, SEQ ID NOs: 237 and 238, SEQ ID NOs: 239 and 240, SEQ ID NOs: 241 and 242, SEQ ID NOs: 243 and 244, SEQ ID NOs: 245 and 246, SEQ ID NOs: 247 and 248, SEQ ID NOs: 249 and 250, SEQ ID NOs: 251 and 252, SEQ ID NOs: 253 and 254, SEQ ID NOs: 255 and 256, SEQ ID NOs: 257 and 258, SEQ ID NOs: 259 and 260, SEQ ID NOs: 261 and 262, SEQ ID NOs: 263 and 264, SEQ ID NOs: 265 and 266, SEQ ID NOs: 267 and 268, SEQ ID NOs: 269 and 270, SEQ ID NOs: 271 and 272, SEQ ID NOs: 273 and 274, SEQ ID NOs: 275 and 276, SEQ ID NOs: 277 and 278, SEQ ID NOs: 279 and 280, SEQ ID NOs: 281 and 282, SEQ ID NOs: 283 and 284, SEQ ID NOs: 285 and 286, SEQ ID NOs: 287 and 288, SEQ ID NO: 289 and 290, SEQ ID NOs:291 and 292, SEQ ID NOs:293 and 294, SEQ ID NOs:295 and 296, SEQ ID NOs:297 and 298, SEQ ID NOs:299 and 300, SEQ ID NOs:301 and 302, SEQ ID NOs:303 and 3...

Claims

1. 1. An isolated bispecific antibody comprising three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3), (i) the HCDR1 comprises an amino acid sequence set forth in any one of SEQ ID NOs: 349, 355, 149, or 136; (ii) the HCDR2 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 350, 352, 354, 356, or 150, or the sequence set forth as I HX1 Y D G S N K (SEQ ID NO: 142), wherein HX1 is any amino acid; (iii) the HCDR3 comprises an amino acid sequence set forth in any one of SEQ ID NOs: 351, 353, 357, 358, or 151, or a sequence set forth as A R HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 F D HX12 (SEQ ID NO: 143), wherein HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acid; (iv) the LCDR1 comprises an amino acid sequence set forth in any one of SEQ ID NOs: 364, 359, 362, 366, 369, 375, or 152, or a sequence set forth as LX1, LX2, GSKLX3V (SEQ ID NO: 144), wherein LX1, LX2, and LX3 are any amino acid; (v) the LCDR2 is selected from the group consisting of SEQ ID NOs: 360, 367, or 153. or the sequence set forth in D D LX4 (SEQ ID NO: 145), wherein LX4 is any amino acid; (vi) An isolated bibinding antibody, wherein the LCDR3 comprises an amino acid sequence set forth in any one of SEQ ID NOs: 384, 361, 363, 365, 368, 370-374, 376-383, 385-407, or 154, or the sequence set forth in QVWDLX5LX6SDLX7VV (SEQ ID NO: 146), wherein LX5, LX6, and LX7 are any amino acid.

2. The antibody, wherein the amino acid sequences of the HCDR and the LCDR are selected from the following set: (a) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 364, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 384; (b) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 354, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 364, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 365; (c) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 359, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 361; (d) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 364, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 371; (e) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 362, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 384; (f) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 353, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 362, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 363; (g) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 366, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 368; (h) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 370; (i) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 353, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 362, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 372; (j) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 359, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 373; (k) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 364, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 374; (l) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 357, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 376; (m) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 362, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 377; (n) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 378; (o) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 379; (p) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 359, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 380; (q) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 379; (r) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 381; (s) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 357, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 370; (t) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 366, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 382; (u) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 370; (v) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 383; (w) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 366, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 385; (x) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 386; (y) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 387; (z) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:388; (aa) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:389; (bb) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:379; (cc) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:390; (dd) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:366, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:391; (ee) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 392; (ff) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:354, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:393; (gg) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:394; (hh) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:395; (ii) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 396; (jj) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:397; (kk) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 398; (ll) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 388; (mm) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:394; (nn) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:398; (oo) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 352, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 357, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 399; (pp) HCDR1 is set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:400; (qq) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 357, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 398; (rr) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:378; (ss) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:401; (tt) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:358, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:402; (uu) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 358, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 403; (vv) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:356, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:358, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:376; (ww) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 402; (xx) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 349, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 353, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 359, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 360, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 404; (yy) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:357, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:405; (zz) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:366, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:406; (aaa) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO:355, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO:350, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO:351, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO:375, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO:367, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:407, and (bbb) The isolated bibinding antibody of claim 1, wherein the antibody is selected from any one of the following: HCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 355; HCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 354; HCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 351; LCDR1 comprises the amino acid sequence set forth in SEQ ID NO: 369; LCDR2 comprises the amino acid sequence set forth in SEQ ID NO: 367; and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO:

379.

3. the VH and the VL are SEQ ID NOs:337 and 338, respectively, SEQ ID NOs:213 and 214, respectively, SEQ ID NOs:209 and 210, respectively, SEQ ID NOs:219 and 220, respectively, SEQ ID NOs:249 and 250, respectively, SEQ ID NOs:155 and 156, respectively, SEQ ID NOs:157 and 158, respectively, SEQ ID NOs:4 and 3, respectively, SEQ ID NOs:6 and 5, respectively, SEQ ID NOs:8 and 7, respectively, SEQ ID NOs:10 and 9, respectively, SEQ ID NOs:12 and 11, respectively, SEQ ID NOs:14 and 13, respectively, SEQ ID NOs:16 and 15, respectively, SEQ ID NOs:18 and 17, respectively, SEQ ID NOs:20 and 19, respectively, SEQ ID NOs:22 and 21, respectively, 3. The isolated bibinding antibody of claim 1 or 2, comprising the amino acid sequence set forth in SEQ ID NOs:24 and 23, respectively, SEQ ID NOs:26 and 25, respectively, SEQ ID NOs:28 and 27, respectively, SEQ ID NOs:30 and 29, respectively, SEQ ID NOs:32 and 31, respectively, SEQ ID NOs:34 and 33, respectively, SEQ ID NOs:36 and 35, respectively, SEQ ID NOs:38 and 37, respectively, SEQ ID NOs:40 and 39, respectively, SEQ ID NOs:42 and 41, respectively, SEQ ID NOs:44 and 43, respectively, SEQ ID NOs:46 and 45, respectively, SEQ ID NOs:48 and 47, respectively, SEQ ID NOs:50 and 49, respectively, SEQ ID NOs:52 and 51, respectively, or SEQ ID NOs:54 and 53, respectively.

4. The antibody is an IgG, Fv, scFv, Fab, F(ab') ２ 4. The isolated bibinding antibody of claim 1, comprising a dimeric antibody, a minibody, a diabody, or a triabody.

5. 5. The isolated bibinding antibody of claim 4, wherein the IgG is IgG1, IgG2, IgG3, or IgG4.

6. 6. The isolated bibinding antibody of claim 4 or 5, wherein the IgG comprises a heavy chain (HC) that comprises a mutation that reduces binding to an Fc receptor, and the bibinding antibody comprising the mutation is unable to bind to an antibody-dependent cellular cytotoxicity component.

7. 7. The isolated bibinding antibody of claim 6, wherein the mutation is a L234A L235A P329G (LALAPG) mutation or a L234A L235A (LALA) mutation.

8. The isolated bibinding antibody of any of claims 6 to 7, wherein the VH and VL comprise the amino acid sequences set forth in SEQ ID NOs: 337 and 338, respectively, and the antibody comprises the L234A L235AP329G (LALAPG) mutation.

9. The isolated dual binding antibody of any of claims 6 to 7, wherein the VH and VL comprise the amino acid sequences set forth in SEQ ID NOs: 337 and 338, respectively, and the antibody comprises the L234A L235A (LALA) mutation.

10. A composition comprising the isolated bibinding antibody of any one of claims 1 to 9 and a pharma- ceutically acceptable carrier.

11. An isolated polynucleotide construct encoding the isolated dual binding antibody of any one of claims 1 to 9.

12. An expression vector comprising the polynucleotide construct of claim 11.

13. A host cell comprising the expression vector of claim 12.

14. A composition comprising an isolated bibinding antibody according to any one of claims 1 to 9 for the preparation of a medicament for treating a disease or condition.

15. 15. The composition of claim 14, wherein the disease or condition is an allergic or respiratory condition, an inflammatory or autoimmune condition, or a tumor or cancer.

16. 15. The composition of claim 14, wherein the disease or condition is asthma, allergic asthma, non-allergic asthma, severe asthma, mild asthma, chronic obstructive pulmonary disease (COPD), conditions involving airway inflammation, cystic fibrosis, allergic lung disease, airway hyperresponsiveness, goblet cell metaplasia, mucus hypersecretion, airway remodeling, pulmonary fibrosis, atopic dermatitis, urticaria, eczema, allergic enterogastritis, allergic rhinitis, inflammatory bowel disease, liver cirrhosis or fibrosis, or a combination thereof.

Images