Beta-glucan for preventing and / or treating fibrosis and related diseases - Patent Application 20070233633

Abstract

The present invention provides beta-glucans, compositions comprising the beta-glucans, and methods of using the beta-glucans to prevent and / or treat fibrosis.

Description

[Technical field]

[0001] Related Applications This application claims the benefit of the filing date of Japanese Application No. 2021-103469, entitled "BETA-GLUCAN FOR PREVENTING AND / OR TREATING FIBROSIS AND RELATED DISEASES," filed on June 22, 2021, the contents of which are incorporated by reference in their entirety into this specification.

[0002] The present invention relates to beta-glucans for preventing and / or treating fibrosis and related diseases, compositions comprising said beta-glucans for preventing and / or treating fibrosis and related diseases, and methods of using the beta-glucans for preventing and / or treating fibrosis and related diseases.

[0003] The present invention also relates to the anti-fibrotic and anti-inflammatory efficacy of beta 1,3-1,6 biological response modified glucans from Aureobasidium pullulans AFO-202 and N-163 in the STAM mouse model of non-alcoholic steatohepatitis. [Background technology]

[0004] Introduction: Nonalcoholic fatty liver disease (NAFLD) refers to a group of diseases in which there is excess fat accumulation in the liver in people who drink little or no alcohol [A1]. Nonalcoholic steatohepatitis (NASH) is a severe form of NAFLD. If left untreated, NAFLD or NASH progresses to liver fibrosis, cirrhosis, liver failure, or cancer. The increasing prevalence of obesity and metabolic syndrome, diabetes, and lipid level imbalances all contribute to the problem of NAFLD and NASH. NAFLD and NASH are associated with pathological features such as fatty liver, lobular inflammation, hepatocyte ballooning, and liver fibrosis, ultimately leading to cirrhosis [A1, A2]. There is no clear treatment for NASH. Conventional approaches aim to address the underlying disease, such as diabetes and metabolic disease, with lifestyle changes, weight loss, specific drugs such as thiazolidinediones, lipid-lowering agents, cytoprotectants, and antioxidants such as vitamin E [A3]. Angiotensin receptor blockers (ARBs) such as telmisartan, which act by modulating the activity of the transcription factor peroxisome proliferator-activated receptor (PPAR)-γ [A4], thereby increasing insulin sensitivity, are increasingly being promoted. However, the underlying etiology and pathogenesis of the disease require a more systemic approach.

[0005] Beta-glucan is a potent biological response modifier that has proven effective in regulating imbalanced metabolism by adjusting blood glucose and lipid levels. 1,3-1,6 beta-glucan from Aureobasidium pullulans (black yeast) strain AFO-202 has been shown in human clinical studies to reduce HbA1c to normal levels and fasting and postprandial blood glucose levels [A5, A6]. This GMP manufactured beta-glucan has been shown in another human clinical study to regulate lipid levels of triglycerides, total cholesterol, and HDL cholesterol [A7]. Another variant of 1,3-1,6 beta-glucan is derived from a novel strain of Aureobasidium pullulans N-163 and has been shown to have a clear effect on lipid metabolism in in vitro studies (unpublished data). [Prior art documents] [Patent documents]

[0006] [Patent Document 1] KR100707917B1 [Non-patent literature]

[0007] [Non-Patent Document 1] Brockman DA, Chen X, Gallaher DD. Consumption of a high β-glucan barley flour improves glucose control and fatty liver and increases muscle acylcarnitines in the Zucker diabetic fatty rat. Eur J Nutr. 2013 Oct;52(7):1743-53. Summary of the Invention

[0008] The present invention relates to the following: 1. A composition for preventing and / or treating fibrosis comprising beta-glucan. 2. The composition of item 1, wherein the beta-glucan comprises beta-glucan produced by Aureobasidium pullulans N-163 (NITE BP-03377). 3. The composition of item 2, wherein the beta-glucan further comprises beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327). 4. The composition of item 1, wherein the beta-glucan consists of beta-glucan produced by Aureobasidium pullulans N-163 (NITE BP-03377) and beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327). 5. The composition of any one of items 1 to 4, which is used to prevent and / or treat nonalcoholic steatohepatitis (NASH). 6. A composition for improving intestinal microflora, comprising beta-glucan produced by Aureobasidium pullulans N-163 (NITE BP-03377). 7. The composition according to item 6, further comprising beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327). 8. The composition according to item 6 or 7, wherein the improvement of the intestinal microflora includes an increase in beneficial bacteria including Lactobacillus in the intestine along with a decrease in Akkermansia. 9. The composition according to any one of items 6 to 8, wherein the composition is for the preventive, ameliorative and / or curative treatment of cancer and / or fibrosis. 10. A composition for balancing amino acids to beneficial levels, including beta-glucan produced by Aureobasidium pullulans N-163 (NITE BP-03377). 11. The composition according to item 10, further comprising beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327). 12. The composition according to item 10, wherein the composition increases tryptophan and / or decreases isoleucine, leucine, and / or spermidine. 13. The composition according to item 11, wherein the composition increases ornithine and / or decreases tryptophan and / or phenylalanine. Effect of the Invention

[0009] In this study, we report the anti-fibrotic and anti-inflammatory effects of N-163-derived beta-glucan in a stereotyped animal model (STAM) that reproduces the pathological condition of NASH that occurs in humans. Based on our previous reports from clinical and preclinical studies in which biological response-modifying glucans produced by AFO-202 and N-163, alone or in combination, induced beneficial outcomes, we report herein on the gut microbiota and fecal metabolome in one of the most metabolically stressed animal models, the Stelic Animal Model (STAM). [Brief description of the drawings]

[0010] [Figure 1] The reduction in non-esterified fatty acids (NEFAs) was greater in the N-163 beta-glucan group compared to the control. [Diagram 2] The reduction in IL-8 was greater in the N-163 beta glucan group compared to the control. The IL8 levels after feeding N-163 were reduced compared to the control. The results show that SD rats fed beta glucan N-163 for 28 days showed a significant reduction in IL8 levels compared to the control group. [Diagram 3] The reduction of IL-6 from immature iPS-derived dendritic cells is greater in the N-163 beta glucan group compared to the control. [Figure 4] The reduction in IL-6 from mature iPS-derived dendritic cells is greater in the N-163 beta-glucan group compared to the control. [Diagram 5] The reduction in IL-8 from immature iPS-derived dendritic cells is greater in the N-163 beta glucan group compared to the control. [Figure 6] The reduction in non-esterified fatty acids (NEFA) was greater in the N-163 beta glucan group compared to the control and AFO-202 beta glucan. NEFA levels were reduced after feeding N-163 compared to AFO-202. This result shows that KK-Ay mice fed beta glucan N-163 for 28 days showed a significant reduction in NEFA levels when compared to the control and AFO-202 groups. NEFA is also called free fatty acid. [Figure 7] Schematic diagram of the clinical study of AFO-202 and the combination of AFO-202 and N-163. [Figure 8A] The decrease in ferritin was greater in AFO-202+N-163 (Gr.II) compared to AFO-202 (Gr.I). Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then discontinued. [Figure 8B] The decrease in ferritin was greater in AFO-202+N-163 (Gr.II) compared to AFO-202 (Gr.I). Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then discontinued. [Figure 8C] The decrease in ferritin was greater in AFO-202+N-163 (Gr.II) compared to AFO-202 (Gr.I). Subgroup B: subjects who took Nichiglucan AFO-202 and N-163 for 35 days. [Figure 9A] The reduction in total cholesterol is significantly more favorable in AFO-202+N-163 (Gr. II) than in AFO-202 (Gr. I). [Figure 9B] The reduction in total cholesterol is significantly more favorable in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then discontinued. [Figure 9C] The reduction in total cholesterol is significantly more favorable in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then discontinued. [Figure 9D] The reduction in total cholesterol is significantly more favorable in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup B: subjects who took Nichiglucan AFO-202 and N-163 for 35 days. [Figure 9E]The reduction in total cholesterol is significantly more favorable in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup B: subjects who took Nichiglucan AFO-202 and N-163 for 35 days. [Figure 10A] The reduction in LDL cholesterol is significantly more favorable in AFO-202+N-163 (Gr. II) than in AFO-202 (Gr. I). [Figure 10B] The reduction in LDL cholesterol is significantly more favorable in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then discontinued. [Figure 10C] The reduction in LDL cholesterol is significantly more favorable in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then discontinued. [Figure 10D] The reduction in LDL cholesterol is significantly more favorable in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup B: subjects who took Nichiglucan AFO-202 and N-163 for 35 days. [Figure 10E] The reduction in LDL cholesterol is significantly more favorable in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup B: subjects who took Nichiglucan AFO-202 and N-163 for 35 days. [Figure 11A] The decrease in galectin-3 was significantly greater in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then discontinued. [Figure 11B] The decrease in galectin-3 was significantly greater in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then discontinued. [Figure 11C] The reduction in galectin-3 was significantly greater in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I).Subgroup B: subjects who received Nichiglucan AFO-202 and N-163 for 35 days. [Figure 12A] The reduction in HbA1c was significantly greater in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I) in subgroup A. Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then stopped. Subgroup B: subjects who took Nichiglucan AFO-202 and N-163 for 35 days. [Figure 12B] The reduction in HbA1c was significantly greater in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I) in subgroup A. Subgroup A: subjects who took Nichiglucan AFO-202 and N-163 for 21 days and then stopped. Subgroup B: subjects who took Nichiglucan AFO-202 and N-163 for 35 days. [Figure 13A] The reduction in glycated albumin (GA) was significantly greater in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I). Subgroup A: subjects who took Nichi Glucan AFO-202 and N-163 for 21 days and then stopped. Subgroup B: subjects who took Nichi Glucan AFO-202 and N-163 for 35 days. [Figure 13B] The reduction in glycated albumin (GA) was significantly greater in AFO-202+N-163 (Gr.II) than in AFO-202 (Gr.I). Subgroup A: subjects who took Nichi Glucan AFO-202 and N-163 for 21 days and then stopped. Subgroup B: subjects who took Nichi Glucan AFO-202 and N-163 for 35 days. [Figure 14A] Body weight and liver weight show no significant differences between groups. [Figure 14B] Body weight and liver weight show no significant differences between groups. [Figure 15] Plasma ALT (mg / dL) levels were significantly reduced in the telmisartan and N-163 groups. [Figure 16A] Sirius red staining shows that the positive staining area was significantly reduced in the AFO-202+N-163 and N-163 groups compared with all other groups. [Figure 16B] Representative photomicrographs of F4 / 80 immunostained liver sections; upper panel: magnification: 200x; lower panel: magnification: 400x. F4 / 80 immunostaining of liver sections from the vehicle group demonstrated accumulation of F4 / 80+ cells (macrophages associated with inflammation) in the liver lobule. [Figure 17A] The average positive staining area for fibrosis shows that the positive staining area was significantly decreased in the AFO-202+N-163 and N-163 groups compared to all other groups. Original magnification for quantification: 200x. Mean ± standard deviation. Bonferroni's multiple comparison test. [Figure 17B] The F4 / 80 immunostaining score for inflammatory macrophages was the least in the N-163 group compared with the other groups. [Figure 18] Representative photomicrographs of HE-stained liver sections. [Figure 19A] Scores of NAFLD, steatosis, inflammation, and ballooning in different groups based on H&E staining. [Figure 19B] Scores of NAFLD, steatosis, inflammation, and ballooning in different groups based on H&E staining. [Figure 19C] Scores of NAFLD, steatosis, inflammation, and ballooning in different groups based on H&E staining. [Figure 19D] Scores of NAFLD, steatosis, inflammation, and ballooning in different groups based on H&E staining. [Figure 20] Illustrative graphical summary of the hepatoprotective effect of beta-glucan from Aureobasidium pullulans in nonalcoholic steatohepatitis [Figure 21] Study group and fecal sample analysis reference numbers given for gut microbiome and metabolome analyses. [Figure 22A] Alpha diversity indices. A. Simpson's index; B. Shannon's index (reflecting the diversity of zOTUs in the samples). Both indices show that Gr.4 (AFO-202+N-163) had the highest bacterial abundance after the intervention. [Figure 22B] Alpha diversity indices. A. Simpson's index; B. Shannon's index (reflecting the diversity of zOTUs in the samples). Both indices show that Gr.4 (AFO-202+N-163) had the highest bacterial abundance after the intervention. [Diagram 23] Index of most abundant taxa across species levels [Figure 24A] Pre- and post-intervention differences in read counts among selected bacteria: A. Enterobacteria; B. Firmicutes; C. Turicibacter; D. Bilophila; E. Lactobacillus; F. Proteobacteria; and G. Akkermansia. [Figure 24B] Pre- and post-intervention differences in read counts among selected bacteria: A. Enterobacteria; B. Firmicutes; C. Turicibacter; D. Bilophila; E. Lactobacillus; F. Proteobacteria; and G. Akkermansia. [Figure 24C] Pre- and post-intervention differences in read counts among selected bacteria: A. Enterobacteria; B. Firmicutes; C. Turicibacter; D. Bilophila; E. Lactobacillus; F. Proteobacteria; and G. Akkermansia. [Figure 24D]Pre- and post-intervention differences in read counts among selected bacteria: A. Enterobacteria; B. Firmicutes; C. Turicibacter; D. Bilophila; E. Lactobacillus; F. Proteobacteria; and G. Akkermansia. [Figure 24E] Pre- and post-intervention differences in read counts among selected bacteria: A. Enterobacteria; B. Firmicutes; C. Turicibacter; D. Bilophila; E. Lactobacillus; F. Proteobacteria; and G. Akkermansia. [Figure 25A] Differential abundance analysis, log2 fold change results for each group before and after intervention. A. Control; BN-163; C. AFO-202+N-163, and D. Telmisartan. [Figure 25B] Abundance variation analysis, log2 fold change results for each group before and after intervention. A. Control; BN-163; C. AFO-202+N-163, and D. Telmisartan. [Figure 25C] Abundance variation analysis, log2 fold change results for each group before and after intervention. A. Control; BN-163; C. AFO-202+N-163, and D. Telmisartan. [Figure 25D] Abundance variation analysis, log2 fold change results for each group before and after intervention. A. Control; BN-163; C. AFO-202+N-163, and D. Telmisartan. [Figure 26A] Score plot of principal component analysis (PCA) and compounds with VIP value > 1 in OPLS-DA of different groups. A. Control; BN-163; C. AFO-202+N-163, and D. Telmisartan. [Figure 26B]Score plot of principal component analysis (PCA) and compounds with VIP value > 1 in OPLS-DA of different groups. A. Control; BN-163; C. AFO-202+N-163, and D. Telmisartan. [Figure 26C] Score plot of principal component analysis (PCA) and compounds with VIP value > 1 in OPLS-DA of different groups. A. Control; BN-163; C. AFO-202+N-163, and D. Telmisartan. [Figure 26D] Score plot of principal component analysis (PCA) and compounds with VIP value > 1 in OPLS-DA of different groups. A. Control; BN-163; C. AFO-202+N-163, and D. Telmisartan. [Figure 27A] Normalized peak heights of detected compounds. A. succinic acid, B. phosphate, C. fructose, D. tryptophan, E. isoleucine, F. leucine, G. phenylalanine, H. methionine, I. spermidine, and J. ornithine. TMS indicates trimethylsilylation, meto indicates methoxymated derivatization (**significant; *not significant; p-value significant <0.05). [Figure 27B] Normalized peak heights of detected compounds. A. succinic acid, B. phosphate, C. fructose, D. tryptophan, E. isoleucine, F. leucine, G. phenylalanine, H. methionine, I. spermidine, and J. ornithine. TMS indicates trimethylsilylated and meto indicates methoxylated derivatives (**significant; *not significant; p-value significant <0.05). [Figure 27C] Normalized peak heights of detected compounds. A. succinic acid, B. phosphate, C. fructose, D. tryptophan, E. isoleucine, F. leucine, G. phenylalanine, H. methionine, I. spermidine, and J. ornithine. TMS indicates trimethylsilylated and meto indicates methoxylated derivatives (**significant; *not significant; p-value significant <0.05). [Figure 27D]Normalized peak heights of detected compounds. A. succinic acid, B. phosphate, C. fructose, D. tryptophan, E. isoleucine, F. leucine, G. phenylalanine, H. methionine, I. spermidine, and J. ornithine. TMS indicates trimethylsilylated and meto indicates methoxylated derivatives (**significant; *not significant; p-value significant <0.05). [Figure 27E] Normalized peak heights of detected compounds. A. succinic acid, B. phosphate, C. fructose, D. tryptophan, E. isoleucine, F. leucine, G. phenylalanine, H. methionine, I. spermidine, and J. ornithine. TMS indicates trimethylsilylated and meto indicates methoxylated derivatives (**significant; *not significant; p-value significant <0.05). [Figure 27F] Normalized peak heights of detected compounds. A. succinic acid, B. phosphate, C. fructose, D. tryptophan, E. isoleucine, F. leucine, G. phenylalanine, H. methionine, I. spermidine, and J. ornithine. TMS indicates trimethylsilylated and meto indicates methoxylated derivatives (**significant; *not significant; p-value significant <0.05). [Figure 27G] Normalized peak heights of detected compounds. A. succinic acid, B. phosphate, C. fructose, D. tryptophan, E. isoleucine, F. leucine, G. phenylalanine, H. methionine, I. spermidine, and J. ornithine. TMS indicates trimethylsilylated and meto indicates methoxylated derivatives (**significant; *not significant; p-value significant <0.05). [Fig. 27H] Normalized peak heights of detected compounds. A. succinic acid, B. phosphate, C. fructose, D. tryptophan, E. isoleucine, F. leucine, G. phenylalanine, H. methionine, I. spermidine, and J. ornithine. TMS indicates trimethylsilylated and meto indicates methoxylated derivatives (**significant; *not significant; p-value significant <0.05). [Figure 28A]Euclidean distance hierarchical clustering analysis revealing different intensity levels of characteristic metabolites in: N-163; AFO-202+N-163; comparison images of Telmisartan vs. control seen in FIG. [Figure 28B] Euclidean distance hierarchical clustering analysis revealing different intensity levels of characteristic metabolites in: N-163; AFO-202+N-163; comparison images of Telmisartan vs. control seen in Figure 31. [Figure 29A] The most abundant taxa at phylum (A), genus (B), and species (C) levels in the different groups of studies. [Figure 29B] The most abundant taxa at phylum (A), genus (B), and species (C) levels in the different groups of studies. [Figure 29C] The most abundant taxa at phylum (A), genus (B), and species (C) levels in the different groups of studies. [Figure 30A] Principal component analysis (PCA) of: A, B: All 10 samples (5 pre-intervention and 5 post-intervention groups) - A. Score plot; B. Loading plot; Study groups: Control / vehicle: 4-baseline, 14-post-intervention; N-163: 6-baseline; 16-post-intervention; AFO-202+N-163: 8-baseline, F18S-18-post-intervention; Telmisartan: 8-baseline, 18-post-intervention. [Figure 30B] Principal component analysis (PCA) of: A, B: All 10 samples (5 pre-intervention and 5 post-intervention groups) - A. Score plot; B. Loading plot; Study groups: Control / vehicle: 4-baseline, 14-post-intervention; N-163: 6-baseline; 16-post-intervention; AFO-202+N-163: 8-baseline, F18S-18-post-intervention; Telmisartan: 8-baseline, 18-post-intervention. [Figure 31A] Euclidean distance hierarchical clustering analysis revealing different intensity levels of characteristic metabolites in - A. subject; B. Telmisartan. [Figure 31B]Euclidean distance hierarchical clustering analysis revealing different intensity levels of characteristic metabolites in - A. subject; B. Telmisartan. [Diagram 32] The reduction in free fatty acids (FFA) was greater in the N-163 beta-glucan group. [Diagram 33] There was a greater reduction in TNF-alpha in the N-163+AFO-202 beta-glucan group than in the N-163 group. [Diagram 34] In the N-163 + AFO-202 beta-glucan group, MCP-1 was reduced more than in the N-163 group. [Diagram 35] Decreased alpha-SMA in the N-163 group. [Diagram 36] Decreased TIMP-1 in the N-163 group. [Figure 37] The decrease in IL-6 was greater in the N-163+AFO-202 beta-glucan group than in the N-163 group. [Figure 38] The decrease in MIP-2 was greater in the N-163+AFO-202 beta-glucan group than in the N-163 group. [Figure 39] Morphology of normal human dendritic cells (NHDC:CC-2701) expressing HLA-DR, CD11C, CD86, CD80, and CD14 treated with five beta-glucans. [Figure 40A] TNF-α and IL-6 mRNA expression in normal human dendritic cells (NHDC:CC-2701) expressing HLA-DR, CD11C, CD86, CD80, and CD14 treated with five types of beta-glucans. [Figure 40B] TNF-α and IL-6 mRNA expression in normal human dendritic cells (NHDC:CC-2701) expressing HLA-DR, CD11C, CD86, CD80, and CD14 treated with five types of beta-glucans. [Diagram 41] The reduction in IL-4 was more significant in the N-163 beta-glucan group compared to the other beta-glucans. [Diagram 42] The reduction in IL-10 was greater in the N-163 beta glucan group compared to the other beta glucans. [Diagram 43] The reduction in IL-13 was greater in the N-163 beta glucan group compared to the other beta glucans. [Diagram 44] Based on the metabolomic data of AFO-202, N-163, and the combination of AFO-202 and N-163, we used a proprietary mathematical information technology to analyze the metabolomic data, which were then converted into enzyme abundances before and after metabolite formation, and to infer imprinting and significant pathways. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] [Detailed Description of the Invention] The glucan used in the present invention may be a glucan derived from Aureobasidium pullulans APNN-M163 strain (also referred to herein as "M163 strain" or "N-163 strain"), and is preferably a β-1,3-1,6 glucan derived from N-163 (also referred to herein simply as "N-163 glucan" or "N-163 beta glucan"). "Aureobasidium pullulans APNN-M163 strain" was deposited on February 9, 2021 at the National Institute of Technology and Evaluation, Patent Microorganisms Deposit Center (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan 292-0818) under the deposit number NITE P-03377.

[0012] A domestic deposit was made on February 9, 2021, but the Aureobasidium pullulans APNN-M163 strain was transferred to an international deposit on September 14, 2021 at the National Institute of Technology and Evaluation, Patent Biological Deposit Center (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818, Japan) under the accession number NITE BP-03377.

[0013] The glucan produced by the N-163 strain was estimated to have the following chemical structure (Japanese Patent Application No. 2021-187255). [ka]

[0014] The glucan used in the present invention may also be a glucan derived from Aureobasidium pullulans FO-68 strain (also referred to herein as "AFO202 strain"), and is preferably a β-1,3-1,6 glucan derived from FO-68 (also referred to herein simply as "AFO-202 glucan" or "AF202 beta glucan"). "Aureobasidium pullulans FO-68 strain" is deposited at the National Institute of Advanced Industrial Science and Technology (NAIST) International Patent Organism Depositary Center under the deposit number FERMP-19327.

[0015] A domestic deposit was made on April 23, 2003, but the Aureobasidium pullulans FO-68 strain was transferred to international deposit on April 21, 2021 at the National Institute of Technology and Evaluation, Patent Biological Deposit Center (Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818, Japan) under the accession number FERM BP-19327.

[0016] Aureobasidium pullulans strain FO-68 is also known as Aureobasidium FERM P-18099 strain.

[0017] The glucan produced by the AFO-202 strain was predicted to have the following chemical structure (Japanese Patent Application No. 2021-187255). [ka]

[0018] N-163 is a powerful drug that reverses disease by modulating the overactive inflammatory system. This anti-inflammatory effect prevents (i) abnormal infiltrating macrophages, (ii) fibroblast accumulation, and (iii) extracellular matrix accumulation. These three effects pave the way for the eventual reversal of fibrosis, which leads to organ failure and chronic inflammation, which leads to cancer in fibrotic organs (Jun et al, JCI 2018, Resolution of organ fibrosis).

[0019] AFO-202 is a metabolic regulator by preventing excess fat or sugar or their derivatives in the blood that leads to accumulation of metabolic products and fat in organs such as the liver. It plays a primarily preventative or prophylactic role, and when combined with the more anti-inflammatory N-163, it is a win-win combination for both prevention and treatment.

[0020] The composition of the present invention exerts its function when it is ingested by mammals, including humans.As used herein, the term "ingestion" does not limit any administration route, as long as it can enter the human body, and can be achieved by all known administration methods, such as oral administration, tube administration, and enteral administration.Generally, oral intake and enteral intake via the digestive tract are preferred.

[0021] The dosage of the present invention can be appropriately set in consideration of various factors such as administration route, age, body weight, and symptoms. The dosage of the composition of the present invention is not particularly limited, but the amount of glucan is preferably 0.05 mg / kg / day or more, more preferably 0.5 mg / kg / day or more, and particularly preferably 1.0 mg / kg / day. However, when ingested for a long period of time, the amount may be smaller than the above-mentioned preferred amount. Furthermore, the glucan used in the present invention has sufficient dietary experience and is not problematic in terms of safety. Therefore, an amount far exceeding the above-mentioned amount (for example, 10 mg / kg / day or more) is also possible.

[0022] The composition of the present invention can be used as a food or drink. The composition of the present invention can be administered to animals such as humans as a food for specified health uses and a food with nutritional function claims, thereby achieving treatment or prevention of various diseases related to fibrosis.

[0023] When the composition of the present invention is used as food or beverage, the type of food or beverage is not particularly limited.Furthermore, the shape of food or beverage is not particularly limited, and can be any shape of commonly used food or beverage.For example, it can be any shape such as solid shape (including powder and granule shape), paste shape, liquid shape, and suspension shape, and is not limited to these shapes.

[0024] When used as a medicine, the composition of the present invention can reach the intestine, so a dosage form that can be administered orally is preferred.Examples of preferred dosage forms of the drug according to the present invention include tablets, coated tablets, capsules, granules, powders, solutions, syrups, troches, etc. These various preparations are formulated according to conventional methods by using glucan as an active ingredient, excipients, binders, disintegrants, lubricants, colorants, flavorings, solubilizers, suspending agents, coating agents, etc. They can be formulated by mixing auxiliary agents that are commonly used in the technical field of pharmaceutical preparations.

[0025] In some embodiments, the present invention may be used in combination with other foods, beverages, drugs, and any other substances to enhance the efficacy of the present invention. EXAMPLES

[0026] The present invention will be described in more detail below based on the following literature studies and examples. Please note that this embodiment does not limit the present invention.

[0027] Animal models are the most useful for investigating disease pathology. For NASH, animal models have been developed by genetic engineering models that induce genetic leptin mutations, dietary methionine choline deficiency (MCD) or long-term high-fat diet (HFD). However, these models do not reproduce the clinical pathology that occurs in humans in the progression of fatty liver, NASH, fibrosis to HCC in a diabetic background. The Stelic Animal Model (STAM™) model is an animal model that reproduces the disease progression that occurs in human NASH / HCC. In this model, 2-day-old C57BL / 6 mice are administered a single dose of streptozotocin to reduce insulin secretion capacity. When the mice are 4 weeks old, they begin to be fed a high-fat diet. This model has a background of fatty liver, NASH, fibrosis, and late-stage type 2 diabetes that eventually progresses to HCC. In this study, the STAM™ model was used to study the anti-fibrotic and anti-inflammatory effects of beta-glucan from the black yeast Aureobasidium pullulans. References: 1.Fujii M, et al., Fuji M_Med Mol Morph_2013, DOI 10.1007 / s00795-013-0016-1. 2.STAM Model, https: / / www.smccro-lab.com / jp / service / service_disease_area / stam.html. 3.Middleton et al., Nat Sci Rep (2018)8:17257 DOI:10.1038 / s41598-018-35653-4.

[0028] Example 1: F1S Study (Part I) Data from the F1S study (part 1) show the significance of N-163 in fibrosis and inflammation linked to liver and kidney disease.

[0029] material and method: -Beta-glucan N-163 was administered to Kk-Ay mice and compared with the control (administration of water for injection). The rats were sacrificed after 28 days. - NEFA levels were analyzed.

[0030] result: See Figure 1. After 28 days of oral administration, the mean levels of NEFA in Kk-Ay mice were: - Control (water for injection): 1,888 μEq / L -N-163 beta-glucan: 1,691 μEq / L.

[0031] Consider: According to Daniele, G. et al., Diabetes 2014 Aug; 63(8): 2812-2820, a reduction in NEFAs is associated with improvements in insulin sensitivity. According to Zhang, JW. et al., Scientific Reports volume 4, Article number: 5832 (2014), and Paschos P. et al., Hippokratia. 2009 Jan Mar; 13(1): 9 19, decreased NEFA levels are associated with the significance of NASH. According to Gai ZB et al., Nutrients. 2019 Apr; 11(4): 722, decreased NEFAs are associated with kidney disease.

[0032] High NEFA concentrations induce a vascular proinflammatory phenotype that encompasses the influence of 9 and 13 hydroxyoctadecadienoic acid and other lipid mediators (https: / / pubmed.ncbi.nlm.nih.gov / 22916905). High NEFA also predisposes to metabolic disease and fatty liver (https: / / www ncbi nlm nih gov / pmc / articles / PMC 2874689 and https: / / pubmed ncbi nlm nih gov / 10952470).

[0033] Reduction of non-esterified fatty acids (NEFA) improves whole body metabolism by affecting mitochondrial function, improves insulin sensitivity, and therefore has an effect on the development of inflammation and metabolic diseases. Increased levels of fatty acids are also associated with chronic kidney disease and fibrosis. Thus, reduction of NEFA is beneficial for preventing and / or reversing fatty liver disease and chronic kidney disease.

[0034] Example 2: F2S Study (Part I) Data from the F2S study (part 1) show benefit of N163 in liver and lung fibrosis.

[0035] material and method: -Nichiglucan N163 was administered to six SD male rats and compared with the control (administration of water for injection). The rats were sacrificed after 15 days. -IL8 levels in blood were analyzed.

[0036] result: See Figure 2. After 28 days of oral administration, the mean IL-8 levels in SD rats were: - Control (water for injection): 170 pg / dL -N-163 beta-glucan: 141pg / dL

[0037] Consider: According to PLoS One. 2011; 6(6): e21381, activation of IL8 is linked to the progression of liver fibrosis in patients. Am J Physiol Lung Cell Mol Physiol. 2018 Jan 1; 314(1): L127 L136 reported that decreased IL8 levels are associated with pulmonary fibrosis.

[0038] Interleukin-8 (IL-8) is a chemoattractant cytokine and is particularly known as a key mediator associated with inflammation, so reducing IL-8 makes N-162 a potential anti-inflammatory agent. IL-8 activation is linked to the progression of liver fibrosis and idiopathic pulmonary fibrosis. Therefore, reducing IL-8 makes N-163 beta-glucan a potential anti-fibrotic agent in liver and lung fibrosis.

[0039] Example 3: F11S Study (Part I) The F11S study data (Part I) demonstrates benefit of N-163 in liver fibrosis, pulmonary fibrosis, and renal fibrosis, along with potential in rheumatoid arthritis and chronic aging-related pathologies.

[0040] material and method: MyCAN Technologies Inc. (Japan) is developing cultured myeloid dendritic cells derived from induced pluripotent stem cell (iPS cell) lines. The cell lines were stimulated with N-163 beta-glucan. The levels of IL-6 and IL-8 secreted into the supernatant were measured by ELISA.

[0041] result: See Figures 3-5. i. IL-6 secretion from immature iPS dendritic cells (DCs) was reduced 1.07-fold in DCs stimulated with N-163 compared to controls. ii. IL-6 secretion from immature iPS dendritic cells (DCs) was reduced 2.07-fold in DCs stimulated with N-163 compared to controls. iii. IL-8 secretion was 1.08-fold less in dendritic cells stimulated with N-163 compared to controls.

[0042] Consider: According to Am J Gastroenterol. 2008 Jun;103(6):1372-9, blocking IL-6 will treat liver fibrosis. According to Favalli EG, Rheumatology and Therapy, 7, 473-516 (2020), inhibiting IL-6 secretion is beneficial for inflammation and joint pain. According to Maggio M. et al., J Gerontol A Biol Sci Med Sci, 2006 Jun; 61(6): 575-584, suppressing IL-6 secretion is beneficial for aging and chronic diseases. According to Papiris SA et al., Cytokine. 2018 Feb;102:168, blocking IL-6 is relevant for the treatment of pulmonary fibrosis. According to Chen W, et al., Theranostics. 2019; 9(14): 3980 3991, blocking IL-6 treats renal fibrosis.

[0043] IL-6 is the primary stimulator of the production of most acute phase proteins associated with at least 25 inflammatory disorders (Arthritis Res Ther. 2006; 8 (Suppl 2): ​​S3), and dysregulated continuous synthesis of IL-6 exerts pathological effects on chronic inflammation (https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC4176007). Several IL-6 antibodies are being developed as therapeutics for inflammatory disorders and also for COVID-19 (https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC4176007). IL-6 promotes fibrosis in the liver, lung, and kidney. Therefore, reduction of IL-6 by N-163 beta-glucan may be beneficial for its effect on inflammation and is a potential therapeutic agent for liver fibrosis, pulmonary fibrosis, and kidney fibrosis, apart from having potential for addressing rheumatoid arthritis and chronic aging-related pathologies.

[0044] The benefit of antibodies against IL-8 is shown in Skov L. et al., J Immunol July 1, 2008, 181 (1) 669-679. According to PLoS One. 2011; 6(6): e21381, decreased IL8 levels are associated with the significance of NASH. According to Yang LB. et al., Am J Physiol Lung Cell Mol Physiol. 2018 Jan 1; 314(1): L127-L136, decreased IL8 levels are associated with pulmonary fibrosis.

[0045] Interleukin-8 (IL-8) is a chemoattractant cytokine that is known to be a key mediator associated with inflammation, particularly in neutrophil recruitment and degranulation (https: / / pubmed.ncbi.nlm.nih.gov / 8315568 / ). Inhibiting the effects of IL-8 signaling is considered a potential therapeutic intervention (https: / / doi.org / 10.4061.2011.908468). IL-6 and IL-8 are important mediator cytokines related to inflammation.The regulation of IL-6 is beneficial in liver, kidney, and lung fibrosis, as well as in chronic aging-related pathologies and rheumatic diseases, and IL-8 is linked to the progression of liver and lung fibrosis.Therefore, the reduction of IL-6 and IL-8 by N-163 beta glucan helps to combat inflammation and is a potential therapeutic agent for liver, kidney, and lung fibrosis.

[0046] Example 4: F1S Study (Part II) Data from the F1S study (Part II) show benefit of N-163 and AFO-202 beta-glucans in NASH (liver disease) and chronic kidney disease.

[0047] material and method: -Beta-glucan N-163 was administered to Kk-Ay mice and compared with a control group (administered water for injection) and an AFO-202 group. The rats were sacrificed after 28 days. - NEFA levels were analyzed.

[0048] result: See Figure 6.

[0049] Consider: According to Zhang, JW. et al., Scientific Reports volume 4, Article number: 5832 (2014), and Paschos P. et al., Hippokratia. 2009 Jan Mar; 13(1): 9 19, decreased NEFA levels are associated with the significance of NASH. According to Gai ZB et al., Nutrients. 2019 Apr; 11(4): 722, decreased NEFAs are associated with kidney disease. According to Vidyasagar Devaprasad Dedeepiya, Case Report, Open Access, Volume 2012, Article ID 895370, and Jegatheesan Saravana Ganesh, J Diet Suppl. J Diet Suppl. 2014 Mar;11(1):1-6, the effects of AFO-202 beta-glucan are shown at lipid levels.

[0050] AFO-202 beta glucan helps to reduce lipid levels. The reduction of NEFA by N-163 beta glucan is higher than that of control and AFO-202 beta glucan. Therefore, adding N-163 beta glucan to AFO-202 beta glucan may have an effect on inflammation and help prevent metabolic diseases, and has potential in fatty liver disease and chronic kidney disease.

[0051] Example 5: F4S Study (Part II) The F4S study data (Part II) demonstrates the benefit of combining N-163 with AFO-202 beta-glucan to prevent and treat liver fibrosis, lung and kidney disease, and diseases due to vascular calcification.

[0052] material and method: See Figure 7.

[0053] result: See Figures 8-13.

[0054] Consider: Ferritin The reduction of ferritin and its significance in NASH has been shown in Jung JY. et al., Hepatology International volume 13, pages222-233(2019) and Kowdley KV et al., Hepatology. 2012 Jan;55(1):77-85. The reduction in ferritin and significance in lung function is shown in Lee JH. et al., Plos One Published: April 2, 2020 (https: / / doi.org / 10.1371 / journal.pone.0231057). The reduction of ferritin and its significance in pulmonary fibrosis is shown in Enomoto N. et al., First published: 05 June 2018 (https: / / doi.org / 10.1111 / crj.12918). The reduction in ferritin and its significance in renal disease and vascular calcification is shown in Balla J. et al, Pharmaceuticals (Basel). 2019 Jun; 12(2): 96.

[0055] Ferritin is associated with the enhancement of vascular calcification, which leads to liver fibrosis, kidney and lung disease, and also to aorta, cerebrovascular and coronary artery disease.The combination of AFO-202+N-163 beta glucan reduces ferritin levels, and thus has great potential as a preventive and therapeutic agent for several vascular diseases, including liver fibrosis, kidney and lung disease, and heart and cerebrovascular diseases.

[0056] ii. Total cholesterol Reduction of total cholesterol and significance in NASH is shown in Kerr TA et al., Hepatology. 2012 Nov; 56(5): 1995-1998. Reduction in total cholesterol and significance in CKD is shown in Blood Purif 2018;46:144-152.

[0057] High and dysregulated cholesterol levels are associated with enhanced liver fibrosis and kidney disease. The combination of AFO-202+N-163 beta glucan reduces cholesterol levels and therefore has great potential as a preventive and therapeutic agent for liver and kidney diseases.

[0058] iii. LDL cholesterol The reduction of LDL cholesterol and its significance in NASH is shown in Chatrath H. et al., Semin Liver Dis. 2012 Feb; 32(1): 22-29. The reduction in LDL cholesterol and its significance in CKD is shown in Haynes R. et al, JASN August 2014, 25 (8) 1825-1833.

[0059] High and dysregulated LDL cholesterol levels are associated with enhanced liver fibrosis and kidney disease. The combination of AFO-202+N-163 beta glucan reduces cholesterol levels and therefore has great potential as a preventive and therapeutic agent for liver and kidney diseases.

[0060] iv. Galectin-3 Decreased galectin-3 and its significance in NASH is shown in Clinical Trial Gastroenterology. 2020 Apr;158(5):1334-1345.e5.

[0061] High and dysregulated levels of galectin-3 are associated with enhanced liver fibrosis disease. The combination of AFO-202+N-163 beta-glucan reduces cholesterol levels and thus has great potential as a preventive and therapeutic agent for fatty liver disease.

[0062] v. HbA1c and glycated albumin (GA) The significance of glycated albumin / HbA1c and NASH is shown in Diabetes Res Clin Pract. 2017 Mar;125:53-61.

[0063] High HbA1c and GA levels are associated with enhanced liver fibrosis disease. The combination of AFO-202+N-163 beta glucan reduces HbA1c and GA levels, and thus has great potential as a preventive and therapeutic agent for fatty liver disease.

[0064] Example 6: F18S research material and method: Each study group included eight STAM mice. There were five study groups, which are described below. Research Group:

[0065] Group 1: Vehicle Eight NASH mice were orally administered vehicle (reverse osmosis [RO] water) in a volume of 5 mL / kg once daily from 6 to 9 weeks of age.

[0066] Group 2: AFO-202 beta-glucan Eight NASH mice were orally administered vehicle supplemented with AFO-202 beta-glucan at a dose of 1 mg / kg once daily at a volume of 5 mL / kg from 6 to 9 weeks of age.

[0067] Group 3: N-163 Beta Glucan Eight NASH mice were orally administered vehicle supplemented with N-163 beta-glucan at a dose of 1 mg / kg once daily at a volume of 5 mL / kg from 6 to 9 weeks of age.

[0068] Group 4: AFO-202 beta-glucan + N-163 beta-glucan Eight NASH mice were orally administered vehicle supplemented with AFO-202 beta-glucan at a dose of 1 mg / kg at 5 mL / kg once daily from 6 to 9 weeks of age, and vehicle supplemented with N-163 beta-glucan at a dose of 1 mg / kg at 5 mL / kg once daily.

[0069] Group 5: Telmisartan Eight NASH mice were orally administered vehicle supplemented with telmisartan at a dose of 10 mg / kg once daily from 6 to 9 weeks of age.

[0070] Test Substance AFO-202 beta-glucan, and B were provided by GN Corporation Ltd. Telmisartan (Micardis®) was purchased from Boehringer Ingelheim GmbH (Germany).

[0071] Test substance preparation instructions AFO-202 Beta Glucan, and N-163 Beta Glucan AFO-202 beta-glucan or N-163 beta-glucan was mixed with the required amount of RO water and stirred until completely dissolved. The solution was dispensed into 7 tubes and stored at 4°C until the day of administration. The dosage formulation was stirred before administration. The dosage formulation was used within 7 days.

[0072] Telmisartan The formulation was freshly prepared before administration: one tablet of telmisartan was transferred to a mortar and ground using a pestle, and a homogenous suspension of 1 mg / mL was obtained by gradually adding RO water.

[0073] Table 1: Study design and treatment schedule [Table 1] Induction of NASH NASH was induced in male mice by a single subcutaneous injection of 200 μg of streptozotocin (STZ, Sigma-Aldrich, USA) solution on day 2 after birth and feeding them with a high-fat diet (HFD, 57 kcal% fat, Cat# HFD32, CLEA Japan, Inc., Japan) after 4 weeks of age.

[0074] Drug Administration Route Vehicle, AFO-202 beta glucan, N-163 beta glucan, and telmisartan were administered orally at a volume of 5 mL / kg.

[0075] Treatment Dose 1) AFO-202 beta glucan was administered once daily at a dosage level of 1 mg / kg. 2) N-163 beta glucan was administered once daily at a dosage level of 1 mg / kg. 3) Telmisartan was administered once daily at a dosage level of 10 mg / kg.

[0076] animal C57BL / 6J mice (female, 14 days pregnant) were obtained from Japan SLC Co., Ltd. (Japan). NASH was induced in male mice (offspring of pregnant mice) by a single subcutaneous injection of 200 μg of streptozotocin (STZ, SigmaAldrich, USA) solution on the second day after birth, and feeding them with a high-fat diet (HFD, 57 kcal% fat, Cat# HFD32, Japan CLEA Co., Ltd. (Japan)) after 4 weeks of age. All animals used in this study were kept under the following guidelines: 1) Animal Protection and Management Act (Ministry of the Environment of Japan, October 1, 1973, Act No. 105) 2) Standards for the care and management of laboratory animals and the alleviation of pain (Notification No. 88 of the Ministry of the Environment of Japan, April 28, 2006) 3) Guidelines for Proper Conduct of Animal Experiments (Science Council of Japan, June 1, 2006)

[0077] environment Animals were maintained in a specific pathogen-free (SPF) facility under controlled conditions of temperature (23 ± 3°C), humidity (50 ± 20%), lighting (12-h artificial light-dark cycle, lights on from 08:00 to 20:00), and air exchange.

[0078] Animal Husbandry The animals were housed in TPX™ cages (CLEA Japan) with a maximum of four animals per cage. Sterile Palmas™ (Material Research Center Co., Ltd, Japan) bedding was used and changed once a week.

[0079] Food and water Sterile solid HFD was provided ad libitum via a metal lid placed on top of the cage. RO water was provided ad libitum via a water bottle equipped with a rubber stopper and sipper tube. The water bottle was changed weekly, washed, sterilized in an autoclave, and reused.

[0080] Animal and cage identification Mice were identified by ear punch and each cage was labeled with a specific identification code.

[0081] Randomization NASH model mice were randomized into 5 groups of 8 mice at 6 weeks of age based on their body weight on the day before treatment began. Randomization was performed by weight-stratified random sampling using Microsoft Excel software. NASH model mice were stratified by their body weight so that the difference in SD and mean body weight between groups was as small as possible.

[0082] Animal monitoring and slaughter Mice were monitored daily for viability, clinical signs (lethargy, twitching, labored breathing), and behavior. Body weights were recorded daily before treatment. Mice were observed for significant clinical signs of toxicity, moribundity, and mortality before and after dosing. Animals were sacrificed at 9 weeks of age by exsanguination via direct cardiac puncture under isoflurane anesthesia (Pfizer Inc.).

[0083] If an animal showed more than 25% weight loss within 1 week or more than 20% weight loss compared to the previous day, the animal was euthanized before the end of the study and no samples were collected. If an animal showed signs of moribundity, such as prone position, the animal was euthanized before the end of the study and no samples were collected.

[0084] Sample collection The following samples were collected and stored: -Frozen plasma samples -Frozen liver samples - Paraffin-embedded liver block -OCT embedded liver block

[0085] Plasma sample preparation: At the end of the study, non-fasting blood was collected by direct cardiac puncture using a pre-chilled syringe. Collected blood was transferred to pre-chilled polypropylene tubes with anticoagulant (novoheparin) and stored on ice until centrifugation. Blood samples were centrifuged at 1,000xg for 15 minutes at 4°C. Supernatants were collected and stored at -80°C for biochemical evaluation.

[0086] Preparation of liver samples: After sacrifice, whole livers were harvested and washed with cold saline. Photographs of individual whole livers (parietal and visceral sides) were taken. Liver weights were measured and liver to body weight ratios were calculated. The left lateral lobe of the liver was isolated, dissected and preserved.

[0087] A: Liver specimens were embedded in optimal cutting temperature (OCT, Sakura Finetech Japan Co., Ltd., Japan) compound and stored at −80°C for immunohistochemical testing. B: Liver specimens were fixed in Bouin's solution (Sigma-Aldrich Japan, Japan) for 24 hours. After fixation, these specimens were embedded in paraffin for HE and Sirius Red staining. C: Liver samples were snap frozen in liquid nitrogen and stored at -80°C for further analysis.

[0088] The left and right medial lobes were snap frozen in liquid nitrogen and stored at -80°C for evaluation.

[0089] The right lobe was snap frozen in liquid nitrogen and stored at -80°C for biochemical analysis.

[0090] The caudate lobes were snap frozen in liquid nitrogen and stored at -80°C for evaluation.

[0091] Plasma biochemistry measurements Plasma ALT levels were measured using a FUJI DRI-CHEM 7000 (Fujifilm Corporation).

[0092] Liver biochemistry measurements Measurement of liver lipid content Liver total lipid extracts were obtained by the Folch method (Folch J. et al., J. Biol. Chem. 1957;226: 497). Liver samples were homogenized in chloroform-methanol (2:1, v / v) and incubated overnight at room temperature. After washing with chloroform-methanol-water (8:4:3, v / v / v), the extracts were evaporated to dryness and dissolved in isopropanol. Liver neutral fat content was measured by Triglyceride E-Test (Wako Pure Chemical Industries, Ltd., Japan). Liver free fatty acid content was measured by NEFA C-Test (Fujifilm Wako Pure Chemical Industries, Ltd.).

[0093] Blinding for histological analysis Sections were cut from the paraffin blocks of liver tissue using a rotary microtome (Leica Microsystems). After sectioning, each slide was coded with a number for blinded evaluation. Numbers were generated using the RAND function in Excel software and assigned to slides in ascending order. Tissue slides were used for the following staining and were evaluated by the experimenter.

[0094] Histological analysis For HE staining, sections cut from paraffin blocks of liver tissue were prefixed in Bouin's solution and stained with Lilly-Meyer hematoxylin (Muto Chemical Co., Ltd., Japan) and eosin solution (Wako Pure Chemical Industries, Ltd.). As shown in Table 2, the NAFLD Activity Score (NAS) was calculated according to the Kleiner criteria (Kleiner DE. Et al., Hepatology, 2005;41:1313). For NAS scoring, bright-field images of HE-stained sections were captured at 50x and 200x magnification using a digital camera (DFC295; Leica, Germany). The steatosis score in one section / mouse (one representative field at 50x magnification), the inflammation score in one section / mouse (one representative field around the central vein at 200x magnification), and the ballooning score in one section / mouse (one representative field around the central vein at 200x magnification) were estimated.

[0095] [Table 2]

[0096] To visualize collagen deposition, sections of Bouin-fixed liver were stained using Picrosirius Red solution (Waldeck, Germany). Briefly, sections were deparaffinized and hydrophilized using xylene, 100-70% alcohol series, and RO water, and then treated with 0.03% Picrosirius Red solution (Cat No.: 1A-280) for 60 min. After washing with 0.5% acetic acid solution and RO water, the stained sections were dehydrated and washed with 70-100% alcohol series and xylene, and then mounted with Entelan® New (Merck, Germany) and used for observation.

[0097] For immunohistochemical testing, sections were cut from frozen liver tissue embedded in Tissue-Tek OCT compound and fixed in acetone. Endogenous peroxidase activity was assayed using 0.03% H 2 O 2The sections were blocked with 5% DMSO for 5 min, followed by incubation with Block Ace (Sumitomo Dainippon Pharma Co., Ltd., Japan) for 10 min. The sections were incubated with anti-F4 / 80 antibody at 4°C overnight. After incubation with the secondary antibody, the sections were stained with 3,3'-diaminobenzidine / H 2 O 2 The enzyme-substrate reaction was performed using solution (Nichirei Biosciences Corporation, Japan). The profiles of the primary and secondary antibodies are shown in Table 3.

[0098] Table 3. Primary and secondary antibody profiles for immunochemical staining [Table 3]

[0099] For quantitative analysis of fibrotic and inflammatory areas, bright-field images of Sirius red-stained and F4 / 80 immunostained sections around the central vein were captured at 200x magnification using a digital camera (DFC295; Leica, Germany), and positive areas were measured in 5 fields / section using ImageJ software (National Institute of Health, USA).

[0100] Statistical Testing Statistical analysis was performed using Prism Software 6 (GraphPad Software, USA). Statistical analysis was performed using Bonferroni's multiple comparison test. Comparisons were made between the following groups: 1) Group 1 (vehicle) vs. Group 2 (AFO-202 beta glucan), Group 3 (N-163 beta glucan), Group 4 (AFO-202 beta glucan + B), and Group 5 (telmisartan) A P value <0.05 was considered statistically significant. Results were expressed as the mean ± standard deviation. A trend or tendency was assumed if a one-tailed t-test returned a P value <0.1. Comparisons were made between the following groups: 2) Group 1 (vehicle) vs. Group 2 (AFO-202 beta-glucan) 3) Group 1 (vehicle) vs. Group 3 (N-163 beta-glucan) 4) Group 1 (vehicle) vs. Group 4 (AFO-202 beta glucan + B) 5) Group 1 (vehicle) vs. Group 5 (telmisartan)

[0101] result: There were highly significant differences between groups in body and liver weights (Figure 14). The mean liver weights were 20.4 g in group 1, 20.3 g in group 2, 20.2 g in group 3, 20 g in group 4, and 17.8 g in group 5. The mean body weights were 1552 mg in group 1, 1552 mg in group 2, 1565 mg in group 3, 1474 mg in group 4, and 1181 mg in group 5.

[0102] Plasma ALT levels were lowest in the telmisartan group (mean=36 U / L), followed by group 3 (mean=44 U / L) (Figure 15).

[0103] Sirius red staining images to assess liver damage showed a significant decrease in the positive staining area in the AFO-202+N-163 and N-163 groups compared to all other groups (mean positive staining area, AFO-202-0.72, AFO-202+N-163: 0.54; N-163: 0.56; telmisartan: 0.59; and vehicle: 0.84) (Figure 16A).

[0104] With regard to NAS, the telmisartan, N-163, and AFO-202+N-163 groups presented significantly lower scores (mean scores, telmisartan: 2.625; AFO-202+N-163: 3.25), as well as less microvesicular and macrovesicular fat deposition, lobular inflammatory cell infiltration, and hepatocyte ballooning compared with the other groups (N-163: 3.5; AFO-202: 3.25, and vehicle: 4.571).

[0105] Inflammation scores were significantly reduced in the AFO-202+N-163 and N-163 groups compared to the telmisartan group (Figures 17A, 17B, 18). Ballooning and steatosis scores were most reduced in the telmisartan group, but a significant reduction was observed in the AFO-202 beta glucan group compared to the vehicle (Figure 19).

[0106] F4 / 80 immunostaining showed that macrophage infiltration was greatly reduced, indicating reduced inflammation, in the N-163 group compared with the vehicle and telmisartan groups. N-163 is helpful in improving inflammation-fibrosis in the STAM model of NASH. N-163 beta-glucan may be a potential agent for improving organ fibrosis in the liver, kidney, lung, and other organ fibrosis.

[0107] N-163 beta glucan has the following effects on biomarkers associated with NASH, so adding it to the AFO-202 beta glucan is an advantage: 1. CD11b is increased compared to AFO-202 beta-glucan; CD11b positive cells are necessary for the improvement of liver fibrosis (Reference: https: / / pubmed.ncbi.nlm.nih.gov / 22544759 / ) - Liver fibrosis 2. AFO-202 reduces ferritin compared to beta-glucan; increased ferritin is associated with increased liver fibrosis (ref: https: / / doi.org / 10.1007 / s12072-018-9892-8). Therefore, the reduction in ferritin levels after N-163 is favorable. - Fibrosis of the liver, kidney, and lung 3. AFO-202 reduces total cholesterol and LDL cholesterol compared to beta-glucan; Cholesterol metabolism disorders contribute to disease severity and cardiovascular risk (Reference: https: / / doi.org / 10.1002 / hep.26088). Therefore, the reduction in total cholesterol and LDL levels after N-163 is favorable. - Liver and kidney disease 4. Decreased galectin-3 compared to AFO-202 beta-glucan. Increased levels of galectin-3 are associated with non-alcoholic steatohepatitis (NASH) and contribute to toxin-induced liver fibrosis (reference: https: / / doi.org / 10.1053 / j.gastro.2019.11.296). Therefore, the reduction in galectin-3 levels after N-163 is favorable. -Liver disease 5.AFO-202 reduces HbA1c and Gly.Alb compared to beta-glucan; however, the reduction in Gly.Alb is greater. The ratio of GA / HbA1c is inversely related to the presence and severity of NAFLD (reference: https: / / doi.org / 10.1016 / j.diabres.2016.12.01). Therefore, the reduction in Gly.Alb after N-163 is favorable. -Liver disease 6. AFO-202 significantly reduced NEFA levels compared to beta-glucan; NAFLD patients had significantly higher serum FFA levels than controls (reference: https: / / doi.org / 10.1038 / srep0583). Therefore, reduced NEFA levels are favorable. - Fibrotic diseases of the liver, kidney, and lungs 7. Significantly reduced IL8 and IL-6 compared to AFO-202 beta-glucan. IL-8 is strongly activated in CLD and therefore likely contributes to hepatitis (reference: http: / / www.annclinlabsci.org / content / 45 / 3 / 278.long). Therefore, reduction of IL6 and IL8 is favorable. - Fibrotic diseases of the liver, kidney, and lung 8. Reduction of ballooning degeneration and liver fibrosis – NASH / Liver fibrosis

[0108] Consider: NASH or NAFLD is a severe chronic liver disease, which initially is a metabolic imbalance that leads to the accumulation of fat in the liver, and the inflammatory response to the excess fat accumulation gradually leads to fibrosis, compromising liver function, and if chronic inflammation continues in the future, it may lead to cirrhosis and hepatocellular carcinoma [A8]. Increased plasma glucose and lipid levels contribute to direct lipid deposition in the liver apart from resulting in systemic inflammation that contributes to the development and aggravation of NAFLD [A9]. Therefore, a strategic approach to NAFLD would be to first address the metabolic imbalance, which can be managed by administration of AFO-202 beta-glucan based on our previous findings [A5-A7], while the resolution of already formed fibrosis can be addressed by N-163 beta-glucan as shown in this study. This study also proves that the combination of AFO-202 and N-163 is effective in addressing the chronic inflammation-fibrosis cascade and ultimately preventing liver cirrhosis or cancer.

[0109] In this study, the effects of AFO-202 and N-163 beta 1,3-1,6 glucan, alone and in combination, were tested in the STAM mouse model of NASH. The reduction in body and liver weight was significantly lower only in the telmisartan group (Figure 14).

[0110] Inflammation and ballooning scores were reduced mainly in the AFO-202 beta-glucan group, pointing out that it helps to act as an anti-inflammatory protective agent against the progression of NASH (Figure 18). AFO-202 beta-glucan has been shown to reduce inflammation-related cytokines in previous studies [A12]. This is further demonstrated in the present study. However, fibrosis, which is a result of inflammation, was reduced mainly in the N-163 group, as well as steatosis and NAFLD scores were reduced in the AFO-202+N-163 group as effectively as in the telmisartan group (Figures 16A-B, 17A-B), pointing out its use as an anti-fibrotic treatment in NASH. Beta-glucan has been reported to help alleviate obesity by acting on regulating the transcription factor peroxisome proliferator-activated receptor (PPAR)-γ [A13]. This could be one possible mechanism for the anti-inflammatory and anti-fibrotic effects of AFO-202 and N-163 in the present study. Dysregulated gut microbiota in metabolic syndrome, diabetes, and dyslipidemia also lead to NASH through the production of endotoxins. The prebiotic effects of AFO-202 and N-163 beta-glucan may also contribute to the alleviation of NASH by favorably altering the gut microbiota [A1], but this requires further validation.

[0111] AFO-202, N-163 beta-glucan, and their combinations are essentially food supplements, as opposed to pharmacological drugs such as telmisartan, with an established safety profile that has been taken by humans for decades [A12]. Other beneficial effects of these beta-glucans on obesity, diabetes, and dyslipidemia [A5-A7, A13, A14] may help address related NASH disease and make them sound preventive and therapeutic agents for NASH.

[0112] Furthermore, although detailed mechanism may be difficult to pinpoint, (i) additional evaluation of gene expression of fibrotic and inflammatory markers in STAM model after AFO-202, N-163 beta-glucan administration may shed light on the complexity for better understanding of these beta-glucans in NASH, while (ii) evaluation of common markers of tissue and organ fibrosis to other organ diseases such as PPAR-γ TGFb, TNFα, MCP-1, α-SMA, TIMP-1 [A15, A16] may add value to consider the possible expanded application of these BRMGs in lung and kidney fibrosis as well. IL-6, which has already been shown to be decreased by AFO-202 beta-glucan and is an important cytokine [A18] involved in lung, liver, and kidney inflammation and fibrosis mechanisms [A17], is a particular biomarker worth evaluating in further studies.

[0113] These two novel beta-glucans, AFO-202, which has been studied for 25 years and has been proven to be safe for human consumption as food supplements, and N-163, would be appropriate for larger multicenter studies in NASH / NAFLD patients. However, although the STAM model largely recapitulates human fatty liver disease, limitations of this study must be kept in mind, including the fact that the human neutrophil-attracting chemokine IL-8 has no direct analog in mice, and there are still differences between humans and mice in the immunological mechanisms mediating inflammation, as well as differences in the corresponding immune cell subsets between mice and humans [A19].

[0114] Conclusion: This study was a comprehensive preclinical evaluation demonstrating the anti-fibrotic effect of N-163, the anti-inflammatory effect of AFO-202 beta-glucan, and the combination of these two biological response-modifying glucans to reduce NAS scores in STAM, an established NASH model of fatty liver disease. Considering the safety of these two food supplements, larger clinical studies in NASH patients are recommended, and further academic investigations into these beta-glucans and their beneficial effects through gene expression and common biomarkers of tissue and organ fibrosis are worthwhile, since the basic mechanisms of fibrosis in other organs such as kidney and lung share common mechanisms.

[0115] summary: background: Nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) are highly prevalent diseases characterized by hepatic inflammation and fibrosis, which progress to cirrhosis and hepatocellular carcinoma if left untreated. Lifestyle disorders such as obesity, diabetes, and dyslipidemia predispose to and are associated with disease progression. Existing therapies are primarily symptomatic with no clear solution. Beta-glucan-based biological response modifiers are a potential alternative strategy due to their beneficial metabolic effects. Beta-glucans from Aureobasidium pullulans strains AFO-202 and N-163 were evaluated in this study for their potential for anti-fibrotic and anti-inflammatory properties in NASH animal models. method: Five groups were studied for 8 weeks in the STAM™ mouse model of NASH - (1) vehicle (RO water), (2) AFO-202 beta glucan; (3) N-163 beta glucan, (4) AFO-202 + N-163 beta glucan, and (5) telmisartan (standard pharmacological intervention). Evaluation of biochemical parameters in plasma and liver histological tests including Sirius red staining and F4 / 80 immunostaining were performed. result: AFO-202 beta glucan significantly reduced inflammation-associated hepatocyte ballooning and steatosis. N-163 beta glucan significantly reduced fibrosis and inflammation (p-value < 0.05). The combination of AFO-202 and N-163 beta glucan significantly reduced NAFLD activity score (NAS) compared to other groups. Conclusion: This preclinical study demonstrates the potential of AFO-202 and N-163 beta-glucan as potential preventive and therapeutic agents against NASH. After validation with additional markers of gene expression, it may be considered to extend the benefit of improving lung and kidney organ fibrosis. Keywords: Nonalcoholic fatty liver disease (NAFLD); Nonalcoholic steatohepatitis (NASH); Beta-glucan; Anti-fibrosis; Anti-inflammatory; Telmisartan

[0116] Glucan N-163, a unique biological response modifier that induces beneficial modulation of the gut microbiota and fecal metabolome in animal models; paving the way for effective use in human health and disease The gut microbiome and its metabolites reflect the metabolic nature and health of a person's immune system, and are influenced by age and stress. Based on our previous reports from clinical and preclinical studies in which biological response-modifying glucans produced by AFO-202 and N-163, alone or in combination, induced beneficial outcomes, we report herein on the gut microbiota and fecal metabolome in the Stelic Animal Model (STAM) model, one of the most metabolically stressed animal models.

[0117] method: Four groups were studied for 8 weeks in the STAM™ mouse model - (1) vehicle (RO water), (3) N-163 beta glucan, (4) AFO-202 + N-163 beta glucan, and (5) telmisartan (standard pharmacological intervention). Fecal samples were collected at 6 weeks of age (pre-treatment) and 9 weeks of age (pre-sacrifice). The gut microbiome was analyzed using 16S rRNA sequences obtained by next generation sequencing. Fecal metabolome analysis was performed by gas chromatography-mass spectrometry (GC-MS).

[0118] result: In AFO-202+N-163 treated mice, gut microbial diversity was significantly increased. After intervention, Bacteroidetes, which was highest in the AFO-202+N-163 group, increased, while Firmicutes decreased. In the N-163 group, Turicibacter and Bilophila were most decreased. Increase in Lactobacillus was highest in the AFO-202+N-163 combination group. Fecal metabolite spermidine, known to be beneficial for inflammation, was significantly increased in the N-163 group, and an increase in tryptophan was also observed in the N-163 treatment group. Metabolites such as leucine and phenylalanine were decreased, and ornithine, which is beneficial for chronic immunometabolic inflammatory conditions such as cancer, was increased in the AFO-202+N-163 combination group.

[0119] Conclusion: In this study, treatment of mice with N-163 was shown to have anti-inflammatory effects associated with organ fibrosis and neuroinflammatory diseases. When administered together, these beneficial effects may also have anti-cancer activity. Overall, the results of this study suggest that long-term investigation of the use of these drugs as natural food supplements is warranted.

[0120] Approximately 100 trillion microorganisms reside in the human gastrointestinal tract, and the microbiome is now considered a virtual organ of the body. The microbiome encodes more than 3 million genes that produce thousands of metabolites, compared to the 23,000 genes in the human genome, and therefore substitutes many of the host's functions that affect its fitness, phenotype, and health. The gut microbiota influences several aspects of human health, encompassing immune, metabolic, and neurobehavioral traits [B1]. The gut microbiota ferments indigestible substances such as dietary fiber, and endogenous intestinal mucus that supports the growth of specialized microorganisms that produce short-chain fatty acids (SCFAs) and gas. The main SCFAs produced are acetate, propionate, and butyrate. Butyrate is essential for the maintenance of colonocytes, helps in the apoptosis of colon cancer cells, activates intestinal gluconeogenesis, has beneficial effects on glucose and energy homeostasis, and maintains oxygen balance in the intestine, and prevents gut dysbiosis.

[0121] Propionate is transported to the liver where it regulates gluconeogenesis, while acetate is an essential metabolite for the growth of other bacteria as well as playing a role in central appetite regulation [B1]. The fecal metabolome represents a functional readout of gut microbial activity and can be considered an intermediate phenotype mediating host-microbiome interactions. On average, 67.7% (±18.8%) of the variance in the fecal metabolome represents gut microbial composition. Thus, fecal metabolic profiling is a novel tool to explore the associations between microbiome composition, host phenotype, and disease states [B2]. Probiotics and prebiotic nutritional supplements are the main strategies, other than fecal microbiota transplantation, to restore a dysbiotic gut to a healthy state.

[0122] Beta-glucan is one of the most promising nutritional supplements with established efficacy in metabolic, diabetes, cancer, cardiovascular, and neurological diseases. Beta-glucan produced from two strains of the black yeast Aureobasidium pullulans, AFO-202 and N-163, has been reported to have beneficial effects in diabetes [B3], dyslipidemia [B4], ASD [B5, B6], nonalcoholic steatohepatitis (NASH) [B7], and infectious diseases, including COVID-19 [B8, B9]. As an extension of this NASH study, the present study was conducted to study the fecal microbiome and metabolome profiles before and after administration of N-163 beta-glucan alone and in combination with AFO-202.

[0123] method: mouse This study is reported in accordance with the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines. C57BL / 6J mice were obtained from Japan SLC Co., Ltd. (Japan). All animals used in this study were maintained under the following guidelines: the Law on Welfare and Management of Animals (Ministry of the Environment, Japan, October 1, 1973, Law No. 105), Standards for the Care and Management of Laboratory Animals and Relief of Pain (Notification No. 88 of the Ministry of the Environment, Japan, April 28, 2006), and Guidelines for Proper Conduct of Animal Experiments (Science Council of Japan, June 1, 2006). Protocol approval was obtained from the IACUC of SMC Laboratories, Japan (study reference number: SP_SLMN128-2107-6_1). Mice were maintained in a specific pathogen-free (SPF) facility under controlled conditions of temperature (23 ± 3°C), humidity (50 ± 20%), lighting (12-h artificial light-dark cycle, lights on from 08:00 to 20:00), and air exchange.

[0124] The STAM model of NASH was generated as previously described [B7]. Mice were given a single subcutaneous injection of 200 μg of streptozotocin (STZ, Sigma-Aldrich, USA) solution on day 2 of life and fed a high-fat diet (HFD, 57 kcal% fat, Cat# HFD32, Nippon CLEA Co., Ltd. (Japan)) from 4 to 9 weeks of age. All mice developed hepatic steatosis and diabetes, and by week 3 mice had established steatohepatitis histologically.

[0125] Study Groups: There were four study groups (n=8 mice per group) as described below. Group 1: Vehicle: NASH mice were orally administered vehicle [RO water] in a volume of 5 mL / kg once daily from 6 to 9 weeks of age. Group 2: N-163 beta glucan: NASH mice were orally administered vehicle supplemented with N-163 beta glucan at a dose of 1 mg / kg once daily in a volume of 5 mL / kg from 6 to 9 weeks of age. Group 3: AFO-202 beta glucan + N-163 beta glucan: Eight NASH mice were orally administered vehicle supplemented with AFO-202 beta glucan at a dose of 1 mg / kg at 5 mL / kg once daily from 6 to 9 weeks of age, and vehicle supplemented with N-163 beta glucan at a dose of 1 mg / kg at 5 mL / kg once daily. Group 4: Telmisartan: Eight NASH mice were orally administered vehicle supplemented with telmisartan at a dose of 10 mg / kg once daily from 6 to 9 weeks of age.

[0126] Table 4: Study design and treatment schedule [Table 4]

[0127] Test Substance AFO-202 beta-glucan and N-163 beta-glucan were provided by GN Corporation (Japan). Telmisartan (Micardis®) was purchased from Boehringer Ingelheim GmbH (Germany).

[0128] Randomization NASH model mice were randomized into 5 groups of 8 mice at 6 weeks of age based on their body weight on the day before treatment began. Randomization was performed by weight-stratified random sampling using Excel software. NASH model mice were stratified by their body weight to minimize the difference in standard deviation and mean body weight between groups.

[0129] Animal monitoring and slaughter Viability, clinical signs (lethargy, twitching, labored breathing), and behavior were monitored daily. Body weights were recorded daily before treatment. Mice were observed for significant clinical signs of toxicity, moribundity, and mortality pre- and post-dosing. Animals were sacrificed at 9 weeks of age by exsanguination via direct cardiac puncture under isoflurane anesthesia (Pfizer Inc.).

[0130] Fecal pellet sample collection: Frequency: Fecal samples were collected at 6 weeks of age (pre-treatment) and 9 weeks of age (pre-slaughter). Procedure: At 6 weeks of age, fecal samples were collected from each mouse by the clean catch method. Animals were handled with clean gloves sterilized with 70% ethanol. A sterile petri dish was placed on the work bench. The abdomen was gently massaged and the mouse's buttocks were positioned on an unused petri dish to collect 1-2 fecal pellets. At the time of sacrifice, fecal samples were collected aseptically from the cecum. Tubes containing feces were immediately placed on ice. These tubes were snap frozen in liquid nitrogen and stored at -80°C for transport. Figure 21 shows the groups and corresponding fecal sample numbers given for microbiome and metabolomic analysis.

[0131] Microbiome Analysis: In this analysis, community analysis was performed using the microbial community analysis program QIIME2 using 16S rRNA sequence data obtained from fecal RNA by next-generation sequencing. Raw read data in FASTQ format output from the next-generation sequencer was trimmed to remove adapter sequences that may be included in the data and low QV regions. Cutadapt was used to remove adapter sequences from DNA sequence reads. Trimmomatic was used as a read trimming tool for Illumina NGS data. Adapter sequences were trimmed using the adapter trimming program "cutadapt" when the trimmed region at the end of the read sequence overlapped with the corresponding sequence by at least one base (mismatch tolerance: 20%). If an N-containing read was present in at least one of reads 1 and 2, both reads 1 and 2 were deleted.

[0132] Illumina adapter sequence information Lead 1 3' end CTGTCTTCTATACACATCTCCGAGCCCACGAGAC Lead 2 3' end CTGTCTTCTATACACATCTGACGCTGCCGACGA

[0133] Trimming of low QV regions was performed on the processed read data using the QV trimming program "Trimomatic" under the following conditions: QV trimming conditions A window of 20 bases is slid from the 5' side and areas with average QV less than 20 are trimmed. After trimming, only reads with 50 bases or more in both read 1 and read 2 were used as output.

[0134] Population analysis The sequence data trimmed in the previous section was used to perform microbial community analysis based on 16S rRNA sequences using the microbial community analysis program "QIIME2." The annotation program "sklearn" included in QIIME2 was used to annotate ASV (OTU) sequences. Using the annotation program “sklearn” included in QIIME2, the obtained ASV (OTU) sequences were annotated with taxonomic information [kingdom / phylum / class / order / family / genus / species] based on the 16S rDNA database.

[0135] The data set of the 16S rDNA database "greengenes" provided on the QIIME2 Resources site was used for the analysis. The ASVs (OTUs) obtained above were tabulated and graphed based on the taxonomic information and read counts of each sample. Various index values ​​of alpha diversity were calculated based on the composition of the bacterial flora of each sample summarized above.

[0136] Metabolomic Analysis: After freeze-drying the fecal samples, about 10 mg of samples were separated and extracted by the Bligh-Dyer method, and the resulting aqueous layer 1 was collected and freeze-dried. The residue was derivatized using 2-methoxyamine hydrochloride and MSTFA, and the analytical sample was subjected to gas chromatography-mass spectrometry (GC-MS). 2-Isopropylmaleic acid was used as the internal standard. In addition, an operational blank test was also performed.

[0137] The analytical equipment used was a GCMS-TQ8030 (Shimadzu Corporation); the column was a BPX-5 (film thickness 0.25 μm, length 30 m, inner diameter 0.25 mm, Shimadzu GLC).

[0138] Peak detection and analysis: The analysis was performed using MS-DIAL ver.4.7 (http: / / prime.psc.riken.jp / compms / index.html) to generate a peak list (peak height). Peaks detected in the QC sample with a CV of less than 20% and an intensity more than twice that of the working blank were considered as detected peaks.

[0139] Abundance variation analysis, PCA, and PCA, OPLS-DA, and clustering analysis: Principal component analysis (PCA) and orthogonal partial least squares-discriminant analysis (OPLS-DA) were performed to visualize the metabolic differences between the experimental groups. SIMCA-P+ver.17 (Umetrics) was used for the principal component analysis. Principal component analysis was performed using all samples as well as five points (F18S-12, F18S-14, F18S-16, F18S-18, and F18S-20) using normalized peak heights of the peaks from the samples. Transform was set to none, and Scaling was set to Pareto scaling. Differential metabolites were selected according to the variable importance (VIP) values ​​in the statistically significant projections obtained from the OPLS-DA model. Hierarchical cluster analysis (HCA) and heatmaps were performed using R (https: / / www.r-project.org / ).

[0140] statistical analysis Statistical data were analyzed using Microsoft Excel statistical package analysis software. Graphs were made using Originb2021 software from Origin Lab. For normally distributed variables, t-test or ANOVA with Tukey HSD was used, and P-values ​​<0.05 were considered significant. For OPLS-DA, two-tailed Student's t-test values ​​were applied to normalized peak areas; metabolites with VIP values ​​>1 and P-values ​​<0.05 were included. Heatmaps were analyzed using Euclidean distance and Ward's method. Means and variances were normalized to have a mean of 0 and a variance of 1.

[0141] result: There were no significant differences in mean body weight between the control group and any of the other treatment groups on any day during the treatment period. There were no significant differences in mean body weight on the day of sacrifice among the treatment groups.

[0142] Gut Microbiome Analysis: Alpha diversity index (Simpson and Shannon) index showed that gut microbiota diversity was highest in the AFO-202+N-163 (Gr. 4) sample after the intervention (Figures 22A and B). Taxonomic profiling showed that Firmicutes represented the most abundant phylum, followed by Bacteroidetes (Figure 23).

[0143] After the intervention, Firmicutes decreased while Bacteroidetes increased, and the decrease in Firmicutes and increase in Bacteroidetes were highest in the AFO-202+N-163 and Telmisartan groups compared to all other groups (Figure 29). Analysis of individual taxa in each of the beta-glucan groups compared to telmisartan (standard) showed that Turicibacter was highest in the N-163 group. Bilophila increased in all groups but decreased to zero in the N-163 group. Increase in Lactobacillus was highest in the AFO-202+N-163 combination group. Proteobacteria decreased in the AFO-202+N-163 group while it increased in telmisartan. Decrease in Akkermansia was highest in the AFO-202+N-163 group (Figure 24).

[0144] Fecal metabolome analysis: The score plots of the principal component analysis results using the normalized peak heights of 10 samples (pre- and post-intervention of 5 groups) are shown in FIG. 30. The contribution rate of the first principal component was 55% and the contribution rate of the second principal component was 20%. The principal component analysis of 5 post-intervention samples (F18S-12, F18S-14, F18S-16, F18S-18, F18S-20) using normalized peak heights and the resulting score plots are shown in FIG. 30A, as well as the loading plots in FIG. 30B. The contribution rate of the first principal component was 49% and the contribution rate of the second principal component was 34%. Values ​​that showed a decrease after intervention are highlighted in bold in the different groups. The number of peaks detected in the QC samples was 108, of which 53 peaks were qualitative and 55 peaks were unknown. The results of abundance shift analysis, log2 fold change, are shown in FIG.

[0145] The score plot of PCA and the compounds with VIP value 1 or more in OPLS-DA are shown in Figure 26. The results of principal component analysis of the control group showed that the contribution rate of the first principal component axis (PC1) was 96.7%, and that of the second principal component axis (PC2) was 1.5%. In the N-163 group, PC1 and PC2 had contribution rates of 94.8% and 2.1%, respectively. In the AFO-202+N-163 group, PC1 and PC2 had contribution rates of 96.5% and 1.4%, respectively. In the telmisartan group, PC1 and PC2 had contribution rates of 95.1% and 1.9%, respectively.

[0146] Phosphate showed the highest increase in log2 fold change while putrescine showed the highest decrease in all groups except telmisartan-treated mice. For specific compounds, the increase in phosphate was highest in N-163, followed by the AFO-202+N-163 combination, but not significant (p-value=0.21). Tryptophan decreased in the AFO-202+N-163 combination group (non-significant p-value=0.99) while it increased in the other groups (Figure 27). The decrease in isoleucine (significant; p-value=0.004) and leucine was highest in the N-163 group (significant; p-value=0.012) (Figure 27). The decrease in phenylalanine was highest in the AFO-202+N-163 combination group (non-significant p-value=0.18) (Figure 27). Methionine was found to increase in all groups (non-significant p-value=0.14) (Figure 27). The decrease in spermidine was highest in the N-163 group, which was statistically significant (Figure 27) (p-value = 0.012). The increase in ornithine was highest in the AFO-202 + N-163 combination group (Figure 27J). Euclidean distance hierarchical clustering analysis, revealing different intensity levels of characteristic metabolites, was also consistent with the above observations (Figures 28 and 31).

[0147] Consider: This is the first study to investigate the effects of beta-glucan on fecal gut microbiome and metabolomic profiles in mice with a NASH model. In this study, we investigated two different beta-glucans produced by different strains of the same species of black yeast, A. pullulans. The beta-glucans were obtained from different sources and their functions depend on the source and extraction / purification process [B11]. The beta-glucans described in this study from A. pullulans black yeast strains AFO-202 and N-163 are unique because they are produced as exopolysaccharides without the need for extraction / purification, and therefore have superior biological effects [B12].

[0148] Moreover, both beta-glucans have the same chemical formula but different structural formulas, hence exerting diverse biological actions. AFO-202 beta-glucan has been reported to have excellent metabolic benefits by normalizing blood glucose levels [B3], apart from immune enhancement in immune-infectious diseases such as COVID-19 [B8, B9], as well as distinct effects on melatonin and alpha-synuclein neurotransmitters [B5, B6], apart from improving sleep and behavior in neurodevelopmental disorders such as ASD. In NASH animal studies, AFO-202 beta-glucan was able to significantly reduce inflammation-associated hepatocyte ballooning and steatosis [B7]. N-163 beta-glucan has been able to produce immune-modulating benefits in terms of regulating dyslipidemia, evident from the balance of the levels of non-esterified fatty acids [B13], as well as reducing fibrosis and inflammation in NASH [B7].

[0149] The combination of AFO-202 and N-163 beta-glucan has been shown to reduce pro-inflammatory markers and increase anti-inflammatory markers in healthy human volunteers [B14], reduce NAFLD activity score (NAS) in NASH models [B7], and significantly control immune-mediated dysregulated levels of IL-6, CRP and ferritin in Covid-19 patients [B8, B9]. In a study done on the analysis of the gut microbiome in ASD subjects, apart from the beneficial reconstitution of the gut microbiome favorable for generating benefits in ASD by AFO-202 beta-glucan, there was an efficient control of gut bacteria [B10]. In the present study, we sought to evaluate the benefits of AFO-202 and N-163 alone and in combination in NASH animal models.

[0150] For these studies, we used the Steric Animal Model of NASH (STAM) [B7, B15, B16]. In this model, mice are injected with streptozotocin solution and fed a high-fat diet on the second day of life to develop hepatic steatosis. This model reproduces most of the features of the metabolic syndrome of NASH that occurs in humans, where obesity and a high-fat diet lead to diabetes, dyslipidemia, and hepatic steatosis. Therefore, the gut microbiome profile and fecal metabolite profile present at baseline may be considered to reproduce those present in the metabolic syndrome [B17, B18], which will produce pathophysiological problems over time in different organ systems of the body, including the heart, liver, and kidneys, apart from the immune-metabolic interactions that lead to an age-related decline in the immune system and its associated complications. Therefore, this study will pave the way for investigating the effects of beta-glucan on different aspects of pathology related to metabolic syndrome, as well as diseases related to such immune-metabolic interactions [B17], including neurological disorders in which immune-metabolic interactions are deeply involved.

[0151] Metabolome and Microbiome Association with NASH: It has been reported that bacterial species such as Proteobacteria, Enterobacteria, and Escherichia coli are abundant in humans with nonalcoholic fatty liver disease (NAFLD). A greater abundance of Prevotella has been reported in obese children with NAFLD [B18, B19]. In the present study, a reduction in Enterobacteria with AFO-202 and a significant reduction in Prevotella with the combination of AFO-202+N-163 have been observed. In terms of fecal metabolites, an increase in tryptophan was observed with N-163, but not as great as telmisartan. It has been found that tryptophan metabolism is inhibited in NAFLD, and tryptophan supplementation has been found to be beneficial as it increases gut integrity and improves liver steatosis and function in a mouse model of NAFLD [B19]. Decreased production of butyrate has been shown to increase gut inflammation, leading to increased intestinal permeability, endotoxemia, and systemic inflammation. In the AFO-202+N-163 group, an increased abundance of 2-hydroxyisobutyric acid is observed.

[0152] [Table 5]

[0153] The increase in tryptophan after administration of N-163 beta glucan has potential as an anti-cancer agent. The decrease in amino acids such as isoleucine and leucine helps against oxidative stress, endothelial dysfunction, and inflammation. The increase in spermidine helps to alleviate inflammation. The decrease in tryptophan after administration of the combination of AFO-202 and N-163 beta glucan is beneficial as it increases intestinal integrity and improves liver steatosis and function. The decrease in phenylalanine helps against hepatic encephalopathy that occurs during liver failure. The increase in ornithine in the combination of AFO-202 and N-163 has potential as an anti-cancer agent.

[0154] Other Involvement: It has been reported that in overweight / obese humans, low fecal bacterial diversity is associated with more pronounced increases in adipose tissue dyslipidemia, impaired glucose homeostasis, and high low-grade inflammation [B26]. In the present study, bacterial diversity increased after the intervention, and the combination (AFO-202+N-163) group in particular showed the highest diversity in Shannon and Simpson indices (Figure 23). Most studies have reported that the increase in Firmicutes and the decrease in Bacteroidetes are directly proportional to weight gain [B26, B27]. In the present study, there was a clear decrease in Firmicutes and an increase in Bacteroidetes in all groups after the intervention, but the highest was in the combination (AFO-202+N-163) and telmisartan groups (Figures 23, 24). Spermidine is a metabolite that has been linked to inflammation and cancer [B28].

[0155] The decrease in spermidine was highest in the N-163 group (Figure 29). Ornithine has been found to be decreased in colon cancer patients [B29]. In the present study, the increase in ornithine was highest in the combination (AFO-202+N-163). Lactobacillus is a common probiotic used to prevent and treat chronic diseases such as cancer [B31] and promote better health. The increase in Lactobacillus was highest in the combination (AFO-202+N-163) (Figure 25). Steroids are common immunosuppressants used to treat chronic autoimmune diseases, as well as organ transplant patients. It has been reported that the use of steroids results in an increase in Escherichia coli, Enterococcus, while a decrease in Bacteroides [B31]. In the present study, the control of enterobacteria with an increase in Bacteroides by AFO-202, N-163, and their combination may also be valuable as an adjuvant to drugs such as steroids. Compared with N-163 alone, the combination of AFO-202+N-163 has a more profound beneficial effect on gut microbiota and alleviates dysbiosis.In particular, the increase in Lactobacillus, one of the most common bacteria used in probiotics, increases in the combination of AFO-202+N-163, making it more significant.

[0156] Conclusion: In summary, beta-glucan produced by two strains of the black yeast A. pullulans, AFO-202 and N-163, promotes healthy bacteria apart from increasing gut microbial diversity, controlling harmful bacteria, and resulting in beneficial differences in fecal metabolites, all of which show healthy profiles both alone and in combination in this NASH animal model. The combination of AFO-202 and N-163 may also act as a preventive agent against chronic inflammatory and immune dysregulation diseases such as cancer, preserving systemic health. Based on the results of this study, further trials are warranted to determine whether the use of beta-glucan is useful for the treatment of many chronic human inflammatory diseases.

[0157] Principal component analysis (PCA) Principal component analysis (PCA) is a widely used technique for analyzing metabolomic data. It is a simple nonparametric method that can represent multidimensional nuclear magnetic resonance spectroscopy (NMR) or mass spectrometry (MS) spectra into a low-dimensional space, thereby providing a low-dimensional representation of the original data, which can be easily visualized and analyzed (Nyamundanda, G., Brennan, L. & Gormley, IC Probabilistic principal component analysis for metabolomic data. BMC Bioinformatics 11, 571 (2010). https: / / doi.org / 10.1186 / 1471-2105-11-571).

[0158] Legend: Principal component analysis (PCA) using the peak heights of all intervention groups after normalization resulted in the score and loading plots shown in Figure 30A and B. The contribution of the first principal component was 67.9% and that of the second was 21.7%. This contribution represents the effect of the intervention. The first principal component is the direction in space where the projection has the greatest variance. The second principal component is the direction that maximizes the variance among all directions orthogonal to the first principal component (https: / / www.stat.cmu.edu / ~cshalizi / uADA / 12 / lectures / ch18.pdf).

[0159] Table 6. Score plot (Figure 30A) [Table 6]

[0160] Table 7. Loading plot (Figure 30B) [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4]

[0161] (N-163 Beta Glucan Benefits for Anti-Inflammatory Activity in the Liver, Kidneys, and Lungs, Helping to Reverse Fibrosis) F18S research (Study in the STAM animal model of NASH disease) method Four groups were studied for 8 weeks in the STAM™ mouse model of NASH - (1) vehicle (RO water), (2) N-163 beta glucan, (3) AFO-202 + N-163 beta glucan, and (4) telmisartan (standard pharmacological intervention).

[0162] Method - RT-PCR Total RNA was extracted from liver and ileum samples using RNAiso (Takara Bio, Japan) according to the manufacturer's instructions. 1 μg of RNA was diluted in 4.4 mM MgCl 2Reverse transcription was performed using a reaction mixture containing 10 mM EDTA (F. Hoffmann-La Roche, Switzerland), 40 U of RNase inhibitor (Toyobo, Japan), 0.5 mM dNTPs (Promega, USA), 6.28 μM of random hexamer (Promega), 5x first strand buffer (Promega), 10 mM dithiothreitol (Invitrogen, USA), and 200 U of MMLV-RT (Invitrogen) in a final volume of 20 μL. The reaction was carried out at 37°C for 1 h and then at 99°C for 5 min. Real-time PCR was performed using real-time PCR DICE and TB Green™ Premix Ex Taq™ II (Takara Bio). To calculate relative mRNA expression levels, the expression of each gene (TNF-α, MCP-1, α-SMA, TIMP-1, PPARα, TGF-β, IL-6) was normalized to that of the reference gene 36B4 (gene symbol: Rplp0). The PCR primer sets and plate layout information are listed in Table 8.

[0163] Table 8. PCR primer information [Table 8]

[0164] result Reductions in free fatty acids (FFA) and alpha-SMA, both of which are associated with the development of cirrhosis secondary to NASH, were greater in the N-163 beta-glucan group. The reduction in TNF-alpha, TIMP-1, and MIP-2 in the N-163+AFO-202 beta-glucan group was greater than that in the N-163 group, making this combination a highly potential drug against inflammation, liver injury, and fibrosis [Figures 32-37].

[0165] Consider When mRNA markers of lipid metabolism and inflammation were studied in mice of NASH model after administration of N-163 and combination of AFO-202 and N-163 compared with control and telmisartan. Hepatic mRNA markers of inflammation (TNF-α, MIP-1) in the combination beta-glucan group of N-163+AFO-202 make it an ideal adjuvant for general inflammation and also in the prevention of liver damage and fibrosis. The mRNA markers of adipogenesis and lipid regulation and fibrosis (TIMP-1) were significant in the N-163 group alone compared with the combination beta-glucan.

[0166] Method - ELISA Plasma MIP2 levels were measured by commercially available ELISA kits, which are shown in Table 9. [Table 9]

[0167] result There was a greater decrease in MIP-2 in the N-163 + AFO-202 beta-glucan group than in the N-163 group [Figure 38].

[0168] Consider Macrophage inflammatory protein (MIP)-2 is produced in response to infection or injury. It plays an important role in the development of liver disease, as it mediates liver inflammation at higher concentrations (Reference: 10.3748 / wjg.v23.i17.3043). The reduction of MIP-2 in the beta-glucan group of the N-163+AFO-202 combination compared to the N-163 group may help make it an adjunct for the treatment of NASH and NAFLD.

[0169] (Comparison of different beta glucans with N-163 - KUWH data) Morphology of normal human dendritic cells (NHDC: CC-2701) expressing HLA-DR, CD11C, CD86, CD80, and CD14 treated with five types of beta-glucans (control: phosphate buffered saline (PBS); BG-2: N-163; BG-3: Micellar Glucan (registered trademark) (gel or liquid type), purchased from RL-JP Co., Ltd. (Japan); BG-4: Beta-Glucan NEW EX (gel or liquid type), purchased from Aureo Co., Ltd. (Japan); BG-5: Yeast Glucan (capsule, is the content powder?), purchased from Shell Life Japan Co., Ltd. (Japan)).

[0170] result The reduction in IL-4, 10 and 13 was highest in the N-163 group [Figures 39 and 40].

[0171] Consider Interleukins 4, 10, and 13 mediate important pro-inflammatory functions (ref: doi:10.1186 / rr40; https: / / www.jimmunol.org / content / 165 / 5 / 2783; https: / / www.frontiersin.org / articles / 10.3389 / fmed.2017.00139 / full). Thus, the reduction of these interleukins after addition of N-163 beta-glucan to normal human dendritic cells demonstrates the efficacy of this beta-glucan as a potent anti-inflammatory adjuvant.

[0172] mRNA expression of IL-4, IL-10 and IL-13 in normal human dendritic cells (NHDC:CC-2701) expressing HLA-DR, CD11C, CD86, CD80 and CD14 treated with beta-glucan Normal human dendritic cells (NHDC CC-2701: LONZA Co.) were treated with several kinds of beta-glucans (control: phosphate buffered saline (PBS); BG-1: N-163; BG-2: beta-glucan NEW EX (gel or liquid type), purchased from Aureo Co., Ltd. (Japan); BG-3: Yeast Glucan (capsule, powder or not), purchased from Shell Life Japan Co., Ltd. (Japan)) (final concentration: 50 μg / mL) for 4 days. IL-4 mRNA expression was tested using RT-PCR.

[0173] result The results are shown in Figure 41. The decrease in IL-4 was significant in N-163BG.

[0174] Consider Interleukin-4 mediates important pro-inflammatory functions in asthma, including induction of IgE isotype rearrangement, expression of VCAM-1 molecule (vascular cell adhesion molecule 1), promoting eosinophil migration through the endothelium, mucus secretion, and T helper 2 (Th2) leading to cytokine release [C1]. Thus, reduction of IL-4 in N-163 is beneficial against inflammation.

[0175] Normal human dendritic cells (NHDC CC-2701: LONZA Co.) were treated with several kinds of beta-glucans (control: phosphate buffered saline (PBS); BG-1: N-163BG; BG-2: Micellar Glucan (registered trademark) (gel or liquid type), purchased from RL-JP Co., Ltd., Japan; BG-3: Yeast Glucan (capsule, powder content?), purchased from Shell Life Japan Co., Ltd., Japan) (final concentration: 50 μg / mL) for 4 days. IL-10 mRNA expression was tested using RT-PCR.

[0176] result The results are shown in Figure 42. The decrease in IL-10 is greatest in BG1-N-163.

[0177] Consider Pro-inflammatory effects of IL-10 During human endotoxemia, IL-10 is considered a potent anti-inflammatory cytokine that strongly suppresses the production of pro-inflammatory cytokines. Recent studies suggest that IL-10 also has immunostimulatory properties for CD4+, CD8+ T cells, and / or NK cells, resulting in increased IFN-γ production. These data point out that treatment with high doses of IL-10 in patients with inflammatory disorders may be associated with undesirable pro-inflammatory effects [C2]. Thus, the reduction of IL-4 in BG1-N-163 is beneficial.

[0178] Normal human dendritic cells (NHDC CC-2701: LONZA Co.) were treated with several kinds of beta-glucans (control: phosphate buffered saline (PBS); BG-1: N-163BG; BG-2: beta-glucan NEW EX (gel or liquid type), purchased from Aureo Co., Ltd. (Japan); BG-3: Yeast Glucan (capsule, powder or not), purchased from Shell Life Japan Co., Ltd. (Japan)) (final concentration: 50 μg / mL) for 4 days. The mRNA expression of IL-13 was tested using RT-PCR.

[0179] result The results are shown in Figure 43. The decrease in IL-13 is significant in N-163BG.

[0180] Consider IL-13 is a pleiotropic type 2 cytokine that has been shown to be essential in the pathogenesis of asthma and other eosinophilic disorders. IL-13 levels are elevated in animal models of eosinophilic inflammation, as well as in the blood and tissues of patients diagnosed with eosinophilic disorders [C3]. Therefore, reduction of IL-13 in BG1-N-163 is beneficial.

[0181] (MoA (Mechanism of Action; Pathway / signature) Evaluation) This assessment is based on the results of metabolomic analysis from the F18S study.

[0182] method 1. Title Elucidation of the MoA of β-glucan-related compounds [Analysis number: SC SC22020201]2. 2. Purpose of the analysis To clarify the MoA of β-glucan-related compounds based on metabolomic analysis using Socium's technology (Attachment 1) using metabolomic data of β-glucan-related compounds provided by GNC Corporation. 3. Analysis details Based on the metabolome data of three beta-glucan-related compounds owned by GNC, Socium's proprietary mathematical information technology will be used to analyze the metabolome data and convert it into enzyme abundance before and after metabolite formation, and imprinting and significant pathways will be inferred. Furthermore, the imprinting and pathway information will be collected through meta-analysis to provide analytical results that contribute to the elucidation of MoA and target molecules. 4. Reagents, Instruments, Analytical Software, and Public Databases Analysis Software Manufacturer Model Number Compound Eyes in-house development, patent no. 6356015 5. Database Configuration URL The Human Metabolome Database The Human Metabolome Library (HML) https: / / hmdb.ca / The Molecular Signatures Database (MSigDB) Broad Institute http: / / software.broadinstitute.org / gsea / msigdb -

[0183] Molecular imprints and significant pathways [Table 10]

[0184] Table 11. Upregulated genes [Table 11]

[0185] Table 12. Downregulated genes [Table 12]

[0186] result There was upregulation of ALDH5A1, BBOX1, P4HA1, P4HA2, SDHA, SDHB, SDHC, and SDHD genes in the N-163 group. Genes such as CPT1A, CPT1B, CPT-2, LPL MGLL, PAPSS1, and PLA2G2E were downregulated in the N-163 group.

[0187] Consider Carnitine palmitoyltransferase (CPT) is present on the outer mitochondrial surface and serves as a regulatory site for fatty acid oxidation. Similarly, downregulation of genes related to lipogenesis and dyslipidemia leading to fatty liver (NASH) makes N-163 beta-glucan effective as a preventive agent against NASH. P4HA genes play a major role in hepatic metabolism. Therefore, their upregulation would help preserve liver function during NASH.

[0188] Modifications and other aspects Various modifications and variations of the described glucan products, compositions and methods, and concepts of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with certain preferred embodiments, it is understood that the invention as claimed is not intended to be limited to such specific embodiments. Various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art of chemistry, biology, medicine, environmental, cosmetic or food technology, or related fields, are intended to be within the scope of the following claims.

[0189] References: A1. Nakashima A, Sugimoto R, Suzuki K, Shirakata Y, Hashiguchi T, Yoshida C, Nakano Y. Anti-fibrotic activity of Euglena gracilis and paramylon in a mouse model of non-alcoholic steatohepatitis. Food Sci Nutr. 2018 Nov 8;7(1):139-147 A2. Oniciu DC, Hashiguchi T, Shibazaki Y, Bisgaier CL. Gemcabene downregulates inflammatory, lipid-altering and cell-signaling genes in the STAM TM model of NASH. PloS One. 2018 May 30;13(5): e0194568. A3. Oseini AM, Sanyal AJ. Therapies in non-alcoholic steatohepatitis (NASH). Liver Int. 2017 Jan;37 Suppl 1(Suppl 1):97-103 A4. Alam S, Kabir J, Mustafa G, Gupta U, Hasan SK, Alam AK. Effect of telmisartan on histological activity and fibrosis of non-alcoholic steatohepatitis: A 1-year randomized control trial. Saudi J Gastroenterol. 2016 Jan-Feb;22(1):69-76. A5. Yano H. Sophy Beta-Glucan is effective in alleviating increased blood sugar levels. Abstract presented at the 55 th Conference of the Japanese Society of Nutrition and Dietetics 2008. A6. Dedeepiya VD, Sivaraman G, Venkatesh AP, Preethy S, Abraham SJ. Potential effects of nichi glucan as a food supplement for diabetes mellitus and hyperlipidemia: preliminary findings from the study on three patients from India. Case Rep Med. 2012;2012:895370. A7. Ganesh JS, Rao YY, Ravikumar R, Jayakrishnan GA, Iwasaki M, Preethy S, Abraham SJ. Beneficial effects of black yeast derived 1-3, 1-6 Beta Glucan-Nichi Glucan in a dyslipidemic individual of Indian origin-a case report. J Diet Suppl 2014:11:1-6. A8. Starley BQ, Calcagno CJ, Harrison SA. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 2010 May;51(5):1820-32. A9. Dharmalingam M, Yamasandhi PG. Nonalcoholic Fatty Liver Disease and Type 2 Diabetes Mellitus. Indian J Endocrinol Metab. 2018 May-Jun;22(3):421-428. 10. Gadge P, Gadge R, Paralkar N, Jain P, Tanna V. Effect of telmisartan on blood pressure in patients of type 2 diabetes with or without complications. Perspect Clin Res. 2018 Oct-Dec;9(4):155-160. A11. Hamamoto Y, Honjo S, Kawasaki Y, Ikeda H, Mori K, Fujimoto K, Tatsuoka H, Iwasaki Y, Nomura K, Wada Y, Koshiyama H. Relationship between telmisartan dose and glycaemic control in Japanese patients with type 2 diabetes mellitus and hypertension: a retrospective study. Clin Drug Investig. 2012 Sep 1;32(9):577-82. A12. Ikewaki N, Fujii N, Onaka T, Ikewaki S, Inoko H. Immunological actions of Sophy beta-glucan (beta-1,3-1,6 glucan), currently available commercially as a health food supplement. Microbiol Immunol 2007: 51:861-73. A13. Zhu Y, Yao Y, Gao Y, Hu Y, Shi Z, Ren G. Suppressive Effects of Barley β-Glucans with Different Molecular Weight on 3T3-L1 Adipocyte Differentiation. J Food Sci. 2016 Mar;81(3):H786-93. A14. Ikewaki N, Dedeepiya VD, Iwasaki M, Abraham SJK. Commentary: Beyond “TRIM” Benefits of β-Glucan by Blood Glucose and Lipid Balancing Potentials in Its Defense Against COVID-19. Front Immunol. 2021 Mar 29;12:620658. A15. Lakatos HF, Thatcher TH, Kottmann RM, Garcia TM, Phipps RP, Sime PJ. The Role of PPARs in Lung Fibrosis. PPAR Res. 2007;2007:71323. A16. Zhang X, Chen X, Hong Q, Lin H, Zhu H, Liu Q, Wang J, Xie Y, Shang X, Shi S, Lu Y, Yin Z. TIMP-1 promotes age-related renal fibrosis through upregulating ICAM-1 in human TIMP-1 transgenic mice. J Gerontol A Biol Sci Med Sci. 2006 Nov;61(11):1130-43. A17. Fielding CA, Jones GW, McLoughlin RM, McLeod L, Hammond VJ, Uceda J, Williams AS, Lambie M, Foster TL, Liao CT, Rice CM, Greenhill CJ, Colmont CS, Hams E, Coles B, Kift-Morgan A, Newton Z, Craig KJ, Williams JD, Williams GT, Davies SJ, Humphreys IR, O’Donnell VB, Taylor PR, Jenkins BJ, Topley N, Jones SA. Interleukin-6 signaling drives fibrosis in unresolved inflammation. Immunity. 2014 Jan 16;40(1):40-50. A18. Jun JI, Lau LF. Resolution of organ fibrosis. J Clin Invest. 2018 Jan 2;128(1):97-107. A19. Liedtke C, Luedde T, Sauerbruch T, Scholten D, Streetz K, Tacke F, Tolba R, Trautwein C, Trebicka J, Weiskirchen R. Experimental liver fibrosis research: update on animal models, legal issues and translational aspects. Fibrogenesis Tissue Repair. 2013 Oct 1;6(1):19.

[0190] B1. Valdes AM, Walter J, Segal E, Spector TD. Role of the gut microbiota in nutrition and health. BMJ. 2018 Jun 13;361:k2179. B2. Zierer J, Jackson MA, Kastenmuller G, Mangino M, Long T, Telenti A, Mohney RP, Small KS, Bell JT, Steves CJ, Valdes AM, Spector TD, Menni C. The fecal metabolome as a functional readout of the gut microbiome. Nat Genet. 2018 Jun;50(6):790-795. B3. Dedeepiya V, Sivaraman G,Venkatesh A, Preethy S, Abraham S. Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia; Preliminary Findings from the Study on Three Patients from India. Case Reports in Medicine 2012 (2012), Article ID 895370 B4. Ganesh JS, Rao YY, Ravikumar R, Jayakrishnan AG, Iwasaki M, Preethy S, Abraham S. Beneficial effects of Black yeast derived 1-3, 1-6 beta glucan- Nichi Glucan in a dyslipidemic individual of Indian origin - A case report. J Diet Suppl. 2014;11(1):1-6. B5. Raghavan K, Dedeepiya VD, Ikewaki N, Sonoda T, Iwasaki M, Preethy S, Abraham SJK. Improvement of behavioural pattern and alpha-synuclein levels in autism spectrum disorder after consumption of a beta-glucan food supplement in a randomized, parallel-group pilot clinical study. BMJ Neurology Open (In print) B6. Raghavan K, Dedeepiya VD, Kandaswamy R, Balamurugan M, Ikewaki N, Sonoda T, Kurosawa G, Iwasaki M, Preethy S, Abraham SJK. Improvement of sleep patterns and serum melatonin levels in children with autism spectrum disorders after consumption of beta-1,3 / 1,6-glucan in a pilot clinical study.Research Square rs.3.rs-701988 / v1; doi: 10.21203 / rs.3.rs-701988 / v1 B7 Ikewaki N, Kurosawa G, Iwasaki M, Preethy S, Dedeepiya VD, Vaddi S, Senthilkumar R, Levy GA, Abraham SJK. Hepatoprotective effects of Aureobasidium pullulans derived Beta 1,3-1,6 biological response modifier glucans in a STAM- animal model of non-alcoholic steatohepatitis. bioRxiv 2021.07.08.451700; doi: 10.1101 / 2021.07.08.451700 B8 Pushkala S, Seshayyan S, Theranirajan E, Sudhakar D, Raghavan K, Dedeepiya VD, Ikewaki N,Iwasaki M, Preethy S, Abraham S. Efficient control of IL-6, CRP and ferritin in Covid-19 patients with two variants of beta-1,3-1,6 glucans in combination trial. withRxiv 2021.12.14.21267778; doi: 10.1101 / 2021.12.14.21267778 B9. Raghavan K, Dedeepiya VD, Suryaprakash V, Rao KS, Ikewaki N, Sonoda T, Levy GA, Iwasaki M, Senthilkumar R, Preethy S, Abraham SJK. Beneficial Effects of novel aureobasidium pullulans strains produced beta-1,3-1,6 glucans on interleukin-6 and D-Dimer levels in COVID-19 patients; results of a randomized multiple-arm pilot clinical study. Biomedicine and Pharmacotherapy 2021. sciencedirect. https: / / doi.org / 10.1016 / j.biopha.2021.112243 B10. Raghavan K, Dedeepiya VD, Yamamoto N, Ikewaki N, Sonoda T, Kurosawa G, Iwasaki M, Kandaswamy R, Senthilkumar R, Preethy S, Abraham SJK. Beneficial reconstitution of gut microbiota and control of alpha-synuclein and curli-amyloids-producing enterobacteria, by beta 1,3-1,6 glucans in a clinical pilot study of autism and potentials in neurodegenerative diseases. medRxiv 2021.10.26.21265505; doi: 10.1101 / 2021.10.26.21265505 B11. Bashir KMI, Choi JS. Clinical and Physiological Perspectives of β-Glucans: The Past, Present, and Future. Int J Mol Sci. 2017 Sep 5;18(9):1906. B12. Ikewaki N, Fujii N, Onaka T, Ikewaki S, Inoko H. Immunological actions of Sophy beta-glucan (beta-1,3-1,6 glucan), currently available commercially as a health food supplement. Microbiol Immunol. 2007;51(9):861-73. B13. Ikewaki N, Onaka T, Ikeue Y, Nagataki M, Kurosawa G, Dedeepiya VD, Rajmohan M, Vaddi S, Senthilkumar R, Preethy S, Abraham SJK. Beneficial effects of the AFO-202 and N-163 strains of Aureobasidium pullulans produced 1,3-1,6 beta glucans on non-esterified fatty acid levels in obese diabetic KKAy mice: A comparative study.bioRxiv 2021.07.22.453362; doi: 10.1101 / 2021.07.22.453362 B14. Ikewaki N, Sonoda T, Kurosawa G, Iwasaki M, Dedeepiya VD, Senthilkumar R, Preethy S, Abraham SJK. Immune and metabolic beneficial effects of Beta 1,3-1,6 glucans produced by two novel strains of Aureobasidium pullulans in healthy middle-aged Japanese men: An exploratory study. medRxiv 2021.08.05.21261640; doi: 10.1101 / 2021.08.05.21261640 B15. STAM Model. https: / / www.smccro-lab.com / service / service_disease_area / stam.html B16. Nakashima A, Sugimoto R, Suzuki K, Shirakata Y, Hashiguchi T, Yoshida C, Nakano Y. Anti-fibrotic activity of Euglena gracilis and paramylon in a mouse model of non-alcoholic steatohepatitis. Food Sci Nutr. 2018;7(1):139-147 B17. Dantzer R. Neuroimmune Interactions: From the Brain to the Immune System and Vice Versa. Physiol Rev. 2018 Jan 1;98(1):477-504. B18. Kolodziejczyk AA, Zheng D, Shibolet O, Elinav E. The role of the microbiome in NAFLD and NASH. EMBO Mol Med. 2019 Feb;11(2):e9302. doi: 10.15252 / emmm.201809302. PMID: 30591521; PMCID: PMC6365925. B19. Chen J, Vitetta L. Gut Microbiota Metabolites in NAFLD Pathogenesis and Therapeutic Implications. Int J Mol Sci. 2020 Jul 23;21(15):5214. doi: 10.3390 / ijms21155214. PMID: 32717871; PMCID: PMC7432372. B20. Kang DW, Adams JB, Vargason T, Santiago M, Hahn J, Krajmalnik-Brown R. Distinct Fecal and Plasma Metabolites in Children with Autism Spectrum Disorders and Their Modulation after Microbiota Transfer Therapy. mSphere. 2020 Oct 21;5(5):e00314-20. doi: 10.1128 / mSphere.00314-20. PMID: 33087514; PMCID: PMC7580952. B21. Vascellari S, Palmas V, Melis M, Pisanu S, Cusano R, Uva P, Perra D, Madau V, Sarchioto M, Oppo V, Simola N, Morelli M, Santoru ML, Atzori L, Melis M, Cossu G, Manzin A. Gut Microbiota and Metabolome Alterations Associated with Parkinson's Disease. mSystems. 2020 Sep 15;5(5):e00561-20. doi: 10.1128 / mSystems.00561-20. PMID: 32934117; PMCID: PMC7498685. B22. Bernstein CN, Forbes JD. Gut Microbiome in Inflammatory Bowel Disease and Other Chronic Immune-Mediated Inflammatory Diseases. Inflamm Intest Dis. 2017 Nov;2(2):116-123. doi: 10.1159 / 000481401. Epub 2017 Oct 20. PMID: 30018962; PMCID: PMC5988152. B23. Walker A, Schmitt-Kopplin P. The role of fecal sulfur metabolome in inflammatory bowel diseases. Int J Med Microbiol. 2021 Jul;311(5):151513. B24. Cirstea M, Radisavljevic N, Finlay BB. Good Bug, Bad Bug: Breaking through Microbial Stereotypes. Cell Host Microbe. 2018 Jan 10;23(1):10-13. B25. Heintz-Buschart A, Pandey U, Wicke T, Sixel-Doring F, Janzen A, Sittig-Wiegand E, Trenkwalder C, Oertel WH, Mollenhauer B, Wilmes P. The nasal and gut microbiome in Parkinson's disease and idiopathic rapid eye movement sleep behavior disorder. Mov Disord. 2018 Jan;33(1):88-98. doi: 10.1002 / mds.27105. Epub 2017 Aug 26. PMID: 28843021; PMCID: PMC5811909. B26. Davis CD. The Gut Microbiome and Its Role in Obesity. Nutr Today. 2016 Jul-Aug;51(4):167-174. doi: 10.1097 / NT.0000000000000167. PMID: 27795585; PMCID: PMC5082693. B27. Jumpertz R, Le DS, Turnbaugh PJ, et al. Energy-balance studies reveal associations between gut microbes, caloric load, and nutrient absorption in humans. Am. J. Clin. Nutr. 2011;94:58-65. B28. Yoshimoto S, Mitsuyama E, Yoshida K, Odamaki T, Xiao JZ. Enriched metabolites that potentially promote age-associated diseases in subjects with an elderly-type gut microbiota. Gut Microbes. 2021 Jan-Dec;13(1):1-11. B29. Le Gall G, Guttula K, Kellingray L, Tett AJ, Ten Hoopen R, Kemsley EK, Savva GM, Ibrahim A, Narbad A. Metabolite quantification of faecal extracts from colorectal cancer patients and healthy controls. Oncotarget. 2018 Sep 7;9(70):33278-33289. doi: 10.18632 / oncotarget.26022. Erratum in: Oncotarget. 2019 Feb 26;10(17):1660. PMID: 30279959; PMCID: PMC6161785. B30. Lu K, Dong S, Wu X, Jin R, Chen H. Probiotics in Cancer. Front Oncol. 2021 Mar 12;11:638148. B31. Gibson CM, Childs-Kean LM, Naziruddin Z, Howell CK. The alteration of the gut microbiome by immunosuppressive agents used in solid organ transplantation. Transpl Infect Dis. 2021 Feb;23(1):e13397. C1. John W Steinke, Larry Borish MD, Th2 cytokines and asthma - Interleukin-4: its role in the pathogenesis of asthma, and targeting it for asthma treatment with interleukin-4 receptor antagonists. Respiratory Research 2, Article number: 66 (2001). C2 Fanny N. Lauw, Dasja Pajkrt, C. Erik Hack, Masashi Kurimoto, Sander JH Van Deventer and Tom Van Der Poll. Proinflammatory Effects of IL-10 During Human Endotoxemia. J Immunol September 1, 2000, 165(5)2783-2789. C3. Emma Doran, Fang Cai, Cecile TJ Holweg, Kit Wong, Jochen Brumm and Joseph R. Arron. Interleukin-13 in Asthma and Other Eosinophilic Disorders. Front. Med., 19 September 2017.

Claims

1. A composition for preventing and / or treating fibrosis, comprising beta-glucan.

2. The composition according to claim 1, wherein the beta-glucan comprises beta-glucan produced by Aureobasidium pullulans N-163 (NITE BP-03377).

3. The composition according to claim 2, wherein the beta-glucan further comprises beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327).

4. The composition according to claim 1, wherein the beta-glucan consists of beta-glucan produced by Aureobasidium pullulans N-163 (NITE BP-03377) and beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327).

5. The composition according to any one of claims 1 to 4, which is used for preventing and / or treating non-alcoholic steatohepatitis (NASH).

6. A composition for improving the intestinal microbiota, comprising beta-glucan produced by Aureobasidium pullulans N-163 (NITE BP-03377).

7. The composition according to claim 6, which further comprises beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327).

8. The composition according to claim 6 or 7, wherein the improvement of the intestinal microbiota includes an increase in beneficial bacteria including Lactobacillus in the intestine and a decrease in Akkermansia.

9. The composition according to claim 6 or 7, wherein the composition is for preventive, ameliorative, and / or curative treatment of cancer and / or fibrosis.

10. A composition for balancing amino acids to a beneficial level, comprising beta-glucan produced by Aureobasidium pullulans N-163 (NITE BP-03377).

11. The composition according to claim 10, which further comprises beta-glucan produced by Aureobasidium pullulans AFO-202 (FERM BP-19327).

12. The composition according to claim 10, wherein the composition increases tryptophan and / or decreases isoleucine, leucine, and / or spermidine.

13. The composition according to claim 11, wherein the composition increases ornithine and / or decreases tryptophan and / or phenylalanine.

Images