Methods for selecting watermelon plants and plant parts containing a modified DWARF14 gene

Abstract

The present invention relates to a genotyping method for a gene designated DWARF14 in watermelon, cucumber or melon, which when mutated confers an increased secondary branching phenotype. Also provided herein are plants containing modifications in the DWARF14 gene.

Description

[Technical field]

[0001] The present invention relates to the identification of a modified (or mutated) gene in watermelon and a method for generating and / or selecting plants and plant parts containing modified (or mutated) alleles of this gene or wild-type alleles of this gene. This gene is called DWARF14, or ClDWARF14, or ClD14, because the wild-type gene is presumed to be an orthologue of the Arabidopsis thaliana AtDWARF14 (AtD14) gene. In normal watermelon plants, the wild-type ClD14 gene is found on chromosome 8 and encodes a ClD14 protein of 267 amino acids. A modified allele of this gene was found in a multibranched watermelon plant, which contained a duplication of 8 amino acids, thus resulting in a protein of 275 amino acids (see FIG. 1). Plants homozygous for this modified allele of the ClD14 gene have a multibranched phenotype, with the average number of secondary branches being 45 or more secondary branches. In contrast, watermelon plants that are heterozygous for the modified allele or homozygous for the wild-type allele have a normal branching phenotype, with the average number of secondary branches being significantly less than 45, e.g., averaging less than about 30 secondary branches, e.g., about 20 secondary branches. [Background technology]

[0002] Other Cucurbitaceae, such as melon and cucumber, also contain genes encoding D14 proteins with high sequence identity to the watermelon ClD14 protein. These are referred to, for example, as CmD14 (Cucumis melo) or CsD14 (Cucumis sativus) genes and proteins. The watermelon, cucumber and melon genes and proteins are also referred to herein simply as D14 genes, D14 alleles or D14 proteins.

[0003] It was further unexpectedly found that the mutant allele containing the eight amino acid duplication actually encoded a non-functional ClD14 protein. This was unexpected, since the D14 protein is a complex protein that interacts with a variety of other proteins, and it was not expected that the eight amino acid duplication would completely eliminate protein function. When screening the watermelon TILLING population, the mutant allele that encoded a truncated non-functional protein (missing 113 of the 267 amino acids) unexpectedly resulted in the same multi-branching phenotype as the mutant allele containing the eight amino acid duplication. Both mutant alleles resulted in an average number of secondary branches that was about 240% compared to the average number of secondary branches in wild-type plants (set at 100% secondary branches). This strong phenotype caused by the non-functional protein is referred to herein as "strong multi-branching" or "complete multi-branching". Furthermore, this result allows the generation of mutant alleles that do not result in "complete multi-branching", but rather in "intermediate multi-branching", whereby the ClD14 protein has reduced function and not loss of function. Summary of the Invention [Means for solving the problem]

[0004] Thus, in one aspect, the present invention relates to watermelon plants that contain a mutant allele of the ClD14 gene that results in a non-functional ClD14 protein and complete multiple branching (when the mutant allele is homozygous), or that contain a mutant allele of the ClD14 gene that results in a reduced-functioning ClD14 protein and intermediate multiple branching (when the mutant allele is homozygous). Watermelon plants that contain a mutant allele that encodes a non-functional protein of SEQ ID NO:1 (ClD14ins) are not included in one aspect.

[0005] The invention in another aspect relates to a method for determining whether a Cucurbitaceae plant, in particular a watermelon, melon or cucumber plant or plant part, comprises a wild-type allele of the D14 gene and / or a mutant allele of the D14 gene. The wild-type allele of the D14 gene encodes the watermelon D14 protein of SEQ ID NO: 2 (or a protein with at least 95% sequence identity with SEQ ID NO: 2), the cucumber D14 protein of SEQ ID NO: 8 (or a protein with at least 95% sequence identity with SEQ ID NO: 8) or the melon protein of SEQ ID NO: 9 (or a protein with at least 95% sequence identity with SEQ ID NO: 9). In one aspect, the mutant allele is an allele encoding a duplication of amino acids 94 to 101 of SEQ ID NO: 2 (watermelon), SEQ ID NO: 8 (cucumber) or SEQ ID NO: 9 (melon). In another aspect, the mutant allele is an allele that encodes a protein that contains one or more amino acids that are inserted, duplicated, substituted or deleted compared to the wild-type protein of SEQ ID NO:2 (watermelon), SEQ ID NO:9 (melon) or SEQ ID NO:8 (cucumber), and is a reduced-function protein that results in intermediate multibranching when the allele is homozygous, or a non-functional protein that results in complete multibranching when the allele is homozygous.

[0006] Methods for detecting wild type or mutant alleles of the D14 gene are also provided, whereby either a primer pair or an oligonucleotide probe is used to amplify or detect the D14 allele in genomic DNA of watermelon, melon or cucumber. The oligonucleotide primer or probe comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides of SEQ ID NO: 5 or 6 (or the complementary DNA strand of either of these) or SEQ ID NO: 15 or 16 (or the complementary DNA strand of either of these). In particular, primer pairs are provided of at least one forward primer and one reverse primer that hybridize to and amplify a portion of the genomic D14 allele in a PCR reaction.

[0007] In another aspect, the method of generating and / or selecting a Cucurbitaceae plant, particularly a watermelon, melon or cucumber plant or plant part, comprises a mutant allele of the D14 gene. In one aspect, the mutant allele is an allele encoding a duplication of amino acids 94-101 of SEQ ID NO:2 (watermelon), SEQ ID NO:8 (cucumber) or SEQ ID NO:9 (melon). In another aspect, the mutant allele is an allele encoding a protein that includes one or more amino acids that are inserted, duplicated, substituted or deleted compared to the wild-type protein of SEQ ID NO:2 (watermelon), SEQ ID NO:9 (melon) or SEQ ID NO:8 (cucumber), and is a reduced function protein that results in intermediate polybranching when the allele is homozygous, or is a non-functional protein that results in complete polybranching when the allele is homozygous.

[0008] In one aspect, watermelon, cucumber or melon plants and plant parts comprising a mutant allele of the D14 gene are also provided. In one aspect, the mutant allele encodes a protein comprising a duplication of amino acids 94-101 of SEQ ID NO:2 (watermelon), SEQ ID NO:8 (cucumber) or SEQ ID NO:9 (melon). In another aspect, the mutant allele is an allele that encodes a protein comprising one or more amino acids inserted, duplicated, substituted or deleted compared to the wild type protein of SEQ ID NO:2 (watermelon), SEQ ID NO:9 (melon) or SEQ ID NO:8 (cucumber), and is a reduced function protein resulting in intermediate polybranching when the allele is homozygous, or a non-functional protein resulting in complete polybranching when the allele is homozygous.

[0009] In one aspect, a watermelon plant is provided that is heterozygous for a mutant allele of the ClD14 gene. In one aspect, the mutant allele encodes a protein comprising a duplication of amino acids 94-101 of SEQ ID NO:2 (watermelon). In another aspect, the mutant allele is an allele that encodes a protein comprising one or more amino acids inserted, duplicated, substituted or deleted compared to the wild-type protein of SEQ ID NO:2 (watermelon), SEQ ID NO:9 (melon) or SEQ ID NO:8 (cucumber), and is a reduced function protein resulting in intermediate polybranching when the allele is homozygous, or is a non-functional protein resulting in complete polybranching when the allele is homozygous.

[0010] US Pat. No. 7,314,979 B2 describes a recessive allele, called the HMBN allele, which in homozygotes increases secondary branching and reduces the average fruit weight to 0.87 kg.

[0011] WO 2006 / 060425 also describes a recessive allele called the HMBN allele. On page 15,

[0090] , the HMBN allele is described as "an unexpected mutant allele that arose from a watermelon breeding program."

[0012] US Patent Publication No. 2020093086 describes watermelon plants that produce small fruits weighing less than 0.9 kg due to a homozygous combination of an HMBN allele and a mutant ts gene allele on chromosome 2.

[0013] The gene and location of the HMBN allele are currently unknown, and as a result, the function of the gene is also unknown.

[0014] The gene for the HMBN allele has been identified herein and found to encode a ClD14 protein that contains a duplication of amino acids 94 to 101 of SEQ ID NO:2 (wild-type ClD14 protein). This mutant protein is shown in SEQ ID NO:1 and is also referred to herein as ClD14ins (for "insertion").

[0015] The wild-type protein ClD14 (SEQ ID NO:2) is believed to be an ortholog of the Arabidopsis DWARF14 protein. AtDWARF14 is a protein that has been shown to have dual functions in strigolactone signaling and strigolactone hydrolysis in Arabidopsis, since mutants have been generated that affect both of these functions. See Seto et al. (2019, Nature Communications 10:191, Strigolactone perception and deactivation by a hydrolase receptor DWARF14). In this publication, the authors describe in Figure 5 a model of the involvement of the Arabidopsis DWARF14 (AtD14) protein in the strigolactone signaling pathway and hydrolysis. Bioactive strigolactone molecules are perceived by the AtD14 protein, inducing a conformational change in the AtD14 protein leading to the formation of a protein complex with other signaling proteins (such as D53). Signaling leads, for example, to the inhibition of branch formation. After signaling, the AtD14 protein changes back to its original conformation and hydrolyzes the strigolactone molecule. Thus, AtD14 is involved in both signaling, for example inhibiting branch formation, and homeostasis of strigolactone levels in plants. The AtD14 protein contains three amino acids called the "catalytic triad", namely S97 (serine 97), D218 (asparagine 218) and H247 (histidine 247). These are shown in FIG. 2 for the corresponding amino acids in the Arabidopsis D14 protein and the modified watermelon ClD14 protein.

[0016] The watermelon protein of SEQ ID NO:1 (ClD14ins), identified as underlying the multibranching phenotype (caused by the HMBN allele), was found to contain a duplication of eight amino acids. The duplication includes one of the amino acids of the catalytic triad, namely S97, which is duplicated, as seen in Figure 2. S97 in the AtD14 protein appears to be located on the surface of the protein and is likely involved in ligand binding.

[0017] First, without being bound by any theory, it is speculated by the applicants that the duplication of eight amino acids in the ClD14 protein may alter the ClD14 structure to reduce or prevent interactions with other proteins / ligands, or alter the ClD14 structure such that the binding pocket for strigolactone molecules is affected, thereby reducing or preventing signal transduction.

[0018] However, further analysis unexpectedly revealed that the effect of the eight amino acid duplication was that the ClD14ins protein was non-functional in vivo and unable to perform its signaling role in watermelon. Thus, the phenotype seen when the mutant allele is homozygous is the most extreme secondary branching, referred to herein as "complete polybranching" or "strong polybranching". This is because the codon for amino acid W155 is replaced by a stop codon (W155 STOP or W155 * ), resulting in a truncated protein containing only amino acids 1-154 of SEQ ID NO:2. * The protein should be non-functional since it is missing 113 amino acids from the wild-type protein. * The effect on (average) secondary branch formation in plants homozygous for was the same as that seen in plants containing the mutant allele encoding the ClD14ins protein. See Examples.

[0019] Thus, unexpectedly, it was found that the ClD14ins protein (containing the eight amino acid duplication) is non-functional in vivo, i.e., it has lost its function in the strigolactone signaling pathway and no longer transmits any signal, thereby inducing inhibition of secondary branching and resulting in maximal expression of the multibranching phenotype.

[0020] Watermelon plants are grown for fruit production that is either diploid (2n), which produces seeded fruits after pollination of female flowers with pollen from male flowers, or triploid (3n), which produces seedless fruits after pollination of female flowers with pollen from another watermelon plant (called the seed plant) (because the flowers of triploid plants do not produce fertile pollen).

[0021] The HMBN allele has been used to generate pollinator plants that contain the HMBN allele in homozygotes and have a multibranching phenotype. One of these pollinators is the Sidekick cultivar (Harris Moran, see hmclause.com / wp-content / uploads / 2014 / 11 / USACANADA_Watermelon_Sidekick_Techsheet_2014_ENG.pdf on the World Wide Web). Sidekick is a non-harvestable pollinator because the seeded fruit has pink flesh and is discarded.

[0022] Commercially available pollinators can be differentiated as being harvestable or non-harvestable pollinators (see also McGregor and Waters 2014, supra). Harvestable pollinators are diploid pollinators that produce marketable seeded fruits after pollination of female flowers. Non-harvestable pollinators are diploid pollinators that produce agronomically undesirable fruits after pollination of female flowers, such as fruits with white flesh or brittle skin. Thus, growers may choose to produce triploid, seedless fruits and diploid, seeded fruits in one field, or to produce only triploid, seedless fruits and discard the diploid, seeded fruits of the pollinators. Obviously, pollinators take up a lot of space in the field that could otherwise be occupied by triploid plants, and for this reason some pollinators have been developed that produce small plants.

[0023] The inventors have discovered that the single recessive gene present in Sidekick and underlying the Sidekick multibranching phenotype encodes a protein that contains an eight amino acid overlap compared to the wild-type protein of SEQ ID NO:2. The modified (or mutant) protein is included herein as SEQ ID NO:1. An alignment of the wild-type and mutant proteins is shown in FIG. 1 ("D14Ins" is the mutant protein of SEQ ID NO:1 and "WT" is the wild-type protein of SEQ ID NO:2). Thus, the genomic DNA and cDNA / mRNA of the mutant ClD14 gene (shown in SEQ ID NO:5 and SEQ ID NO:3) contain an overlap of 24 nucleotides compared to the wild-type genomic DNA and cDNA / mRNA (shown in SEQ ID NO:6 and SEQ ID NO:4).

[0024] The inventors further discovered that the Sidekick multibranching phenotype is non-functional in vivo due to the protein containing a duplication of eight amino acids compared to the wild-type protein of SEQ ID NO:2, and that the phenotype is "fully multibranched", i.e., there is no signaling that inhibits secondary branching from occurring. Thus, for the first time, the inventors are not only able to create a variety of mutant alleles (different from those present in Sidekick) that result in full multibranching when the mutant alleles are homozygous, but also to create mutant alleles that retain function in vivo, but have reduced function compared to the wild-type protein, and result in milder or intermediate multibranching when the mutant alleles are homozygous.

[0025] BLAST analysis identified corresponding proteins in cucumber (CsD14) and melon (CmD14), which have very high sequence identity to each other (using Emboss Needle pairwise alignment, default parameters), as shown in Table 1 below.

[0026] [Table 1]

[0027] Given the high protein sequence identity, the in vivo functions of the watermelon, cucumber and melon D14 proteins are expected to be the same.

[0028] Correspondingly, the duplication of amino acids 94-101 in ClD14 (SEQ ID NO:2), CsD14 (SEQ ID NO:8) and CmD14 (SEQ ID NO:9) should therefore cause the homozygotes to form many more secondary branches ("full multi-branching") than plants homozygous for the wild-type allele encoding the wild-type protein. Similarly, other mutant alleles resulting in loss of function of the D14 protein should result in "full multi-branching" and mutant alleles resulting in reduced function of the D14 protein should result in "intermediate multi-branching". Figure 3 shows a multiple sequence alignment of the mutant watermelon ClD14 protein (SEQ ID NO:1, ClD14ins in Figure 3) and the wild-type cucumber and melon proteins.

[0029] In one aspect, encompassed herein are these mutant alleles, as well as plants and plant parts (such as fruits) that contain these mutant alleles in homozygous or heterozygous form.

[0030] Thus, encompassed herein are any mutant alleles in the ClD14, CsD14 or CmD14 gene and plants comprising such mutant alleles, particularly mutant alleles in which one or more amino acids are inserted, deleted, duplicated or substituted compared to the wild-type protein of SEQ ID NO:2 (watermelon ClD14), SEQ ID NO:8 (cucumber CsD14) or SEQ ID NO:9 (melon CmD14). In one aspect, the insertion, deletion, duplication or substitution of one or more amino acids results in the encoded protein being a reduced or loss-of-function D14 protein in vivo. In one aspect, the mutant allele encodes a protein comprising a duplication of at least 1, 2, 3, 4, 5, 6, 7 or all 8 amino acids from amino acids 94 to 101 of SEQ ID NO:2, SEQ ID NO:8 or SEQ ID NO:9. In one aspect, at least the Ser (S) at position 97 of ClD14, CsD14 or CmD14 is duplicated.

[0031] Further methods for generating mutant alleles in the ClD14, CsD14 or CmD14 genes are encompassed herein, particularly methods for generating mutant alleles that encode proteins that have reduced or lost function in vivo and result in full multibranching (in the case of loss of function in vivo) or intermediate multibranching (in the case of loss of function in vivo) when the mutant allele is homozygous.

[0032] In one aspect, a method is included for generating mutant alleles encoding proteins that include a duplication of at least 1, 2, 3, 4, 5, 6, 7 or all 8 of amino acids 94-101 of SEQ ID NO:2, SEQ ID NO:8 or SEQ ID NO:9. In one aspect, a method is provided for generating mutant alleles encoding proteins in which at least the Ser (S) at position 97 of wild-type ClD14, CsD14 or CmD14 protein is duplicated.

[0033] Also provided herein are methods of screening (eg, genotyping) and / or selecting plants or plant parts or seeds for the presence of mutant and / or wild-type alleles of the ClD14, CsD14 or CmD14 genes.

[0034] Mutant ClD14, CsD14 or CmD14 alleles may include alleles encoding proteins in which one or more amino acids have been inserted, duplication, deletion and / or substitution compared to the wild-type ClD14, CsD14 or CmD14 protein, or mutant ClD14, CsD14 or CmD14 alleles may include one or more mutations (insertion, duplication, deletion and / or substitution of one or more nucleotides) in a regulatory region of a gene, such as a promoter or enhancer, thereby creating a reduced-function or loss-of-function wild-type protein.

[0035] In one embodiment, the mutant allele encodes a protein that contains one or more amino acids that are substituted, inserted and / or deleted, so that the protein is non-functional in vivo, and plants that are homozygous for the mutant allele show complete multibranching. Thus, complete multibranching is completely lacking in inhibition of secondary branch formation, since functional D14 is not present in the plant. Complete multibranching in watermelon is seen, for example, as an average number of secondary branches of about 240% compared to wild-type plants (set at 100% secondary branches) (see examples). Preferably, the phenotypes of plants containing mutant alleles in homozygotes and plants containing wild-type alleles in homozygotes are compared in the same genetic background, so that the background genomes are very similar, minimizing genotypic differences.

[0036] In one aspect, the mutant allele encodes a wild-type D14 protein, the mutant allele is not expressed in vivo, e.g., due to a mutation in a regulatory region (such as a promoter), and plants homozygous for the mutant allele exhibit complete multibranching.

[0037] Knockout alleles of D14 or mutant alleles of D14, in which the mutation results in loss of function of the D14 protein in vivo, can be readily generated de novo, as described elsewhere herein.

[0038] In one aspect, the mutant allele encodes a protein that contains one or more amino acids that are substituted, inserted and / or deleted, so that the protein has reduced function in vivo, and plants that are homozygous for the mutant allele show intermediate multibranching. Thus, intermediate multibranching is not completely absent from the inhibition of secondary branch formation in plants, and the mutant D14 protein retains some functionality in vivo and partially inhibits secondary branch formation. Intermediate multibranching in watermelon is seen, for example, as the average number of secondary branches that occurs between the average number of wild-type plants (homozygous for functional D14 allele) and the average number of plants that are homozygous for non-functional D14 protein or knockout allele. For example, if a plant homozygous for a functional D14 allele produces an average number of secondary branches set at 100%, and a plant homozygous for an allele encoding a non-functional D14 protein (or homozygous for a knockout allele) produces 240% secondary branches compared to wild type, then "intermediate multi-branching" would produce an average number of secondary branches between 100% (homozygous wild type) and 240% (homozygous non-functional), thereby producing an average number of secondary branches that is about at least 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190% or 200% compared to wild type plants (set at 100% secondary branches), but less than full multi-branching (see Examples). Mutant alleles in the D14 gene, in which the mutation results in reduced in vivo function of the D14 protein, can be readily generated de novo, as described elsewhere herein.

[0039] In one aspect, the mutant allele encodes a protein that contains one or more amino acids substituted, inserted and / or deleted in the IPR000073 domain starting at amino acid 22 and ending at amino acid 259 of SEQ ID NO:2 (watermelon), SEQ ID NO:8 (cucumber) or SEQ ID NO:9 (melon).

[0040] In one embodiment, the mutant allele encodes a mutant D14 protein as shown in Table 2 or FIG.

[0041] In one aspect, the mutant allele encodes a protein that contains one or more amino acids substituted, inserted and / or deleted in the region of amino acids 94 to 101 of SEQ ID NO:2 (wild-type watermelon protein), or SEQ ID NO:8 (wild-type cucumber protein), or SEQ ID NO:9 (wild-type melon protein).

[0042] In one aspect, the mutant allele encodes a protein that includes a duplicate of one or more amino acids selected from amino acids 94 to 101 of SEQ ID NO:2 (wild-type watermelon protein), or SEQ ID NO:8 (wild-type cucumber protein), or SEQ ID NO:9 (wild-type melon protein).

[0043] In one aspect, the mutant allele encodes a protein that includes a duplicated 1, 2, 3, 4, 5, 6, 7 or all 8 amino acids selected from amino acids 94-101 of SEQ ID NO:2 (wild type watermelon protein ClD14), or SEQ ID NO:8 (wild type cucumber protein CsD14), or SEQ ID NO:9 (wild type melon protein CmD14). In one aspect, the mutant allele encodes a protein that includes at least a duplicate of serine 97 (S97) of SEQ ID NO:2 (wild type watermelon protein), or SEQ ID NO:8 (wild type cucumber protein), or SEQ ID NO:9 (wild type melon protein). In one aspect, one or more of the duplicated amino acids flank a wild type amino acid.

[0044] In one aspect, the mutant alleles described above result in increased secondary branching of watermelon, cucumber or melon plants when the mutant allele is homozygous compared to plants homozygous for the wild type allele (encoding wild type proteins of ClD14, CsD14 and CmD14). In one aspect, the mutant allele is a knockout allele or encodes a non-functional D14 protein that results in complete multi-branching when the mutant allele is homozygous. In one aspect, the mutant allele results in a mutant D14 protein that has reduced function compared to the wild type D14 protein but still retains function in vivo and results in intermediate multi-branching when the mutant allele is homozygous.

[0045] The mutant alleles described above can be easily generated de novo, for example, by targeted gene editing techniques such as CRISPR-based techniques or mutagenesis such as radiation-induced or chemically-induced mutagenesis. To determine whether the number of secondary branches is higher in homozygous mutant plants, plants homozygous for the mutant allele can be generated by selfing the plants and then growing the homozygous plants in comparison to wild-type controls (e.g., non-mutated plants).

[0046] In another aspect, a mutant ClD14, CmD14 or CsD14 allele encodes a truncated protein in which at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or more amino acids at the C-terminus of the wild-type ClD14, CsD14 or CmD14 protein have been deleted or optionally substituted with different amino acids, such that the protein has reduced or no in vivo function.

[0047] In different aspects, the mutant ClD14, CmD14 or CsD14 allele encodes a protein in which at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or more amino acids are inserted into, duplicated with, substituted for or deleted from the wild-type ClD14, CsD14 or CmD14 protein, such that the protein has reduced or no in vivo function.

[0048] As mentioned above, the degree of multibranching is determined by the functionality of the mutant protein, whereby a non-functional mutant protein results in the highest level of multibranching (referred to herein as complete or strong multibranching), while a reduced-function mutant protein results in a lower degree of multibranching (referred to herein as intermediate multibranching). Thus, there is a direct relationship between D14 functionality and the degree of multibranching. One skilled in the art can easily generate various mutant alleles and homozygous plants containing the mutant alleles, then cultivate the plants and select the mutant allele that results in the desired degree of multibranching.

[0049] In one aspect of the invention there is provided a plant or plant cell characterised in that it has a reduced activity of ClD14 protein, CsD14 protein or CmD14 protein compared to a corresponding wild-type plant cell, wherein the ClD14, CsD14 or CmD14 protein of the wild-type plant cell is a) a nucleic acid molecule encoding a protein having an amino acid sequence as set forth in SEQ ID NO: 2 (watermelon ClD14), SEQ ID NO: 8 (cucumber CsD14) or SEQ ID NO: 9 (melon CmD14); b) a nucleic acid molecule encoding a protein whose sequence has at least 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence set forth in SEQ ID NO: 2 (watermelon ClD14), SEQ ID NO: 8 (cucumber CsD14) or SEQ ID NO: 9 (melon CmD14); c) a nucleic acid molecule encoding a ClD14 protein, of a sequence comprising SEQ ID NO:4 or SEQ ID NO:6 or at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:4 or SEQ ID NO:6; d) a nucleic acid molecule encoding the CsD14 protein, of a sequence comprising SEQ ID NO: 17 or SEQ ID NO: 15 or at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 17 or SEQ ID NO: 15; e) a nucleic acid molecule encoding a CmD14 protein, the sequence of which comprises SEQ ID NO: 18 or SEQ ID NO: 16 or at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 18 or SEQ ID NO: 16 The nucleic acid molecule is encoded by a nucleic acid molecule selected from the group consisting of:

[0050] The reduced activity of the ClD14, CsD14 or CmD14 protein is caused by a mutated ClD14, CsD14 or CmD14 allele.

[0051] The reduced activity can be caused by knocking down or knocking out expression of a mutant allele (e.g., by mutations in the promoter or other regulatory sequences) or by a mutant allele encoding a loss-of-function or reduced-function ClD14, CsD14 or CmD14 protein. A mutant allele or knockout allele encoding a loss-of-function protein will result in a plant with a strong multi-branching phenotype in homozygotes, while a mutant allele or knockdown allele encoding a reduced-function protein will result in a multi-branching phenotype in homozygotes that is intermediate between a plant homozygous for the wild-type allele and a plant homozygous for the loss-of-function (or knockout) allele.

[0052] In one aspect, a mutant ClD14, CsD14 or CmD14 allele encodes a mutant ClD14, CsD14 or CmD14 protein that has reduced or lost function compared to the wild type protein, e.g., the mutant protein comprises one or more amino acids that are substituted, deleted and / or inserted or duplicated compared to the wild type protein. In one aspect, a mutant allele encodes a protein that comprises one or more amino acids that are substituted, deleted or inserted compared to the wild type protein of SEQ ID NO: 2, 8 or 9, such that the mutant protein either has a loss of function, resulting in strong multiple branching (if homozygous), or has a reduced function, resulting in intermediate multiple branching (if homozygous).

[0053] The W155 produced in watermelon herein * Mutant alleles resulting in truncated D14 proteins, such as mutants, will generally result in loss of function. *also lacks the last 13 amino acids of the protein, including 5 amino acids of the highly conserved IPR000073 domain, which may result in loss or reduced function.

[0054] Alleles encoding truncated proteins or proteins containing one or more amino acids substituted with another amino acid or deleted or inserted can be readily generated and, when the allele is homozygous, tested in vivo to determine the effect on multiple branching. The mutants described in Table 2 and in Table A below can also be readily generated in watermelon, melon or cucumber, or other mutants can be generated using known methods such as random mutagenesis followed by, for example, TILLING, targeted mutagenesis methods.

[0055] Software programs such as SIFT or PROVEAN analysis can also be used to make predictions of the effect of amino acid insertions, deletions or substitutions on protein function, but this is only a prediction and still needs to be confirmed in vivo. For example, P245L is predicted to be "not tolerated" by SIFT analysis and "detrimental" by Provean analysis, meaning that the function of the protein is predicted to be lost or reduced. For changes predicted to be "tolerated" using SIFT analysis or "neutral" using Provean analysis, function is predicted to be unchanged. However, as described, the prediction does not have to be true (it is based on a statistical model) and in vivo analysis is required. In addition, tools can be useful to focus further analysis on mutant alleles predicted to have an effect on protein function.

[0056] [Table 2]

[0057] Thus, one aspect herein is a watermelon plant comprising a mutant allele of a gene designated ClD14 (Citrullus lanatus Dwarf14), wherein the mutant allele comprises a mutation in one or more regulatory sequences that results in reduced or no gene expression compared to a corresponding wild type allele, or the mutant allele encodes a protein that comprises a deletion, truncation, insertion or substitution of one or more amino acids compared to the protein encoded by the wild type allele, resulting in reduced or lost function of the ClD14 protein, wherein the mutant allele, when homozygous for the mutant allele, results in said plant developing an increased average number of secondary branches, and wherein the mutant allele is not a mutant allele that encodes a protein of SEQ ID NO:1, and the ClD14 protein of the wild type allele a) a nucleic acid molecule encoding a protein having the amino acid sequence set forth in SEQ ID NO:2; b) a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO:6 or its complementary sequence The watermelon plant is encoded by a nucleic acid molecule selected from the group consisting of:

[0058] Another aspect herein is a cucumber plant comprising a mutant allele of a gene designated CsD14 (Cucumis sativus Dwarf14), wherein the mutant allele comprises a mutation in one or more regulatory sequences that results in reduced or no gene expression compared to a corresponding wild type allele, or the mutant allele encodes a protein that comprises a deletion, truncation, insertion or substitution of one or more amino acids compared to the protein encoded by the wild type allele, resulting in reduced or lost function of the CsD14 protein, wherein the mutant allele causes said plant to develop an increased average number of secondary branches when the mutant allele is homozygous, and the CsD14 protein of the wild type allele a) a nucleic acid molecule encoding a protein having the amino acid sequence set forth in SEQ ID NO:8; b) a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO: 15 or its complementary sequence A cucumber plant, wherein the nucleic acid molecule is encoded by a nucleic acid molecule selected from the group consisting of:

[0059] Yet another aspect herein is a melon plant comprising a mutant allele of a gene designated CmD14 (Cucumis melo Dwarf14), wherein the mutant allele comprises a mutation in one or more regulatory sequences that results in reduced or no gene expression compared to a corresponding wild type allele, or the mutant allele encodes a protein that comprises a deletion, truncation, insertion or substitution of one or more amino acids compared to the protein encoded by the wild type allele, resulting in reduced or lost function of the CmD14 protein, wherein the mutant allele causes said plant to develop an increased average number of secondary branches when the mutant allele is homozygous, and the CmD14 protein of the wild type allele a) a nucleic acid molecule encoding a protein having the amino acid sequence set forth in SEQ ID NO:9; b) a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO: 16 or its complementary sequence The melon plant is encoded by a nucleic acid molecule selected from the group consisting of:

[0060] In particular, the watermelon, cucumber or melon plant comprises a mutant allele encoding a protein in which one or more amino acids have been inserted, substituted or deleted, and the mutant protein comprises a reduction in function rather than a loss of function of the protein, such that the average number of secondary branches is greater than in plants homozygous for a wild-type D14 allele, but not as great as in plants homozygous for a mutant D14 allele encoding a non-functional protein.

[0061] In one aspect, the watermelon plant, cucumber plant or melon plant also comprises a mutant allele encoding a protein in which one or more amino acids have been inserted, substituted or deleted, said mutant protein comprising a loss of function of the protein.

[0062] In one embodiment, the mutant allele encodes a protein in which V14 of SEQ ID NO: 2, 8 or 9 has been replaced with a different amino acid, in particular with an I or a stop codon.

[0063] In one embodiment, the mutant allele encodes a protein in which P44 of SEQ ID NO: 2, 8 or 9 has been replaced with a different amino acid, in particular with an S or a stop codon.

[0064] In one embodiment, the mutant allele encodes a protein in which L72 of SEQ ID NO: 2, 8 or 9 has been replaced with a different amino acid, in particular with F or a stop codon.

[0065] In one embodiment, the mutant allele encodes a protein in which H89 of SEQ ID NO: 2, 8 or 9 is replaced with a different amino acid, in particular Y or a stop codon.

[0066] In one embodiment, the mutant allele encodes a protein in which G121 of SEQ ID NO: 2, 8 or 9 has been replaced with a different amino acid, in particular S or a stop codon.

[0067] In one embodiment, the mutant allele encodes a protein in which S139 of SEQ ID NO: 2 or 9 has been replaced with a different amino acid, in particular with an N or a stop codon.

[0068] In one embodiment, the mutant allele encodes a protein in which W155 of SEQ ID NO: 2, 8 or 9 has been replaced with a different amino acid or a stop codon.

[0069] In one embodiment, the mutant allele encodes a protein in which G235 of SEQ ID NO: 2, 8 or 9 is replaced with a different amino acid, in particular V or a stop codon.

[0070] In one embodiment, the mutant allele encodes a protein in which P254 of SEQ ID NO: 2, 8 or 9 has been replaced with a different amino acid, in particular with an L or a stop codon.

[0071] In one embodiment, the mutant allele encodes a protein in which Q255 of SEQ ID NO: 2, 8 or 9 has been replaced with a different amino acid or a stop codon.

[0072] In one aspect, the mutant allele encodes a protein comprising a duplication of at least 1, 2, 3, 4, 5, 6, 7 or all 8 amino acids selected from amino acid 94 to amino acid 101 of SEQ ID NO: 2, 8 or 9. In one aspect, at least S97 is duplicated. In one aspect, amino acids 94 to 101 are duplicated.

[0073] In another aspect, the mutant allele encodes a protein comprising a deletion or substitution of at least one, two, three, four, five, six, seven or all eight amino acids selected from amino acid 94 to amino acid 101 of SEQ ID NO: 2, 8 or 9. In one aspect, at least S97 is deleted or substituted with another amino acid. In one aspect, amino acids 94 to 101 are deleted or substituted with another amino acid.

[0074] Thus, in one aspect, the mutant allele encodes a ClD14, CsD14, CmD14 protein of SEQ ID NO: 2, 8 or 9, respectively, in which at least S97 is duplicated, or at least 1, 2, 3, 4, 5, 6, 7 or all 8 of the following consecutive amino acids are duplicated: V94 (valine 94), G95 (glycine 95), H96 (histidine 96), S97 (serine 97), V98 (valine 98), S99 (serine 99), A100 (alanine 100), M101 (methionine 101). In one aspect, at least 1, 2, 3, 4 or more consecutive amino acids include S97.

[0075] In one aspect, the overlap of at least 1, 2, 3, 4 or more amino acids is located adjacent to the original amino acid, ie, with no spacing of other amino acids between the overlapped amino acids.

[0076] In another aspect, the mutant allele encodes a ClD14, CsD14, CmD14 protein of SEQ ID NO: 2, 8 or 9, respectively, where at least one amino acid, such as at least one amino acid selected from amino acids 94-101 of SEQ ID NO: 2, 8 or 9, or at least one amino acid in the IPR000073 domain of SEQ ID NO: 2, 8 or 9, or at least one amino acid in the helical lid domain, is substituted with another amino acid or a stop codon, resulting in a loss-of-function or reduced-function protein and a phenotypic change (increased secondary branching) when the allele is homozygous (when the wild type allele is not present in the diploid plant or plant cell). The IPR000073 domain starts at amino acid 22 of SEQ ID NO: 2, 8 and 9 and ends at amino acid 259 of SEQ ID NO: 2, 8 and 9. The helical lid domain starts at amino acid 136 of SEQ ID NO: 2, 8 and 9 and ends at amino acid 193 of SEQ ID NO: 2, 8 and 9. When referring to a start or end, the amino acid or nucleotide referred to is included.

[0077] In yet another embodiment, the mutant allele encodes a ClD14, CsD14, CmD14 protein of SEQ ID NO: 2, 8 or 9, respectively, in which at least one amino acid of the catalytic triad or only positions 1, 2, 3, 4, 5, 6, 7 or 8 of the catalytic triad are substituted with another amino acid or a stop codon before or after the amino acid of the catalytic triad, resulting in a loss-of-function or reduced function protein and altered phenotype (increased secondary branching) when the allele is homozygous (when the wild type allele is not present in the diploid plant or plant cell). The amino acids of the catalytic triad are S97, D218 and H247 of SEQ ID NO: 2, 8 or 9.

[0078] In another embodiment, one or more amino acids are deleted, for example, by a mutation resulting in a premature stop codon, resulting in a loss of function or reduced function protein and phenotypic changes (increased secondary branching) when the allele is homozygous (when no wild type allele is present in the diploid plant or plant cell). In particular, in one embodiment, one or more amino acids selected from amino acids 94-101 of SEQ ID NO: 2, 8 or 9 are deleted, for example, by a premature stop codon mutation present in the sequence preceding the codon encoding said amino acid. Alternatively, one or more amino acids of the IPR000073 domain are deleted, or one or more amino acids of the helical lid domain are deleted, or one or more amino acids of the catalytic triad and / or only positions 1, 2, 3, 4, 5, 6, 7 or 8 are deleted before or after the amino acid of the catalytic triad, for example, by a premature stop codon mutation present in the sequence preceding the codon encoding said amino acid.

[0079] If the mutant allele changes the in vivo phenotype from the wild type phenotype, i.e., normal secondary branching when the wild type allele is present in homozygote, to increased secondary branching when the mutant allele is homozygote in the diploid plant, there is a loss or loss of function of the protein. Thus, the term "increased secondary branching" or "increased average number of secondary branches" encompasses both the "full multi-branching" phenotype caused by knocking out the expression of the loss-of-function D14 protein or D14 allele, and the "intermediate multi-branching" phenotype caused by reduced expression of the loss-of-function D14 protein or D14 allele compared to the wild type functional D14 allele. Although the absolute average number of secondary branches may vary somewhat between genotypes, the relative effect should be the same in various genotypes. Thus, in a particular genetic background or genotype, the wild type has a particular average number of secondary branches, the loss-of-function protein or knockout allele has the maximum or "full" average number of secondary branches, and the loss-of-function or knockdown allele is intermediate between these two extremes. For example, if the average number of secondary branches in wild type is set to 100% and the loss of function is 240% compared to wild type, then an average secondary branching of more than 100% and less than 240% is an "intermediate multi-branched" phenotype. In one embodiment, the "increased average secondary branching" is at least 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210% compared to wild type (which is 100%). In one embodiment, the "increased average secondary branching" is less than "fully multi-branched", which is, for example, 95% or less, 90% or less, 85% or less, 80% or less, 70% or less, 60% or less, 50% or less of "fully multi-branched" (which is 100%).

[0080] In one aspect, the increased secondary branches is an average number of 45 or more secondary branches as seen in watermelon plants homozygous for an allele encoding the protein of SEQ ID NO:1 (containing a duplication of amino acids 94-101 of SEQ ID NO:2) compared to watermelon plants homozygous for a wild type allele encoding the protein of SEQ ID NO:2, which produces an average of about 20 secondary branches. See also Examples.

[0081] In watermelon and other cucurbits, the main stem grows and forms primary lateral branches. On the primary lateral branches, the plant forms secondary lateral branches. These secondary branches are counted, for example, starting from 90 cm from the end / crown on the main stem to the end / crown. Thus, secondary branches are measured in one embodiment by counting the number of secondary branches starting from a distance of 90 cm from the crown of the plant to the end / crown of the plant. This is done for several (at least 4, 5, 6, 7, 8, 9, 10) plants of a line, and then the average number of secondary branches is calculated for each line. However, secondary branches can also be measured by counting the number of secondary branches starting from a shorter distance from the crown, for example 40 cm.

[0082] overview Cultivated watermelon, cucumber or melon plants or plant parts are provided which contain at least one copy of a mutant allele of a gene designated ClD14 in watermelon, CsD14 in cucumber or CmD14 in melon, said mutant allele conferring an increased average number of secondary branches when the mutant allele is homozygous in a diploid plant.

[0083] In one embodiment, the watermelon ClD14 gene is located on chromosome 8 of the watermelon genome, in particular, the gene is located in the region of chromosome 8 of the Charleston Gray chromosome (cucurbitgenomics.org) starting at base 28794281 and ending at base 28795173. The promoter sequence is located upstream of the genomic coding sequence, e.g., within 1000 or 2000 bases upstream from base 28794281.

[0084] In one aspect, a mutant ClD14, CsD14 or CmD14 allele, when homozygous, confers complete multibranching in which the highest average number of secondary branches is formed because the encoded mutant protein is non-functional or because the mutant allele is not expressed, i.e., a knockout allele.

[0085] In another embodiment, a mutant ClD14, CsD14 or CmD14 allele, when homozygous, confers intermediate multibranching in which an increased average number of secondary branches are formed compared to wild-type plants, but the highest average number of branches is not formable in a fully multibranched plant. The intermediate multibranching is due to the encoded mutant protein having reduced function compared to the wild-type protein, or due to the mutant allele being expressed at a lower level than the wild-type allele, i.e., a knockdown allele.

[0086] In one embodiment, the plant or plant part or seed comprising the mutant allele of ClD14 gene is a watermelon plant or plant part or seed, and is diploid, tetraploid, triploid or polyploid.Preferably, the mutant allele is present in one or two copies in a diploid plant or plant part or seed.Optionally, it can be present in two or four copies in a tetraploid plant or plant part or seed, or in one, two or three copies in a triploid plant or plant part or seed.

[0087] The plant, plant part or seed may be a watermelon comprising at least one copy of a mutant allele of a gene designated ClD14, whereby the wild-type gene encodes a wild-type protein of SEQ ID NO:2 (or a wild-type protein comprising at least 95%, 96%, 97% or 98% sequence identity to SEQ ID NO:2); or a cucumber comprising at least one copy of a mutant allele of a gene designated CsD14, whereby the wild-type gene encodes a wild-type protein of SEQ ID NO:8 (or a wild-type protein comprising at least 95%, 96%, 97% or 98% sequence identity to SEQ ID NO:8); or a melon comprising at least one copy of a mutant allele of a gene designated CmD14, whereby the wild-type gene encodes a wild-type protein of SEQ ID NO:9 (or a wild-type protein comprising at least 95%, 96%, 97% or 98% sequence identity to SEQ ID NO:9).

[0088] The plant part containing a mutant allele of the ClD14, CsD14 or CmD14 gene may be a cell, flower, leaf, stem, cutting, pollen, root, rootstock, scion, fruit, protoplast, embryo or anther.

[0089] Also included are vegetatively propagated watermelon, cucumber or melon plants propagated from such plant parts which contain at least one mutant allele of the ClD14, CsD14 or CmD14 gene.

[0090] Also provided are seeds from which plants of the invention can be grown.

[0091] Further provided are male or female flowers, ovaries, anthers and pollen or microspores produced by plants according to the invention.

[0092] Methods for producing watermelon, cucumber or melon fruit are provided which include growing a diploid plant containing one or two copies of a mutant allele of the ClD14, CsD14 or CmD14 gene, the mutant allele being a D14 allele described elsewhere herein which, in homozygotes, confers increased secondary branching (homozygous for the mutant allele) compared to normal secondary branching (homozygous for the wild-type D14 allele).

[0093] A method for producing seedless watermelon fruits is provided, comprising growing a triploid plant and a diploid pollinator seed plant that contain two copies of a mutant allele of the ClD14 gene, allowing pollination of the flowers of the triploid plant, and optionally harvesting the seedless triploid fruit.

[0094] A method for producing seedless watermelon fruits is provided that includes growing triploid plants and diploid pollinator seed plants that contain one, two or three copies of a mutant allele of the ClD14 gene, allowing pollination of the flowers of the triploid plants, and optionally harvesting the seedless triploid fruits.

[0095] A further method of producing watermelon fruit is provided, comprising growing a diploid plant containing one or two copies of a mutant allele of the ClD14 gene, allowing pollination of the flowers, and optionally harvesting the seeded diploid fruit.

[0096] Methods of growing watermelon, cucumber or melon plants are provided, particularly comprising growing in a field or greenhouse or tunnel a diploid watermelon, cucumber or melon plant that contains one or two copies of a mutant allele of the ClD14, CsD14 or CmD14 gene.

[0097] 1. A method for producing a cultivated watermelon, cucumber or melon plant which produces an increased (average) number of secondary branches (compared to plants homozygous for a wild-type D14 gene), comprising: a) introducing random or targeted mutations into one or more watermelon, cucumber or melon plants, plant parts or seeds; or providing a population of mutant plants or seeds (e.g., a TILLING population); b) selecting plants that contain mutant alleles of the ClD14, CsD14 or CmD14 gene, e.g. mutant alleles that produce significantly reduced or no wild-type ClD14, CsD14 or CmD14 protein (e.g. knockdown or knockout alleles) or that encode a protein that contains one or more amino acids that are deleted, substituted, inserted or duplicated compared to the wild-type protein; c) optionally removing any transgenic constructs (e.g., CRISPR constructs) from the plant; and / or d) optionally generating plants homozygous for the mutant allele and analyzing the average number of secondary branches produced by the plants compared to plants homozygous for the wild-type allele. A method is provided that includes:

[0098] 1. A method for selecting or identifying a watermelon, cucumber or melon plant, seed or plant part, comprising: a) analyzing whether the genomic DNA of the plant or plant parts contains a mutant allele and / or whether it contains a wild type allele of the ClD14, CsD14 or CmD14 gene in its genome; and, optionally, b) selecting plants or plant parts that contain one or two copies of a mutant allele of the ClD14, CsD14 or CmD14 gene in their genome; wherein a wild type allele of the ClD14 gene encodes the protein of SEQ ID NO:2, a wild type allele of the Cs14 gene encodes the protein of SEQ ID NO:8, and a wild type allele of the CmD14 gene encodes the protein of SEQ ID NO:9.

[0099] Step a) can be carried out in various ways, for example using PCR-based methods, sequencing-based methods, nucleic acid hybridization-based methods, gene expression levels, etc. In one embodiment, for example, KASP assay can be used (see, for example, the Examples).

[0100] 1. A method for screening (e.g., genotyping) genomic DNA of a watermelon, cucumber, or melon plant, seed, or plant part, comprising: a) providing a sample (or samples) of genomic DNA from a watermelon, melon or cucumber plant or plants (e.g., an F2 population, an inbred line, a backcross population, a breeding population, a hybrid plant, etc.); b) providing a pair of PCR primers or an oligonucleotide probe, the primers or (oligonucleotide) probe comprising at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more consecutive nucleotides of a genomic D14 allele of the ClD14, CsD14 or CmD14 gene and capable of hybridizing to the genomic allele and / or amplifying a portion of the genomic allele in a PCR assay; c) subjecting the sample of step a) to a PCR assay using the primer pair of step b) or a hybridization assay using the probe; and optionally, d) selecting plants or plant parts or seeds that contain one or two copies of an allele (e.g., a wild-type allele and / or a mutant allele) of the ClD14, CsD14 or CmD14 gene in their genome; wherein a wild type allele of the ClD14 gene encodes the protein of SEQ ID NO:2, a wild type allele of the Cs14 gene encodes the protein of SEQ ID NO:8, and a wild type allele of the CmD14 gene encodes the protein of SEQ ID NO:9.

[0101] In step b), the PCR primer pair is at least one forward primer complementary to the DNA strand of the D14 allele and one reverse primer complementary to the other DNA strand of the D14 allele, which hybridizes to the denatured genomic DNA in a PCR reaction and amplifies a part of the D14 allele. The primers can be designed to amplify the wild type or any mutant D14 allele using a primer design tool. In one embodiment, two forward primers and one common reverse primer are used, one designed to amplify the wild type allele of the D14 gene and one designed to amplify the mutant allele of the D14 gene. These three primers can be used in a KASP assay to genotype the sample of step a). Thus, in one embodiment the assay in step c) is a KASP assay, although other genotyping assays such as those described on the World Wide Web at biosearchtech.com / sectors / agrigenomics / agrigenomics-pcr-qpcr-technologies may also be used.

[0102] In one embodiment, the assay distinguishes between wild type and mutant alleles of the D14 gene, for example, between the wild type ClD14 allele of SEQ ID NO: 6 and the mutant ClD14ins allele of SEQ ID NO: 5 or another mutant allele. Examples of other mutant alleles are shown in Table A and Table 2, but also include any other mutant allele, for example, any mutant allele that significantly increases the average number of secondary branches that occur in homozygotes compared to control plants, for example plants containing a wild type allele in homozygotes. In one embodiment, the mutant allele is a knockout allele or a mutant allele that encodes a loss-of-function protein that results in strong multiple branching, and in another embodiment, the mutant allele is a knockdown allele or a mutant allele that encodes a reduced-function protein that results in intermediate multiple branching. Thus, any wild type and / or mutant allele of the D14 gene can be detected in the assay.

[0103] To analyze genomic DNA, at least crude genomic DNA extraction may be necessary. The presence of mutant or wild-type alleles in genomic DNA can be detected directly or indirectly. Directly can be, for example, by nucleic acid hybridization of, for example, an oligonucleotide probe. Indirectly can be, for example, by nucleic acid amplification using, for example, a PCR primer, which includes, for example, a tail sequence attached to the primer, during PCR, the allele-specific primer binds to and extends the template DNA, thereby binding the tail sequence to the newly synthesized strand, and in the subsequent PCR round, a FRET cassette (fluorescence resonance energy transfer cassette) binds to the tail and emits fluorescence. The fluorescent signal can then be detected. This is used, for example, in KASP assays.

[0104] A mutant allele may differ from a wild-type allele in various ways, for example, in promoter or protein coding sequences or intron / exon splice sites. A mutant allele may have reduced or no gene expression, or it may result in the production of a protein that contains one or more amino acids that are deleted, substituted or inserted or duplicated compared to the wild-type protein.

[0105] In one aspect, a mutant allele is an allele that encodes a protein that contains one or more amino acids substituted, inserted or deleted compared to the functional protein of SEQ ID NO: 2, 8 or 9, such that the mutant protein has reduced or no function in vivo.

[0106] In one aspect, the mutant allele is an allele that encodes a protein that contains one or more amino acids selected from any one or more of the conserved IPR00073 domain amino acids and / or any one or more of the helical lid domain amino acids and / or any one or more of the catalytic triad amino acids and / or any one or more of the eight amino acids before or after the catalytic triad amino acid that are substituted, inserted or deleted compared to the functional protein of SEQ ID NO: 2, 8 or 9, whereby the mutant protein has reduced or no function in vivo. Thus, not only are plants and plant parts that contain one or more of the mutant alleles described herein, but also assays that allow for the detection of plants or plant parts that contain at least one of the mutant alleles described herein. Thus, any watermelon, cucumber or melon plant, seed or plant part or DNA derived therefrom can be analyzed for the presence of the wild type D14 allele or the presence of at least one of any of the mutant D14 alleles described herein. For any mutant allele, assays can be easily developed since methods for generating primers or probes for specific mutant alleles are well known. For example, W155 * For an allele, an assay can be readily designed to detect the presence of the allele in genomic DNA derived from a watermelon plant.

[0107] In one aspect, the mutant allele is an allele encoding a protein that comprises a duplication of 1, 2, 3, 4, 5, 6, 7 or 8 amino acids from amino acids 94 to 101 of SEQ ID NO: 2, 8 or 9. In one aspect, the mutant allele comprises a duplication of at least Ser 97 of SEQ ID NO: 2, 8 or 9. In one aspect, the mutant allele comprises a duplication of all amino acids from amino acids 94 to 101 of SEQ ID NO: 2, 8 or 9.

[0108] In one aspect, the plant or plant part is a watermelon and the mutant allele encodes a protein of SEQ ID NO: 1 (D14ins). This mutant allele, which encodes the eight amino acid duplication described herein, can be detected as described herein.

[0109] In another embodiment, the plant or plant part is a watermelon and the mutant allele encodes a mutant protein that includes one or more amino acids that are inserted, substituted or deleted resulting in reduced or lost function, but which is not the protein of SEQ ID NO:1 (D14ins), i.e., it is not an allele present in the Sidekick variety. Thus, the plant does not include the sequence of SEQ ID NO:5 in its genome. In one embodiment, the plant includes only one copy of the sequence of SEQ ID NO:5 in its genome.

[0110] Methods for generating and / or selecting plants or plant parts which contain in their genome at least one mutant allele of the watermelon ClD14 gene, or the cucumber CsD14 gene, or the melon CmD14 gene are also provided.

[0111] In one aspect, a method for detecting the presence of wild-type and / or mutant alleles of the watermelon ClD14 gene, or the cucumber CsD14 gene, or the melon CmD14 gene in a genome is also provided.

[0112] In one aspect, methods are provided for detecting whether a watermelon plant or plant part or seed comprises at least one copy of a wild type allele encoding the protein of SEQ ID NO:2 and / or whether it comprises at least one copy of a mutant allele encoding any protein that comprises one or more amino acids substituted, inserted or deleted, e.g., compared to the protein of SEQ ID NO:1 or the protein of SEQ ID NO:2 (as described elsewhere), and, optionally, for selecting a plant, plant part or seed that comprises at least one copy of a mutant allele encoding any protein that comprises one or more amino acids substituted, inserted or deleted, e.g., compared to the protein of SEQ ID NO:1 or the protein of SEQ ID NO:2 (as described elsewhere).

[0113] In another aspect, a method for detecting whether a watermelon plant or plant part or seed contains at least one copy of a wild type allele comprising SEQ ID NO:6 and / or at least one copy of a mutant allele comprising one or more nucleotides inserted, substituted or deleted relative to SEQ ID NO:6, whereby the encoded protein has reduced or lost function in vivo.

[0114] In one aspect, there is provided a method for detecting and optionally selecting watermelon plants, seeds or plant parts that contain at least one copy of a mutant allele of a gene designated ClD14 (Citrullus lanatus Dwarf14), comprising: a) providing one or more genomic DNA samples of one or more watermelon plants, seeds or plant parts; b) performing a genotyping assay using the DNA sample of a) as a template, which distinguishes between wild-type and mutant ClD14 alleles, said genotyping assay being based on nucleic acid amplification using ClD14 allele-specific oligonucleotide primers and / or said genotyping assay being based on nucleic acid hybridization using ClD14 allele-specific oligonucleotide probes; and optionally c) selecting plants, seeds or plant parts containing one or two copies of the mutant allele; wherein the mutant ClD14 allele comprises one or more nucleotides that are inserted, duplicated, deleted or substituted relative to the sequence of SEQ ID NO:6, resulting in a mutant ClD14 protein that comprises one or more amino acids that are inserted, duplicated, deleted or substituted relative to the sequence of SEQ ID NO:2.

[0115] In this method, in one embodiment, the ClD14 allele-specific oligonucleotide primer or the ClD14 allele-specific oligonucleotide probe is a primer or probe comprising at least 10 nucleotides of SEQ ID NO:6 or the complementary strand of SEQ ID NO:6.

[0116] In this method, in one embodiment, the mutant allele comprises at least one codon inserted or duplicated in the coding region of the allele, or at least one codon changed to another codon, or at least one codon deleted or changed to a stop codon. For example, the mutant allele is a mutant allele as described in Table A or Table 2 herein. The mutant allele can be an allele that encodes a mutant D14 protein having loss of function or reduced function, resulting in strong multiple branching or intermediate multiple branching, respectively, when the mutant allele is homozygous.

[0117] Also provided is a KASP assay (Kbioscience Kompetitive Allele-specific PCR-Genotyping Assay) comprising two allele-specific forward primers, e.g., FAM primer of SEQ ID NO: 10 and VIC primer of SEQ ID NO: 11, and a common reverse primer, e.g., SEQ ID NO: 12. See also the Examples. Obviously, other allele-specific primers can be developed to detect and / or distinguish between the wild-type allele (encoding the protein of SEQ ID NO: 2) and the mutant allele that includes a 24-nucleotide overlap (encoding 8 amino acids) and encodes the protein of SEQ ID NO: 1 or any other mutant allele that includes, e.g., one or more amino acids that are substituted, duplicated, deleted or inserted compared to the wild-type protein. For example, a KASP assay is provided for detecting a mutant allele in which the codon at W155 is changed to a stop codon or any of the mutant alleles of Table 2 and any other mutant allele that results in a loss-of-function or reduced-function D14 protein in vivo.

[0118] Similarly, isolated sequences or branches of the (wild-type or mutant) genomic, cDNA or mRNA sequences, protein sequences, as well as oligonucleotide primers or probes for detecting wild-type or mutant alleles of the watermelon ClD14 gene, or the cucumber CsD14 gene, or the melon CmD14 gene, are encompassed herein.

[0119] 1. A method for generating PCR amplification products and / or oligonucleotide hybridization products of (parts of) genomic DNA of a watermelon, cucumber or melon plant, seed or plant part, comprising: a) providing a sample (or samples) of genomic DNA from a watermelon, melon or cucumber plant or plants (e.g., an F2 population, an inbred line, a backcross population, a breeding population, a hybrid plant, etc.); b) providing at least a pair of PCR primers or at least one oligonucleotide probe, the primers or (oligonucleotide) probe comprising at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more consecutive nucleotides of a genomic D14 allele of the ClD14, CsD14 or CmD14 gene, and capable of hybridizing to the genomic allele and / or amplifying a portion of the genomic allele in a PCR assay; c) performing a PCR assay using the primer pair or a hybridization assay using the probe of step b) on the sample of step a) to generate a PCR amplification product and / or an oligonucleotide hybridization product; and optionally, d) selecting plants or plant parts or seeds that contain one or two copies of an allele (e.g., a wild-type allele and / or a mutant allele) of the ClD14, CsD14 or CmD14 gene in their genome; wherein a wild type allele of the ClD14 gene encodes a protein of SEQ ID NO:2 (or comprises genomic DNA of SEQ ID NO:6), a wild type allele of the Cs14 gene encodes a protein of SEQ ID NO:8 (or comprises genomic DNA of SEQ ID NO:15), and a wild type allele of the CmD14 gene encodes a protein of SEQ ID NO:9 (or comprises genomic DNA of SEQ ID NO:16), and methods are also provided.

[0120] Furthermore, there is provided a method for amplifying and / or hybridizing (part of) genomic DNA of a watermelon, cucumber or melon plant, seed or plant part, comprising the steps of: a) providing a sample (or samples) of genomic DNA from a watermelon, melon or cucumber plant or plants (e.g., an F2 population, an inbred line, a backcross population, a breeding population, a hybrid plant, etc.); b) providing at least a pair of PCR primers or at least one oligonucleotide probe, the primers or (oligonucleotide) probe comprising at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more consecutive nucleotides of a genomic D14 allele of the ClD14, CsD14 or CmD14 gene, and capable of hybridizing to the genomic allele and / or amplifying a portion of the genomic allele in a PCR assay; c) performing a PCR assay using the primer pair or a hybridization assay using the probe of step b) on the sample of step a) to generate a PCR amplification product and / or an oligonucleotide hybridization product; and optionally, d) selecting plants or plant parts or seeds that contain one or two copies of an allele (e.g., a wild-type allele and / or a mutant allele) of the ClD14, CsD14 or CmD14 gene in their genome; wherein a wild type allele of the ClD14 gene encodes a protein of SEQ ID NO:2 (or comprises genomic DNA of SEQ ID NO:6), a wild type allele of the Cs14 gene encodes a protein of SEQ ID NO:8 (or comprises genomic DNA of SEQ ID NO:15), and a wild type allele of the CmD14 gene encodes a protein of SEQ ID NO:9 (or comprises genomic DNA of SEQ ID NO:16), and a method is provided.

[0121] Genotyping kits containing primers and / or probes and reaction components that amplify and / or hybridize a portion of the genomic DNA of the D14 gene are also provided.

[0122] Primers and probes are preferably labeled or modified, for example with a tail sequence or a label, so as to enable detection of the amplification or hybridization reaction products.

[0123] General definition The verb "comprise" and its conjugations are used in its open-ended sense to mean that items following this term are included, but items not specifically mentioned are not excluded. Furthermore, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that there is more than one of that element, unless the context clearly dictates that there is one and only one of that element. Thus, the indefinite article "a" or "an" usually means "at least one," e.g., "a plant" also refers to several cells, plants, etc. Similarly, "fruit" or "plant" also refers to a plurality of fruits and plants.

[0124] As used herein, the term "plant" includes a whole plant or any part or derivative thereof, preferably having the same genetic structure as the plant from which it is derived, such as a plant organ (e.g., harvested or unharvested fruit, leaves, flowers, anthers, etc.), a plant cell, a plant protoplast, a plant cell tissue culture capable of regenerating a whole plant, a plant callus, a plant cell clump, a plant explant, a seedling, an intact plant cell in a plant, a plant clone or micropropagation, or a plant part, such as a plant cutting, an embryo, a pollen, an anther, an ovule, a fruit (e.g., a harvested tissue or organ), a flower, a leaf, a seed, a clonally propagated plant, a root, a stem, a root tip, a graft (a scion and / or a rootstock), etc. Also included are any developmental stages, such as a seedling, a cutting before or after rooting. When "seeds of a plant" are referred to, these refer to either a seed from which a plant can be grown or a seed generated in a plant after self-fertilization or cross-fertilization.

[0125] As used herein, the term "variety" or "cultivar" refers to a population of plants within a single botanical taxonomic group of the lowest known rank that can be defined by the expression of characteristics resulting from a given genotype or combination of genotypes.

[0126] The term "allele" refers to any of one or more alternative forms of a gene at a particular locus, for example the D14 locus (where the D14 gene is located; an allele of a gene can be a wild-type allele or a mutant allele designated ClD14 (in watermelon) or CsD14 (in cucumber) or CmD14 (in melon), which are associated with one trait or characteristic (e.g., secondary branching) at a particular locus. In diploid cells of an organism, alleles of a given gene are located at specific positions or loci (multiple loci) on a chromosome. There is one allele on each chromosome of a pair of homologous chromosomes. A diploid plant species can contain many different alleles at a particular locus. These can be identical alleles of the gene (homozygous) or two different alleles (heterozygous), for example two identical copies of a mutant or one copy of a mutant allele and one copy of a wild-type allele. Similarly, a triploid plant is said to be homozygous for a gene if it has three identical alleles of that gene (e.g., three copies of a mutant allele), and a tetraploid plant is said to be homozygous for that gene if it has four identical alleles of that gene, e.g., four copies of a mutant allele.

[0127] The "ClD14 gene" is a single recessive gene identified on chromosome 8 in cultivated watermelon which, when mutated, results in a phenotypic change of increased (average) number of secondary branches that occur when the mutant allele is homozygous compared to plants that are homozygous for the wild-type, non-mutated ClD14 gene. The CsD14 and CmD14 genes are orthologs of the ClD14 gene, but in cucumber and melon.

[0128] "F1, F2, F3, etc." refer to successive related generations following a cross between two parent plants or parent lines. Plants grown from seeds produced by crossing two plants or lines are referred to as the F1 generation. Selfing the F1 plant produces the F2 generation, and so on.

[0129] An "F1 hybrid" plant (or F1 hybrid seed) is the generation resulting from crossing two inbred parent lines. Thus, F1 hybrid seed is the seed from which an F1 hybrid plant is grown. F1 hybrids are more vigorous and have higher yields due to hybrid vigor. Inbred lines are essentially homozygous at most loci in the genome.

[0130] "Plant line" or "breeding line" refers to a plant and its progeny. As used herein, the term "inbred line" refers to a plant line that has been repeatedly selfed and is nearly homozygous. Thus, "inbred line" or "parent line" refers to a plant that has been inbred for several generations (e.g., at least 4, 5, 6, 7 or more generations) to result in a plant line with high uniformity.

[0131] The term "gene" refers to a (genomic) DNA sequence that comprises a region that is transcribed in a cell into a messenger RNA molecule (mRNA) (transcribed region) and an operably linked regulatory region (e.g., a promoter). An example is the D14 gene of the present invention. Different alleles of the gene are thus different alternative forms of the gene, which may be in the form of differences in the genomic DNA sequence (e.g., in the promoter sequence, exon sequence, intron sequence, etc.), in the mRNA and / or in the amino acid sequence of the encoded protein, e.g., of one or more nucleotides.

[0132] "Mutant ClD14 allele" refers herein to a mutant allele of a gene in watermelon that, when the mutant allele is homozygous, causes watermelon plants to have an increased (average) number of secondary branches, for example 45 or more secondary branches (also called "multiple branches"). Similarly, "mutant CsD14 allele or mutant CmD14 allele" refers to a mutant allele of an orthologous gene in cucumber and melon that causes increased secondary branching in these crops. The mutation in the mutant allele can be any mutation or combination of mutations, including deletions, truncations, insertions, duplications, point mutations, nonsense mutations, missense mutations or nonsynonymous mutations, splice site mutations, frameshift mutations and / or mutations in one or more regulatory sequences, such as promoter sequences or enhancer or silencer sequences. A mutant ClD14 allele may result in "full multi-branching" or "strong multi-branching", which refers to a mutant allele that does not transmit a signal in the plant to suppress secondary branch formation, with the mutant allele encoding a non-functional protein or being a knock-out allele. A mutant ClD14 allele may result in "intermediate multi-branching", which refers to a mutant allele that transmits some signal in the plant to suppress secondary branch formation to some extent, but to a much lesser extent than wild-type plants, with the mutant allele encoding a reduced-function protein or being a knock-down allele. Thus, the "intermediate multi-branching" phenotype is intermediate between the average number of secondary branches of plants homozygous for the wild-type, non-mutant allele and the average number of secondary branches of plants with the "full multi-branching" phenotype.

[0133] "Wild-type ClD14, or CsD14, or CmD14 allele" herein refers to a functional allele of a gene that causes a plant to develop a normal number of secondary branches. A wild-type ClD14 allele is found in any commercial cultivar of watermelon (e.g., Nunhems cultivar Premium F1, Montreal F1, etc.). In one aspect, a wild-type ClD14 allele is a wild-type allele of the ClD14 gene, whereby the ClD14 gene is a gene that encodes a protein of SEQ ID NO:2 or that contains at least 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:2 (e.g., when aligned pairwise using Needle). In one aspect, a wild-type CsD14 allele is a wild-type allele of the CsD14 gene, whereby the CsD14 gene encodes a protein of SEQ ID NO: 8 or a gene encoding a protein that comprises at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 8 (e.g., when aligned pairwise using Needle). In one aspect, a wild-type CmD14 allele is a wild-type allele of the CmD14 gene, whereby the CmD14 gene encodes a protein of SEQ ID NO: 9 or a gene encoding a protein that comprises at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 9 (e.g., when aligned pairwise using Needle).

[0134] The term "locus" (plural loci) refers to one or more specific positions or sites on a chromosome where, for example, a gene or genetic marker is found. Thus, the ClD14 locus is the location in the watermelon genome where mutant and / or wild-type alleles of the ClD14 gene are found. The ClD14 locus is a locus on cultivated watermelon chromosome 8 (using the chromosomal assignments of the published watermelon genome found on the World Wide Web at cucurbitgenomics.org under "Watermelon: Genome," "Charleston Gray," or "97103 V1 or V2").

[0135] An "induced mutant allele" is a mutant allele in which a mutation has been induced by human intervention, e.g., by mutagenesis using physical or chemical mutagenesis methods, including targeted gene editing techniques (Crispr-based techniques, TALENS, etc.), or using, e.g., tissue culture (e.g., as described in Zhang et al, Plos 9(5)e96879).

[0136] "Diploid plant" refers to a plant having two sets of chromosomes, designated herein as 2n, a vegetatively propagated plant part, or a seed from which a diploid plant can be grown.

[0137] A "DH plant" or "doubled haploid plant" is a diploid plant produced by doubling the haploid genome of a diploid plant, for example using in vitro techniques. Thus, DH plants are homozygous at all genetic loci.

[0138] "Triploid plant" refers to a plant having three sets of chromosomes, designated herein as 3n, a vegetatively propagated plant part, or a seed from which a triploid plant can be grown.

[0139] "Tetraploid plant" refers to a plant having four sets of chromosomes, designated herein as 4n, a vegetatively propagated plant part, or a seed from which a tetraploid plant can be grown.

[0140] "Polyploid plant" refers to a plant having a ploidy higher than diploid, i.e., triploid (3n), tetraploid (4n), hexaploid (6n), octoploid (8n), etc.

[0141] "Pollinator plant" or "pollinator" refers to a diploid plant or part thereof (e.g., its pollen or scions) that is suitable as a pollinator (inbred or cross) to induce fruit set in a triploid plant. Thus, the pollinator plant can produce the right amount of pollen at the right time and for the right period of time to result in good fruit set (and good triploid fruit yield) of a normal triploid plant.

[0142] A "breeding triploid plant" or "F1 triploid" or "triploid breeding line" is a triploid plant grown from a breeding triploid seed obtained by cross-fertilizing a male diploid parent with a female tetraploid parent. The male parent is used to induce fruit set and seed production in the tetraploid female parent, resulting in a fruit that contains an F1 breeding triploid seed. Both the male and female parents used to produce the F1 triploid seed are inbred, so that each parent line is nearly homozygous and stable.

[0143] "Seedless fruit" is a fruit that does not contain viable mature seeds. The fruit may contain one or more small edible white ovules. Optionally, the fruit may contain a few brown or black seeds, which are not viable. A viable mature seed is a seed that can germinate in soil under suitable conditions and grow into a plant.

[0144] "Interplanting" refers to a combination of two or more kinds of seeds and / or transplants sown or transplanted in the same field, especially triploid mating plants (in the case of seedless fruit production in triploid plants and diploid fruit production in pollinator plants) and pollinator plants in the same field. For example, pollinator plants can be planted in separate rows or interplanted with triploid plants in the same row (e.g., in raised areas within each row). Pollinator plants can also be planted between triploid rows. Pollinator and triploid mating seeds can also be mixed before sowing, resulting in random seeding. The transplants of triploid mating plants and / or pollinator plants can also include rootstocks of various plants. Suitable rootstocks are known in the art. Watermelon plants with various rootstocks are referred to as "grafted".

[0145] "Planting" or "planted" refers to sowing (direct seeding) or transplanting seedlings (plantlets) into a field by machine or by hand.

[0146] "Vegetative propagation" or "clonal propagation" refers to the propagation of plants from vegetative tissue, e.g., by in vitro propagation or grafting (using scions and rootstocks). In vitro propagation includes in vitro cell or tissue culture and the regeneration of whole plants from in vitro culture. Grafting includes the propagation of an original plant by grafting onto a rootstock. Thus, clones (i.e. genetically identical vegetative propagation) of an original plant can be generated either by in vitro culture or by grafting. "Cell culture" or "tissue culture" refers to the in vitro culture of plant cells or tissues. "Regeneration" refers to the development of a plant from cell or tissue culture or vegetative propagation. "Non-propagating cells" refer to cells that cannot be regenerated into whole plants.

[0147] "Recessive" refers to an allele that expresses its phenotype (e.g., multiple branching) when the dominant allele is not present in the diploid genome, i.e., when it is homozygous in the diploid. When the mutant ClD14 allele is present in two copies in a diploid plant, optionally in four copies in a tetraploid plant, or in two or three copies in a triploid plant, or in the respective number of copies in another ploidy, it results in a plant with a phenotypic change (described elsewhere). The dominant allele is also referred to herein as the wild type (WT) allele.

[0148] "Cultivated watermelon" or "Citrullus lanatus" as used herein refers to Citrullus lanatus ssp. vulgaris or Citrullus lanatus (Thunb.) Matsum. & Nakai subsp. vulgaris (Schrad.) having good agronomic characteristics and producing marketable fruit with particularly good fruit quality and fruit uniformity. It excludes wild watermelon.

[0149] "Wild watermelon" refers to Citrullus lanatus ssp. lanatus and Citrullus lanatus ssp. mucosospermus, which produce fruit of poor quality and poor uniformity.

[0150] "cultivated cucumber" or "cultivated melon" refers to Cucumis sativus or Cucumis melo having good agronomic characteristics and producing marketable fruit having especially good fruit quality and fruit uniformity. It excludes wild cucumber or wild melon, which produces fruit having poor quality and poor uniformity.

[0151] "SNP marker" refers to, for example, a single nucleotide polymorphism between a mutant ClD14, CsD14 or CmD14 allele and a wild-type allele. A SNP marker assay (i.e., an allele-specific assay) that can distinguish between mutant and wild-type alleles of a gene can be used to screen plants, plant parts or DNA derived therefrom for the presence of mutant and / or wild-type alleles.

[0152] "Indel marker" refers to, for example, an insertion / deletion polymorphism between a mutant ClD14, CsD14 or CmD14 allele and a wild-type ClD14, CsD14 or CmD14 allele. For example, the marker mWM23349015_k2 is an indel marker that distinguishes between a wild-type ClD14 allele encoding the protein of SEQ ID NO:2 and a mutant ClD14 allele encoding the protein of SEQ ID NO:1 (containing a duplication of eight amino acids). An indel marker assay (i.e., an allele-specific assay) that can distinguish between mutant and wild-type alleles of a gene can be used to screen plants, plant parts or DNA derived therefrom for the presence of mutant alleles.

[0153] A "genotyping" method is a method capable of determining the genotype or allelic composition of a plant or plant part or seed. A biallelic genotyping assay, such as the KASP assay, can distinguish between two alleles at a locus.

[0154] "Cultivated watermelon genome" and "physical location on the cultivated watermelon genome" and "chromosome 8" refer to the physical genome of cultivated watermelon (a reference genome can be found on the World Wide Web at cucurbitgenomics.org under "watermelon:genome", e.g., "Watermelon (Charleston Gray)") and the physical chromosomes and physical location on the chromosome.

[0155] A "chromosomal region containing a mutant ClD14 allele" refers to a genomic region, e.g., chromosome 8, of cultivated watermelon, that carries a mutant ClD14 allele. The presence of an allele can be determined phenotypically and / or by detection of a marker that distinguishes between different ClD14 alleles or by the genomic sequence of the allele sequence itself (e.g., determined by sequencing the allele). An "allele-specific marker" is a marker that is specific for a particular allele (e.g., a specific mutant allele), and thus distinguishes, e.g., between a mutant allele and a wild-type allele.

[0156] A genetic element, introgression fragment or gene or allele that confers a trait (such as the phenotypic characteristic of a mutant D14 allele) is said to be "obtainable from" or "obtainable from" or "derivable from" or "derivable from" or "present in" or "as found in" a plant or seed or tissue or cell if it can be transferred using conventional breeding techniques from a plant or seed in which it is present to another plant or seed in which it is absent (such as a wild type line or variety) without causing a phenotypic change in the recipient plant apart from the addition of the trait conferred by the genetic element, locus, introgression fragment, gene or allele. These terms are used synonymously and thus the genetic element, locus, introgression fragment, gene or allele can be transferred into any other genetic background lacking the trait. Cultivated watermelons containing genetic elements, loci, introgression fragments, genes or alleles (e.g., mutant ClD14 alleles) can be generated de novo, for example, by mutagenesis (e.g., chemical mutagenesis, CRISPR-Cas induction, etc.), and then crossed, for example, to other cultivated watermelons. Similarly, cultivated cucumbers or melons containing genetic elements, loci, introgression fragments, genes or alleles (e.g., mutant CsD14 or CmD14 alleles) can be generated de novo.

[0157] "Average" or "mean" refers to the arithmetic mean herein, and both terms are used interchangeably. Thus, the term "average" or "mean" refers to the arithmetic mean of several measurements. Those skilled in the art will understand that the phenotype of a plant line or variety depends to some extent on the growing conditions, and therefore the arithmetic mean of at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more plants (or plant parts) is preferably measured in a randomized experimental design in which several replicates and suitable control plants are grown under the same conditions in the same experiment. "Statistically significant" or "statistically significantly" different or "significantly" different refers to a characteristic of a plant line or variety that, when compared to a suitable control, shows a statistically significant difference in that characteristic from the (average of) the control (e.g., using ANOVA, with a p-value of less than 0.05, p<0.05). For example, when reference is made herein to a difference in the average number of secondary branches, it is understood that the difference referred to is a statistically significant difference, e.g., an "intermediate multi-branched" plant genotype has a statistically significantly higher average number of secondary branches than a control plant genotype that contains a wild-type D14 allele in homozygotes.

[0158] The term "conventional breeding techniques" as used herein includes crossing, backcrossing, selfing, selection, doubled haploid production, chromosome doubling, embryo rescue, protoplast fusion, marker assisted selection, mutation breeding, and the like, all as known to breeders, which can result in obtaining, identifying and / or transferring chromosome 8 containing, for example, a mutant ClD14 allele.

[0159] "Backcrossing" refers to a breeding method that allows the transfer of a (single) trait, such as a phenotypic change conferred by a mutant ClD14 allele, from one (often inferior) genetic background (also called the "donor") to another (often superior) genetic background (also called the "recurrent parent"). The progeny of the cross (e.g., an F1 plant obtained by crossing a donor with a recurrent parent watermelon, or an F2 or F3 plant obtained by selfing the F1) is "backcrossed" to, for example, a parent with a superior genetic background. After repeated backcrossing, the trait from one (often inferior) genetic background will have been incorporated into the other (often superior) genetic background.

[0160] "Marker assisted selection" or "MAS" is a process in which plants are selected for the presence of a particular locus or region or allele using the presence of a molecular marker (such as a SNP marker or an indel marker) that is genetically and physically linked to a particular locus or a particular chromosomal region or allele-specific marker. For example, a molecular marker that is genetically and physically linked to a mutant ClD14 allele or an allele-specific marker can be used to detect and / or select watermelon plants or plant parts that contain, for example, a mutant ClD14 allele. Allele-specific markers are preferred markers because they directly select for an allele.

[0161] "Transgene" or "chimeric gene" refers to a genetic locus containing a DNA sequence, such as a recombinant gene, that has been introduced into the genome of a plant by transformation, such as Agrobacterium-mediated transformation. A plant that contains a transgene stably integrated into its genome is called a "transgenic plant."

[0162] An "isolated nucleic acid sequence" or "isolated DNA" refers to a nucleic acid sequence that is no longer in the natural environment from which it was isolated, e.g., a nucleic acid sequence in a bacterial host cell or in a plant nuclear or plastid genome. It is understood that references herein to a "sequence" refer to a molecule, e.g., a nucleic acid molecule, having such a sequence.

[0163] "Host cell" or "recombinant host cell" or "transformed cell" are terms referring to a new individual cell (or organism) resulting from the introduction of at least one nucleic acid molecule into said cell. The host cell is preferably a plant cell or a bacterial cell. The host cell may contain the nucleic acid as an extrachromosomal (episomal) replicating molecule, or it may contain the nucleic acid integrated into the nuclear or plastid genome of the host cell, or it may contain the nucleic acid as an introduced chromosome, e.g., a minichromosome.

[0164] "Sequence identity" and "sequence similarity" can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms. Sequences can then be called "substantially identical" or "essentially similar" when they share at least a certain minimum percentage of sequence identity (as further defined below) when optimally aligned, for example by the programs GAP or BESTFIT or the Emboss program "Needle" (using default parameters, see below). These programs use the Needleman and Wunsch global alignment algorithm to align two sequences so that the number of matches is maximized and the number of gaps is minimized over their entire length. Generally, default parameters are used, with gap creation penalty = 10 and gap extension penalty = 0.5 (for both nucleotide and protein alignments). For nucleotides, the default scoring matrix used is DNAFULL, and for proteins, the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 10915-10919). Sequence alignment and percentage sequence identity scores can be determined using computer programs such as EMBOSS, available on the World Wide Web at, for example, ebi.ac.uk / Tools / psa / emboss_needle / . Alternatively, sequence similarity or identity can be determined by searching databases such as FASTA, BLAST, etc., but to compare sequence identity, hits should be obtained and aligned pairwise.Two proteins or two protein domains or two nucleic acid sequences have "substantial sequence identity" if the percentage sequence identity is at least 95%, 96%, 97%, 98%, 99% or more (as determined by Emboss "needle" using the scoring matrices DNAFULL for nucleic acids and Blosum62 for proteins using default parameters, i.e., gap creation penalty=10, gap extension penalty=0.5).

[0165] When reference is made to a nucleic acid sequence (e.g., DNA or genomic DNA) that has "substantial sequence identity with" a reference sequence or has a sequence identity of at least 95%, e.g., at least 96%, 97%, 98% or 99% nucleic acid sequence identity with a reference sequence, in one embodiment, the nucleotide sequence is considered to be substantially identical to the given nucleotide sequence and can be identified using stringent hybridization conditions. In another embodiment, a nucleic acid sequence contains one or more mutations compared to the given nucleotide sequence, but can still be identified using stringent hybridization conditions.

[0166] "Stringent hybridization conditions" can be used to identify nucleotide sequences that are substantially identical to a given nucleotide sequence. Stringent conditions are sequence-dependent and will be different in different circumstances. In general, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) of a particular sequence at a defined ionic strength and pH. Tm is the temperature (under defined ionic strength and pH) at which a probe that is 50% identical to the target sequence hybridizes. Typically, stringent conditions will be selected such that the salt concentration is about 0.02 molar at pH 7 and the temperature is at least 60°C. Reducing the salt concentration and / or increasing the temperature increases the stringency. Stringent conditions for RNA-DNA hybridization (e.g., Northern blots using a 100 nt probe) include at least one wash at t63°C for 20 minutes in 0.2×SSC or equivalent conditions. Stringent conditions for DNA-DNA hybridization (e.g., Southern blot using a 100 nt probe) include, for example, at least one wash (usually two) in 0.2×SSC for 20 minutes at a temperature of at least 50° C., usually about 55° C., or equivalent conditions.

[0167] "M1 generation" or "M1 plant" in the context of the present invention refers to the first generation directly generated from the mutagenesis treatment. For example, a plant grown from a seed treated with a mutagen is a representative example of the M1 generation.

[0168] "M2 generation" or "M2 plants" as used herein refer to the generation resulting from self-pollination of the M1 generation. Plants grown from seeds obtained from self-pollinated M1 plants are M2 plants. M3, M4, etc. refer to subsequent generations obtained after self-pollination.

[0169] "mRNA coding sequence" is intended to have its general meaning herein: it corresponds to the respective DNA coding (cDNA) sequence of a gene / allele, except that thymine (T) is replaced by uracil (U).

[0170] A "mutation" of a nucleic acid molecule (DNA or RNA) is a change in one or more nucleotides compared to the corresponding wild-type sequence, for example by substitution, deletion or insertion of one or more nucleotides. Examples of such mutations are point mutations, nonsense mutations, missense mutations, splice site mutations, frameshift mutations or mutations in regulatory sequences.

[0171] A "nucleic acid molecule" is as commonly understood in the art and is composed of nucleotides containing either the sugar deoxyribose (DNA) or ribose (RNA).

[0172] A "point mutation" is a substitution of a single base or an insertion or deletion of a single base.

[0173] A "nonsense mutation" is a (point) mutation in a nucleic acid sequence encoding a protein, which changes a codon in the nucleic acid molecule to a stop codon. This results in a premature stop codon being present in the mRNA, leading to the translation of a truncated protein. The truncated protein may have reduced or no function.

[0174] A "missense or non-synonymous mutation" is a (point) mutation in a nucleic acid sequence encoding a protein, whereby a codon is changed to code for a different amino acid. The resulting protein may have reduced or lost function.

[0175] A "splice site mutation" is a mutation in a nucleic acid sequence encoding a protein that alters RNA splicing of a pre-mRNA, resulting in an mRNA with a different nucleotide sequence than the wild-type and a protein with a different amino acid sequence. The resulting protein may have reduced or lost function.

[0176] A "frameshift mutation" is a mutation in a nucleic acid sequence encoding a protein, thereby altering the reading frame of the mRNA, resulting in a different amino acid sequence. The resulting protein may have reduced or lost function.

[0177] A "deletion" in the context of the present invention is intended to mean that, anywhere in a given nucleic acid sequence, at least one nucleotide is deleted compared to the nucleic acid sequence of the corresponding wild-type sequence, or, anywhere in a given amino acid sequence, at least one amino acid is deleted compared to the amino acid sequence of the corresponding (wild-type) sequence.

[0178] "Truncation" shall be understood to mean that at least one nucleotide at either the 3' or 5' end of a nucleotide sequence has been deleted compared to the nucleic acid sequence of the corresponding wild-type sequence, or at least one amino acid, but preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more amino acids at either the N- or C-terminus of the protein has been deleted compared to the amino acid sequence of the corresponding wild-type protein. The 5' end is determined by the ATG codon used as start codon in the translation of the corresponding wild-type nucleic acid sequence.

[0179] A "substitution" is intended to mean that at least one nucleotide in a nucleic acid sequence or at least one amino acid in a protein sequence differs compared to the corresponding wild-type nucleic acid sequence or the corresponding wild-type amino acid sequence, respectively, due to an exchange of a nucleotide in the coding sequence of the respective protein.

[0180] An "insertion" is intended to mean that the nucleic acid sequence or amino acid sequence of the protein contains at least one additional nucleotide or amino acid compared to the corresponding wild-type nucleic acid sequence or the corresponding wild-type amino acid sequence, respectively.

[0181] "Duplication" is intended to mean that one or more (consecutive) nucleotides or one or more (consecutive) amino acids are present at least twice in a nucleotide or amino acid sequence, instead of once in the wild-type sequence. Thus, a duplication is an insertion of one or more consecutive nucleotides or one or more consecutive amino acids that were already present once in the wild-type sequence. The insertion may be adjacent to the original sequence, or it may be separated by one or more nucleotides or amino acids, i.e. it may be duplicated further away from the original sequence.

[0182] A "premature stop codon" in the context of the present invention means that a stop codon is present in a coding sequence (cds) closer to the 5' end start codon than the stop codon of the corresponding wild-type coding sequence.

[0183] For example, a "mutation in a regulatory sequence" in the promoter or enhancer of a gene is a change in one or more nucleotides compared to the wild-type sequence, e.g., by substitution, deletion or insertion of one or more nucleotides, that leads to, for example, a reduced or no mRNA transcript of the gene being produced.

[0184] A "protein mutation" is an alteration of one or more amino acid residues compared to the wild-type sequence, for example by substitution, deletion, truncation or insertion or duplication of one or more amino acid residues.

[0185] A "mutant protein," as used herein, is a protein that contains one or more mutations in a nucleic acid sequence encoding the protein, whereby the mutations result in a (mutated nucleic acid molecule encoding) a "reduced-function" or "loss-of-function" protein, e.g., as measurable in vivo, e.g., by a phenotype conferred by a mutant allele.

[0186] "Wild-type three-dimensional structure" or "wild-type protein fold" refers to the in vivo folding of a wild-type protein to carry out its normal function in vivo. "Modified three-dimensional structure or modified protein fold" refers to a mutant protein that has a different fold than the wild-type protein, which reduces or eliminates its normal function or activity in vivo, i.e., the protein has reduced or lost function. Protein truncation also leads to modified three-dimensional structures. The 3-D structure can be predicted, for example, using a program such as RaptorX, comparing the predicted wild-type protein structure to the predicted protein structure to be modified.

[0187] In the context of the present invention, a "reduced activity" of a protein is intended to mean a reduced activity of the D14 protein when compared to the corresponding wild-type plant cell or the corresponding wild-type plant. Reduction, in one aspect, is intended to include a complete knockout or knockdown of gene expression or the production of a loss-of-function or reduced-function D14 protein, e.g., a mutant D14 protein may have a loss-of-function or reduced-function compared to a wild-type functional D14 protein. The reduced activity may be a reduced expression (also called knockdown) of the gene encoding the D14 protein, or a knockout of the expression of the gene encoding the D14 protein and / or a reduced amount of D14 protein in the cell, or a reduced function or loss-of-function of the activity of the D14 protein in the cell. As it has been found that D14 protein function directly reflects (causes) the degree of secondary branching, a loss-of-function protein (or knockout allele) or a reduced-function protein (or knockdown allele) may be phenotypically determined in a plant homozygous for the mutant allele and will be seen in either a "full multi-branching" phenotype or an "intermediate multi-branching" phenotype.

[0188] In the context of the present invention, the term "wild type plant cells" or "wild type plants" means that they contain a wild type D14 allele and do not contain a mutant D14 allele. Thus, a wild type plant or wild type plant cell is a plant or plant cell that contains a fully functional D14 gene encoding a fully functional ClD14, CsD14 or CmD14 protein (also called wild type D14 protein), for example, for a watermelon plant or plant cell, a diploid watermelon plant that contains SEQ ID NO:6 in its genome and / or produces a protein of SEQ ID NO:2 (or a protein that contains at least 95% sequence identity with SEQ ID NO:2) and has a normal branching phenotype.

[0189] A "knockout" or "complete knockout" shall be understood as meaning that the expression of the respective gene is no longer detectable.

[0190] "Loss of function", or "reduced function", or "reduced function", in the context of the present invention, shall mean that the protein is likely present in equal or similar amounts as the corresponding wild-type protein, but no longer causes its normal effect, i.e., for a mutant allele encoding such a protein, when present homozygously in a diploid plant, the plant will develop the phenotypic changes described elsewhere herein. As described, it has been found that D14 protein function directly reflects (causes) the degree of secondary branching, and loss-of-function or reduced-function proteins can be phenotypically determined in plants homozygous for the mutant allele, and will be seen in either a "full multi-branching" phenotype or an "intermediate multi-branching" phenotype.

[0191] "Catalytic triad" refers to the three conserved amino acids in the wild-type ClD14, CsD14 and CmD14 proteins, S97, D218 and H247 of SEQ ID NO:2 (ClD14), SEQ ID NO:8 (CsD14) and SEQ ID NO:9 (CmD14). "Targeted gene editing" refers to techniques by which an endogenous target gene can be modified, e.g., one or more nucleotides can be inserted, substituted and / or deleted, e.g., in a promoter or coding sequence. For example, CRISPR-based techniques such as Crispr-Cas9 gene editing, Crispr-CpfI gene editing, or a more recent technique referred to as "base editing" or "primer editing" can be used to modify endogenous target genes such as the endogenous wild-type ClD14 gene in watermelon (encoding a protein of SEQ ID NO:2 or a wild-type protein that contains at least 95% sequence identity to SEQ ID NO:2), the endogenous wild-type CsD14 gene in cucumber (encoding a protein of SEQ ID NO:8 or a wild-type protein that contains at least 95% sequence identity to SEQ ID NO:8), and the endogenous wild-type CmD14 gene in melon (encoding a protein of SEQ ID NO:9 or a wild-type protein that contains at least 95% sequence identity to SEQ ID NO:9).

[0192] An "oligonucleotide" or "oligo" or "oligonucleotide primer or probe" is a short, single-stranded polymer of nucleic acid, e.g., at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more nucleotides in length. Oligos can be unmodified or modified with various chemical reactions depending on their intended use, e.g., addition of 5' or 3' phosphate groups to allow ligation or block extension, respectively, labeling with radionuclides or fluorophores and / or quenchers for use as probes, incorporation of thiols, amino or other reactive moieties to allow covalent attachment of functional molecules such as enzymes, and extension with other linkers and spacers of various functionalities. DNA oligos are most commonly used, but RNA oligos are also available. The length of an oligo is usually designated by adding the suffix -mer. For example, an oligonucleotide with 19 nucleotides (bases) is called a 19-mer. In most uses, oligonucleotides are designed to base pair with strands of DNA or RNA. The most common use of oligonucleotides is as primers for PCR (polymerase chain reaction). Primers are designed with at least a portion of their sequence complementary to the sequence targeted for amplification. Optimal primer lengths for complementary sequences are, for example, 18-22 nucleotides. Optimal primer sequences for PCR are usually determined by primer design software.

[0193] A "DNA microarray" is an array with many microscopic spots of DNA, usually oligonucleotides, attached to a solid support. The assay target can be DNA, cDNA, or cRNA. Depending on the system, hybridization of the target to a specific spot is detected by fluorescence, chemiluminescence, or colloidal silver or gold. Microarrays are used in multiple applications, such as simultaneous measurement of the expression of many genes, allowing genome-wide gene expression analysis, as well as genotyping studies, for example, using single nucleotide polymorphism (SNP) or indel analysis.

[0194] "Complementary strand" refers to two complementary strands, sometimes referred to as the sense (or positive) and antisense (or negative) strands for double-stranded DNA. The sense / positive strand is generally the transcribed sequence of DNA (or the mRNA produced by transcription), while the antisense / negative strand is the strand complementary to the sense sequence. For any sequence provided herein, only one strand of the sequence is shown, but the complementary strand of the shown strand is also encompassed herein. The complementary nucleotides of DNA are A, which is complementary to T, and G, which is complementary to C. The complementary nucleotides of RNA are A, which is complementary to U, and G, which is complementary to C. [Brief description of the drawings]

[0195] [Figure 1] Pairwise amino acid sequence alignment between the wild-type (WT) ClD14 protein of SEQ ID NO: 2 and the mutant ClD14ins protein of SEQ ID NO: 1. The eight overlapping amino acids are highlighted in bold. [Diagram 2] Pairwise amino acid sequence alignment between the Arabidopsis AtD14 protein (SEQ ID NO: 7) and the ClD14ins protein of SEQ ID NO: 1. The amino acids of the catalytic triad are highlighted in bold. [Diagram 3] Multiple sequence alignment of the watermelon ClD14ins protein of SEQ ID NO:1, and the wild-type cucumber CsD14 protein (SEQ ID NO:8), and the wild-type melon CmD14 protein (SEQ ID NO:9). [Figure 4-1] Pairwise alignment of the wild-type genomic sequence (SEQ ID NO:6) encoding the wild-type watermelon ClD14 protein of SEQ ID NO:2 and the mutant genomic sequence (SEQ ID NO:5) containing 24 duplicated / inserted nucleotides and encoding the mutant protein of SEQ ID NO:1 (containing a duplication of eight amino acids, including one of the amino acids at the catalytic triad, S97). Intron sequences are shown in bold. [Figure 4-2] Continued from Figure 4-1. [Diagram 5]Allelic discrimination plot for indel marker mWM23349015_k2 with Fam alleles (mutated insertion alleles) on the X-axis and VIC alleles (wild type / deletion alleles) on the Y-axis. [Figure 6] TILLING mutants identified in the wild-type ClD14 protein are shown in bold and underlined with the amino acid substitutions indicated below. The boxed amino acids are those of the catalytic triad. The light grey bar indicates the helical lid domain from amino acids 136 to 193 (described in Seto et al., 2019, Nature Communications 10:191). The two black triangles (with arrows) indicate the start and end of the conserved domain IPR00073 (amino acids 22 to 259), an InterPro domain described as the "α / β hydrolase fold-1" or "AB_hydrolase_1" domain. This domain is described as follows: The α / β hydrolase fold is common to several hydrolases of diverse phylogenetic origins and catalytic functions. The core of each enzyme is an α / β-sheet (rather than a barrel) containing eight strands connected by helices. The enzymes are thought to diverge from a common ancestor, conserving the arrangement of the catalytic residues. All have a catalytic triad, elements of which are located on loops that are the most conserved structural features of the fold. The catalytic triad is shown on loops. One of these, the nucleophile elbow, is the most conserved structural feature of the fold. [Figure 7] The photograph on the right shows a W155STOP TILLING mutant (homozygous for the W155STOP allele) displaying a multi-branching phenotype. The photograph on the left shows a single organ plant (homozygous for the wild type allele) in which functional ClD14 protein binds strigolactone and suppresses secondary branching. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0196] A first embodiment of the present invention relates to a cultivated watermelon, cucumber or melon plant that comprises at least one copy of a mutant allele of a gene referred to herein as the D14 gene (ClD14, CsD14 or CmD14), which (when homozygous) confers an altered average number of secondary branches that develop compared to a plant that is homozygous for a functional wild-type allele of the gene.

[0197] The ClD14 gene is an endogenous gene in cultivated watermelon that, when mutated and in homozygotes, results in a significant increase in the secondary branches produced by the plant.

[0198] In multibranched watermelon, both copies of the endogenous allele of the ClD14 gene were found to contain a 24 nucleotide duplication in the coding sequence, thus leading to a duplication of eight amino acids. The protein is referred to herein as ClD14ins and is shown in SEQ ID NO:1. The duplication included one of the amino acids of the catalytic triad (S97). It was initially speculated by the inventors that this duplication may reduce or abolish proper function of the catalytic triad in vivo.

[0199] D14 is a complex protein with several functions in plants and several functional domains in proteins, including strigolactone binding, hydrolysis, interactions with a variety of other proteins and ligands, structural changes and signal transduction.

[0200] Therefore, the truncated, non-functional D14 protein (W155 *It was highly unexpected that TILLING mutants that generated a D14 protein (referred to as a D14 protein) had the same phenotype as the protein containing the eight amino acid duplication. This meant that the protein containing the eight amino acid duplication (including the catalytic triad amino acid S97) was indeed a loss-of-function protein, and that the phenotype seen was the strongest secondary branching (referred to herein as "fully multibranched" or "strongly multibranched"). It also means that mutant proteins that do not have a complete loss of function can be generated, giving rise to an "intermediate multibranched" phenotype, i.e., secondary branch formation is suppressed such that there is only partial suppression of secondary branching, and signaling pathways that are still triggered and transduced by the reduced function D14 protein.

[0201] Thus, in one aspect, there is provided a watermelon plant comprising a mutant allele of a gene designated ClD14 (Citrullus lanatus Dwarf14), wherein the mutant allele comprises a mutation in one or more regulatory sequences that results in reduced or no gene expression compared to a corresponding wild type allele, or the mutant allele encodes a protein that comprises a deletion, truncation, insertion or substitution of one or more amino acids compared to the protein encoded by the wild type allele, resulting in reduced or lost function of the ClD14 protein, and the mutant allele results in said plant developing an increased average number of secondary branches when the mutant allele is homozygous, and the mutant allele is not a mutant allele that encodes the protein of SEQ ID NO:1 (ClD14ins protein), and the ClD14 protein of the wild type allele a) a nucleic acid molecule encoding a protein having the amino acid sequence set forth in SEQ ID NO:2; b) a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO:6 or its complementary sequence A watermelon plant is provided, wherein the watermelon plant is encoded by a nucleic acid molecule selected from the group consisting of:

[0202] In one aspect, the mutant allele encodes a protein in which one or more amino acids are inserted, substituted or deleted, resulting in a loss of function of the protein, such that the average number of secondary branches is at least 200%, 210%, 215%, 220% or more than its highest level (full multibranching), e.g., at least 200%, 210%, 215%, 220% or more than that of a wild-type control plant containing a wild-type allele in homozygote, e.g., it is a non-functional protein ClD14ins protein or W155 * As many as plants are homozygous for a mutant ClD14 allele that encodes a protein, the mutant allele is not an allele that encodes the ClD14ins protein of SEQ ID NO: 1. Thus, the genome of the plant does not contain SEQ ID NO: 5 on chromosome 8, which is the genomic sequence that encodes the ClD14ins protein.

[0203] ClD14 alleles encoding loss-of-function D14 proteins can be easily generated de novo, for example by random or targeted mutagenesis. Two specific mutant alleles are generated in the examples: W155 * Mutants and Q255 * However, any other mutant alleles that result in loss of ClD14 protein function are included and can be easily generated and their phenotypes tested.

[0204] In another embodiment, the mutant allele encodes a protein in which one or more amino acids have been inserted, substituted or deleted, resulting in a reduced function of the protein, but not a loss of function of the protein, such that the average number of secondary branches is greater than in plants homozygous for a wild-type ClD14 allele, but not greater than, for example, the ClD14ins protein or W155. * There are fewer plants that are homozygous for a mutant ClD14 allele that encodes a non-functional protein, such as a mitochondrial protein.

[0205] The watermelon plant, in one embodiment, is homozygous for the mutant allele and develops an increased average number of secondary branches (full or intermediate multibranching) compared to a plant homozygous for the wild-type allele. Also included are seeds from which plants having increased average secondary branches (full or intermediate multibranching) can be grown.

[0206] For the original polybranched mutant (containing an 8 amino acid duplication referred to herein as the ClD14ins protein), a high-throughput genotyping assay based on indel markers (insertion / deletion) in the mutant allele, i.e., the insertion of 24 additional nucleotides in the mutant / modified allele and the "deletion" (absence) of these 24 nucleotides in the wild-type allele, was developed to screen the genomic DNA of populations of plants, seeds or plant parts for indels. Figure 4 shows the genomic sequences of the ClD14 wild-type allele (SEQ ID NO:6; "24 nucleotide deletion") and the mutant / modified allele (SEQ ID NO:5, "24 nucleotide insertion").

[0207] The two sequences containing the indel that were used to design two forward and one reverse PCR primers are shown in SEQ ID NO:13 (the "deletion" sequence, i.e. the wild type allele) and SEQ ID NO:14 (the "insertion sequence", i.e. the mutant allele). These are the sequences of the reverse strand (-strand) of the allele. The forward strand (plus strand) is shown in SEQ ID NO:6 (the wild type genomic sequence) and SEQ ID NO:5 (the mutant genomic sequence with an insertion) and further in FIG. 4.

[0208] However, similar genotyping assays can be developed (and are encompassed herein) for any mutant allele of the D14 gene, such as any mutant shown in Table A or Table 2, or other mutant alleles of the ClD14 gene.

[0209] Thus, in one aspect, there is provided a genotyping assay for genotyping a watermelon plant, seed, plant part, cell or tissue, comprising: a) providing genomic DNA of one or more watermelon plants or a population of plants; b) performing a genotyping assay to detect the presence of a wild type allele and / or the presence of a mutant allele of SEQ ID NO: 6 (or its complement), wherein the mutant allele comprises one or more nucleotides that are inserted, deleted, substituted or duplicated relative to SEQ ID NO: 6; and, optionally, c) selecting plants, seeds, plant parts, cells or tissues that contain either two copies of the wild-type allele, or one copy of the wild-type allele and one copy of the mutant allele, or two copies of the mutant allele; A genotyping assay is provided comprising:

[0210] In step b), the mutation of the mutant allele preferably results in the insertion, deletion or substitution of one or more amino acids compared to the wild-type protein.

[0211] In one aspect, a genotyping assay for genotyping a watermelon plant, plant part, cell or tissue, comprising: a) providing genomic DNA of one or more watermelon plants or populations of plants (e.g., breeding populations, F2 populations, backcross populations, etc.); b) performing a genotyping assay to detect the presence of a wild type allele encoding a protein of SEQ ID NO:2 and / or the presence of a mutant allele, the mutant allele comprising one or more amino acids that are inserted, deleted, substituted or duplicated compared to SEQ ID NO:2; and, optionally, c) selecting plants, seeds, plant parts, cells or tissues that contain either two copies of the wild-type allele, or one copy of the wild-type allele and one copy of the mutant allele, or two copies of the mutant allele; A genotyping assay is provided comprising:

[0212] Step a) may involve the isolation of genomic DNA from the plant, seed, plant part, cell or tissue to be analyzed in the genotyping assay. Often, crude DNA extraction methods may be used, as known in the art.

[0213] Step b) preferably comprises a bi-allele genotyping assay utilising allele-specific primers and / or allele-specific probes.

[0214] The plant of step a) may be mutagenized, for example, using chemical or radiation mutagens or gene editing techniques. Thus, prior to step a), there may be a step of treating the plant, seed or plant part with a mutagen or of inducing targeted mutations in the ClD14 allele.

[0215] Various genotyping assays can be used as long as they can detect indels and SNPs and can distinguish between the wild-type allele of SEQ ID NO: 6 present in genomic DNA (at the ClD14 locus on chromosome 8) or the mutant allele of the ClD14 gene present in genomic DNA. Genotyping assays are generally based on allele-specific primers that are used to amplify either the wild-type or mutant allele in a PCR or thermocycling reaction (polymerase chain reaction) and detect the amplification product, or on allele-specific oligonucleotide probes that hybridize to either the wild-type or mutant allele or both. For example, genotyping with BHQplus probes uses two allele-specific probes and two primers flanking the region of the polymorphism, and during thermocycling, the polymerase encounters the allele-specific probes bound to DNA and emits a fluorescent signal. Allele discrimination involves competitive binding of two allele-specific BHQPlus probes (see also biosearchtech.com).

[0216] Examples of genotyping assays include the KASP assay (by LGC, see www.LGCgenomics.com and also www.biosearchtech.com / products / pcr-kits-and-reagents / genotyping-assays / kasp-genotyping-chemistry), which is based on competitive allele-specific PCR and end-point fluorescence detection, the TaqMan assay (Applied Biosytstems), which is also PCR-based, the HRM assay (high resolution melting assay), in which allele-specific probes are detected using real-time PCR, or the rhAmp assay, which is based on Rnase H2-dependent PCR, BHQplus genotyping, BHQplex CoPrimer genotyping, and many others.

[0217] The KASP assay is also described in He C, Holme J, Anthony J. 'SNP genotyping: the KASP assay. Methods Mol Biol. 2014;1145:75-86' and in EP 1726664 B1 or US 7615620 B2 (incorporated by reference). The KASP genotyping assay detects single nucleotide polymorphisms (SNPs) or insertions and deletions (indels) utilizing a unique form of competitive allele-specific PCR in combination with a novel homogeneous fluorescence-based reporter system for the identification and measurement of genetic variations occurring at the nucleotide level. The KASP technology is suitable for use on a variety of instrument platforms, offering flexibility in terms of the number of SNPs and number of samples that can be analyzed. The KASP chemistry works equally well in 96-well, 384-well and 1,536-well microtiter plate formats and has been utilized for many years in large and small laboratories by users across the fields of human, animal and plant genetics.

[0218] TaqMan genotyping assays are also described in Woodward J.'Bi-allelic SNP genotyping using the TaqMan® assay.' Methods Mol Biol.2014;1145:67-74, US Patent No. 5,210,015 and US Patent No. 5,487,972, which are incorporated herein by reference. In TaqMan® technology, allele-specific probes are used for rapid and reliable genotyping of known polymorphic sites. TaqMan assays are robust in genotyping multiple variants, including single nucleotide polymorphisms, insertions / deletions and the presence or absence of variants. To interrogate a single biallelic polymorphism, two TaqMan probes labeled with different fluorophores are designed to hybridize to different alleles during PCR-based amplification of the surrounding target region. During the primer extension phase of PCR, the fluorophore is cleaved and released from the bound probe by the 5'-3' exonuclease activity of Taq polymerase. At the end of the PCR, the emission intensity of each fluorophore is measured and a determination of the allele at the interrogated site can be made.

[0219] Thus, various genotyping assays can be used that can distinguish between the presence of a wild type allele of the ClD14 gene encoding the protein of SEQ ID NO: 2 or a mutant allele of the ClD14 gene. Various mutant alleles of the ClD14 gene can be detected. Thus, in addition to the mutant allele encoding the protein of SEQ ID NO: 1 (containing 8 additional amino acids due to the 24 nucleotide overlap), the assay can be designed to detect any other mutant allele of the ClD14 gene, such as any mutant allele as described in Table A or Table 2.

[0220] As described, preferably a biallelic genotyping assay may be used, such as the KASP assay, the TaqMan assay, the BHQplus assay, the PACE genotyping (see idtdna.com / pages / products / qpcr-and-pcr / genotyping / pace-snp-genotyping-assays on the world wide web) or any other biallelic genotyping assay.

[0221] In one embodiment, the genotyping assay in step b) of the above method is a KASP assay. Thus, in step b), competitive PCR is performed with two forward primers and one common reverse primer. The two forward primers comprise at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides complementary to SEQ ID NO: 6 (or its complementary strand). Furthermore, the two forward primers comprise one, two, three or more nucleotides (preferably at the 3' end of the primer) that provide specificity for SNPs or indels that distinguish the wild-type sequence of the allele from the mutant sequence. The two forward primers thereby have different binding specificities (or preferences) for either the wild-type allele or the mutant allele. For example, the Fam-primer comprises 17 nucleotides of the wild-type sequence and one nucleotide specific for the insertion allele, and the VIC-primer in the example comprises 18 nucleotides of the wild-type allele and one nucleotide specific for the "deletion" allele. The KASP assay can be readily designed to distinguish between the wild-type allele of SEQ ID NO:6 and any mutant allele of the ClD14 gene that differs from the wild-type allele by one or more inserted, deleted or substituted nucleotides, and thus, for example, the assay can be designed for any SNP or indel that distinguishes between the two alleles.

[0222] For example, it is noted that genotyping assays such as the KASP assay described in the Examples can also be performed to detect mutant and / or wild-type ClD14 alleles in triploid or tetraploid watermelon plants and plant parts in the same manner as described for diploid watermelon plants and plant parts.

[0223] In one embodiment, a mutant allele of the ClD14 gene encodes a protein that comprises one or more amino acids that are inserted, duplicated, substituted or deleted compared to the wild-type protein of SEQ ID NO:2.

[0224] In one aspect, a mutant allele of the ClD14 gene encodes a truncated protein compared to the protein of SEQ ID NO:2, e.g. at least 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more amino acids are deleted at the C-terminus or, optionally, the N-terminus.

[0225] In one aspect, a mutant allele of the ClD14 gene encodes a protein that contains one or more amino acids deleted or substituted compared to the protein of SEQ ID NO:2, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids are deleted or substituted with one or more different amino acids.

[0226] In another aspect, the mutant allele of the ClD14 gene encodes a protein which comprises one or more amino acids inserted or duplicated compared to the protein of SEQ ID NO:2, for example at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acids are inserted or duplicated. In one aspect, at least one or more amino acids from amino acid 94 to amino acid 101 of SEQ ID NO:2 are duplicated, preferably at least S97 is duplicated. In one aspect, at least 2, 3, 4, 5, 6, 7 or 8 consecutive amino acids from amino acid 94 to amino acid 101 of SEQ ID NO:2 are duplicated, preferably the consecutive amino acids include S97.

[0227] Thus, in one embodiment, there is provided a method for detecting and optionally selecting watermelon plants, seeds or plant parts that contain at least one copy of a wild type and / or mutant allele of a gene designated ClD14 (Citrullus lanatus Dwarf14), comprising: a) providing genomic DNA of a watermelon plant or a plurality of plants (e.g., a breeding population, an F2, a backcross, etc.); b) performing an assay (e.g., a bi-allelic genotyping assay) that distinguishes or is capable of distinguishing the presence of alleles in the genomic DNA of a) based on nucleic acid amplification (e.g., including the use of allele-specific oligonucleotide primers) and / or nucleic acid hybridization (e.g., including the use of allele-specific oligonucleotide probes) to detect the presence of a wild-type allele of the gene and / or a mutant allele of the gene, wherein the wild-type allele comprises the sequence of SEQ ID NO: 6 (or the wild-type allele encodes the protein of SEQ ID NO: 2) and the mutant allele comprises one or more nucleotides that are inserted, duplicated, deleted or substituted relative to the sequence of SEQ ID NO: 6 (or the mutant allele encodes a protein that comprises one or more amino acids that are inserted, duplicated, deleted or substituted relative to the wild-type protein of SEQ ID NO: 2); and, optionally, c) selecting plants, seeds or plant parts containing one or two copies of the mutant allele; A method is provided that includes:

[0228] In step b), the genotyping assay distinguishes between wild type and mutant alleles based on a nucleic acid (particularly DNA) amplification reaction using oligonucleotide primers, such as, for example, PCR (polymerase chain reaction) and PCR primers, preferably allele-specific primers, and / or nucleic acid hybridization using oligonucleotide probes, preferably allele-specific probes.

[0229] The primer or probe is preferably modified to include a label, such as a fluorescent label, or to include a tail sequence or other modification.

[0230] In one embodiment, in any of the above methods, the assay uses one or more ClD14 allele-specific primers or one or more ClD14 allele-specific probes. As described, based on the genomic sequence of SEQ ID NO:6 or other (e.g., degenerate) genomic sequence encoding the protein of SEQ ID NO:2 or the genomic sequence of a mutant allele encoding a protein that contains one or more amino acids inserted, duplicated, deleted or substituted compared to SEQ ID NO:2, PCR primers and nucleic acid probes can be designed using known methods or software programs for oligonucleotide design. The primers and probes can be, for example, at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more nucleotides (bases) in length and anneal to (or hybridize to) the template DNA sequence, i.e., they preferably have at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the target sequence. The primer or probe specificity for wild type or mutant alleles is due to at least one, two, three or more nucleotides of the primer or probe being specific for either allele. Thus, the primer or probe is designed as a polymorphism (e.g., SNP or indel) between the two alleles of the target gene, so that they distinguish between them. In one embodiment, the assay is a biallelic genotyping assay, for example, selected from KASP assay, TaqMan assay, BHQplus probe assay, or any other biallelic genotyping assay.

[0231] In one aspect, a mutant allele contains at least one codon that has been inserted or duplicated in the coding region of the allele, or at least one codon that has been changed to another codon (e.g., by a single base change), or at least one codon that has been deleted or changed to a stop codon.

[0232] In any of the above methods, in one aspect, the mutant allele comprises the sequence of SEQ ID NO:5, i.e., a 24 nucleotide insertion / duplication, resulting in a duplication of 8 amino acids in the protein. Thus, in one aspect, the method may be used to differentiate plants, seeds or plant parts that contain two copies of a wild type ClD14 allele encoding the protein of SEQ ID NO:2, two copies of a mutant ClD14 allele encoding the protein of SEQ ID NO:1, or one copy of each allele (heterozygote). Optionally, plants, plant parts or seeds containing any of these genotypes may be selected, for example, for further breeding or for use in watermelon production.

[0233] In any of the above methods, in another aspect, the mutant allele encodes a mutant protein as described herein, e.g., in Table A or Table 2. Thus, in one aspect, the method may be used to differentiate plants, seeds, or plant parts that contain two copies of a wild type ClD14 allele that encodes a protein of SEQ ID NO:2, two copies of a mutant ClD14 allele that encodes a mutant protein as described herein, e.g., in Table A or Table 2, or one copy of each allele (heterozygote). Optionally, plants, plant parts, or seeds that contain any of these genotypes may be selected, for example, for further breeding or for use in watermelon production.

[0234] Thus, in one aspect, in any of the above methods, the mutant allele encodes a loss-of-function or reduced-function protein, as described.

[0235] While any DNA genotyping assay, whether PCR-based (using PCR primers) and / or hybridization-based (using probes), can be used in the above methods, in one embodiment, the KASP assay is used to distinguish between wild-type and mutant alleles. This assay can be used in a high-throughput format, for example in 96-well plates or larger well plates (e.g., 384-well plates).

[0236] Depending on the SNP or indel between the wild-type and mutant ClD14 alleles, various allele-specific primers and probes can be designed for use in the assay.

[0237] In one embodiment, two forward primers (one for the wild type allele and one for the mutant allele) and one common reverse primer (for both wild type and mutant alleles) are used in the KASP assay. In one embodiment, the two forward primers and the reverse primer comprise at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more nucleotides of SEQ ID NO:6 or the complementary sequence of SEQ ID NO:6. The forward primer further comprises at least 1, 2 or 3 nucleotides (preferably at the 3' end of the primer) that confer specificity (or preference) for either the amplification of the wild type allele or the amplification of the mutant allele. Each forward primer forms a primer pair with the common reverse primer to amplify the DNA sequence of the target allele between the primer pair during thermal cycling. Standard components for thermal cycling are used, and standard components for KASP assay are used.

[0238] In one embodiment, the KASP assay distinguishes between indels found in ClD14 alleles, i.e., the KASP assay can distinguish between the presence of genomic DNA of SEQ ID NO:6 (ClD14 wild type, normal branched allele) in homozygotes, the presence of SEQ ID NO:5 (ClD14 allele with an insertion, multi-branched allele) in homozygotes, and the presence of both SEQ ID NO:6 and SEQ ID NO:5 in the watermelon genome. Different forward and reverse primers can be designed to achieve allele discrimination in the assay.

[0239] In one aspect, the forward primer comprises the sequence of SEQ ID NO: 10 and / or SEQ ID NO: 11 or a complementary sequence of any of these. In one aspect, the common primer optionally comprises the sequence of SEQ ID NO: 12 or a complementary sequence thereof.

[0240] In one aspect, the primers comprise one or more of SEQ ID NO:10 (forward primer), SEQ ID NO:11 (forward primer) and SEQ ID NO:12 (common primer) or a sequence comprising at least 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:12 or a complementary sequence of any one of these sequences.

[0241] In another embodiment, a method for producing hybridization or amplification products of wild type and / or mutant alleles of a gene designated ClD14 (Citrullus lanatus Dwarf14) comprising: a) providing genomic DNA of a watermelon plant or a plurality of plants (e.g., a breeding population, an F2, a backcross, etc.); b) performing an assay (e.g. a bi-allele genotyping assay) that distinguishes or is capable of distinguishing the presence of the alleles in the genomic DNA of a), where the assay generates a nucleic acid amplification product (e.g. by using an allele-specific oligonucleotide primer to generate said product) and / or the assay generates a nucleic acid hybridization product (e.g. by using an allele-specific oligonucleotide probe to generate a hybridization product), whereby the amplification product or hybridization product indicates the presence of a wild-type allele of the gene and / or a mutant allele of the gene in the DNA, where the wild-type allele comprises the sequence of SEQ ID NO: 6 (or the wild-type allele encodes a protein of SEQ ID NO: 2) and the mutant allele comprises one or more nucleotides that are inserted, duplicated, deleted or substituted relative to the sequence of SEQ ID NO: 6 (or the mutant allele encodes a protein that comprises one or more amino acids that are inserted, duplicated, deleted or substituted relative to the wild-type protein of SEQ ID NO: 2); and, optionally, performing c) selecting plants, seeds or plant parts containing one or two copies of the mutant allele; A method is provided that includes:

[0242] Also provided is a method for amplifying all or a portion of a mutant and / or wild-type ClD14 allele from a genomic DNA sample derived from a watermelon plant, plant part or seed, comprising contacting the genomic DNA with a primer pair that amplifies all or a portion of a mutant ClD14 or a wild-type ClD14 allele in the sample, and detecting the amplification product.

[0243] Also provided is a method for hybridizing a probe to mutant and / or wild-type ClD14 alleles in a genomic DNA sample derived from a watermelon plant, plant part or seed, comprising contacting the genomic DNA with an oligonucleotide probe that hybridizes to a mutant ClD14 or a wild-type ClD14 allele in the sample and detecting the hybridization product.

[0244] All embodiments described above and elsewhere herein also apply to these embodiments. Thus, the amplification products can be PCR amplification products, e.g., competitive PCR amplification products, generated, for example, in a KASP assay or other assay, to detect mutant and / or wild-type alleles in a DNA sample. Thus, the hybridization products can be hybridization products of oligonucleotide probes that hybridize to nucleic acids in a DNA sample to detect mutant and / or wild-type alleles in the DNA sample. The primer pairs or probes are preferably allele-specific, and thus, these products are distinguishable as either two copies of the wild-type allele, two copies of the mutant allele, or one copy of each, present in the genomic DNA of the watermelon plant, plant part, or seed.

[0245] Primers or probes are preferably modified, eg, labeled or otherwise modified, with a tail sequence or a fluorescent label, compared to the wild-type sequence to which they amplify or hybridize.

[0246] Since the methods described require detection of mutant and / or wild type alleles in the genomic DNA of plants, plant parts or seeds, genomic DNA needs to be available for detection, e.g. it can be extracted from plant cells using DNA extraction methods, or at least eluted from damaged cells in solution (e.g. buffer).

[0247] Since orthologous genes in other Cucurbitaceae are provided herein, the above methods can also be applied to other D14 genes and alleles in other species, particularly cucumber and melon.

[0248] Thus, in one aspect there is provided a genotyping assay for genotyping a watermelon, cucumber or melon plant, seed, plant part, cell or tissue comprising: a) providing genomic DNA of one or more watermelon, cucumber or melon plants or populations of plants (e.g., breeding populations, F2 populations, backcross populations, etc.); b) performing a genotyping assay capable of or which detects the presence of a wild type allele of SEQ ID NO: 6 or comprising at least 95% identity thereto (watermelon gene), or SEQ ID NO: 15 or comprising at least 95% identity thereto (cucumber gene), or SEQ ID NO: 16 or comprising at least 95% identity thereto (melon gene) and / or the presence of a mutant allele, wherein the mutant allele comprises one or more nucleotides that are inserted, deleted, substituted or duplicated compared to SEQ ID NO: 6 (or compared to the wild type sequence comprising at least 95% identity thereto), SEQ ID NO: 15 (or compared to the wild type sequence comprising at least 95% identity thereto), or SEQ ID NO: 16 (or compared to the wild type sequence comprising at least 95% identity thereto); and, optionally, c) selecting plants, seeds, plant parts, cells or tissues that contain either two copies of the wild-type allele, or one copy of the wild-type allele and one copy of the mutant allele, or two copies of the mutant allele; A genotyping assay is provided comprising:

[0249] In one aspect, there is provided a genotyping assay for genotyping a watermelon, melon or cucumber plant, seed, plant part, cell or tissue, comprising: a) providing genomic DNA of one or more watermelon, cucumber or melon plants or populations of plants (e.g., breeding populations, F2 populations, backcross populations, etc.); b) performing a genotyping assay capable of (or which detects) the presence of a wild-type allele encoding a protein of SEQ ID NO:2 or a protein comprising at least 95% sequence identity thereto (watermelon wild-type ClD14 protein), or a protein of SEQ ID NO:8 or a protein comprising at least 95% sequence identity thereto (cucumber wild-type ClD14 protein), or a protein of SEQ ID NO:9 or a protein comprising at least 95% sequence identity thereto (melon wild-type ClD14 protein), wherein the mutant allele comprises one or more amino acids that are inserted, deleted, substituted or duplicated compared to SEQ ID NO:2 (or compared to the wild-type sequence comprising at least 95% identity thereto), or SEQ ID NO:8 (or compared to the wild-type sequence comprising at least 95% identity thereto), or SEQ ID NO:9 (or compared to the wild-type sequence comprising at least 95% identity thereto); and, optionally, c) selecting plants, seeds, plant parts, cells or tissues that contain either two copies of the wild-type allele, or one copy of the wild-type allele and one copy of the mutant allele, or two copies of the mutant allele; A genotyping assay is provided comprising:

[0250] Accordingly, there is provided a method for detecting and optionally selecting watermelon, cucumber or melon plants, seeds or plant parts which contain at least one copy of a wild type and / or mutant allele of a gene designated ClD14 (Citrullus lanatus Dwarf14), CsD14 (Cucumis sativus Dwarf14) or CmD14 (Cucumis melo Dwarf14), comprising: a) performing an assay on a genomic DNA sample obtained from at least one plant to detect or distinguish the D14 allele based on nucleic acid amplification and / or nucleic acid hybridization to detect the presence of a wild type allele of the gene and / or a mutant allele of the gene, wherein the wild type allele encodes a protein of SEQ ID NO:2 or a protein comprising at least 95% sequence identity thereto (in watermelon), a protein of SEQ ID NO:8 or a protein comprising at least 95% sequence identity thereto (in cucumber) and a protein of SEQ ID NO:9 or a protein comprising at least 95% sequence identity thereto (in melon), and the mutant allele comprises one or more amino acids that are inserted, deleted or substituted compared to SEQ ID NO:2 (or compared to the wild type sequence comprising at least 95% identity thereto), SEQ ID NO:8 (or compared to the wild type sequence comprising at least 95% identity thereto) or SEQ ID NO:9 (or compared to the wild type sequence comprising at least 95% identity thereto); and optionally b) selecting plants, seeds or plant parts that contain one or two copies of the mutant allele; A method is provided that includes:

[0251] Further provided is a method for determining the genotype of the D14 gene and, optionally, selecting a particular genotype, for example a watermelon, cucumber or melon plant, seed or plant part comprising at least one copy of a wild type and / or mutant allele of the gene designated ClD14 (Citrullus lanatus Dwarf14), CsD14 (Cucumis sativus Dwarf14) or CmD14 (Cucumis melo Dwarf14), comprising a) performing a bi-allele genotyping assay on one or more genomic DNA samples obtained from one or more plants, the genotyping assay detecting or distinguishing D14 alleles based on D14 allele-specific primers and / or D14 allele-specific probes, where the allele-specific primers or allele-specific probes detect the presence of a wild type allele of the gene or a mutant allele of the gene, the wild type alleles encoding SEQ ID NO: 2 or a protein comprising at least 95% sequence identity thereto (in watermelon), SEQ ID NO: 8 or a protein comprising at least 95% sequence identity thereto (in cucumber) and SEQ ID NO: 9 or a protein comprising at least 95% sequence identity thereto (in melon), and the mutant alleles comprising one or more amino acids that are inserted, deleted or substituted compared to SEQ ID NO: 2 (or compared to the wild type sequence comprising at least 95% identity thereto), SEQ ID NO: 8 (or compared to the wild type sequence comprising at least 95% identity thereto) or SEQ ID NO: 9 (or compared to the wild type sequence comprising at least 95% identity thereto); and optionally b) selecting one or more plants, seeds or plant parts that contain one or two copies of the mutant allele; A method is provided that includes:

[0252] Such assays can be used, for example, for marker-assisted selection (MAS) of plants in breeding programs to select plants containing particular genotypes, for example, homozygous for a wild-type allele (with normal secondary branching) of the D14 gene, homozygous or heterozygous for a mutant D14 allele.

[0253] Thus, also provided herein is a method of breeding a watermelon, cucumber or melon plant, the method comprising genotyping one or more plants for allelic composition at the D14 locus in the genome, and optionally selecting one or more plants having a particular genotype at the D14 locus. In one embodiment, genotyping by sequencing can also be performed on the D14 gene.

[0254] As described, optionally, plants or seeds containing two copies of the mutant D14 allele can be grown and phenotyped for secondary branching phenotype. The mutant allele, in one aspect, is a mutant allele that confers multiple branching / increased secondary branching in homozygotes. In one aspect, the mutant allele confers "full multiple branching" when homozygotes. In another aspect, the mutant allele confers "intermediate multiple branching" when homozygotes. Thus, the mutant allele can contain one or more nucleotides that are substituted, inserted or deleted, such that the encoded protein has a loss of function or the allele is not expressed in the plant, resulting in "full multiple branching" when the mutant allele is homozygotes, or the mutant allele can contain one or more nucleotides that are substituted, inserted or deleted, such that the encoded protein has a reduced function or the allele has reduced expression in the plant, resulting in "intermediate multiple branching" when the mutant allele is homozygotes.

[0255] In one aspect, the mutant allele encodes a protein having reduced or lost function in vivo, since at least one amino acid in the IPR000073 domain of SEQ ID NO:2, SEQ ID NO:8 and SEQ ID NO:9 (or the equivalent amino acid in a protein with at least 95% identity to any of these) has been deleted or replaced with a different amino acid or a stop codon. In another aspect, the mutant allele encodes a protein having reduced or lost function in vivo, since at least one amino acid in the IPR000073 domain of SEQ ID NO:2, SEQ ID NO:8 and SEQ ID NO:9 (or the equivalent amino acid in a protein with at least 95% identity to any of these) has been inserted or duplicated.

[0256] In a different embodiment, the mutant allele encodes a protein having reduced or lost function in vivo because a protein comprising at least one amino acid in the helical lid domain of SEQ ID NO:2, SEQ ID NO:8, and SEQ ID NO:9 (or an equivalent amino acid in a protein comprising at least 95% identity to any of these) has been deleted or replaced with a different amino acid or a stop codon. In another embodiment, the mutant allele encodes a protein having reduced or lost function in vivo because a protein comprising at least one amino acid in the helical lid domain of SEQ ID NO:2, SEQ ID NO:8, and SEQ ID NO:9 (or an equivalent amino acid in a protein comprising at least 95% identity to any of these) has been inserted or duplicated.

[0257] In another aspect, mutant alleles encode proteins that have reduced or lost function in vivo because at least one amino acid of the catalytic triad of SEQ ID NO:2, SEQ ID NO:8 and SEQ ID NO:9 (or the equivalent amino acid in a protein that comprises at least 95% identity to any of these) or a protein that comprises 1, 2, 3, 4, 5, 6, 7 or 8 amino acids before or after the catalytic triad amino acid is deleted or substituted with a different amino acid or a stop codon. In another aspect, mutant alleles encode proteins that have reduced or lost function in vivo because a protein that comprises at least one amino acid of the catalytic triad of SEQ ID NO:2, SEQ ID NO:8 and SEQ ID NO:9 (or the equivalent amino acid in a protein that comprises at least 95% identity to any of these) is duplicated, or because at least one of 1, 2, 3, 4, 5, 6, 7 or 8 amino acids before or after the catalytic triad amino acid is duplicated, or because at least one amino acid is inserted in the stretch of 8 amino acids before or after the catalytic triad amino acid.

[0258] In yet another embodiment, the mutant allele encodes a protein of Table A or Table 2.

[0259] In one aspect, the mutant allele encodes a protein that contains a duplication of at least one amino acid selected from amino acids 94-101 of SEQ ID NO:2, SEQ ID NO:8, and SEQ ID NO:9 (or an equivalent amino acid in a protein that contains at least 95% identity to any of these).

[0260] In one aspect, the mutant allele encodes a protein that comprises a duplication of at least serine 97 of SEQ ID NO:2, SEQ ID NO:8 and SEQ ID NO:9 (or an equivalent amino acid in a protein that comprises at least 95% identity to any of these).

[0261] In yet other aspects, the mutant allele encodes a protein that contains a duplication of amino acids 94 to 101 of SEQ ID NO:2, SEQ ID NO:8, or SEQ ID NO:9 (or the equivalent amino acids in a protein that contains at least 95% identity to any of these).

[0262] The embodiments further described above for the assay for detecting watermelon ClD14 wild-type and / or mutant alleles also apply to the assay for detecting cucumber CsD14 wild-type and / or mutant alleles or melon CmD14 wild-type and / or mutant alleles.

[0263] In a different aspect, a watermelon, cucumber or melon plant, seed or plant part is provided that comprises at least one copy of a mutant allele of a gene designated ClD14 in watermelon, CsD14 in cucumber and CmD14 in melon, said mutant allele comprising: a) contains one or more mutations in a regulatory element that result in no or reduced expression of the allele compared to the wild-type allele; and / or b) encodes a mutant protein that contains one or more amino acids that are substituted, inserted, duplicated or deleted compared to the wild-type protein, The mutant allele of a) or b) confers an increased average number of secondary branches occurring when the mutant allele is homozygous (compared to a plant containing the wild-type allele in homozygote), wherein the wild-type watermelon ClD14 allele encodes a protein of SEQ ID NO:2 or a protein that has at least 95%, 96%, 97%, 98%, 99% or more sequence identity with SEQ ID NO:2, the wild-type cucumber CsD14 allele encodes a protein of SEQ ID NO:8 or a protein that has at least 95%, 96%, 97%, 98%, 99% or more sequence identity with SEQ ID NO:8, and the wild-type melon CmD14 allele encodes a protein of SEQ ID NO:9 or a protein that has at least 95%, 96%, 97%, 98%, 99% or more sequence identity with SEQ ID NO:9.

[0264] A wild-type functional D14 protein in watermelon is set forth in SEQ ID NO: 2, in cucumber in SEQ ID NO: 8, and in melon in SEQ ID NO: 9. However, some amino acid sequence variation may exist in watermelon, cucumber, and melon, and a functional D14 protein may contain, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acids that differ from SEQ ID NO: 2, SEQ ID NO: 8, or SEQ ID NO: 9 provided herein, or the protein contains at least 95%, 96%, 97%, 98%, 99% or 99.3%, 99.4%, 99.5% or 99.6%, 99.7%, 99.8% or 99.9% sequence identity (e.g., when aligned pairwise using Emboss-Needle) with the protein of SEQ ID NO: 2, 8 or 9. Such functional variants of the D14 protein of SEQ ID NO: 2, 8 or 9 may exist in other lines or varieties. Thus, these alleles may vary in sequence, but the phenotype of the plant is equivalent to the wild-type phenotype. Such functional variant alleles (allelic polymorphisms) can be found, for example, by sequencing the D14 gene of many different watermelon, cucumber or melon lines or varieties that have the normal secondary branching pattern.

[0265] Thus, in one aspect, a functional variant of a protein of SEQ ID NO: 2, 8 or 9 is a protein that comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.3%, 99.4%, 99.5% or 99.6%, 99.7%, 99.8% or 99.9% sequence identity with a protein of SEQ ID NO: 2, 8 or 9 when aligned pairwise (e.g. using Needle with default parameters).

[0266] In one aspect, there is provided a watermelon, cucumber or melon plant, seed or plant part comprising at least one copy of a mutant allele of a gene designated D14, said mutant allele comprising: a) the region starting at amino acid 94 and ending at amino acid 101 of SEQ ID NO: 2, 8 or 9, or the equivalent amino acid in a mutant D14 protein comprising at least 95% sequence identity with SEQ ID NO: 2, 8 or 9; b) the region of the IPR000073 domain starting at amino acid 22 and ending at amino acid 259 of SEQ ID NO: 2, 8 or 9, or the equivalent amino acid in a variant D14 protein that contains at least 95% sequence identity to SEQ ID NO: 2, 8 or 9; c) the region of the helical lid domain starting at amino acid 136 and ending at amino acid 193 of SEQ ID NO: 2, 8 or 9, or an equivalent amino acid in a mutant D14 protein that contains at least 95% sequence identity to SEQ ID NO: 2, 8 or 9; d) the catalytic triad amino acid or 1, 2, 3, 4, 5, 6, 7 or 8 amino acids before or after the catalytic triad amino acids S97, D218 and H247 of SEQ ID NO: 2, 8 or 9 or equivalent amino acids in a mutant D14 protein that contains at least 95% sequence identity to SEQ ID NO: 2, 8 or 9 and encoding a mutant protein comprising one or more amino acids inserted, duplicated, deleted or substituted in a region of the protein selected from The mutant allele confers a (significantly) increased average number of secondary branches occurring when the mutant allele is homozygous, and preferably confers an intermediate multibranching or complete multibranching phenotype when the mutant allele is homozygous.

[0267] The terms "starting with" and "ending with" or "from" and "to" include the first and last amino acid listed.

[0268] In a), the insertion, duplication, deletion and / or substitution of one or more amino acids in the region of the protein starting at amino acid 94 and ending at amino acid 101 of SEQ ID NO: 2, 8 or 9 may be an insertion, duplication, deletion and / or substitution of at least 1, 2, 3, 4, 5, 6, 7 or 8 amino acids, preferably at least S97.

[0269] In one aspect at least 1, 2, 3, 4, 5, 6, 7 or 8 consecutive amino acids of amino acids 94 to 101 are duplicated, deleted or substituted, preferably including a duplication, deletion or substitution of at least S97. In one aspect the mutant allele comprises H96 (histidine 96) and S97 (serine 97); or S97 (serine 97) and V98 (valine 98); or H96 (histidine 96), S97 (serine 97) and V98 (valine 98); or G95 (glycine 95), H96 (histidine 96), S97 (serine 97), V98 (valine 98) and S99 (serine 99); or V94 (valine 94), G95 (glycine 95), or duplications, deletions or substitutions of V94 (valine 94), G95 (glycine 95), H96 (histidine 96), S97 (serine 97), V98 (valine 98), S99 (serine 99), A100 (alanine 100) and M101 (methionine 101).

[0270] In another aspect, there is provided a watermelon, cucumber or melon plant, seed or plant part comprising at least one copy of a mutant allele of a gene designated D14, said mutant allele encoding a mutant protein comprising one or more amino acids inserted, duplication, deletion or substitution in the region of the protein starting at amino acid 197 and ending at amino acid 249 of SEQ ID NO: 2, 8 or 9 or the equivalent amino acid in a mutant D14 protein comprising at least 95% sequence identity with SEQ ID NO: 2, 8 or 9, said mutant allele conferring an increased average number of secondary branches occurring when the mutant allele is homozygous. Thus, one aspect is an insertion, duplication, deletion and / or substitution of one or more amino acids in the region of the protein starting at amino acid 197 and ending at amino acid 249 of SEQ ID NO: 2, 8 or 9, which may be an insertion, duplication, deletion and / or substitution of at least 1, 2, 3, 4, 5, 6, 7 or 8 amino acids, preferably at least D218 or H247.

[0271] In yet another aspect, there is provided a watermelon, cucumber or melon plant, seed or plant part comprising at least one copy of a mutant allele of a gene designated D14, said mutant allele encoding a mutant protein comprising at least 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or more amino acids inserted, duplications, deletions and / or substitutions in SEQ ID NO:2, 8 or 9 or a mutant D14 protein or a protein comprising at least 95% sequence identity to SEQ ID NO:2, 8 or 9, said mutant allele conferring a modified phenotype as described when the mutant allele is homozygous. Thus, the mutant D14 protein may, for example, be truncated at the N- or C-terminus to lack said at least 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60 70, 80, 90, 100, 150, 200 or more amino acids at the N- or C-terminus, or any other at least 4, 5, 6, 7, 8, 9, 10 amino acids may be deleted, substituted or inserted or duplicated compared to the wild-type functional D14 protein. In one aspect, at least 1, 2, 3, 4, 5, 6, 7 or 8 amino acids (preferably consecutive amino acids) are deleted, duplicated or substituted, whereby the deletion, duplication or substitution comprises amino acids of the catalytic triad selected from S97, D218 and H247 of SEQ ID NO: 2, 8 or 9 or the equivalent amino acids in a mutant sequence of any of these.

[0272] Mutant alleles can be generated by various techniques, such as random mutagenesis or targeted gene editing, and then the phenotype of the mutant allele can be analyzed in plants that are homozygous for the mutant allele. Using random or targeted mutagenesis techniques, any mutation can be generated or reproduced, for example, the mutants described herein can be easily created de novo. TILLING primers can be designed for specific mutations in, for example, alleles, allowing de novo identification of M2 plants that contain, for example, the mutants described herein. Mutant alleles present in the variety Sidekick F1 can also be created de novo. If the gene sequence is disclosed, seed deposit is not an enabling requirement. Similarly, targeted gene editing can be used to generate any desired mutation in an allele.

[0273] TILLING is described, for example, in McCallum, et al. (Jun 2000). "Targeting induced local lesions IN genomes (TILLING) for plant functional genomics". Plant Physiol. 123(2):439-42.

[0274] In one embodiment, the mutant allele of the ClD14 gene is not the mutant allele present in variety Sidekick F1, but a different mutant allele, e.g., one or more nucleotides may differ, but the encoded mutant protein may still be the same (i.e., the protein of SEQ ID NO: 1), or one or more amino acids may differ compared to SEQ ID NO: 1 (i.e., pairwise alignment of the mutant protein does not result in 100% sequence identity with SEQ ID NO: 1), e.g., due to the degeneracy of the genetic code. For example, instead of a duplication of eight amino acids, only five, six or seven amino acids may be duplicated; or nine, ten or eleven amino acids may be duplicated. In another embodiment, the mutant allele of the ClD14 gene is identical to the mutant allele in variety Sidekick F1, but is induced de novo by a mutagenesis technique, such as a CRISPR-based technique.

[0275] Any mutant allele in the ClD14, CsD14 or CmD14 gene that results in the insertion, deletion and / or substitution of one or more amino acids of the wild-type functional protein may result in a mutant protein with reduced or no function and therefore a much more frequent secondary branching phenotype occurring when the mutant allele is homozygous. Plants and plant parts containing such mutant alleles are an embodiment herein.

[0276] "Equivalent amino acids" can be readily determined by pairwise amino acid sequence alignment, for example using Emboss Needle (default parameters).

[0277] In one aspect, the mutant allele encodes a protein that comprises a duplication or insertion of the codon for the equivalent amino acid in amino acid number S97, D218 or H247 of SEQ ID NO: 2, 8 or 9, or a protein that comprises at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2, 8 or 9.

[0278] In one aspect, the mutant allele encodes a protein that contains a duplication or insertion of one or more codons for the equivalent amino acids in amino acid numbers 94-101 of SEQ ID NO:2, 8 or 9, or a protein that contains at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:2, 8 or 9.

[0279] A mutation of a codon can be a (at least one) nucleotide insertion, deletion or substitution in the codon, resulting in, for example, a different reading frame or a different codon or a stop codon encoding a different amino acid. The entire codon can also be deleted or replaced with a different codon (or optionally a stop codon), resulting in either the deletion of the encoded amino acid or its replacement.

[0280] In one aspect, the mutant allele encodes a protein that includes an amino acid substitution (replacement) or deletion or stop codon of amino acid number S97, D218 or H247 of SEQ ID NO: 2, 8 or 9, or an equivalent amino acid in a protein that contains at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2, 8 or 9.

[0281] In one aspect, the mutant allele encodes a mutant ClD14, CsD14 or CmD14 protein comprising a truncation of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 113, 115, 120, 130, 140, 150, 160, 170, 180, 190 or 200 amino acids at the C-terminus of the protein of SEQ ID NO:2, 8 or 9 or a protein comprising at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:2, 8 or 9. In one aspect, all amino acids starting at (and including) amino acid 94, 95, 96 or 97 of SEQ ID NO: 2, 8 or 9, or starting at (and including) amino acid 218, or starting at (and including) amino acid 247 of SEQ ID NO: 2, 8 or 9, or the equivalent amino acids in a protein comprising at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 2, 8 or 9, are deleted or substituted with one or more different amino acids.

[0282] As described, watermelon, cucumber or melon plants or plant parts can contain mutant D14 alleles, and the mutant alleles are generated by random mutagenesis or targeted mutagenesis, for example, CRISPR-based methods. Random mutagenesis can be, for example, chemically induced (e.g., EMS treatment) or radiation-induced mutagenesis or other methods, whereby mutations are randomly induced in the genome, and then plants or plant parts containing mutations in endogenous D14 genes can be screened and identified. Targeted mutagenesis is a method of specifically introducing mutations into target genes, such as D14 genes, for example, using Crispr-Cas9 or Crispr-CpfI or other known methods.

[0283] In one aspect, a plant containing a mutant allele is not produced solely by essentially biological processes, meaning that the mutant allele was generated at some point by human intervention. If such a human-generated mutant allele is transferred from one plant to another by breeding and selection, the patent covers the plant containing the mutant allele, even if the plant itself was generated solely by breeding and selection.

[0284] In one embodiment, the watermelon, cucumber or melon plant is diploid and contains at least one copy of the mutant D14 allele as described above, i.e., the plant is heterozygous. These plants have normal secondary branching, since this phenotype is only seen when the mutant allele is homozygous. Selfing such a heterozygous plant will generate a plant that is homozygous and contains two copies of the mutant allele. In one embodiment, the watermelon plant is diploid and contains two copies of the mutant D14 allele as described above, i.e., the plant is homozygous. Thus, the plant also has the modified phenotype described herein.

[0285] The plants and plant parts comprising at least one copy of the mutant D14 allele are preferably cultivated, non-wild plants, and thus preferably cultivated watermelon (Citrullus lanatus), cucumber or melon. The plants may be inbred lines, F1 crosses or breeding lines.

[0286] In one embodiment, the plant is a watermelon plant, and the watermelon plant is diploid, triploid or tetraploid, comprising at least one copy of mutant ClD14 allele. In one embodiment, the diploid plant or plant part comprises 2 copies, the triploid plant or plant part comprises 1, 2 or 3 copies, and the tetraploid plant or plant part comprises 2 or 4 copies of mutant ClD14 allele. It is noted that the genotyping method or assay described herein for diploid plants, seeds and plant parts applies equally to triploid or tetraploid plants, seeds or tissues / plant parts. Triploid plants, seeds or parts can be selected that comprise 1, 2 or 3 copies of mutant ClD14 allele or wild type allele, and tetraploid plants can be selected that comprise 1, 2, 3 or 4 copies of mutant ClD14 allele or wild type allele. KASP assay can be used, for example, to analyze triploid and tetraploid genomic DNA for the ClD14 alleles present and their copy number.

[0287] Also encompassed herein are seeds from which the above plants or plant parts can grow.

[0288] The plant part containing at least one copy of the mutant D14 allele can be a cell, flower, leaf, stem, cutting, ovule, pollen, root, rootstock, scion, fruit, protoplast, embryo, anther.

[0289] Further provided is a vegetatively propagated plant propagated from the plant part and containing at least one copy of the mutant D14 allele in its genome.

[0290] In one aspect, a method of producing a diploid, seeded watermelon fruit is also provided, the method comprising growing a diploid watermelon plant that contains one or two copies of a mutant ClD14 allele, allowing the flowers to be pollinated, and optionally harvesting the diploid, seeded fruit that develops on the plant, whereby the fruit tissue also contains one or two copies of the mutant ClD14 allele.

[0291] In one aspect, a method of producing seedless watermelon fruits is also provided, the method comprising growing a diploid watermelon plant containing two copies of a mutant ClD14 allele close to a triploid watermelon plant, allowing pollination of flowers of the triploid plant with pollen from the diploid plant, and optionally harvesting seedless fruits that develop on the triploid plant and / or seeded fruits that develop on the diploid plant after self-pollination of the diploid plant.

[0292] When referring to "growing closely," this means that the diploid pollinator plant is close enough to the triploid plant to allow insects that may visit the pollinator plant to transfer pollen from the male flowers of the pollinator plant to the triploid plant. The pollinator can be planted in rows or between rows or randomly inter-planted in the same field as the triploid plants. The pollinator can also be grafted onto the same rootstock as the triploid plants to produce two-step grafted plants. Such two-step grafted plants can then be grown close to the triploid plants to provide pollen to those plants.

[0293] In one aspect, the mutant ClD14 allele can be combined with a different gene, such as the Ts gene (tomato seed size gene) on chromosome 2, as described in WO 2021 / 165091. By combining the mutant ClD14 alleles described herein and a Ts gene deletion or a mutant allele encoding, for example, a reduced or lost function Ts protein, plants with a "strong multi-branched" or "intermediate multi-branched" phenotype as described herein can produce fruits with small seeds. Because seed size is determined by the chromosome 2 and chromosome 6 loci (as described in WO 2021 / 165091), fruits of the plants described herein can have any seed size, from large to medium to very small.

[0294] However, the ClD14 alleles described herein can also be combined with genes that confer parthenocarpy or pseudoparthenocarpy, such that seedless fruit can be produced in plants with a "strong multi-branched" or "intermediate multi-branched" phenotype, as described herein. See WO 2022 / 096451, WO 2022 / 078792, WO 2019238832, WO 2018060444, or WO 2017202715, all of which are incorporated herein by reference.

[0295] Also provided is a method for screening a plant, plant part or DNA derived therefrom for the presence of a mutant allele of the gene named ClD14, CsD14 or CmD14, or for selecting a plant or plant part which comprises a mutant allele of the gene named ClD14, CsD14 or CmD14, or for generating a plant or plant part which comprises a mutant allele of the gene named ClD14, CsD14 or CmD14, wherein the mutant allele a) contains one or more mutations in a regulatory element that result in no or reduced expression of the allele compared to the wild-type allele; and / or b) encodes a mutant protein that contains one or more amino acids that are substituted, inserted, duplicated and / or deleted compared to the wild-type protein, The wild-type watermelon allele encodes a protein of SEQ ID NO:2 or a protein having at least 95% sequence identity with SEQ ID NO:2, the wild-type cucumber allele encodes a protein of SEQ ID NO:8 or a protein having at least 95% sequence identity with SEQ ID NO:8, and the wild-type melon allele encodes a protein of SEQ ID NO:9 or a protein having at least 95% sequence identity with SEQ ID NO:9.

[0296] As mentioned above, the methods herein preferably relate to mutant alleles as described herein, which, when homozygous, result in a "full multi-branched" or "intermediate multi-branched" phenotype of the plant.

[0297] Methods for screening plants, plant parts or DNA derived therefrom include providing genomic DNA or sequence information of the genomic DNA, determining the D14 gene sequence in the genomic DNA and comparing the gene sequence to a wild-type gene sequence, or genotyping the genomic DNA for alleles at the D14 locus, e.g., amplifying all or part of the gene sequence or cDNA (mRNA), e.g., using PCR primers, or sequencing the genomic region (e.g., genotyping by sequencing) and comparing the D14 allele sequence to the wild-type sequence.

[0298] A method for generating mutants comprising mutagenizing (e.g., using radiation or chemical mutagens) one or more seeds, plants or plant parts, for example, of watermelon, cucumber or melon, or providing a population of mutagenized plants, and screening M1 or M2 or further generations for the mutant D14 allele present. Plants containing the mutant allele can then be made homozygous for the mutant allele for phenotypic analysis.

[0299] In one aspect, a mutant ClD14, CsD14 or CmD14 allele comprises a mutation in genomic DNA resulting in expression of a mutant D14 protein that comprises one or more inserted, duplication, deletion or substituted amino acids, as described elsewhere herein, for example a duplication of amino acids 94-101 of SEQ ID NO:2, 8 or 9 (or the equivalent amino acids in a sequence that comprises at least 95% identity to SEQ ID NO:2, 8 or 9).

[0300] Thus, any mutant allele of the ClD14, CsD14 or CmD14 gene that, when homozygous, results in at least a (significantly) higher average number of secondary branches occurring is an embodiment of the present invention. Such mutant ClD14, CsD14 or CmD14 alleles can be generated by the skilled artisan without undue burden. The skilled artisan can, for example, generate mutants in the ClD14, CsD14 or CmD14 gene and determine whether they result in at least a higher average number of secondary branches when homozygous, for example, in a diploid plant, compared to a diploid plant that is homozygous for the wild-type allele. The skilled artisan can also generate mutants that code for non-functional proteins, which plants can be used, for example, as a comparison. Thereby, the new mutants can be compared to the wild-type branching phenotype and the "full multi-branching" phenotype to determine whether the effect of the mutant allele is, for example, "intermediate multi-branching" or "full multi-branching". It is preferred to compare the phenotype of the mutant allele in the same genetic background line, thus for example in a non-mutagenized line (control, wild type) and a mutant line with a complete multi-branching phenotype, preferably also in the same background line. The least branched and most branched phenotypes in the same background as well as any new mutants can be compared and placed in the broadest range.

[0301] Having identified the nucleotide sequence of the gene, the skilled artisan can generate watermelon, cucumber or melon plants containing mutations in the D14 gene by various methods, such as mutagenesis, TILLING or CRISPR-Cas or other methods known in the art. In particular, targeted mutations can be performed by the skilled artisan using targeted recombinant gene techniques such as Crispr-Cas, TALENS and others. The skilled artisan can then confirm the phenotype of plants that are homozygous for the mutant D14 allele, i.e., develop a higher average number of secondary branches. Thus, the skilled artisan is not limited to the specific D14 mutants disclosed herein, and the skilled artisan can similarly generate other mutations of the D14 allele of watermelon, cucumber or melon, thereby generating other mutants that result in multiple branches when homozygous. Various mutations can be generated and tested for the resulting phenotype, for example, regulatory elements can be mutated to reduce (knock down) or eliminate (knock out) the expression of the allele, thus reducing or eliminating the amount of wild-type D14 protein present in the cell or plant. Alternatively, mutations can be generated which result in reduced or lost function of the D14 protein, i.e. mutations which result in one or more amino acids being substituted, inserted, duplicated and / or deleted (such as missense or frameshift mutations) or whereby the protein is truncated by the introduction of a premature stop codon in the coding sequence (nonsense mutations).

[0302] Since the D14 protein contains conserved amino acids of the catalytic triad, in one aspect it is encompassed that one or more amino acids of the catalytic triad or including the amino acids of the catalytic triad are substituted, deleted, duplication and / or inserted, and thus the mutations are likely to result in loss of function.

[0303] Whether any mutation in the D14 allele results in the predicted phenotype can then be tested by generating plants that are homozygous for the mutation, growing the plant line close to a wild-type plant line, and analyzing the phenotype of both lines, e.g., a multi-branching phenotype.

[0304] Alternatively, one skilled in the art may describe a method for producing a cultivated watermelon, cucumber or melon plant capable of producing a higher average number of secondary branches (multi-branching) and / or a method for producing a watermelon, cucumber or melon plant comprising a mutant D14 allele, comprising the steps of: a) introducing a mutation into a watermelon, cucumber or melon plant, plant part or seed, particularly a population of cultivated plants, or providing a population of mutated plants or their progeny; b) selecting plants which, when grown, develop a higher average number of secondary branches; c) optionally determining whether the plant selected in b) contains a mutant allele of the D14 gene; d) optionally growing the plant obtained in c); It is possible to carry out a method comprising:

[0305] Steps b) and c) can also be optionally swapped such that step b) is selecting plants containing a mutant allele of the D14 gene, and step c) is determining whether the plants (or their progeny) produce a higher average secondary branching / multi-branching phenotype.

[0306] Step a) may be carried out by inducing mutations in seeds of one or more lines or varieties of e.g. watermelon, cucumber or melon, for example by treatment with a mutagen such as a chemical mutagen, e.g. EMS (ethyl methanesulfonate), or by irradiation with UV light, X-rays or gamma rays, etc. The population may for example be a TILLING population. Preferably, the mutagenized plant population is selfed at least once (e.g. to generate an M2 generation or M3, M4, etc.) before carrying out step b).

[0307] The phenotyping of step b) can easily be carried out visually, for example by counting the secondary branches.

[0308] Such plants or their progeny can be tested for the presence of a mutant D14 gene by phenotypic analysis (e.g., secondary branching) and / or by genotyping the plants for mutations in or expression of the D14 gene and the encoded protein, sequencing, and other methods known to those of skill in the art. Thus, there are a variety of methods or combinations of methods to determine whether a phenotypically selected plant contains a mutant allele of the D14 gene.

[0309] If step b) is the selection of plants containing mutant alleles of the D14 gene, the skilled artisan can also use various methods to detect the DNA, mRNA or protein of the D14 gene to identify plants containing mutant D14 alleles. The genomic DNA of the wild-type watermelon ClD14 gene encoding the functional ClD14 protein (SEQ ID NO: 2) is the DNA of SEQ ID NO: 6, and the cDNA (mRNA) encoding the protein of SEQ ID NO: 2 is shown in SEQ ID NO: 4. The promoter is upstream of this sequence and can be retrieved, for example, by sequencing or from the watermelon genome database. For example, at least 1000 or at least 2000 bases upstream of the ATG start contain the promoter sequence.

[0310] The genomic DNA of the wild-type cucumber CsD14 gene encoding the functional CsD14 protein (SEQ ID NO: 8) is the DNA of SEQ ID NO: 15, and the cDNA (mRNA) encoding the protein of SEQ ID NO: 8 is shown in SEQ ID NO: 17. The promoter is upstream of this sequence and can be retrieved, for example, by sequencing or from a cucumber genome database. For example, at least 1000 or at least 2000 bases upstream of the ATG start comprise the promoter sequence.

[0311] The genomic DNA of the wild-type melon CmD14 gene encoding a functional CmD14 protein (SEQ ID NO: 9) is the DNA of SEQ ID NO: 16, and the cDNA (mRNA) encoding the protein of SEQ ID NO: 9 is shown in SEQ ID NO: 18. The promoter is upstream of this sequence and can be retrieved, for example, by sequencing or from a cucumber genome database. For example, at least 1000 or at least 2000 bases upstream of the ATG start comprise the promoter sequence.

[0312] In one aspect, the mutant allele of the D14 gene is a mutant allele that results in reduced or no expression of the D14 gene, or a mutant allele that results in one or more amino acids of the encoded D14 protein being substituted, inserted, duplicated or deleted compared to the wild-type D14 protein.

[0313] In one aspect, mutant alleles of the D14 gene can be obtained by inducing either targeted or random mutations in the gene (promoter or other regulatory elements, splice sites, coding regions, etc.) and selecting plants containing mutant D14 alleles, e.g., from progeny. In one aspect, alleles are selected that contain codon mutations or that contain one or more insertions, deletions or duplications of one or more codons, e.g., codons encoding amino acids 94-101 of SEQ ID NO: 2, 8 or 9. In one aspect, the mutant alleles cause truncation of the encoded watermelon, cucumber or melon D14 protein.

[0314] In one embodiment, an indel marker (marker mWM23349015_k2) is detected in the genome of a watermelon plant or plant part or DNA derived therefrom. This indel marker is described in the Examples and detects the insertion allele (containing 24 inserted / duplicated nucleotides resulting in a duplication of 8 amino acids) and / or the wild type allele in watermelon.

[0315] It is noted that the reference to the indel marker mWM23349015_k2 is not limited to the specific forward and reverse PCR primers provided herein, but relates to any biallelic marker that can distinguish the wild type ClD14 allele of SEQ ID NO: 6 and the mutant ClD14 allele (containing the duplicated / inserted 24 nucleotides) of SEQ ID NO: 5. The skilled artisan can easily make other allele-specific primers or allele-specific probes to be used as biallelic markers to detect the genotype for these two ClD14 alleles.

[0316] In one aspect, the indel marker (marker mWM23349015_k2) is detected in the genome of a watermelon plant or plant part or genomic DNA or cDNA derived therefrom. Thus, a method for detecting the presence of a 24 nucleotide insertion is provided herein. Thus, watermelon genomic DNA or cDNA / mRNA can be screened for the presence of wild-type ClD14 alleles and / or insertion alleles, and optionally selected.

[0317] In another aspect, SNPs conferring a single amino acid substitution with another amino acid or a stop codon as shown in Table A or Table 2 are detected in the genome of a watermelon plant or plant part or DNA derived therefrom. Thus, methods are provided herein for detecting the presence of any of those SNPs. Thus, watermelon genomic DNA or cDNA / mRNA can be screened for the presence of, and optionally selected for, wild-type and / or mutant ClD14 alleles of Table A or Table 2.

[0318] For other mutant D14 alleles in watermelon, cucumber or melon, indel or SNP markers (or other markers) and indel or SNP genotyping (or other genotyping) assays can be readily designed. Thus, allele-specific markers and detection methods are encompassed herein, particularly for any mutant allele that results in an amino acid insertion, duplication, deletion or substitution in the D14 protein of watermelon, cucumber or melon.

[0319] In particular, in one aspect, the genotype of an indel marker (e.g., marker mWM23349015_k2) may be determined and used to select plants or progeny plants that contain a wild type allele of SEQ ID NO:6 and / or a mutant ClD14 allele of SEQ ID NO:5.

[0320] A diploid plant that is heterozygous for the mutant ClD14 allele will contain both SEQ ID NO:5 and SEQ ID NO:6 in its genome. A diploid plant that is homozygous for the mutant ClD14 allele will only contain SEQ ID NO:5 at the locus on chromosome 8. A diploid plant that is homozygous for the wild type allele will also only contain SEQ ID NO:6 in its genome.

[0321] As described, mutant allele-specific markers and marker assays can similarly be readily developed for any mutant D14 allele, since the underlying genomic change, e.g., in a codon, can be used to design marker assays to detect genomic changes underlying, e.g., the amino acid changes disclosed herein or other genomic changes in the mutant D14 allele compared to the wild-type D14 allele.

[0322] Using such allele-specific markers that detect specific mutant D14 alleles, genotyping can be performed to detect the presence and copy number of the allele in plants and plant materials (or DNA derived therefrom).

[0323] In accordance with the present invention, the mutation of the mutant allele of the D14 gene may be any mutation, including deletion, truncation, insertion, point mutation, nonsense mutation, missense or nonsynonymous mutation, splice site mutation, frameshift mutation and / or mutation in a regulatory sequence. In one aspect, the mutation of the mutant allele of the D14 gene is a point mutation. The mutation may occur in a DNA sequence comprising the coding sequence of the D14 gene or an RNA sequence encoding the D14 protein, or it may occur in the amino acid of the D14 protein. With respect to the DNA sequence of the D14 protein-encoding gene, the mutation may occur in the coding sequence, or it may occur in a non-coding sequence, such as the 5'- and 3'-untranslated regions, promoters, enhancers, etc. of the D14 gene. With respect to the RNA encoding the D14 protein, the mutation may occur in the pre-mRNA or mRNA. In one aspect, the mutant allele results in a protein having loss or reduced function due to one or more amino acids being substituted, inserted, duplicated and / or deleted, for example, resulting in one or more amino acids being substituted, inserted, duplicated and / or deleted in the C-terminus of the protein, the IPR000073 domain, the helical lid domain, or including one of the amino acids of the catalytic triad.

[0324] Thus, one embodiment of the present invention is a plant cell or plant according to the present invention comprising a mutant allele of the D14 gene, the mutant allele being a) deletions, truncations, insertions, point mutations, nonsense mutations, missense or nonsynonymous mutations, splice site mutations, frameshift mutations in the genomic sequence; b) a mutation in one or more regulatory sequences; c) deletions, truncations, insertions, point mutations, nonsense mutations, missense or nonsynonymous mutations, splice site mutations, frameshift mutations in the coding sequence; d) deletions, truncations, insertions, point mutations, nonsense mutations, missense or nonsynonymous mutations, splice site mutations, frameshift mutations in the pre-mRNA or mRNA; and / or e) a deletion, truncation, insertion, duplication or substitution of one or more amino acids in the D14 protein The present invention relates to a plant cell or plant, characterized in that it contains or carries one or more mutations selected from the group consisting of:

[0325] In one embodiment, the mutant allele results in reduced or no expression of the D14 gene, or the mutant allele encodes a protein with reduced or lost function. In particular, homozygotes for the mutant allele result in a significant increase in the average number of secondary branches in plants homozygous for the mutant allele compared to control plants homozygous for the wild-type allele. The significant increase in average secondary branches is either "full multi-branching" if the allele is a knock-out allele or produces a non-functional protein, or "intermediate multi-branching" if the allele is a knock-down allele or produces a reduced function protein.

[0326] Reduced expression (knockdown allele) or no expression (knockout allele) means that there is a mutation in the regulatory region of the D14 gene, such as the promoter, which results in reduced or no mRNA transcripts of the D14 allele compared to plants and plant parts containing the wild-type D14 allele. Reduced expression can be determined, for example, by measuring the amount of mRNA transcripts encoding the D14 protein, for example using Northern blot analysis or RT-PCR. In this specification, reduction preferably means a reduction in the amount of RNA transcripts of at least 50%, in particular at least 70%, optionally at least 85% or at least 95% or 100% (no expression) compared to plants or plant parts containing the wild-type D14 gene. Expression can be analyzed, for example, in flower tissue or leaf tissue.

[0327] In one embodiment, the protein comprises one or more amino acids that are substituted, inserted, duplicated or deleted compared to the wild-type protein. Thus, for watermelon, cucumber or melon, one or more amino acids are inserted, deleted or substituted compared to the wild-type D14 protein of SEQ ID NO: 2, 8 or 9 or the wild-type D14 protein comprising at least 95%, 96%, 97%, or 98%, or 99% sequence identity with SEQ ID NO: 2, 8 or 9; thereby, the mutant protein has a reduced or lost function compared to the wild-type protein, thus resulting in (intermediate or strong) multiple branching when the mutant allele is present in homozygote in a diploid plant.

[0328] A mutant allele of the above wild type allele is, in one aspect, a mutant allele that produces a mutant protein with reduced or no expression (e.g., by mutation of a promoter or enhancer element) or that contains one or more amino acids inserted, duplicated, deleted or substituted compared to the wild type protein, whereby the mutant protein has reduced or no function in vivo, as can be determined when the mutant allele is homozygous in the plant and by analyzing the phenotype of a plant that is homozygous for the mutant allele compared to a plant that is homozygous for the wild type allele. The same phenotypic analysis can be performed for mutant alleles with reduced or no gene expression. Thus, any mutant allele can be made homozygous in a plant and the phenotype can be compared to a control plant containing the original non-mutated allele and / or a mutant allele encoding a non-functional protein (e.g., ClD14ins or W155). * etc., or the same mutation in the cucumber or melon D14 protein).

[0329] When amino acids are referred to herein from one amino acid to another, this includes the starting / first and ending / last amino acids referred to.

[0330] When an amino acid is referred to as being "deleted," this includes mutations in which a codon is changed to a stop codon, or in which a codon is deleted or there is a frameshift that results in an amino acid not being coded for. Similarly, when an amino acid is referred to as being "substituted," this includes mutations in which a codon codes for a different amino acid, or in which a codon is inserted or there is a frameshift that results in a different amino acid being coded for.

[0331] The watermelon can be any type of watermelon. In one aspect, a watermelon plant containing one or two copies of a mutant ClD14 allele, such as a mutant allele encoding the protein of SEQ ID NO:1 or a different mutant allele, is not a pollinator plant, i.e., it is not suitable as a pollinator for triploid fruit production, for example because its flowering time is not synchronized with triploid flowering and / or its pollen production is not sufficiently abundant to be suitable as a pollen source. In one aspect, it is used for fruit production itself, not for pollen production. Thus, it is not mixed with triploid plants (not suitable for mixed planting), but is grown by itself for fruit production by self-pollination. The fruit produced after self-pollination is also not "unharvestable" with pink or white flesh and low Brix, but is well suited for harvesting and consumption (i.e., has high Brix, red flesh, etc.).

[0332] Watermelon plants and parts thereof containing at least one copy of the mutant D14 allele can be diploid, tetraploid or triploid. The diploid plant can be heterozygous for the mutant allele or homozygous for the mutant allele, such as the mutant allele encoding the protein of SEQ ID NO: 1 or any other mutant allele described. In one aspect, the diploid plant containing the mutant D14 allele in homozygosity is a doubled dwarf plant (DH), such as a doubled dwarf watermelon, cucumber or melon plant or plant cell or plant part.

[0333] Triploid watermelon plants can have one, two or three copies of the mutant ClD14 allele. Triploid plants with one copy of the mutant allele can be produced by crossing a wild-type female tetraploid (having four wild-type copies) with a diploid male that is homozygous for the mutant allele. Triploid plants with two mutant alleles can be produced by crossing a female tetraploid containing four copies of the mutant allele with a diploid male that is homozygous for the wild-type allele.

[0334] Tetraploid watermelon plants can have one, two, three or four copies of the mutant ClD14 allele. Genotypes containing two copies of the mutant allele can be created by doubling the chromosomes of a diploid that is heterozygous for the mutant allele. Genotypes containing four copies of the mutant allele can be created by doubling the chromosomes of a diploid that is homozygous for the mutant allele.

[0335] The watermelon, cucumber or melon plants encompassed herein may also be vegetatively (clonally) propagated, and such vegetatively propagated plants or "vegetative propagation" is one embodiment of the present invention. They may be easily distinguished from other plants by the presence of the mutant D14 allele and / or phenotypically (optionally after selfing). The presence of one or more mutant D14 alleles may be determined as described elsewhere herein.

[0336] Vegetative propagation can be produced by various methods, for example, one or more scions of a plant of the invention can be grafted onto different rootstocks, such as biotic or abiotic stress tolerant rootstocks.

[0337] Other methods include in vitro cell or tissue culture methods and vegetative propagation from such cultures. Such cell or tissue cultures comprise or consist of various cells or tissues of the plants of the invention. In one aspect, such cell or tissue cultures comprise or consist of vegetative cells or vegetative tissues of the plants of the invention.

[0338] In another aspect, the cell or tissue cultures comprise or consist of reproductive cells or tissues, such as anthers, pollen, microspores or ovules, of the plants of the invention. Such cultures may be treated with a chromosome doubling agent, for example to produce doubled haploid plants, or they may alternatively be used to produce haploid plants (e.g., to produce diploids from tetraploids or haploids from diploids).

[0339] The in vitro cell or tissue culture may therefore comprise or consist of cells or protoplasts or plant tissue from a plant part selected from the group consisting of fruit, embryo, meristem, cotyledon, pollen, microspore, ovule, leaf, anther, root, root tip, pistil, flower, seed, stem, or any part of these, such as for example only the seed coat (maternal tissue).

[0340] Thus, in one aspect of the invention, there is provided a cell or tissue culture (all as described above) of cells of a plant comprising one or two copies of a mutant D14 allele. As described, the cell or tissue culture comprises cells or protoplasts or plant tissue from a plant part of a plant comprising a mutant D14 allele, and may comprise or consist of cells or tissues selected from the group consisting of embryos, meristems, cotyledons, pollen, microspores, leaves, anthers, roots, root tips, pistils, flowers, seeds, stems; or any part thereof.

[0341] Also provided are watermelon, cucumber or melon plants regenerated from such cell or tissue cultures, wherein the regenerated plants (or their progeny, e.g., obtained after crossing or selfing the regenerated plants) comprise a mutant D14 allele.Thus, in one aspect, a watermelon, cucumber or melon plant comprising a mutant D14 allele in one or more copies is a vegetatively propagated plant.

[0342] In a different embodiment, the cells and tissues (and optionally further cell or tissue cultures) of the invention that comprise a mutant D14 allele in one or more copies are non-reproductive cells or tissues.

[0343] Further methods 1. A method for producing a watermelon, cucumber or melon plant capable of producing an increased average number of secondary branches or a method for producing a mutant allele of the D14 gene, comprising: a) introducing a mutation into a population of watermelon, cucumber or melon plants or providing a mutant population of watermelon, cucumber or melon plants; or providing a watermelon, cucumber or melon plant comprising a randomly induced mutation or a targeted induced mutation in the D14 target gene; b) selecting plants containing a mutant allele of the D14 gene; c) Optionally, determining whether the plants selected in b) produce an increased average number of secondary branches when homozygous for the mutant D14 allele, compared to a control plant containing a wild-type allele of the D14 gene. A method is also provided that includes:

[0344] 1. A method for producing a watermelon, cucumber or melon plant capable of generating a complete multi-branching phenotype or a method for generating a mutant allele of the D14 gene which, when homozygous, confers a complete multi-branching phenotype, comprising: a) introducing a mutation into a population of watermelon, cucumber or melon plants or providing a mutant population of watermelon, cucumber or melon plants; or providing a watermelon, cucumber or melon plant comprising a randomly induced mutation or a targeted induced mutation in the D14 target gene; b) selecting plants containing a mutant allele of the D14 gene, wherein the mutant D14 allele is a knock-out allele or an allele encoding a loss-of-function D14 protein; c) Optionally, determining whether the plants selected in b) produce an increased average number of secondary branches when homozygous for the mutant D14 allele, compared to a control plant containing a wild-type allele of the D14 gene. A method is also provided that includes:

[0345] 1. A method for producing a watermelon, cucumber or melon plant capable of producing an intermediate multi-branching phenotype or a method for producing a mutant allele of the D14 gene which, when homozygous, confers an intermediate multi-branching phenotype, comprising: a) introducing a mutation into a population of watermelon, cucumber or melon plants or providing a mutant population of watermelon, cucumber or melon plants; or providing a watermelon, cucumber or melon plant comprising a randomly induced mutation or a targeted induced mutation in the D14 target gene; b) selecting plants containing a mutant allele of the D14 gene, wherein the mutant D14 allele is a knockdown allele or an allele encoding a reduced-function D14 protein; c) Optionally, determining whether the plants selected in b) produce an increased average number of secondary branches when homozygous for the mutant D14 allele, compared to a control plant containing a wild-type allele of the D14 gene. Further provided is a method comprising:

[0346] The watermelon, melon or cucumber plant includes at least one copy of the mutant D14 allele generated by the above method and / or induced and identified by the above method. In one embodiment, the watermelon plant produced by the above method and including the mutant allele that confers complete multibranching in homozygotes does not include the mutant allele of SEQ ID NO: 5. In another embodiment, the watermelon plant produced by the above method and including the mutant allele that confers complete multibranching in homozygotes is in a watermelon background different from cultivar Sidekick and differs from cultivar Sidekick in one or more properties when it encodes the same protein (protein ClD14ins shown in SEQ ID NO: 1) as that encoded by the pollinator Sidekick. It may differ from Sidekick, for example, in producing fruits that are not suitable as pollinators and / or have red flesh and / or have a higher average fruit weight, or have other properties that distinguish the plant from Sidekick.

[0347] The population of watermelon, cucumber or melon plants in a) is preferably a single genotype of cultivated watermelon, cucumber or melon breeding line or variety that has been treated / treated (or exposed to) with a mutagenizing agent or the progeny of such a population obtained after selfing individuals of the population to produce plants of, for example, M2, M3 or further generations. It can be, for example, a TILLING population. It can also be, for example, a watermelon, cucumber or melon line that has been subjected to targeted genetic modification using a Crispr-based method.

[0348] In step b), the selection of plants containing a mutant allele of the D14 gene can be carried out phenotypically and / or by screening the plants (or plant parts or DNA derived therefrom) for the presence of a mutant allele of the D14 gene, i.e. an allele that either has reduced expression of the wild-type D14 allele (in the case of a knockdown allele) or has no expression (in the case of a knockout allele) or an allele that encodes a mutant D14 protein.

[0349] With regard to screening for phenotypes, it is understood that these can only be selected if the mutant D14 allele is homozygous and if the mutant allele has reduced or no expression or encodes a reduced or loss of function protein, thereby giving a phenotype. Screening for phenotypes or combinations of phenotypes can be performed as described, for example by growing lines containing mutant D14 alleles in homozygote under the same growth conditions as a control line or variety containing wild type D14 allele in homozygote, and then analyzing the secondary branches.

[0350] With regard to screening or selecting plants for the presence of a mutant allele of the D14 gene, this can be done by a variety of methods to detect D14 DNA, RNA or protein, for example by designing PCR primers to amplify genomic DNA, amplify part of the coding region or all of the coding region, or otherwise to determine whether the plant contains a mutation in the genomic DNA.

[0351] Thus, various methods can be used to determine the presence of mutant D14 alleles or to select plants that contain mutant D14 alleles present. For example, marker analysis or sequence analysis of alleles or chromosomal regions that contain the D14 locus can be performed, or PCR or RT-PCR can be used to amplify D14 alleles (or parts thereof) or mRNA (cDNA), or sequencing can be performed. Genetic analysis to determine recessive inheritance can also be performed. Thus, alleles can be, for example, sequenced (e.g., their genomic DNA or cDNA) to determine what mutations are present. In step b), Provean and / or SIFT analysis can also be used to select plants that have mutant alleles that are predicted to reduce or eliminate D14 protein function. See examples.

[0352] If gene editing methods are used, the vector / construct introduced into the plant to induce mutation of the endogenous allele is preferably removed from the plant line containing the mutant D14 allele, so that the plant line does not contain such vector or construct.

[0353] In one embodiment, the plant does not contain a genetic construct inserted into its genome by transformation.

[0354] In one embodiment, the mutant allele is generated by mutagenesis (e.g., chemical or radiation mutagenesis) or by targeted mutagenesis, particularly using a CRISPR system (e.g., Crispr / Cas9 or Crispr / CpfI or other nucleases). In one embodiment, cultivated plants containing mutant D14 alleles are not transgenic plants, i.e., non-transgenic progeny that do not contain, for example, a CRISPR construct are selected.

[0355] In one embodiment, the mutant allele of the D14 gene comprises an artificial mutation, i.e. a mutation introduced by a mutagenesis technique such as chemical mutagenesis or radiation mutagenesis or a targeted mutagenesis technique such as Crispr-based technology.

[0356] Provided herein are methods for targeted mutagenesis of the endogenous D14 gene in watermelon, cucumber, or melon using any targeted genetic engineering method, such as CRISPR-based methods (e.g., Crispr / Cas9 or Crispr / CpfI), TALENS, zinc finger, or other methods.

[0357] In one aspect, an isolated mutant D14 protein and an isolated wild-type D14 protein or an isolated nucleic acid molecule encoding the mutant D14 protein or the wild-type D14 protein are provided. Antibodies capable of binding to mutant or wild-type D14 proteins are also encompassed herein. The isolated mutant protein in one aspect is a protein of SEQ ID NO: 1, which includes a duplication of eight amino acids, but can also be an isolated protein of any other mutant D14 allele described herein. In one aspect, the isolated mutant protein is a protein described in Table A or Table 2. In one aspect, the isolated nucleic acid is a DNA or RNA encoding a mutant protein described in Table A or Table 2.

[0358] In a further aspect, fragments of the nucleotide sequences or nucleic acid molecules provided herein (and / or complementary strands of the sequences or molecules) are encompassed, as these may be used as PCR primers or probes to detect sequences in DNA or RNA samples. Fragments include, for example, a stretch of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 55, 60, 65 or more nucleotides of the genomic sequence of SEQ ID NO: 5 or 6, SEQ ID NO: 13 or 14, SEQ ID NO: 15 or 16, SEQ ID NO: 10, 11 or 12, or the complementary or reverse complement of any of these, or an mRNA or cDNA sequence, or a molecule of SEQ ID NO: 3 or 4, or SEQ ID NO: 17 or 18, or the complementary or reverse complement of any of these. Also encompassed are fragments of isolated nucleic acid molecules or sequences (DNA or RNA) that encode a mutant protein as described in Table A or Table 2.

[0359] Detection Method In one aspect, a screening method is provided for identifying and / or selecting seeds, plants or plant parts or DNA from such seeds, plants or plant parts which contain mutant and / or wild type alleles of the D14 protein-encoding gene in their genome.

[0360] The methods include screening at the DNA (particularly genomic DNA), RNA (or cDNA) or protein level using known methods to detect the presence of mutant and / or wild-type alleles. There are many methods for detecting the presence of mutant and / or wild-type alleles of a gene.

[0361] Thus, there is provided a method for screening and / or selecting plants or plant materials or plant parts or DNA or RNA or proteins derived therefrom for the presence of mutant D14 alleles and / or wild type D14 alleles, comprising the steps of: a) determining gene expression of the endogenous D14 gene, for example to detect whether it is reduced or eliminated; b) determining the amount of wild-type D14 protein, for example to detect whether it is reduced or absent; c) determining whether mutant and / or wild-type mRNA, cDNA or genomic DNA encoding a mutant or wild-type D14 protein is present; d) determining whether mutant and / or wild-type D14 protein is present; e) determining whether the plant or its progeny exhibits a mutant phenotype (e.g., strong multi-branching or intermediate multi-branching, as described) or a wild-type phenotype (normal branching); The method includes one or more of the following:

[0362] Conventional methods such as RT-PCR, PCR, antibody-based assays, sequencing, genotyping assays (e.g., allele-specific genotyping), genotyping by sequencing, phenotyping, and the like may be used.

[0363] The plant or plant material or plant part may be a watermelon, cucumber or melon plant or plant material or plant part, such as a leaf, leaf part, cell, fruit, fruit part, ovary, stem, hypocotyl, seed, seed part, seed coat, embryo, etc.

[0364] For example, if there is a single nucleotide difference between the wild-type allele and the mutant allele (single nucleotide polymorphism, SNP or insertion deletion polymorphism, indel), a SNP or indel genotyping assay can be used to detect whether a plant or plant part or cell contains a wild-type nucleotide (or nucleotides) or a mutant nucleotide (or nucleotides) in its genome. For example, a SNP or indel can be easily detected using a KASP assay (see kpbioscience.co.uk on the World Wide Web) or other genotyping assay, particularly a bi-allele genotyping assay. To develop a KASP assay, for example, about 70 base pairs upstream and about 70 base pairs downstream of the SNP or indel can be selected, and two allele-specific forward primers and one reverse primer can be designed. See, for example, Allen et al. 2011, Plant Biotechnology J. 9, 1086-1099, particularly p097-1098 for the KASP assay method.

[0365] Similarly, other genotyping assays can be used, such as TaqMan SNP genotyping assays, high-resolution melting (HRM) assays, SNP-genotyping arrays such as microarrays (e.g., Fluidigm, Illumina, etc.) or DNA sequencing (e.g., genotyping by sequencing).

[0366] Thus, based on the differences in the genomic sequences of wild-type and mutant alleles, one of skill in the art can readily develop markers or assays that can be used to detect a particular allele.

[0367] Also provided herein is a method for identifying a watermelon, cucumber or melon plant (or plant part) containing a mutant D14 allele, the method comprising detecting the presence of a mutant D14 allele in the plant (or plant part), the presence being detected by detecting at least one marker (e.g., a SNP marker or an indel marker) in the D14 allele or a protein encoded by the D14 allele. The method for detecting a mutant D14 allele is selected from the group consisting of methods comprising PCR amplification, nucleic acid sequencing, nucleic acid hybridization and an antibody-based assay (e.g., immunoassay) for detecting the D14 protein encoded by the allele.

[0368] Also provided herein is a method for identifying a watermelon, cucumber or melon plant (or plant part) containing a mutant D14 allele comprising a mutation in a regulatory element, the method comprising detecting reduced or absent gene expression of the mutant D14 allele in the plant (or plant part), the presence of which is detected by detecting the mRNA level (cDNA) of the wild-type D14 allele or the protein level of the wild-type D14 protein. The method for detecting the mutant D14 allele is selected from the group consisting of PCR amplification (e.g., RT-PCR), nucleic acid sequencing, Western blotting, and an antibody-based assay (e.g., immunoassay) for detecting the D14 protein encoded by the allele.

[0369] Also provided and provided herein are methods of determining, detecting or assaying whether a cell or a watermelon, cucumber or melon plant or plant part contains a mutant allele of a gene designated D14 that encodes a protein of SEQ ID NO: 2, 8 or 9 or a protein comprising at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2, 8 or 9. In one aspect, the method comprises determining expression of the allele and / or determining the coding sequence of the allele and / or determining a portion of the coding sequence of the allele (e.g., the SNP or indel genotype of the allele) and / or determining the amino acid sequence of the protein produced and / or the amount of the protein produced.

[0370] Various methods can be used to determine whether a plant or part thereof contains the mutant D14 allele of the present invention. As described, the mRNA (or cDNA) level of the wild-type allele can be determined, or the wild-type protein level can be determined to see whether there is reduced or no expression of the wild-type allele. The coding sequence or a part thereof can be analyzed, for example, even if one already knows which mutant alleles may be present, and an assay can be developed to detect the mutation, for example, a SNP or indel genotyping assay, for example, genotyping for marker mWM23349015_k2 (see examples) or genotyping for any of the mutant alleles of Table A or Table 2 or other mutant alleles, can distinguish the presence of the mutant allele and the wild-type allele, for example.

[0371] 1. A method for selecting a plant, comprising the steps of: a) identifying a plant having a mutation in an allele encoding a D14 protein-encoding gene, wherein the wild type allele of the gene encodes a D14 protein that comprises at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of the proteins selected from the group of SEQ ID NOs: 2, 8 or 9; and optionally b) determining whether the plant or progeny plant produces a multi-branched phenotype; and, optionally, c) selecting plants containing at least one copy of the mutant allele of step a); The method includes:

[0372] A method for the production of a plant, comprising the steps of: a) introducing a mutation into a population of plants or providing a population of mutated plants (e.g., a TILLING population); b) producing a multi-branched phenotype and / or selecting plants containing mutant D14 alleles; c) optionally determining whether the plants selected in b) have a mutation in the allele encoding the D14 protein-encoding gene and selecting plants containing such a mutation; and optionally d) growing / cultivating the plant obtained in c); wherein a wild type allele of the gene encodes a D14 protein comprising at least 95% sequence identity to the protein of SEQ ID NO: 2, 8 or 9.

[0373] 1. A method for selecting plants containing a strong or intermediate multi-branching phenotype, comprising: a) screening a plant (or DNA derived therefrom) for the presence of a mutant allele of the D14 gene, wherein a wild type allele of the gene encodes a D14 protein that comprises at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of the proteins selected from the group of SEQ ID NOs: 2, 8 or 9; b) selecting plants containing either i) a knockout allele or a mutant allele encoding a non-functional D14 protein (which allele produces a strong multi-branching phenotype in homozygotes), or ii) a knockdown allele or a mutant allele encoding a reduced-function D14 protein (which allele produces an intermediate multi-branching phenotype in homozygotes); and optionally c) confirming that a plant or a progeny plant containing the mutant allele in homozygote produces the strong multi-branching phenotype of i) or the intermediate multi-branching phenotype of ii. The method includes:

[0374] In one embodiment, step b) comprises predicting whether the mutant allele encodes a D14 protein with reduced or lost function, for example by performing a SIFT or Provean analysis of the effect of the amino acid change on protein function. One or more plants containing alleles predicted to be "deleterious" in the Provean analysis and / or "not tolerated" in the SIFT analysis are selected in step b).

[0375] 1. A method for producing or selecting a plant comprising a strong or intermediate multi-branching phenotype, comprising the steps of: a) introducing a mutation into a population of plants or providing a population of mutated plants (e.g., a TILLING population); b) selecting plants containing either i) a mutant D14 allele, either where i) is a knock-out allele or encodes a non-functional D14 protein, which allele produces a strong multi-branching phenotype in homozygotes, or ii) a mutant D14 allele, either where ii) is a knock-down allele or encodes a reduced-function D14 protein, which allele produces an intermediate multi-branching phenotype in homozygotes; c) selecting plants containing the mutant allele of i) or ii); wherein a wild type allele of the gene encodes a D14 protein comprising at least 95% sequence identity to the protein of SEQ ID NO: 2, 8 or 9.

[0376] Selected plants can be selfed to produce plants containing the mutant allele in homozygotes, and the homozygous plants can be grown to determine the phenotype.

[0377] A method for the production of a plant, comprising the steps of: a) the introduction of a foreign nucleic acid molecule into a plant, the foreign nucleic acid molecule comprising: i) a DNA molecule encoding at least one antisense RNA that results in a reduction in expression of an endogenous gene encoding a D14 protein; ii) a DNA molecule that, by a co-suppression effect, results in a reduction in expression of the endogenous gene encoding the D14 protein; iii) a DNA molecule encoding at least one ribozyme that cleaves a specific transcript of an endogenous gene encoding a D14 protein; iv) a DNA molecule simultaneously encoding at least one antisense RNA and at least one sense RNA, said antisense RNA and said sense RNA forming a double-stranded RNA molecule, which results in a reduction in the expression of the endogenous gene encoding the D14 protein (RNAi technology); v) a nucleic acid molecule introduced by in vivo mutagenesis resulting in a mutation or an insertion of a heterologous sequence in an endogenous gene encoding a D14 protein, the mutation or insertion resulting in a decrease in expression of the gene encoding the D14 protein or resulting in the synthesis of a loss-of-function or reduced-function D14 protein; vi) a nucleic acid molecule encoding an antibody, the antibody resulting in a reduction in the activity of an endogenous gene encoding an endogenous D14 protein upon binding of the antibody to the endogenous D14 protein; vii) DNA molecules containing transposons, the integration of which leads to a mutation or an insertion in the endogenous gene encoding the D14 protein, which leads to a decrease in the expression of the endogenous gene encoding the D14 protein or leads to the synthesis of an inactive protein; viii) a T-DNA molecule, the insertion of which results in reduced expression of the endogenous gene encoding the D14 protein or in the synthesis of a loss-of-function or reduced-function D14 protein; ix) Nucleic acid molecules encoding rare-cutting endonucleases or custom rare-cutting endonucleases, preferably meganucleases, TALENs or CRISPR / Cas systems. A process selected from the group consisting of: b) selecting the plant or plant progeny, which produces male flowers and / or flowers with a higher percentage of fused petals and / or leaves; optionally c) determining whether the plant or progeny selected in b) has a reduced activity of the D14 protein, e.g. compared to a wild-type plant in which the foreign nucleic acid molecule is not integrated into the genome; and optionally d) growing / cultivating the plants obtained in c) The method includes:

[0378] Plants obtained by any of the above methods are encompassed herein.

[0379] In one aspect, genetically modified plants and plant parts are provided that have reduced or no expression of the endogenous D14 gene, for example by silencing the endogenous D14 gene. Such plants can be any plant, and in one aspect, it is a watermelon, cucumber, or melon.

[0380] In another aspect, watermelon, cucumber or melon plants and plant parts are provided that comprise a mutation in the endogenous D14 gene, e.g., an induced mutation generated by targeted mutagenesis, whereby gene expression is either reduced or eliminated, or the expressed gene encodes a reduced- or loss-of-function D14 protein compared to the wild-type protein.

[0381] In another aspect, there is provided a method for detecting and optionally selecting watermelon plants, seeds or plant parts that contain at least one copy of a wild type and / or mutant allele of a gene designated ClD14 (Citrullus lanatus Dwarf14), comprising: a) providing one or more genomic DNA samples of one or more watermelon plants, seeds or plant parts; b) performing a genotyping assay using the DNA sample of a) as a template, which distinguishes between wild-type and mutant ClD14 alleles, said genotyping assay being based on nucleic acid amplification using ClD14 allele-specific oligonucleotide primers and / or said genotyping assay being based on nucleic acid hybridization using ClD14 allele-specific oligonucleotide probes; and optionally c) selecting plants, seeds or plant parts containing one or two copies of the mutant allele; wherein the wild type ClD14 allele comprises the sequence of SEQ ID NO:6 and the mutant ClD14 allele comprises one or more nucleotides that are inserted, duplicated, deleted or substituted relative to the sequence of SEQ ID NO:6.

[0382] In the above method, a ClD14 allele-specific oligonucleotide primer or said ClD14 allele-specific oligonucleotide probe comprising at least 10, 11, 12, 13, 14, 15 or more nucleotides of SEQ ID NO:6 or the complementary strand of SEQ ID NO:6 may be used.

[0383] In one embodiment of the above method, the mutant allele comprises at least one codon that has been inserted or duplicated in the coding region of the allele, or at least one codon that has been changed to another codon, or at least one codon that has been deleted or changed to a stop codon.

[0384] In one embodiment of the above method, the mutant allele comprises the sequence of SEQ ID NO:5.

[0385] In another embodiment of the above method, the mutant allele is an allele that encodes a protein listed in Table A or Table 2.

[0386] In another embodiment of the above method, the mutant allele is an allele that encodes a loss-of-function or reduced-function D14 protein, as described elsewhere herein.

[0387] In one embodiment of the above method, the oligonucleotide primer or oligonucleotide probe comprises at least 15, 16, 17 or more nucleotides complementary to SEQ ID NO:6 or the complement of SEQ ID NO:6.

[0388] Preferably, the genotyping assay used in the above method is a KASP assay, which comprises a first forward primer for detecting a wild-type allele of SEQ ID NO: 6 in a DNA sample, a second forward primer for detecting a mutant allele comprising one or more nucleotides inserted, deleted or substituted relative to SEQ ID NO: 6 in a DNA sample, and one common reverse primer.

[0389] In one embodiment, the second forward primer detects a mutant allele of SEQ ID NO:5 in a DNA sample.

[0390] In another embodiment, the second forward primer detects a mutant allele that is an allele that encodes a protein listed in Table A or Table 2.

[0391] In another embodiment, the second forward primer detects a mutant allele that is an allele that encodes a loss-of-function or reduced-function D14 protein, as described elsewhere herein.

[0392] In one embodiment of the KASP assay, the first forward primer comprises SEQ ID NO: 11 or a complementary sequence thereof and / or the second forward primer comprises SEQ ID NO: 10 or a complementary sequence thereof.

[0393] Also encompassed herein are synthetic or synthetic nucleic acid primers or probes, which for example comprise at least 15 nucleotides of SEQ ID NO:5 (or another mutant allele) or SEQ ID NO:6 or a complementary sequence of either of these. Such oligos can be synthesized using common methods for oligo synthesis. The primers or probes are preferably DNA oligos, provided, for example, in a buffer solution, for use, for example, in a genotyping assay.

[0394] 1. A method for detecting and optionally selecting watermelon, cucumber or melon plants, seeds or plant parts which contain at least one copy of a wild-type and / or mutant D14 allele of a gene designated ClD14 (Citrullus lanatus Dwarf14), CsD14 (Cucumis sativus Dwarf14) or CmD14 (Cucumis melo Dwarf14), comprising: a) providing one or more genomic DNA samples of one or more watermelon, cucumber or melon plants, seeds or plant parts; b) performing a genotyping assay using the DNA sample of a) as a template, said genotyping assay being based on nucleic acid amplification using D14 allele-specific oligonucleotide primers and / or said genotyping assay being based on nucleic acid hybridization using D14 allele-specific oligonucleotide probes; and optionally c) selecting plants, seeds or plant parts containing one or two copies of the mutant allele; wherein the wild type D14 allele encodes the protein of SEQ ID NO:2 (in watermelon), SEQ ID NO:8 (in cucumber) and SEQ ID NO:9 (in melon) and the mutant D14 allele comprises one or more amino acids inserted, deleted or substituted compared to SEQ ID NO:2, SEQ ID NO:8 or SEQ ID NO:9.

[0395] In one aspect, the mutant D14 allele is an allele that encodes a loss-of-function or reduced-function D14 protein, as described elsewhere herein.

[0396] In one aspect of this method, the D14 allele-specific oligonucleotide primer or the D14 allele-specific oligonucleotide probe comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides of SEQ ID NO: 6, or SEQ ID NO: 15, or SEQ ID NO: 16, or the complementary strand of any of these.

[0397] In further aspects of the above methods, the mutant allele encodes a protein comprising a duplication of at least one amino acid selected from amino acids 94-101 of SEQ ID NO:2, SEQ ID NO:8, and SEQ ID NO:9. In one aspect, the mutant allele encodes a protein comprising a duplication of at least serine 97 of SEQ ID NO:2, SEQ ID NO:8, and SEQ ID NO:9. In another aspect, the mutant allele encodes a protein comprising a duplication of amino acids 94-101 of SEQ ID NO:2, SEQ ID NO:8, or SEQ ID NO:9.

[0398] Further provided is a breeding method for watermelon comprising marker assisted selection (MAS) using indel markers to select watermelon lines, wherein the indel markers detect the sequence of SEQ ID NO:6 (the deletion allele or its complementary sequence) and / or the sequence of SEQ ID NO:5 (the insertion allele or its complementary sequence) in one or more genomic DNA samples.

[0399] Also provided is a breeding method for watermelon comprising marker assisted selection (MAS) using indel or SNP markers to select watermelon lines, the indel or SNP markers detecting in one or more genomic DNA samples alleles encoding mutant proteins comprising one or more amino acids deleted, inserted, duplicated or substituted compared to the wild type protein of SEQ ID NO:2 and / or the wild type protein of SEQ ID NO:6. In one aspect, the mutant protein is a loss-of-function or reduced-function D14 protein as described elsewhere herein. In one aspect, the mutant protein is a protein of Table A or Table 2.

[0400] In one aspect, the mutant protein comprises a duplication of one or more amino acids of SEQ ID NO: 94-101 of SEQ ID NO: 2. In one aspect, the mutant protein comprises the sequence of SEQ ID NO: 1.

[0401] In one embodiment, the indel marker is marker mWM23349015_k2.

[0402] Also provided is a breeding method for cucumber or melon comprising marker assisted selection (MAS) using indel or SNP markers to select cucumber or melon lines, wherein the indel or SNP markers detect, in one or more genomic DNA samples, alleles encoding a wild type protein of SEQ ID NO: 8 or 9 and / or alleles encoding a mutant protein comprising one or more amino acids deleted, inserted, duplicated or substituted compared to the wild type protein of SEQ ID NO: 8 or 9. In one aspect, the mutant protein comprises a duplication of one or more amino acids of SEQ ID NO: 94-101 of SEQ ID NO: 8 or 9.

[0403] These methods described above can be used to select or detect or breed with any of the mutant D14 alleles described elsewhere herein.

[0404] In a different aspect, there is provided a method for producing a plant, in particular a watermelon plant, a cucumber plant or a melon plant, comprising the steps of: - providing a first inbred plant having two copies of a wild-type D14 allele; - providing a second inbred plant having two copies of a mutant D14 allele, such as the mutant allele of SEQ ID NO: 5 for watermelon or any other mutant allele described herein; - crossing the first plant with a second plant to produce seeds of the F1 cross; - Optionally, harvest F1 hybrid seeds. A method is provided that includes:

[0405] In a different aspect, there is provided a method for producing a plant, in particular a watermelon plant, a cucumber plant or a melon plant, comprising the steps of: - providing a first inbred plant having two copies of a mutant D14 allele; - providing a second inbred plant having two copies of a mutant D14 allele, such as the mutant allele of SEQ ID NO: 5 for watermelon or any other mutant allele described herein; - crossing the first plant with a second plant to produce seeds of the F1 cross; - Optionally, harvest F1 hybrid seeds. A method is provided that includes:

[0406] In a different aspect, there is provided a method for producing a plant, in particular a watermelon plant, a cucumber plant or a melon plant, comprising the steps of: - providing a first plant having two copies of a wild-type D14 allele; - providing a second plant having one or two copies of a mutant D14 allele, such as the mutant allele of SEQ ID NO: 5 for watermelon or any other mutant allele described herein, - crossing the first plant with a second plant to produce seeds of an F1 plant; - selfing the F1 plant to produce an F2 plant or crossing the F1 plant with another plant to produce a progeny plant; - optionally further selfing or further (back)crossing the F2 plants or progeny plants of the previous step to produce further selfed or backcrossed plants; - optionally selecting plants having at least one copy of the mutant D14 allele. A method is provided that includes:

[0407] In a further embodiment, a method of introgressing a mutant D14 allele into a breeding line or variety of watermelon, cucumber or melon, comprising crossing a plant containing the mutant D14 allele with a plant lacking the mutant D14 allele, backcrossing the F1, F2 or further generation progeny to the recurrent parent, and finally selecting a recurrent parent containing the mutant D14 allele.

[0408] Optionally, MAS can be used to select for mutant and / or wild-type D14 alleles in the first or second plants or any further generations such as F2, F3, or backcross generations.

[0409] These methods described above can be used to select or detect or breed with any of the mutant D14 alleles described elsewhere herein.

[0410] Encompassed herein are seeds and / or plants produced by any of the above methods and containing at least one copy, optionally two copies, of the mutant D14 allele.

[0411] Array Description SEQ ID NO: 1: Mutant D14 protein of watermelon containing an insertion (ClD14ins) SEQ ID NO:2: Wild-type D14 protein from watermelon (ClD14) SEQ ID NO:3: cDNA encoding the mutant ClD14ins protein of SEQ ID NO:1 SEQ ID NO: 4: cDNA encoding the wild-type D14 protein of SEQ ID NO: 2 SEQ ID NO:5: Genomic DNA encoding the mutant ClD14ins protein of SEQ ID NO:1, including the inserted / duplicated 24 nucleotides SEQ ID NO: 6: Genomic DNA encoding the wild-type ClD14 protein, intron from nucleotides 375 to 463 SEQ ID NO: 7: Arabidopsis thaliana D14 protein SEQ ID NO: 8: Wild-type D14 protein of cucumber, Cucumis sativus, CsD14 protein SEQ ID NO: 9: Wild-type D14 protein of melon, Cucumis melo, CmD14 protein SEQ ID NO: 10: FAM primer of the KASP assay for marker mWM23349015_k2 SEQ ID NO: 11: VIC primer of the KASP assay for marker mWM23349015_k2 SEQ ID NO: 12: Common reverse primer of the KASP assay for marker mWM23349015_k2 SEQ ID NO: 13: Minus strand of ClD14 wild type allele, used to design KASP primers SEQ ID NO: 14: Minus strand of ClD14ins mutant allele (containing 24 inserted / duplicatable nucleotides) used to design KASP primers SEQ ID NO: 15: Genomic DNA of the cucumber wild-type CsD14 gene SEQ ID NO: 16: Genomic DNA of melon wild-type CmD14 gene SEQ ID NO: 17: cDNA of the cucumber wild-type CsD14 gene SEQ ID NO: 18: cDNA of melon wild-type CmD14 gene

[0412] The following non-limiting examples are provided. EXAMPLES

[0413] Example 1 QTL mapping for secondary branching (also called "multi-branching") was performed on an F2 population developed by crossing the multi-branching cultivar Sidekick F1 with a proprietary normally branching watermelon plant.

[0414] Phenotyping was performed by counting the number of secondary branches starting from the main stem at 90 cm from the crown to the end of the stem. Counts were performed on 5-7 plants per line / genotype and the average secondary branches were calculated.

[0415] It was found that a gene on chromosome 8 caused the multibranching phenotype in Sidekick F1. This gene contained a 24-nucleotide duplication that encoded eight additional amino acids compared to the wild-type gene normally present in the branching parent. This gene is referred to herein as ClD14. The multibranching phenotype was only seen when the mutant allele of the gene (containing the 24-nucleotide duplication) was present in the homozygote.

[0416] A KASP marker called mWM23349015_k2 was developed to distinguish between the wild type allele of the gene shown in SEQ ID NO: 6 and the mutant allele of the gene shown in SEQ ID NO: 5, which contains 24 additional nucleotides (the insertion is a duplication of the wild type sequence of 24 nucleotides), see Figure 4 (intron sequence shown in bold).

[0417] The F3 population was analyzed for mWM23349015_k2 and the average number of secondary branches, with the following results:

[0418] [Table 3]

[0419] Thus, the mutant allele of the gene (SEQ ID NO:5; ClD14ins, containing a 24 nucleotide insertion) was responsible for changing the average branching pattern of watermelon plants containing the mutant allele in homozygotes to a branching pattern in which more than 45 secondary branches were formed.

[0420] The KASP assay mWM23349015_k2 was performed with two forward primers and a common / reverse primer: SEQ ID NO:10 (Fam primer, 5'GAGACGGAGTGGCCGACC3'), and SEQ ID NO:11 (VIC primer, 5'GGAGACGGAGTGGCCGACA3'), SEQ ID NO:12 (common primer 5'CACGTCCACCGCTGCGCCTT3').

[0421] The Fam and Vic primers also contained tail sequences at the 5' ends as described for the KASP assay.

[0422] It is noted that the DNA sequences for the KASP assay were designed on the reverse DNA strand (minus strand), but can be similarly designed based on the plus strand of the allele. The plus and minus strands are complementary strands of double-stranded DNA. Nucleotide G is C in the complementary strand and nucleotide A is T in the complementary strand.

[0423] DNA sequences used for KASP assay primer design, mWM23349015_k2 (FAM and VIC primers are shaded grey).

[0424] [Table 4]

[0425] According to the KASP brochure, KASP™ genotyping technology from LGC, Biosearch Technologies™ uses a proprietary form of competitive allele-specific PCR (polymerase chain reaction) that allows highly accurate biallelic scoring of SNPs (single nucleotide polymorphisms) and indels (insertion / deletion) at specific loci across a wide range of genomic DNA samples. Discrimination of both alleles is achieved by competitive binding of two allele-specific forward primers, each with a unique tail sequence that matches one of the two universal probes; one is labeled with FAM™ dye and the other with HEX™ dye.

[0426] Besides the DNA templates (genomic DNA of various watermelon lines or populations obtained from crosses with Sidekick) and PCR-primers as described above, standard components (e.g. KASP assay mix, KASP-master mix, etc.) and assay protocols were used in the assay as described by LGC, Biosearch Technologies™ on the World Wide Web at biosearchtech.com / products / pcr-kits-and-reagents / genotyping-assays / kasp-genotyping-chemistry.

[0427] The allele discrimination plot (Figure 5) distinguished between homozygous wild type, heterozygous and homozygous samples for the ClD14ins allele. Due to the presence of repeats / duplications in the ClD14ins allele, the ClD14ins allele containing samples (ClD14ins / ClD14 or ClD14ins / ClD14ins) generate more signals compared to the wild type samples (ClD14 / ClD14), so that the distribution of signals deviates from the classical distribution in the allele discrimination plot, but it is noted that the genotypes are clearly distinguished in different clusters. The top left cluster in Figure 5 represents plants homozygous for the wild type allele, the top right cluster represents plants homozygous for the mutant allele containing the insertion / duplication, and the middle cluster represents heterozygous plants.

[0428] In Figure 4, an alignment of the two genomic sequences (plus strand) is shown, where SEQ ID NO:6 is the wild type genomic sequence (lacking the insertion) and SEQ ID NO:5 is the mutant ClD14 sequence containing a 24 nucleotide insertion, thus resulting in an insertion (duplication) of 8 amino acids in the ClD14 protein, also called ClD14ins (see Figures 1 and 3).

[0429] Thus, the above KASP assay can be used to detect a wild-type ClD14 allele of SEQ ID NO:6 (lacking the 24 nucleotide insertion / duplication) or a mutant ClD14 allele of SEQ ID NO:5 that contains a 24 nucleotide insertion (duplication) in the genomic sequence, i.e., an insertion of nucleotides 280-303 in SEQ ID NO:5 (see Figure 4) (which is in fact a duplication of nucleotides 281-304 of the wild-type sequence of SEQ ID NO:6) (shown in italics in Figure 4).

[0430] This KASP assay, or other assays, can be used to detect a wild-type allele of the ClD14 gene of SEQ ID NO:6 and / or a mutant allele of the ClD14 gene that contains one or more nucleotides inserted, deleted or substituted compared to the wild-type allele, such as a mutant allele of SEQ ID NO:5.

[0431] BLAST analysis of the ClD14 protein against Uniprot / Swiss-prot was performed to identify orthologs of the ClD14 gene in other species, and two orthologs were identified: the Cucumis sativus CsD14 gene encoding the protein of SEQ ID NO:8 and the Cucumis melo CmD14 gene encoding the protein of SEQ ID NO:9.

[0432] Example 2 The watermelon TILLING population was screened and several mutations resulting in amino acid substitutions or stop codons were found in the ClD14 gene. The mutations are listed in Table 2 below and are also shown in FIG.

[0433] [Table 5]

[0434] W155 stop mutants have a multibranching phenotype when the mutation is homozygous (W155 * / W155 * ). The phenotype appears to be that of the original mutant (ClD14ins / ClD14ins) containing a duplication of eight amino acids. The average number of secondary branches was determined 40 cm from the crown and is shown in Table 3 below.

[0435] [Table 6]

[0436] Phenotypically identical, and W155 *Since the protein must be non-functional (it is truncated and lacks the C-terminal 113 amino acids), one can unexpectedly conclude that the ClD14ins mutant allele must also code for a non-functional protein that does not transmit a signal to inhibit secondary branching. It is therefore concluded that knockouts of the ClD14 gene or mutants resulting in non-functional ClD14 proteins no longer transmit any signal and therefore there is no longer any inhibition of secondary branching. This is sometimes referred to as "fully multibranched" or "strongly multibranched".

[0437] Here, this indicates that the multibranching phenotype is a normal wild-type branching, and that the ClD14ins / ClD14ins and W155 * / W155 * We also demonstrate that other mutants can be generated in which the multibranching phenotype is weaker and in which some inhibition of secondary branching is still active, intermediate to the strong multibranching phenotype seen in plants, resulting in an average number of secondary branches of approximately 240% compared to wild-type plants.

[0438] Because the protein is highly conserved, such that nearly the entire protein is a conserved domain (IPR00073, see www.ebi.ac.uk / interpro / entry / InterPro / IPR000073 / ), single amino acid substitutions, deletions and / or insertions can be made, for example, in the IPR00073 domain, which still allows for binding of some strigolactone to the protein pocket and transmission of some of the signal in the strigolactone signaling pathway. For example, any of the TILLING mutants in Table 2 above, in homozygotes, may result in a reduced function ClD14 protein and "intermediate multibranching", e.g., at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190% secondary branching compared to wild-type plants, but may not result in "complete multibranching" as seen in plants in which the ClD14 protein has lost its function and no longer suppresses secondary branching.

[0439] This more "gentle branching" or "medium branching" is desirable because strongly branched plants tend to have high humidity under the leaves, making them more susceptible to diseases such as fungi.

[0440] Therefore, any newly induced mutations in the ClD14 gene (and plants containing these in heterozygotes or homozygotes) other than the existing ClD14ins mutant (containing the eight amino acid duplication shown in SEQ ID NO:1) are also contemplated, particularly the ClD14ins mutant or W155. * Mutations that result in less robust multibranching than the mutant ("intermediate multibranching") are encompassed herein.

[0441] However, any knockout mutants or mutant alleles resulting in non-functional ClD14 proteins other than the existing ClD14ins mutant (containing the eight amino acid duplication shown in SEQ ID NO:1) are also encompassed herein, as are plants containing such mutants in heterozygotes or homozygotes.

[0442] Example 3 - Targeted mutagenesis Targeted genome editing using engineered nucleases has become widely used in various fields. In watermelon, Crispr has been used successfully to modify target genes. For example, see Wang, Y., Wang, J., Guo, S. et al. CRISPR / Cas9-mediated mutagenesis of ClBG1 decreased seed size and promoted seed germination in watermelon. Hortic Res 8, 70 (2021). https: / / doi.org / 10.1038 / s41438-021-00506-1, and this method and vector can also be used to generate mutations in the D14 gene.

[0443] Single base substitutions or deletions of one or more nucleotides can be performed by homologous recombination (HR).

[0444] Binary CRISPR / Cas9 vectors can be used, for example, as described in Wang et al. (supra). Specific single guide RNAs (sgRNAs) targeted to D14 can be selected following evaluation with CRISPR-P (http: / / cbi.hzau.edu.cn / crispr / ). Target sequences are cloned into vectors and then used to transform watermelon cultivars.

[0445] Watermelon explants can be transformed according to the modified method of Yu et al. (2011 Plant Cell Rep 30:359-371). Briefly, surface-sterilized watermelon seeds were sown on Murashige-Skoog basal solid medium supplemented with 3% Suc for 3 days. Then, the embryo-free cotyledons were cut into 2 × 2 mm pieces. Agrobacterium tumefaciens strain EHA105 carrying the vector can be used for transformation. The cotyledon explants are co-cultivated in the dark for 4 days and then transferred to selective induction medium containing 1.5 mg / L 6 BA, 2 mg / L Basta. The regenerated adventitious shoots are excised and transferred to selective elongation medium containing 0.1 mg / L 6 BA, 0.01 mg / L NAA, 2 mg / L Basta.

[0446] The plasmid vector carries a cassette expressing CAS9 and two guide RNAs (gRNAs) and a donor fragment as a template for homology-directed repair (HDR). Expression of the Cas9 gene and gRNAs is driven by a strong promoter, such as the ubiquitin promoter. The gRNAs are designed on the opposite strands of the two target sites.

[0447] The donor fragment contains the desired mutation in the middle of the fragment that corresponds to the sequence of the target D14 gene (excluding the mutation). Optionally, additional synonymous mutations that do not change the amino acid residues in the donor fragment will prevent Cas9 from cutting the donor fragment again after HDR is successfully achieved. The fragment is flanked by two gRNA target sequences, each of which contains a PAM motif, so that the donor DNA can be released by Cas9 / gRNA from the plasmid vector; see, for example, Sun et al. (2016) Molecular Plant 9,628-631 DOI:10.1016 / j.molp.2016.01.001.

[0448] To increase HDR, additional free DNA donor fragments can be co-introduced into the explants. After transformation, regenerated shoots, selected for example on the basis of antibiotic resistance encoded in the plasmid vector, are grown and analyzed for the presence of mutations. This can be done by primers to amplify the target gene sequence from the DNA by PCR. The primers are designed so that they cannot amplify the fragment from the plasmid. The amplified products can be sequenced to confirm the presence of the mutation.

[0449] Plants can be regenerated from the transformed plant material containing the desired mutation using standard methods.

[0450] For example, as described by Wang et al. (supra), genomic DNA can be extracted from young leaves of T0-T4 transgenic plants, which is then used to generate templates to amplify specific fragments in the target gene using primers flanking the two targeting sites. PCR can be performed under the following conditions: 94°C / 5 min; 94°C / 30 sec, 56°C / 30 sec and 72°C / 1 min (35 cycles); and 72°C / 10 min as a final extension. PCR products can be directly sequenced using standard methods.

[0451] Transgenic plants can also be confirmed to be free of Cas9 using primers specific for Cas9. PCR can be performed under the following conditions: 94°C / 5 min; 94°C / 30 sec, 60°C / 30 sec, and 72°C / 1 min (29 cycles); and 72°C / 10 min as a final extension.

Claims

1. A watermelon plant comprising a mutant allele of the gene named ClD14 (Citrullus lanatus Dwarf14), wherein the mutant allele comprises a mutation in one or more regulatory sequences that results in reduced gene expression or no gene expression compared to the corresponding wild-type allele, or the mutant allele encodes a protein comprising a deletion, truncation, insertion, or substitution of one or more amino acids compared to the protein encoded by the wild-type allele, resulting in reduced or loss of function of the ClD14 protein, and the mutant allele results in the plant producing an increased average number of secondary branches when the mutant allele is homozygous, and the mutant allele is not the mutant allele encoding the protein of SEQ ID NO: 1, and the wild-type ClD14 protein of the wild-type allele is a) a nucleic acid molecule encoding a protein having the amino acid sequence set forth in SEQ ID NO: 2, b) a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO: 6 or its complementary sequence A watermelon plant encoded by a nucleic acid molecule selected from the group consisting of.

2. The mutant allele encodes a protein in which one or more amino acids have been inserted, substituted, or deleted, resulting in reduced function of the protein but not loss of function of the protein, whereby the average number of secondary branches is greater than that of a plant homozygous for the wild-type ClD14 allele but not as great as that of a plant homozygous for a mutant ClD14 allele encoding a non-functional protein. The watermelon plant according to claim 1.

3. The watermelon plant according to claim 1 or 2, which is homozygous for the mutant allele and produces an increased average number of secondary branches compared to the plant that is homozygous for the wild-type allele.

4. A seed from which the plant according to claim 1 or 2 can grow.

5. A method for detecting and optionally selecting a watermelon plant, seed, or plant part comprising at least one copy of a mutant allele of the gene named ClD14 (Citrullus lanatus Dwarf14), comprising: a) providing one or more genomic DNA samples of one or more watermelon plants, seeds, or plant parts; b) performing a genotyping assay that distinguishes between the wild-type ClD14 allele and the mutant ClD14 allele, using the DNA sample of a) as a template, wherein the genotyping assay is based on nucleic acid amplification using ClD14 allele-specific oligonucleotide primers and / or the genotyping assay is based on nucleic acid hybridization using ClD14 allele-specific oligonucleotide probes; and optionally, c) selecting a plant, seed or plant part comprising one or two copies of the mutant allele comprising, wherein the mutant ClD14 allele comprises one or more nucleotides inserted, duplicated, deleted or substituted relative to the sequence of SEQ ID NO: 6, and results in a mutant ClD14 protein comprising one or more amino acids inserted, duplicated, deleted or substituted relative to the sequence of SEQ ID NO:

2. **Claim 6** The method according to claim 5, wherein the ClD14 allele-specific oligonucleotide primer or the ClD14 allele-specific oligonucleotide probe comprises at least 10 nucleotides of SEQ ID NO: 6 or the complementary strand of SEQ ID NO:

6. **Claim 7** The method according to claim 5 or 6, wherein the mutant allele comprises at least one codon inserted or duplicated in the coding region of the allele, or at least one codon changed to another codon, or at least one codon deleted or changed to a stop codon. **Claim 8** The method according to claim 5 or 6, wherein the mutant allele comprises the sequence of SEQ ID NO:

5. **Claim 9** The method according to claim 5 or 6, wherein the oligonucleotide primer or oligonucleotide probe comprises at least 15 nucleotides complementary to SEQ ID NO: 6 or the complementary sequence of SEQ ID NO:

6. **Claim 10** The method according to claim 5 or 6, wherein the genotyping assay is a KASP assay, and the KASP assay comprises a first forward primer that detects the wild-type allele of SEQ ID NO: 6 in the DNA sample, a second forward primer that detects the mutant allele comprising one or more nucleotides inserted, deleted or substituted relative to SEQ ID NO: 6 in the DNA sample, and one common reverse primer.

Images