Nucleic acids, compositions and complexes containing the same, and methods of preparation and use

JP2024525800A5Pending Publication Date: 2025-07-03SUZHOU RIBO LIFE SCIENCE CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024502055
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-07-16
Filing Date
2022-06-30
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Current siRNA drugs used to suppress APOC3 gene expression suffer from significant off-target effects, which pose toxicity issues, limiting their use in clinical applications.

Method used

Development of siRNAs with stabilizing modified nucleotides at specific positions in the sequence, enhancing thermal stability and reducing off-target effects while maintaining effective APOC3 gene suppression.

Benefits of technology

The modified siRNAs exhibit significantly lower off-target effects, hepatotoxicity, and improved lipid-lowering activity, demonstrating high safety and efficacy in suppressing APOC3 gene expression in vivo and in vitro.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure provides an siRNA capable of suppressing the expression of the apolipoprotein C3 (APOC3) gene. The siRNA comprises a sense strand and an antisense strand, and the sense strand and the antisense strand each comprise a nucleotide sequence I or a nucleotide sequence II consisting of 19 modified or unmodified nucleotides, and the nucleotide sequence I and the nucleotide sequence II form a double-stranded region at least partially in reverse complementarity, and the nucleotide sequence II is at least partially reverse complementary to one nucleotide sequence in the mRNA expressed by the APOC3 gene, and at least one of the nucleotides at positions 3 to 6 of the nucleotide sequence II from the 5' end to the 3' end is a stabilizing modified nucleotide. The siRNA provided by the present disclosure and the pharmaceutical composition and siRNA complex containing the siRNA can effectively treat and / or prevent a disease or symptom associated with the expression of the APOC3 gene, and can significantly reduce off-target effects.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present disclosure relates to nucleic acids that can reduce off-target effects and inhibit Apolipoprotein C3 (APOC3) gene expression, compositions and complexes that contain the nucleic acids. The present disclosure further relates to methods for preparing and using these nucleic acids, compositions and complexes. [Background technology]

[0002] Dyslipidemia, also known as hyperlipidemia, is a systemic disease in which plasma lipids are elevated above normal levels due to abnormalities in fat metabolism or function, and poses a serious threat to the health of patients worldwide. Apolipoprotein C3 (APOC3) plays an important role in lipid metabolism, and individuals carrying APOC3 mutant genes have a 46% lower expression of APOC3 in the blood circulation and a 39% lower triglyceride level in plasma compared to the general population. Therefore, there is no doubt that blocking APOC3 by silencing gene expression at the gene level using small interfering RNA (siRNA) would be an ideal means to treat APOC3-related dyslipidemia. In recent years, considerable progress has been made in the development of siRNA drugs that suppress the expression of the APOC3 gene.

[0003] In the development research of siRNA drugs, off-target effects are one of the important side effects related to toxicity. Currently, many siRNAs that show excellent pharmacological activity in preclinical pharmaceutical studies are difficult to use in actual drug research and development due to toxicity caused by off-target effects. The ideal siRNA expected to be used in the preparation of drugs actually administered to patients should undoubtedly be low-toxic, including low toxicity caused by off-target effects. Therefore, in this field, it is necessary to explore further in depth how to obtain siRNAs with low off-target effects. Summary of the Invention [Problem to be solved by the invention]

[0004] In order to develop siRNA that can suppress APOC3 gene with significantly reduced off-target effect, the present inventors unexpectedly found that siRNA with stabilizing modified nucleotide at specific position of sequence shows significantly lower off-target effect than siRNA without stabilizing modified nucleotide at corresponding position.Furthermore, some siRNA with stabilizing modified nucleotide at specific position of sequence has significantly lower off-target effect and shows APOC3 gene suppression activity that is not obviously reduced or equivalent to that of siRNA without stabilizing modified nucleotide.Therefore, the present inventors have made the following invention. [Means for solving the problem]

[0005] In one aspect, the present disclosure provides an siRNA, the siRNA comprising a sense strand and an antisense strand, the sense strand comprising a nucleotide sequence I, the antisense strand comprising a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II each consisting of 19 nucleotides, each nucleotide in the nucleotide sequence I and the nucleotide sequence II being a modified or unmodified nucleotide, the nucleotide sequence I and the nucleotide sequence II at least partially reverse-complementarily forming a double-stranded region, the nucleotide sequence II being at least partially reverse-complementary to a first nucleotide sequence, the first nucleotide sequence being at least partially reverse-complementary to a second nucleotide sequence, the first nucleotide sequence being at least partially reverse-complementary to a second nucleotide sequence, the second nucleotide sequence being at least partially reverse-complementary to a third nucleotide sequence, the second nucleotide sequence being at least partially reverse-complementary to a third nucleotide sequence, the third nucleotide sequence being at least partially reverse-complementary to a fourth nucleotide sequence, and the fourth nucleotide sequence being at least partially reverse-complementary to a fourth nucleotide sequence. The nucleotide sequence is a nucleotide sequence having a length of 19 nucleotides in mRNA expressed by the APOC3 gene, and from the 5' end to the 3' end, at least one of the nucleotides at positions 3 to 6 of the nucleotide sequence II is a stabilizing modified nucleotide, and the stabilizing modified nucleotide refers to a nucleotide in which the hydroxyl at the 2' position of the ribose of the nucleotide is replaced with a stabilizing modified group. Compared to an siRNA in which the nucleotide at the corresponding position is an unmodified nucleotide, the siRNA containing the stabilizing modified nucleotide has increased thermal stability and the steric hindrance of the stabilizing modified group is greater than that of 2'-O-methyl.

[0006] In another embodiment, the present disclosure further provides a pharmaceutical composition, the pharmaceutical composition comprising a siRNA provided by the present disclosure and a pharma- ceutically acceptable carrier.

[0007] In yet another aspect, the present disclosure further provides an siRNA complex, the siRNA complex comprising an siRNA provided by the present disclosure and a conjugation group conjugated and bound to the siRNA, the conjugation group comprising a linker and a pharma- ceutically acceptable targeting group, the siRNA, the linker, and the targeting group being, in turn, covalently or non-covalently bound, and each of the targeting groups being selected from ligands capable of binding to a cell surface receptor.

[0008] In yet another aspect, the present disclosure further provides the use of the siRNAs, pharmaceutical compositions, and siRNA complexes of the present disclosure in the preparation of a medicament for treating and / or preventing a disease or condition associated with the mRNA level expressed by the APOC3 gene.

[0009] In yet another aspect, the present disclosure further provides a method for treating and / or preventing a disease or condition associated with mRNA levels expressed by the APOC3 gene, the method comprising administering an siRNA, pharmaceutical composition, and / or siRNA complex of the present disclosure to a subject in need thereof.

[0010] In yet another aspect, the present disclosure further provides a method for suppressing the expression level of the APOC3 gene in a cell, the method comprising contacting the cell with an effective amount of an siRNA, pharmaceutical composition, and / or siRNA complex of the present disclosure.

[0011] Additionally, the present disclosure further provides kits, the kits comprising the siRNA, pharmaceutical composition, and / or siRNA complexes of the present disclosure.

[0012] [Incorporation by reference] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. Effect of the Invention

[0013] The siRNA, pharmaceutical composition, and / or siRNA complex of the present disclosure has good stability, low off-target effect, good APOC3 gene expression suppression activity, and good lipid-lowering effect. The following is a detailed description.

[0014] First, the siRNA, pharmaceutical composition, and / or siRNA complex of the present disclosure may have lower off-target effects and / or toxic reactions due to off-target effects in vitro or in vivo.In particular, mice administered with the siRNA complex of the present disclosure showed significantly lower blood biochemical results and obvious toxicity superiority compared to the reference siRNA complex.For example, mice administered with the siRNA complex of the present disclosure at a dose of 100 mg / kg showed significantly lower blood biochemical indicators and no obvious abnormalities compared to the blank control group, and mice administered with the siRNA complex of the present disclosure showed no moderate or higher inflammatory cell infiltration and necrosis compared to the reference siRNA complex, showing significantly lower toxic reactions in histopathology. In addition, even at a high dose of, for example, 300 mg / kg, there was no obvious difference in serum ALT compared to the blank control group, and in the histopathological sections of six mice administered with the reference complex, all showed inflammatory cell infiltration, whereas only three mice administered with the complex of the present disclosure showed inflammatory cell infiltration, and the number of mice showing inflammatory cell infiltration was obviously reduced. In addition, for example, the siRNA complex of the present disclosure has low off-target effects, and in an in vitro sicheck system, the siRNA complex of the present disclosure showed excellent on-target target sequence suppression activity, and IC 50The values ​​were 4.50 pM to 11.3 pM, and the off-target target sequence inhibition rates within the entire range of siRNA concentrations tested were all less than 50%, indicating low off-target effects. For example, in mice administered with the siRNA complex of the present disclosure at a high dose of 300 mg / kg every week for three consecutive weeks, serum ALT and AST concentrations were equivalent to the levels of the blank control group. Furthermore, in pathological sections of mice administered with the siRNA complex of the present disclosure, responses in terms of hepatic steatosis and inflammation were similar to those of the blank control group, with no significant abnormalities, indicating that the siRNA complex of the present disclosure has very low hepatotoxicity.

[0015] Second, the siRNA, pharmaceutical composition, and / or siRNA complex of the present disclosure exhibits excellent APOC3 gene expression regulating activity in in vitro and in vivo experiments. For example, the siRNA complex provided by the present disclosure exhibits very high target sequence suppression activity in an in vitro sicheck system, and IC 50 The siRNA complexes provided by the present disclosure have a target sequence suppression activity of at least 38.92% and up to 67.54% at a low concentration of 0.01 nM, and at a concentration of 0.1 nM, the target sequence suppression rate reaches 84.73 to 89.35%. The siRNA complexes have a target sequence suppression activity level that is close to or not significantly lower than that of the reference siRNA complexes that do not contain stabilizing modified nucleotides.

[0016] Third, the siRNA, pharmaceutical composition, and / or siRNA complex of the present disclosure exhibits good lipid TG lowering effect in vivo. For example, at different time points after administration, the siRNA complex of the present disclosure can obviously lower the TG and CHO levels in mouse serum, and exhibits lipid level lowering effect close to or not significantly lowered by the reference siRNA complex that does not contain the corresponding stabilized modified nucleotide. In particular, at a dose of 3 mg / kg, the siRNA complex of the present disclosure consistently exhibits a very high lipid TG lowering effect within the entire administration time of up to 50 days, and the maximum inhibition rate can reach 90.2%. Also, for example, at different time points after administration, the siRNA complex of the present disclosure can obviously lower the TG and CHO levels in mouse serum, and exhibits lipid level lowering effect close to the reference siRNA complex that does not contain the corresponding stabilized modified nucleotide. In particular, at a dose of 3 mg / kg and 1 mg / kg, the siRNA complex of the present disclosure consistently exhibits a very high lipid TG lowering effect within the entire administration time of up to 50 days, and the maximum inhibition rate can reach 92.0%. Also, for example, at different time points after administration, the siRNA complex of the present disclosure at different concentrations can all reduce the TG level in mouse serum, and in particular, after administration only once at a dose of 9 mg / kg, the siRNA complex of the present disclosure can consistently maintain a TG level suppression rate of more than 50% over a long period of 64 days, and the suppression rate can reach a maximum of 89.5%, showing excellent lipid suppression ability. Also, for example, at different time points after administration, the siRNA complex of the present disclosure can obviously reduce the TG and CHO levels in mouse serum. Also, within the 43-day experimental period, it consistently maintains a high suppression effect, and in particular, the siRNA complex of the present disclosure at a dose of 3 mg / kg all show excellent lipid suppression effects on mice, with the maximum serum TG suppression rate being higher than 88% and the maximum serum CHO suppression rate being 51.18% to 57.41%. Furthermore, for example, at different time points after administration, the siRNA complexes of the present disclosure could clearly reduce TG and CHO levels in mouse serum, and also maintained a consistently high inhibitory effect within the 22-day experimental period, and showed lipid level-reducing effects close to those of the reference siRNA complexes that did not contain the corresponding stabilizing modified nucleotides.

[0017] As a result, the siRNA, pharmaceutical composition, and siRNA complex provided by the present disclosure have significantly low off-target effects and toxic reactions due to off-target effects, particularly hepatotoxic reactions, and can effectively suppress APOC3 gene expression in vivo and in vitro and exhibit good lipid-lowering activity, thereby having significantly high safety and being able to effectively treat and / or prevent disease symptoms associated with the mRNA levels expressed by the APOC3 gene, particularly dyslipidemia, and have bright prospects for application. [Brief description of the drawings]

[0018] [Figure 1A-1B] FIG. 13 is a scatter plot of ALT and AST concentrations in mouse serum following three consecutive weekly administrations of 300 mg / kg of siRNA complexes of the present disclosure or PBS, respectively. [Diagram 2] 1 is a histogram of the relative expression levels of a target sequence in the in vitro sicheck system after co-transfection of a plasmid containing the target sequence with a siRNA complex or a reference siRNA NC. [Figure 3A-3B] 1 is a line graph showing the change in serum TG or CHO levels over time following administration of a siRNA complex of the present disclosure, a reference siRNA complex, or PBS, respectively. [Figure 4A-4B] 1 is a line graph showing the change in serum TG or CHO levels over time following administration of a siRNA complex of the present disclosure, a reference siRNA complex, or PBS, respectively. [Figure 5A-5B] 1 is a line graph showing the change in serum TG levels or serum CHO levels over time following administration of the siRNA complex of the present disclosure or PBS, respectively. [Figure 6] 1 is a line graph showing the time course of serum TG levels after administration of different concentrations of the siRNA complex of the present disclosure or PBS. [Figure 7A-7B]1 is a line graph showing the change in serum TG levels or serum CHO levels over time following administration of the siRNA complex of the present disclosure or PBS, respectively. [Figure 8A-8B] 1 is a line graph showing the change in serum TG or CHO levels over time following administration of a siRNA complex of the present disclosure, a reference siRNA complex, or PBS, respectively. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] Hereinafter, specific embodiments of the present disclosure will be described in detail. It should be understood that the specific embodiments described herein are merely for the purpose of explaining and interpreting the present disclosure, and are not intended to limit the present disclosure.

[0020] In this disclosure, unless otherwise specified, APOC3 mRNA or "mRNA expressed by the APOC3 gene" refers to the mRNA having the sequence set forth in Genbank accession number NM_000040.3, and APOC3 gene refers to the gene that transcribes the above-mentioned APOC3 mRNA.

[0021] <Definition> Unless otherwise stated in the context, capital letters C, G, U, and A represent the base composition of a nucleotide, lower case letter m represents that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide, lower case letter f represents that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide, lower case letter s represents that two nucleotides adjacent to the left and right sides of the letter s are linked by a phosphorothioate, P1 represents that one nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide, and in some embodiments, P1 is specifically modified VP, Ps, or P, the combination letter VP represents that one nucleotide adjacent to the right side of the combination letter VP is a vinyl phosphate (5'-(E)-vinylphosphonate (E-VP))-modified nucleotide, the combination letter Ps represents that one nucleotide adjacent to the right side of the combination letter Ps is a phosphorothioate-modified nucleotide, and capital letter P represents that one nucleotide adjacent to the right side of the letter P is a 5'-phosphate nucleotide.

[0022] In this context, the "fluoro-modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl of the ribose of the nucleotide is replaced with fluorine, and the "non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analog in which the 2'-hydroxyl of the ribose of the nucleotide is replaced with a non-fluorine group. The "nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide, such as an isonucleotide, bridged nucleotide (abbreviated as BNA), or acyclic nucleotide. The "methoxy-modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl of the ribose is replaced with methoxy.

[0023] In the context of this specification, the terms "complementary" or "reverse complementary" may be used interchangeably and have the meaning well known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, bases on one strand are paired with bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA), and the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair contains one purine and one pyrimidine. If adenine on one strand always pairs with thymine (or uracil) on the other strand and guanine always pairs with cytosine, it is considered that both strands are complementary and that the sequence of the strand can be inferred from the sequence of the complementary strand. Accordingly, in the art, the term "mismatch" means that bases at corresponding positions in a double-stranded nucleic acid are not present in a complementary pairing.

[0024] Unless otherwise specified in context, "essentially reverse complementary" refers to no more than three base mismatches between two related nucleotide sequences, "substantially reverse complementary" refers to no more than one base mismatch between two nucleotide sequences, and "fully reverse complementary" refers to no base mismatches between two nucleotide sequences.

[0025] In the context, particularly in describing the method for preparing the siRNA, pharmaceutical composition, or siRNA complex of the present disclosure, unless otherwise specified, the nucleoside monomer refers to modified or unmodified nucleoside phosphoramidite monomers (unmodified or modified RNA phosphoramidites, RNA phosphoramidites are sometimes referred to as nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis according to the type and order of nucleotides in the siRNA or siRNA complex to be prepared. Phosphoramidite solid-phase synthesis is a method used for RNA synthesis known to those skilled in the art. All of the nucleoside monomers used in the present disclosure are commercially available.

[0026] It will be understood by those of skill in the art that with respect to any group that contains one or more substituents, it is not intended that these groups introduce any substitutions or substitution patterns that are sterically impractical, synthetically impractical, and / or inherently unstable.

[0027] As used herein, "alkyl" refers to straight and branched chains having a specified number of carbon atoms, typically 1 to 20 carbon atoms, e.g., 1 to 10 carbon atoms, such as 1 to 8 or 1 to 6. For example, C1-C6 alkyl includes straight and branched chain alkyls of 1 to 6 carbon atoms. When naming an alkyl residue having a specific number of carbons, it is intended to include all branched and straight chain forms having that number of carbons. Thus, for example, "butyl" is meant to include n-butyl, sec-butyl, isobutyl, and tert-butyl, and "propyl" includes n-propyl and isopropyl. Alkylene is a subset of alkyl and refers to the same residue as alkyl but having two points of attachment.

[0028] As used herein, "alkenyl" refers to an unsaturated branched or straight chain alkyl having at least one carbon-carbon double bond, which is obtained by removing one hydrogen molecule from adjacent carbon atoms of a parent alkyl. The group may be in the cis or trans configuration of the double bond. Exemplary alkenyls include, but are not limited to, vinyl, propenyl such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl), prop-2-en-2-yl, and butenyl such as but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2-en-1-yl, but-2-en-2-yl, buta-1,3-dien-1-yl, and buta-1,3-dien-2-yl. In some embodiments, alkenyl has from 2 to 20 carbon atoms, but in other embodiments, from 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylene is a subset of alkenyl, referring to residues similar to alkenyl, but having two points of attachment.

[0029] As used herein, "alkynyl" refers to an unsaturated branched or straight chain alkyl having at least one carbon-carbon triple bond, the carbon-carbon triple bond being obtained by removing two hydrogen molecules from adjacent carbon atoms of the parent alkyl. Exemplary alkynyls include, but are not limited to, ethynyl, propynyl such as prop-1-yn-1-yl, prop-2-yn-1-yl, and butynyl such as but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1-yl. In certain embodiments, alkynyl has 2-20 carbon atoms, while in other embodiments, 2-10, 2-8, or 2-6 carbon atoms. Alkynylene is a subset of alkynyl and refers to a residue that is the same as alkynyl but has two points of attachment.

[0030] As used herein, "alkoxy" refers to an alkyl of the specified number of carbon atoms attached through an oxygen bridge, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3-methylpentyloxy, etc. An alkoxy typically has 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms attached through an oxygen bridge.

[0031] As used herein, "aryl" refers to a group formed by removing a hydrogen atom from a ring carbon atom derived from an aromatic monocyclic or polycyclic hydrocarbon ring system. The aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen and carbon from 6 to 18 carbon atoms, and at least one of the rings in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2) π-electron system according to the Hückel theory. Aryl includes, but is not limited to, groups such as phenyl, fluorenyl, and naphthyl. Arylene is a subset of aryl and refers to a residue that is the same as aryl but has two points of attachment.

[0032] "Heteroaryl" refers to a group derived from a 3-18 membered aromatic ring radical containing 2-17 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen and sulfur. As used herein, a heteroaryl may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, in which at least one of the rings in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2) π-electron system according to the Hückel theory. A heteroaryl includes fused or bridged ring systems. In some embodiments, a heteroatom in a heteroaryl is an oxidized heteroatom. In some embodiments, a heteroaryl includes one or more nitrogen atoms. In some embodiments, one or more of the nitrogen atoms in a heteroaryl is a quaternized nitrogen atom. A heteroaryl is bonded to the remainder of the molecule through any atom in the ring. Illustrative examples of heteroaryl include azepinyl, acridinyl, benzimidazolyl, benzindole, 1,3-benzodioxazolyl, benzofuryl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, benzo[b][1,4]oxazinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzo Pyronyl, benzofuryl, benzofuranonyl, benzothiophenyl, benzothieno[3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuryl, dibenzothiophenyl, furyl, furanonyl, furo[3,2-c]pyridyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridyl, isothiazolyl, imidazolyl, indazolyl, indole, isoindole, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, iso 5,8-methano-5,6,7,8-tetrahydroquinazolinyl, naphthyridinyl, 1,6-naphthyridinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 5,6,6a,7,8,9,10,10a-octahydrobenzo[H]quinazolinyl, 1-phenyl-1H-pyrrolidinyl aryl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolyl, tetrahydroquinolyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzo Examples include, but are not limited to, [4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl, and thiophenyl / thienyl.

[0033] A variety of hydroxy protecting groups can be used in the present disclosure. Generally, a protecting group can render a chemical functionality insensitive to a particular reaction condition and can be added to or removed from that functional group in a molecule without substantially damaging the remainder of the molecule. Representative hydroxy protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, which are incorporated herein by reference in their entirety. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxy protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthen-9-yl (Mox). In some embodiments, non-exclusive illustrative examples of hydroxy protecting groups that can be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), and TMTr (4,4',4''-trimethoxytrityl).

[0034] The term "subject" as used herein refers to any animal, e.g., a mammal or marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, and any type of poultry.

[0035] As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including, but not limited to, a therapeutic effect. A "therapeutic effect" refers to eradicating or ameliorating the underlying disorder being treated. A therapeutic effect is also obtained by observing an improvement in a subject by eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder, even though the subject may still be afflicted by the underlying disorder.

[0036] As used herein, "prevention" refers to a method of obtaining a beneficial or desired result, including but not limited to a prophylactic effect. To obtain a "prophylactic effect", a double-stranded siRNA, pharmaceutical composition or siRNA complex may be administered to a subject who may not have been diagnosed with a particular disease, but who is at risk of suffering from the disease, or who has been reported to have one or more physiological symptoms of the disease.

[0037] siRNA of the present disclosure In one embodiment, the present disclosure provides siRNAs that have high APOC3 gene suppression activity and low off-target effects.

[0038] The siRNA of the present disclosure contains a nucleotide group as a basic structural unit, and the nucleotide group contains a phosphate group, a ribose group, and a base, which is known to those skilled in the art, and therefore will not be described here.

[0039] The siRNA of the present disclosure comprises a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II each consist of 19 nucleotides, each nucleotide in the nucleotide sequence I and the nucleotide sequence II is a modified or unmodified nucleotide, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region at least partially in a reverse complementary manner, the nucleotide sequence II is at least partially reverse complementary to a first nucleotide sequence, the first nucleotide sequence is a nucleotide sequence having a length of 19 nucleotides in an mRNA expressed by an APOC3 gene, and at least one of the nucleotides at positions 3 to 6 of the nucleotide sequence 2 from the 5' end to the 3' end is a stabilizing modified nucleotide, the stabilizing modified nucleotide refers to a nucleotide in which the hydroxyl at the 2' position of the ribose of the nucleotide is substituted with a stabilizing modified group, and compared to an siRNA in which the nucleotide at the corresponding position is an unmodified nucleotide, the siRNA containing the stabilizing modified nucleotide has increased thermal stability and the steric hindrance of the stabilizing modified group is greater than that of 2'-O-methyl.

[0040] In some embodiments, the nucleotide at the third or fifth position in the nucleotide sequence II from the 5'-end to the 3'-end is the stabilizing modified nucleotide. In some embodiments, no more than two of the nucleotides at the third to ninth positions in the nucleotide sequence II from the 5'-end to the 3'-end are the stabilizing modified nucleotide. By limiting the number of stabilizing modified nucleotides at a particular position, the siRNA of the present disclosure can optimally balance pharmaceutical activity with low off-target effects and has excellent stability. In some embodiments, the nucleotide at the third and / or fifth position in the nucleotide sequence II from the 5'-end to the 3'-end is the stabilizing modified nucleotide. In some embodiments, the nucleotide at the third position in the nucleotide sequence II from the 5'-end to the 3'-end is the stabilizing modified nucleotide. In some embodiments, the nucleotide at the fifth position in the nucleotide sequence II from the 5'-end to the 3'-end is the stabilizing modified nucleotide.

[0041] In the siRNA of the present disclosure, from the 5' end to the 3' end, none of the nucleotides other than the nucleotides at positions 3 to 9 in the nucleotide sequence II is a stabilizing modified nucleotide. When at least one of the nucleotides at positions 3 to 6 in the nucleotide sequence II is a stabilizing modified nucleotide and a stabilizing modified nucleotide is contained other than the nucleotides at positions 3 to 9, the ability of the siRNA to regulate the expression level of the target sequence may be significantly affected.

[0042] In some embodiments, "thermal stability of siRNA is increased" refers to an increase in the thermal dissociation temperature (Tm) of the siRNA. In some embodiments, "thermal stability of double-stranded siRNA is increased" refers to an increase in Tm of the siRNA of at least 0.05°C, in some embodiments, an increase of 0.1-6°C, and in some embodiments, an increase in Tm of 0.5-4°C. Without being limited to theoretical interpretation, by including a stabilizing modified nucleotide at a specific position, the antisense strand of the siRNA of the present disclosure is hardly affected in its binding ability to the mRNA expressed by the APOC3 gene, and its binding to off-target target mRNA is significantly reduced, thereby reducing or eliminating the off-target effect.

[0043] In some embodiments, each of the stabilizing modifying groups independently has the structure shown in -XR, where X is O, NR', S, or SiR'2, R is one of C2-C6 alkyl, substituted C2-C6 alkyl, C6-C8 aryl, and substituted C6-C8 aryl, and each R' is independently one of H, C1-C6 alkyl, substituted C1-C6 alkyl, C6-C8 aryl, and substituted C6-C8 aryl, where the substituted C2-C6 alkyl, substituted C6-C8 aryl, or substituted C1-C6 alkyl refers to a group in which one or more hydrogen atoms in the C2-C6 alkyl, C6-C8 aryl, or C1-C6 alkyl are replaced with a substituent, and the substituent is one or more selected from C1-C3 alkyl, C6-C8 aryl, C1-C3 alkoxy, halogen, oxy subunits, and sulfide subunits. It should be noted that the present disclosure does not intend to cover all the modification groups that satisfy the above structure, but only relates to the stabilizing modification group that can realize the increase of thermal stability of siRNA, and in some embodiments, each of the stabilizing modification groups is independently selected from 2'-O-methoxyethyl, 2'-O-allyl, 2'-C-allyl, 2'-O-2-N-methylamino-2-oxyylideneethyl, 2'-O-2-N,N-dimethylaminoethyl, 2'-O-3-aminopropyl, and 2'-O-2,4-dinitrophenyl. In some embodiments, each of the stabilizing modification groups is 2'-O-methoxyethyl.

[0044] In some embodiments, the siRNA having stabilizing nucleotides of the present disclosure may be the following first, second, or third type of siRNA, each of which is described below.

[0045] First type of siRNA In some embodiments, the siRNA of the present disclosure is a first type of siRNA, wherein the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 are equal in length and have no more than three nucleotide differences; 5'-CAAUAAAGCUGGACAAGAZ1-3'(SEQ ID NO:1), 5'-Z2UCUUGUCCAGCUUUAUUG-3'(SEQ ID NO:2), where Z1 is A and Z2 is U, Also, the nucleotide sequence I includes a nucleotide Z3 whose position corresponds to Z1, and the nucleotide sequence II includes a nucleotide Z4 whose position corresponds to Z2, and the Z4 is the first nucleotide at the 5' end of the antisense strand. The first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:1, except that each U is optionally replaced with a T. In the context of the present disclosure, "corresponding in position" refers to being at the same position in the nucleotide sequence from the same end of the nucleotide sequence. For example, the first nucleotide at the 3' end of nucleotide sequence I is the nucleotide whose position corresponds to the first nucleotide of SEQ ID NO:1.

[0046] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0047] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2.

[0048] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 comprises a difference at position Z4, where Z4 is selected from A, G or C. In some embodiments, the nucleotide difference is at position Z4, where Z4 is selected from A, G or C. In some embodiments, Z3 is a nucleotide complementary to Z4. These nucleotide differences do not significantly reduce the target gene suppression ability of the siRNA or increase the off-target effect of the siRNA, and the siRNAs comprising these nucleotide differences are also within the scope of protection of the present disclosure.

[0049] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary, where basically reverse complementary means that there are no more than three base mismatches between the two nucleotide sequences, substantially reverse complementary means that there are no more than one base mismatches between the two nucleotide sequences, and completely reverse complementary means that there are no mismatches between the two nucleotide sequences.

[0050] In some embodiments, the nucleotides at positions 2 to 19 of the nucleotide sequence II and the nucleotides at positions 1 to 18 of the first nucleotide sequence are completely reverse-complementary from the 5' to 3' end. In some embodiments, the nucleotide sequence II and the nucleotide sequence I are completely reverse-complementary, or there is a base mismatch between the nucleotide at position 2 in the nucleotide sequence II from the 5' to 3' end and the nucleotide at position 2 in the nucleotide sequence I from the 3' to 5' end. By including the base mismatch, it is possible to maintain a low off-target effect and further improve the activity of the siRNA of the present disclosure in suppressing the expression of a target gene.

[0051] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:3, and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:4; 5'-CAAUAAAGCUGGACAAGAZ3-3'(SEQ ID NO:3), 5'-Z4UCUUGUCCAGCUUUAUUG-3'(SEQ ID NO:4), In some embodiments, Z3 is A and Z4 is U, and Z4 is a nucleotide complementary to Z3.

[0052] Furthermore, the sense strand and the antisense strand may have the same or different lengths, with the sense strand having a length of 19 to 23 nucleotides and the antisense strand having a length of 19 to 26 nucleotides. Thus, the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure may be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 21, 21 / 23, or 23 / 25.

[0053] In some embodiments, the sense strand further comprises a nucleotide sequence III, and the antisense strand further comprises a nucleotide sequence IV, wherein each nucleotide of the nucleotide sequence III and the nucleotide sequence IV is independently one of non-fluoro-modified nucleotides and is not the stabilizing modification, the nucleotide sequence III and the nucleotide sequence IV are each 1 to 4 nucleotides in length, the nucleotide sequence IV and the nucleotide sequence III are equal in length and are substantially reverse-complementary or completely reverse-complementary, the nucleotide sequence III is bound to the 5' end of the nucleotide sequence I, and the nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse-complementary or completely reverse-complementary, and the second nucleotide sequence refers to a nucleotide sequence adjacent to the first nucleotide sequence in the mRNA expressed by the APOC3 gene and having the same length as the nucleotide sequence IV.

[0054] In some embodiments, the nucleotide sequences III and IV are both 1 nucleotide in length, the base of the nucleotide sequence III is C, the base of the nucleotide sequence IV is G, and the base of the second nucleotide sequence is C, and the length ratio of the sense strand to the antisense strand is 20 / 20; or the nucleotide sequences III and IV are both 2 nucleotides in length, the base composition of the nucleotide sequence III is CC, the base composition of the nucleotide sequence IV is GG, and the composition of the second nucleotide sequence is CC, and the length ratio of the sense strand to the antisense strand is 21 / 21; or the nucleotide sequences III and IV are both 3 nucleotides in length, the base composition of the nucleotide sequence III is UCC, the base composition of the nucleotide sequence IV is GGA, and the composition of the second nucleotide sequence is UCC, and the length ratio of the sense strand to the antisense strand is 22 / 22; or the nucleotide sequences III and IV are both 4 nucleotides in length, the base composition of the nucleotide sequence III is CUCC, the base composition of the nucleotide sequence IV is GGAG, and the base composition of the second nucleotide sequence is CUCC, and the length ratio of the sense strand to the antisense strand is 21 / 21.

[0055] In some embodiments, nucleotide sequence III and nucleotide sequence IV are perfectly reverse complementary, such that given the base composition of nucleotide sequence III, the base composition of nucleotide sequence IV is also determined.

[0056] Second type of siRNA In some embodiments, the siRNA of the present disclosure is a second type of siRNA, wherein the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:45 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:46 are equal in length and have no more than three nucleotide differences; 5'-UUAAAAGGGACAGUAUUCZ5-3'(SEQ ID NO:45), 5'-Z6GAAUACUGUCCCUUUUAA-3'(SEQ ID NO:46), However, Z5 is U and Z6 is A, and wherein said nucleotide sequence I includes nucleotide Z7 at a position corresponding to Z5, and said nucleotide sequence II includes nucleotide Z8 at a position corresponding to Z6, said Z8 being the first nucleotide at the 5' end of the antisense strand. The first nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO:45, except that each U is optionally replaced with a T.

[0057] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0058] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:45, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:46.

[0059] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:46 comprises a difference at position Z8, where Z8 is selected from U, G, or C. In some embodiments, the nucleotide difference is at position Z8, where Z8 is selected from U, G, or C. In some embodiments, Z7 is a nucleotide complementary to Z8. These nucleotide differences do not significantly reduce the target gene suppression ability of the siRNA or increase the off-target effect of the siRNA, and the siRNAs comprising these nucleotide differences are also within the scope of protection of the present disclosure.

[0060] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary, where basically reverse complementary means that there are no more than three base mismatches between the two nucleotide sequences, substantially reverse complementary means that there are no more than one base mismatches between the two nucleotide sequences, and completely reverse complementary means that there are no mismatches between the two nucleotide sequences.

[0061] In some embodiments, the nucleotides at positions 2 to 19 of the nucleotide sequence II and the nucleotides at positions 1 to 18 of the first nucleotide sequence are completely reverse-complementary from the 5' to 3' end. In some embodiments, the nucleotide sequence II and the nucleotide sequence I are completely reverse-complementary, or there is a base mismatch between the nucleotide at position 2 in the nucleotide sequence II from the 5' to 3' end and the nucleotide at position 2 in the nucleotide sequence I from the 3' to 5' end. By including the base mismatch, it is possible to maintain a low off-target effect and further improve the activity of the siRNA of the present disclosure in suppressing the expression of a target gene.

[0062] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:47, and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:48; 5'-UUAAAAGGGACAGUAUUCZ7-3'(SEQ ID NO:47), 5'-Z8GAAUACUGUCCCUUUUAA-3'(SEQ ID NO:48), In some embodiments, Z7 is U and Z8 is A, and Z7 is selected from A, U, G, or C, and Z8 is the complementary nucleotide to Z7.

[0063] Furthermore, the sense strand and the antisense strand may have the same or different lengths, with the sense strand having a length of 19 to 23 nucleotides and the antisense strand having a length of 19 to 26 nucleotides. Thus, the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure may be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 21, 21 / 23, or 23 / 25.

[0064] In some embodiments, the sense strand further comprises a nucleotide sequence III, and the antisense strand further comprises a nucleotide sequence IV, wherein each nucleotide of the nucleotide sequence III and the nucleotide sequence IV is independently one of non-fluoro-modified nucleotides and is not the stabilizing modification, the nucleotide sequence III and the nucleotide sequence IV are each 1 to 4 nucleotides in length, the nucleotide sequence IV and the nucleotide sequence III are equal in length and are substantially reverse-complementary or completely reverse-complementary, the nucleotide sequence III is bound to the 5' end of the nucleotide sequence I, and the nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse-complementary or completely reverse-complementary, and the second nucleotide sequence refers to a nucleotide sequence adjacent to the first nucleotide sequence in the mRNA expressed by the APOC3 gene and having the same length as the nucleotide sequence IV.

[0065] In some embodiments, the nucleotide sequences III and IV are both 1 nucleotide in length, the base of the nucleotide sequence III is C, the base of the nucleotide sequence IV is G, and the base of the second nucleotide sequence is C, and the length ratio of the sense strand to the antisense strand is 20 / 20; or the nucleotide sequences III and IV are both 2 nucleotides in length, the base composition of the nucleotide sequence III is GC, the base composition of the nucleotide sequence IV is GC, and the composition of the second nucleotide sequence is GC, and the length ratio of the sense strand to the antisense strand is 21 / 21; or the nucleotide sequences III and IV are both 3 nucleotides in length, the base composition of the nucleotide sequence III is UGC, the base composition of the nucleotide sequence IV is GCA, and the composition of the second nucleotide sequence is GCA, and the length ratio of the sense strand to the antisense strand is 22 / 22; or the nucleotide sequences III and IV are both 4 nucleotides in length, the base composition of the nucleotide sequence III is UUGC, the base composition of the nucleotide IV is GCAA, and the base composition of the second nucleotide sequence is GCAA, and the length ratio of the sense strand to the antisense strand is 21 / 21.

[0066] In some embodiments, nucleotide sequence III and nucleotide sequence IV are perfectly reverse complementary, such that given the base composition of nucleotide sequence III, the base composition of nucleotide sequence IV is also determined.

[0067] The third type of siRNA In some embodiments, the siRNA of the present disclosure is a third type of siRNA, wherein the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 105 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 106 are equal in length and have no more than three nucleotide differences; 5'-GGACAGUAUUCUCAGUGCZ9-3'(SEQ ID NO:105), 5'-Z 10 GCACUGAGAAUACUGUCC-3'(SEQ ID NO:106), However, Z9 is U and Z 10 is A, Also in nucleotide sequence I, nucleotide Z corresponds to position Z9. 11 and in said nucleotide sequence II, position Z 10 Nucleotide Z corresponding to 12 wherein Z8 is the first nucleotide at the 5' end of the antisense strand. The first nucleotide sequence is the nucleotide sequence set forth in SEQ ID NO:105, except that each U is optionally replaced with a T.

[0068] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0069] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:105, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:106.

[0070] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:106 is Z 12 Including the difference in position of Z 12 is selected from G, C, or U. In some embodiments, the nucleotide difference is Z 12 is the difference in position between 12 is selected from G, C, or U. In some embodiments, Z 11 is Z 12These nucleotide differences do not significantly reduce the target gene suppression ability of the siRNA or increase the off-target effect of the siRNA, and the siRNAs containing these nucleotide differences are also within the scope of protection of the present disclosure.

[0071] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary, where basically reverse complementary means that there are no more than three base mismatches between the two nucleotide sequences, substantially reverse complementary means that there are no more than one base mismatches between the two nucleotide sequences, and completely reverse complementary means that there are no mismatches between the two nucleotide sequences.

[0072] In some embodiments, the nucleotides at positions 2 to 19 of the nucleotide sequence II and the nucleotides at positions 1 to 18 of the first nucleotide sequence are completely reverse-complementary from the 5' to 3' end. In some embodiments, the nucleotide sequence II and the nucleotide sequence I are completely reverse-complementary, or there is a base mismatch between the nucleotide at position 2 in the nucleotide sequence II from the 5' to 3' end and the nucleotide at position 2 in the nucleotide sequence I from the 3' to 5' end. By including the base mismatch, it is possible to maintain a low off-target effect and further improve the activity of the siRNA of the present disclosure in suppressing the expression of a target gene.

[0073] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 107, and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO: 108; 5'-GGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:107), 5'-Z 12 GCACUGAGAAUACUGUCC-3'(SEQ ID NO:108), However, Z 11 is selected from A, U, G or C; Z 12 is Z 11 and in some embodiments, Z 11 is U and Z 12 is A.

[0074] Furthermore, the sense strand and the antisense strand may have the same or different lengths, with the sense strand having a length of 19 to 23 nucleotides and the antisense strand having a length of 19 to 26 nucleotides. Thus, the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure may be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 21, 21 / 23, or 23 / 25.

[0075] In some embodiments, the sense strand further comprises a nucleotide sequence III, and the antisense strand further comprises a nucleotide sequence IV, wherein each nucleotide of the nucleotide sequence III and the nucleotide sequence IV is independently one of non-fluoro-modified nucleotides and is not the stabilizing modification, the nucleotide sequence III and the nucleotide sequence IV are each 1 to 4 nucleotides in length, the nucleotide sequence IV and the nucleotide sequence III are equal in length and are substantially reverse-complementary or completely reverse-complementary, the nucleotide sequence III is bound to the 5' end of the nucleotide sequence I, and the nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse-complementary or completely reverse-complementary, and the second nucleotide sequence refers to a nucleotide sequence adjacent to the first nucleotide sequence in the mRNA expressed by the APOC3 gene and having the same length as the nucleotide sequence IV.

[0076] In some embodiments, the nucleotide sequences III and IV are both one nucleotide in length, the base of the nucleotide sequence III is C, the base of the nucleotide sequence IV is G, and the base of the second nucleotide sequence is C, and the length ratio of the sense strand to the antisense strand is 20 / 20; or the nucleotide sequences III and IV are both two nucleotides in length, the base composition of the nucleotide sequence III is AG, the base composition of the nucleotide sequence IV is CU, and the composition of the second nucleotide sequence is AG, and the length ratio of the sense strand to the antisense strand is 21 / 21; or the nucleotide sequences III and IV are both 3 nucleotides in length, the base composition of the nucleotide sequence III is AAG, the base composition of the nucleotide sequence IV is CUU, and the composition of the second nucleotide sequence is AAG, and the length ratio of the sense strand to the antisense strand is 22 / 22; or the nucleotide sequences III and IV are both 4 nucleotides in length, the base composition of the nucleotide sequence III is AAAG, the base composition of the nucleotide sequence IV is CUUU, and the base composition of the second nucleotide sequence is AAAG, and the length ratio of the sense strand to the antisense strand is 21 / 21.

[0077] In some embodiments, nucleotide sequence III and nucleotide sequence IV are perfectly reverse complementary, such that given a base of nucleotide sequence III, the base of nucleotide sequence IV is also determined.

[0078] Hereinafter, the description of nucleotide sequence V, nucleotide modification in siRNA, and modified sequence are applied to the above-mentioned siRNA of the present disclosure, for example, the first type siRNA, the second type siRNA, or the third type siRNA. That is, unless otherwise specified, the description of siRNA below should be considered as describing the above-mentioned siRNA of the present disclosure, for example, the first type siRNA, the second type siRNA, and the third type siRNA one by one. For example, if no specific siRNA is specified, "the siRNA further comprises nucleotide sequence V" means "the siRNA of the present disclosure, for example, the above-mentioned first type siRNA, the second type siRNA, or the third type siRNA further comprises nucleotide sequence V".

[0079] In some embodiments, the sense strand and the antisense strand are different in length, and the antisense strand further comprises a nucleotide sequence V, each nucleotide of the nucleotide sequence V being independently one of non-fluoro-modified nucleotides and not the stabilizing modified nucleotide, and the nucleotide sequence V is 1-3 nucleotides in length and is linked to the 3' end of the antisense strand to constitute a 3' overhang end of the antisense strand. Thus, the length ratio of the sense strand and the antisense strand of the siRNA provided by the present disclosure may be 19 / 20, 19 / 21, 19 / 22, 20 / 21, 20 / 22, 20 / 23, 21 / 22, 21 / 23, 21 / 24, 22 / 23, 22 / 24, 22 / 25, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the nucleotide sequence V is 2 nucleotides in length, such that the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure may be 19 / 21, 21 / 23, or 23 / 25.

[0080] Each nucleotide in the nucleotide sequence V can be any nucleotide, and for easy synthesis and cost saving, the nucleotide sequence V is two consecutive thymine deoxyribonucleotides (dTdT) or two consecutive uracil ribonucleotides (UU); or for improving the affinity between the antisense strand of siRNA and target mRNA, the nucleotide sequence V and the third nucleotide sequence are completely reverse complementary, and the third nucleotide sequence refers to the nucleotide sequence adjacent to the first nucleotide sequence or the second nucleotide sequence in the mRNA expressed by APOC3 gene and has a length equal to the nucleotide sequence V. Thus, in some embodiments, the length ratio of the sense strand and the antisense strand of the siRNA of the present disclosure is 19 / 21 or 21 / 23, and the siRNA of the present disclosure has a better mRNA silencing activity.

[0081] In some embodiments, for the first type of siRNA, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO:1, the base composition of the third nucleotide sequence is CC, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:5, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:6; 5'-CAAUAAAGCUGGACAAGAZ3-3'(SEQ ID NO:5), 5'-Z4UCUUGUCCAGCUUUAUUGGG-3'(SEQ ID NO:6), Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:7, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:8; 5'-CCCAAUAAAGCUGGACAAGAZ3-3'(SEQ ID NO:7), 5'-Z4UCUUGUCCAGCUUUAUUGGGAG-3'(SEQ ID NO:8), wherein Z4 is the first nucleotide at the 5' end of the antisense strand; Z3 is selected from A, U, G, or C; and Z4 is the nucleotide complementary to Z3.

[0082] In some embodiments, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:9, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:10; 5'-CAAUAAAGCUGGACAAGAA-3'(SEQ ID NO:9), 5'-UUCUUGUCCAGCUUUAUUGGG-3'(SEQ ID NO:10), Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:11, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:12; 5'-CCCAAUAAAGCUGGACAAGAA-3'(SEQ ID NO:11), 5'-UUCUUGUCCAGCUUUAUUGGGAG-3'(SEQ ID NO:12).

[0083] In some embodiments, for the second type of siRNA, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO: 45, and the base composition of the third nucleotide sequence is GC. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 49, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 50. 5'-UUAAAAGGGACAGUAUUCZ7-3'(SEQ ID NO:49), 5'-Z8GAAUACUGUCCCUUUUAAGC-3'(SEQ ID NO:50), Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:51, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:52; 5'-GCUUAAAAGGGACAGUAUUCZ7-3'(SEQ ID NO:51), 5'-Z8GAAUACUGUCCCUUUUAAGCAA-3'(SEQ ID NO:52), Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 49, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 149; 5'-UUAAAAGGGACAGUAUUCZ7-3'(SEQ ID NO:49), 5'-Z8GAAUACUGUCCCUUUUAAUU-3'(SEQ ID NO:149), Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:51, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:150; 5'-GCUUAAAAGGGACAGUAUUCZ7-3'(SEQ ID NO:51), 5'-Z8GAAUACUGUCCCUUUUAAGCUU-3'(SEQ ID NO:150), wherein Z8 is the first nucleotide at the 5' end of the antisense strand; Z7 is selected from A, U, G, or C; and Z8 is the nucleotide complementary to Z7.

[0084] In some embodiments, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:53, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:54; 5'-UUAAAAGGGACAGUAUUCU-3'(SEQ ID NO:53), 5'-AGAAUACUGUCCCUUUUAAGC-3'(SEQ ID NO:54), Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:55, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:56; 5'-GCUUAAAAGGGACAGUAUUCU-3'(SEQ ID NO:55), 5'-AGAAUACUGUCCCUUUUAAGCAA-3'(SEQ ID NO:56).

[0085] In some embodiments, for the third type of siRNA, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO: 105, and the base composition of the third nucleotide sequence is AG. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 109, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 110. 5'-GGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:109), 5'-Z 12 GCACUGAGAAUACUGUCCCU-3'(SEQ ID NO:110), Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 111, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 112; 5'-AGGGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:111), 5'-Z 12 GCACUGAGAAUACUGUCCCUUU-3'(SEQ ID NO:112), However, the above Z 12 is the first nucleotide at the 5' end of the antisense strand, and Z 11 is selected from A, U, G or C; Z 12 is Z 11 is a nucleotide complementary to

[0086] In some embodiments, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 113, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 114; 5'-GGACAGUAUUCUCAGUGCU-3'(SEQ ID NO:113), 5'-AGCACUGAGAAUACUGUCCCU-3'(SEQ ID NO:114), Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 115, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 116; 5'-AGGGACAGUAUUCUCAGUGCU-3'(SEQ ID NO:115), 5'-AGCACUGAGAAUACUGUCCCUUU-3'(SEQ ID NO:116).

[0087] As described above, each nucleotide in the siRNA of the present disclosure is independently modified or unmodified, and in some embodiments, some or all of the nucleotides in the siRNA of the present disclosure are modified nucleotides, and these modifications on the nucleotide groups do not appreciably weaken or eliminate the function of the siRNA of the present disclosure in suppressing APOC3 gene expression.

[0088] In the context of the present disclosure, the term "modified nucleotide" refers to a nucleotide or nucleotide analogue in which the 2'-position hydroxyl of ribose of nucleotide is replaced with another group, or a nucleotide in which the base on nucleotide is a modified base.The modified nucleotide does not obviously weaken or lose the function of siRNA to suppress gene expression.For example, the modified nucleotide disclosed in JK Watts, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13(19-20): 842-55 may be selected.

[0089] In some embodiments, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II from the 5' end to the 3' end are 2'-fluoro modified nucleotides if they are not the stabilized modified nucleotide. In some embodiments, all of the nucleotides in the nucleotide sequence II are modified nucleotides, and the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II from the 5' end to the 3' end are 2'-fluoro modified nucleotides if they are not the stabilized modified nucleotide, and each of the other nucleotides in the nucleotide sequence II is independently one of the non-fluoro modified nucleotides. In some embodiments, the nucleotides at positions 7 to 9 of the nucleotide sequence I from the 5' end to the 3' end are 2'-fluoro modified nucleotides. In some embodiments, all of the nucleotides in the nucleotide sequence I are modified nucleotides, and the nucleotides at positions 7 to 9 of the nucleotide sequence I from the 5' end to the 3' end are 2'-fluoro modified nucleotides, and each of the other nucleotides in the nucleotide sequence I is independently one of the non-fluoro modified nucleotides. The siRNA of the present disclosure has the above modifications, thereby achieving a good balance between gene expression regulatory activity and in vivo stability.

[0090] In the context of this disclosure, "fluoro-modified nucleotide" refers to a nucleotide having the structure shown in formula (7) below, in which the 2'-position hydroxyl of the ribose of the nucleotide is replaced with fluorine. "Non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analog in which the 2'-position hydroxyl of the ribose of the nucleotide is replaced with a non-fluorine group. In some embodiments, each non-fluoro-modified nucleotide is an independently selected one from nucleotides or nucleotide analogs in which the 2'-position hydroxyl of the ribose of the nucleotide is replaced with a non-fluorine group.

[0091] These nucleotides in which the hydroxyl at the 2'-position of ribose is substituted with a non-fluorine group are known to those skilled in the art, and these nucleotides may be one selected from a 2'-alkoxy modified nucleotide, a 2'-alkyl modified nucleotide, a 2'-substituted alkyl modified nucleotide, a 2'-amino modified nucleotide, a 2'-substituted amino modified nucleotide, and a 2'-deoxy nucleotide.

[0092] In some embodiments, the 2'-alkoxy modified nucleotide is a methoxy modified nucleotide (2'-OMe) as shown in formula (8). In some embodiments, the 2'-amino modified nucleotide (2'-NH2) is as shown in formula (9). In some embodiments, the 2'-deoxyribonucleotide (DNA) is as shown in formula (10).

[0093] [ka]

[0094] A nucleotide analog refers to a group that can substitute for a nucleotide in a nucleic acid, but that differs in structure from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, a nucleotide analog can be an isonucleotide, a bridged nucleotide (abbreviated as BNA), or an acyclic nucleotide.

[0095] BNA refers to a constrained or inaccessible nucleotide. BNAs may include five-, six-, or seven-membered bridged structures with a "fixed" C3'-endo sugar puckering. Typically, the bridge is introduced at the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide. In some embodiments, the BNA may be an LNA as shown in formula (12), an ENA as shown in formula (13), a cET BNA as shown in formula (14), or the like.

[0096] [ka]

[0097] An acyclic nucleotide is a nucleotide in which the sugar ring of the nucleotide is opened. In some embodiments, the acyclic nucleotide may be an unlocked nucleic acid (UNA) as shown in formula (15) or a glycerol nucleic acid (GNA) as shown in formula (16).

[0098] [ka]

[0099] In the above formula (15) and formula (16), R is selected from H, OH, or alkoxy (O-alkyl).

[0100] An isonucleotide refers to a compound in which the position of the base in the ribose ring in a nucleotide is changed. In some embodiments, an isonucleotide may be a compound in which the base is shifted from the 1'-position to the 2'-position or 3'-position of the ribose ring, as shown in formula (17) or (18).

[0101] [ka]

[0102] In the compounds of formula (17) and formula (18) above, Base represents a nucleic acid base such as A, U, G, C or T, and R is selected from H, OH, F or the non-fluorine groups described above.

[0103] In some embodiments, the nucleotide analog is one selected from an isonucleotide, an LNA, an ENA, a cET, an UNA, and a GNA. In some embodiments, each non-fluoro modified nucleotide is a methoxy modified nucleotide, which in this context refers to a nucleotide in which the 2'-hydroxy of the ribose is replaced with methoxy.

[0104] In this context, "fluoro-modified nucleotide", "2'-fluoro-modified nucleotide", "nucleotide in which the 2'-hydroxy of the ribose group is replaced with fluorine" and "nucleotide having 2'-fluoro ribose" have the same meaning and all refer to a compound having the structure shown in formula (7) in which the 2'-hydroxy of the nucleotide is replaced with fluorine, and "methoxy-modified nucleotide", "2'-methoxy-modified nucleotide", "nucleotide in which the 2'-hydroxy of the ribose is replaced with methoxy" and "nucleotide having 2'-methoxy ribose" have the same meaning and all refer to a compound having the structure shown in formula (8) in which the 2'-hydroxy of the ribose of the nucleotide is replaced with methoxy.

[0105] In some embodiments, the siRNA comprising the stabilizing modified nucleotides of the present disclosure is an siRNA having the following modifications: from the 5' end to the 3' end, in the sense strand, the nucleotides at positions 7, 8, 9 or 5, 7, 8, 9 of the nucleotide sequence I are fluoro-modified nucleotides, and the nucleotides at other positions are methoxy-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 14, 16 or 2, 6, 8, 9, 14, 16 of the nucleotide sequence II are fluoro-modified nucleotides, the nucleotides at positions 3 or 5 are stabilizing modified nucleotides, and the nucleotides at other positions are methoxy-modified nucleotides.

[0106] The siRNA having the above modification is not only low-cost, but also can make nucleic acid difficult to be cut by ribonuclease in blood, thereby improving the stability of nucleic acid and giving nucleic acid stronger resistance to nuclease hydrolysis.In addition, the above modification reduces the off-target effect of siRNA, but does not significantly reduce the inhibitory ability of siRNA.

[0107] In some embodiments, the siRNA provided by the present disclosure is one of siAPOC3a1-M1, siAPOC3a1-M2, siAPOC3a2-M1, siAPOC3a2-M2, siAPOC3b1-M1, siAPOC3b1-M2, siAPOC3b2-M1, siAPOC3b2-M2, siAPOC3b3-M1, siAPOC3b3-M2, siAPOC3b4-M1, siAPOC3b4-M2, siAPOC3c1-M1, siAPOC3c1-M2, siAPOC3c2-M1, and siAPOC3c2-M2.

[0108] In some embodiments, in the sense strand and antisense strand of the siRNA provided by the present disclosure, at least a portion of the phosphate ester in the phosphate-sugar backbone of at least one single strand is a phosphate ester having a modified group.In some embodiments, the phosphate ester having a modified group is a thiophosphate ester in which at least one oxygen atom in the phosphodiester bond of the phosphate ester is replaced with a sulfur atom.In some embodiments, the phosphate ester having a modified group is a thiophosphate ester having the structure shown in formula (1).

[0109] [ka]

[0110] Such modifications stabilize the double-stranded structure of siRNA and enable high specificity and high affinity base pairing to be maintained.

[0111] In some embodiments, in the siRNA provided by the present disclosure, the thiophosphate is present at at least one selected from the group consisting of between the 1st and 2nd nucleotides at any one end of the sense strand or antisense strand, between the 2nd and 3rd nucleotides at any one end of the sense strand or antisense strand, and any combination thereof. In some embodiments, the thiophosphate is present at all of the above positions except the 5' end of the sense strand. In some embodiments, the thiophosphate is present at all of the above positions except the 3' end of the sense strand. In some embodiments, the thiophosphate is present at Between the first and second nucleotides of the 5'-terminal end of the sense strand, Between the second and third nucleotides of the 5'-terminal end of the sense strand, Between the first and second nucleotides of the 3'-terminal end of the sense strand, Between the second and third nucleotides of the 3'-terminal end of the sense strand, Between the first and second nucleotides at the 5'-terminal end of the antisense strand, Between the second and third nucleotides of the 5'-terminal end of the antisense strand, between the first and second nucleotides of the 3'-terminal end of the antisense strand, and It is bound to at least one nucleotide selected from between the second and third nucleotides at the 3'-terminal end of the antisense strand.

[0112] In some embodiments, the siRNA provided by the present disclosure is one of siAPOC3a1-M1S, siAPOC3a1-M2S, siAPOC3a2-M1S, siAPOC3a2-M2S, siAPOC3b1-M1S, siAPOC3b1-M2S, siAPOC3b2-M1S, siAPOC3b2-M2S, siAPOC3b3-M1S, siAPOC3b3-M2S, siAPOC3b4-M1S, siAPOC3b4-M2S, siAPOC3c1-M1S, siAPOC3c1-M2S, siAPOC3c2-M1S, and siAPOC3c2-M2S shown in Tables 1a-1c.

[0113] In some embodiments, the 5'-terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide.

[0114] The commonly used 5'-phosphate nucleotides or 5'-phosphate analog modified nucleotides are known to those skilled in the art. For example, the 5'-phosphate nucleotide may have the following structure:

[0115] [ka]

[0116] Furthermore, for example, Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3):238-48 disclose the following four types of 5'-phosphate analog modified nucleotides:

[0117] [ka]

[0118] wherein R is selected from H, OH, methoxy, and fluorine; and Base represents a nucleic acid base selected from A, U, C, G, or T.

[0119] In some embodiments, the 5'-phosphate nucleotide is a nucleotide containing a 5'-phosphate modification as shown in formula (2), and the 5'-phosphate analog modified nucleotide is a nucleotide containing a vinyl phosphate (5'-(E)-vinylphosphonate (E-VP)) modification as shown in formula (3), or a thiophosphate modified nucleotide as shown in formula (5).

[0120] In some embodiments, the siRNA of the present disclosure is selected from the group consisting of siAPOC3a1-M1P1, siAPOC3a1-M2P1, siAPOC3a2-M1P1, siAPOC3a2-M2P1, siAPOC3a1-M1SP1, siAPOC3a1-M2SP1, siAPOC3a2-M1SP1, siAPOC3a2-M2SP1, siAPOC3b1-M1P1, siAPOC3b1-M2P1, siAPOC3b2-M1P1, siAPOC3b2-M2P1, siAPOC3b1-M1SP1, siAPOC3b1-M2SP1, siAPOC3b2-M1 ...1SP1, siAPOC3b2-M1SP1, siAPOC3b2-M1SP1, siAPOC3b2-M1SP1, siAPOC3b2-M1SP1, siAPOC3b2-M1SP1, siAPOC3b2-M1SP1 one of iAPOC3b2-M2SP1, siAPOC3b3-M1P1, siAPOC3b3-M2P1, siAPOC3b4-M1P1, siAPOC3b4-M2P1, siAPOC3b3-M1SP1, siAPOC3b3-M2SP1, siAPOC3b4-M1SP1, siAPOC3b4-M2SP1, siAPOC3c1-M1P1, siAPOC3c1-M2P1, siAPOC3c2-M1P1, siAPOC3c2-M2P1, siAPOC3c1-M1SP1, siAPOC3c1-M2SP1, siAPOC3c2-M1SP1, siAPOC3c2-M1SP1, and siAPOC3c2-M2SP1.

[0121] The inventors of the present disclosure have unexpectedly discovered that the siRNAs provided by the present disclosure have significantly improved plasma and lysosomal stability, significantly reduced off-target effects, and retain extremely high gene silencing activity.

[0122] The siRNA provided by the present disclosure can be obtained by the usual siRNA preparation methods in the field (for example, solid-phase synthesis method and liquid-phase synthesis method).Here, solid-phase synthesis has already been commercially customized.The modified nucleotide can be introduced into the siRNA described in the present disclosure by using the nucleoside monomer having the corresponding modification, and the method of preparing the nucleoside monomer having the corresponding modification and the method of introducing the modified nucleotide into the siRNA are also well known to those skilled in the art.

[0123] Pharmaceutical Compositions The present disclosure provides a pharmaceutical composition, which comprises the above-mentioned siRNA as an active ingredient and a pharma- ceutically acceptable carrier.

[0124] The pharma- ceutically acceptable carrier may be a carrier commonly used in the field of siRNA administration, such as magnetic nanoparticles (e.g., nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate ester), poly( ... and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA), and derivatives thereof.

[0125] In some embodiments, there is no particular requirement for the content of siRNA and pharma- ceutically acceptable carrier in the pharmaceutical composition, and in some embodiments, the weight ratio of siRNA to pharma- ceutically acceptable carrier may be 1:(1 to 500). In some embodiments, the weight ratio is 1:(1 to 50).

[0126] In some embodiments, the pharmaceutical composition may include other pharma- ceutically acceptable additives, which may be one or more of various agents or compounds commonly used in the art. For example, the other pharma-ceutically acceptable additives may include at least one of a pH buffer, a protectant, and an osmolality regulator.

[0127] The pH buffer solution may be a trishydroxymethylaminomethane hydrochloride buffer solution having a pH of 7.5 to 8.5 and / or a phosphate buffer solution having a pH of 5.5 to 8.5, for example, a phosphate buffer solution having a pH of 5.5 to 8.5.

[0128] The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. The content of the protective agent may be 0.01 to 30% by weight based on the total weight of the pharmaceutical composition.

[0129] The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator is determined so that the osmotic pressure of the pharmaceutical composition is 200 to 700 milliosmoles per kilogram (mOsm / kg). Depending on the desired osmotic pressure, a person skilled in the art can easily determine the content of the osmotic pressure regulator. In some embodiments, the dosage during the administration of the formulation produced from the pharmaceutical composition is adjusted according to the administration method.

[0130] In some embodiments, the pharmaceutical composition may be a liquid formulation such as an injection solution, or may be a lyophilized powder injection that is mixed with a liquid additive at the time of administration to form a liquid formulation. The liquid formulation may be used for subcutaneous, intramuscular, or intravenous administration, but is not limited thereto, and may be administered to the lungs by aerosolization, or administered to other organ tissues (e.g., the liver) through the lungs by aerosolization, or the pharmaceutical composition may be delivered by a method such as oral inhalation or nasal administration, but is not limited thereto. In some embodiments, the pharmaceutical composition is administered by aerosolization.

[0131] In some embodiments, the pharmaceutical composition may be in the form of a liposome formulation. In some embodiments, the pharma- ceutical acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (hereinafter also referred to as organic amine), an auxiliary lipid, and / or a polyethylene glycolated lipid. Here, the organic amine, the auxiliary lipid, and the polyethylene glycolated lipid may be one or more selected from the amine-containing transfection compound or its pharma- ceutical acceptable salt or derivative, the auxiliary lipid, and the polyethylene glycolated lipid, respectively, described in Chinese Patent Publication No. 103380113 (incorporated herein by reference in its entirety).

[0132] In some embodiments, the organic amine may be a compound represented by formula (201) or a pharma- ceutically acceptable salt thereof, as described in Chinese Patent Publication No. 103380113:

[0133] [ka] however, X 101 and X 102 are each independently O, S, NA, or CA, and A is hydrogen or C1-C 20 is a hydrocarbon chain, Y 101 and Z 101 are each independently C=O, C=S, S=O, CH-OH or SO2; R 101 , R 102 , R 103 , R 104 , R 105 , R 106 and R 107are each independently hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or straight chain aliphatic group, a cyclic or acyclic, substituted or unsubstituted, branched or straight chain heteroaliphatic group, a substituted or unsubstituted, branched or straight chain acyl, a substituted or unsubstituted, branched or straight chain aryl, or a substituted or unsubstituted, branched or straight chain heteroaryl; x is an integer from 1 to 10; n is an integer of 1 to 3, m is an integer of 0 to 20, and p is 0 or 1, where m=p=0, R 102 is hydrogen, When at least one of n and m is 2, R 103 and the nitrogen in formula (201) form a structure represented by formula (202) or formula (203).

[0134] [ka] In the above, g, e, and f are each independently an integer of 1 to 6, and "HCC" represents a hydrocarbon chain. * N represents a nitrogen atom in formula (201).

[0135] In some embodiments, R 103 is a polyamine. In another embodiment, R 103 In some embodiments, R in formula (201) is a ketal. 101 and R 102 each is independently any substituted or unsubstituted, branched or straight chain alkyl or alkenyl, said alkyl or alkenyl having 3 to about 20 carbon atoms, e.g., 8 to about 18 carbon atoms, and 0 to 4 double bonds, e.g., 0 to 2 double bonds.

[0136] In some embodiments, when each of n and m is independently a value of 1 or 3, R 103 may be any one of the following formulas (204) to (213).

[0137] [ka]

[0138] In formulae (204) to (213), g, e, and f each independently represent an integer of 1 to 6, each "HCC" represents a hydrocarbon chain, * is R 103 and the nitrogen atom in formula (201), and * Each H on position may be substituted to provide a bond with the nitrogen atom in formula (201).

[0139] The compound of formula (201) may be prepared according to the description in Chinese Patent Publication No. 103380113.

[0140] In some embodiments, the organic amine is an organic amine represented by formula (214) and / or an organic amine represented by formula (215).

[0141] [ka]

[0142] the co-lipid is cholesterol, a cholesterol analogue and / or a cholesterol derivative; The polyethylene glycolated lipid is 1,2-dipalmitamido-sn-glycero-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.

[0143] In some embodiments, the molar ratio of the organic amine, the colipid, and the polyethylene glycolated lipid in the pharmaceutical composition is (19.7 to 80):(19.7 to 80):(0.3 to 50), and may be, for example, (50 to 70):(20 to 40):(3 to 20).

[0144] In some embodiments, the pharmaceutical composition particles formed by the siRNA of the present disclosure and the amine-containing transfection reagent have an average diameter of about 30 nm to about 200 nm, typically about 40 nm to about 135 nm, and more typically, the average diameter of the liposome particles is about 50 nm to about 120 nm, about 50 nm to about 100 nm, about 60 nm to about 90 nm, or about 70 nm to about 90 nm, e.g., the average diameter of the liposome particles is about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, or 160 nm.

[0145] In some embodiments, in a pharmaceutical composition formed by an siRNA of the disclosure and the amine-containing transfection reagent, the weight ratio (weight / weight ratio) of siRNA to total lipids (e.g., organic amine, auxiliary lipid, and / or pegylated lipid) is within the range of about 1:1 to about 1:50, about 1:1 to about 1:30, about 1:3 to about 1:20, about 1:4 to about 1:18, about 1:5 to about 1:17, about 1:5 to about 1:15, about 1:5 to about 1:12, about 1:6 to about 1:12, or about 1:6 to about 1:10, e.g., the weight ratio of siRNA of the disclosure to total lipids is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, or 1:18.

[0146] In some embodiments, the pharmaceutical composition may be present as each component independently when marketed, or may be present as a liquid formulation when used.In some embodiments, the pharmaceutical composition formed by the siRNA provided by the present disclosure and the above-mentioned pharmaceutical acceptable carrier may be prepared according to various known methods, and the siRNA provided by the present disclosure may be used instead of conventional siRNA.In some embodiments, it may be prepared according to the following method.

[0147] The organic amine, auxiliary lipid and polyethylene glycolated lipid are suspended in alcohol in the above molar ratio and mixed uniformly to obtain a lipid solution. The amount of alcohol is determined so that the total mass concentration of the obtained lipid solution is 2 to 25 mg / mL, for example, 8 to 18 mg / mL. The alcohol is one or more selected from pharma- ceutically acceptable alcohols, such as ethanol, propylene glycol, benzyl alcohol, glycerin, polyethylene glycol 200, polyethylene glycol 300, polyethylene glycol 400, and other alcohols that are liquid at around room temperature, and may be, for example, ethanol.

[0148] The siRNA provided by the present disclosure is dissolved in a buffer salt solution to obtain an siRNA aqueous solution. The concentration of the buffer salt solution is 0.05 to 0.5 M, and may be, for example, 0.1 to 0.2 M, the pH of the buffer salt solution is adjusted to 4.0 to 5.5, and may be, for example, 5.0 to 5.2, and the amount of the buffer salt solution is determined so that the concentration of the siRNA is 0.6 mg / mL or less, and may be, for example, 0.2 to 0.4 mg / mL. The buffer salt is one or more selected from soluble acetates and soluble citrates, and may be, for example, sodium acetate and / or potassium acetate.

[0149] After mixing the lipid solution and the siRNA aqueous solution, the resulting product is incubated at 40-60°C for at least 2 minutes, for example, 5-30 minutes, to obtain an incubated liposome formulation. The volume ratio of the lipid solution to the siRNA aqueous solution is 1:(2-5), and may be, for example, 1:4.

[0150] The incubated liposome preparation is concentrated or diluted, impurities are removed, and bacteria are sterilized to obtain a pharmaceutical composition provided by the present disclosure, whose physicochemical parameters are pH 6.5-8, encapsulation efficiency 80% or more, particle size 40-200 nm, polydispersity index 0.30 or less, and osmotic pressure 250-400 mOsm / kg, and for example, the physicochemical parameters may be pH 7.2-7.6, encapsulation efficiency 90% or more, particle size 60-100 nm, polydispersity index 0.20 or less, and osmotic pressure 300-400 mOsm / kg.

[0151] Here, the concentration or dilution may be performed before removing impurities, after removing impurities, or simultaneously. As a method for removing impurities, various conventional methods may be used, for example, ultrafiltration may be performed under conditions of 100K Da using a tangential flow system and a hollow fiber column, and the ultrafiltration exchange solution may be a phosphate buffer solution (PBS) of pH 7.4. As a method for sterilization, various conventional methods may be used, for example, sterilization may be performed by filtering through a 0.22 μm filter.

[0152] siRNA complex The present disclosure provides a siRNA complex, the siRNA complex comprises an siRNA provided by the present disclosure and a conjugation group conjugated to the siRNA. In some embodiments, the conjugation group comprises a linker and a pharma- ceutically acceptable targeting group and / or delivery aid group, the siRNA, the linker, the targeting group or the delivery aid group are covalently or non-covalently linked in order, each of the targeting groups is selected from a ligand that can bind to a cell surface receptor, and each of the delivery aid groups is selected from a group that can improve the biocompatibility of the siRNA complex in a delivery target organ or tissue.

[0153] In the context of the present disclosure, unless otherwise specified, "conjugate" refers to two or more chemical moieties each having a specific function being covalently bonded to each other, and accordingly, "conjugate" refers to a compound formed by covalently bonding the respective chemical moieties. Furthermore, "siRNA complex" refers to a compound formed by covalently bonding one or more chemical moieties having a specific function to siRNA. Depending on the context, the siRNA complex should be understood as a collective term for multiple siRNA complexes, or an siRNA complex represented by a certain chemical formula. In the context of the present disclosure, a "conjugate molecule" should be understood as a specific compound that can be reacted to be conjugated to siRNA and ultimately form the siRNA complex of the present disclosure.

[0154] In general, the conjugated group comprises at least one pharma- ceutically acceptable targeting group and an optional linker, and the siRNA, the linker and the targeting group are linked in order. In some embodiments, the number of targeting groups is 1 to 6. In some embodiments, the number of targeting groups is 2 to 4. The siRNA molecule may be non-covalently or covalently conjugated to the conjugated group, for example, may be covalently conjugated to the conjugated group. The conjugation site between the siRNA and the conjugated group may be at the 3' or 5' end of the sense strand of the siRNA, at the 5' end of the antisense strand, or in an internal sequence of the siRNA. In some embodiments, the conjugation site between the siRNA and the conjugated group is at the 3' end of the sense strand of the siRNA.

[0155] In some embodiments, the conjugated group may be attached to the phosphate group, 2'-hydroxyl or base of the nucleotide. In some embodiments, the conjugated group may be attached to the 3'-hydroxyl, in which case the nucleotides are linked by a 2'-5' phosphodiester bond. When the conjugated group is attached to the end of the siRNA chain, it is usually attached to the phosphate group of the nucleotide, and when the conjugated group is attached to the internal sequence of the siRNA, it is usually attached to the ribose sugar ring or base. For various binding methods, see Muthiah Manoharan et.al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology,2015,10 (5):1181-7.

[0156] The targeting group may be linked to the siRNA molecule via a suitable linker, and those skilled in the art can select a suitable linker according to the specific type of the targeting group.For these linkers, the types of targeting groups and the method of linking to siRNA, reference may be made to the disclosure of International Publication No. 2015006740, the contents of which are incorporated herein by reference in their entirety.

[0157] In some embodiments, the targeting group may be a ligand commonly used in the field of siRNA administration, such as various ligands described in International Publication No. WO2009082607, the disclosure of which is incorporated herein by reference in its entirety.

[0158] In some embodiments, the or each targeting group is selected from a ligand capable of binding to a cell surface receptor expressing the APOC3 gene.

[0159] In some embodiments, at least one or each of the targeting groups is selected from ligands capable of binding to a mammalian hepatocyte surface receptor (ASGPR). In some embodiments, each of the targeting groups is independently a ligand with affinity for a mammalian hepatocyte surface asialoglycoprotein receptor. In some embodiments, each of the targeting groups is independently an asialoglycoprotein or a sugar. In some embodiments, each of the targeting groups is independently an asialoglycoprotein, such as asialoorosomucoid (ASOR) or asialofetuin (ASF).In some embodiments, each of the targeting groups is D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-gluc ... Glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isopropyl ... Sobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formylamino-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl In some embodiments, the targeting group is independently selected from ethyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose. In some embodiments, at least one or each of the targeting groups is galactose or N-acetylgalactosamine.

[0160] In some embodiments, the linker in the siRNA complex of the present disclosure has the structure shown in formula (301):

[0161] [ka] where k is an integer from 1 to 3, L A has a structure containing an amide bond as shown in formula (302), and L B has a structure containing an N-acylpyrrolidine represented by formula (303), contains a carbonyl and an oxygen atom, and L C is a linking group based on hydroxymethylaminomethane, dihydroxymethylaminomethane or trihydroxymethylaminomethane.

[0162] [ka] However, n 302 , q 302 and p 302 are each independently an integer of 2 to 6, and preferably, 302 , q 302 and p 302 are each independently 2 or 3; n 303 is an integer from 4 to 16, preferably, 303 is an integer between 8 and 12, JPEG2024525800000015.jpg5133 represents the site to which the group is covalently attached.

[0163] In the linker, L A each is linked to one of the targeting groups by an ether bond; C The hydroxy oxygen atom in the moiety is L C The L moiety is linked by forming an ether bond. B In formula (303), the carbonyl is L C The oxygen atom in formula (303) is bonded to the siRNA by forming a phosphate bond or a thiophosphate bond via the oxygen atom in the formula (304).

[0164] In some embodiments, the siRNA complex provided by the present disclosure has the structure shown in formula (305):

[0165] [ka] where Nu represents a siRNA provided by the present disclosure.

[0166] In some embodiments, the linker in the siRNA complex of the present disclosure has the structure shown in formula (306):

[0167] [ka] However, n 306 is an integer from 0 to 3, and each p 306 are independently an integer from 1 to 6, JPEG2024525800000018.jpg6128 represents a site to which a group is covalently attached, said linking group being * The oxygen atom indicated by # is linked to the targeting group by forming an ether bond, and the linking group is linked to the siRNA by forming a phosphate bond or a thiophosphate bond with at least one of the oxygen atoms indicated by #, and the oxygen atom indicated by # is linked to a hydrogen atom to form a hydroxyl or to a C1-C3 alkyl to form a C1-C3 alkoxy group.

[0168] In some embodiments, the siRNA complex of the present disclosure has the structure shown in formula (307):

[0169] [ka] where Nu represents a siRNA provided by the present disclosure.

[0170] In some embodiments, the siRNA complex of the present disclosure has the structure shown in formula (308):

[0171] [ka] however, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4, m1, m2, and m3 each independently represent an integer selected from 2 to 10; R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are each independently H or C1-C 10 Alkyl, C1-C 10 Alkyl halides and C1-C 10 alkoxy; R3 has the structure shown in formula A59.

[0172] [ka] wherein E1 is OH, SH, or BH2, and Nu is an siRNA provided by the present disclosure; R2 is a straight chain alkylene of 1 to 20 carbon atoms in length, where one or more of the carbon atoms is selected from the group consisting of C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene, C2-C 10 Alkynylene, C6-C 10 Arylene, C3-C 18 Heterocyclylene and C5-C 10 heteroarylene, and R2 is C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 Heteroaryl, C1-C 10 Alkyl halides, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-OH, -OC1-C 10 Alkyl halides, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C10 Alkyl halides, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N(C1-C 10 Alkyl)(C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl)(C1-C 10 alkylphenyl), -NH(C1-C 10 alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 alkyl), -CON(C1-C 10 Alkyl)(C1-C 10 alkyl), -CONH(C1-C 10 alkyl), -CONH2, -NHC(O)(C1-C 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)C1-C 10 Alkyl, -SO2(C1-C 10 alkyl), -SO2(phenyl), -SO2(C1-C 10 Alkyl halides), -SO2NH2, -SO2NH(C1-C 10 alkyl), -SO2NH(phenyl), -NHSO2(C1-C 10 alkyl), -NHSO2(phenyl) and -NHSO2(C1-C 10 and optionally one or more substituents selected from the group consisting of alkyl halide; Each L1 is a straight chain alkylene of 1 to 70 carbon atoms in length, where one or more of the carbon atoms is selected from the group consisting of C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene, C2-C 10 Alkynylene, C6-C 10 Arylene, C3-C18 Heterocyclylene and C5-C 10 heteroarylene, and L1 is C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 Heteroaryl, C1-C 10 Alkyl halides, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-OH, -OC1-C 10 Alkyl halides, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Alkyl halides, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N(C1-C 10 Alkyl)(C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl)(C1-C 10 alkylphenyl), -NH(C1-C 10 alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 alkyl), -CON(C1-C 10 Alkyl)(C1-C 10 alkyl), -CONH(C1-C 10 alkyl), -CONH2, -NHC(O)(C1-C 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)C1-C 10 Alkyl, -SO2(C1-C 10alkyl), -SO2(phenyl), -SO2(C1-C 10 Alkyl halides), -SO2NH2, -SO2NH(C1-C 10 alkyl), -SO2NH(phenyl), -NHSO2(C1-C 10 alkyl), -NHSO2(phenyl) and -NHSO2(C1-C 10 and optionally having one or more substituents selected from the group consisting of alkyl halide, JPEG2024525800000022.jpg5131 represents the site to which the group is covalently attached, M1 represents a targeting group, the definition and range of options of which are the same as those described above. In some embodiments, each M1 is an independently selected one from ligands having affinity for the asialoglycoprotein receptor on the surface of mammalian hepatocytes.

[0173] For convenience, L1 is defined as a linear alkyl, but it will be understood by those skilled in the art that it may be, for example, an amino or alkenyl resulting from the above replacement and / or substitution, which may not be a linear group or may have a different name. For purposes of this disclosure, the length of L1 is the number of atoms in the chain connecting the two attachment points. For this purpose, the ring (e.g., heterocyclylene or heteroarylene) obtained by substituting the carbon atoms of the linear alkylene is considered to be one atom.

[0174] When M1 is a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian hepatocytes, in some embodiments, n1 may be an integer of 1-3, and n3 may be an integer of 0-4, ensuring that the number of M1 ligands in the complex is at least 2. In some embodiments, n1+n3≧2, so that the number of M1 ligands is at least 3, which allows the M1 ligand to bind more easily to the asialoglycoprotein receptor on the surface of the liver, and further promotes the complex to be taken up into cells by intracellular uptake. As can be seen from experiments, when the number of M1 ligands is 3 or more, the ease of binding between the M1 ligand and the asialoglycoprotein receptor on the surface of the liver is not clearly improved. Therefore, in consideration of various aspects such as ease of synthesis, structure / process cost, and delivery efficiency, in some embodiments, n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3=2-3.

[0175] In some embodiments, the spatial location between multiple M1 ligands can be adapted for binding of the M1 ligand to an asialoglycoprotein receptor on the liver surface when m1, m2, and m3 are independently selected from integers from 2 to 10. To simplify, facilitate synthesis, and / or reduce costs of the conjugates provided by the present disclosure, in some embodiments, m1, m2, and m3 are each independently an integer from 2 to 5, and in some embodiments, m1=m2=m3.

[0176] R 10 , R 11 , R 12 , R 13 , R 14 and R 15 are H, C1-C, respectively. 10 Alkyl, C1-C 10 Alkyl halides and C1-C 10 It will be understood by those skilled in the art that when R is one independently selected from alkoxy, any of them can achieve the objectives of the present disclosure without changing the properties of the conjugates of the present disclosure.10 , R 11 , R 12 , R 13 , R 14 and R 15 Each is independently selected from H, methyl, and ethyl. 10 , R 11 , R 12 , R 13 , R 14 and R 15 are both H.

[0177] In the siRNA complex provided by the present disclosure, R3 is a group having the structure shown in formula A59, wherein E1 is OH, SH or BH2, and in some embodiments, E1 is OH or SH, taking into consideration the availability of preparation materials.

[0178] In some embodiments, R2 is selected to provide a bond between N on the nitrogen-containing backbone and A59. In the context of this disclosure, a "nitrogen-containing backbone" refers to R 10 , R 11 , R 12 , R 13 , R 14 and R 15 A59 refers to a chain structure in which the carbon atom to which A59 is bonded and N are bonded to each other. Thus, R2 may be any linking group capable of linking the group of A59 to N on the nitrogen-containing backbone in an appropriate manner. In some embodiments, when preparing the siRNA complex of the present disclosure by a solid-phase synthesis process, R2 must include both a binding site that is bonded to N on the nitrogen-containing backbone and a binding site that is bonded to P in R3. In some embodiments, the site that is bonded to N on the nitrogen-containing backbone in R2 forms an amide bond with N, and the site that is bonded to P on R3 forms a phosphate ester bond with P. In some embodiments, R2 is B5, B6, B5', or B6'.

[0179] [ka] however, JPEG2024525800000024.jpg5133 represents the site to which the group is covalently attached.

[0180] The value of q2 may range from 1-10, and in some embodiments, q2 is an integer from 1-5.

[0181] L1 serves to link the M1 ligand to the N on the nitrogen-containing backbone and provide targeting functionality to the siRNA complex of the present disclosure. In some embodiments, L1 is a combination of one or more bonds selected from the groups of formulae A1-A26. In some embodiments, L1 is a combination of one or more bonds selected from A1, A4, A5, A6, A8, A10, A11, and A13, in some embodiments, L1 is a combination of at least two bonds selected from A1, A4, A8, A10, and A11, in some embodiments, L1 is a combination of at least two bonds selected from A1, A8, A10.

[0182] [ka] JPEG2024525800000026.jpg26149

[0183] In some embodiments, the length of L1 can be 3 to 25 atoms, 3 to 20 atoms, 4 to 15 atoms, or 5 to 12 atoms. In some embodiments, the length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 atoms.

[0184] In some embodiments, j1 is an integer from 2 to 10, and in some embodiments, j1 is an integer from 3 to 5. In some embodiments, j2 is an integer from 2 to 10, and in some embodiments, j2 is an integer from 3 to 5. R' is a C1-C4 alkyl, and in some embodiments, R' is one of methyl, ethyl, and isopropyl. Ra is one of A27, A28, A29, A30, and A31, and in some embodiments, Ra is A27 or A28. Rb is a C1-C5 alkyl, and in some embodiments, Rb is one of methyl, ethyl, isopropyl, and butyl. In some embodiments, j1, j2, R', Ra, and Rb are each selected in formulae A1 to A26 to realize the binding of the M1 ligand to N on the nitrogen-containing backbone, and the spatial position between the M1 ligands is more suitable for the binding of the M1 ligand to the asialoglycoprotein receptor on the liver surface.

[0185] [ka]

[0186] In some embodiments, the siRNA complex of the present disclosure has a structure as shown in formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422).

[0187] [ka] JPEG2024525800000029.jpg201129JPEG2024525800000030.jpg201129JPEG2024525800000031.jpg190134 JPEG2024525800000032.jpg230130JPEG2024525800000033.jpg211125JPEG2024525800000034.jpg160120

[0188] In some embodiments, P in formula A59 may be bound to any possible position in the siRNA sequence, for example, P in formula A59 may be bound to any one nucleotide of the sense strand or antisense strand of siRNA, and in some embodiments, P in formula A59 is bound to any one nucleotide of the sense strand of siRNA. In some embodiments, P in formula A59 is bound to the end of the sense strand or antisense strand of siRNA, and in some embodiments, P in formula A59 is bound to the end of the sense strand of siRNA. The end refers to the previous 4 nucleotides from the end of the sense strand or the antisense strand. In some embodiments, P in formula A59 is bound to the end of the sense strand or antisense strand of siRNA, and in some embodiments, P in formula A59 is bound to the 3' end of the sense strand of siRNA. When bound to the above position of the sense strand of siRNA, the complex provided by the present disclosure can release the single antisense strand of siRNA when unwound after entering a cell, and suppress the expression of a target gene by RNAi mechanism.

[0189] P in formula A59 may be attached to any available position on the nucleotide in the siRNA, such as the 5' position of the nucleotide, the 2' position of the nucleotide, the 3' position of the nucleotide, or the base of the nucleotide. In some embodiments, P in formula A59 may be attached to the 2', 3', or 5' position of the nucleotide in the siRNA by forming a phosphodiester bond. In some embodiments, P in formula A59 is attached to the oxygen atom obtained by dehydrogenating the 3' hydroxyl of the nucleotide at the 3' end of the sense strand of the siRNA, or P in formula A59 is attached to the nucleotide by replacing the hydrogen in the 2'-hydroxyl of one nucleotide in the sense strand of the siRNA, or P in formula A59 is attached to the nucleotide by replacing the hydrogen in the 5' hydroxyl of the nucleotide at the 5' end of the sense strand of the siRNA.

[0190] In some embodiments, the siRNA contained in the siRNA complex of the present disclosure may be, for example, any siRNA shown in Tables 1a, 1b, or 1c. siRNA complexes containing these siRNAs exhibit low off-target effects and high inhibitory activity against mRNA expressed by the APOC3 gene.

[0191] Table 1a. First class siRNA sequences of the present disclosure [Table 1]

[0192] Table 1b. Second class siRNA sequences of the present disclosure [Table 2] JPEG2024525800000037.jpg193132

[0193] Table 1c. Third class siRNA sequences of the present disclosure [Table 3]

[0194] where capital letters C, G, U, and A represent the base composition of the nucleotide, lower case letter m represents that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide, lower case letter f represents that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide, underlined capital letter S represents that one nucleotide adjacent to the left side of the letter S is a stabilizing modified nucleotide, lower case letter s represents that two nucleotides on the left and right sides of the letter s are linked by a phosphorothioate ester, and P1 represents that one nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide. In some embodiments, S represents a specific stabilizing modification, such as moe, and underlined combination letter moe represents that one nucleotide adjacent to the left side of the combination letter moe is a nucleotide having a 2'-O-methoxyethyl modification. In some embodiments, P1 represents specifically modified VP, Ps, or P, the combination letter VP represents that one nucleotide adjacent to the right side of the combination letter VP is a vinyl phosphate (5'-(E)-vinylphosphonate, E-VP) modified nucleotide, the combination letter Ps represents that one nucleotide adjacent to the right side of the combination letter Ps is a thiophosphate modified nucleotide, and the capital letter P represents that one nucleotide adjacent to the right side of the letter P is a 5'-phosphate nucleotide. In addition, each U in the sequences shown in Tables 1a to 1c above may be optionally replaced with T, without any obvious effect on the activity or off-target effect of the siRNA.

[0195] Preparation of siRNA Complexes of the Present Disclosure The siRNA complex may be synthesized by a method already described in detail in the prior art. For example, WO 2015006740 describes in detail the preparation method of multiple types of siRNA complex. The siRNA complex of the present disclosure can also be obtained by a method well known to those skilled in the art. For example, WO 2014025805 describes the preparation method of the structure shown in formula (305), and Rajeev et al. described the preparation method of the structure shown in formula (307) in ChemBioChem 2015,16,903-908. China Patent Publication No. 110959011 also discloses in detail the preparation method of the siRNA complex shown in formula (308). The above literature contents are incorporated herein by reference.

[0196] The siRNA complex of the present disclosure may be used in combination with other pharma- ceutically acceptable additives, which may be one or more of various preparations or compounds commonly used in the art; for details, see the description of the pharmaceutical composition of the present disclosure above.

[0197] Uses of the siRNAs, pharmaceutical compositions and siRNA complexes of the present disclosure In some embodiments, the present disclosure provides the use of the siRNA and / or pharmaceutical composition and / or siRNA complex of the present disclosure in the preparation of a drug for treating and / or preventing a disease or condition associated with the mRNA level expressed by APOC3 gene.In some embodiments, the disease or condition associated with the mRNA level expressed by APOC3 gene is dyslipidemia.In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia or atherosclerosis.

[0198] In some embodiments, the present disclosure provides a method for treating and / or preventing a disease or condition related to the mRNA level expressed by APOC3 gene, the method comprising administering the siRNA and / or pharmaceutical composition and / or siRNA complex of the present disclosure to a subject in need thereof.In some embodiments, the disease or condition related to the mRNA level expressed by APOC3 gene is dyslipidemia.In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia or atherosclerosis.

[0199] In some embodiments, the present disclosure further provides a method for suppressing the expression level of the APOC3 gene in a cell, the method comprising contacting the cell with an effective amount of an siRNA, and / or pharmaceutical composition, and / or siRNA of the present disclosure.

[0200] By administering the siRNA, pharmaceutical composition and / or siRNA complex provided by the present disclosure to a subject in need thereof, the mechanism of regulating gene expression can be used to achieve the goal of preventing and / or treating a pathological condition or disease caused by the expression of a specific gene in a cell. Thus, the siRNA, pharmaceutical composition and / or siRNA complex provided by the present disclosure may be used for the prevention and / or treatment of the pathological condition or disease, or may be used for the preparation of a drug for preventing and / or treating the pathological condition or disease described herein.

[0201] The term "drug administration / administration" as used herein refers to placing siRNA, pharmaceutical composition and / or siRNA complex into the body of a subject by a method or route that allows the siRNA, pharmaceutical composition and / or siRNA complex to at least partially localize to a desired site to produce a desired effect. Suitable administration routes for the methods of the present disclosure include local administration and systemic administration. Generally, local administration delivers more siRNA, pharmaceutical composition and / or siRNA complex to a specific site than to the entire body of the subject, while systemic administration delivers the siRNA, pharmaceutical composition and / or siRNA complex to almost the entire body of the subject. Considering that the present disclosure is intended to provide a means for preventing and / or treating pathological conditions or diseases caused by the expression of a specific gene in liver cells, in some embodiments, the administration method can deliver drugs to the liver.

[0202] Administration to a subject may be by any suitable route known in the art, including, but not limited to, oral or non-gastrointestinal (parenteral) routes, such as intravenous, intramuscular, subcutaneous, transdermal, intratracheal (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration. The frequency of administration may be once or more per day, week, biweekly, triweekly, monthly, or yearly.

[0203] The dose of the siRNA, pharmaceutical composition and / or siRNA complex described in the present disclosure may be a dose common in the art, and the dose may be determined according to various parameters, in particular the age, weight and sex of the subject. Toxicity and therapeutic efficacy are measured by standard pharmaceutical procedures in cell cultures or experimental animals, and are determined, for example, by LD50 (the dose that causes the death of 50% of the colony) and ED 50 (For a quantitative response, this refers to the dose which produces 50% of the maximum response strength; for a qualitative response, this refers to the dose at which a positive response occurs in 50% of experimental subjects) may be determined. A range of human dosages can be derived based on data obtained from cell culture assays and animal studies.

[0204] When administering the siRNA, pharmaceutical composition, and / or siRNA complex described in the present disclosure to, for example, male or female, 6-12 weeks old, weighing 18-25g C57BL / 6J or C3H / HeNCrlVr mice, the amount of siRNA in the siRNA, pharmaceutical composition, and / or siRNA complex may be 0.001-100 mg / kg body weight for the siRNA complex formed with the siRNA and a pharma- ceutically acceptable conjugate molecule, and in some embodiments, it is 0.01-50 mg / kg body weight, in further embodiments, it is 0.05-20 mg / kg body weight, in still further embodiments, it is 0.1-15 mg / kg body weight, and in still further embodiments, it is 0.1-10 mg / kg body weight. When administering the siRNA, pharmaceutical composition, and / or siRNA complex described in the present disclosure, the above doses are preferred.

[0205] In addition, the siRNA, pharmaceutical composition, and / or siRNA complex of the present disclosure can be introduced into cells in which a specific gene is abnormally expressed, thereby achieving the purpose of suppressing the expression of the specific gene in the cell through a mechanism of regulating gene expression. In some embodiments, the cell is a hepatocyte. In some embodiments, the hepatocyte may be a cell selected from a hepatoma cell line such as Hep3B, HepG2, Huh7, or an isolated primary hepatocyte, and in some embodiments, the primary hepatocyte.

[0206] The method provided by the present disclosure suppresses the expression of a particular gene in a cell, and the dose of the siRNA in the provided siRNA, pharmaceutical composition, and / or siRNA complex is easily determined by one skilled in the art based on the effect to be obtained. For example, in some embodiments, the dose of the siRNA in the provided siRNA complex is generally an amount that can reduce the expression of the target gene and results in an extracellular concentration of 1 pM to 1 μM, 0.01 nM to 100 nM, 0.05 nM to 50 nM, or 0.05 nM to about 5 nM at the surface of the target cell. The amount required to achieve the local concentration varies depending on various factors, including the delivery method, the delivery site, the number of cell layers between the delivery site and the target cell or tissue, whether the delivery is local or systemic, etc. The concentration at the delivery site may be significantly higher than the concentration at the surface of the target cell or tissue.

[0207] kit The present disclosure provides kits, which comprise the siRNA, pharmaceutical composition and / or siRNA complex provided by the present disclosure.

[0208] In some embodiments, the kits described herein may provide the siRNA, pharmaceutical composition, and / or complex in one container. In some embodiments, the kits described herein may include a container providing a pharma- ceutically acceptable excipient. In some embodiments, the kits may include other components, such as stabilizers or preservatives. In some embodiments, the kits described herein may include at least one other therapeutic agent in a container separate from the container providing the siRNA, pharmaceutical composition, and / or complex described herein. In some embodiments, the kits may include instructions for mixing the siRNA, pharmaceutical composition, and / or complex with a pharma- ceutically acceptable carrier and / or excipient or other components, if present.

[0209] In the kit of the present disclosure, the siRNA, pharma- ceutically acceptable carrier and / or additive, and the pharmaceutical composition and / or complex, and / or pharma- ceutically acceptable additive can be provided in any form, such as liquid, dry, or lyophilized. In some embodiments, the siRNA and pharma- ceutically acceptable carrier and / or additive, and the pharmaceutical composition and / or complex, and any pharma- ceutically acceptable additive are essentially clean and / or sterile. In some embodiments, sterile water can be provided in the kit of the present disclosure.

[0210] The present disclosure will be further described below with reference to examples, but the present disclosure is not limited thereto in any way.

[0211] <Example> Unless otherwise specified, all reagents and media used in the following examples are commercially available products, and all operations such as nucleic acid electrophoresis and real-time PCR are performed with reference to the methods described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).

[0212] Preparation Examples 1 to 7: Synthesis of siRNA Complexes Provided by the Present Disclosure Complexes 1 to 7 in Table 2 below were prepared and obtained by the preparation method described in Preparation Example 1 of China Patent Publication No. 110959011. The only differences are as follows. The sense strand and antisense strand of the siRNA contained in each siRNA complex are shown in Table 2, respectively, and the sense strand and antisense strand of the siRNA were synthesized according to the nucleic acid sequences of the siRNAs numbered Complex 1 to Complex 7 in Table 2. Ultrapure water (Milli-Q ultrapure water system, resistivity 18.2 MΩ) was used. *Each siRNA complex was diluted to a concentration of 0.2 mg / mL (as siRNA) using a 1000 sq. cm (25°C) and then the molecular weight was detected using a liquid chromatography mass spectrometer (LC-MS, Liquid Chromatography-Mass Spectrometry, purchased from Waters, model number: LCT Premier). The measured values ​​were consistent with the theoretical values, indicating that the synthesized complexes 1 to 7 were double-stranded nucleic acid sequences of the intended design. Each siRNA complex has a structure shown in formula (403), and the siRNA contained in the siRNA complex has an siRNA sequence corresponding to complexes 1 to 7 in Table 2, respectively. For example, the theoretical value of the molecular weight (mw) of the sense strand of complex 5 is 7581.42, the measured value is 7581.22, and the theoretical value of the antisense strand is 6948.55, the measured value is 6948.72, and the measured value is consistent with the theoretical value, indicating that the complex has a structure shown in formula (403), and that the complex has an siRNA sequence corresponding to complex 5 in Table 2.

[0213] Table 2 siRNA sequences in siRNA complexes [Table 4] JPEG2024525800000040.jpg171134

[0214] Here, capital letters C, G, U, A, and T represent the base composition of nucleotides, lower case letter m represents that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide, lower case letter f represents that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide, the underlined combination letter moe represents that one nucleotide adjacent to the left side of the combination letter moe is a ribose 2'-O-methoxyethyl-modified nucleotide, lower case letter s represents that the two nucleotides on the left and right of the letter s are linked by a thiophosphate, and P represents that one nucleotide on the right side of the letter P is a 5'-phosphate nucleotide.

[0215] Comparative Preparation Example 1-3: Synthesis of reference siRNA complex Reference siRNA complexes numbered Reference Complexes 1 to 3 in Table 2 below were prepared according to the preparation method described in Preparation Example 1 of China Patent Publication No. 110959011, except that the sense strand and antisense strand of the siRNA contained in each reference siRNA complex are shown in Table 2, respectively, and the sense strand and antisense strand of the siRNA were synthesized according to the nucleic acid sequences of the siRNAs numbered Reference Complexes 1 to 3 in Table 2 below. Ultrapure water (Milli-Q ultrapure water system, resistivity 18.2 MΩ) was used. * Each reference siRNA complex was diluted to a concentration of 0.2 mg / mL (as siRNA) using a 500 sq. cm (25°C) and then the molecular weight was detected using a liquid chromatography mass spectrometer (LC-MS, Liquid Chromatography-Mass Spectrometry, purchased from Waters, model number: LCT Premier). The measured values ​​were consistent with the theoretical values, indicating that the synthesized reference complexes 1 to 3 each had a double-stranded nucleic acid sequence of the intended design. Each reference siRNA complex has a structure shown in formula (403), and the siRNA contained therein has an siRNA sequence corresponding to reference complexes 1 to 3 in Table 2, respectively, and these siRNA sequences do not contain stabilizing modified nucleotides.

[0216] Comparative Preparation Example 4: Synthesis of reference siRNA NC The following reference siRNA NC was synthesized by solid-phase synthesis according to the method described in Preparation Example 1 of WO2019105418, except that the sense strand shown in SEQ ID NO:161 and the antisense strand shown in SEQ ID NO:162, which are complementary to each other, were dissolved in equimolar amounts using DEPC water, and then annealed to obtain the reference siRNA NC.

[0217] 5'-UmsUmsCmUmCmCmGfAfAfCmGmUmGmUmCmAmCmGmUm-3' (SEQ ID NO:161), 5'-AmsCfsGmUmGmAfCmAmCmGmUmUmCmGfGmAfGmAmAmsCmsUm-3' (SEQ ID NO:162).

[0218] Preparation Examples 8 to 14: Synthesis of siRNAs provided by the present disclosure The siRNA sequences shown in Table 2 were each synthesized by solid-phase synthesis using the method described in Preparation Example 1 of WO 2019105418, except that the complementary sense and antisense strands in Table 2 were dissolved in equimolar amounts using DEPC water, and then annealed to obtain siRNA1 to siRNA7 provided by the present disclosure, whose sequences are shown in Table 2.

[0219] Comparative Preparation Examples 4-10 Reference siRNA1 to Reference siRNA7 were prepared in the same manner as in Preparation Examples 8 to 14.

[0220] Experimental Example 1: Toxic effects of siRNA complexes in mice Complex 1, Complex 2 and Reference Complex 1 were each dissolved in PBS to a 10mg / ml solution (as siRNA complex). ICR mice (half male and half female, weighing 18-22g, 5-6 weeks old, purchased from Sigma Co., Ltd.) were randomly divided into groups, with 6 mice (half male and half female) per group, and each was numbered. As the test group, each mouse was administered the above siRNA complex solution at a dose of 10mL / kg by subcutaneous injection at the neck, and as the blank control group, each mouse in one group was administered PBS at a dose of 10mL / kg.

[0221] The administration time was set as day 1, and on day 8, 0.6 mL of blood was collected from each mouse in the test group and blank control group via the orbit. After blood collection, the mice were incubated at 37°C for 60 min, and then centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. In addition, the concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy). The results are shown in Table 1.

[0222] Furthermore, after blood sampling on day 8, the mice were sacrificed and autopsied, and the sections were preserved in 10% neutral buffered formalin fixative and prepared for pathological examination. The severity of hepatic steatosis and inflammation in the sections was evaluated and graded.

[0223] Table 1 Blood biochemistry results of mice administered siRNA complexes [Table 5]

[0224] In Table 1, % and the number before it represent the percentage of the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in mouse serum and the concentration in the serum of the blank control group, relative to the concentration in the serum of the blank control group. For example, 420% in Table 1 represents that the in vivo concentration of alanine aminotransferase in mice administered with 100 mg / Kg of Reference Complex 1 is 420% higher than that of the blank control group.

[0225] As can be seen from the results in Table 1, compared with the blank control, mice administered with reference complex 1 without stabilized modified nucleotides showed obvious changes in blood biochemical indicators, with ALT levels increasing by 420% and AST levels increasing by 126%. In mice administered with siRNA complex 1 or 2 of the present disclosure, ALT levels increased by 116% and 118%, respectively, and AST levels increased by 32%, showing significantly decreased blood biochemical indicators.

[0226] As can be seen from the results of the pathological sections, compared with the blank control, of the six mice administered with reference complex 1 without stabilized modified nucleotides, one mouse showed a moderate hepatocyte inflammatory response, with specific symptoms including a small amount of diffuse inflammatory cell infiltration in its hepatic lobule and diffuse proliferation of fibrocytes in the hepatic sinus, three mice showed only a mild hepatocyte inflammatory response, with focal infiltration of inflammatory cells in the localized hepatic lobule, and one mouse showed localized hepatic lobule inflammatory necrosis and punctate necrosis of individual hepatocytes. Of the mice administered with complex 1 of the present disclosure, only two mice showed a mild hepatocyte inflammatory response, with a small amount of inflammatory cell infiltration, and no moderate or higher inflammatory response and necrosis. Of the mice administered with complex 2 of the present disclosure, only one mouse showed a mild hepatocyte inflammatory response, with no moderate or higher inflammatory response and necrosis. Compared with reference complex 1, complexes 1 and 2 showed significantly lower toxic responses.

[0227] As is evident from the above results, compared with the reference complex, the siRNA complex of the present disclosure can effectively reduce hepatotoxic responses caused by off-target effects, and therefore exhibits significantly higher safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0228] Experimental Example 2: Toxic effects of siRNA complexes in mice Complex 6, Complex 7 and Reference Complex 3 were dissolved in PBS to 10mg / ml and 30mg / ml solutions (as siRNA complexes), respectively. ICR mice (half male and half female, weighing 18-22g, 5-6 weeks old, purchased from Sigma Co., Ltd.) were randomly divided into groups and numbered. For each concentration of each complex, animals were divided into two groups, a 2-week group and a 4-week group, with 6 mice (half male and half female) per group. As the test group, each mouse was administered the above siRNA complex solution by subcutaneous injection at the neck at a dose volume of 10mL / kg, and as the blank control group for the 2-week group or the 4-week group, each mouse in the two groups was administered PBS at a dose volume of 10mL / kg.

[0229] The administration time was set as day 1, and after day 15, six mice in the 2-week group of the 300 mg / kg complex were killed and autopsied, and each was preserved in 10% neutral buffered formalin fixative to prepare pathological sections. On day 29, blood was collected from six mice in the 4-week group of the test group and blank control group, with 0.6 mL of blood collected from the orbit, respectively, and after blood collection, the blood was incubated at 37°C for 60 min, and then centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. In addition, the concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy) and compared with the blank control group, and the results are shown in Table 2. The severity of inflammatory cell infiltration and hepatocyte necrosis in the pathological sections was evaluated and graded, and a relative comparison was made.

[0230] Table 2 Blood biochemistry results of mice administered siRNA complexes [Table 6]

[0231] In Table 2, F represents female mice, and % and the number before it represent the percentage of the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in mouse serum and the concentration in the serum of the blank control group, relative to the concentration in the serum of the blank control group. For example, F: 212% in Table 2 represents that the in vivo concentration of alanine aminotransferase in female mice administered 300 mg / Kg of reference complex 3 is 212% higher than that of the blank control group.

[0232] As can be seen from the results in Table 2, compared with the blank control, mice administered with reference complex 3 that does not contain stabilized modified nucleotides showed obvious changes in blood biochemical indicators, and at a high dose of 300 mg / Kg, the in vivo ALT and AST concentrations of female mice increased by 212% and 36%, respectively. At the same dose, the in vivo ALT and AST concentrations of female mice administered with complex 7 of the present disclosure increased by 130% and 32%, respectively, and compared with reference complex 3, the ALT concentration was obviously reduced, and mice administered with complex 6 of the present disclosure showed no increase in the in vivo ALT and AST concentrations, but compared with reference complex 3, the degree of change in blood biochemical indicators was obviously reduced.

[0233] As can be seen from the results of the pathological sections, compared with the blank control, the mice administered with reference complex 3 that does not contain stabilized modified nucleotides showed obvious hepatic inflammatory response, and all six mice showed inflammatory cell infiltration. Of the mice administered with complex 6, only three mice showed inflammatory cell infiltration. Of the mice administered with complex 7, only three mice showed inflammatory cell infiltration. Compared with the reference complex, the number of mice showing inflammatory cell infiltration was also significantly reduced histopathologically in the case of the complex of the present disclosure.

[0234] As is evident from the above results, compared with the reference complex, the siRNA complex of the present disclosure can effectively reduce hepatotoxic responses caused by off-target effects, and therefore exhibits significantly higher safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0235] Experimental Example 3: Toxic effects of siRNA complexes in mice The toxicity effect of siRNA complex in mice was verified by the method of Experimental Example 2, except that the test was conducted using complex 3 and reference complex 2. Each complex was dissolved in PBS at 10 mg / ml (as siRNA complex), and divided into 2-week and 4-week groups (referred to as D15 and D29 groups in Table 19, respectively), with 3 mice per group, all male. That is, the toxicity effect of complex 13 and reference complex 2 at a dose of 100 mg / kg in mice was tested.

[0236] Table 3. Blood biochemistry results of mice administered siRNA complexes [Table 7]

[0237] In Table 3, the % and the number preceding it represent the percentage of the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in mouse serum and the concentration in serum of the blank control group relative to the concentration in serum of the blank control group.

[0238] As can be seen from the results in Table 3, compared with the blank control, mice administered with reference complex 2 that does not contain stabilized modified nucleotides showed obvious changes in blood biochemical indicators, and on the 15th day after administration, the serum ALT and AST concentrations increased by 71% and 54%, respectively, and on the 29th day after administration, the serum ALT and AST concentrations increased by 118% and 94%, respectively. In mice administered with the same dose of complex 3, no increase in serum ALT and AST concentrations was observed. Complex 3 of the present disclosure shows significantly lower blood biochemical indicators.

[0239] As can be seen from the results of the pathological sections, compared with the blank control, among the mice administered with reference complex 2 without stabilized modified nucleotides, one mouse showed severe hepatocyte degeneration in the histopathological results, with specific symptoms of extensive swelling of hepatocytes, loose and lightly stained cytoplasm, some hepatocytes with vacuolar degeneration, and small round vacuoles in the cytoplasm, and two mice showed moderate hepatocyte degeneration, with specific symptoms of numerous to extensive loose cytoplasm of hepatocytes, some hepatocytes with vacuolar degeneration, and small round vacuoles in the cytoplasm. Among the mice administered with siRNA complex 3 of the present disclosure, three mice showed mild hepatocyte degeneration, with fewer hepatocytes with loose cytoplasm. Compared with the reference complex, the degree of hepatocyte degeneration was obviously reduced in histopathological results, showing a significantly lower toxic reaction.

[0240] As is evident from the above results, compared with the reference complex, the siRNA complex of the present disclosure can effectively reduce hepatotoxic responses caused by off-target effects, and therefore exhibits significantly higher safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0241] Experimental Example 4: Toxic effects of siRNA complexes in mice Complex 3 and Complex 5 were dissolved in PBS to a solution of 30 mg / ml (as siRNA complex). ICR mice (half male and half female, weighing 18-22 g, 5-6 weeks old, purchased from Sigma Co., Ltd.) were randomly divided into groups, with 10 mice (half male and half female) per group, and each was numbered. As the test group, each mouse was administered the above siRNA complex solution by subcutaneous injection at the neck in a volume of 10 mL / kg, and as a blank control group, each mouse in one group was administered PBS in a volume of 10 mL / kg.

[0242] The first administration was on day 1, and the mice were repeatedly administered on days 8 and 15, respectively. The concentration and administration volume of the siRNA complex solution (or PBS) used were the same as those of the first administration. On day 16, 0.6 mL of blood was collected from the orbit of each mouse in the test group and blank control group. After blood collection, the blood was incubated at 37°C for 60 min, and then centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. In addition, the concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy). The results are shown in Figure 1A and Figure 1B.

[0243] Figures 1A and 1B are scatter plots of ALT and AST concentrations in mouse serum after 300 mg / kg weekly administration of the siRNA complex of the present disclosure or PBS for 3 consecutive weeks. As can be seen from Figures 1A and 1B, compared with the blank control group, after administration of the siRNA complex of the present disclosure, the ALT and AST concentrations in serum were comparable to the levels of the blank control group, indicating that the siRNA complex of the present disclosure has very low hepatotoxicity.

[0244] Furthermore, after blood collection, the mice were killed and autopsied, and the sections were preserved in 10% neutral buffered formalin fixative to prepare pathological sections for comparative comparison. As can be seen from the pathological sections, the mice administered with the siRNA complex 3 or complex 5 of the present disclosure showed similar responses to the blank control group in both hepatic steatosis and inflammation, with no significant abnormalities. Similarly, the siRNA complex of the present disclosure was shown to have very low hepatotoxicity.

[0245] As is evident from the above results, the siRNA complex of the present disclosure can effectively reduce hepatotoxic reactions caused by off-target effects, and therefore exhibits remarkably high safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0246] Experimental Example 4: Inhibitory activity of siRNA complexes in in vitro sicheck system In this experimental example, the in vitro sicheck system was used to detect the target sequence suppression activity of Complex 1, Complex 2, Complex 3, Complex 4, Complex 6, Complex 7, Reference Complex 1, Reference Complex 2, Reference Complex 3 or Reference siRNA NC in the in vitro sicheck system.

[0247] [1] Construction of detection plasmid psiCHECK TM -2(Promega TM ) plasmid was used to construct the detection plasmid, which contains one target sequence 1, i.e., the siRNA target sequence. For the siRNA complexes to be tested, target sequence 1 is shown below.

[0248] (SEQ ID NO: 163)

[0249] The target sequence 1 is a nucleotide sequence in the mRNA expressed by the human APOC3 gene, which is the target of the detected siRNA, so the inhibitory effect of each siRNA complex on the target sequence 1 can reflect the ability of the siRNA in the detected siRNA complex to inhibit APOC3 gene expression. The target sequence 1 and its complementary sequence are listed in psiCHECK. TM The fragment was cloned into the Xho I / Not I sites of the -2 plasmid.

[0250] [2] Transfection HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) were cultured in DMEM complete medium (Hyclone) supplemented with 20% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of penicillin-streptomycin (Gibco, Invitrogen) in a 5% CO2 / 95% air-containing incubator at 37°C.

[0251] 8 × 10 HEK293A cells 3 Cells were seeded into a 96-well plate at 10 cells / well. After 16 hours, when the cell proliferation density reached 70-80%, the complete H-DMEM medium in the culture wells was aspirated, and 80 μL of Opti-MEM medium (GIBCO) was added to each well and the culture was continued for 1.5 hours.

[0252] The above detection plasmid was diluted using DEPC water to obtain a detection plasmid diluted standard solution of 200 ng / μL, and each of the following siRNA complexes or reference siRNA NC was prepared using DEPC water to obtain siRNA complex diluted standard solutions or reference siRNA NC diluted standard solutions of three different concentrations (as siRNA), namely 10 nM, 3 nM, and 1 nM, respectively. The siRNA complexes used were Complex 1, Complex 2, Complex 3, Complex 4, Complex 6, Complex 7, Reference Complex 1, Reference Complex 2, and Reference Complex 3, respectively, obtained by the above preparation.

[0253] For each siRNA complex or reference siRNA NC, solutions 1A1 to 1A3 were prepared, respectively. Each solution 1A1 to 1A3 contained, in order, 1 μL of the siRNA complex dilution standard solution or reference siRNA NC dilution standard solution of the above three concentrations, 0.05 μL of detection plasmid dilution standard solution (containing 10 ng of detection plasmid), and 10 μL of Opti-MEM medium.

[0254] Prepare 1B solution: 1 part 1B solution contains 0.2 µL of Lipofectamine TM 2000 and 10 μL of Opti-MEM medium.

[0255] A 1C solution was prepared, with one part of the 1C solution containing 0.05 μL of detection plasmid working solution (containing 10 ng of detection plasmid) and 10 μL of Opti-MEM medium.

[0256] One part of each of the 1B solutions was mixed with one part of each of the obtained siRNA complexes or reference siRNA NC solutions 1A1 to 1A3, and incubated at room temperature for 20 minutes to obtain transfection complexes 1X1 to 1X3 of each of the siRNA complexes and reference siRNA NC.

[0257] One part of solution 1B was mixed with one part of solution 1C and incubated at room temperature for 20 min to obtain blank transfection complex 1X4.

[0258] Each siRNA complex or reference siRNA NC transfection complex 1X1 to 1X3 was added to the culture wells at an addition amount of 20 μL / well and mixed uniformly to obtain transfection complexes of each siRNA complex or reference siRNA NC with final concentrations of approximately 0.1 nM, 0.03 nM and 0.01 nM (as siRNA), respectively. Each siRNA complex or reference siRNA NC transfection complex 1X1 to 1X3 was transfected into three culture wells, respectively, to obtain co-transfection mixtures containing the siRNA complex or reference siRNA NC, which were used as test groups.

[0259] For each siRNA complex or reference siRNA NC, transfection complex 1X4 was added to the other three culture wells at a loading volume of 20 μL / well, respectively, to obtain a transfection mixture without siRNA, which served as a blank control group.

[0260] After the co-transfection mixtures with and without siRNA were transfected into the culture wells for 4 h, 100 μL of H-DMEM complete medium containing 20% ​​FBS was added to each well. The 96-well plate was placed in a CO2 incubator and cultured for 24 h.

[0261] [3] Detection The medium in the culture wells was aspirated, and 150 μL of Dual-Glo (registered trademark) Luciferase reagent and H-DMEM mixed solution (volume ratio 1:1) was added to each well, mixed thoroughly and uniformly, and incubated at room temperature for 10 min. Then, 120 μL of the mixed solution was transferred to a 96-well microplate, and the Firefly chemiluminescence value (Fir) in each culture well of the 96-well microplate was read using a Synergy II multifunction microplate reader (BioTek). Furthermore, 60 μL of Dual-Glo (registered trademark) Stop & Glo (registered trademark) reagent was added to each well of the 96-well microplate, mixed thoroughly and uniformly, and incubated at room temperature for 10 min. Then, the Renilla chemiluminescence value (Ren) in each culture well of the 96-well microplate was read using a microplate reader according to the order of reading Fir.

[0262] The emission ratio Ratio = Ren / Fir of each well of the 96-well microplate was calculated, and the emission ratio Ratio (test) or Ratio (control) of each test group or control group was the average value of the Ratio of three culture wells. The emission ratio of each test group was normalized based on the emission ratio of the control group, and the relative expression level of the Renilla reporter gene, that is, the ratio R of Ratio (test) / Ratio (control) was obtained to indicate the residual activity. The inhibition rate of each siRNA complex or reference siRNA NC for the target sequence 1 = (1-R) ​​× 100%.

[0263] The inhibitory effect of each siRNA complex or reference siRNA NC against target sequence 1 is shown in Figure 2. Figure 2 shows a histogram of the relative expression level of target sequence 1 in an in vitro sicheck system after co-transfection of a plasmid containing target sequence 1 with a test siRNA complex or reference siRNA NC. Furthermore, the expression inhibition rate of each siRNA complex or reference siRNA NC against target sequence 1 is summarized in Table 3.

[0264] Table 4. Expression inhibition rate of target sequence 1 in the in vitro sicheck system [Table 8]

[0265] As can be seen from the results of Figure 2 and Table 4, the siRNA complex provided by the present disclosure has very high target sequence suppression activity in the in vitro sicheck system. At a low concentration of 0.01 nM, the expression suppression rate of target sequence 1 is at least 38.92% and up to 67.54%, and at a concentration of 0.1 nM, the expression suppression rate of target sequence 1 is at least 84.73% and up to 89.35%. In addition, the siRNA complex has a target sequence suppression activity level close to that of Reference Complex 1, Reference Complex 2, or Reference Complex 3, which does not contain stabilizing modified nucleotides.

[0266] Experimental Example 6: Inhibitory activity of siRNA complexes in in vitro sicheck system In this experimental example, the in vitro sicheck system was used to detect the target sequence suppression activity of complex 6, complex 7 or reference complex 3 in the in vitro sicheck system.

[0267] Based on the method described in Kumico Ui-Tei et.al.,Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36(7), 2136-2151, construct a detection plasmid, co-transfect the detection plasmid with the complex to be tested into HEK293A cells, and reflect the target sequence suppression activity of siRNA by the expression level of dual luciferase reporter gene. The specific steps are as follows:

[0268] [1] Construction of detection plasmid psiCHECK TM -2(Promega TM ) plasmid was used to construct a detection plasmid, which contains one target sequence 2, i.e., the target sequence of the siRNA complex. For the siRNA complex to be tested, the target sequence 2 is shown below.

[0269] TTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACC(SEQ ID NO: 164)

[0270] Since the target sequence 2 is a sequence that is completely complementary to the antisense strand in the detected siRNA complex, the inhibitory effect of each siRNA complex on the target sequence 1 can reflect the ability of the detected siRNA complex to inhibit the expression of the target gene. TMThe fragment was cloned into the Xho I / Not I sites of the -2 plasmid.

[0271] [2] Transfection HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) were cultured in DMEM complete medium (Hyclone) supplemented with 20% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of penicillin-streptomycin (Gibco, Invitrogen) in a 5% CO2 / 95% air-containing incubator at 37°C.

[0272] 8 × 10 HEK293A cells 3 Cells were seeded into a 96-well plate at 10 cells / well. After 16 hours, when the cell proliferation density reached 70-80%, the complete H-DMEM medium in the culture wells was aspirated, and 80 μL of Opti-MEM medium (GIBCO) was added to each well and the culture was continued for 1.5 hours.

[0273] The detection plasmid was diluted with DEPC water to obtain a detection plasmid dilution standard solution of 200ng / μL, and each siRNA complex in Table 4 was prepared with DEPC water to obtain 11 different concentrations of siRNA complex dilution standard solutions, namely 1.00μM, 0.330μM, 0.110μM, 0.0370μM, 0.0123μM, 0.00412μM, 0.00137μM, 0.000457μM, 0.000152μM, 0.0000508μM and 0.0000169μM (as the amount of siRNA in the siRNA complex). The siRNA complexes used are complex 6, complex 7 and reference complex 3 obtained by the above preparation, respectively.

[0274] For each siRNA complex, 2A1 to 2A11 solutions were prepared, each of which contained 1 μL of the 11 concentrations of siRNA dilution standard solution, 0.05 μL of detection plasmid dilution standard solution (containing 10 ng of detection plasmid), and 10 μL of Opti-MEM medium, in that order.

[0275] Prepare 2B solution: 1 part 2B solution contains 0.2 µL Lipofectamine TM 2000 and 10 μL of Opti-MEM medium.

[0276] A 2C solution is prepared, with one part of the 2C solution containing 0.05 μL of detection plasmid working solution (containing 10 ng of detection plasmid) and 10 μL of Opti-MEM medium.

[0277] One part of each of the 2B solutions was mixed with one part of each of the 2A1 to 2A11 solutions of the obtained siRNA complexes, and each was incubated at room temperature for 20 minutes to obtain 2X1 to 2X11 solutions of transfection complexes of each siRNA complex.

[0278] One part of solution 2B was mixed with one part of solution 2C and incubated at room temperature for 20 min to obtain blank transfection complex 2X12.

[0279] The transfection complexes 2X1 to 2X11 of each siRNA complex were added to the culture wells in an amount of 20 μL / well and mixed uniformly to obtain transfection complexes with final concentrations of each siRNA complex of about 0.01 μM, 0.0033 μM, 0.0011 μM, 0.00037 μM, 0.000123 μM, 0.0000412 μM, 0.0000137 μM, 0.00000457 μM, 0.00000152 μM, 0.000000508 μM and 0.000000169 μM (as the amount of siRNA in the siRNA complex). The transfection complexes 2X1 to 2X11 of each siRNA complex were transfected into three culture wells, respectively, to obtain co-transfection mixtures containing the siRNA complexes, which were used as test groups.

[0280] For each siRNA complex, transfection complex 2X12 was added to the other three culture wells at an addition volume of 20 μL / well, respectively, to obtain a transfection mixture without siRNA complex, which served as a blank control group.

[0281] The co-transfection mixtures with and without siRNA complexes were transfected into the culture wells for 4 h, respectively, and then 100 μL of H-DMEM complete medium containing 20% ​​FBS was added to each well. The 96-well plate was placed in a CO2 incubator and cultured for 24 h.

[0282] [3] Detection The medium in the culture wells was aspirated, and 150 μL of Dual-Glo (registered trademark) Luciferase reagent and H-DMEM mixed solution (volume ratio 1:1) was added to each well, mixed thoroughly and uniformly, and incubated at room temperature for 10 min. Then, 120 μL of the mixed solution was transferred to a 96-well microplate, and the Firefly chemiluminescence value (Fir) in each culture well of the 96-well microplate was read using a Synergy II multifunction microplate reader (BioTek). Furthermore, 60 μL of Dual-Glo (registered trademark) Stop & Glo (registered trademark) reagent was added to each well of the 96-well microplate, mixed thoroughly and uniformly, and incubated at room temperature for 10 min. Then, the Renilla chemiluminescence value (Ren) in each culture well of the 96-well microplate was read using a microplate reader according to the order of reading Fir.

[0283] The emission ratio Ratio = Ren / Fir of each well of the 96-well microplate was calculated, and the emission ratio Ratio (test) or Ratio (control) of each test group or control group was the average value of the Ratio of three culture wells. The emission ratio of each test group was normalized based on the emission ratio of the control group, and the relative expression level of the Renilla reporter gene, that is, the ratio R of Ratio (test) / Ratio (control) to indicate the residual activity, was obtained. The inhibition rate of siRNA for the target sequence = (1-R) ​​× 100%.

[0284] Based on the relative residual activity of Renilla in HEK293A cells after transfection with different concentrations of the tested siRNAs, a log(inhibitor) vs. response-Variable slope (four parameters) dose-effect curve was fitted using the nonlinear regression analysis function of Graphpad 5.0 software.

[0285] Based on the function corresponding to the fitted dose-effect curve, the IC of the siRNA targeting the sequence of interest under test was calculated. 50 The value is calculated as follows:

[0286]

number

[0287] From the dose-effect curve and the corresponding function, X corresponding to Y=50% is 50 The IC value of each siRNA was determined. 50 Value=10^X 50 Calculate the IC (nM) 50 The values ​​are summarized in Table 5.

[0288] Table 5 IC of siRNA complexes in the pscheck system 50 [Table 9]

[0289] As can be seen from the results in Table 5, the siRNA complex of the present disclosure has extremely high target sequence suppression activity in the in vitro sicheck system, and IC 50 between 6.89 and 8.55 pM. It also has target sequence suppression activity close to that of reference complex 3, which is identical to the remaining sequence but does not contain stabilizing modified nucleotides.

[0290] Experimental Example 7: Inhibitory activity of siRNA complexes in in vitro sicheck system The off-target sequence suppression activity of complex 3 and complex 6 was tested in an in vitro sicheck system by the method of Experimental Example 6. Detection was performed using complex 3 or complex 6 instead of the siRNA complex to be tested, with the only difference being that for complex 6, the target sequence used was target sequence 2, or target sequences 3 to 5 shown below were used instead of target sequence 2, and for complex 3, the target sequence used was target sequence 2, or target sequences 6 to 8 shown below were used instead of target sequence 2.

[0291] Destination array 3: TAGGCCCCTTTCAAGTATTCT(SEQ ID NO: 165) Target sequence 4: AGAATACTGTCCCTTTTAAGC(SEQ ID NO: 166) Target sequence 5: CTCCGCAGTGAAATTTTAAGC(SEQ ID NO: 167) Target sequence 6: CTTTCACTGCGGATCAGTGCT(SEQ ID NO: 168) Target sequence 7: AGCACTGAGAATACTGTCCCT(SEQ ID NO: 169) Target sequence 8: CTACAGTCTCCGCCTGTCCCT(SEQ ID NO: 170)

[0292] Since the target sequence 2 contains a sequence that is completely complementary to the antisense strand of the siRNA in the complex 3 and the complex 6, the inhibitory effect of the complex 3 or 6 on the target sequence 2 can reflect the ApoC3 mRNA inhibitory activity of the complex 3 or 6, the target sequence 3 contains a sequence that is partially complementary to the antisense strand of the siRNA in the complex 6, the target sequence 4 contains a sequence that is completely complementary to the sense strand of the siRNA in the complex 6, and the target sequence 5 contains a sequence that is partially complementary to the sense strand of the siRNA in the complex 6, so that the inhibitory effect of the complex 6 on the target sequence 3, 4 or 5 can reflect the degree of off-target effect. That is, the higher the inhibitory effect, the higher the possibility that the complex 6 will cause off-target. Similarly, since target sequence 6 contains a sequence complementary to a portion of the antisense strand of the siRNA in complex 3, target sequence 7 contains a sequence completely complementary to the sense strand of the siRNA in complex 3, and target sequence 8 contains a sequence complementary to a portion of the sense strand of the siRNA in complex 3, the inhibitory effect of complex 3 on target sequence 6, target sequence 7, or target sequence 8 can reflect the degree of off-target effect. That is, the higher the inhibitory effect, the higher the possibility that complex 3 will cause off-target effects.

[0293] As a result, in the in vitro sicheck system, the inhibitory IC 50 The IC value of the complex 3 for the target sequence 2 was 11.3 pM, and the inhibition rate for the target sequence 3, 4, or 5 was less than 50% in the entire range of siRNA concentrations tested, i.e., no off-target was generated in any of the siRNAs. 50 The inhibition rate for target sequences 6, 7, and 8 was less than 50% within the entire range of siRNA concentrations tested, that is, no off-target activity occurred.

[0294] As can be seen from the above, in the in vitro sicheck system, the siRNA complex of the present disclosure exhibited excellent on-target target sequence suppression activity and IC 50The values ​​range from 4.50 pM to 11.3 pM, and the siRNA complexes of the present disclosure have low off-target effects.

[0295] Experimental Example 8: Inhibitory activity of siRNA complexes in in vitro sicheck system The inhibitory activity of complex 5 in the in vitro sicheck system was tested according to the method of Experimental Example 6, except that complex 5 was used instead of the siRNA complex tested. As a result, complex 5 showed high inhibitory activity against the target sequence in the in vitro sicheck system, and IC 50 is 49.8 pM.

[0296] Experimental Example 9: Lipid-lowering effect of siRNA complexes in vivo in mice Human APOC3 transgenic mice Tg(APOC3)3707Bres (purchased from Jackson Laboratory, USA) with serum TG content >2mmol / L were randomly divided into groups, with 6 mice per group, and half of each sex. Mice in each group were administered with complex 6, reference complex 3, and PBS blank control, respectively. All animals were administered with a single dose by subcutaneous injection, with the dose (as the amount of siRNA) of each siRNA complex being 3mg / kg mouse body weight, and the administration volume being 5ml / kg. Each siRNA complex was provided in a PBS aqueous solution, and the concentration of the complex to be prepared was calculated based on the dose and administration volume. Another group of mice was administered with 1xPBS at a dose volume of 5ml / kg, which served as the blank control group.

[0297] The administration time was set to day 1, and 100 μL of blood was collected from the orbital venous plexus of the mice on days 1, 9, and 15. After blood collection, the blood was left at room temperature for 30 min, and then centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. In addition, the total cholesterol (CHO) and triglyceride (TG) contents in the serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy).

[0298] Standardized lipid level = (lipid content in test group after drug administration / lipid content in test group before drug administration) x 100%.

[0299] Inhibition rate of lipid level = (1 - lipid content in the test group after drug administration / lipid content in the test group before drug administration) x 100%.

[0300] Lipid refers to total cholesterol (CHO) or triglycerides (TG).

[0301] Figures 3A and 3B are line graphs showing the time course of serum TG levels or serum CHO levels after administration of the siRNA complex of the present disclosure, the reference siRNA complex, or PBS, respectively. Furthermore, the serum TG suppression rate and serum CHO suppression rate at each time point are summarized in Tables 6A and 6B below.

[0302] Table 6A Serum TG suppression rate of siRNA complex in transgenic mice [Table 10]

[0303] Table 6B Serum CHO suppression rate of siRNA complexes in transgenic mice [Table 11]

[0304] As can be seen from the results in Figures 3A, 3B and Tables 6A and 6B, at different time points after administration, Complex 6 could obviously reduce TG and CHO levels in mouse serum, and showed a lipid level lowering effect of 11% or less compared with the reference Complex 3 not containing the corresponding stabilizing modified nucleotide.

[0305] Experimental Example 10: Lipid-lowering effect of siRNA complexes in vivo in mice The lipid-lowering effect of the complex 7 of the present disclosure in vivo in mice was investigated by the method of Experimental Example 9. The only difference was that the mice in each group were administered with complex 7, reference complex 3, and PBS blank control, respectively. The dosage was calculated according to body weight for all animals, and administered once by subcutaneous injection, with the dosage of each siRNA complex (as the amount of siRNA) being 3 mg / kg and 1 mg / kg mouse body weight, and the administration volume being 5 ml / kg. The administration time was set to the 1st day, and blood was collected from the orbital venous plexus of the mice on the 1st, 9th, 15th, 22nd, 29th, 36th, and 50th days, respectively.

[0306] Figures 4A and 4B are line graphs showing the time course of serum TG levels or serum CHO levels after administration of the siRNA complex of the present disclosure, the reference siRNA complex, or PBS, respectively. Furthermore, the serum TG suppression rate and serum CHO suppression rate at each time point are summarized in Tables 7A and 7B below.

[0307] Table 7A Serum TG suppression rate of siRNA complex in transgenic mice [Table 12]

[0308] Table 7B Serum CHO suppression rate of siRNA complexes in transgenic mice [Table 13]

[0309] As can be seen from the results in Figures 4A, 4B and Tables 7A and 7B, at different time points after administration, complex 7 can obviously reduce TG and CHO levels in mouse serum, and compared with the reference complex 3 that does not contain the corresponding stabilized modified nucleotide, it showed the same or better lipid level lowering effect. In particular, at a dose of 3 mg / kg, complex 7 consistently showed a very high lipid TG lowering effect within the entire administration time up to 50 days, and the maximum inhibition rate can reach 90.2%.

[0310] Experimental Example 11: Lipid-lowering effect of siRNA complexes in vivo in mice The lipid-lowering effect of the siRNA complex in vivo in mice was detected by the method of Experimental Example 9, except that the siRNA complex used was Complex 3 or Complex 4. The results are shown in Figures 9A and 9B.

[0311] 9A and 9B are line graphs showing the time course of serum TG levels or serum CHO levels after administration of the siRNA complex of the present disclosure or PBS, respectively. Furthermore, the serum TG suppression rate and serum CHO suppression rate at each time point are summarized in Tables 8A and 8B below.

[0312] Table 8A Serum TG suppression rate of siRNA complex in transgenic mice [Table 14]

[0313] Table 8B Serum CHO suppression rate of siRNA complexes in transgenic mice [Table 15]

[0314] As can be seen from the results in Figures 5A, 5B and Tables 8A and 8B, at different time points after administration, complex 3 and complex 4 can obviously reduce TG and CHO levels in mouse serum. In particular, at doses of 3 mg / kg and 1 mg / kg, complex 4 consistently exhibits a very high lipid TG lowering effect within the entire administration period up to 50 days, and the maximum inhibition rate can reach 92.0%.

[0315] Experimental Example 12: Reducing effect of siRNA complexes on lipids in vivo in mice The lipid-lowering effect of the siRNA complex in vivo in mice was detected by the method of Experimental Example 9, except that the siRNA complex used was complex 3, the dosage (as the amount of siRNA) of each siRNA complex was 9 mg / kg, 3 mg / kg, 1 mg / kg, 0.5 mg / kg, 0.25 mg / kg, 0.1 mg / kg, or 0.05 mg / kg of mouse body weight, and the administration volume was 5 ml / kg. Each siRNA complex was provided in a PBS aqueous solution, and the concentration of the complex to be prepared was calculated based on the dosage and administration volume. The administration time was set to the first day, and blood was collected from the orbital venous plexus of the mouse on the first, eighth, fifteenth, twenty-second, twenty-ninth, thirty-sixth, forty-third, fifty-seventh, and sixty-fourth days to detect the TG level in serum. The results are shown in FIG. 6.

[0316] 6 is a line graph showing the time course of serum TG levels after administration of different concentrations of Complex 3 or PBS. Furthermore, the serum TG suppression rate at each time point is summarized in Table 9 below.

[0317] Table 9. Serum TG suppression rate of siRNA complex in transgenic mice [Table 16]

[0318] As can be seen from the results in Figure 6 and Table 9, at different time points after administration, different concentrations of complex 3 could all reduce the TG levels in mouse serum. In particular, after a single administration at a dose of 9 mg / kg, the siRNA complex of the present disclosure could consistently maintain a TG level inhibition rate of more than 50% for a long period of 64 days, and the inhibition rate could reach a maximum of 89.5%, demonstrating excellent lipid inhibition ability.

[0319] Experimental Example 13 Lipid-lowering effect of siRNA complex in vivo in mice Human APOC3 transgenic mice Tg(APOC3)3707Bres (purchased from Jackson Laboratory, USA) with serum TG content >2mmol / L were randomly divided into groups, with 8 mice per group, and half of each sex. Mice in each group were administered with Complex 3, Complex 5, and PBS blank control, respectively. All animals were administered with a single dose by subcutaneous injection, with the dose (as the amount of siRNA) of each siRNA complex being 3mg / kg and 1mg / kg mouse body weight, and the administration volume being 5ml / kg. Each siRNA complex was provided in a PBS aqueous solution, and the concentration of the complex to be prepared was calculated based on the dose and administration volume. Another group of mice was administered with 1xPBS, with a dose volume of 5ml / kg, and served as the blank control group.

[0320] The administration time was set to day 1, and 100 μL of blood was collected from the orbital venous plexus of the mice on days 1, 8, 15, 22, 29, 36, and 43. After blood collection, the blood was left at room temperature for 30 minutes, and then centrifuged at 4°C and 3000 rpm for 15 minutes to obtain serum. In addition, the total cholesterol (CHO) and triglyceride (TG) contents in the serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy).

[0321] Standardized lipid level = (lipid content in test group after drug administration / lipid content in test group before drug administration) x 100%.

[0322] Inhibition rate of lipid level = (1 - lipid content in the test group after drug administration / lipid content in the test group before drug administration) x 100%.

[0323] Lipid refers to total cholesterol (CHO) or triglycerides (TG).

[0324] 7A and 7B are line graphs showing the time course of serum TG levels or serum CHO levels after administration of the siRNA complex of the present disclosure or PBS, respectively. Furthermore, the mouse serum TG suppression rate and serum CHO suppression rate at each time point after administration of the siRNA complex of the present disclosure are summarized in the following Tables 10A and 10B.

[0325] Table 10A Serum TG suppression rate of siRNA complex in transgenic mice [Table 17]

[0326] Table 10B Serum CHO suppression rate of siRNA complexes in transgenic mice [Table 18]

[0327] As can be seen from the analysis of the results of Figures 7A, 7B and Tables 10A and 10B, at different time points after administration, complex 3 and complex 5 can obviously reduce the TG and CHO levels in mouse serum. In addition, the inhibitory effect was consistently high within the 43-day experimental period. In particular, complex 3 and complex 5 at a dose of 3 mg / kg both showed excellent lipid inhibitory effect in mice, with the maximum inhibitory rate of serum TG being higher than 88% and the maximum inhibitory rate of serum CHO being 51.18% and 57.41%, respectively. As can be seen from the above results, the siRNA complex of the present disclosure can effectively reduce lipid levels within a long period of time, showing good development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0328] Experimental Example 14: Reducing effect of siRNA complexes on lipids in vivo in mice Human APOC3 transgenic mice Tg(APOC3)3707Bres (purchased from Jackson Laboratory, USA) with serum TG content >2mmol / L were randomly divided into groups, with 6 mice per group, and half of each sex. Each group was administered with Complex 1, Complex 2, Reference Complex 1, and PBS blank control, respectively. All animals were administered with a single dose by subcutaneous injection, with the dosage (as the amount of siRNA) of each siRNA complex being 3mg / kg and 1mg / kg mouse body weight, and the administration volume being 5ml / kg. Each siRNA complex was provided in a PBS aqueous solution, and the concentration of the complex to be prepared was calculated based on the dosage and administration volume. Another group of mice was administered with 1xPBS at a dosage volume of 5ml / kg, which served as the blank control group.

[0329] The administration time was set to day 1, and 100 μL of blood was collected from the orbital venous plexus of the mice on days 1, 8, 15, and 22. After blood collection, the blood was left at room temperature for 30 min, and then centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. In addition, the total cholesterol (CHO) and triglyceride (TG) contents in the serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy).

[0330] Standardized lipid level = (lipid content in test group after drug administration / lipid content in test group before drug administration) x 100%.

[0331] Inhibition rate of lipid level = (1 - lipid content in the test group after drug administration / lipid content in the test group before drug administration) x 100%.

[0332] Lipid refers to total cholesterol (CHO) or triglycerides (TG).

[0333] Figures 8A and 8B are line graphs showing the time course of serum TG levels or serum CHO levels after administration of the siRNA complex of the present disclosure, the reference siRNA complex, or PBS, respectively. Furthermore, the mouse serum TG suppression rate and serum CHO suppression rate at each time point after administration of the siRNA complex of the present disclosure are summarized in Tables 11A and 11B below.

[0334] Table 11A Serum TG suppression rate of siRNA complex in transgenic mice [Table 19]

[0335] Table 11B Serum CHO suppression rate of siRNA complexes in transgenic mice [Table 20]

[0336] As can be seen from the results of Figures 8A, 8B and Tables 11A and 11B, at different time points after administration, Complex 1 and Complex 2 can obviously reduce TG and CHO levels in mouse serum, and within the 22-day experimental period, they maintained a consistently high inhibitory effect and showed a lipid level-reducing effect close to that of the reference Complex 1 that does not contain the corresponding stabilizing modified nucleotide.

[0337] In particular, complex 1 and complex 2 at a dose of 3 mg / kg both showed excellent lipid suppression effects in mice, with the maximum serum TG suppression rates both being higher than 92%, and the maximum serum CHO suppression rates being 57.5% and 54.9%, respectively. As is evident from the above results, the siRNA complex of the present disclosure can effectively reduce lipid levels within a long period of time, and shows excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0338] Experimental Example 15: Measurement of double-stranded thermal dissociation temperature Tm Using 1XPBS buffer, the above-prepared siRNA1-siRNA7 and reference siRNA1-reference siRNA7 were each prepared into a 0.02 mg / mL solution, which was used as the test solution. The test solution was added to a quartz cuvette with a 10 mm path length in an Agilent cary300 UV spectrophotometer with a stored heating program, and the temperature-absorbance curve was monitored at a wavelength of 260 nm, with a heating rate of 0.5°C / min, and the temperature was raised from 20.0°C to 95°C. The double-stranded thermal dissociation temperature Tm was calculated from the first derivative of the temperature-absorbance curve based on the spectrophotometer's instructions. The Tm value results are shown in Table 12 below.

[0339] Table 12 Double-stranded thermal dissociation temperature Tm [Table 21]

[0340] Reference siRNA1 to Reference siRNA7 have the same base sequence as siRNA1 to siRNA7, respectively, but are siRNAs that do not have any modified nucleotides at the positions where stabilizing modified nucleotides are present in siRNA1 to siRNA7.

[0341] ΔTm value (test siRNA) = Tm (siRNA) - Tm (reference siRNA).

[0342] As can be seen from the results in Table 12, compared to when the same position is an unmodified nucleotide, the double-stranded oligonucleotides and their complexes containing the stabilizing modified nucleotides of the present disclosure have higher double-stranded thermal dissociation temperatures, with the double-stranded thermal dissociation temperature increased by at least 1.33°C, of ​​which the highest increase was in siRNA1, which increased by 2.91°C compared to the reference siRNA.

[0343] Although several embodiments of the present disclosure have been described in detail above, the present disclosure is not limited to the specific details of the above embodiments, and within the scope of the technical idea of ​​the present disclosure, several simple modifications may be made to the technical solutions of the present disclosure, and all of these simple modifications fall within the protection scope of the present disclosure.

[0344] It should be noted that the specific technical features described in the above embodiments may be combined in any suitable manner if not contradictory, and in order to avoid unnecessary duplication, the present disclosure does not separately describe all possible combination manners.

[0345] Furthermore, the various embodiments of the present disclosure can be combined in any manner and should be considered as being disclosed in the present disclosure unless they deviate from the spirit of the present disclosure.

Claims

**Claim 1** An siRNA comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, both the nucleotide sequence I and the nucleotide sequence II consist of 19 nucleotides, each nucleotide in the nucleotide sequence I and the nucleotide sequence II is a modified or unmodified nucleotide, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region at least partially in reverse complementarity, the nucleotide sequence II is at least partially reverse complementary to a first nucleotide sequence, the first nucleotide sequence is a nucleotide sequence of 19 nucleotides in the mRNA expressed by the apolipoprotein C3 gene, and at least one of the nucleotides at positions 3 to 6 of the nucleotide sequence II is a stabilized modified nucleotide when going from the 5'-end to the 3'-end. The stabilized modified nucleotide refers to a nucleotide in which the hydroxy group at the 2'-position of the ribose of the nucleotide is substituted with a stabilized modifying group. Compared with an siRNA in which the corresponding position nucleotide is an unmodified nucleotide, the siRNA containing the stabilized modified nucleotide has increased thermal stability and the steric hindrance of the stabilized modifying group is larger than that of 2'-O-methyl. **Claim 2** When going from the 5'-end to the 3'-end, the nucleotide at the 3rd or 5th position in the nucleotide sequence II is the stabilized modified nucleotide, or When going from the 5'-end to the 3'-end, no more than 2 nucleotides among the nucleotides at positions 3 to 9 in the nucleotide sequence II are the stabilized modified nucleotides. The siRNA according to claim 1. **Claim 3** The increase in the thermal stability of the siRNA means that the Tm of the siRNA increases. Tm is the double-stranded thermal dissociation temperature of the siRNA, or The increase in the thermal stability of the siRNA means that the Tm of the siRNA increases by at least 0.05 °C, or The increase in the thermal stability of the siRNA means that the Tm of the siRNA increases by 0.1 to 6 °C, or The increase in the thermal stability of the siRNA means that the Tm of the siRNA increases by 0.5 to 4 °C. The siRNA according to claim 1. **Claim 4** Each of the stabilizing modifying groups independently has a structure represented by -X-R, where X is O, NR', S, or SiR' 2 and R is C 2 -C 6 alkyl, substituted C 2 -C 6 alkyl, C 6 -C 8 aryl, substituted C 6 -C 8 aryl, and each R' is independently H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 6 -C 8 aryl, substituted C 6 -C 8 aryl, and the substituted C 2 -C 6 alkyl, substituted C 6 -C 8 aryl, or substituted C 1 -C 6 alkyl refers to a group in which one or more hydrogen atoms in C 2 -C 6 alkyl, C 6 -C 8 aryl, or C 1 -C 6 alkyl are substituted by substituents, and the substituents are C 1 -C 3 alkyl, C 6 -C 8 aryl, C 1 -C 3 alkoxy, halogen, oxy subunit, and sulfide subunit, and are one or more selected therefrom, or Each of the stabilization modifying groups is one independently selected from 2'-O-methoxyethyl, 2'-O-allyl, 2'-C-allyl, 2'-O-2-N-methylamino-2-oxyylideneethyl, 2'-O-2-N,N-dimethylaminoethyl, 2'-O-3-aminopropyl, and 2'-O-2,4-dinitrophenyl, or The siRNA according to claim 1, wherein each of the stabilization modifying groups is 2'-O-methoxyethyl. **Claim 5** The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1 have the same length and three or fewer nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 have the same length and three or fewer nucleotide differences. 5'-CAAUAAAGCUGGACAAGAZ 1 -3' (SEQ ID NO: 1), 5'-Z 2 UCUUGUCCAGCUUUAUUG-3' (SEQ ID NO: 2), However, Z 1 is A, and Z 2 is U. In the nucleotide sequence I, the nucleotide Z 1 corresponding to the position Z 3 is included. In the nucleotide sequence II, the nucleotide Z 2 corresponding to the position Z 4 is included. The said Z 4 is the first nucleotide at the 5'-end of the antisense strand. Alternatively, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 45 have the same length and three or fewer nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 46 have the same length and three or fewer nucleotide differences. 5'-UUAAAAGGGA CAGUAUUCZ 5 -3' (SEQ ID NO: 45), 5'-Z 6 GAAUACUGUCCCUUUUAA-3' (SEQ ID NO: 46), However, Z 5 is U, and Z 6 is A. In the nucleotide sequence I, the nucleotide Z 5 corresponding to the position Z 7 is included. In the nucleotide sequence II, the nucleotide Z 6 corresponding to the position Z 8 is included. The said Z 8 is the first nucleotide at the 5'-end of the antisense strand. Alternatively, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 105 have the same length and three or fewer nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 106 have the same length and three or fewer nucleotide differences. 5'-GGACAGU AUUCUCAGUGC Z 9 -3' (SEQ ID NO: 105), 5'-Z 10 GCACUGAGAAUACUGUCC-3' (SEQ ID NO: 106), However, Z 9 is U, and Z 10 is A. In the nucleotide sequence I, a nucleotide Z 9 corresponding to the position Z 11 is included. In the nucleotide sequence II, a nucleotide Z 10 corresponding to the position Z 12 is included. The Z 8 is the first nucleotide at the 5'-end of the antisense strand. The siRNA according to claim 1. **Claim 6** The nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 includes a difference at the position of Z 4 and Z 4 is selected from A, G or C, Alternatively, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 46 includes a difference in the position of Z 8 and Z 8 is selected from G, C or U, Alternatively, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 106 includes a difference at the position of Z 12 and Z 12 is selected from G, C or U, and the siRNA according to claim 5. **Claim 7** The nucleotide sequence II and the first nucleotide sequence are substantially reverse complementary, substantially reverse complementary or completely reverse complementary. The term "substantially reverse complementary" means that there are three or fewer base mismatches between the two nucleotide sequences. The term "substantially reverse complementary" means that there is one or fewer base mismatches between the two nucleotide sequences. The term "completely reverse complementary" means that there are no mismatches between the two nucleotide sequences. Or The siRNA according to claim 1, wherein, from the 5'-end to the 3'-end, the nucleotides at positions 2 to 19 of the nucleotide sequence II and the nucleotides at positions 1 to 18 of the first nucleotide sequence are completely reverse complementary. **Claim 8** The sense strand and the antisense strand may have the same or different lengths. The length of the sense strand is 19 to 23 nucleotides, and the length of the antisense strand is 19 to 26 nucleotides. The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

4. 5'-CAAUAAAGCUGGACAAGAZ 3 -3' (SEQ ID NO: 3), 5'-Z 4 UCUUGUCCAGCUUUAUUG-3' (SEQ ID NO: 4), However, Z 3 is selected from A, U, G, or C, and Z 4 is a nucleotide complementary to Z 3 and Alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 47, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

48. 5'-UUAAAAGGGA CAGUAUUCZ 7 -3' (SEQ ID NO: 47), 5'-Z 8 GAAUACUGUCCCUUUUAA-3' (SEQ ID NO: 48), However, Z 7 is selected from A, U, G, or C, and Z 8 is a nucleotide complementary to Z 7 and Alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 107, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

108. 5'-GGACAGUAUUCUCAGUGCZ 11 -3' (SEQ ID NO: 107), 5'-Z 12 GCACUGAGAAUACUGUCC-3' (SEQ ID NO: 108), However, Z 11 is selected from A, U, G or C, and Z 12 is a nucleotide complementary to Z 11 or Z3 is A, Z4 is U, or Z7 is U, Z8 is A, or Z11 is U, Z12 is A. The siRNA according to claim 1.

9. When the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are not the stabilized modified nucleotides from the 5'-end to the 3'-end, they are 2'-fluoro modified nucleotides, or The nucleotides at positions 7 to 9 of the nucleotide sequence I are 2'-fluoro modified nucleotides from the 5'-end to the 3'-end. The siRNA according to claim 1.

10. The sense strand further includes nucleotide sequence III, the antisense strand further includes nucleotide sequence IV, each nucleotide of the nucleotide sequence III and the nucleotide sequence IV is independently one of the non-fluorinated modified nucleotides and is not the stabilization modification, the length of the nucleotide sequence III is 1, 2, 3, or 4 nucleotides, the nucleotide sequence IV and the nucleotide sequence III have the same length and are substantially reverse complementary or completely reverse complementary, the nucleotide sequence III is bound to the 5'-end of the nucleotide sequence I, the nucleotide sequence IV is bound to the 3'-end of the nucleotide sequence II, and the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to a second nucleotide sequence, where the second nucleotide sequence refers to a nucleotide sequence adjacent to the first nucleotide sequence and having the same length as the nucleotide sequence IV in the mRNA expressed by the APOC3 gene, or the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1 have the same length and have 3 or fewer nucleotide differences, the lengths of both the nucleotide sequences III and IV are 1 nucleotide, the base of the nucleotide sequence III is C, the base of the nucleotide sequence IV is G, or the lengths of both the nucleotide sequences III and IV are 2 nucleotides, the base composition of the nucleotide sequence III is CC, the base composition of the nucleotide sequence IV is GG, or the lengths of the nucleotide sequences III and IV are both 3 nucleotides, the base composition of the nucleotide sequence III is UCC, the base composition of the nucleotide IV is GGA, or the lengths of the nucleotide sequences III and IV are both 4 nucleotides, the base composition of the nucleotide sequence III is CACC, the base composition of the nucleotide IV is GGAG, or The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 45 have the same length and three or fewer nucleotide differences. The nucleotide sequences III and IV both have a length of one nucleotide. The base of the nucleotide sequence III is C, and the base of the nucleotide sequence IV is G. Or, the nucleotide sequences III and IV both have a length of two nucleotides. The base composition of the nucleotide sequence III is GC, and the base composition of the nucleotide sequence IV is GC. Or, the lengths of the nucleotide sequences III and IV are both three nucleotides. The base composition of the nucleotide sequence III is UGC, and the base composition of the nucleotide sequence IV is GCA. Or, the nucleotide sequences III and IV both have a length of four nucleotides. The base composition of the nucleotide sequence III is UUGC, and the base composition of the nucleotide sequence IV is GCAA. Or The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 105 have the same length and three or fewer nucleotide differences. The nucleotide sequences III and IV both have a length of one nucleotide. The base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C. Or, the nucleotide sequences III and IV both have a length of two nucleotides. The base composition of the nucleotide sequence III is AG, and the base composition of the nucleotide sequence IV is CU. Or, the lengths of the nucleotide sequences III and IV are both three nucleotides. The base composition of the nucleotide sequence III is AAG, and the base composition of the nucleotide sequence IV is CUU. Or, the nucleotide sequences III and IV both have a length of four nucleotides. The base composition of the nucleotide sequence III is AAAG, and the base composition of the nucleotide sequence IV is CUUU. The siRNA according to claim 1 **Claim 11** The siRNA further includes an oligonucleotide sequence V, each nucleotide of the oligonucleotide sequence V is independently one of the non-fluorinated modified nucleotides and is not the stabilized modified nucleotide, the nucleotide sequence V has a length of 1 to 3 nucleotides, is bound to the 3'-end of the antisense strand, constitutes the 3'-overhang end of the antisense strand, or the nucleotide sequence V has a length of 2 nucleotides, and from the 5'-end to the 3'-end, the nucleotide sequence V is two consecutive thymidine deoxyribonucleotides, two consecutive uracil ribonucleotides, or is completely reverse complementary to a third nucleotide sequence, the third nucleotide sequence refers to a nucleotide sequence that is adjacent to the first nucleotide sequence or the second nucleotide sequence in the mRNA expressed by the APOC3 gene and has the same length as the nucleotide sequence V. The siRNA according to claim 1. **Claim 12** The sense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 5, and the antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 6, 5'-CAAUAAAGCUGGACAAGAZ 3 -3' (SEQ ID NO: 5), 5'-Z 4 UCUUGUCCAGCUUUAUUGGG-3' (SEQ ID NO: 6), However, the above Z 4 is the first nucleotide at the 5'-end of the antisense strand, and Z 3 is selected from A, U, G, or C, and Z 4 is the nucleotide complementary to Z 3 and or, the sense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 8, 5'-CCCAATAAAGCUGGACAAGAZ 3 -3' (SEQ ID NO: 7), 5'-Z 4 UCUUGUCCAGCUUUAUUGGGA G-3' (SEQ ID NO: 8), However, the above Z 4 is the first nucleotide at the 5'-end of the antisense strand, and Z 3 is selected from A, U, G or C, and Z 4 is the nucleotide complementary to Z 3 and or, the sense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 49, and the antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 50, 5'-UUAAAAGGGA CAGUAUUCZ 7 -3' (SEQ ID NO: 49), 5'-Z 8 GAAUACUGUCCCUUUUAAGC-3' (SEQ ID NO: 50), However, the above Z 8 is the first nucleotide at the 5'-end of the antisense strand, and Z 7 is selected from A, U, G or C, and Z 8 is Z 7 is a nucleotide complementary to or, the sense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 51, and the antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 52, 5'-GCU UAAAAGGGACAGUAUUCZ 7 -3' (SEQ ID NO: 51), 5'-Z 8 GAAUACUGUCCCUUUUAAGCAA-3' (SEQ ID NO: 52), However, the above Z 8 is the first nucleotide at the 5'-end of the antisense strand, and Z 7 is selected from A, U, G, or C, and Z 8 is, and Z 7 is a nucleotide complementary to Z or, the sense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 49, and the antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 149, 5'-UUAAAAGGGA CAGUAUUCZ 7 -3' (SEQ ID NO: 49), 5'-Z 8 GAAUACUGUCCCCUUUUAAUU-3' (SEQ ID NO: 149), However, the above Z 8 is the first nucleotide at the 5'-end of the antisense strand, and Z 7 is selected from A, U, G, or C, and Z 8 is Z 7 and is a nucleotide complementary to or, the sense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 51, and the antisense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 150, 5'-GCU UAAAAGGGACAGUAUUCZ 7 -3' (SEQ ID NO: 51), 5'-Z 8 GAAUACUGUCCCUUUUAAGCUU-3' (SEQ ID NO: 150), However, the above Z 8 is the first nucleotide at the 5'-end of the antisense strand, and Z 7 is selected from A, U, G, or C, and Z 8 is the nucleotide complementary to Z 7 and Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 109, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 110, 5'-GGACAGUAUUCUCAGUGCZ 11 -3' (SEQ ID NO: 109), 5'-Z 12 GCACUGAGAAUACUGUCCCCU-3' (SEQ ID NO: 110), However, the above Z 12 is the first nucleotide at the 5'-end of the antisense strand, and Z 11 is selected from A, U, G, or C, and Z 12 is Z 11 and is a nucleotide complementary to Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 111, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 112, 5'-AGGGACAGU AUUCUCAGUGC Z 11 -3' (SEQ ID NO: 111), 5'-Z 12 GCACUGAGAAUACUGUCCCCUUU-3' (SEQ ID NO: 112), However, the above Z 12 is the first nucleotide at the 5'-end of the antisense strand, and Z 11 is selected from A, U, G, or C, and Z 12 is the nucleotide complementary to Z 11 The siRNA according to claim 1, which is a nucleotide. [

13. ] Each non-fluoro-modified nucleotide is a methoxy-modified nucleotide, and the methoxy-modified nucleotide refers to a nucleotide in which the 2'-hydroxy of ribose is substituted with methoxy, or The siRNA is one of siAPOC3a1-M1, siAPOC3a1-M2, siAPOC3a2-M1, siAPOC3a2-M2, siAPOC3b1-M1, siAPOC3b1-M2, siAPOC3b2-M1, siAPOC3b2-M2, siAPOC3b3-M1, siAPOC3b3-M2, siAPOC3b4-M1, siAPOC3b4-M2, siAPOC3c1-M1, siAPOC3c1-M2, siAPOC3c2-M1, and siAPOC3c2-M2, the siRNA according to claim 1. [

14. ] At least one of the phosphate esters in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand is a phosphate ester having a modifying group, and the phosphate ester having a modifying group is between the first nucleotide and the second nucleotide at the 5'-terminal end of the sense strand, between the second nucleotide and the third nucleotide at the 5'-terminal end of the sense strand, between the first nucleotide and the second nucleotide at the 3'-terminal end of the sense strand, between the second nucleotide and the third nucleotide at the 3'-terminal end of the sense strand, between the first nucleotide and the second nucleotide at the 5'-terminal end of the antisense strand, between the second nucleotide and the third nucleotide at the 5'-terminal end of the antisense strand, present in at least one selected from the group consisting of between the first nucleotide and the second nucleotide at the 3'-terminal end of the antisense strand and between the second nucleotide and the third nucleotide at the 3'-terminal end of the antisense strand, or The siRNA according to claim 1 is one of siAPOC3a1-M1S, siAPOC3a1-M2S, siAPOC3a2-M1S, siAPOC3a2-M2S, siAPOC3b1-M1S, siAPOC3b1-M2S, siAPOC3b2-M1S, siAPOC3b2-M2S, siAPOC3b3-M1S, siAPOC3b3-M2S, siAPOC3b4-M1S, siAPOC3b4-M2S, siAPOC3c1-M1S, siAPOC3c1-M2S, siAPOC3c2-M1S and siAPOC3c2-M2S.

15. The nucleotide at the 5'-end of the antisense strand is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide, or The siRNA according to claim 1 is one of siAPOC3a1-M1P1, siAPOC3a1-M2P1, siAPOC3a2-M1P1, siAPOC3a2-M2P1, siAPOC3a1-M1SP1, siAPOC3a1-M2SP1, siAPOC3a2-M1SP1, siAPOC3a2-M2SP1, siAPOC3b1-M1P1, siAPOC3b1-M2P1, siAPOC3b2-M1P1, siAPOC3b2-M2P1, siAPOC3b1-M1SP1, siAPOC3b1-M2SP1, siAPOC3b2-M1SP1, siAPOC3b2-M2SP1, siAPOC3b3-M1P1, siAPOC3b3-M2P1, siAPOC3b4-M1P1, siAPOC3b4-M2P1, siAPOC3b3-M1SP1, siAPOC3b3-M2SP1, siAPOC3b4-M1SP1, siAPOC3b4-M2SP1, siAPOC3c1-M1P1, siAPOC3c1-M2P1, siAPOC3c2-M1P1, siAPOC3c2-M2P1, siAPOC3c1-M1SP1, siAPOC3c1-M2SP1, siAPOC3c2-M1SP1, and siAPOC3c2-M2SP1.

16. A pharmaceutical composition comprising the siRNA according to claim 1 and a pharmaceutically acceptable carrier.

17. An siRNA complex comprising the siRNA according to claim 1 and a complexing group complexed and bound thereto, wherein the complexing group comprises a linker and a pharmaceutically acceptable targeting group, and the siRNA, the linker, and the targeting group are covalently or non-covalently bound in sequence, and each said targeting group is selected from ligands capable of binding to cell surface receptors.

18. Use of the siRNA according to claim 1, and / or its pharmaceutical composition, and / or its siRNA complex, in the preparation of a drug for treating and / or preventing a disease or condition related to the mRNA level expressed by the APOC3 gene.

19. The use according to claim 18, wherein the disease or condition related to the mRNA level expressed by the APOC3 gene is dyslipidemia.

20. A method for suppressing the expression level of the APOC3 gene in a cell, the method comprising contacting an effective amount of the siRNA according to claim 1, and / or its pharmaceutical composition, and / or its siRNA complex, with the cell.