Products and methods for analyzing omics information of a sample - Patents.com

Abstract

The present application relates to products and methods for analyzing omics information of a sample, the method comprising: contacting at least one target molecule in a sample with at least one probe, the probe containing a target molecule binding domain capable of specifically binding to the target molecule and at least one reaction-blocking modification, under conditions that allow the probe to bind to the target molecule; performing a first treatment on a first region of the sample and performing a second treatment on a second region of the sample that is different from the first region to attach the probe in the first region to a first tag sequence and the probe in the second region to a second tag sequence, the second tag sequence being different from the first tag sequence; and determining a composition of the probe attached to the first tag sequence and a composition of the probe attached to the second tag sequence.

Description

[Technical field]

[0001] The present application relates to the biomedical field, and in particular to products and methods for analyzing omics information of a sample. [Background technology]

[0002] As the sequencing of the human and other species genomes is gradually completed, research in modern biology has entered the post-genomic era. In recent years, high-throughput technologies for the study of various biological macromolecules, including genomic, transcriptomic, proteomic, and other technologies, have been constantly developed. In addition, various omics approaches for small or single-cell samples have been flourishing and applied. As the demand for large-scale data processing and analysis increases, bioinformatics is also developing rapidly.

[0003] Traditional methods such as in situ hybridization and other multiplex detection of different transcripts have revealed the spatial distribution of gene expression and helped to elucidate the molecular basis of development and disease. However, these methods cannot simultaneously measure the expression of multiple genes or the presence and / or activity of multiple proteins at various spatial locations in a sample.

[0004] Therefore, in order to analyze omics information of multiple regions in a sample, a method capable of simultaneously detecting multiple regions in a sample with high efficiency is required. Summary of the Invention

[0005] The present application provides a method for analyzing omics information of a sample, which has one or more of the following properties: 1) it is possible to perform transcriptomic and proteomic detection with high efficiency; 2) it is possible to perform multiple detections on omics information simultaneously.

[0006] The present application provides a method for detecting a target molecule comprising the steps of: contacting at least one target molecule in a sample with at least one probe under conditions that allow the probe to specifically bind to the target molecule, the probe containing a target molecule binding domain capable of specifically binding to the target molecule and at least one reaction-blocking modification; performing a first treatment on a first region of the sample, the first treatment capable of at least partially removing the reaction-blocking modifications on the probes in the first region and attaching the probes in the first region to a first tag sequence; performing a second treatment on a second region in the sample that is distinct from the first region, the second treatment being capable of at least partially removing the reaction-blocking modification on the probe in the second region and attaching the probe in the second region to a second tag sequence, the second tag sequence being distinct from the first tag sequence; determining a composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence, and determining from the composition of the probes the presence and / or content of the target molecule in the first region and the presence and / or content of the target molecule in the second region in the sample; The present invention provides a method comprising:

[0007] In some embodiments, the sample comprises a tissue section.

[0008] In some embodiments, the tissue section has a thickness in the range of 1-1000 μm.

[0009] In some embodiments, the tissue section in the method is selected from the group consisting of a frozen section, a paraffin section, a carbowax section, an ultrathin section, and a plastic section.

[0010] In some embodiments, the tissue section comprises a fixed tissue section.

[0011] In some embodiments, the tissue section comprises a formalin-fixed tissue section.

[0012] In some embodiments, the tissue sections are formalin-fixed paraffin sections.

[0013] In some embodiments, the tissue section is a frozen section.

[0014] In some embodiments, the tissue in the tissue section is derived from a multicellular organism.

[0015] In some embodiments, the tissue in the tissue section is from a human.

[0016] In some embodiments, the tissue section is a clinically relevant tissue sample.

[0017] In some embodiments, the tissue in the tissue section is from the group consisting of myocardial tissue, liver tissue, spleen tissue, lung tissue, kidney tissue and brain tissue.

[0018] In some embodiments, the first region is a first region on a tissue section, and the second region is a second region on the tissue section that does not substantially overlap with the first region.

[0019] In some embodiments, the sample is a single cell.

[0020] In some embodiments, the cells are selected from the group consisting of cells isolated from an organism, cells cultured in vitro, primary cells, and cells separated from an explant.

[0021] In some embodiments, the cells in this method are fixed.

[0022] In some embodiments, the first region is a first subcellular structure within a cell.

[0023] In some embodiments, the second region is a second subcellular structure within the cell.

[0024] In some embodiments, the target molecule comprises a protein, a nucleic acid molecule and / or a lipid.

[0025] In some embodiments, the nucleic acid molecule comprises a DNA molecule and / or an RNA molecule.

[0026] In some embodiments, the DNA comprises cDNA.

[0027] In some embodiments, the RNA comprises cRNA, mRNA, miRNA, lncRNA and / or eRNA.

[0028] In some embodiments, when the target molecule comprises RNA, the target molecule binding domain in the probe comprises a nucleic acid sequence complementary to the RNA.

[0029] In some embodiments, the target molecule binding domain in the probe comprises polyA.

[0030] In some embodiments, the target molecule binding domain in the probe comprises a polyT.

[0031] In some embodiments, the target molecule binding domain in the probe is at least 50% complementary to the sequence of the target molecule.

[0032] In some embodiments, the method comprises contacting two or more target molecules in a sample with two or more probes, wherein the two or more probes are capable of specifically binding the two or more target molecules.

[0033] In some embodiments, the two or more target molecules are different.

[0034] In some embodiments, in the method, the reaction-blocking modification on the probe in the first region is selected from the group consisting of a releasable, base-modified group, a cleavable linker, and a photolabile group.

[0035] In some embodiments, when the target molecule comprises RNA, the reaction-blocking modification on the probe in the first region in the method is a cleavable linker.

[0036] In some embodiments, the linker in this method is located at the 5' end of the probe in the first region.

[0037] In some embodiments, the linker in the probe in the first region is cleavable upon the first treatment.

[0038] In some embodiments, the first treatment in the method is selected from the group consisting of electron beam treatment, sonication, and illumination.

[0039] In some embodiments, the first treatment in the method is illumination.

[0040] In some embodiments, the light in the method is provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode.

[0041] In some embodiments, the light in the methods is provided by a UV light source.

[0042] In some embodiments, in the method, the reaction-blocking modification on the probe in the first region is a releasable, base-modified group.

[0043] In some embodiments, in the method, the reaction-blocking modification on the probe in the first region comprises at least one releasable, base-modified group.

[0044] In some embodiments, the reaction-blocking modification on the probe in the first region comprises at least one releasable photolabile group.

[0045] In some embodiments, the base-modified groups in the probe in the first region comprise NPOM protecting groups.

[0046] In some embodiments, the base-modified groups in the probe in the first region are releasable upon the first treatment.

[0047] In some embodiments, the first treatment in the method is selected from the group consisting of electron beam treatment, sonication, and illumination.

[0048] In some embodiments, the first treatment in the method is illumination.

[0049] In some embodiments, the light in the method is provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode.

[0050] In some embodiments, the light in the methods is provided by a UV light source.

[0051] In some embodiments, when the target molecule comprises RNA, the reaction-blocking modification on the probe in the second region is selected from the group consisting of a releasable, base-modified group, a cleavable linker, and a photolabile group.

[0052] In some embodiments, in the method, the reaction-blocking modification on the probe in the second region is a cleavable linker.

[0053] In some embodiments, the linker in this method is located at the 5' end of the probe in the second region.

[0054] In some embodiments, the linker in the probe in the second region is cleavable upon the second treatment.

[0055] In some embodiments, the second treatment in the method is selected from the group consisting of electron beam treatment, sonication, and illumination.

[0056] In some embodiments, the second treatment in the method is illumination.

[0057] In some embodiments, the light in the method is provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode.

[0058] In some embodiments, the light in the methods is provided by a UV light source.

[0059] In some embodiments, in the method, the reaction-blocking modification on the probe in the second region is a releasable, base-modified group.

[0060] In some embodiments, in the method, the reaction-blocking modification on the probe in the second region comprises at least one releasable, base-modified group.

[0061] In some embodiments, in the method, the reaction-blocking modification on the probe in the second region comprises at least one releasable photolabile group.

[0062] In some embodiments, the base-modified group in this method comprises an NPOM protecting group.

[0063] In some embodiments, the base-modified groups in the probe in the second region are releasable upon the second treatment.

[0064] In some embodiments, the second treatment in the method is selected from the group consisting of electron beam treatment, sonication, and illumination.

[0065] In some embodiments, the second treatment in the method is illumination.

[0066] In some embodiments, the light in the method is provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode.

[0067] In some embodiments, the light in the methods is provided by a UV light source.

[0068] In some embodiments, the first treatment and the second treatment in the method are the same or different.

[0069] In some embodiments, a second treatment is performed on a second region of the sample while or after a first treatment is performed on a first region of the sample.

[0070] In some embodiments, the method comprises administering a first tag molecule containing a first tag sequence to said first region of said sample after a first treatment.

[0071] In some embodiments, the method comprises administering a second tag molecule containing a second tag sequence to said second region of said sample after the second treatment.

[0072] In some embodiments, the probe further comprises a first binding domain of an adaptor, the first binding domain of the adaptor comprising at least one reaction-blocking modification.

[0073] In some embodiments, in the probe, the first binding domain of the adaptor is located at the 5' end of the target molecule binding domain.

[0074] In some embodiments, the method includes, during a first process, a probe in the first region forms a complex with a first tag sequence and an oligonucleotide adaptor, the oligonucleotide adaptor comprising a probe-binding domain and a tag-binding domain.

[0075] In some embodiments, the first tag sequence in the method comprises at least one barcode and a second binding domain of the adapter.

[0076] In some embodiments, the method comprises, during a first treatment, a nucleic acid sequence in the probe binding domain is complementary to a nucleic acid sequence in a first binding domain of an adaptor in the probe in the first region, and a nucleic acid sequence in the tag binding domain is complementary to a nucleic acid sequence in a second binding domain of the adaptor in the first tag sequence, thereby forming a partially double-stranded structure.

[0077] In some embodiments, the second binding domain of the adaptor in the first tag sequence is ligated by a ligase to the first binding domain of the adaptor in the probe in the first region, thereby producing a probe attached to the first tag sequence.

[0078] In some embodiments, the ligase comprises T4 ligase.

[0079] In some embodiments, the barcode of the first tag sequence characterizes the spatial location information of the first region.

[0080] In some embodiments, the first tag sequence comprises multiple barcodes.

[0081] In some embodiments, the barcodes in the first tag are different.

[0082] In some embodiments, the nucleic acid sequence in the second binding domain of the adaptor in the first tag sequence is located at the 3' end of the barcode in the first tag sequence.

[0083] In some embodiments, the first tag sequence comprises a unique molecular identifier region.

[0084] In some embodiments, the first tag sequence comprises a sequencing primer.

[0085] In some embodiments, the probe in the second region comprises a first binding domain of the adaptor, and the first binding domain of the adaptor comprises at least one reaction-blocking modification.

[0086] In some embodiments, in the probe, the first binding domain of the adaptor is located at the 5' end of the target molecule binding domain.

[0087] In some embodiments, the method includes, during the second processing, the probe in the second region forms a complex with a second tag sequence and an oligonucleotide adaptor, wherein the oligonucleotide adaptor comprises a probe-binding domain and a tag-binding domain.

[0088] In some embodiments, the second tag sequence comprises at least one barcode and a second binding domain of the adapter.

[0089] In some embodiments, the method comprises, during the second treatment, a nucleic acid sequence in the probe binding domain is complementary to a nucleic acid sequence in a first binding domain of an adaptor in the probe in the second region, and a nucleic acid sequence in the tag binding domain is complementary to a nucleic acid sequence in a second binding domain of the adaptor in the second tag sequence, thereby forming a partially double-stranded structure.

[0090] In some embodiments, the second binding domain of the adaptor in the second tag sequence is ligated by a ligase to the first binding domain of the adaptor in the probe in the second region, thereby producing a probe attached to the second tag sequence.

[0091] In some embodiments, the ligase comprises T4 ligase.

[0092] In some embodiments, the barcode in the second tag sequence characterizes the spatial location information of the second region.

[0093] In some embodiments, the second tag sequence comprises multiple barcodes.

[0094] In some embodiments, the multiple barcodes in the second tag sequence are different.

[0095] In some embodiments, the nucleic acid sequence in the second binding domain of the adaptor in the second tag sequence is located at the 3' end of the barcode in the second tag sequence.

[0096] In some embodiments, the second tag sequence comprises a unique molecular identifier region.

[0097] In some embodiments, the second tag sequence comprises a sequencing primer.

[0098] In some embodiments, at least one target molecule in a sample is subjected to in situ hybridization with at least one probe.

[0099] In some embodiments, the method includes digesting the sample after in situ hybridization to obtain a probe attached to a first tag sequence and a probe attached to a second tag sequence.

[0100] In some embodiments, the method includes amplifying the resulting probe attached to the first tag sequence and the probe attached to the second tag sequence.

[0101] In some embodiments, the method further comprises amplifying the resulting probe attached to the first tag sequence and the probe attached to the second tag sequence, and then sequencing the probe attached to the first tag sequence and the probe attached to the second tag sequence to determine the composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence.

[0102] In some embodiments, when the target molecule comprises a protein, the target molecule binding domain in the probe comprises a protein-binding molecule that specifically binds to the protein.

[0103] In some embodiments, the protein binding molecule is selected from the group consisting of an antibody, a peptide, and a peptoid.

[0104] In some embodiments, when the target molecule comprises a lipid, the target molecule binding domain in the probe recognizes and binds to the target molecule.

[0105] In some embodiments, the target molecule comprises DNA derived from the sample.

[0106] In some embodiments, the DNA comprises genomic DNA, open chromatin DNA, regions of DNA bound by proteins, and / or exogenous nucleic acids linked to proteins, lipids and / or small molecule compounds, which are capable of binding target molecules within a cell.

[0107] In some embodiments, the method comprises fragmenting the DNA prior to contacting at least one target molecule in the sample with at least one probe.

[0108] In some embodiments, fragmenting in the method comprises incorporating a sequence containing the probe into the DNA using a transposase-nucleic acid complex and releasing the transposase.

[0109] In some embodiments, the transposase-nucleic acid complex in the methods comprises a transposase and a transposon end nucleic acid molecule, wherein the transposon end nucleic acid molecule comprises an oligonucleotide adapter sequence.

[0110] In some embodiments, the transposase comprises Tn5.

[0111] In some embodiments, the DNA comprises a region of DNA bound by a protein, and the transposase-nucleic acid complex further comprises a moiety that directly or indirectly recognizes the protein.

[0112] In some embodiments, in the method, the moiety that directly or indirectly recognizes the protein comprises one or more of the group consisting of an antibody that specifically binds the protein and Protein A or Protein G.

[0113] In some embodiments, in the method, the reaction-blocking modification on the probe in the first region is selected from the group consisting of a releasable, base-modified group, a cleavable linker, and a photolabile group.

[0114] In some embodiments, the reaction-blocking modification on the probe in the first region is a cleavable linker.

[0115] In some embodiments, the linker is located at the 5' end of the probe in the first region.

[0116] In some embodiments, the linker is cleavable upon the first treatment.

[0117] In some embodiments, the first treatment is selected from the group consisting of electron beam treatment, sonication, and illumination.

[0118] In some embodiments, the first treatment is lighting.

[0119] In some embodiments, the light is provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode.

[0120] In some embodiments, the light is provided by a UV light source.

[0121] In some embodiments, the reaction-blocking modification on the probe in the first region is a releasable, base-modified group.

[0122] In some embodiments, the reaction-blocking modification on the probe in the first region comprises at least one releasable, base-modified group.

[0123] In some embodiments, the reaction-blocking modification on the probe in the first region comprises at least one releasable photolabile group.

[0124] In some embodiments, the base-modified group comprises an NPOM protecting group.

[0125] In some embodiments, the base-modified group is releasable upon the first treatment.

[0126] In some embodiments, the first treatment is selected from the group consisting of electron beam treatment, sonication, and illumination.

[0127] In some embodiments, the first treatment is lighting.

[0128] In some embodiments, the light is provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode.

[0129] In some embodiments, the light is provided by a UV light source.

[0130] In some embodiments, the reaction-blocking modification on the probe in the second region is selected from the group consisting of a releasable, base-modified group, a cleavable linker, and a photolabile group.

[0131] In some embodiments, the reaction-blocking modification on the probe in the second region is a cleavable linker.

[0132] In some embodiments, the linker is located at the 5' end of the probe in the second region.

[0133] In some embodiments, the linker is cleavable upon the second treatment.

[0134] In some embodiments, the second treatment is selected from the group consisting of electron beam treatment, sonication, and illumination.

[0135] In some embodiments, the second treatment is lighting.

[0136] In some embodiments, the light is provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode.

[0137] In some embodiments, the light is provided by a UV light source.

[0138] In some embodiments, the reaction-blocking modification on the probe in the second region is a releasable, base-modified group.

[0139] In some embodiments, the reaction-blocking modification on the probe in the second region comprises at least one releasable, base-modified group.

[0140] In some embodiments, the base-modified group comprises an NPOM protecting group.

[0141] In some embodiments, the base-modified group is releasable upon a second treatment.

[0142] In some embodiments, the second treatment is selected from the group consisting of electron beam treatment, sonication, and illumination.

[0143] In some embodiments, the second treatment is lighting.

[0144] In some embodiments, the light is provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode.

[0145] In some embodiments, the light is provided by a UV light source.

[0146] In some embodiments, the first treatment and the second treatment are the same or different.

[0147] In some embodiments, a second treatment is performed on a second region of the sample while or after a first treatment is performed on a first region of the sample.

[0148] In some embodiments, the method comprises administering a first tag molecule containing a first tag sequence to the first region of the sample after the first treatment.

[0149] In some embodiments, the method comprises administering a second tag molecule containing a second tag sequence to a second region of the sample after the second treatment.

[0150] In some embodiments, the probe contains a first binding domain of the adaptor, wherein the first binding domain of the adaptor comprises at least one reaction-blocking modification.

[0151] In some embodiments, in the probe, the first binding domain of the adaptor is located at the 5' end of the target molecule binding domain.

[0152] In some embodiments, the probe further comprises a barcode.

[0153] In some embodiments, the barcode in the probe characterizes the identity of the antibody.

[0154] In some embodiments, the method includes, during a first process, a probe in the first region forms a complex with a first tag sequence and an oligonucleotide adaptor, the oligonucleotide adaptor comprising a probe-binding domain and a tag-binding domain.

[0155] In some embodiments, the first tag sequence comprises at least one barcode and a second binding domain of the adapter.

[0156] In some embodiments, the method comprises, during a first treatment, a nucleic acid sequence in the probe binding domain is complementary to a nucleic acid sequence in a first binding domain of an adaptor in the probe in the first region, and a nucleic acid sequence in the tag binding domain is complementary to a nucleic acid sequence in a second binding domain of the adaptor in the first tag sequence, thereby forming a partially double-stranded structure.

[0157] In some embodiments, the second binding domain of the adaptor in the first tag sequence is ligated by a ligase to the first binding domain of the adaptor in the probe in the first region, thereby producing a probe attached to the first tag sequence.

[0158] In some embodiments, the ligase comprises T4 ligase.

[0159] In some embodiments, the barcode of the first tag sequence characterizes the spatial location information of the first region.

[0160] In some embodiments, the first tag sequence comprises multiple barcodes.

[0161] In some embodiments, the multiple barcodes in the first tag sequence are different.

[0162] In some embodiments, the nucleic acid sequence in the second binding domain of the adaptor in the first tag sequence is located at the 3' end of the barcode in the first tag sequence.

[0163] In some embodiments, the first tag sequence comprises a unique molecular identifier region.

[0164] In some embodiments, the first tag sequence comprises a sequencing primer.

[0165] In some embodiments, the probe in the second region comprises a first binding domain of the adaptor, the first binding domain of the adaptor comprising at least one reaction-blocking modification.

[0166] In some embodiments, in the probe, the first binding domain of the adaptor is located at the 5' end of the target molecule binding domain.

[0167] In some embodiments, the method includes during the second treatment the probe in the second region forms a complex with a second tag sequence and an oligonucleotide adaptor.

[0168] In some embodiments, the second tag sequence comprises at least one barcode and a second binding domain of the adapter.

[0169] In some embodiments, the method comprises, during the second treatment, a nucleic acid sequence in the probe binding domain is complementary to a nucleic acid sequence in a first binding domain of an adaptor in the probe in the second region, and a nucleic acid sequence in the tag binding domain is complementary to a nucleic acid sequence in a second binding domain of the adaptor in the second tag sequence, thereby forming a partially double-stranded structure.

[0170] In some embodiments, the second binding domain of the adaptor in the second tag sequence is ligated by a ligase to the first binding domain of the adaptor in the probe in the second region, thereby producing a probe attached to the second tag sequence.

[0171] In some embodiments, the ligase comprises T4 ligase.

[0172] In some embodiments, the barcode in the second tag sequence characterizes the spatial location information of the second region.

[0173] In some embodiments, the second tag sequence comprises multiple barcodes.

[0174] In some embodiments, the multiple barcodes in the second tag sequence are different.

[0175] In some embodiments, the nucleic acid sequence in the second binding domain of the adaptor in the second tag sequence is located at the 3' end of the barcode in the second tag sequence.

[0176] In some embodiments, the second tag sequence comprises a unique molecular identifier region.

[0177] In some embodiments, the second tag sequence comprises a sequencing primer.

[0178] In some embodiments, at least one probe specifically recognizes at least one target molecule in a sample.

[0179] In some embodiments, the method includes digesting the sample to obtain a probe attached to a first tag sequence and a probe attached to a second tag sequence.

[0180] In some embodiments, the method includes amplifying the resulting probe attached to the first tag sequence and the probe attached to the second tag sequence.

[0181] In some embodiments, after amplifying the resulting probe attached to the first tag sequence and the probe attached to the second tag sequence, the method further comprises sequencing the probe attached to the first tag sequence and the probe attached to the second tag sequence to determine the composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence.

[0182] In another aspect, the present application relates to a combination comprising: 1) a plurality of probes, each of the probes comprising a target molecule binding domain, a first binding domain of an adaptor, and at least one reaction-blocking modification; 2) an oligonucleotide adapter comprising a probe-binding domain and a tag-binding domain; 3) a plurality of tag sequences, each of the tag sequences comprising at least one barcode and a second binding domain of an adapter, wherein a nucleic acid sequence in the probe binding domain is complementary to a nucleic acid sequence in the first binding domain of the adapter, and a nucleic acid sequence in the tag binding domain is complementary to a nucleic acid sequence in the second binding domain of the adapter.

[0183] In some embodiments, the barcodes in the combination differ in two or more of the tag sequences.

[0184] In some embodiments, the reaction-blocking modifications in the combination are selected from the group consisting of releasable, base-modified groups, cleavable linkers and biotin.

[0185] In some embodiments, the reaction-blocking modification in the combination is a cleavable linker.

[0186] In some embodiments, the reaction-blocking modifications in combination are releasable, base-modified groups.

[0187] In some embodiments, in the combination, 1), 2), and 3) are present independently of each other.

[0188] In some embodiments, the combination 1), 2) and 3) are present as a mixture.

[0189] In another aspect, the present application provides a kit containing the combination.

[0190] In some embodiments, the kit comprises a transposase.

[0191] In some embodiments, the kit further comprises at least one of a nucleic acid amplification agent, a reverse transcriptase, a fixation agent, a permeabilization agent, a ligation agent, and a lysis agent.

[0192] In some embodiments, the kit comprises instructions for use.

[0193] In some embodiments, the instructions include the following steps: contacting at least one target molecule in a sample with at least one probe under conditions that allow the probe to specifically bind to the target molecule, the probe containing a target molecule binding domain capable of specifically binding to the target molecule and at least one reaction-blocking modification; performing a first treatment on a first region of the sample, the first treatment being capable of at least partially removing a reaction-blocking modification on a probe in the first region and attaching the probe in the first region to a first tag sequence in the tag sequences; performing a second treatment on a second region in the sample that is different from the first region, the second treatment being capable of at least partially removing a reaction-blocking modification on the probe in the second region to attach the probe in the second region to a second tag sequence in the tag sequences, the second tag sequence being different from the first tag sequence; determining the composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence, and from the composition of the probes, determining the presence and / or content of the target molecule in the first region and the presence and / or content of the target molecule in the second region in the sample; Please write:

[0194] Other aspects and advantages of the present application can be easily recognized by those skilled in the art from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are shown and described. As will be recognized by those skilled in the art, the contents of the present application allow those skilled in the art to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention contained in the present application. Correspondingly, the drawings and descriptions in the specification of the present application are merely illustrative, not limiting.

[0195] Particular features of the invention contained in this application are set forth in the appended claims. The features and advantages of the invention contained in this application can be better understood with reference to the exemplary embodiments detailed below and the accompanying drawings, the brief description of which follows. [Brief description of the drawings]

[0196] [Figure 1] FIG. 1 shows a schematic diagram of an exemplary method for analyzing omics information of a sample in accordance with the present application. [Diagram 2] FIG. 2 shows a schematic diagram of different regions of mouse tissue, e.g., the eye and epithelium. [Diagram 3] FIG. 3 shows gene expression results for region 1 (eye) of the mouse tissue in FIG. [Figure 4] FIG. 4 shows the results of ATAC omics analysis of region 1 (eye) and region 2 (epithelium) of the mouse tissue in FIG. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0197] The practice of the present invention is described below with reference to specific embodiments, and other advantages and benefits of the present invention will be readily apparent to those skilled in the art from the disclosure herein.

[0198] Definition of Terms In this application, the term "characterize" generally refers to the description of information about nucleic acids and other related molecules obtained by sequencing or other biological analytical methods such as genomics and / or proteomics. For example, the information may include sequence information from whole genome sequencing, information about available chromatin sequence and distribution, information about the binding of nucleic acid sequences to binding factors of nucleic acid sequences, information about mutations in disease-causing genes, single nucleotide polymorphisms (SNPs), nucleotide methylation, transcriptome information (e.g., temporal or spatial variations in gene expression levels), and the like.

[0199] In this application, the term "sequencing" generally refers to the technology for obtaining information on nucleic acid molecule sequence.For example, when analyzing the base sequence of a specific DNA fragment (such as the arrangement of adenine (A), thymine (T), cytosine (C) and guanine (G)); sequencing methods can include Sanger dideoxy chain termination method, pyrosequencing and the "parallel sequencing by synthesis" or "sequencing by ligation" platform used by Illumina, Life Technologies and Roche for new generation sequencing, sequencing equipment from MGI Tech / Complete Genomics; in general, sequencing methods can also include nanopore sequencing, such as the method developed by Oxford Nanopore Technologies, the third generation sequencing equipment from PacBio, or the method based on electronic detection, such as the Ion Torrent technology launched by Life Technologies, etc.

[0200] In this application, the term "protein A" generally refers to a cell-derived protein that can bind to the conserved region of the heavy chain of antibodies from different species, i.e., the recognition protein of antibodies. For example, protein A can bind to the Fc fragment of IgG molecules from the serum of humans and various mammals, where the mammals may include pigs, dogs, rabbits, humans, monkeys, rats, mice, and cows, etc., and the subclasses of IgG that protein A binds to may mainly include IgG1, IgG2, and IgG4; in addition to binding to IgG, protein A can also bind to IgM and IgA in serum. For example, protein A may include staphylococcal protein A (SPA). SPA is the main component of cell wall antigens and is present in almost more than 90% of Staphylococcus aureus strains. However, there is a significant variation in the content of this component among different strains. The functionality of protein A binding to antibodies allows for the localization and / or analysis of target proteins through the formation of target protein-antibody-protein A complexes.

[0201] In this application, the term "unique molecular identifier region" may also be referred to as "molecular barcode", "molecular marker", "unique identifier (UID)", "unique molecular identifier (UMI)", etc., and generally refers to encoding a unique sequence on each original nucleotide fragment in the same sample. Unique molecular identifier regions can typically be designed as completely random nucleotide chains (e.g., NNNNNNN), partially specified nucleotide chains (e.g., NNNRNYN), or specified nucleotide chains (e.g., when the template molecule is limited). The design, incorporation and application of UMIs can be carried out in a manner known in the art, for example as disclosed in International Publication No. 2012 / 142213 by Islam et al., Kivioja, T. et al. (Nat. Methods) (2014) 11:163-166 and (Nat. Methods) (2012) 9:72-74, which are incorporated herein by reference in their entirety.

[0202] In this application, the term "barcode" generally refers to a nucleotide sequence or derived or modified forms thereof that can identify the source of a probe. For example, a barcode can distinguish between probes derived from different regions.

[0203] In this application, the term "oligonucleotide adaptor" generally refers to a nucleotide sequence that can be complementary to the first binding domain of the adaptor in the probe and complementary to the second binding domain of the adaptor in the tag sequence. The nucleotide sequence can be partially double-stranded, for example, it can have a prominent sequence that hybridizes with the tag sequence. In some embodiments, the oligonucleotide adaptor can also include an amplification primer recognition sequence. In some embodiments, the oligonucleotide adaptor can also include a reverse transcription primer sequence.

[0204] In this application, the term "transposase-nucleic acid complex" generally refers to a complex formed from a transposase and a sequence containing the first binding domain of the adapter in the probe. Transposase generally refers to an enzyme capable of binding to a transposon end and catalyzing the movement of the transposon to other parts of the genome via mechanisms such as cut-and-paste or replicative transposition. Transposons generally refer to segments of nucleotides that can move freely within a genome, a concept first proposed by Barbara McClintock in the late 1940s during her work on the genetic mechanisms of maize. Subsequent work by other groups has elucidated the molecular basis of transposition. For example, McClintock discovered that chromosomal segments can change position and jump from one chromosome to another. The rearrangement of these transposons can change the expression of other genes. For example, in maize, transposons can cause color changes. In other organisms, such as bacteria, transposons can induce antibiotic resistance during the course of human evolution. The transposase-nucleic acid complex can include a dimer formed by two transposases, each binding to a first binding domain of an adapter in the probe, and the two transposases can be the same or different.

[0205] In this application, the term "Tn5" generally refers to Tn5 transposase, a member of the ribonuclease (RNase) superfamily. Tn5 can be found in Shewanella oneidensis and Escherichia coli. Tn5 can include the naturally occurring Tn5 transposase and its various active variants. Like many of the other transposases, Tn5 contains a DDE motif that serves as a catalytically active site to mediate the transposition of transposons. It has been reported that the DDE motif can coordinate with divalent metal ions such as magnesium and manganese, which play an important role in catalyzing the reaction. Transposase Tn5 has elevated transposition activity and can catalyze the movement of transposons through mutations in the DDE region. For example, the glutamic acid at position 326 is converted to an aspartic acid, and the two aspartic acids at positions 97 and 188 are converted to glutamic acids (based on the amino acid numbering of the amino acid sequence of GenBank Accession No. YP_001446289).

[0206] In this application, the terms "hybridized," "hybridizable," or "complementary" generally mean that a nucleic acid (e.g., RNA, DNA) comprises a nucleotide sequence capable of non-covalently and specifically binding (i.e., forming Watson-Crick base pairs and / or G / U base pairs) to another nucleic acid sequence under in vitro and / or in vivo conditions of appropriate temperature and solution ionic strength. Watson-Crick base pairing includes adenine / adenosine (A) paired with thymidine / thymine (T), A paired with uracil / uridine (U), and guanine / guanosine (G) paired with cytosine / cytidine (C). In some embodiments, G can also pair with U bases for hybridization between two RNA molecules (e.g., dsRNA) or for hybridization between a DNA molecule and an RNA molecule (e.g., when a base of a DNA target nucleic acid is paired with a guide RNA). Hybridization requires that two nucleic acids contain complementary sequences, but cannot exclude possible mismatches between bases.The conditions suitable for hybridization between two nucleic acids depend on the length of the nucleic acid and the degree of complementarity, and are well known in the art.The greater the degree of complementarity between two nucleotide sequences, the greater the melting temperature (Tm) value of the hybrid of the nucleic acid with these complementary sequences.

[0207] In this application, "releasable base-modified group" generally refers to a base-modified group that can be released from the probe after processing. For example, "releasable base-modified group" can include a photolabile group. In some examples, the introduction of a photolabile group can control reactions (e.g., complementary hybridization). For example, the photolabile group can include photocleavable and photoalibolic groups. When exposed to light, the photolabile group can absorb energy and undergo electron transfer and energy level transition, resulting in bond cleavage and release of the modified probe. For example, the photolabile group can include o-nitrobenzyl (NPP) and its derivatives. For example, the photolabile group can include 4,5-dimethoxy-2-nitrobenzyl (DMNB) and / or 6-nitro-3,4-methylenedioxybenzoxymethyl (NPOM).

[0208] In this application, "cleavable linker" generally refers to a segment of a nucleotide sequence that can be cleaved upon processing (e.g., optical processing). In some embodiments, the nucleotide can be a segment of a fixed nucleotide sequence. For example, the cleavable linker can include a photocleavable linker (PC linker). For example, the photocleavable linker can be located between DNA bases. For example, the 5'-phosphate group of the probe can be exposed after the photocleavable linker is cleaved.

[0209] In this application, "substantially non-overlapping" generally means that the overlap between a first region and a second region approaches zero. For example, a first region does not overlap with a second region.

[0210] Detailed Description of the Invention In one aspect, the present application provides a method for detecting a target molecule comprising the steps of: contacting at least one target molecule in a sample with at least one probe under conditions that allow the probe to specifically bind to the target molecule, the probe containing a target molecule binding domain capable of specifically binding to the target molecule and at least one reaction-blocking modification; performing a first treatment on a first region of the sample, the first treatment capable of at least partially removing the reaction-blocking modifications on the probes in the first region and attaching the probes in the first region to a first tag sequence; performing a second treatment on a second region in the sample that is distinct from the first region, the second treatment being capable of at least partially removing the reaction-blocking modification on the probe in the second region and attaching the probe in the second region to a second tag sequence, the second tag sequence being distinct from the first tag sequence; determining a composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence, and determining from the composition of the probes the presence and / or content of the target molecule in the first region and the presence and / or content of the target molecule in the second region in the sample; The present invention provides a method comprising:

[0211] In another aspect, the present application provides a method for analyzing omics information of a sample, comprising: contacting at least one target molecule in a sample with at least one probe under conditions that allow the probe to specifically bind to the target molecule, said probe containing a target molecule binding domain capable of specifically binding to said target molecule and at least one reaction-blocking modification; performing a first treatment on a first region of the sample, the first treatment capable of at least partially removing the reaction-blocking modifications on the probes in the first region and attaching the probes in the first region to a first tag sequence; performing a second treatment on a second region in the sample that is distinct from the first region, the second treatment being capable of at least partially removing the reaction-blocking modification on the probe in the second region and attaching the probe in the second region to a second tag sequence, the second tag sequence being distinct from the first tag sequence; determining a composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence, and determining from the composition of the probes the presence and / or content of the target molecule in the first region and the presence and / or content of the target molecule in the second region in the sample; The present invention further provides a method comprising:

[0212] A schematic diagram of an exemplary method for analyzing the omics information of a sample is shown in FIG.

[0213] In another aspect, the present application provides a sequencing method, comprising: contacting at least one target molecule in a sample with at least one probe under conditions that allow the probe to specifically bind to the target molecule, said probe containing a target molecule binding domain capable of specifically binding to said target molecule and at least one reaction-blocking modification; performing a first treatment on a first region of the sample, the first treatment capable of at least partially removing the reaction-blocking modifications on the probes in the first region and attaching the probes in the first region to a first tag sequence; performing a second treatment on a second region in the sample that is distinct from the first region, the second treatment being capable of at least partially removing the reaction-blocking modification on the probe in the second region and attaching the probe in the second region to a second tag sequence, the second tag sequence being distinct from the first tag sequence; determining a composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence, and determining from the composition of the probes the presence and / or content of the target molecule in the first region and the presence and / or content of the target molecule in the second region in the sample; The present invention provides a method for sequencing, comprising:

[0214] sample In this application, the sample may be from almost any organism, including multicellular organisms such as plants, fungi, and animals. For example, the sample may be from an animal (e.g., a mammal). For example, the sample may be from a human source. For example, the sample may be a biopsy tumor or a portion thereof. For example, the sample may be a clinically significant tissue sample. For example, the tumor may include a solid tumor. For example, the tumor may include a hematological tumor.

[0215] In this application, a sample may contain any number of substances, including, but not limited to, cells of almost any organism (including both primary cells and cultured cell lines), cell lysates or extracts (including, but not limited to, RNA extracts, purified mRNA), tissues and tissue extracts (including, but not limited to, RNA extracts, purified mRNA), body fluids (including, but not limited to, blood, urine, serum, lymph, bile, cerebrospinal fluid, interstitial fluid, aqueous or vitreous fluid, colostrum, sputum, amniotic fluid, saliva, anal and vaginal secretions, sweat and semen, exudates, exudates (e.g., body fluids from an abscess or any other site of infection or inflammation) or joints (e.g., normal joints or joints affected by diseases such as rheumatoid arthritis, osteoarthritis, gout or septic arthritis). Test samples include extracellular fluids, extracellular supernatants from cell cultures, inclusion bodies in bacteria, cellular compartments, periplasmic and mitochondrial compartments.

[0216] In the present application, a sample may include at least one cell. For example, a sample may include one or more, two or more, three or more, four or more, five or more, or six or more cells. In the present application, a cell may be selected from the group consisting of a cell isolated from an organism, a cell cultured in vitro, a primary cell, and a cell separated from an explant. For example, an "isolated cell from an organism" generally refers to a cell derived from a multicellular organism. For example, the cell may be isolated from a human. For example, an "in vitro cultured cell" generally refers to a cell cultured under suitable culture conditions in an ex vivo environment. For example, a cell cultured in vitro may be cultured in a medium. For example, a "primary cell" generally refers to a cell cultured immediately after being taken from an organism. For example, an "isolated cell from an explant" generally refers to an isolated cell obtained by hydrolyzing a plant tissue.

[0217] In the present application, the sample may include a tissue section. In the present application, the tissue section has a thickness in the range of 1 to 1000 μm. For example, the thickness of the tissue section is at least 1 μm, at least 5 μm, at least 20 μm, at least 50 μm, at least 100 μm, at least 150 μm, at least 200 μm, at least 250 μm, at least 300 μm, at least 350 μm, at least 400 μm, at least 450 μm, at least 500 μm, at least 550 μm, at least 600 μm, at least 650 μm, at least 700 μm, at least 750 μm, at least 800 μm, at least 850 μm, at least 900 μm, at least 950 μm.

[0218] In the present application, the sample can be selected from the group consisting of frozen section, paraffin section, carbowax section, ultrathin section and plastic section.For example, the tissue section can be a fixed tissue section.For example, the tissue section can be a formalin-fixed tissue section.For example, the tissue section can be a formalin-fixed paraffin section.For example, the tissue section can be a frozen section.For example, the tissue in the tissue section can be from the group consisting of myocardial tissue, liver tissue, spleen tissue, lung tissue, kidney tissue and brain tissue.

[0219] In this application, "frozen section" generally refers to a method of rapidly cooling tissue to a certain hardness at low temperature followed by sectioning. In this application, "paraffin section" generally refers to fixing and embedding tissue in paraffin for sectioning. In this application, "carbowax section" generally refers to fixing and cleaning tissue, then embedding the tissue directly in carbowax for sectioning. In this application, "ultrathin section" generally refers to ultrathin specimen sections for transmission electron microscopy, typically embedded in resin. In this application, "plastic section" generally refers to fixing tissue, then embedding in plastic for sectioning.

[0220] Probe and target molecule In the present application, the probe may include a target molecule binding domain. In the present application, the target molecule may include one or more selected from the group consisting of a protein, a nucleic acid molecule, a metabolite, and / or a lipid. For example, the nucleic acid molecule may include a DNA molecule and / or an RNA molecule. For example, the DNA molecule may be a cDNA. For example, the RNA molecule may include a cRNA, an mRNA, an miRNA, an lncRNA, and / or an eRNA. For example, the RNA may be an mRNA. For example, the lipid may include a fat, a cholesterol (cporesterol), a cholesterol (cporesterol) ester, a phospholipid, and / or a glycolipid.

[0221] In the present application, when the target molecule comprises RNA, the target molecule binding domain in the probe comprises a nucleic acid sequence complementary to RNA.In the present application, the target molecule binding domain in the probe can comprise polyA.For example, the length of polyA can be at least 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides or more.In the present application, the target molecule binding domain in the probe comprises polyT.For example, the length of polyT can be at least 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides or more.

[0222] In this application, the target molecule may comprise mRNA, and the target molecule binding domain of the probe may comprise a single-stranded nucleic acid. For example, the target molecule hybridizes with the target molecule binding domain. With respect to hybridization, the conditions suitable for hybridization between two nucleic acids depend on the length of the nucleic acid and the degree of complementarity, which are well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the melting temperature (Tm) value of the hybrid of the nucleic acid with these complementary sequences. For example, the single-stranded nucleic acid may comprise at least 10 nucleotides. For example, single-stranded nucleic acid can comprise 10 nucleotides or more, 12 nucleotides or more, 14 nucleotides or more, 16 nucleotides or more, 18 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 24 nucleotides or more, 26 nucleotides or more, 28 nucleotides or more, 30 nucleotides or more, 32 nucleotides or more, 34 nucleotides or more, 36 nucleotides or more, 38 nucleotides or more, 40 nucleotides or more, 42 nucleotides or more, 44 nucleotides or more, 46 nucleotides or more, 48 nucleotides or more, 50 nucleotides or more, 52 nucleotides or more, 54 nucleotides or more, 56 nucleotides or more, 58 nucleotides or more or 60 nucleotides or more.For example, hybridization does not exclude the possibility of mismatch between bases.For example, the target molecule binding domain in the probe is at least 50% complementary to the mRNA sequence. For example, the complementarity can be 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, 99.9% or more. The remaining non-complementary nucleotides can be clustered or interspersed with complementary nucleotides and do not have to be adjacent to each other or to complementary nucleotides. For example, polynucleotides can hybridize on one or more segments such that intermediate or adjacent segments are not involved in the hybridization event (e.g., formation of hairpin structures, "bumps", etc.).

[0223] In the present application, the target molecule may comprise a protein, and the target molecule binding domain of the probe may comprise an antibody or antigen-binding fragment capable of specifically binding the target molecule. For example, the antigen-binding fragment may comprise a Fab, Fab', F(ab)2, Fv fragment, F(ab')2, scFv, di-scFv, VHH, and / or dAb.

[0224] In the present application, two or more target molecules in a sample can be contacted with two or more probes. For example, the two or more target molecules can be the same or different.

[0225] In the present application, the target molecule may include DNA derived from the sample. For example, the DNA may include genomic DNA, open chromatin DNA, DNA regions bound by proteins, and / or exogenous nucleic acids linked to proteins, lipids and / or small molecule compounds, which can bind target molecules in cells.

[0226] In the present application, the method may include fragmenting DNA before contacting at least one target molecule in a sample with at least one probe. Fragmentation may include incorporating a sequence containing a probe into DNA using a transposase-nucleic acid complex and releasing the transposase. For example, the probe sequence includes a transposon end sequence. For example, the transposon end sequence is a Tn5 or modified Tn5 transposon end sequence. For example, the transposon end sequence is a Mu transposon end sequence. For example, the Tn5 or modified Tn5 transposon end sequence or the Mu transposon end sequence may include 15 to 25 nucleotides, such as 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides.

[0227] For example, Tn5M and Tn5B can be used as transposon end sequences. Tn5B: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3'; (SEQ ID NO: 11) Tn5M: 5'-CTGTCTCTTATACACATCT-3'. (SEQ ID NO: 12)

[0228] In this application, DNA can be fragmented using a variety of methods. For example, restriction digestion utilizing restriction endonucleases creates cleavage sites in DNA sequences by either blunt-end cleavage or heterogeneous cleavage on both strands, generating sticky ends. For example, DNA strand breakage mediated by shear stress can include processes such as sonication, acoustic shearing, needle shearing, pipetting or atomization. Sonication is a type of hydrodynamic shearing that exposes DNA sequences to short periods of shear forces, resulting in fragment sizes of approximately 700 bp. Acoustic shearing applies high frequency acoustic energy to a DNA sample in a cup-shaped transducer. Needle shearing generates shear forces by passing the DNA through a small diameter needle, physically tearing the DNA into smaller segments. Atomization forces can be generated by passing the DNA through a small opening in a nebulizer unit, where the resulting DNA fragments are collected from fine mist droplets exiting the unit. Typically, these fragments can be any length from about 200 to about 100,000 bases. For example, the fragments are from about 200 bp to about 500 bp, from about 500 bp to about 1 kb, from about 1 kb to about 10 kb, or from about 5 kb to about 50 kb, or from about 10 kb to about 30 kb, such as from about 15 kb to about 25 kb. For example, fragmentation of larger genetic components can be performed by any readily available method, including, for example, commercially available shear-based fragmentation systems (e.g., Covaris fragmentation system), size-targeted fragmentation systems (e.g., Blue Pippin (Sage Sciences)), enzymatic fragmentation methods (e.g., DNA endonucleases, DNA exonucleases), and the like. For example, fragmentation involves disruption by the use of sonication.

[0229] For example, transposases include Staphylococcus aureus Tn5 (Colegio et al., J. BacterioL, 183:2384-8, 2001; Kirby C et al., Mol. Microbiol., 43:173-86, 2002), tylosin (Tyl) (Devine and Boeke, Nucleic Acids Res., 22:3765-72, 1994 and WO 95 / 23875), transposon Tn7 (Craig, NL, Science. 271:1512, 1996; the overview of Craig, NL in Curr Top Microbiol Immunol., 204:27-48, 1996), Tn / O and IS 10 (Kleckner N et al., Curr Top Microbiol Immunol.,204:49-82,1996), mariner transposase (Lampe DJ et,al.,EMBO J.,15:5470-9,1996), Tel (Plasterk RH,Curr.Topics Microbiol.Immunol.,204:125-43,1996), P elements (Gloor,GB,Methods Mol.Biol.,260:97-114,2004), Tn3 (Ichikawa and Ohtsubo,J Biol.Chem.,265:18829-32,1990), bacterial insertion sequences (Ohtsubo and Sekine,Curr.Top.Microbiol.Immunol.,204:1-26,1996), retroviruses (Brown et,al.,Proc Natl Acad Sci USA,86:2525-9,1989) and yeast retrotransposons (Boeke and Corces,Annu Rev Microbiol.,43:403-34,1989), and engineered forms of IS5, Tn10, Tn903, IS911 and transposase family enzymes (Zhang et,al.,(2009),PLoS Genet.,5:el000689.Published electronically on October 16,2009;Wilson C.et,al.(2007),J.Microbiol. Methods, 71:332-5).

[0230] For example, the transposase is Mu transposase.For example, the transposase is Tn5 transposase or Tn10 transposase.The Tn5 transposase is selected from full-length Tn5 transposase, some functional domains of Tn5 transposase, and mutants of Tn5 transposase.The Tn10 transposase is selected from full-length Tn10 transposase, some functional domains of Tn10 transposase, and mutants of Tn10 transposase. For example, the mutant of Tn5 transposase may be selected from R30Q, K40Q, Y41H, T47P, E54K / V, M56A, R62Q, D97A, E110K, D188A, Y319A, R322A / K / Q, E326A, K330A / R, K333A, R342A, E344A, E345K, N348A, L372P, S438A, K439A, S445A, G462D, A466D.

[0231] For example, two transposase molecules can combine the same or different double-stranded DNA transposons so that the insertion site is marked with one or two DNAs. For example, two transposase molecules (e.g., Tn5 and hyperactive Tn or another type of transposase containing point mutations) can be assembled with a probe sequence and another standard transposon DNA sequence to form a hybrid transposition complex. Alternatively, only the above double-stranded structure 2 is used to form a single Tn5 transposition complex. The standard transposon DNA sequence can include an amplification primer sequence and / or a sequencing primer sequence.

[0232] For example, the DNA may include a DNA region bound by a protein, and the transposase-nucleic acid complex further includes a portion that directly or indirectly recognizes the protein. For example, the portion that directly or indirectly recognizes the protein may include Staphylococcus aureus protein A (protein A), Streptococcus protein G (protein G), Streptococcus protein L (protein L), or other protein analogs that have the function of binding an antibody. For example, the portion that directly or indirectly recognizes the protein may also include an antibody that specifically binds the protein. For example, Staphylococcus aureus protein A (protein A), Streptococcus protein G (protein G), Streptococcus protein L (protein L), or other protein analogs that have the function of binding an antibody are each capable of binding an antibody that specifically binds the protein.

[0233] For example, the transposase forms a fusion protein with Staphylococcus aureus Protein A (Protein A), Streptococcus Protein G (Protein G), Streptococcus Protein L (Protein L) or other protein analogs that have the function of binding antibodies.

[0234] For example, the fusion protein may be complexed with an antibody that specifically binds the protein, and then targets the protein.

[0235] For example, an antibody that specifically binds the protein is bound to the protein, and then the fusion protein is bound to the antibody to target the protein. For example, the translocation reactions and processes described herein can be performed in batches.

[0236] In the present application, the probes may be provided in a concentration of 100nM, 70nM, 60nM, 50nM, 40nM, 30nM, 20nM, 10nM, 9nM, 8nM, 7nM, 6nM, 5nM, 4nM, 3nM, 2nM, 1nM, 0.9nM, 0.8nM, 0.7nM, 0.6nM, 0.5nM, 0.4nM, 0.3nM, 0.2nM, 0.1nM, 0.09nM, 0.08nM, 0.07nM, 0.06nM, 0.05nM, 0.04nM, 0.03nM, 0.02nM, 0.01nM or less, and any concentration therebetween.

[0237] Reaction blocking modification In the present application, the reaction blocking modification can be selected from one or more of the group consisting of a releasable base-modified group, a cleavable linker, and biotin.For example, the reaction blocking modification can modify the 5' end of the probe.For example, the reaction blocking modification can modify the 3' end of the probe.

[0238] For example, the reaction blocking modification can be a releasable, base-modified group. For example, the base-modified group can include a photolabile group. For example, the photolabile group can include a photocleavable group and a photoalibolic group. When exposed to light, the photolabile group can absorb energy and undergo electron transfer and energy level transition, resulting in bond cleavage and release of the modified probe. For example, the photolabile group can include o-nitrobenzyl (NPP) and its derivatives. For example, the photolabile group can include 4,5-dimethoxy-2-nitrobenzyl (DMNB) and / or 6-nitro-3,4-methylenedioxybenzoxymethyl (NPOM). The introduction of the photolabile group can control the reaction (e.g., complementary hybridization). In the present application, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20 or more reaction-blocking modifications may be included on a probe.

[0239] For example, the cleavable linker can be a segment of a fixed nucleotide sequence. For example, the cleavable linker can include a photocleavable linker (PC linker). For example, the photocleavable linker can be located between DNA bases. For example, the 5'-phosphate group of the probe can be exposed after the photocleavable linker is cleaved. In this application, the sample is placed under an excitation light of a wavelength capable of cleaving the linker and photoexciting the sample, thereby cleaving the linker and exposing the 5'-phosphate group.

[0240] process In the present application, two or more regions of a sample can be processed. For example, the two or more regions can be different. For example, at least a first region of a sample can be processed. For example, at least a second region of a sample can be processed. For example, at least a third region, a fourth region, a fifth region, a sixth region, a seventh region, an eighth region, a ninth region, a tenth region, an eleventh region, a twelfth region, a thirteenth region, a fourteenth region, a fifteenth region, a sixteenth region, a seventeenth region, an eighteenth region, a nineteenth region, a twentieth region of a sample can be processed. For example, two or more (e.g., 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more) regions of a sample can be processed simultaneously.

[0241] In the present application, after the probe specifically binds to the target molecule, a first treatment can be performed on the first region of the sample. For example, the first treatment can be selected from the group consisting of electron beam treatment, sound wave, and illumination. For example, the first treatment can be illumination. For example, the light can be provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode. For example, the light can be provided by a UV light source.

[0242] In the present application, after the probe specifically binds to the target molecule, a second treatment can be performed on the second region of the sample. For example, the second treatment can be selected from the group consisting of electron beam treatment, sound wave, and illumination. For example, the second treatment can be illumination. For example, the light can be provided by a light source selected from the group consisting of an arc lamp, a laser, a UV light source, and a light emitting diode. For example, the light can be provided by a UV light source.

[0243] Oligonucleotide Adapters In the present application, the oligonucleotide adaptor can comprise a probe binding domain and a tag binding domain.For example, the probe binding domain in the oligonucleotide adaptor can comprise a single-stranded nucleic acid.For example, the length of the probe binding domain in the oligonucleotide adaptor can be 1 nucleotide or more, 2 nucleotides or more, 3 nucleotides or more, 5 nucleotides or more, 8 nucleotides or more, 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more.

[0244] In the present application, the probe-binding domain of the oligonucleotide adaptor can be complementary to the first binding domain of the adaptor in the probe. For the probe-binding domain, the conditions suitable for hybridization between two nucleic acids depend on the length of the nucleic acid and the degree of complementarity, which are well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the melting temperature (Tm) value of the hybrid of the nucleic acid with these complementary sequences. For example, the length of the probe-binding domain is sufficient to form a double-stranded structure with the first binding domain of the adaptor to which the probe-binding domain is complementary.

[0245] For example, the length of the tag binding domain in an oligonucleotide adaptor can be 1 nucleotide or more, 2 nucleotides or more, 3 nucleotides or more, 5 nucleotides or more, 8 nucleotides or more, 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more.

[0246] In the present application, the tag binding domain of the oligonucleotide adaptor can be complementary to the second binding domain of the adaptor in the tag sequence. For the tag binding domain, the conditions suitable for hybridization between two nucleic acids depend on the length of the nucleic acid and the degree of complementarity, which are well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the melting temperature (Tm) value of the hybrid of the nucleic acid with these complementary sequences. For example, the length of the tag binding domain is sufficient to form a double-stranded structure with the second binding domain of the adaptor to which the tag binding domain is complementary.

[0247] For example, the length of the tag-binding domain in an oligonucleotide sequence may be the same as or different from the length of the nucleic acid sequence of the probe-binding domain.

[0248] For example, the double-stranded structure does not exclude the possibility of mismatch between bases. For example, the tag-binding domain or the probe-binding domain does not need to be 100% complementary to its complementary sequence. For example, the complementarity can be 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more. The remaining non-complementary nucleotides can be clustered or interspersed with complementary nucleotides and do not need to be adjacent to each other or to complementary nucleotides. For example, a polynucleotide can hybridize on one or more segments such that the intermediate or adjacent segments are not involved in the hybridization event (e.g., the formation of a hairpin structure, "bumps", etc.).

[0249] Tag sequence In the present application, the tag sequence may comprise at least one barcode and a second binding domain of the adaptor. For example, the barcode may characterize the spatial location information of different regions. For example, the second binding domain of the adaptor in the tag sequence may comprise a single-stranded nucleic acid. The length of the second binding domain of the adaptor may be 1 nucleotide or more, 2 nucleotides or more, 3 nucleotides or more, 5 nucleotides or more, 8 nucleotides or more, 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more.

[0250] In the present application, during the first processing, the probe in the first region can form a complex with the first tag sequence and the oligonucleotide adaptor, and the oligonucleotide adaptor comprises a probe binding domain and a tag binding domain.For example, during the first processing, the nucleic acid sequence in the probe binding domain is complementary to the nucleic acid sequence in the first binding domain of the adaptor in the probe in the first region, and the nucleic acid sequence in the tag binding domain is complementary to the nucleic acid sequence in the second binding domain of the adaptor in the first tag sequence, thereby forming a partially double-stranded structure.

[0251] For example, the double-stranded structure does not exclude the possibility of mismatch between bases. For example, the tag-binding domain or the probe-binding domain does not need to be 100% complementary to its complementary sequence. For example, the complementarity can be 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more. The remaining non-complementary nucleotides can be clustered or interspersed with complementary nucleotides and do not need to be adjacent to each other or to complementary nucleotides. For example, a polynucleotide can hybridize on one or more segments such that the intermediate or adjacent segments are not involved in the hybridization event (e.g., the formation of a hairpin structure, "bumps", etc.).

[0252] In the present application, the second binding domain of the adaptor in the first tag sequence can be ligated by a ligase to the first binding domain of the adaptor in the probe in the first region, thereby producing a probe attached to the first tag sequence.

[0253] For example, the ligase may include DNA ligases such as Escherichia coli DNA ligase, T4 DNA ligase, T7 DNA ligase, mammalian ligases (e.g., DNA ligase I, DNA ligase III, DNA ligase IV), thermostable ligases, etc. T4 DNA ligase may ligate segments containing DNA, oligonucleotides, RNA, and RNA-DNA hybrids. Ligation may not involve DNA ligase, but uses alternatives such as topoisomerase. Rapid ligation may be achieved by using high concentrations of DNA ligase along with the inclusion of PEG. To select the optimal temperature for ligation, one may consider the preferred temperature of the DNA ligase (which may be, for example, 37° C.) and the melting temperature of the DNA to be ligated. To minimize ionization that may affect ligation, the target nucleic acid and the barcoded solid support may be suspended in an appropriate buffer. For example, the ligase may include T4 ligase.

[0254] For example, the barcode of the first tag sequence may characterize the spatial location information of the first region. For example, the first tag sequence may include multiple barcodes. For example, the multiple barcodes in the first tag may be different.

[0255] In the present application, the nucleic acid sequence in the second binding domain of the adapter in the first tag sequence may be located at the 3' end of the barcode in the first tag sequence.

[0256] In the present application, the first tag sequence may comprise a unique molecular identification region. For example, the unique molecular identification region may comprise a single-stranded nucleic acid. For example, the single-stranded nucleic acid in the unique molecular identification region may comprise 1 nucleotide or more, 2 nucleotides or more, 3 nucleotides or more, or 4 nucleotides or more, 5 nucleotides or more, 6 nucleotides or more, 7 nucleotides or more, or 8 nucleotides or more, 9 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, or 20 nucleotides or more. For example, the single-stranded nucleic acid in the unique molecular identification region may comprise 8 nucleotides. In the present application, the first tag sequence may comprise a sequencing primer.

[0257] In the present application, upon second processing, the probe in the second region may form a complex with a second tag sequence and an oligonucleotide adaptor.

[0258] In the present application, the second tag sequence can comprise at least one barcode and the first binding domain of the adaptor.For example, during the second processing, the nucleic acid sequence in the probe binding domain is complementary to the nucleic acid sequence in the first binding domain of the adaptor in the probe in the second region, and the nucleic acid sequence in the tag binding domain is complementary to the nucleic acid sequence in the second binding domain of the adaptor in the second tag sequence, thus forming a partially double-stranded structure.

[0259] For example, the double-stranded structure does not exclude the possibility of mismatch between bases. For example, the tag-binding domain or the probe-binding domain does not need to be 100% complementary to its complementary sequence. For example, the complementarity can be 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more. The remaining non-complementary nucleotides can be clustered or interspersed with complementary nucleotides and do not need to be adjacent to each other or to complementary nucleotides. For example, a polynucleotide can hybridize on one or more segments such that the intermediate or adjacent segments are not involved in the hybridization event (e.g., the formation of a hairpin structure, "bumps", etc.).

[0260] For example, the second binding domain of the adaptor in the second tag sequence can be ligated by a ligase to the first binding domain of the adaptor in the probe in the second region, thereby producing a probe attached to the second tag sequence.

[0261] For example, the ligase may include DNA ligases such as Escherichia coli DNA ligase, T4 DNA ligase, T7 DNA ligase, mammalian ligases (e.g., DNA ligase I, DNA ligase III, DNA ligase IV), thermostable ligases, etc. T4 DNA ligase may ligate segments containing DNA, oligonucleotides, RNA, and RNA-DNA hybrids. Ligation may not involve DNA ligase, but uses alternatives such as topoisomerase. Rapid ligation may be achieved by using high concentrations of DNA ligase along with the inclusion of PEG. To select the optimal temperature for ligation, one may consider the preferred temperature of the DNA ligase (which may be, for example, 37° C.) and the melting temperature of the DNA to be ligated. To minimize ionization that may affect ligation, the target nucleic acid and the barcoded solid support may be suspended in an appropriate buffer. For example, the ligase may include T4 ligase.

[0262] In the present application, the barcode in the second tag sequence can characterize the spatial location information of the second region.For example, the second tag sequence can include multiple barcodes.For example, the multiple barcodes in the second tag sequence can be different.

[0263] In the present application, the second tag sequence can include a unique molecular identification region. For example, the unique molecular identification region can include a single-stranded nucleic acid. For example, the single-stranded nucleic acid in the unique molecular identification region can include 1 nucleotide or more, 2 nucleotides or more, 3 nucleotides or more, or 4 nucleotides or more, 5 nucleotides or more, 6 nucleotides or more, 7 nucleotides or more, or 8 nucleotides or more, 9 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, or 20 nucleotides or more. For example, the single-stranded nucleic acid in the unique molecular identification region can include 8 nucleotides. In the present application, the second tag sequence can include a sequencing primer.

[0264] In the present application, more than one area of ​​the sample can be treated. For example, upon processing, a probe in the third region, fourth region, fifth region, sixth region, seventh region, eighth region, ninth region, tenth region, eleventh region, twelfth region, thirteenth region, fourteenth region, fifteenth region, sixteenth region, seventeenth region, eighteenth region, nineteenth region, twentieth region in a sample may form a complex with the third tag sequence, fourth tag sequence, fifth tag sequence, sixth tag sequence, seventh tag sequence, eighth tag sequence, ninth tag sequence, tenth tag sequence, eleventh tag sequence, twelfth tag sequence, thirteenth tag sequence, fourteenth tag sequence, fifteenth tag sequence, sixteenth tag sequence, seventeenth tag sequence, eighteenth tag sequence, nineteenth tag sequence, twentieth tag sequence and an oligonucleotide adaptor.

[0265] Upon processing, the nucleic acid sequence in the probe binding domain in the oligonucleotide adaptor is complementary to the nucleic acid sequence in the first binding domain of the adaptor in the probe in the second region, the third region, the fourth region, the fifth region, the sixth region, the seventh region, the eighth region, the ninth region, the tenth region, the eleventh region, the twelfth region, the thirteenth region, the fourteenth region, the fifteenth region, the sixteenth region, the seventeenth region, the eighteenth region, the nineteenth region, the twentieth ... is complementary to a nucleic acid sequence in the second binding domain of the adaptor in the second tag sequence, the third tag sequence, the fourth tag sequence, the fifth tag sequence, the sixth tag sequence, the seventh tag sequence, the eighth tag sequence, the ninth tag sequence, the tenth tag sequence, the eleventh tag sequence, the twelfth tag sequence, the thirteenth tag sequence, the fourteenth tag sequence, the fifteenth tag sequence, the sixteenth tag sequence, the seventeenth tag sequence, the eighteenth tag sequence, the nineteenth tag sequence, the twentieth tag sequence, and thereby forms a partially double-stranded structure.

[0266] For example, the double-stranded structure does not exclude the possibility of mismatch between bases. For example, the tag-binding domain or the probe-binding domain does not need to be 100% complementary to its complementary sequence. For example, the complementarity can be 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more. The remaining non-complementary nucleotides can be clustered or interspersed with complementary nucleotides and do not need to be adjacent to each other or to complementary nucleotides. For example, a polynucleotide can hybridize on one or more segments such that the intermediate or adjacent segments are not involved in the hybridization event (e.g., the formation of a hairpin structure, "bumps", etc.).

[0267] Compositions and Kits The present application also provides a combination comprising: a plurality of probes, each of the probes comprising a target molecule binding domain, a first binding domain of an adaptor, and at least one reaction-blocking modification; an oligonucleotide adaptor comprising a probe-binding domain and a tag-binding domain; and a plurality of tag sequences, each of the tag sequences comprising at least one barcode and a second binding domain of the adaptor, wherein the nucleic acid sequence in the probe-binding domain is complementary to the nucleic acid sequence in the first binding domain of the adaptor, and the nucleic acid sequence in the tag-binding domain is complementary to the nucleic acid sequence in the second binding domain of the adaptor. For example, the barcodes in two or more of the plurality of tag sequences can be different. For example, the reaction-blocking modification can be selected from the group consisting of a releasable, base-modified group, a cleavable linker, and a photolabile group. For example, the reaction-blocking modification can be a cleavable linker. For example, the reaction-blocking modification can be a releasable, base-modified group. For example, the combination can be a composition.

[0268] The present application also provides a kit that may include the combination of the present application. For example, the kit may further include a transposase. For example, the kit may further include at least one of a nucleic acid amplification agent, a reverse transcriptase, a fixation agent, a permeabilization agent, a ligation agent, and a lysis agent. For example, the kit may also include instructions for use. For example, the instructions for use may include the following methods: contacting at least one target molecule in a sample with at least one probe under conditions that allow the probe to specifically bind to the target molecule, the probe containing a target molecule binding domain capable of specifically binding to the target molecule and at least one reaction-blocking modification; performing a first treatment on a first region of the sample, the first treatment being capable of at least partially removing a reaction-blocking modification on a probe in the first region to attach the probe in the first region to a first tag sequence in the tag sequences; performing a second treatment on a second region in the sample that is different from the first region, the second treatment being capable of at least partially removing a reaction-blocking modification on the probe in the second region to attach the probe in the second region to a second tag sequence in the tag sequences, the second tag sequence being different from the first tag sequence; determining the composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence, and from the composition of the probes, determining the presence and / or content of the target molecule in the first region and the presence and / or content of the target molecule in the second region in the sample; Please write:

[0269] Without being limited by any theory, the following examples are intended to illustrate the compositions, kits, analytical methods and uses of the present application, but are not intended to limit the scope of the invention.

[0270] example Example 1. Transcriptome detection 1.1. Design of probes containing reaction-blocking modifications (1) Probes containing cleavable linkers (PC linkers) Probe structure: 5'PC-linker-first binding domain of adapter-UMI-polyT Probe sequence: 5' PC-Linker-AGGCCAGAGCATTCG (SEQ ID NO:1) NNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT wherein the sequence of the first binding domain of the adaptor is AGGCCAGAGCATTCG (SEQ ID NO:1) and the UMI is NNNNNNNN. (2) Design of probes containing NPOM protecting groups Probe sequence: p-AGGCCAGAGCA(NPOM-T)(NPOM-T)CG(SEQ ID NO: 1)NNNNNNNNTTTTTTTTTTTTTTTTTTTTTT

[0271] 1.2 Tag sequence and oligonucleotide adapter design (1) Tag sequence The tag sequence has the structure of amplification primer recognition region-6 base pair barcode-adapter second binding domain Specific composition of tag sequences: CCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 3) - 6 base pair barcode - ATCCACGTGCTTGAG (SEQ ID NO: 2) A six base pair barcode is used to distinguish different regions on the slice, which can be any combination of bases, which can be A, T, C, and G. The second binding domain of the adapter is ATCCACGTGCTTGAG (SEQ ID NO:2) and the amplification primer recognition region is CCCTACACGACGCTCTTCCGATCT (SEQ ID NO:3). (2) Oligonucleotide Adapter CGAATGCTCTGGCCTCTCAAGCACGTGGAT (SEQ ID NO: 4) (3) After annealing, the exemplary tag sequence and oligonucleotide adapter can form a partially double-stranded structure I, as shown below. [ka]

[0272] (1.3) Sample preparation (1) Specimen type: formalin-fixed paraffin sections or formaldehyde-fixed frozen sections. (2) The fixed sections were subjected to antigen unmasking treatment: first, the samples were treated with Abcam antigen unmasking solution or other buffer at 100°C for 5 min, then digested with a PBS-diluted solution of proteinase K or pepsin (with a concentration of 1 mg / ml) at 37°C for 10-30 min, and finally washed with PBS.

[0273] 1.4. Reverse transcription reaction was carried out using a reaction system containing 1x reverse transcription buffer, 1μM dNTP, 2μM reverse transcription primer, 2μM reverse transcription primer, 1% Triton, 1% BSA and 2u / μl reverse transcriptase. The amount of the above reagents is related to the sample size. When the tissue section was 1cm×1cm in size, the reaction system was about 50μl of solution.

[0274] They were reacted at 72°C for 5 minutes and 4°C for 10 minutes, then left at 42°C for 1 hour.

[0275] 1.5 Antibody staining (1) One or more antibodies were diluted to a concentration of 1 μg / 100 μl in 1× PBS buffer containing 1% BSA. (2) Primary antibody binding: The antibody solution was reacted with the sections at 25° C. for 1 hour or at 4° C. overnight. (3) The sections were washed with 1×PBS buffer containing 1% BSA. (4) Secondary antibody binding: The secondary antibody was diluted with 1×PBS buffer containing 1% BSA and reacted with the sections at room temperature for 1 hour. (5) The sections were washed with 1x PBS buffer containing 1% BSA.

[0276] 1.6 Microscopic observation: The area of ​​interest within the section was irradiated with 280 nm UV excitation light for 10 seconds to 5 minutes.

[0277] 1.7 The sections were washed with 1x PBS buffer containing 1% BSA.

[0278] 1.8 1x T4 ligase buffer, 1μM tag sequence and 1μl / μl T4 DNA ligase were added to the sections and reacted at room temperature for 15 minutes.Then, the sections were washed with 1x PBS buffer containing 1% BSA to remove the tag sequence.

[0279] 1.9 The next region of interest is irradiated and steps 1.6-1.8 above are repeated so that different regions of interest on the section are labeled with different tag sequences.

[0280] 1.10 After completion of all reactions, the sections were digested with a dilute solution of proteinase K (having a concentration of 20 μg / ml) in 1×PBS containing 1% SDS at 65° C. for 1 hour.

[0281] 1.11 Then, the cDNA was purified with magnetic beads and double strand synthesis was carried out in a reaction system containing digested cDNA, 1x reverse transcription buffer, 1μM strand conversion primer, 1μM dNTP and 1u / μl reverse transcriptase. The amount of the above reagents is related to the sample size. If the tissue section was 1cm×1cm in size, the reaction system was about 50μl of solution.

[0282] Here, the strand conversion primer is AAGCAGTGGTATCAACGCAGAGTACATGGG (SEQ ID NO: 14).

[0283] After reacting at 42°C for 1 hour, the cDNA was purified with magnetic beads, and then PCR amplification was carried out in a PCR amplification system containing 1 μM primer 1, 1 μM primer 2, 1×Taq buffer, 1 μM dNTPs, and 1 u / μl Taq enzyme. The sequence of primer 1 is AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO: 5), and the sequence of primer 2 is CCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 3). The amount of the above reagents is related to the sample size. When the tissue section was 1 cm×1 cm in size, the amplification system was about 50 μl of solution.

[0284] After thorough mixing, the PCR reaction was carried out. 95℃ 3 minutes 95℃ 30 seconds 55℃ 30 seconds 72℃ 3 minutes Repeat the above process 20 to 30 times. 72℃ 5 minutes

[0285] 1.12 cDNA was purified and a library was constructed using the Illumina Nextera kit. (1) The Illumina Nextera reaction system contains 1 ng of cDNA, 1× Nextera buffer, and 1 μl of Nextera enzyme. The reaction volume is 20 μl. The reaction was carried out at 55°C for 7 minutes. (2) The reaction product was subjected to PCR amplification in a reaction system containing the reaction product in (1) above, 1 μM primer 3, 1 μM Illumina N70x primer, 1x Taq buffer, 1 μM dNTPs and 1 u / μl Taq enzyme. Here, primer 3 is CCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 3). The reaction volume is 20 μl. After thorough mixing, the PCR reaction was carried out. 95℃ 3 minutes 95℃ 30 seconds 55℃ 30 seconds 72℃ 3 minutes Repeat the above process 20 to 30 times. 72℃ 5 minutes (3) Sequencing of the purified library (4) According to the barcode in the tag sequence, it is determined which light-treated region of interest the final sequencing product comes from.

[0286] Example 2. Non-reverse transcription-based detection of the transcriptome 2.1 Primer design Primers were designed by primer design programs well known in the art (e.g., primer 3). In the transcriptome gene model of the target species, target genes were selected, and 10 pairs of primers were designed for each gene. For adjacent positions in the gene, upstream and downstream primers with a length of 25 base pairs were designed, respectively, to ensure their specificity.

[0287] Examples: Upstream primer of each pair of primers: ATCCACGTGCTTGAG (SEQ ID NO:2)-UMI-probe sequence Downstream primer of each pair of primers: Probe-AGATCGGAAGAGCACACGTCTG (SEQ ID NO: 9) Here, the sequence of UMIs is nnnnnnnn (random sequence).

[0288] (1) Synthesis of upstream primer First, probe primer sets were synthesized in parallel by Twist Bioscience. The sequences of the probe primer set are: ATCCACGTGCTTGAG (SEQ ID NO: 2)-nnnnnnnn-probe-GATCACTCTGCGTTGATACCAC (SEQ ID NO: 15). The upstream primer library was amplified by PCR using primers as shown below. Primer 4: Biotin-ATCCACGTGCTTGAG (SEQ ID NO:2) Primer 5: GTGGTATCAACGCAGAGTGATC (SEQ ID NO: 6) The PCR product was then purified and digested with DpnII enzyme to remove sequences downstream of the probe. This is then bound to streptavidin (simply SA) magnetic beads, the sequence of which is shown below: Magnetic beads-SA-Biotin-ATCCACGTGCTTGAG (SEQ ID NO: 2) nnnnnnnn-Probe- It was then denatured with 0.1 M NaOH to remove the PCR complementary strand. This was then heated to 100° C. to release the forward probe primer bound to the streptavidin magnetic beads. Biotin-ATCCACGTGCTTGAG (SEQ ID NO: 2) nnnnnnnn-probe- (2) Synthesis of downstream primer Probe primer sets were synthesized in parallel by Twist Bioscience. The sequences of the probe primer set are: CTTCCGATCTGGTCTCG (SEQ ID NO: 7)-Probe-AGATCGGAAGAGCACACGTCTG (SEQ ID NO: 9). The library of downstream primers was amplified by PCR using primers as shown below. Primer 6: Biotin-CTTCCGATCTGGTCTCG (SEQ ID NO: 7) Primer 7: Biotin-CAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 8) The PCR products were bound to streptavidin magnetic beads and excess primer sequences were removed by digestion with BsaI-HF enzyme. It was then denatured by heating at 95° C. to give the final primers as shown below. Probe - AGATCGGAAGAGCACACGTCTG (SEQ ID NO: 9) (3) Preparation of probes containing cleavable linkers (PC linkers) As in Example 1, a cleavable linker was ligated to the 5' end of the probe. (4) Preparation of probes containing NPOM protecting groups As in Example 1, an NPOM protecting group was ligated to the 5' end of the probe.

[0289] 2.2 Sample preparation and hybridization of probes to samples (1) First, tissue sections were fixed with 4% formaldehyde in PBS at room temperature for 10 minutes, and then the cells were dehydrated and stored in 100% ethanol at -20°C. (2) A hybridization solution was then formulated using the following components: 10% formamide + 2x sodium citrate buffer (SSC) + 10% dextran sulfate. (3) The tissue sections were prehybridized in hybridization solution at 42° C. for 1 hour. (4) The upstream primer pool and the downstream primer pool were added to the tissue sections at a total concentration of 10 μM. (5) They were then hybridized at 42°C for 12 to 24 hours. (6) The tissue sections were washed twice with hybridization solution. (7) The tissue sections were further washed twice with PBS containing 1% BSA. (8) This was ligated with T4 ligase at room temperature for 1 hour. (9) The tissue sections were further washed twice with PBS containing 1% BSA.

[0290] 2.3 Antibody staining (1) One or more antibodies were diluted to a concentration of 1 μg / 100 μl in 1× PBS buffer containing 1% BSA. (2) Primary antibody binding: The antibody solution was reacted with the sections at 25° C. for 1 hour or at 4° C. overnight. (3) The sections were washed with 1×PBS buffer containing 1% BSA. (4) Secondary antibody binding: The secondary antibody was diluted with 1×PBS buffer containing 1% BSA and reacted with the sections at room temperature for 1 hour. (5) The sections were washed with 1x PBS buffer containing 1% BSA.

[0291] 2.4 Microscopic observation: The area of ​​interest within the section was irradiated with 280 nm UV excitation light for 10 seconds to 5 minutes.

[0292] 2.5 The sections were washed with 1x PBS buffer containing 1% BSA.

[0293] 2.6 1x T4 ligase buffer, 1μM tag sequence and 1μl / μl T4 DNA ligase were added to the sections and reacted at room temperature for 15 minutes.Then, the sections were washed with 1x PBS buffer containing 1% BSA to remove the tag sequence.

[0294] 2.7 The next region of interest is irradiated and steps 2.4-2.6 above are repeated so that different regions of interest on the section are labeled with different tag sequences.

[0295] 2.8 After completion of all reactions, the sections were digested with a dilute solution of proteinase K (having a concentration of 20 μg / ml) in 1×PBS containing 1% SDS at 65° C. for 1 hour.

[0296] 2.9. Library construction and sequencing.

[0297] Example 3: Epigenetic analysis 3.1. Design of probes containing reaction-blocking modifications (1) Probes containing cleavable linkers (PC linkers) Probes for epigenomic analysis: 5'PC-Linker-AGGCCAGAGCATTCGAGATGTGTATAAGAGACAG (SEQ ID NO: 10) (2) Design of probes containing NPOM protecting groups p-AGGCCAGAGCA(NPOM-T)(NPOM-T)CGAGATGTGTATAAGAGACAG(SEQ ID NO: 10)

[0298] 3.2 The above primer was annealed with the Tn5M primer 5'-P-CTGTCTCTTATACACATCT (SEQ ID NO: 12) to form a double strand.

[0299] 3.3 Tn5B primer The Tn5B primer was GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 11), and the Tn5B primer was annealed to the Tn5M primer 5'-P-CTGTCTCTTATACACATCT (SEQ ID NO: 12) to form a double strand.

[0300] 3.4 Equal amounts of the protected Tn5 transposons and Tn5B transposons were mixed together and further mixed with an equal molar amount of Tn5 protein to assemble the Tn5 enzyme.

[0301] 3.5 Formaldehyde-fixed frozen sections were prepared and the tissues were permeabilized with 0.1% Trion 10 mM Tris buffer.

[0302] 3.6 1×TD buffer (obtained from Illumina Nextera kit) and 5 μM Tn5 enzyme assembled in the above step were added to the sections, and the sections were subjected to ATAC reaction at 37°C for 1 hour.

[0303] 3.7 The sections were washed with 1x PBS buffer containing 1% BSA to remove unreacted Tn5 enzyme.

[0304] 3.8 Microscopic observation of sections: The area of ​​interest within the section was irradiated with 280 nm UV excitation light for 10 seconds to 5 minutes.

[0305] 3.9 The sections were washed with 1x PBS buffer containing 1% BSA.

[0306] 3.10 1x T4 ligase buffer, 1μM tag sequence and 1μl / μl T4 DNA ligase were added to the sections and reacted at room temperature for 15 minutes.Then, the sections were washed with 1x PBS buffer containing 1% BSA to remove the tag sequence.

[0307] 3.11 The next region of interest is illuminated and steps 3.8-3.10 above are repeated so that different regions of interest on the section are labeled with different tag sequences.

[0308] 3.12 After completion of all reactions, the sections were digested with a dilute solution of proteinase K (having a concentration of 20 μg / ml) in 1×PBS containing 1% SDS at 65° C. for 1 hour.

[0309] 3.13 DNA was purified with magnetic beads and then amplified in an amplification system containing the above reaction product, 1 μM primer 5, 1 μM Illumina N70x primer, 1×Taq buffer, 1 μM dNTP and 1 u / μl Taq enzyme. The sequence of primer 8 is CCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 3). The amount of the above reagents is related to the sample size. When the tissue section was 1 cm×1 cm in size, the amplification system was about 50 μl of solution.

[0310] After thorough mixing, amplification was carried out. 72c 5 minutes 95c 3 minutes 95c 30 seconds 55c 30 seconds 72c 3 minutes Repeat the above process 20-30 times 72c 5 minutes

[0311] 3.14 Sequencing of purified libraries

[0312] 3.15 According to the barcode in the tag sequence, it is determined which light-treated region of interest the final sequencing product comes from.

[0313] Example 4. Multi-omics detection of proteins 4.1 The following structures were conjugated to antibodies: Antibody probe: AGGCCAGAGCATTCG (SEQ ID NO: 1) NNNNNNNN-barcode-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC (SEQ ID NO: 13) Here, the 5' end sequence of the antibody probe is the sequence of the first binding domain of the adaptor, AGGCCAGAGCATTCG (SEQ ID NO: 1), and the 3' end sequence of the antibody probe is CTGTCTCTTATACACATCTCCGAGCCCACGAGAC (SEQ ID NO: 13).

[0314] 4.2 A cleavable linker or an NPOM protecting group was linked to the 5' end of the antibody probe as in Example 1. Barcodes were used to distinguish different antibodies.

[0315] 4.3 The 3' end of the antibody probe has an amino modification, which can be coupled to the target antibody by a common antibody oligo coupling kit.

[0316] 4.4 Antibody binding: Same as step 2.3 in Example 2.

[0317] 4.5 In constructing the libraries, an additional purification step was added, i.e., after protease digestion of the whole tissue section, the oligo portions of the antibodies (less than 100 bp) were obtained by magnetic bead purification and amplified, while the portions with a length of more than 100 bp were subjected to conventional cDNA or Tn5 amplification.

[0318] Example 5. Analyzing the results Different regions of mouse tissue were detected. Figure 2 shows different regions of mouse tissue such as the eye and epithelium.

[0319] The transcriptome identification results for region 1 (eye) and region 2 (epithelium) of the mouse tissue in FIG. 2 are shown in the table below. [Table 1]

[0320] Figure 3 shows gene expression results for region 1 (eye) of the mouse tissue in Figure 2. The results show that the method of the present application can identify eye-specific gene expression in region 1 (eye).

[0321] The following table shows gene expression results for region 2 (epithelium) of the mouse tissue in Figure 2. The results show that the method of the present application can identify epithelial-specific gene expression in region 2 (epithelium). [Table 2]

[0322] Figure 4 shows the results of ATAC-omics analysis for region 1 (eye) and region 2 (epithelium) of mouse tissues in Figure 2. The results show that the genomic distribution of the sequenced fragments shows a typical ATAC signal pattern, i.e., the sequenced fragments were mainly distributed around the transcription start site and showed peak values.

[0323] After fixing the tissue in Figure 2, the tissue was stained with an oligo-conjugated antibody Actin1 against actin, and then subjected to the protein quantitative labeling experiment of the present application. The obtained results are shown in the following table. [Table 3]

[0324] Actin is known to be highly expressed in epithelial tissues but lowly expressed in the eye, and the number of molecules obtained by sequencing is consistent with this.

[0325] The above results demonstrate that the method of the present application can simultaneously detect various omics information.

[0326] The foregoing detailed description has been provided by way of illustration and example, and is not intended to limit the scope of the appended claims. Various modifications of the embodiments recited herein will be apparent to those skilled in the art and are intended to fall within the scope of the appended claims and their equivalents. [Sequence List Free Text]

[0327] Sequence Listing 1 <223> First binding domain of the adaptor Sequence Listing 2 <223> Second binding domain of the adapter; primer 4 Sequence Listing 3 <223> Amplification primer recognition sequences: primer 2; primer 3, primer 8 Sequence Listing 4 <223> Oligonucleotide Adapters Sequence Listing 5 <223> Primer 1 Sequence Listing 6 <223> Primer 5 Sequence Listing 7 <223> Primer 6 Sequence Listing 8 <223> Primer 7 Sequence Listing 9 <223> probe Sequence Listing 10 <223> Probes for epigenetic analysis Sequence Listing 11 <223> Tn5B primer Sequence Listing 12 <223> Tn5M primer Sequence Listing 13 <223> 3′ end sequence of antibody probe Sequence Listing 14 <223> Strand conversion primer Sequence Listing 15 <223> Downstream sequence

Claims

1. contacting at least one target molecule in a sample with at least one probe under conditions that allow the probe to specifically bind to the target molecule, said probe containing a target molecule binding domain capable of specifically binding to said target molecule and at least one reaction-blocking modification; performing a first treatment on a first region of the sample, the first treatment being capable of at least partially removing the reaction-blocking modifications on the probes in the first region and attaching the probes in the first region to a first tag sequence; performing a second treatment on a second region in the sample that is distinct from the first region, the second treatment being capable of at least partially removing the reaction-blocking modification on the probe in the second region and attaching the probe in the second region to a second tag sequence, the second tag sequence being distinct from the first tag sequence; determining a composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence, and determining from the composition of the probes the presence and / or content of the target molecule in the first region and the presence and / or content of the target molecule in the second region in the sample; A method comprising:

2. The method of claim 1 , wherein the sample comprises a tissue section.

3. The method of claim 2 , wherein the tissue section comprises a fixed tissue section.

4. 3. The method of claim 2, wherein the first region is a first region on the tissue section and the second region is a second region on the tissue section that does not substantially overlap with the first region.

5. The method of claim 1 , wherein the sample is a single cell.

6. The method of claim 5 , wherein the cells are fixed.

7. The method of claim 1 , wherein the target molecule comprises a protein, a nucleic acid molecule and / or a lipid.

8. The method of claim 1, wherein the reaction blocking modification on the probe in the first region or the reaction blocking modification on the probe in the second region is selected from the group consisting of a releasable, base-modified group, a cleavable linker and a photolabile group.

9. The method of claim 1, wherein the first treatment or the second treatment is selected from the group consisting of electron beam treatment, sonic waves and illumination.

10. 2. The method of claim 1, further comprising administering, after the first treatment, a first tag molecule containing a first tag sequence to the first region of the sample.

11. 2. The method of claim 1, further comprising administering, after the second treatment, a second tag molecule containing a second tag sequence to the second region of the sample.

12. 2. The method of claim 1, further comprising, during the first processing, the probe in the first region forming a complex with the first tag sequence and an oligonucleotide adaptor, the oligonucleotide adaptor comprising a probe-binding domain and a tag-binding domain.

13. 13. The method of claim 12, further comprising: during the first processing, a nucleic acid sequence in the probe binding domain is complementary to a nucleic acid sequence in the first binding domain of the adapter in the probe in the first region, and a nucleic acid sequence in the tag binding domain is complementary to a nucleic acid sequence in the second binding domain of the adapter in the first tag sequence, thereby forming a partially double-stranded structure.

14. 2. The method of claim 1, further comprising, during the second processing, the probe in the second region forming a complex with the second tag sequence and an oligonucleotide adaptor, the oligonucleotide adaptor comprising a probe-binding domain and a tag-binding domain.

15. 15. The method of claim 14, further comprising, during the second processing, a nucleic acid sequence in the probe binding domain is complementary to a nucleic acid sequence in the first binding domain of the adapter in the probe in the second region, and a nucleic acid sequence in the tag binding domain is complementary to a nucleic acid sequence in the second binding domain of the adapter in the second tag sequence, thereby forming a partially double-stranded structure.

16. The method of claim 1 , comprising performing in situ hybridization between at least one target molecule in the sample and at least one probe.

17. 17. The method of claim 16, comprising digesting the sample after the in situ hybridization to obtain the probe attached to the first tag sequence and the probe attached to the second tag sequence.

18. 2. The method of claim 1, comprising amplifying the resulting probe attached to the first tag sequence and the probe attached to the second tag sequence.

19. 20. The method of Claim 18, further comprising amplifying the resulting probe attached to the first tag sequence and the probe attached to the second tag sequence and then sequencing the probe attached to the first tag sequence and the probe attached to the second tag sequence to determine a composition of the probe attached to the first tag sequence and the probe attached to the second tag sequence.

20. A combination comprising: (1) a plurality of probes, each of the probes comprising a target molecule binding domain, a first binding domain of an adapter, and at least one reaction-blocking modification; (2) an oligonucleotide adapter comprising a probe binding domain and a tag binding domain; and (3) a plurality of tag sequences, each of the tag sequences comprising at least one barcode and a second binding domain of an adapter, wherein a nucleic acid sequence in the probe binding domain is complementary to a nucleic acid sequence in the first binding domain of the adapter, and a nucleic acid sequence in the tag binding domain is complementary to a nucleic acid sequence in the second binding domain of the adapter.

21. A kit comprising the combination of claim 20.

Images