Aryl compounds and pharmaceutical compositions that modulate IKZF2

Abstract

Disclosed are compounds and their salts that bind to cereblon and modulate cereblon activity. In some embodiments, the binding and modulation of cereblon results in the degradation of IKAROS family zinc finger proteins (e.g., IKZF2). The compounds have the formula (I): The compound is TIFF2024529298000179.tif31170.

Description

[Technical field]

[0001] [CROSS REFERENCE TO RELATED APPLICATIONS] This application claims the benefit under 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 220,323, filed July 9, 2021, and U.S. Provisional Application No. 63 / 314,992, filed February 28, 2022, each of which is incorporated by reference in its entirety.

[0002] The present disclosure provides compounds and their salts that bind to cereblon and thereby modulate cereblon activity. In some embodiments, certain compounds described herein bind to cereblon, resulting in a decrease in cellular IKAROS family zinc finger (IKZF) protein levels. In some embodiments, certain compounds described herein bind to cereblon but do not result in a decrease in cellular IKZF protein levels. In some embodiments, compounds disclosed herein bind to cereblon, thereby initiating the degradation of IKZF proteins (e.g., IKZF2). Also disclosed are pharmaceutical compositions comprising these compounds or their salts (e.g., pharma- ceutically acceptable salts), and methods of using such compounds and / or their salts in the treatment of various IKZF2-mediated diseases or disorders. [Background technology]

[0003] IKAROS family zinc finger 2 (IKZF2) (also known as Helios) is one of five members of the Ikaros family of transcription factors found in mammals. IKZF2 is a key regulator of T cell activity and function. Genetic deletion of Helios resulted in enhanced antitumor immune responses (Non-Patent Document 1). Notably, Helios is highly expressed in regulatory T cells (Treg), a subpopulation of T cells that limits the activity of effector T cells (Non-Patent Document 2). Selective deletion of Helios in regulatory T cells resulted in both loss of suppressive activity and acquisition of effector T cell function (Non-Patent Document 3, Non-Patent Document 4). Thus, Helios is a key factor in limiting T cell effector function in Treg.

[0004] Helios expression has also been reported to be upregulated in "exhausted" T cells in both chronic viral infection (Non-Patent Document 5, Non-Patent Document 6, Non-Patent Document 7) and tumor (Non-Patent Document 8, Non-Patent Document 9, Non-Patent Document 10, Non-Patent Document 11, Non-Patent Document 12) situations, as well as in the dysfunction of chimeric antigen receptor (CAR) T cells (Non-Patent Document 13). Overexpression or aberrant expression of Helios and various splice isoforms has been reported in several hematological malignancies, including T cell leukemia and lymphoma (Non-Patent Document 14, Non-Patent Document 15, Non-Patent Document 16). Furthermore, knockdown of Helios in a model of mixed lineage leukemia (MLL)-induced myeloid leukemia strongly suppressed proliferation and increased cell death (Non-Patent Document 17, Non-Patent Document 18).

[0005] Currently, anti-CTLA4 antibodies are used in clinical trials to target Tregs in tumors. However, targeting CTLA4 often leads to systemic activation of T effector cells, resulting in excessive toxicity and limiting therapeutic usefulness. Up to 75% of patients treated with anti-PD1 and anti-CTLA4 combination reported grade 3 or higher adverse events (Non-Patent Document 19).

[0006] There is a need for therapies that can target Tregs within tumors without causing systemic activation of T effector cells. Thus, IKZF2-specific modulators or degraders may focus enhanced immune responses to tumor or proximal areas, providing a potentially more tolerable and less toxic therapy for the treatment of IKZF2-mediated diseases. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Kim et al., Science 350:334-339 (2015) [Non-Patent Document 2] Elkord et al., Expert Opin. Biol. Ther. 12:1423-1425 (2012) [Non-Patent Document 3] Najagawa et al., Proc. Natl. Acad. Sci. USA 113:6248-6253 (2016) [Non-Patent Document 4] Yates et al., Proc. Natl. Acad. Sci. USA 115:2162-2167 (2018) [Non-Patent Document 5] Crawford et al., Immunity 40:289-302 (2014) [Non-Patent Document 6] Doering et al., Immunity 371130-1144 (2012) [Non-Patent Document 7] Scott-Browne et al., Immunity 45:1327-1340 (2016) [Non-Patent Document 8] Martinez et al., Immunity 42:265-278 (2015) [Non-Patent Document 9] Mognol et al., Proc. Natl. Acad. Sci. USA 114:E2776-E2785 (2017)

Non-Patent Document 10

Non-Patent Document 11

Non-Patent Document 12

Non-Patent Document 13

Non-Patent Document 14

Non-Patent Document 15

Non-Patent Document 16

Non-Patent Document 17

Non-Patent Document 18

Non-Patent Document 19

Summary of the Invention

[0008] Disclosed are compounds that bind to cereblon, thereby modulating cereblon activity. In some embodiments, certain compounds described herein bind to cereblon, resulting in a decrease in cellular IKAROS family zinc finger (IKZF) protein levels. In some embodiments, certain compounds described herein bind to cereblon, but do not result in a decrease in cellular IKZF protein levels. In some embodiments, certain compounds disclosed herein bind to cereblon, thereby initiating the degradation of IKZF proteins (e.g., IKZF2). Also disclosed are pharmaceutical compositions comprising these compounds or salts thereof (e.g., pharma- ceutically acceptable salts), and methods of using such compounds and / or salts thereof in the treatment of various IKZF2-mediated diseases or disorders, including, for example, cancer.

[0009] In one embodiment, the disclosed compounds that bind to and modulate cereblon and optionally degrade IKZF2 have formula I: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, n, p, q, r, s, and t are as defined in the detailed description and throughout the specification.

[0010] In one embodiment, the disclosed compounds that bind to and modulate cereblon and optionally degrade IKZF2 have formula II: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, n, p, s, and t are as defined in the detailed description and throughout the specification.

[0011] In one embodiment, the disclosed compounds that bind to and modulate cereblon and optionally degrade IKZF2 have formula III: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, q, r, s, and t are as defined in the detailed description and throughout the specification.

[0012] In one embodiment, the disclosed compounds that bind to and modulate cereblon and optionally degrade IKZF2 have formula IV: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, s, and t are as defined in the detailed description and throughout the specification.

[0013] In some embodiments, the disclosed compounds that bind to and modulate cereblon and optionally degrade IKZF2 have formula V: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, q, r, s, and t are as defined in the detailed description and throughout the specification.

[0014] In some embodiments, the disclosed compounds that bind to and modulate cereblon and optionally degrade IKZF2 have formula VI: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, s, and t are as defined in the detailed description and throughout the specification.

[0015] In one embodiment, compounds of Formula I or subformulas thereof are provided that selectively modulate IKZF (e.g., relative to translation termination factor GSPT1 (G1 to S phase transition 1 protein)). In one embodiment, compounds of Formula I or subformulas thereof are provided that selectively modulate IKZF2 relative to GSPT1.

[0016] In one embodiment, there is provided a composition comprising a compound of formula I or any subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, or tautomer of a compound of formula I or any subformula thereof. "Compounds of formula I and its subformulas" refers to compounds of formula I, II or subformulas thereof, III, IV, V, and VI, as defined herein.

[0017] In one embodiment, the disclosure provides a method of modulating cereblon, comprising contacting cereblon with an effective amount of a compound of Formula I, Formula II or any subformula thereof, Formula III, Formula IV, Formula V, or Formula VI, or a pharma- ceutically acceptable salt, solvate, stereoisomer, or tautomer thereof, under conditions such that cereblon is modulated.

[0018] In one embodiment, the disclosure provides a method for degrading IKZF2, comprising contacting IKZF2 with an effective amount of a compound of Formula I, Formula II or a subformula thereof, Formula III, Formula IV, Formula V, or Formula VI, or a pharma- ceutically acceptable salt, solvate, stereoisomer, or tautomer thereof, under conditions in which IKZF2 is degraded.

[0019] In one embodiment, a method of degrading IKZF2 in a subject is provided, comprising administering to the subject an effective amount of a compound of Formula I, Formula II or a subformula thereof, Formula III, Formula IV, Formula V, or Formula VI, or a pharma- ceutically acceptable salt, solvate, stereoisomer, or tautomer thereof, or administering to the subject a pharmaceutical composition comprising a pharma- ceutically acceptable excipient and an effective amount of a compound of Formula I, Formula II, or a subformula thereof, Formula III, Formula IV, Formula V, or Formula VI, or a pharma- ceutically acceptable salt, solvate, stereoisomer, or tautomer thereof.

[0020] Further provided is a method of treating cancer in a subject in need thereof, comprising selecting a subject with a cancer mediated at least in part by IKZF2, and administering to the subject an effective amount of a compound of Formula I, Formula II, or a subformula thereof, Formula III, Formula IV, Formula V, or Formula VI, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, or administering to the subject a pharmaceutical composition comprising a pharma- ceutically acceptable excipient and an effective amount of a compound of Formula I, Formula II, or a subformula thereof, Formula III, Formula IV, Formula V, or Formula VI, or a pharma- ceutically acceptable salt, solvate, stereoisomer, or tautomer thereof. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0021] The present disclosure provides compounds for treating diseases, disorders, or conditions mediated at least in part by IKZF2 transcription factor, pharmaceutical compositions comprising such compounds, and methods for treating diseases, disorders, or conditions mediated at least in part by IKZF2 transcription factor using such compounds and compositions.However, before providing a detailed description of the present disclosure, the following terms are first defined.Unless otherwise defined, the terms used herein have their generally accepted scientific meanings.

[0022] definition The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure. As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0023] A dash ("-") that is not between two letters or symbols is used to indicate a point of attachment to a substituent. For example, -C(O)NH2 is attached through a carbon atom. Dashes at the beginning or end of a chemical group are for convenience, and a chemical group may be shown with one or more dashes or without any dashes without loss of ordinary meaning. Wavy or dashed lines drawn through a line in a structure indicate a particular point of attachment of a group. Unless chemically or structurally required, no orientation or stereochemistry is indicated or implied by the order of listing or naming chemical groups.

[0024] Prefix “C” u~v " indicates that the following group has u to v carbon atoms. For example, "C 1~6 "Alkyl" indicates that the alkyl group has from 1 to 6 carbon atoms.

[0025] The term "about" when used before a numerical designation including a range, e.g., temperature, time, amount, concentration, etc., indicates an approximation that may vary by (+) or (-) 10%, 5%, 1%, or any subrange or subvalue therebetween. In one embodiment, the term "about" when used in reference to the amount of a dose means that the dose may vary by ±10%.

[0026] "Comprising" or "comprises" is intended to mean that the compositions and methods include the recited elements, but do not exclude other elements.

[0027] "Consisting essentially of," when used to define compositions and methods, shall mean excluding any other elements that are essential to the combination for the specified purpose. Thus, a composition consisting essentially of the elements defined herein does not exclude other materials or steps that do not materially affect the basic and novel characteristic(s) of the claimed disclosure.

[0028] "Consisting of" is intended to mean excluding more than trace amounts of other ingredients and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure.

[0029] "Alkyl" refers to an unbranched or branched saturated hydrocarbon chain. As used herein, alkyl refers to an alkyl group having 1 to 20 carbon atoms (i.e., C 1~20 alkyl), 1 to 12 carbon atoms (i.e. C 1~12 alkyl), 1 to 8 carbon atoms (i.e. C 1~8 alkyl), 1 to 6 carbon atoms (i.e. C 1~6 alkyl), or 1 to 4 carbon atoms (i.e., C 1~4 Examples of alkyl groups include, for example, methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl, and 3-methylpentyl. When an alkyl residue having a particular number of carbon atoms is named by a chemical name or identified by a molecular formula, all positional isomers having that number of carbon atoms may be included, so that, for example, "butyl" includes n-butyl (i.e., -(CH2)3CH3), sec-butyl (i.e., -CH(CH3)CH2CH3), isobutyl (i.e., -CH2CH(CH3)2), and tert-butyl (i.e., -C(CH3)3), and "propyl" includes n-propyl (i.e., -(CH2)2CH3) and isopropyl (i.e., -CH(CH3)2).

[0030] Certain commonly used alternative chemical names may be used. For example, divalent groups such as divalent "alkyl" groups, divalent "aryl" groups, divalent heteroaryl groups, etc. may also be referred to as "alkylene" or "alkylenyl" groups (e.g., methylenyl, ethylenyl, and propylenyl), "arylene" or "arylenyl" groups (e.g., phenylenyl or naphthylenyl, or, in the case of heteroarylene, quinolinyl), respectively. Also, unless otherwise indicated, when a combination of groups is referred to herein as a moiety, such as arylalkyl or aralkyl, the last-mentioned group includes the atom to which the moiety is attached to the remainder of the molecule.

[0031] "Alkenyl" refers to an alkyl group containing at least one (e.g., 1 to 3, or 1) carbon-carbon double bond and 2 to 20 carbon atoms (i.e., C 2~20 alkenyl), 2 to 12 carbon atoms (i.e. C 2~12 alkenyl), 2 to 8 carbon atoms (i.e. C 2~8 alkenyl), 2 to 6 carbon atoms (i.e. C 2~6 alkenyl), or 2 to 4 carbon atoms (i.e. C 2~4 Alkenyl refers to an alkyl group having an aryl group such as 1,2-butadienyl, 1,3-butadienyl, and 1,4-butadienyl. Examples of alkenyl groups include, for example, ethenyl, propenyl, and butadienyl (including 1,2-butadienyl and 1,3-butadienyl).

[0032] "Alkynyl" refers to an alkyl group containing at least one (e.g., 1 to 3, or 1) carbon-carbon triple bond and 2 to 20 carbon atoms (i.e., C 2~20 alkynyl), 2 to 12 carbon atoms (i.e., C 2~12 alkynyl), 2 to 8 carbon atoms (i.e., C 2~8 alkynyl), 2 to 6 carbon atoms (i.e., C 2~6 alkynyl), or 2 to 4 carbon atoms (i.e., C 2~4 The term "alkynyl" refers to an alkyl group having one triple bond and one double bond.

[0033] "Alkoxy" refers to the group "alkyl-O-." Example alkoxy groups include, for example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, sec-butoxy, n-pentoxy, n-hexoxy, and 1,2-dimethylbutoxy.

[0034] "Alkylthio" refers to the group "alkyl-S-". "Alkylsulfinyl" refers to the group "alkyl-S(O)-". "Alkylsulfonyl" refers to the group "alkyl-S(O)2-". "Alkylsulfonylalkyl" refers to -alkyl-S(O)2-alkyl.

[0035] "Acyl" is the group -C(O)R y Here, R y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein. Examples of acyls include, for example, formyl, acetyl, cyclohexylcarbonyl, cyclohexylmethyl-carbonyl, and benzoyl.

[0036] An "amide" is the group -C(O)NR y R z and the "C-amide" group, which refers to the group -NR y C(O)R z refers to both an "N-amido" group, where R y and R z is independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein, or R y and R z taken together form a cycloalkyl or heterocyclyl, each of which may be unsubstituted or substituted as defined herein.

[0037] "Amino" is the group -NR y R z where R y and R z is independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein.

[0038] "Amidino" is -C(NR y )(NR z 2), where R y and R z is independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein.

[0039] "Aryl" refers to an aromatic carbocyclic group having a single ring (e.g., monocyclic) or multiple rings (e.g., bicyclic or tricyclic), including fused systems. As used herein, aryl refers to an aromatic carbocyclic group having 6 to 20 ring carbon atoms (i.e., C 6~20 aryl), 6 to 12 ring carbon atoms (i.e. C 6~12 aryl), or 6 to 10 ring carbon atoms (i.e., C 6~10 aryl). Examples of aryl groups include, for example, phenyl, naphthyl, fluorenyl, and anthryl. However, aryl does not encompass or overlap in any way with heteroaryl, as defined below. When one or more aryl groups are fused to a heteroaryl, the resulting ring system is a heteroaryl, regardless of the point of attachment. When one or more aryl groups are fused to a heterocyclyl, the resulting ring system is a heterocyclyl, regardless of the point of attachment. When one or more aryl groups are fused to a cycloalkyl, the resulting ring system is a cycloalkyl, regardless of the point of attachment.

[0040] "Carbamoyl" is the group -OC(O)NR y Rz and the group -NR y C(O)OR z "N-carbamoyl" refers to both the y and R z is independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein.

[0041] "Carboxyl ester" or "ester" refers to the -OC(O)R x and -C(O)OR x and where R x is alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein.

[0042] "Cycloalkyl" refers to saturated or partially unsaturated cyclic alkyl groups having a single ring or multiple rings, including fused, bridged, and spiro ring systems. The term "cycloalkyl" includes cycloalkenyl groups (i.e., cyclic groups having at least one double bond) and at least one sp 3 As used herein, cycloalkyl includes carbocyclic fused ring systems having 3 to 20 ring carbon atoms (i.e., C 3~20 cycloalkyl), 3 to 14 ring carbon atoms (i.e., C 3~14 cycloalkyl), 3 to 12 ring carbon atoms (i.e., C 3~12 cycloalkyl), 3 to 10 ring carbon atoms (i.e., C 3~10 cycloalkyl), 3 to 8 ring carbon atoms (i.e., C 3~8 cycloalkyl), or 3 to 6 ring carbon atoms (i.e., C 3~6cycloalkyl). Monocyclic groups include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic groups include, for example, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, adamantyl, norbornyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. Furthermore, the term cycloalkyl is intended to encompass any non-aromatic ring that may be fused to an aryl ring, regardless of attachment to the remainder of the molecule. Furthermore, cycloalkyl also includes "spirocycloalkyl" when there are two substitution positions on the same carbon atom, such as spiro[2.5]octanyl, spiro[4.5]decanyl, or spiro[5.5]undecanyl.

[0043] "Imino" is the group -C(NR y )R z Here, R y and R z Each is independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein.

[0044] An "imide" is the group -C(O)NR y C(O)R z Here, R y and R z Each is independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein.

[0045] "Halogen" or "halo" refers to atoms occupying Group VIIA of the periodic table, such as fluoro, chloro, bromo, or iodo.

[0046] "Haloalkyl" refers to an unbranched or branched alkyl group as defined above in which one or more (e.g., 1-6 or 1-3) hydrogen atoms are replaced by halogen. For example, if a residue is substituted with more than two halogens, it can be referred to by using a prefix corresponding to the number of halogen moieties attached. Dihaloalkyl and trihaloalkyl refer to an alkyl substituted with two ("di") or three ("tri") halo groups, which may be, but are not necessarily, the same halogen. Examples of haloalkyl include, for example, trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, and the like.

[0047] "Haloalkoxy" refers to an alkoxy group, as defined above, in which one or more (eg, 1 to 6 or 1 to 3) hydrogen atoms are replaced by halogen.

[0048] "Hydroxyalkyl" refers to an alkyl group, as defined above, in which one or more (eg, 1 to 6 or 1 to 3) hydrogen atoms are replaced by a hydroxy group.

[0049] "Heteroalkyl" refers to an alkyl group in which one or more carbon atoms (and any associated hydrogen atoms), excluding any terminal carbon atom(s), are each independently replaced with the same or different heteroatomic group, but the point of attachment to the remainder of the molecule is through a carbon atom. The term "heteroalkyl" includes unbranched or branched saturated chains having carbon and heteroatoms. By way of example, one, two, or three carbon atoms may be independently replaced with the same or different heteroatomic groups. Heteroatomic groups include, but are not limited to, -NR y -, -O-, -S-, -S(O)-, -S(O)2-, etc., in which R yis hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein. Examples of heteroalkyl groups include, for example, ethers (e.g., -CHOCH, -CH(CH)OCH, -CHCHOCH, -CHCHOCH, -CHCHOCHCHOCH, etc.), thioethers (e.g., -CHSCH, -CH(CH)SCH, -CHCHSCH, -CHCHSCHCHSCH, etc.), sulfones (e.g., -CHS(O)CH, -CH(CH)S(O)CH, -CHCHS(O)CH, -CHCHS(O)CHCHOCH, etc.), and amines (e.g., -CHNR y CH3, -CH(CH3)NR y CH3, -CH2CH2NR y CH3, -CH2CH2NR y CH2CH2NR y CH3, etc., where R y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein. As used herein, heteroalkyl includes 2 to 10 carbon atoms, 2 to 8 carbon atoms, or 2 to 4 carbon atoms and 1 to 3 heteroatoms, 1 to 2 heteroatoms, or 1 heteroatom.

[0050] "Heteroaryl" refers to an aromatic group having a single ring, multiple rings, or multiple condensed rings, with one or more ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. As used herein, heteroaryl refers to an aromatic group having 1 to 20 ring carbon atoms (i.e., C 1~20 Heteroaryl), 3 to 12 ring carbon atoms (i.e., C 3~12 heteroaryl), or 3 to 8 carbon ring atoms (i.e., C 3~8Heteroaryl) and 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, oxygen, and sulfur. In certain cases, heteroaryl includes a 5- to 10-membered ring system, a 5- to 7-membered ring system, or a 5- to 6-membered ring system, each independently having 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, oxygen, and sulfur. Examples of heteroaryl groups include, for example, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzofuranyl, benzothiazolyl, benzothiadiazolyl, benzonaphthofuranyl, benzoxazolyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, and isoindo. canyl, isoquinolyl, isoxazolyl, naphthyridinyl, oxadiazolyl, oxazolyl, 1-oxidopyridinyl, 1-oxidopyrimidinyl, 1-oxidopyrazinyl, 1-oxidopyridazinyl, phenazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolinyl, quinuclidinyl, isoquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, and triazinyl. Examples of fused heteroaryl rings include, but are not limited to, benzo[d]thiazolyl, quinolinyl, isoquinolinyl, benzo[b]thiophenyl, indazolyl, benzo[d]imidazolyl, pyrazolo[1,5-a]pyridinyl, and imidazo[1,5-a]pyridinyl, where the heteroaryl may be bonded through any ring of the fused system. Any aromatic ring having a single ring or multiple fused rings and containing at least one heteroatom is considered heteroaryl, regardless of attachment to the rest of the molecule (i.e., through any one of the fused rings). Heteroaryl does not include or have in common with aryl as defined above.

[0051] "Heterocyclyl" (used interchangeably with "heterocycloalkyl") refers to a saturated or partially unsaturated cyclic alkyl group having one or more ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. The term "heterocyclyl" includes heterocycloalkenyl groups (i.e., heterocyclyl groups having at least one double bond), bridged heterocyclyl groups, fused heterocyclyl groups, and spiro heterocyclyl groups. Heterocyclyls may be monocyclic or polycyclic, where the polycyclic rings may be fused, bridged, or spiro, and may contain one or more (e.g., 1 to 3) oxo (=O) moieties or N-oxide (-O - ) moieties. Any non-aromatic ring containing at least one heteroatom, regardless of attachment (i.e., it may be bonded via a carbon atom or a heteroatom), is considered a heterocyclyl. Additionally, the term heterocyclyl is intended to encompass any non-aromatic ring containing at least one heteroatom, which may be fused to a cycloalkyl, aryl, or heteroaryl ring, regardless of attachment of the ring to the remainder of the molecule. As used herein, heterocyclyl refers to a ring having from 2 to 20 ring carbon atoms (i.e., C 2~20 heterocyclyl), 2 to 12 ring carbon atoms (i.e., C 2~12 heterocyclyl), 2 to 10 ring carbon atoms (i.e., C 2~10 heterocyclyl), 2 to 8 ring carbon atoms (i.e., C 2~8 heterocyclyl), 3 to 12 ring carbon atoms (i.e., C 3~12 heterocyclyl), 3 to 8 ring carbon atoms (i.e., C 3~8 heterocyclyl), or 3 to 6 ring carbon atoms (i.e., C 3~6Heterocyclyl) and has 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, sulfur, or oxygen. Examples of heterocyclyl groups include, for example, azetidinyl, azepinyl, benzodioxolyl, benzo[b][1,4]dioxepinyl, 1,4-benzodioxanyl, benzopyranyl, benzodioxinyl, benzopyranonyl, benzofuranonyl, dioxolanyl, dihydropyranyl, hydropyranyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, furanonyl, imidazolinyl, imidazolidinyl, indolinyl, indolizinyl, isoindolinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoquinol ... The term "heterocyclyl" includes "spiroheterocyclyl" when there are two substitution positions on the same carbon atom. Examples of spiro-type heterocyclyl rings include bicyclic and tricyclic ring systems such as, for example, oxabicyclo[2.2.2]octanyl, 2-oxa-7-azaspiro[3.5]nonanyl, 2-oxa-6-azaspiro[3.4]octanyl, and 6-oxa-1-azaspiro[3.3]heptanyl. Examples of fused heterocyclyl rings include, but are not limited to, 1,2,3,4-tetrahydroisoquinolinyl, 4,5,6,7-tetrahydrothieno[2,3-c]pyridinyl, indolinyl, and isoindolinyl, where the heterocyclyl may be attached via either ring of the fused system.In some embodiments, the heterocycloalkyl can be optionally substituted with oxo group(s) on the heteroatom (eg, S=O, S(=O)2).

[0052] "Oxime" is a group -CR y (=NOH), where R y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein.

[0053] "Oxo" refers to the moiety ═O.

[0054] "Sulfonyl" refers to the group -S(O)R y where R y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein. Examples of sulfonyl are methylsulfonyl, ethylsulfonyl, phenylsulfonyl, and toluenesulfonyl.

[0055] "Sulfinyl" is the group -S(O)R y where R y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein. Examples of sulfinyl are methylsulfinyl, ethylsulfinyl, phenylsulfinyl, and toluenesulfinyl.

[0056] "Sulfonamide" is the group -SONR y R z and -NR y SO2R z where R y and R zEach is independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be unsubstituted or substituted as defined herein.

[0057] The term "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and the description includes cases where that event or circumstance occurs or does not occur. Also, the term "optionally substituted" refers to any one or more (e.g., 1-5 or 1-3) hydrogen atoms on a specified atom or group may or may not be replaced with a non-hydrogen moiety.

[0058] As used herein, the term "substituted" refers to at least one (e.g., 1 to 5 or 1 to 3) hydrogen atom in any of the above groups (i.e., alkyl, alkenyl, alkynyl, alkylene, alkoxy, haloalkyl, haloalkoxy, cycloalkyl, aryl, heterocyclyl, heteroaryl, and / or heteroalkyl) being substituted with, but not limited to, alkyl, alkenyl, alkynyl, alkoxy, alkylthio, acyl, amido, amino, amidino, aryl, aralkyl, azido, carbamoyl, carboxy, or carboxyl. sil, carboxylester, cyano, cycloalkyl, cycloalkylalkyl, guanadino, halo, haloalkyl, haloalkoxy, hydroxyalkyl, heteroalkyl, heteroaryl, heteroarylalkyl, heterocyclyl, heterocyclylalkyl, -NHNH2, =NNH2, imino, imido, hydroxy, oxo, oxime, nitro, sulfonyl, sulfinyl, alkylsulfonyl, alkylsulfinyl, thiocyanate, -S(O)OH, -S(O)2OH, sulfonamide, thiol, thioxo, N-oxide, or -Si(R y )3 (where each R yis replaced by a bond to a non-hydrogen atom, such as an alkyl, alkyl group, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, aryl, heteroaryl, or heterocyclyl, which are independently hydrogen, alkyl, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, aryl, heteroaryl, or heterocyclyl.

[0059] In certain embodiments, "substituted" refers to any one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms in any of the above alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl groups being independently substituted with deuterium, halo, cyano, nitro, azido, oxo, alkyl, alkenyl, alkynyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, -NR g R h , -NR g C(O)R h , -NR g C(O)NR g R h , -NR g C(O)OR h , -NR g S(O) 1~2 R h , -C(O)R g , -C(O)OR g , -OC(O)OR g , -OC(O)R g , -C(O)NR g R h , -OC(O)NR g R h , -OR g , -SR g , -S(O)R g , -S(O)2R g , -OS(O) 1~2 R g , -S(O) 1~2 OR g , -NR g S(O) 1~2 NR g R h , =NSO2R g , =NOR g , -S(O) 1~2 NR g R h, -SF5, -SCF3, or -OCF3. In certain embodiments, "substituted" also refers to any of the above in which one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms have been replaced with -C(O)R g , -C(O)OR g , -C(O)NR g R h , -CH2SO2R g or -CH2SO2NR g R h In the above, R g and R h are the same or different and are independently hydrogen, alkyl, alkenyl, alkynyl, alkoxy, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, haloalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, and / or heteroarylalkyl. In certain embodiments, "substituted" refers to one or more (e.g., 1-5 or 1-3) hydrogen atoms in any of the above groups being replaced by a bond to amino, cyano, hydroxy, imino, nitro, oxo, thioxo, halo, alkyl, alkoxy, alkylamino, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, haloalkyl, heterocyclyl, N-heterocyclyl, heterocyclylalkyl, heteroaryl, and / or heteroarylalkyl, or R g and R h are taken together with the atom to which they are attached to form a heterocyclyl ring that is unsubstituted or substituted with oxo, halo, or alkyl (unsubstituted or substituted with oxo, halo, amino, hydroxy, or alkoxy).

[0060] Polymers or similar indefinite structures arrived at by defining a substituent with unlimited addition of further substituents (e.g., substituted aryl with substituted alkyl, itself substituted with substituted aryl group, which is further substituted with substituted heteroalkyl group, etc.) are not intended to be included herein. Unless otherwise specified, the maximum number of consecutive substitutions in the compounds described herein is 3. For example, consecutive substitution of a substituted aryl group with two other substituted aryl groups is limited to ((substituted aryl) substituted aryl) substituted aryl. Similarly, the above definition is not intended to include impermissible substitution patterns (e.g., methyl substituted with 5 fluorines, or a heteroaryl group with two adjacent oxygen ring atoms). Such impermissible substitution patterns are well known to those skilled in the art. When used to modify a chemical group, the term "substituted" may refer to other chemical groups as defined herein.

[0061] In certain embodiments, as used herein, the phrase "one or more" refers to 1 to 5. In certain embodiments, as used herein, the phrase "one or more" refers to 1 to 3.

[0062] Any compound or structure depicted herein is intended to represent unlabeled forms of the compound as well as isotopically labeled forms. These forms of the compounds may also be referred to as "isotopically enriched analogs." Isotopically labeled compounds have structures depicted herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Examples of isotopes that can be incorporated into the disclosed compounds include, but are not limited to, isotopically labeled, isotopically labeled, and isotopically labeled. 2 H, 3 H, 11 C. 13 C. 14 C. 13 N, 15 N, 15 O. 17 O. 18 O. 31 P, 32 P, 35 S, 18F, 36 Cl, 123 I, and 125 Included are isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, chlorine, and iodine, such as I. Various isotopically labeled compounds of the present disclosure are, for example, 3 H and 14 C. Such isotopically labeled compounds may be useful in metabolic studies, reaction kinetic studies, detection or imaging techniques such as positron emission tomography (PET) or single photon emission computed tomography (SPECT), including drug or substrate tissue distribution assays, or in radiation treatment of patients.

[0063] The term "isotopically enriched analog" includes the "deuterated analog" of the compounds described herein, in which one or more hydrogens, such as hydrogens on carbon atoms, are replaced by deuterium. Such compounds are highly resistant to metabolism and are therefore useful for increasing the half-life of any compound when administered to a mammal, particularly a human. See, for example, Foster, "Deuterium Isotope Effects in Studies of Drug Metabolism," Trends Pharmacol. Sci. 5(12): 524-527 (1984). Such compounds are synthesized by means known in the art, for example, using starting materials in which one or more hydrogens are replaced by deuterium.

[0064] Deuterium-labeled or substituted therapeutic compounds of the present disclosure may have improved DMPK (drug metabolism and pharmacokinetic) properties related to absorption, distribution, metabolism, and excretion (ADME). Substitution with heavier isotopes such as deuterium may confer certain therapeutic advantages due to greater metabolic stability, e.g., increased in vivo half-life, reduced dosage requirements, and / or improved therapeutic index. 18 F, 3 H or 11C labeled compounds may be useful for PET or SPECT or other imaging studies. The isotopically labeled compounds and their prodrugs of the present disclosure can generally be prepared by carrying out the procedures disclosed in the schemes or in the examples and preparations described below, substituting non-isotopically labeled reagents with readily available isotopically labeled reagents. In this regard, it is understood that deuterium is considered as a substituent in the compounds described herein.

[0065] The concentration of such heavier isotopes, specifically deuterium, can be defined by the isotopic enrichment factor. In the compounds of the present disclosure, any atom not specifically designated as a particular isotope is meant to represent any stable isotope of that atom. Unless otherwise noted, when a position is specifically designated as "H" or "hydrogen", the position is understood to have hydrogen in natural abundance isotopic composition. Thus, in the compounds of the present disclosure, any atom specifically designated as deuterium (D) is meant to represent deuterium.

[0066] In many cases, the compounds of the present disclosure are capable of forming acid and / or base salts by virtue of the presence of amino and / or carboxyl groups or groups similar thereto.

[0067] Pharmaceutically acceptable salts, isotopically enriched analogs, deuterated analogs, stereoisomers, mixtures of stereoisomers, and prodrugs of the compounds described herein are also provided. "Pharmaceutically acceptable" or "physiologically acceptable" refers to compounds, salts, compositions, dosage forms, and other materials useful in the preparation of pharmaceutical compositions suitable for veterinary or human pharmaceutical use.

[0068] The term "pharmaceutically acceptable salt" of a given compound refers to a salt that retains the biological effectiveness and properties of the given compound and is not biologically or otherwise undesirable. "Pharmaceutically acceptable salt" or "physiologically acceptable salt" includes, for example, salts with inorganic acids and salts with organic acids. Furthermore, when a compound described herein is obtained as an acid addition salt, the free base can be obtained by basifying a solution of the acid salt. Conversely, when the product is a free base, an addition salt, particularly a pharmaceutically acceptable addition salt, can be produced by dissolving the free base in a suitable organic solvent and treating the solution with an acid according to conventional procedures for preparing acid addition salts from base compounds. Those skilled in the art will recognize various synthetic methods that can be used to prepare non-toxic pharmaceutically acceptable addition salts. Pharmaceutically acceptable acid addition salts can be prepared from inorganic or organic acids. Salts derived from inorganic acids include, for example, salts of hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. Salts derived from organic acids include, for example, acetic acid, propionic acid, gluconic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluene-sulfonic acid, salicylic acid, and the like. Similarly, pharmaceutically acceptable base addition salts can be prepared from inorganic or organic bases. Salts derived from inorganic bases include, by way of example only, sodium, potassium, lithium, aluminum, ammonium, calcium, and magnesium salts.Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, such as alkylamines (i.e., NH2(alkyl)), dialkylamines (i.e., HN(alkyl)2), trialkylamines (i.e., N(alkyl)3), substituted alkylamines (i.e., NH2(substituted alkyl)), di(substituted alkyl)amines (i.e., HN(substituted alkyl)2), tri(substituted alkyl)amines (i.e., N(substituted alkyl)3), alkenylamines (i.e., NH2(alkenyl)), dialkenylamines (i.e., HN(alkenyl)), aryl)2), trialkenylamines (i.e., N(alkenyl)3), substituted alkenylamines (i.e., NH2(substituted alkenyl)), di(substituted alkenyl)amines (i.e., HN(substituted alkenyl)2), tri(substituted alkenyl)amines (i.e., N(substituted alkenyl)3), mono-, di-, or tri-cycloalkylamines (i.e., NH2(cycloalkyl), HN(cycloalkyl)2, N(cycloalkyl)3), mono-, di-, or tri-arylamines (i.e., NH2(aryl), HN(aryl)2, N(aryl)3), or mixed amines, etc. Specific examples of suitable amines include, by way of example only, isopropylamine, trimethylamine, diethylamine, tri(iso-propyl)amine, tri(n-propyl)amine, ethanolamine, 2-dimethylaminoethanol, piperazine, piperidine, morpholine, N-ethylpiperidine, and the like.

[0069] Some of the compounds exist as tautomers. Tautomers are in equilibrium with each other. For example, an amide-containing compound may exist in equilibrium with an imidic acid tautomer. Regardless of which tautomer is shown and the nature of the equilibrium between the tautomers, one skilled in the art will understand the compound to include both the amide and imidic acid tautomers. Thus, amide-containing compounds are understood to include their imidic acid tautomers. Similarly, imidic acid-containing compounds are understood to include their amide tautomers.

[0070] The compounds or their pharma- ceutically acceptable salts may contain asymmetric centers and thus give rise to enantiomers, diastereomers and other stereoisomers that can be de?ned in terms of absolute stereochemistry as (R)- or (S)-, or for amino acids as (D)- or (L)-. The present disclosure is meant to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents or separated using conventional techniques, e.g., chromatography and / or fractional crystallization. Conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from suitable optically pure precursors or separation of the racemates (or racemates of salts or derivatives) using, e.g., chiral high performance liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, and unless otherwise specified, the compounds are intended to include both E and Z geometric isomers.

[0071] "Stereoisomers" refer to compounds made up of the same atoms joined by the same bonds but with different three-dimensional structures, and are not interchangeable. The present disclosure contemplates various stereoisomers or mixtures thereof, and includes "enantiomers," which refers to two stereoisomers whose molecules are non-superimposable mirror images of one another.

[0072] "Diastereomers" are stereoisomers that have at least two asymmetric atoms, but which are not mirror-images of each other.

[0073] Relative centers of compounds depicted herein are shown diagrammatically using a "thick bond" style (bold or parallel lines) and absolute stereochemistry is depicted using wedge bonds (bold or parallel lines).

[0074] "Prodrug" refers to any compound that releases an active parent drug according to the structures described herein in vivo when such prodrug is administered to a mammalian subject. Prodrugs of the compounds described herein are prepared by modifying functional groups present in the compounds described herein such that the modifications can be cleaved in vivo to release the parent compound. Prodrugs can be prepared by modifying functional groups present in the compounds described herein such that the modifications can be cleaved either by routine manipulation or in vivo to yield the parent compound. Prodrugs include compounds described herein in which a hydroxy, amino, carboxyl, or sulfhydryl group in the compounds described herein is bonded to any group that can be cleaved in vivo to regenerate a free hydroxy, amino, or sulfhydryl group, respectively. Examples of prodrugs include, but are not limited to, esters (e.g., acetate, formate, and benzoate derivatives), amides, guanidines, carbamates (e.g., N,N-dimethylaminocarbonyl), and the like of the hydroxy functional groups in the compounds described herein. The preparation, selection, and use of prodrugs are discussed in T. Higuchi and V. Stella, "Pro-drugs as Novel Delivery Systems," Vol. 14 of the ACS Symposium Series, "Design of Prodrugs," ed. H. Bundgaard, Elsevier, 1985, and Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987, each of which is incorporated herein by reference in its entirety.

[0075] compound In some embodiments, provided herein are antibodies, such as those of formula I: [ka] (In the formula, m, n, and p are independently 0, 1, 2, or 3; q is 1, 2, or 3; r is 0, 1, or 2; s is 0 if r is not 0 and is 1 if r is 0; t is 0 or 1; X is hydrogen, deuterium, or fluoro; Y is oxygen or NR, where R is hydrogen or C1-C4 alkyl; Z and Z 1 are each independently 1 or N, Each R 1 are independently hydrogen, amino, unsubstituted or 1 to 3 R 5 (C1-C4 alkyl)amino substituted with a substituent, unsubstituted or each alkyl group having 1 to 3 R 5 Substituted di(C1-C4 alkyl)amino, cyano, halo, hydroxyl, unsubstituted or 1-3 R 5 C1-C4 alkyl substituted with a substituent, and unsubstituted or 1-3 R 5 or C1-C4 alkoxy substituted with a substituent; Z 1 CR 1 If, then, two adjacent R 1 together with the carbon atom to which they are attached, C3-C7 cycloalkyl, C6-C 10 A 4- to 7-membered heterocycloalkenyl having 1 to 3 heteroatoms selected from aryl, oxygen, nitrogen, or sulfur, or a 5- to 6-membered heteroaryl having 1 to 3 heteroatoms selected from oxygen, nitrogen, and sulfur, wherein each of the cycloalkyl, heterocycloalkenyl, aryl, and heteroaryl independently has 1 to 3 R 6 is substituted with a group, Each R 2are independently cyano, halo, hydroxyl, amino, unsubstituted or 1 to 3 R 5 C1-C4 alkylamino substituted with a substituent, unsubstituted or each alkyl group having 1 to 3 R 5 Di(C1-C4 alkyl)amino substituted with a substituent, unsubstituted or 5 C1-C4 alkyl substituted with a substituent, and unsubstituted or 1-3 R 5 C1-C4 alkoxy substituted with a substituent; R 3 is unsubstituted or 1 to 3 R 7 C6-C substituted with substituents 10 is aryl, R 4 is hydrogen and -CH2-OR 8 where R 8 is C(O)-R 9 Or-P(O)(OR 10 )2, and R 9 is C1-C4 alkyl or C1-C4 alkoxy, and each R 10 are independently H or C1-C4 alkyl; Each R 5 are independently hydrogen, amino, (C1-C4 alkyl)amino, di(C1-C4 alkyl)amino, cyano, halo, hydroxyl, or C1-C4 alkoxy; Each R 6 is independently selected from amino, (C1-C4 alkyl)amino, di(C1-C4 alkyl)amino, cyano, halo, hydroxyl, and oxo; Each R 7 are independently selected from amino, C1-C4 alkyl unsubstituted or substituted with 1-3 halo, C1-C4 alkoxy unsubstituted or substituted with 1-3 halo, (C1-C4 alkyl)amino, di(C1-C4 alkyl)amino, cyano, halo, hydroxyl, nitro, oxo, C5-C6 heteroaryl having 1-3 heteroatoms selected from O, NR, and / or S, 4- to 7-membered heterocycloalkyl having 1-3 heteroatoms selected from oxygen, nitrogen, and / or sulfur, and -C(O)CH3; and R 11 is hydroxyl, halo, or cyano), or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof.

[0076] In some embodiments, provided herein are antibodies, such as those of formula I: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, n, p, q, r, s, and t are as defined herein.

[0077] In some embodiments, the compound of Formula I that binds to and modulates cereblon and optionally degrades IKZF2 has Formula II: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, n, p, s, and t are as defined herein.

[0078] In some embodiments, the compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-1: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, n, p, s, and t are as defined herein.

[0079] In some embodiments, the compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-2: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, n, p, s, and t are as defined herein.

[0080] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-A: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , m, n, p, and t are each independently as defined herein.

[0081] In some embodiments, the compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has the formula II-A1: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , m, n, and t are each independently as defined herein.

[0082] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-A2: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , m, n, p, and t are each independently as defined herein.

[0083] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-B: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , m, n, p, and t are each independently as defined herein.

[0084] In some embodiments, the compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has the formula II-B1: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , m, n, and t are each independently as defined herein.

[0085] In some embodiments, the compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-B2: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , m, n, and t are each independently as defined herein.

[0086] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-C: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , m, and t are each independently as defined herein.

[0087] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has the formula II-C1: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , m, and t are each independently as defined herein.

[0088] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-C2: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , m, and t are each independently as defined herein.

[0089] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-D: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 3 , and R 4 are each independently as defined herein.

[0090] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-D1: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R1 , R 3 , and R 4 are each independently as defined herein.

[0091] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-D2: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 3 , and R 4 are each independently as defined herein.

[0092] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-E: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 7 is as defined herein.

[0093] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has the formula II-E1: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 7 is as defined herein.

[0094] In some embodiments, a compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula II-E2: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 7 is as defined herein.

[0095] In some embodiments, in the compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, X is hydrogen or deuterium. In some embodiments, X is hydrogen. In some embodiments, X is deuterium. In some embodiments, X is tritium.

[0096] In some embodiments, in the compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, X is fluoro.

[0097] In some embodiments, in the compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, p is 1. In some embodiments, in the compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, p is 2. In some embodiments, in the compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, p is 3.

[0098] In some embodiments, in a compound of Formula I or Formula II or any subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, n is 0. In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, n is 1. In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, n is 2. In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, n is 3.

[0099] In some embodiments, in a compound of Formula I or Formula II or any subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, R 4 In some embodiments, in the compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, R 4 -CH2-OC(O)-R 9 or -CH2-OP(O)(OR 10 In some embodiments, in the compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, R 4 is -CH2-OC(O)-CH3, -CH2-OC(O)-CH2CH3, -CH2-OC(O)-CH2CH2CH3, or -CH2-OC(O)-CH(CH3). In some embodiments, in a compound of Formula I or Formula II, or any subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, R 4 is -CH2-OP(O)(OCH3)2, -CH2-OP(O)(OCH2CH3)2, -CH2-OP(O)(OCH2CH2CH3)2, or -CH2-OP(O)(O(CH(CH3)2).

[0100] In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, Z and Z 1 are CR 1 In some such embodiments, Z and Z 1 In some embodiments, Z and Z are each CH. In some embodiments, Z and Z are each CH. 1 are CR 1 where one R 1 is halo, such as bromo, fluoro, or chloro, and the other R 1 In some embodiments, Z and Z are hydrogen in the compound of formula I or formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof. 1 are each N. In some embodiments, in the compound of formula I or formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, Z or Z 1 One is CR 1 and Z or Z 1 The other is N. In some such embodiments, Z or Z 1 is CH and Z or Z 1 and the other is N. In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, R 1 is H. In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, one R 1 is H and the other R 1 is F. In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, one R 1 is H and the other R1 In some embodiments, Z and Z are Cl. 1 are CH, and R 1 is hydrogen.

[0101] In some embodiments, in a compound of Formula I or Formula II, or any subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, m is 0. In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, m is 1. In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, m is 2.

[0102] In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, q is 1 and r is 1. In some embodiments, in a compound of Formula I or Formula II, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, q is 1 and r is 0.

[0103] In some embodiments, the compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula III: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, q, r, s, and t are as defined herein. In some embodiments of Formula III, Y is O. In some embodiments of Formula III, Y is NR. In some embodiments of Formula III, Z and Z1 are CH, respectively.

[0104] In some embodiments, the compound of formula III that binds to and regulates cereblon and optionally degrades IKZF2 has formula IV: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, s, and t are as defined herein. In some embodiments of Formula IV, Y is O. In some embodiments of Formula IV, Y is NR. In some embodiments of Formula IV, Z and Z 1 are CH, respectively.

[0105] In some embodiments, the compound of Formula I that binds to and regulates cereblon and optionally degrades IKZF2 has Formula V: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, q, r, s, and t are as defined herein. In some embodiments of Formula V, Y is O. In some embodiments of Formula V, Y is NR. In some embodiments of Formula V, Z and Z 1 are CH, respectively.

[0106] In some embodiments, the compound of formula V that binds to and regulates cereblon and optionally degrades IKZF2 has formula VI: [ka] or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, s, and t are as defined herein. In some embodiments of Formula VI, Y is O. In some embodiments of Formula VI, Y is NR. In some embodiments of Formula VI, Z and Z 1 are CH, respectively.

[0107] In some embodiments, for any compound of formula I or a subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, [ka] teeth, [ka] Selected from TIFF2024529298000034.tif138170.

[0108] R 3 It is to be understood that the substituents can be located at any position on the heterocycloalkyl ring other than the nitrogen.

[0109] In some embodiments, for any compound of formula I or a subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, where q is 1, 2, or 3 and r is 1 or 2, the moiety [ka] In some of these embodiments, q is 1, r is 1, and s is 0, and the moiety [ka] In some embodiments, for any compound of formula I or any subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, where r is 0, the moiety [ka] is a monocyclic ring and s is 1.

[0110] In some embodiments, for any compound of formula I or a subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, Y is O. In some embodiments, for any compound of formula I or a subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, Y is NR. In some embodiments, for any compound of formula I or a subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, R 2 is halo, e.g., fluoro. In some embodiments, for any compound of formula I or a subformula thereof, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, R 2 is C1-C4 alkyl, e.g., methyl. In some embodiments, for any compound of formula I or a subformula thereof, or a pharma-ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, t is 0. In some embodiments, for any compound of formula I or a subformula thereof, or a pharma-ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, t is 1 and R 11 is hydroxyl.

[0111] In some embodiments, provided herein is a compound selected from Table 1, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof.

[0112]

Table 1

[0113] In some embodiments, provided herein is a compound that binds to cereblon selected from Table 1A, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof.

[0114] [Table 2] TIFF2024529298000067.tif226170TIFF2024529298000068.tif226170TIFF2024529298000069.tif238170TIFF2024529298000070.tif227170TIFF2024529298000071.tif242170TIFF2024529298000072.tif236170TIFF2024529298000073.tif245170TIFF2024529298000074.tif218170TIFF2024529298000075.tif239170TIFF2024529298000076.tif238170TIFF2024529298000077.tif221170TIFF2024529298000078.tif234170TIFF2024529298000079.tif237170TIFF2024529298000080.tif249170TIFF2024529298000081.tif245170TIFF2024529298000082.tif240170TIFF2024529298000083.tif255170TIFF2024529298000084.tif244170TIFF2024529298000085.tif246170TIFF2024529298000086.tif254170TIFF2024529298000087.tif231170TIFF2024529298000088.tif239170TIFF2024529298000089.tif255170TIFF2024529298000090.tif242170TIFF2024529298000091.tif237170TIFF2024529298000092.tif219170TIFF2024529298000093.tif222170TIFF2024529298000094.tif254170TIFF2024529298000095.tif252170TIFF2024529298000096.tif230170TIFF2024529298000097.tif226170TIFF2024529298000098.tif239170TIFF2024529298000099.tif249170TIFF2024529298000100.tif247170TIFF2024529298000101.tif249170TIFF2024529298000102.tif189170.

[0115] In some embodiments, provided herein is a compound that degrades IKZF2 selected from Table 1B, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof.

[0116] [Table 3] TIFF2024529298000104.tif223170TIFF2024529298000105.tif239170TIFF2024529298000106.tif238170 TIFF2024529298000107.tif246170TIFF2024529298000108.tif255170TIFF2024529298000109.tif254170

[0117] General synthesis method The compounds of formula I, formula II, formula III, formula IV, formula V, and formula VI described herein can be prepared from readily available starting materials using the following general methods and procedures. Where typical process conditions (i.e., reaction temperature, time, molar ratios of reactants, solvents, pressure, etc.) are given, it will be understood that other process conditions can also be used unless otherwise specified. Optimum reaction conditions may vary with the particular reactants or solvents used, but such conditions can be determined by one of ordinary skill in the art by routine optimization procedures.

[0118] Moreover, as will be appreciated by those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing undesired reactions. Suitable protecting groups for various functional groups as well as suitable conditions for protecting and deprotecting specific functional groups are well known in the art. Numerous protecting groups are described, for example, in TW Greene and PGM Wuts, Protecting Groups in Organic Synthesis, Third Edition, Wiley, New York, 1999, and references cited therein.

[0119] Moreover, as will be appreciated by those skilled in the art, intermediates and final compounds obtained as enantiomeric mixtures can be separated into their separate enantiomers by liquid chromatography using chiral stationary phases that exhibit chiral selectivity. Suitable chiral stationary phases as well as suitable conditions for chiral separation are well known in the art. Numerous methods are described, for example, in F. Toda, Enantiomeric Separation: Fundamentals and Practical Methods, First Edition, Springer, Dordrecht, 2004, and references cited therein.

[0120] The starting materials for the following reactions are generally known compounds or can be prepared by known procedures or obvious modifications thereof. For example, many of the starting materials are available from commercial suppliers such as Sigma Aldrich (St. Louis, MO, USA), Bachem (Torrance, CA, USA), Emka-Chemce (St. Louis, MO, USA). The starting materials are also disclosed in Fieser and Fieser's Reagents for Organic Synthesis, Volumes 1-15 (John Wiley, and Sons, 2016), Rodd's Chemistry of Carbon Compounds, Volumes 1-5, and Supplementals (Elsevier Science Publishers, 2001), Organic Reactions, Volumes 1-40 (John Wiley, and Sons, 2019), March's Advanced Organic Chemistry, (John Wiley, and Sons, 8 th Others can be prepared by procedures described in standard reference texts such as E. G. Schneider (Eds. Edition, 2019) and Larock's Comprehensive Organic Transformations (VCH Publishers Inc., 1989) or obvious modifications thereof.

[0121] Synthesis of representative compounds A general synthesis of the compounds described herein is shown in the following reaction scheme. In the scheme below, the substituent R 1 , R 2 , R 3 , R 4 , R 11 , X, Y, Z, Z 1 , m, n, p, q, r, s, and t are as defined throughout the specification. Q is a leaving group (including but not limited to, Br, Cl, I, triflate, etc.).

[0122] [ka]

[0123] With reference to Scheme 1, in the first step, at least a stoichiometric amount of a protected amino alcohol (compound 2) is reacted with compound 1 (CAS number 64169-34-2) (wherein R 1 =H, Z and Z 1 and (wherein each is CH). The reaction is typically maintained at 20° C. to 50° C. until the reaction is substantially complete. Conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), and the like, can provide compound 3.

[0124] In the next step, at least a stoichiometric equivalent of thionyl chloride is combined with compound 3 in a diluent such as methanol, ethanol, etc. The reaction is typically maintained at 50° C.-80° C. until the reaction is substantially complete. Conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can provide compound 6.

[0125] In the next step, at least a stoichiometric amount of 3-aminopiperidine-2,6-dione hydrochloride (CAS number 24666-56-6) (wherein R 4 =H, X=H, q=1, r=0, and s=1) (compound 5) is combined with compound 4. The reaction is typically maintained at 0°C to 30°C until the reaction is substantially complete. Conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can provide compound 6.

[0126] In the final step, the t-butoxycarbonyl (BOC) protecting group is removed by conventional conditions. The BOC group is merely exemplary, and other conventional amino blocking groups such as benzyl, 9-fluorenylmethoxycarbonyl (Fmoc), benzyloxycarbonyl (Cbz), p-nitrobenzyloxycarbonyl, etc. can be used. Once the reaction is complete, conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can provide compound 7, which can be used as an intermediate to synthesize compounds of formula I.

[0127] [ka]

[0128] With reference to Scheme 2, the first step is a conventional acetylation reaction in which at least a stoichiometric equivalent of an acetylation reagent is combined with an aryl acetate (compound 8) in the presence of a suitable base, such as sodium hydride, LDA, n-BuLi, and the like, in an inert diluent, such as THF, MeCN, and the like. The reaction is typically maintained at 0° C.-70° C. until the reaction is substantially complete. Conventional workup of the reaction solution followed by an isolation / purification process, such as crystallization, chromatography, high performance liquid chromatography (HPLC), and the like, can provide compound 9.

[0129] In the next step, at least a stoichiometric amount of compound 9 is reacted in an inert diluent such as THF, MeCN, toluene, etc., in the presence of a suitable reducing agent such as lithium aluminum hydride, borane, etc. Typically, the reaction is maintained at 0° C. to 30° C. until the reaction is substantially complete. Conventional workup of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc., can provide compound 10.

[0130] In the next step, the diol is converted to a suitable leaving group and at least a stoichiometric amount of tosyl chloride is added to compound 10 in an inert diluent such as THF, MeCN, toluene, etc., in the presence of a suitable base such as triethylamine, diisopropylethylamine, pyridine, etc. Typically, the reaction is maintained at 0° C.-30° C. until the reaction is substantially complete. The Ts group is merely illustrative, and other conventional leaving groups such as iodo, bromo, triflate, mesylate, etc. can be used. Conventional workup of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can provide compound 11.

[0131] In the final step, at least a stoichiometric amount of compound 11 is added to compound 7 in an inert diluent such as THF, MeCN, toluene, etc., in the presence of a suitable base such as triethylamine, diisopropylethylamine, pyridine, etc. Typically, the reaction is maintained at 80° C.-120° C. until the reaction is substantially complete. Conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can provide the compound of formula I.

[0132] [ka]

[0133] In some embodiments, compounds of formula I and its subformulas are prepared as shown in Scheme 3. In Scheme 3, the first step is a conventional esterification and chlorination reaction in which at least a stoichiometric equivalent of thionyl chloride and 5-bromoisobenzo-1(3H)-one (CAS No. 64169-34-2), where R 1 =H, Z and Z 1are each CH) (compound 1a). The reaction is typically maintained at 50° C. to 80° C. until the reaction is substantially complete. Conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can provide compound 2a.

[0134] In the next step, at least a stoichiometric amount of 3-aminopiperidine-2,6-dione hydrochloride (CAS number 24666-56-6), where R 4 =H, X=H, q=1, r=0, and s=1) (compound 3) is combined with compound 2. The reaction is typically maintained at 80° C.-100° C. until the reaction is substantially complete. Conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can provide compound 4.

[0135] In the next step, at least stoichiometric amounts of compound 5a and compound 4a are combined in an inert diluent such as THF, MeCN, toluene, etc., typically in the presence of a suitable catalyst such as Ir, Cu(OAc)2, SmI2, etc. The reaction is typically maintained at 60°C-80°C until the reaction is substantially complete. Conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can provide compound 6a.

[0136] In the next step, compound 6a is combined with at least a stoichiometric amount of an oxidation reagent under conventional oxidation reaction conditions well known in the art, including the use of Jones reagent, mCPBA, Dess-Martin periodinane. The reaction is typically carried out in an inert solvent such as MeCN, THF, methylene chloride, toluene, and the like. The reaction is typically carried out at about 0° C. to about 30° C. for a period of time sufficient for substantial completion of the reaction as evidenced, for example, by thin layer chromatography. Once the reaction is complete, conventional workup of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), and the like, can provide compound 7a.

[0137] In the final step, compound 7a is combined with at least a stoichiometric amount of the appropriate amine (compound 8a) under conventional reductive amination reaction conditions well known in the art, including the use of NaCNBH3, NaBH(OAc)3, NaBH4, and the like. The reaction is typically carried out in an inert solvent, such as MeCN, MeOH, THF, and the like. The reaction is typically carried out at about 0° C. to about 30° C. for a period of time sufficient for substantial completion of the reaction, as evidenced, for example, by thin layer chromatography. Once the reaction is complete, conventional workup of the reaction solution, followed by optional isolation / purification processes such as crystallization, chromatography, high performance liquid chromatography (HPLC), and the like, can be used to obtain the compound of formula I.

[0138] [ka]

[0139] With respect to Scheme 4, the first step is a conventional protection reaction in which at least a stoichiometric equivalent of 2-(trimethylsilyl)ethoxymethyl chloride is reacted with compound 4a (CAS number 1010100-26-1), where R 1 and X=H, Z and Z1 are each CH, q and s are each 1, and r is 0). The reaction is typically maintained at 0° C. to 30° C. until the reaction is substantially complete. Conventional workup of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), and the like, can provide compound 12.

[0140] In the next step, the Miyaura boronation reaction (J. Org. Chem., 1995, 60, 7508), at least stoichiometric amounts of compound 12 are combined with bis(pinacolato)diboron in the presence of a suitable catalyst such as PdCl2(dppf)2, PdCl2(PPh3)2, and the like, in an inert diluent such as DMSO, 1,4-dioxane, and the like. The reaction is typically maintained at 80° C.-110° C. until the reaction is substantially complete. Conventional workup of the reaction solution can be followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), and the like.

[0141] The intermediate boronic acid pinacol ester is added to an aqueous diluent such as acetone:H2O, THF:H2O, acetonitrile:H2O, and the like, in the presence of sodium perborate tetrahydrate, dihydrogen peroxide, and the like. The reaction is typically maintained at 20°C-40°C until the reaction is substantially complete. Conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), and the like, can provide compound 13, which can be used as an intermediate to synthesize compounds of formula I.

[0142] [ka]

[0143] In some embodiments, compounds of formula I and its subformulas are prepared as shown in Scheme 5. In Scheme 5, the first step is a conventional Mitsunobu reaction in which at least a stoichiometric equivalent of 4-nitrobenzoic acid is combined with tert-butyl ((1S,2S)-2-hydroxycyclohexyl)carbamate (compound 14) (CAS number 145166-06-9) under conventional reaction conditions well known in the art, including the use of diethyl azodicarboxylate and triphenylphosphine (Hughes, DL (2004). The Mitsunobu Reaction, Organic Reactions, (Ed.)). The reaction is typically carried out in an inert solvent such as acetonitrile, THF, toluene, and the like. The reaction is typically maintained at 0° C. to 30° C. until the reaction is substantially complete. Conventional workup of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), and the like, can provide compound 15.

[0144] In the next step, the t-butoxycarbonyl (BOC) protecting group is removed by conventional conditions. The BOC group is merely exemplary, and other conventional amino blocking groups such as benzyl, 9-fluorenylmethoxycarbonyl (Fmoc), benzyloxycarbonyl (Cbz), p-nitrobenzyloxycarbonyl, etc. can be used. Once the reaction is complete, compound 16 can be obtained by conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc.

[0145] In the next step, at least a stoichiometric amount of compound 11 is added to compound 16 in an inert diluent such as THF, MeCN, toluene, etc., in the presence of a suitable base such as triethylamine, diisopropylethylamine, pyridine, etc. Typically, the reaction is maintained at 80° C.-120° C. until the reaction is substantially complete. Conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can provide compound 17.

[0146] In the next step, the 4-nitrophenyl ester protecting group is removed under basic hydrolysis conditions to give compound 18. The 4-nitrophenyl ester group is merely exemplary and other conventional carboxylic acid protecting groups such as benzyl, ethyl, tert-butyl, etc. can be used. Once the reaction is complete, conventional work-up of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), etc. can give compound 18.

[0147] In the final step, at least stoichiometric amounts of compound 18 and compound 13 are combined under conventional Mitsunobu reaction conditions well known in the art, including the use of diethyl azodicarboxylate and triphenylphosphine (Hughes, DL (2004). The Mitsunobu Reaction, Organic Reactions, (Ed.).). The reaction is typically carried out in an inert solvent such as acetonitrile, THF, toluene, and the like. The reaction is typically maintained at 0° C.-30° C. until the reaction is substantially complete. Once the reaction is complete, conventional workup of the reaction solution followed by an isolation / purification process such as crystallization, chromatography, high performance liquid chromatography (HPLC), and the like can provide the compound of formula I.

[0148] Other starting materials used herein are well known in the art, are commercially available, or can be prepared by routine synthetic methods.

[0149] method In one embodiment, the compounds and compositions of Formula I, II, III, IV, V, and / or VI described herein are useful in a method of modulating cereblon activity comprising administering to a subject an effective amount of a compound described herein, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, or a pharmaceutical composition comprising said compound, or a pharma-ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof.

[0150] In one embodiment, the compounds and compositions of Formula I, II, III, IV, V, and / or VI described herein are useful in a method of treating an IKZF2-dependent disease or disorder or a disease or disorder mediated at least in part by IKZF2, comprising administering to a subject suffering from an IKZF2-dependent disease or disorder an effective amount of a compound described herein, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, or a pharmaceutical composition comprising said compound, or a pharma-ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof.

[0151] In one embodiment, the compounds and compositions of Formula I, II, III, IV, V, and / or VI described herein selectively modulate IKZF (e.g., relative to the translation termination factor GSPT1). In some embodiments, the compounds and compositions of Formula I, II, III, IV, V, and / or VI described herein selectively modulate IKZF2 relative to GSPT1.

[0152] In one embodiment, there is provided a compound described herein, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, or a pharmaceutical composition comprising said compound, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, for use in the treatment of an IKZF2-dependent disease or disorder.

[0153] In one embodiment, the method relates to a compound described herein, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, for use in the manufacture of a medicament for reducing IKZF2 protein levels, thereby treating or ameliorating a disease or disorder, or a pharmaceutical composition comprising the compound, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof.

[0154] In one embodiment, the methods described herein include the use of prodrugs of the compounds described herein.

[0155] In one embodiment, the method comprises determining the concentration IC of a compound required for cereblon target engagement dose response. 50 The present invention relates to a compound as described herein, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, used as described herein, or a pharmaceutical composition comprising said compound, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein the Cereblon target binding dose response IC is in the range of about 0.003 μM to about 0.06 μM. 50 is measured by the assay described in the Biological Examples. In some embodiments, the cereblon binding concentration is about 0.003 μM to about 0.006 μM, about 0.005 μM to about 0.008 μM, about 0.007 μM to about 0.01 μM, about 0.009 μM to about 0.012 μM, about 0.012 μM to about 0.015 μM, about 0.015 μM to about 0.018 μM, about 0.018 μM to about 0.021 μM, about 0.021 μM to about 0.024 μM, about 0.024 μM to about 0.027 μM, or about 0.027 μM to about 0.030 μM. In some embodiments, the cereblon binding concentration is less than 0.015 μM. In some embodiments, the cereblon binding concentration is less than 0.010 μM. In some embodiments, the cereblon binding concentration is less than 0.005 μM.

[0156] In one embodiment, the method relates to a compound described herein, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, used as described herein, or a pharmaceutical composition comprising the compound, or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof, wherein the IKZF2 degradation at a concentration of 1 μM of the compound described herein is in the range of about 25% to about 99%. IKZF2 degradation is measured by the assay described in the Biological Examples. In some embodiments, IKZF2 degradation is about 25% to about 50%, about 45% to about 70%, about 65% to about 90%, or about 75% to about 99%. In some embodiments, IKZF2 degradation is about 25% to about 35%, about 35% to about 45%, about 45% to about 55%, about 55% to about 65%, about 65% to about 75%, about 75% to about 85%, about 85% to about 99%. In some embodiments, IKZF2 degradation is greater than 60%. In some embodiments, IKZF2 degradation is greater than 70%. In some embodiments, IKZF2 degradation is greater than 80%. In some embodiments, IKZF2 degradation is greater than 90%.

[0157] Non-limiting examples of IKZF2-dependent diseases or disorders include proliferative diseases or disorders, which can be non-cancerous or cancerous.

[0158] Examples of non-cancerous conditions or disorders include rheumatoid arthritis; inflammation; autoimmune diseases; lymphoproliferative conditions; acromegaly; rheumatoid spondylitis; osteoarthritis; gout and other arthritic conditions; sepsis; septic shock; endotoxic shock; gram-negative sepsis; toxic shock syndrome; asthma; adult respiratory distress syndrome; chronic obstructive pulmonary disease; chronic pneumonia; inflammatory bowel disease; Crohn's disease; psoriasis; eczema; ulcerative colitis; pancreatic fibrosis; hepatic fibrosis; acute and chronic kidney disease; irritable bowel syndrome; pyresis; restenosis; cerebral malaria; stroke and ischemic injury; neurotrauma; Alzheimer's disease; Huntington's disease; Parkinson's disease; acute and chronic These include, but are not limited to, pain; allergic rhinitis; allergic conjunctivitis; chronic heart failure; acute coronary syndromes; cachexia; malaria; leprosy; leishmaniasis; Lyme disease; Reiter's syndrome; acute synovitis; muscle degeneration, bursitis; tendonitis; tenosynovitis; herniated, ruptured, or prolapsed disc syndrome; osteopetrosis; thrombosis; restenosis; silicosis; pulmonary sarcoidosis; bone resorption diseases such as osteoporosis; graft versus host reaction; multiple sclerosis; lupus; fibromyalgia; AIDS and other viral diseases such as shingles, herpes simplex type I or type II, influenza virus, and cytomegalovirus; and diabetes mellitus.

[0159] In certain embodiments, the compounds or compositions described herein are useful in the treatment of cancer and other proliferative disorders, including, but not limited to, breast cancer, cervical cancer, colon and rectal cancer, leukemia, lung cancer, melanoma, multiple myeloma, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, prostate cancer, and gastric cancer. In certain embodiments, the compounds or compositions described herein are effective against solid tumors.

[0160] In certain embodiments, the compounds or compositions described herein are useful for the treatment of cancer (including but not limited to glioblastoma, retinoblastoma, breast cancer, cervical cancer, colon and rectal cancer, leukemia, lymphoma, lung cancer (including but not limited to small cell lung cancer), melanoma and / or skin cancer, multiple myeloma, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, prostate cancer and gastric cancer, bladder cancer, uterine cancer, kidney cancer, testicular cancer, stomach cancer, brain cancer, liver cancer, or esophageal cancer).

[0161] In some embodiments, exemplary cancers include adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, anorectal cancer, cancer of the anal canal, appendix cancer, pediatric cerebellar astrocytoma, pediatric cerebral astrocytoma, basal cell carcinoma, skin cancer (non-melanoma), cholangiocarcinoma, extrahepatic bile duct cancer, intrahepatic cholangiocarcinoma, bladder cancer, urinary bladder cancer, bone and joint cancer, osteosarcoma, and malignant fibrous histiocytoma, brain cancer, brain tumor, brain stem glioma, cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, visual pathway and hypothalamic glioma, breast cancer, bronchial adenoma / carcinoid, carcinoid tumor, gastrointestinal nervous system cancer, nervous system lymphoma, central nervous system cancer, central nervous system lymphoma, cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorder, colon cancer, colorectal cancer, cutaneous T-cell lymphoma, lymphoid neoplasms, mycosis fungoides, Sezary syndrome, endometrial cancer, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor, ovarian germ cell tumor, gestational trophoblastic neoplasm glioma, head and neck cancer, hepatocellular (liver) carcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, eye intraocular (eye) melanoma, eye cancer, islet cell tumor (endocrine pancreas), Kaposi's sarcoma, kidney cancer, cancer of the kidney, kidney cancer, laryngeal cancer, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, hairy cell leukemia, lip cancer, liver cancer, lung cancer, non-small cell lung cancer, small cell lung cancer, AIDS-related lymphoma, non-Hodgkin's lymphoma, primary central nervous system lymphoma, Waldenstrom macroglobulinemia, medulloblastoma, melanoma, intraocular (eye) melanoma, Merkel cell carcinoma, malignant mesothelioma, mesothelioma, metastatic squamous cell carcinoma of the neck, mouth cancer, tongue cancer, multiple endocrine neoplasia syndrome, mycosis fungoides, bone marrow Dysplastic syndromes, myelodysplastic / myeloproliferative disorders, chronic myeloid leukemia, acute myeloid leukemia, multiple myeloma, chronic myeloproliferative disorders, nasopharyngeal carcinoma, neuroblastoma, cancer of the mouth, oral cavity cancer, oropharyngeal cancer, ovarian cancer, ovarian epithelial cancer, ovarian low malignant potential tumor, pancreatic cancer, islet cell pancreatic cancer, paranasal sinus and nasal cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumors, plasma cell neoplasms / multiple myeloma, pleuroblastoma, prostate cancer, rectal cancer, transitional cell carcinoma of the renal pelvis and ureter, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Ewing's sarcoma family of tumors, Kaposi's sarcoma,These include, but are not limited to, soft tissue sarcoma, uterine cancer, uterine sarcoma, skin cancer (non-melanoma), skin cancer (melanoma), Merkel cell skin cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, gastric (stomach) cancer, supratentorial primitive neuroectodermal tumor, testicular cancer, laryngeal cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter and other urinary organs, gestational trophoblastic tumor, urethral cancer, endometrial uterine cancer, uterine sarcoma, uterine body cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.

[0162] In certain embodiments, the compounds described herein are useful for the treatment of cancer (including but not limited to glioblastoma, retinoblastoma, breast cancer, cervical cancer, colon and rectal cancer, leukemia, lymphoma, lung cancer (including but not limited to small cell lung cancer), melanoma and / or skin cancer, multiple myeloma, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, prostate cancer and gastric cancer, bladder cancer, uterine cancer, kidney cancer, testicular cancer, stomach cancer, brain cancer, liver cancer, or esophageal cancer) and / or any other cancer described herein.

[0163] In certain embodiments, the compounds described herein are useful in the treatment of cancer and other proliferative disorders, including, but not limited to, breast cancer, cervical cancer, colon and rectal cancer, leukemia, lung cancer, melanoma, multiple myeloma, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, prostate cancer, and gastric cancer. In certain embodiments, the compounds are effective against solid tumors.

[0164] In certain embodiments, the compounds and compositions described herein are useful in treating IKZF2-dependent diseases or disorders, such as liposarcoma, glioblastoma, bladder cancer, adrenocortical carcinoma, multiple myeloma, colorectal cancer, non-small cell lung cancer, human papillomavirus-associated cervical cancer, oropharyngeal cancer, penile cancer, anal cancer, thyroid cancer, or vaginal cancer, or Epstein-Barr virus-associated nasopharyngeal cancer, gastric cancer, rectal cancer, thyroid cancer, Hodgkin's lymphoma, or diffuse large B-cell lymphoma. The cancer may be selected from prostate cancer, breast cancer, lymphoma, leukemia, myeloma, bladder cancer, colon cancer, cutaneous melanoma, hepatocellular carcinoma, endometrial cancer, ovarian cancer, cervical cancer, lung cancer, renal cancer, glioblastoma multiforme, glioma, thyroid cancer, parathyroid tumor, nasopharyngeal cancer, tongue cancer, pancreatic cancer, esophageal cancer, bile duct cancer, gastric cancer, soft tissue sarcoma, rhabdomyosarcoma (RMS), synovial sarcoma, osteosarcoma, rhabdoid cancer, immune response defective cancer, immunogenic cancer, and Ewing's sarcoma. In one embodiment, the IKZF2-dependent disease or disorder is a disease or disorder selected from non-small cell lung cancer (NSCLC), melanoma, triple-negative breast cancer (TNBC), nasopharyngeal carcinoma (NPC), microsatellite-stable colorectal cancer (mssCRC), thymoma, carcinoid, and gastrointestinal stromal tumor (GIST). In another embodiment, the cancer is selected from non-small cell lung cancer (NSCLC), melanoma, triple-negative breast cancer (TNBC), nasopharyngeal carcinoma (NPC), microsatellite-stable colorectal cancer (mssCRC), thymoma, carcinoid, acute myeloid leukemia, and gastrointestinal stromal tumor (GIST). In another embodiment, the IKZF2-dependent disease or disorder is a disease or disorder selected from non-small cell lung cancer (NSCLC), melanoma, triple-negative breast cancer (TNBC), nasopharyngeal carcinoma (NPC), and microsatellite-stable colorectal cancer (mssCRC).

[0165] The compounds of the present disclosure can be administered in an effective amount to treat or prevent, and / or prevent the onset of, a disorder in a subject.

[0166] In general, the methods of using the compounds of the present application include administering to a subject in need thereof a therapeutically effective amount of a compound described herein.

[0167] In certain embodiments, the compounds described herein are useful for treating proliferative diseases (e.g., cancer, benign neoplasms, inflammatory diseases, and autoimmune diseases). In certain embodiments, the levels of cellular proteins, such as pathogenic and oncogenic proteins, of a subject are modulated, their growth is inhibited, or proteins are degraded, by contacting the cells with a compound or composition as described herein in accordance with the therapeutic methods of the present application. In other embodiments, the compounds are useful for treating cancer.

[0168] Thus, in another aspect of the present application, there is provided a method of treating cancer comprising administering to a subject in need thereof a therapeutically effective amount of a compound or composition as described herein. In certain embodiments, there is provided a method of treating cancer comprising administering to a subject in need thereof a therapeutically effective amount of a compound or a pharmaceutical composition comprising a compound as described herein in such an amount and for such a time as is required to achieve the desired result. In some embodiments, the compounds of the present application are administered orally or intravenously. In certain embodiments of the present application, a "therapeutically effective amount" of a compound or pharmaceutical composition is an amount effective to kill or inhibit the growth of tumor cells. The compounds and compositions according to the present application methods can be administered in any amount and using any route of administration effective to kill or inhibit the growth of tumor cells. Thus, the phrase "an amount effective to kill or inhibit the growth of tumor cells" as used herein refers to an amount of agent sufficient to kill or inhibit the growth of tumor cells. The exact amount required will vary from subject to subject depending on the species, age and general condition of the subject, the severity of the disease, the particular anti-cancer agent, its method of administration, etc. In certain embodiments of the present application, a "therapeutically effective amount" of a compound or pharmaceutical composition described herein is an amount effective to reduce the level of a target protein. In certain embodiments of the present application, a "therapeutically effective amount" of a compound or pharmaceutical composition is an amount effective to kill or inhibit the growth of skin cells.

[0169] In certain embodiments, the methods comprise administering a therapeutically effective amount of a compound or a pharma- ceutically acceptable derivative thereof to a subject (including, but not limited to, a human or other mammal) in need thereof.

[0170] Additionally, the present application provides pharma- ceutically acceptable derivatives of the compounds, and methods of treating a subject with these compounds, pharmaceutical compositions thereof, or any of these in combination with one or more additional therapeutic agents.

[0171] Another aspect of the present application relates to a method of treating or lessening the severity of a disease or condition associated with a proliferation disorder in a patient, comprising administering to said patient a compound of formula I or a composition comprising said compound.

[0172] It is recognized that the compounds and compositions according to the methods of the present application can be administered in any amount and using any route of administration effective for treating cancers and / or disorders associated with cell hyperproliferation. For example, when a compound is used to treat cancer, the term "effective amount" as used herein refers to an amount of agent sufficient to inhibit cell proliferation or to reduce the effects of cancer. The exact amount required will vary from subject to subject depending on the species, age and general condition of the subject, the severity of the disease, the particular anti-cancer agent, its method of administration, etc.

[0173] The present application also provides a method of treating a proliferative disorder in a subject in need thereof by administering to the subject in need of such treatment a therapeutically effective amount of a compound of the present application or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof. The proliferative disorder can be cancer or a precancerous condition. The present application further provides the use of a compound of the present application or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof for the preparation of a medicament useful for treating a proliferative disorder.

[0174] The present application provides a method of preventing a proliferative disorder in a subject in need thereof by administering to the subject in need of such treatment a therapeutically effective amount of a compound of the present application or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof. The proliferative disorder can be cancer or a precancerous condition. The present application also provides the use of a compound of the present application or a pharma- ceutically acceptable salt, solvate, stereoisomer, and / or tautomer thereof for the preparation of a medicament useful for the prevention of a proliferative disorder.

[0175] As used herein, the term "proliferative disorder" refers to a condition in which unregulated or abnormal growth of cells or both can lead to the development of an undesirable condition or disease, which may be cancerous or non-cancerous. Exemplary proliferative disorders of the present application encompass a variety of conditions in which cell division is deregulated. Examples of proliferative disorders include, but are not limited to, neoplasms, benign tumors, malignant tumors, precancerous conditions, intraepithelial neoplasia, encapsulated tumors, metastatic tumors, liquid tumors, solid tumors, immune tumors, hematological tumors, cancers, carcinomas, leukemias, lymphomas, sarcomas, and rapidly dividing cells. The term "rapidly dividing cells" as used herein is defined as any cell that divides at a rate that exceeds or exceeds the rate expected or observed between adjacent or juxtaposed cells in the same tissue. Proliferative disorders include precancer or precancerous conditions. Proliferative disorders include cancer. The methods provided herein are preferably used to treat or alleviate the symptoms of cancer. The term "cancer" includes solid tumors, as well as hematological tumors and / or hematological malignancies. A "pre-cancerous cell" or "pre-cancerous cell" is a cell that exhibits a proliferative disorder that is a pre-cancer or pre-cancerous condition. A "cancer cell" or "cancerous cell" is a cell that exhibits a proliferative disorder that is a cancer. Any reproducible means of measurement can be used to identify cancer or pre-cancerous cells. Cancer or pre-cancerous cells can be identified by histological classification or grading of a tissue sample (e.g., a biopsy sample). Cancer or pre-cancerous cells can be identified by using appropriate molecular markers.

[0176] A "proliferative disorder of the blood system" is a proliferative disorder affecting cells of the blood system. Proliferative disorders of the blood system can include lymphoma, leukemia, myeloid neoplasms, mast cell neoplasms, myelodysplasia, benign monoclonal gammopathy, lymphomatoid granulomatosis, lymphomatoid papulosis, polycythemia vera, chronic myelocytic leukemia, primary myeloid metaplasia, and essential thrombocythemia. Proliferative disorders of the blood system can include hyperplasia, dysplasia, and metaplasia of cells of the blood system. Preferably, the compositions of the present application can be used to treat a cancer selected from the group consisting of a blood cancer of the present application or a hematological proliferative disorder of the present application. Hematological cancers of the present application may include multiple myeloma, lymphomas (including Hodgkin's lymphoma, non-Hodgkin's lymphoma, childhood lymphoma, and lymphomas of lymphocytic and cutaneous origin), leukemias (including childhood leukemia, hairy cell leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, chronic lymphocytic leukemia, chronic myelocytic leukemia, chronic myelogenous leukemia, and mast cell leukemia), myeloid neoplasms, and mast cell neoplasms.

[0177] A "pulmonary proliferative disorder" is a proliferative disorder affecting lung cells. A pulmonary proliferative disorder may include all forms of proliferative disorders affecting lung cells. A pulmonary proliferative disorder may include lung cancer, pre-cancer or pre-cancerous conditions of the lung, benign growths or lesions of the lung, and malignant growths or lesions of the lung, as well as metastatic lesions of tissues and organs in the body other than the lung. Preferably, the compositions of the present application can be used to treat lung cancer or a pulmonary proliferative disorder. A lung cancer may include all forms of lung cancer. A lung cancer may include malignant lung neoplasms, carcinoma in situ, typical carcinoid tumors, and atypical carcinoid tumors. A lung cancer may include small cell lung cancer ("SCLC"), non-small cell lung cancer ("NSCLC"), squamous cell carcinoma, adenocarcinoma, small cell carcinoma, large cell carcinoma, adenosquamous carcinoma, and mesothelioma. Lung cancer may include "scar carcinoma," bronchoalveolar carcinoma, giant cell carcinoma, spindle cell carcinoma, and large cell neuroendocrine carcinoma. Lung cancer may include lung neoplasms with histologic and ultrastructural heterogeneity (e.g., mixed cell types).

[0178] Pulmonary proliferative disorders may include all forms of proliferative disorders affecting lung cells. Pulmonary proliferative disorders may include lung cancer, precancerous lung conditions. Pulmonary proliferative disorders may include pulmonary hyperplasia, metaplasia, and dysplasia. Pulmonary proliferative disorders may include asbestos-induced hyperplasia, squamous metaplasia, and benign reactive mesothelial metaplasia. Pulmonary proliferative disorders may include replacement of columnar epithelium with stratified squamous epithelium and mucosal dysplasia. Individuals exposed to inhalable harmful environmental agents such as tobacco smoke and asbestos may be at increased risk of developing pulmonary proliferative disorders. Preceding pulmonary diseases that may predispose an individual to developing pulmonary proliferative disorders include chronic interstitial lung disease, necrotizing lung disease, scleroderma, rheumatic diseases, sarcoidosis, interstitial pneumonia, tuberculosis, recurrent pneumonia, idiopathic pulmonary fibrosis, granulomas, asbestosis, fibrosing alveolitis, and Hodgkin's disease.

[0179] A "proliferative disorder of the colon" is a proliferative disorder affecting cells of the colon. Preferably, the proliferative disorder of the colon is colon cancer. Preferably, the compositions of the present application can be used to treat colon cancer or proliferative disorders of the colon. Colon cancer can include all forms of cancer of the colon. Colon cancer can include sporadic colon cancer and hereditary colon cancer. Colon cancer can include malignant colon neoplasms, carcinoma in situ, typical carcinoid tumors, and atypical carcinoid tumors. Colon cancer can include adenocarcinoma, squamous cell carcinoma, and adenosquamous cell carcinoma. Colon cancer can be associated with a genetic syndrome selected from the group consisting of hereditary nonpolyposis colorectal cancer, familial adenomatous polyposis, Gardner's syndrome, Peutz-Jeghers syndrome, Turcot's syndrome, and juvenile polyposis. The colon cancer may be caused by a genetic syndrome selected from the group consisting of hereditary nonpolyposis colorectal cancer, familial adenomatous polyposis, Gardner's syndrome, Peutz-Jeghers syndrome, Turcot's syndrome, and juvenile polyposis.

[0180] Colonic proliferative disorders may include all forms of proliferative disorders affecting colon cells. Colonic proliferative disorders may include colon cancer, colonic precancerous conditions, colonic adenomatous polyps, and colonic metachronous lesions. Colonic proliferative disorders may include adenomas. Colonic proliferative disorders may be characterized by colonic hyperplasia, metaplasia, and dysplasia. Antecedent colonic diseases that may predispose an individual to developing colonic proliferative disorders may include antecedent colon cancer. Current diseases that may predispose an individual to developing colonic proliferative disorders may include Crohn's disease and ulcerative colitis. Colonic proliferative disorders may be associated with mutations in genes selected from the group consisting of p53, ras, FAP, and DCC. An individual may be at increased risk of developing colonic proliferative disorders due to the presence of a mutation in a gene selected from the group consisting of p53, ras, FAP, and DCC.

[0181] A "proliferative disorder of the pancreas" is a proliferative disorder affecting cells of the pancreas. A proliferative disorder of the pancreas may include all forms of proliferative disorders affecting pancreatic cells. A proliferative disorder of the pancreas may include pancreatic cancer, precancer or precancerous conditions of the pancreas, pancreatic hyperplasia and pancreatic dysplasia, benign growths or lesions of the pancreas, and malignant growths or lesions of the pancreas, as well as metastatic lesions of tissues and organs of the body other than the pancreas. Pancreatic cancer includes all forms of cancer of the pancreas. Pancreatic cancer may include tubular adenocarcinoma, adenosquamous carcinoma, pleomorphic giant cell carcinoma, mucinous adenocarcinoma, osteoclast-like giant cell carcinoma, mucinous cystadenoma, acinar carcinoma, large cell carcinoma unclassifiable, small cell carcinoma, pancreatoblastoma, papillary neoplasm, mucinous cystadenoma, papillary cystic neoplasm, and serous cystadenoma. Pancreatic cancer can also include pancreatic neoplasms with histologic and ultrastructural heterogeneity (eg, mixed cell types).

[0182] A "proliferative disorder of the prostate" is a proliferative disorder affecting cells of the prostate. Proliferative disorders of the prostate may include all forms of proliferative disorders affecting prostate cells. Proliferative disorders of the prostate may include prostate cancer, pre-cancer or pre-cancerous conditions of the prostate, benign growths or lesions of the prostate, and malignant growths or lesions of the prostate, as well as metastatic lesions of tissues and organs in the body other than the prostate. Proliferative disorders of the prostate may include hyperplasia, metaplasia, and dysplasia of the prostate.

[0183] A "proliferative disorder of the skin" is a proliferative disorder affecting cells of the skin. Proliferative disorders of the skin can include all forms of proliferative disorders affecting skin cells. Proliferative disorders of the skin can include precancerous or precancerous conditions of the skin, benign growths or lesions of the skin, melanoma, malignant melanoma, and other malignant growths or lesions of the skin, as well as metastatic lesions of body tissues and organs other than the skin. Proliferative disorders of the skin can include hyperplasia, metaplasia, and dysplasia of the skin.

[0184] An "ovarian proliferative disorder" is a proliferative disorder affecting cells of the ovary. Ovarian proliferative disorders may include all forms of proliferative disorders affecting cells of the ovary. Ovarian proliferative disorders may include precancer or precancerous conditions of the ovary, benign growths or lesions of the ovary, ovarian cancer, malignant growths or lesions of the ovary, and metastatic lesions of tissues and organs of the body other than the ovary. Proliferative disorders of the skin may include ovarian cell hyperplasia, metaplasia, and dysplasia.

[0185] A "proliferative disorder of the breast" is a proliferative disorder affecting cells of the breast. Proliferative disorders of the breast can include all forms of proliferative disorders affecting breast cells. Proliferative disorders of the breast can include breast cancer, precancer or precancerous conditions of the breast, benign growths or lesions of the breast, and malignant growths or lesions of the breast, as well as metastatic lesions in body tissues and organs other than the breast. Proliferative disorders of the breast can include hyperplasia, metaplasia, and dysplasia of the breast.

[0186] The cancer to be treated may be staged according to the American Joint Committee on Cancer (AJCC) TNM classification system, where the tumor (T) may be assigned a stage of TX, T1, T1mic, T1a, T1b, T1c, T2, T3, T4, T4a, T4b, T4c, or T4d, the regional lymph nodes (N) may be assigned a stage of NX, N0, N1, N2, N2a, N2b, N3, N3a, N3b, or N3c, and the distant metastases (M) may be assigned a stage of MX, M0, or M1. The cancer to be treated may be staged according to the American Joint Committee on Cancer (AJCC) classification as stage I, stage IIA, stage IIB, stage IIIA, stage IIIB, stage IIIC, or stage IV. The cancer to be treated may be assigned a grade according to the AJCC classification as grade GX (e.g., grade cannot be determined), grade 1, grade 2, grade 3, or grade 4. The cancer to be treated may be staged according to the AJCC pathological classification (pN): pNX, pN0, PN0(I-), PN0(I+), PN0(mol-), PN0(mol+), PN1, PN1(mi), PN1a, PN1b, PN1c, pN2, pN2a, pN2b, pN3, pN3a, pN3b, or pN3c.

[0187] The cancer to be treated may include a tumor determined to be about 2 centimeters or less in diameter. The cancer to be treated may include a tumor determined to be about 2 centimeters to about 5 centimeters in diameter. The cancer to be treated may include a tumor determined to be about 3 centimeters or more in diameter. The cancer to be treated may include a tumor determined to be more than 5 centimeters in diameter. The cancer to be treated may be classified by microscopy as well differentiated, moderately differentiated, poorly differentiated, or undifferentiated. The cancer to be treated may be classified by microscopy for mitotic count (e.g., amount of cell division) or nuclear pleomorphism (e.g., changes in cells). The cancer to be treated may be classified by microscopy as having areas of necrosis (e.g., areas of dying or degenerating cells). The cancer to be treated may be classified as having an abnormal karyotype, having an abnormal number of chromosomes, or having one or more chromosomes with an abnormal appearance. The cancer to be treated may be classified as being aneuploid, triploid, tetraploid, or as having a ploidy change. The cancer to be treated may be classified as having a chromosomal translocation, or an area of ​​deletion or duplication of an entire chromosome, or a deletion, duplication, or amplification of a portion of a chromosome.

[0188] The cancer to be treated can be assessed by DNA cytometry, flow cytometry, or image cytometry. The cancer to be treated can be typed as having 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the cells in the synthetic stage of cell division (e.g., S phase of cell division). The cancer to be treated can be typed as having a low S phase fraction or a high S phase fraction.

[0189] As used herein, a "normal cell" is a cell that cannot be classified as part of a "proliferative disorder." Normal cells lack unregulated or abnormal growth, or both, that can lead to the development of an undesirable pathology or disease. Preferably, normal cells normally have functional cell cycle checkpoint control mechanisms.

[0190] Those skilled in the art can refer to general reference documents for detailed descriptions of known techniques or equivalent techniques discussed herein, including Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc. (2005), Sambrook et al., Molecular Cloning, A Laboratory Manual (3rd edition), Cold Spring Harbor Press, Cold Spring Harbor, NY (2000), Coligan et al., Current Protocols in Immunology, John Wiley & Sons, NY, Erma et al., Current Protocols in Pharmacology, John Wiley & Sons, NY, Fingl et al., The Pharmacological Basis of Therapeutics (1975), Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 18th edition (1990). These documents can of course also be referred to in order to carry out or use aspects of the present application.

[0191] In certain embodiments, the compounds of the present application are useful for treating proliferative diseases (e.g., cancer, benign neoplasms, inflammatory diseases, and autoimmune diseases). In certain embodiments, the levels of or growth of cellular proteins of a subject, such as pathogenic and oncogenic proteins, are modulated by contacting the cells with a compound or composition as described herein in accordance with the therapeutic methods of the present application. In other embodiments, the compounds are useful for treating cancer.

[0192] In certain embodiments, the methods comprise administering a therapeutically effective amount of a compound or a pharma- ceutically acceptable derivative thereof to a subject (including, but not limited to, a human or an animal) in need thereof.

[0193] Additionally, the present application provides pharma- ceutically acceptable derivatives of the compounds, and methods of treating a subject with these compounds, pharmaceutical compositions thereof, or any of these in combination with one or more additional therapeutic agents.

[0194] For example, other therapies or anti-cancer agents that can be used in combination with the compounds disclosed herein include surgery, radiation therapy, endocrine therapy, biological response modifiers (interferons, interleukins, and tumor necrosis factor (TNF) to name a few), hyperthermia and cryotherapy, agents that attenuate any adverse effects (e.g., antiemetics), as well as alkylating agents (mechlorethamine, chlorambucil, cyclophosphamide, melphalan, ifosfamide), antimetabolites (methotrexate), purine antagonists, and pyrimidine antagonists (6-mercaptopurine, 5-fluroxane, 5-methylcyclohexanediaminetetraacetate ... Other approved chemotherapeutic agents include, but are not limited to, olouracil, cytarabine, gemcitabine, spindle poisons (vinblastine, vincristine, vinorelbine, paclitaxel), podophyllotoxins (etoposide, irinotecan, topotecan), antibiotics (doxorubicin, bleomycin, mitomycin), nitrosoureas (carmustine, lomustine), inorganic ions (cisplatin, carboplatin), enzymes (asparaginase), and hormones (tamoxifen, leuprolide, flutamide, and megestrol). For a more comprehensive discussion of cancer therapy overview, see The Merck Manual, Twentieth Ed. 2020, the contents of which are incorporated herein by reference in their entirety. See also the National Cancer Institute's (NCI) website (www.nci.nih.gov) and the U.S. Food and Drug Administration's (FDA) website (www.fda.gov / cder / cancer / druglistframe) for a list of FDA-approved oncology drugs.

[0195] In certain embodiments, pharmaceutical compositions comprising compounds disclosed herein further comprise one or more additional therapeutically active ingredients (e.g., chemotherapy and / or palliatives). For purposes of this application, the term "palliative" refers to treatments that focus on relieving symptoms of a disease and / or side effects of a treatment regimen, but are not curative. For example, palliative treatments include painkillers, anti-nausea drugs, and anti-sickness drugs. In addition, chemotherapy, radiation therapy, and surgery can all be used palliatively (i.e., to reduce symptoms without curing, e.g., to shrink tumors, reduce pressure, bleeding, pain, and other symptoms of cancer).

[0196] Administration, Pharmaceutical Compositions Administration of the disclosed compounds and pharmaceutical compositions can be achieved via any mode of administration for a therapeutic agent, including systemic or local administration, such as oral, nasal, parenteral, transdermal, subcutaneous, vaginal, buccal, rectal, or topical.

[0197] Depending on the intended mode of administration, the disclosed compositions may be administered in solid, semi-solid, or liquid forms, optionally in unit dosage amounts, consistent with customary pharmaceutical practice, such as, for example, injections, tablets, suppositories, pills, sustained release capsules, elixirs, tinctures, emulsions, syrups, powders, solutions, suspensions, and the like. Likewise, they may be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts.

[0198] Exemplary pharmaceutical compositions include a compound of the present disclosure and a pharma- ceutically acceptable carrier, such as a) a diluent, such as purified water, triglyceride oil, such as hydrogenated or partially hydrogenated vegetable oil, or mixtures thereof, corn oil, olive oil, sunflower oil, safflower oil, fish oil, such as EPA or DHA, or esters or triglycerides thereof, or mixtures thereof, omega-3 fatty acids or derivatives thereof, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, sodium, saccharin, glucose, and / or glycine, b) a lubricant, such as silica, talc, stearic acid, magnesium or calcium salts thereof, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, c) a lubricant, such as glycerin, stearate, sorbitol, cellulose, sodium saccharin, glucose, and / or glycine, d) a lubricant, such as glycerin, stearate, sorbitol ... In the case of tablets and if desired also c) binders, for example magnesium aluminium silicate, starch paste, gelatine, tragacanth, methylcellulose, sodium carboxymethylcellulose, magnesium carbonate, natural sugars, for example glucose or β-lactose, corn sweeteners, natural and synthetic gums, for example acacia, tragacanth or sodium alginate, waxes and / or polyvinylpyrrolidone, d) disintegrants, for example starch, agar, methylcellulose, bentonite, xanthan gum, alginic acid or its sodium salt, or effervescent mixtures, e) absorbents, colourings, flavourings and sweeteners, f) emulsifiers or dispersing agents, for example Tween g) tablets and gelatin capsules comprising an emulsifier such as cyclodextrin, hydroxypropyl-cyclodextrin, PEG 400, PEG 200, PEG 300, PEG 400, PEG 500, PEG 600, PEG 700, PEG 80, Labrasol, HPMC, DOSS, caproyl 909, labrafac, labrafil, peceol, transcutol, capmul MCM, capmul PG-12, captex 355, gelucire, vitamin E TGPS, or other acceptable emulsifier, and / or g) an agent that enhances absorption of the compound, such as cyclodextrin, hydroxypropyl-cyclodextrin, PEG 400, PEG 200.

[0199] Liquid, particularly injectable compositions can be prepared, for example, by dissolving, dispersing, etc. For example, the disclosed compounds are dissolved in or mixed with a pharma- ceutically acceptable solvent, such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, etc., to form an injectable isotonic solution or suspension. Proteins, such as albumin, chylomicron particles, or serum proteins, can be used to solubilize the disclosed compounds.

[0200] The disclosed compounds can also be formulated as suppositories which can be prepared from fatty emulsions or suspensions, using polyalkylene glycols, such as propylene glycol, as the carrier.

[0201] The disclosed compounds can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles, and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids containing cholesterol, stearylamine, or phosphatidylcholines.

[0202] In some embodiments, a coating of lipid components is hydrated with an aqueous solution of the drug to form a lipid layer that encapsulates the drug, as described in U.S. Pat. No. 5,262,564, which is incorporated herein by reference in its entirety.

[0203] The disclosed compounds can also be delivered by using monoclonal antibodies as individual carriers to which the disclosed compounds are coupled. The disclosed compounds can also be coupled with soluble polymers as targetable drug carriers. Such polymers include polyvinylpyrrolidone, pyran copolymers, polyhydroxypropylmethacrylamidephenol, polyhydroxyethylaspanamidephenol, or polyethylene oxide polylysine substituted with palmitoyl residues. In addition, the disclosed compounds can be coupled to classes of biodegradable polymers useful for achieving controlled release of drugs, such as crosslinked or amphiphilic block copolymers of polylactides, polyepsiloncaprolactones, polyhydroxybutyrates, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates, and hydrogels. In one embodiment, the disclosed compounds are not covalently attached to polymers, such as polycarboxylic acid polymers or polyacrylates.

[0204] Parenteral injectable administration is generally used for subcutaneous, intramuscular, or intravenous injections and infusions. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, or as solid forms suitable for dissolving in liquid prior to injection.

[0205] Another aspect of the present disclosure relates to a pharmaceutical composition comprising a compound of formula (I) and a pharma- ceutically acceptable carrier, which may further include an excipient, diluent, or surfactant.

[0206] The compositions can be prepared according to conventional mixing, granulating, or coating methods, respectively, and the pharmaceutical compositions can contain about 0.1% to about 99%, about 5% to about 90%, or about 1% to about 20% of the disclosed compounds by weight or volume.

[0207] In one embodiment, the present disclosure provides a kit comprising two or more separate pharmaceutical compositions, at least one of which contains a compound of the present disclosure. In one embodiment, the kit comprises a means for separately holding the compositions, such as a container, a divided bottle, or a divided foil packet. One example of such a kit is a blister pack, typically used for packaging tablets, capsules, and the like.

[0208] The kits of the present disclosure can be used to administer different dosage forms, e.g., oral and parenteral dosage forms, to administer the separate compositions at various dosage intervals, or to titrate the separate compositions relative to one another. To aid in compliance, the kits of the present disclosure typically include instructions for administration.

[0209] Pharmaceutical dosage forms of the compounds of the present disclosure can be prepared by any of the methods well known in the art, such as, for example, conventional mixing, sieving, dissolving, melting, granulating, dragee-making, tableting, suspending, extruding, spray-drying, wet-grinding, emulsifying, (nano / micro)encapsulating, entrapping, or lyophilizing processes. As mentioned above, the compositions of the present disclosure may contain one or more physiologically acceptable inactive ingredients that facilitate processing of the active molecules into preparations for pharmaceutical use.

[0210] As mentioned above, the composition generally comprises the combination of the compound of the present disclosure and at least one pharma-ceutically acceptable additive.Acceptable additive is non-toxic, aids administration, and does not adversely affect the therapeutic utility of the claimed compound.Such additive can be any solid additive, liquid additive, semi-solid additive, or gaseous additive in the case of aerosol composition, that is generally available to those skilled in the art.

[0211] Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk, etc. Liquid excipients and semi-solid excipients can be selected from glycerol, propylene glycol, water, ethanol, and various oils including oils of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. In some embodiments, liquid carriers, particularly for injectable solutions, include water, saline, aqueous dextrose, and glycols.

[0212] The compounds of the present disclosure can be dispersed in aerosol form using compressed gases. Suitable inert gases for this purpose include nitrogen, carbon dioxide, etc. Other suitable pharmaceutical additives and their formulations are described in Remington's Pharmaceutical Sciences, edited by EW Martin (Mack Publishing Company, 18th ed., 1990).

[0213] The compositions of the present disclosure may be provided in a pack or dispenser device that contains one or more unit dosage forms containing active ingredient if desired.Such a pack or device may contain metal or plastic foil, such as a blister pack, or may contain glass and rubber stopper, such as a vial.The pack or dispenser device may be accompanied by instructions for use on administration.Compositions containing the compounds of the present disclosure that can be formulated in a compatible pharmaceutical carrier may be prepared, placed in a suitable container, and labeled for the treatment of the indicated disease.

[0214] The amount of the compound in the formulation can vary within the full range used by those skilled in the art. Typically, the formulation will contain, on a weight percent (wt%) basis, about 0.01% to 99.99% by weight of the compound of the present disclosure relative to the total formulation, with the remainder being one or more suitable pharmaceutical excipients. In one embodiment, the compound is present at a level of about 1% to 80% by weight. Representative pharmaceutical formulations are described below.

[0215] Formulation examples The following are representative pharmaceutical formulations containing the compounds of the present disclosure.

[0216] Formulation Example 1--Tablet Formulation The following ingredients are intimately mixed and compressed into single scored tablets:

[0217] [Table 4]

[0218] Formulation Example 2--Capsule formulation The following ingredients are intimately mixed and loaded into a hard shell gelatin capsule:

[0219] [Table 5]

[0220] Formulation Example 3--Suspension Formulation The following ingredients are mixed to form a suspension for oral administration:

[0221] [Table 6]

[0222] Formulation Example 4 - Injection formulation The following ingredients are mixed to form an injectable formulation:

[0223] [Table 7]

[0224] Formulation Example 5--Suppository Formulation Suppositories with a total weight of 2.5 g are prepared by mixing a compound of the present disclosure with Witepsol™ H-15 (triglyceride of saturated vegetable fatty acids, Riches-Nelson, Inc., New York), the suppositories having the following composition: [Table 8]

[0225] dosage Dosage regimens utilizing the disclosed compounds are selected according to a variety of factors, including the type, species, age, weight, sex, and condition of the patient, the severity of the condition being treated, the route of administration, the renal or hepatic function of the patient, and the particular disclosed compound being used. A physician or veterinarian of ordinary skill in the art can readily determine and prescribe the effective amount of the agent required to prevent, counter, or arrest the progress of the condition.

[0226] The effective dosage of the disclosed compounds, when used for the indicated effects, ranges from about 0.5 mg to about 5000 mg of the disclosed compounds required to treat a condition. Compositions for use in vivo or in vitro may contain about 0.5 mg, 5 mg, 20 mg, 50 mg, 75 mg, 100 mg, 150 mg, 250 mg, 500 mg, 750 mg, 1000 mg, 1250 mg, 2500 mg, 3500 mg, or 5000 mg of the disclosed compounds, or within a range from one amount to another amount listed in the dosage. In one embodiment, the composition is in the form of a tablet, which may be scored.

[0227] The following synthetic and biological examples are offered to illustrate this disclosure and are not to be construed in any way as limiting the scope of this disclosure. All temperatures are in degrees Celsius unless otherwise specified. EXAMPLES

[0228] The present disclosure will be further understood by reference to the following examples, which are intended purely to be illustrative of the present disclosure. The present disclosure is not limited in scope by the illustrated embodiments, which are merely intended as illustrations of single aspects of the present disclosure. Any functionally equivalent methods are also within the scope of the present disclosure. Various modifications of the present disclosure in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to be within the scope of the appended claims.

[0229] In this specification and in the examples below, all temperatures are in degrees Celsius. Additionally, the following abbreviations have the following meanings. If not defined, these abbreviations have their art recognized meaning.

[0230] [Table 9] TIFF2024529298000121.tif175170

[0231] LC-MS method (general method) Method A: Phenomenex Luna C 18 Experiments were performed using a mass spectrometer using a column (150 mm x 30 mm x 5 μm) at a flow rate of 20 mL / min and ESI as the ionization source. Solvent A was 4.0 mL TFA in 4 L water and solvent B was 4.0 mL TFA in 4 L acetonitrile. The gradient consisted of 10% -> 45% solvent B over 8 min and the LC column temperature was 40°C. UV absorbance was collected at 220 nm and 254 nm.

[0232] Method B: Waters Xbridge C 18Experiments were performed using a mass spectrometer using a column (150 mm x 50 mm x 10 μm) at a flow rate of 20 mL / min and ESI as the ionization source. Solvent A was 4.0 mL TFA in 4 L water and solvent B was 4.0 mL TFA in 4 L acetonitrile. The gradient consisted of 40% -> 60% solvent B over 10 min and the LC column temperature was 40°C. UV absorbance was collected at 220 nm and 254 nm.

[0233] Example A: 3-(5-(((1S,2S)-2-aminocyclohexyl)oxy)-1-oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione: [ka]

[0234] This intermediate was prepared according to a reported literature procedure (ADCOCK, Claire et al., U.S. Patent Application Publication No. 2020 / 17461, 2020).

[0235] Example 1 (S)-3-(1-oxo-5-(((1S,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl)oxy)isoindolin-2-yl)piperidine-2,6-dione (compound 10) [ka]

[0236] Step 1: [ka]

[0237] To a solution of 2-phenylpropane-1,3-diol (5 g, 32.85 mmol, 1 equiv) in DCM (100 mL), TsCl (21.92 g, 114.99 mmol, 3.5 equiv), DMAP (401.37 mg, 3.29 mmol, 0.1 equiv), and Et3N (13.30 g, 131.41 mmol, 18.29 mL, 4 equiv) were added and the mixture was stirred at 20° C. for 16 h. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography (1:100→1:50 petroleum ether in ethyl acetate) to give 2-phenylpropane-1,3-diylbis(4-methylbenzenesulfonate). 1 H NMR (400 MHz, CDCl3) δ 2.45 (s, 6 H), 3.27 (m, 1 H), 4.21 (d, J=6.02 Hz, 4 H), 7.01 - 7.07 (m, 2 H), 7.21 - 7.27 (m, 3 H), 7.30 (d, J=8.03 Hz, 4 H), 7.67 (d, J=8.53 Hz, 4 H).

[0238] Step 2: [ka]

[0239] 3-(5-(((1S,2S)-2-aminocyclohexyl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (500 mg, 1.03 mmol, 1 equiv), 2-phenylpropane-1,3-diylbis(4-methylbenzenesulfonate) (708.32 mg, 1.54 mmol, 1.5 equiv), and DIEA (530.04 mg, 4.10 mmol, 714.34 μL, 4 equiv) were dissolved in ACN (10 mL) in a microwave tube. The sealed tube was heated at 120° C. for 16 h. Three additional vials were prepared as above. All four reaction mixtures were combined and worked up. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by preparative HPLC (Method B) to give 3-(1-oxo-5-(((1S,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl)oxy)isoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione. MS (ESI+): m / z 604.5 (M+H) + .

[0240] Step 3: [ka]

[0241] To a solution of 3-(1-oxo-5-(((1S,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl)oxy)isoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione (0.7 g, 1.16 mmol, 1 equiv) in DCM (50 mL) was added MsOH (445.67 mg, 4.64 mmol, 330.13 μL, 4 equiv) at 20 °C and the mixture was stirred at 20 °C for 2 h before being cooled to rt with N 1 ,N 2-Dimethylethane-1,2-diamine (122.63 mg, 1.39 mmol, 149.73 μL, 1.2 equiv) and TEA (938.46 mg, 9.27 mmol, 1.29 mL, 8 equiv) were added to the mixture. The mixture was stirred at 20° C. for 2 h. LCMS showed that the starting material was completely consumed. The reaction mixture was filtered and the filtrate was concentrated in vacuo to give a residue. The residue was purified by preparative HPLC (Method A) to give 3-(1-oxo-5-(((1S,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl)oxy)isoindolin-2-yl)piperidine-2,6-dione. 1 H NMR (400 MHz, d6-DMSO) δ 1.07 - 1.19 (m, 1 H), 1.20 - 1.32 (m, 1 H), 1.34 - 1.44 (m, 2 H), 1.65 (br s, 2 H), 1.78 - 1.89 (m, 1 H), 1.92 - 2.05 (m, 2 H), 2.35 - 2.45 (m, 2 H), 2.55 - 2.63 (m, 1 H), 2.84 - 2.96 (m, 1 H), 3.12 (br s, 1 H), 3.26 (br d, J=7.15 Hz, 1 H), 3.45 - 3.55 (m, 1 H), 3.62 (m, 2 H), 4.20 - 4.32 (m, 2 H), 4.33 - 4.42 (m, 1 H), 5.06 (m, 1 H), 7.04 (br d, J=8.58 Hz, 1 H), 7.16 - 7.21 (m, 2 H), 7.26 - 7.34 (m, 4 H), 7.60 (d, J=8.58 Hz, 1 H), 10.97 (s, 1 H).

[0242] When X is hydrogen, it is believed that the 3-stereocenter of piperidine-2,6-dione may undergo epimerization in vivo. The epimers of the 3-stereocenter of the piperidine-2,6-dione product can be separated by chiral HPLC (column: (S,S)-WHELK-O1, (250 mm×30 mm×10 μm), mobile phase: (0.1% IPAm in IPA)).

[0243] Example 2 3-(5-((2-(3-(6-methoxypyridin-3-yl)azetidin-1-yl)cyclohexyl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (compound 27) [ka]

[0244] Step 1: [ka]

[0245] To a solution of methyl 2-(2-fluorophenyl)acetate (5 g, 28.54 mmol, 1 equiv) in THF (150 mL) was added dimethyl carbonate (7.71 g, 85.62 mmol, 7.21 mL, 3 equiv) at 20° C. under N2 atmosphere. NaH (2.85 g, 71.35 mmol, 60%, 2.5 equiv) was added at 0° C. The mixture was stirred at 70° C. for 3 h. After cooling to 0° C., the reaction mixture was quenched with water (100 mL). The reaction mixture was partitioned between ethyl acetate (150 mL) and water (50 mL). The combined organic layers were washed with saturated brine (100 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (10%→20% ethyl acetate in petroleum ether) to give dimethyl 2-(2-fluorophenyl)malonate. 1 H NMR (400 MHz, d6-DMSO) δ ppm 3.70 (s, 6 H), 5.16 (s, 1 H), 7.19 - 7.28 (m, 2 H), 7.37 - 7.46 (m, 2 H).

[0246] Step 2: [ka]

[0247] To a solution of dimethyl 2-(2-fluorophenyl)malonate (3.5 g, 15.47 mmol, 1 equiv.) in THF (80 mL) was added LiAlH4 (1.17 g, 30.95 mmol, 2 equiv.) at 0° C. under N2 atmosphere. The mixture was stirred at 20° C. for 12 h. The reaction was quenched at 0° C. by addition of sodium sulfate decahydrate and filtered. The filter cake was washed with THF (3×100 mL) and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (25%→50% ethyl acetate in petroleum ether) to give 2-(2-fluorophenyl)propane-1,3-diol. 1 H NMR (400 MHz, d6-DMSO) δ 3.35 (s, 1 H), 3.55 - 3.78 (m, 4 H), 4.62 (t, J=5.37 Hz, 2 H), 7.05 - 7.16 (m, 2 H), 7.19 - 7.26 (m, 1 H), 7.34 (td, J=7.73, 1.86 Hz, 1H).

[0248] Step 3: [ka]

[0249] To a solution of 2-(2-fluorophenyl)propane-1,3-diol (300 mg, 1.76 mmol, 1 equiv), TsCl (533.91 mg, 6.17 mmol, 3.5 equiv), and DMAP (21.54 mg, 176.28 μmol, 0.1 equiv) in ACN (3 mL) was added TEA (713.52 mg, 7.05 mmol, 981.46 μL, 4 equiv) at 0° C. The mixture was stirred at 20° C. for 12 h. The reaction was filtered, the filter cake was washed with ACN (3×50 mL), and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (25%→50% ethyl acetate in petroleum ether) to give 2-(2-fluorophenyl)propane-1,3-diylbis(4-methylbenzenesulfonate). 1H NMR (400 MHz, d6-DMSO) δ ppm 2.41 (s, 6 H), 4.15 - 4.28 (m, 4 H), 7.03 - 7.24 (m, 4 H), 7.31 (ddd, J=15.38, 5.44, 1.69 Hz, 1 H), 7.41 (d, J=8.00 Hz, 4 H), 7.62 (d, J=8.38 Hz, 4 H).

[0250] Step 4: [ka]

[0251] To a solution of 3-(5-(((1S,2S)-2-aminocyclohexyl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione (100 mg, 279.80 μmol, 1 equiv.) and 2-(2-fluorophenyl)propane-1,3-diylbis(4-methylbenzenesulfonate) (174.07 mg, 363.74 μmol, 1.3 equiv.) in ACN (3 mL) was added DIEA (144.65 mg, 1.12 mmol, 194.94 μL, 4 equiv.) at 20° C. The mixture was stirred at 120° C. for 12 h in a sealed tube. The reaction was concentrated under reduced pressure to give a residue. The residue was purified by preparative HPLC (Method B) to give 3-(5-(((1S,2S)-2-(3-(2-fluorophenyl)azetidin-1-yl)cyclohexyl)oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione. 1H NMR (400 MHz, d6-DMSO) δ 1.17 - 1.51 (m, 5 H), 1.69 - 1.82 (m, 2 H), 1.98 (br dd, J=11.13, 4.75 Hz, 1 H), 2.09 - 2.26 (m, 3 H), 2.86 - 2.95 (m, 1 H), 3.64 - 3.77 (m, 1 H), 4.07 - 4.46 (m, 6 H), 4.48 - 4.56 (m, 2 H), 5.04 - 5.13 (m, 1 H), 7.15 - 7.33 (m, 4 H), 7.36 - 7.44 (m, 1 H), 7.56 (br t, J=7.25 MS (ESI+): m / z 492.2 (M+H) + .

[0252] Example 3 Racemic 4-(1-((trans)-2-((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)cyclohexyl)azetidin-3-yl)-2-fluorobenzonitrile (compound 119) and racemic 4-(1-((cis)-2-((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)cyclohexyl)azetidin-3-yl)-2-fluorobenzonitrile (compound 122). [ka]

[0253] Step 1: [ka]

[0254] 3-(5-bromo-1-oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione (3.84 g, 33.08 mmol, 1.5 equiv.) (prepared according to the literature procedure described in PCT International Application WO2020012334), cyclohexane-1,2-diol (2.55 g, 22.0 mmol, 1.5 equiv.) in CHCN (100 mL). To a mixture of Ir[(dF(CF3)ppy)2dtbbpy]PF6 (247.44 mg, 220.56 μmol, 0.01 equiv.), dtbbpy (295.98 mg, 1.10 mmol, 0.05 equiv.), Ir[(dF(CF3)ppy)2dtbbpy]PF6 (247.44 mg, 220.56 μmol, 0.01 equiv.), and NiCl2·glyme (242.30 mg, 1.10 mmol, 0.05 equiv.) was added TMP (3.74 g, 26.47 mmol, 4.49 mL, 1.2 equiv.). The reaction mixture was stirred at 25 °C for 12 h. The reaction mixture was filtered and then concentrated in vacuo. The residue was purified by column chromatography (50%→100% ethyl acetate in petroleum) to give 3-(5-((2-hydroxycyclohexyl)oxy)-1-oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione. 11H NMR (400 MHz, d6-DMSO) δ 7.65 - 7.57 (m, 1H), 7.19 (s, 1H), 7.07 (dd, J = 2.1, 8.4 Hz, 1H), 5.18 (dd, J = 5.0, 13.4 Hz, 1H), 5.05 (q, J = 9.7 Hz, 2H), 4.94 (dd, J = 1.2, 4.7 Hz, 1H), 4.47 (d, J = 3.6 Hz, 1H), 4.40 (dd, J = 4.9, 17.1 Hz, 1H), 4.26 - 4.12 (m, 2H), 3.61 - 3.46 (m, 3H), 3.14 - 2.99 (m, 2H), 2.78 (br dd, J = 2.1, 15.6 Hz, 1H), 2.43 - 2.28 (m, 1H), 2.07 - 2.01 (m, 2H), 1.94 - 1.82 (m, 1H), 1.79 - 1.69 (m, 1H), 1.63 (br d, J = 9.6 Hz, 2H), 1.58 - 1.53 (m, 1H), 1.37 - 1.27 (m, 3H), 1.13 (br d, J = 7.9 Hz, 1H), 0.90 - 0.78 (m, 2H), 0.02 (s, 9H).

[0255] Project 2: [Chemical]

[0256] To a mixture of 3-(5-((2-hydroxycyclohexyl)oxy)-1-oxoisoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione (5 g, 10.23 mmol, 1 equiv.) in DCM (50 mL) was added DMP (8.68 g, 20.46 mmol, 6.34 mL, 2 equiv.). The mixture was stirred at 25° C. for 2 h. The reaction mixture was filtered and concentrated in vacuo. The residue was purified by column chromatography (50%→100% petroleum ether in ethyl acetate) to give 3-(1-oxo-5-((2-oxocyclohexyl)oxy)isoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione. 1 H NMR (400 MHz, d6-DMSO) δ 7.59 (d, J = 8.4 Hz, 1H), 7.07 (s, 1H), 7.00 (dd, J = 1.2, 8.4 Hz, 1H), 5.25 - 5.14 (m, 2H), 5.09 - 4.97 (m, 2H), 4.38 (dd, J = 5.0, 17.0 Hz, 1H), 4.25 - 4.15 (m, 1H), 3.72 - 3.42 (m, 2H), 3.16 - 3.00 (m, 1H), 2.87 - 2.73 (m, 1H), 2.71 - 2.58 (m, 1H), 2.40 - 2.28 (m, 3H), 2.10 - 1.99 (m, 2H), 1.93 - 1.74 (m, 3H), 1.66 - 1.51 (m, 1H), 0.88 - 0.79 (m, 2H), 0.02 (d, J = 1.4 Hz, 9H).

[0257] One skilled in the art would be able to separate and isolate the individual stereoisomers of the reported 3-(1-oxo-5-((2-oxocyclohexyl)oxy)isoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione product using techniques known in the art.

[0258] Step 3: [ka]

[0259] To a solution of 4-bromo-2-fluorobenzonitrile (1.59 g, 7.94 mmol, 1.00 equiv.) and (1-tert-butoxycarbonylazetidin-3-yl)-iodozinc (4.15 g, 11.91 mmol, 1.50 equiv.) in DMA (20 mL) was added Pd2(dba)3 (145.40 mg, 158.80 μmol, 0.02 equiv.) and TFP (184.32 mg, 794.00 μmol, 0.10 equiv.) under N2. The reaction mixture was stirred at 25° C. for 12 h. After addition of water (50 mL), the aqueous residue was extracted with ethyl acetate (3×50 mL), the combined organic layers were dried over Na2SO4, and the solvent was evaporated under reduced pressure to give the crude product. The residue was purified by column chromatography (SiO 2 , 0%→50% ethyl acetate in petroleum ether) to give tert-butyl 3-(4-cyano-3-fluorophenyl)azetidine-1-carboxylate. 1 H NMR (400 MHz, d6-DMSO) δ 7.90 (dd, J = 7.2, 7.8 Hz, 1H), 7.56 (dd, J = 1.3, 10.9 Hz, 1H), 7.40 (dd, J = 1.5, 8.1 Hz, 1H), 4.24 (br t, J = 8.0 Hz, 2H), 3.97 - 3.82 (m, 3H), 1.39 (s, 9H).

[0260] Step 4: [ka]

[0261] To a solution of tert-butyl 3-(4-cyano-3-fluorophenyl)azetidine-1-carboxylate (1.00 g, 3.62 mmol, 1.00 equiv) in DCM (10 mL) was added TFA (4.62 g, 40.52 mmol, 3 mL, 11.20 equiv). The reaction mixture was stirred at 25° C. for 12 h. Water (50 mL) was added and the aqueous residue was washed with DCM (3×10 mL). The aqueous phase was lyophilized to give 4-(azetidin-3-yl)-2-fluorobenzonitrile. 1 H NMR (400 MHz, d6-DMSO) δ 8.02 - 7.92 (m, 1H), 7.67 (dd, J = 1.3, 10.9 Hz, 1H), 7.45 (dd, J = 1.4, 8.1 Hz, 1H), 4.26 - 4.19 (m, 2H), 4.19 - 4.05 (m, 3H).

[0262] Step 5: [ka]

[0263] To a solution of 3-[1-oxo-5-(2-oxocyclohexoxy)isoindolin-2-yl]piperidine-2,6-dione (50 mg, 140.30 μmol, 1.00 equiv.) and 4-(azetidin-3-yl)-2-fluorobenzonitrile (49.44 mg, 280.60 μmol, 2.00 equiv.) in DMA (1 mL) and MeOH (1 mL) was added ZnCl2 (76.49 mg, 561.20 μmol, 26.29 μL, 4.00 equiv.). The reaction mixture was stirred at 25° C. for 10 h. NaBH3CN (26.45 mg, 420.90 μmol, 3.00 equiv.) was added. The reaction mixture was stirred at 25° C. for 2 h. The mixture was filtered and the filtrate was concentrated to give the crude product. The residue was purified by preparative HPLC (Method A) to give racemic 4-(1-((trans)-2-((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)cyclohexyl)azetidin-3-yl)-2-fluorobenzonitrile (compound 122) and racemic 4-(1-((cis)-2-((2-(2,6-dioxopiperidin-3-yl)-1-oxoisoindolin-5-yl)oxy)cyclohexyl)azetidin-3-yl)-2-fluorobenzonitrile (compound 119).

[0264] Example 4 3-(1-oxo-5-(((1S,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl)oxy)isoindolin-2-yl)piperidine-2,6-dione (compound 127) [ka]

[0265] Step 1: [ka]

[0266] To a solution of methyl 4-bromo-2-(bromomethyl)benzoate (1 eq.) in DMF (0.3 M) was added 3-aminopiperidine-2,6-dione (1.2 eq.) and DIEA (4 eq.) portionwise at 20° C. The mixture was stirred at 120° C. for 16 h. The reaction mixture was poured into ice water and stirred for 20 min. The precipitated solid was filtered and the resulting material was dried to give 3-(5-bromo-1-oxo-isoindolin-2-yl)piperidine-2,6-dione. 1 H NMR (400 MHz, d6-DMSO) δ 1.94 - 2.07 (m, 1 H), 2.32 - 2.45 (m, 1 H), 2.56 - 2.65 (m, 1 H), 2.89 - 2.96 (m, 1 H), 2.90 - 2.97 (m, 1 H), 3.82 (s, 1 H), 4.29 - 4.52 (m, 2 H), 5.11 (dd, J=13.26, 5.13 Hz, 1 H), 7.62 - 7.77 (m, 2 H), 7.89 (s, 1 H), 7.87 - 7.91 (m, 1 H), 11.00 (s, 1 H).

[0267] Step 2: [ka]

[0268] To a solution of 3-(5-bromo-1-oxo-isoindolin-2-yl)piperidine-2,6-dione (1 eq.) in DMF (0.2 M) was added DBU (2 eq.). 2-(chloromethoxy)ethyl-trimethyl-silane (1.6 eq.) was added dropwise at 0° C. over 30 min. The mixture was stirred at 20° C. for 1 h. The reaction mixture was poured into ice water and stirred for 20 min. The precipitated solid was filtered and dried to give 3-(5-bromo-1-oxo-isoindolin-2-yl)-1-(2-trimethylsilylethoxymethyl)piperidine-2,6-dione. 1H NMR (400 MHz, d6-DMSO) δ 0.02 (s, 9 H), 0.75 - 0.88 (m, 2 H), 2.00 - 2.11 (m, 1 H), 2.38 (qd, J=13.30, 4.50 Hz, 1 H), 2.74 - 2.85 (m, 1 H), 2.98 - 3.13 (m, 1 H), 3.47 - 3.57 (m, 2 H), 4.27 - 4.35 (m, 1 H), 4.45 - 4.54 (m, 1 H), 5.05 (q, J=9.76 Hz, 2 H), 5.23 (dd, J=13.45, 5.07Hz, 1H), 7.65 - 7.75 (m, 2H), 7.90 (s, 1H).

[0269] Step 3: [ka]

[0270] To a solution of 3-(5-bromo-1-oxo-isoindolin-2-yl)-1-(2-trimethylsilylethoxymethyl)piperidine-2,6-dione (1 eq.) in dioxane (0.4 M) was added BPD (2 eq.) and KOAc (5 eq.). Pd2(dba)3 (0.03 eq.) was added portionwise at 20° C. under N2. The mixture was stirred at 100° C. under N2 for 12 h. The mixture was cooled to 20° C. THF (to make a 0.36 M solution), water (to make a 0.36 M solution), and sodium 3-oxidedioxaborilane tetrahydrate (2 eq.) were added and the mixture was stirred at 25° C. for 4 h. The reaction mixture was poured into water and extracted with ethyl acetate (3 times). The combined organic phase was washed with saturated brine, dried over anhydrous Na2SO4, and concentrated in vacuo to give a residue. The residue was purified by silica gel chromatography (10%→20% ethyl acetate in petroleum ether) to give 3-(5-hydroxy-1-oxo-isoindolin-2-yl)-1-(2-trimethylsilylethoxymethyl)piperidine-2,6-dione. 1H NMR (400 MHz, d6-DMSO) δ 0.02 (s, 9 H), 0.77 - 0.89 (m, 2 H), 1.95 - 2.06 (m, 1 H), 2.34 (qd, J=13.24, 4.32 Hz, 1 H), 2.70 - 2.87 (m, 1 H), 2.95 - 3.17 (m, 1 H), 3.43 - 3.60 (m, 2 H), 4.12 - 4.21 (m, 1 H), 4.36 (d, J=16.88 Hz, 1 H), 5.04 (q, J=9.67 Hz, 2 H), 5.17 (dd, J=13.45, 5.07 Hz, 1 H), 6.83 - 7.00 (m, 2 H), 7.54 (d, J=8.25 Hz, 1 H), 10.19 (s, 1 H).

[0271] Step 4: [ka]

[0272] To a solution of tert-butyl ((1S,2S)-2-hydroxycyclohexyl)carbamate (1 equiv.), 4-nitrobenzoic acid (1.1 equiv.), and PPh3 (1.7 equiv.) in THF (0.3 M) was added DEAD (1.5 equiv.) dropwise at 0° C. under N2. The mixture was stirred at 25° C. under N2 for 12 h. The reaction was poured into water and extracted with ethyl acetate (3 times). The combined organic phase was washed with saturated brine, dried over anhydrous Na2SO4, and concentrated in vacuo to give a residue. The residue was triturated with ethyl acetate, filtered, and the filtrate was concentrated under reduced pressure to give (1R,2S)-2-((tert-butoxycarbonyl)amino)cyclohexyl 4-nitrobenzoate, which was used directly in the subsequent step.

[0273] Step 5: [ka]

[0274] To a solution of (1R,2S)-2-((tert-butoxycarbonyl)amino)cyclohexyl 4-nitrobenzoate (1 equiv.) in DCM (0.3 M) was added TFA (9.23 equiv.) at 20 °C. The reaction was stirred at 20 °C for 12 h. The mixture was concentrated in vacuo to give a residue. The residue was triturated with ethyl acetate for 12 h. After filtration, the mother liquor was concentrated under reduced pressure to give a residue. The residue was triturated with 1:2 (v / v) ethyl acetate:TBME and the precipitated solid was collected by filtration followed by trituration with CHCl. ​​The solid was collected by filtration and dried under reduced pressure to give [(1R,2S)-2-aminocyclohexyl] 4-nitrobenzoate·TFA. 1 H NMR (400 MHz, d6-DMSO) δ ppm 1.34 - 1.54 (m, 3 H), 1.61 - 1.91 (m, 4 H), 1.96 - 2.09 (m, 1 H), 3.48 (br t, J=6.19 Hz, 1 H), 5.25 - 5.38 (m, 1 H), 5.75 (s, 3 H), 8.29 - 8.40 (m, 4 H).

[0275] Step 6: [ka]

[0276] To a solution of 2-phenylpropane-1,3-diol (1 eq.) in MeCN (0.35 M) was added TfO (2.1 eq.) slowly over 20 min at -20 °C. DIEA (2.5 eq.) was added dropwise over 20 min. The mixture was stirred for 30 min. A solution of [(1R,2S)-2-aminocyclohexyl] 4-nitrobenzoate·TFA (1 eq.) and DIEA (3.5 eq.) in MeCN (1.0 M) was added dropwise. The reaction was stirred at 70 °C for 12 h. The mixture was concentrated under reduced pressure to give a residue. The residue was triturated with EtOAc and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel chromatography (10%→50% ethyl acetate in petroleum ether) to give [(1R,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl] 4-nitrobenzoate. 1 H NMR (400 MHz, d6-DMSO) δ 1.29-1.38 (m, 1H), 1.47-1.65 (m, 5H), 1.66-1.77 (m, 1H), 1.92-1.98 (m, 1H), 2.46 (br d, J=7.50 Hz, 1H), 3.01-3.19 (m, 2H), 3.43-3.71 (m, 3H), 5.20-5.30 (m, 1H), 7.10-7.34 (m, 5H), 8.15-8.42 (m, 4H).

[0277] Step 7: [ka]

[0278] To a solution of [(1R,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl] 4-nitrobenzoate (1 eq.) in THF (0.35 M) was added an aqueous solution of lithium hydroxide monohydrate (2.0 M, 6.04 eq.). The mixture was stirred at 20° C. for 12 h. The organic phase was separated and the aqueous layer was extracted with THF / TBME (1 L, 1:1, v / v). The combined organic phase was concentrated under reduced pressure to give a residue. The residue was purified by silica gel chromatography (10%→50% ethyl acetate in petroleum ether) to give (1R,2S)-2-(3-phenylazetidin-1-yl)cyclohexanol.

[0279] Step 8: [ka]

[0280] To a solution of (1R,2S)-2-(3-phenylazetidin-1-yl)cyclohexanol (1 eq.), PPh3 (1.59 eq.), 3-(5-hydroxy-1-oxo-isoindolin-2-yl)-1-(2-trimethylsilylethoxymethyl)piperidine-2,6-dione (0.66 eq.) in anhydrous toluene (0.2 M) was added DIAD (1.49 eq.) dropwise at 0° C. The mixture was warmed to 20° C. and stirred for 12 h. The mixture was filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel chromatography (10%→50% ethyl acetate in petroleum ether) to give 3-(1-oxo-5-(((1S,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl)oxy)isoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione.

[0281] Step 9: [ka]

[0282] To a solution of 3-(1-oxo-5-(((1S,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl)oxy)isoindolin-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione (1 eq.) in DCM (0.2 M) was added MsOH (4 eq.). The mixture was stirred at 20° C. for 2 h. 1 ,N 2 -Dimethylethane-1,2-diamine (1.2 eq.) and TEA (8 eq.) were added. The mixture was stirred for 2 h. The reaction mixture was filtered and the filtrate was concentrated in vacuo to give a residue. The residue was purified by preparative HPLC to give 3-(1-oxo-5-(((1S,2S)-2-(3-phenylazetidin-1-yl)cyclohexyl)oxy)isoindolin-2-yl)piperidine-2,6-dione. 1 H NMR (400 MHz, d6-DMSO) δ 10.96 (s, 1H), 7.60 (d, J = 8.4 Hz, 1H), 7.38 - 7.25 (m, 4H), 7.23 - 7.14 (m, 2H), 7.04 (br d, J = 8.4 Hz, 1H), 5.06 (dd, J = 4.9, 13.3 Hz, 1H), 4.45 - 4.17 (m, 3H), 3.82 - 3.46 (m, 3H), 3.30 - 3.14 (m, 2H), 2.96 - 2.82 (m, 1H), 2.59 (br d, J = 17.0Hz, 1H), 2.48 - 2.27 (m, 2H), 2.09 - 1.92 (m, 2H), 1.92 - 1.80 (m, 1H), 1.66 (br s, 2H), 1.45 - 1.33 (m, 2H), 1.32 - 1.07 (m, 2H).

[0283] The additional compounds shown in Table 2 were prepared following the procedures set forth above, except that the amine in the above example was replaced with the amine shown in the final product.

[0284] [Table 10] TIFF2024529298000149.tif255170TIFF2024529298000150.tif255170TIFF2024529298000151.tif255170TIFF2024529298000152.tif255170TIFF202 4529298000153.tif255170TIFF2024529298000154.tif255170TIFF2024529 298000155.tif255170TIFF2024529298000156.tif255170TIFF20245292980 00157.tif255170TIFF2024529298000158.tif255170TIFF2024529298000159.tif255170TIFF2024529298000160.tif255170TIFF2024529298000161.t if255170TIFF2024529298000162.tif255170TIFF2024529298000163.tif255170TIFF2024529298000164.tif255170TIFF2024529298000165.tif243170

[0285] Biological Examples Cereblon (CRBN) target binding HEK293T cells were harvested with trypsin at approximately 75% confluence and plated in 2 mL of Dulbecco's Modified Eagle Medium (DMEM) + 10% fetal bovine serum (FBS) in 6-well tissue culture plates (500,000 cells per well) and incubated overnight at 37°C.

[0286] The NanoLuc-CRBN fusion vector (Nluc-CRBN, Promega) contains the coding region of the human E3 ligase component cereblon (CRBN) fused to the C-terminus of the NanoLuc luciferase coding region. A mixture of 10 ng of Nluc-CRBN and 990 ng of DDB1 expression vector (Promega) was added to 125 μL of Opti-Minimum Essential Medium (Opti-MEM™, Thermo Fisher) with 2 μL of P3000 reagent (Thermo Fisher) in a 1.5 mL Eppendorf tube. This solution was added to Lipofectamine 3000 transfection reagent (5 μL, Thermo Fisher) in Opti-MEM (125 μL), mixed well, and incubated at room temperature for 15 min. The transfection mixture was added dropwise to the cells and incubated overnight at 37° C., 5% CO2. After transfection, cells were washed once with PBS and trypsin (250 μL) was added and incubated for 30-45 s to dislodge the cells. Complete medium (2 mL) was added to resuspend the cells to form a single cell suspension. Cells were centrifuged at 320 × g for 5 min at room temperature, the supernatant was removed, and the cell pellet was resuspended in Opti-MEM (3 mL, washing step was repeated twice). After a final resuspension in 5 mL Opti-MEM, cells were counted and resuspended in Opti-MEM at 200000 cells per mL.

[0287] Cereblon target binding was monitored by bioluminescence resonance energy transfer (BRET) in transfected HEK-293T cells using the NanoBRET TE Intracellular E3 Ligase Assay (Promega). Briefly, 384-well plates (white opaque plates, Corning 3574, low binding surface) were seeded with transfected HEK-293T cells (38 μL per well). 2 μL of 10 μM CRBN tracer (diluted 1:5 in tracer dilution buffer) was added to each well. Plates were centrifuged at 320×g for 1 minute at room temperature. Test compounds were added in an 11-point dilution series (typically 10 μM to 100 pM) using a TECAN D300e digital dispenser. Plates were shaken for 2 minutes on a microplate shaker to mix the compounds. Plates were centrifuged at 320×g for 1 minute at room temperature and subsequently incubated at 37°C for 2 hours.

[0288] After incubation, plates were allowed to cool to room temperature for 15 minutes. 20 μL of 3X Complete Nano BRET™ Nano-Glo™ Substrate + Inhibitor Solution (Promega, 1:166 substrate and 1:500 dilution of extracellular NanoLuc™ inhibitor in Opti-MEM) was added to each well. Plates were incubated at room temperature for 3 minutes with shaking, covered in foil. Plates were read on a CLARIOstar microplate reader (BMG LabTech) measuring at 450 nm (donor emission) and 610 nm (acceptor emission). IC 50 Values ​​were determined by regression to a best-fit four-parameter logistic curve using GraphPad Prism.

[0289] IKZF2 degradation assay Generation of stable cell lines Polycistronic plasmids were constructed for mammalian expression of fluorescent reporter fusions of human transcription factors IKZF1 (Ikaros), IKZF2 (Helios), and IKZF3 (Aiolos). Each protein sequence had a C-terminus spliced ​​with three repeated GGGGS linkers followed by mNeonGreen, P2A sequences, and mScarlet. The DNA sequences of the open reading frames are as follows:

[0290] IKZF1-mNeonGreen-P2A-mScarlet coding sequence:

[0291] IKZF2-mNeonGreen-P2A-mScarlet coding sequence:

[0292] IKZF3-mNeonGreen-P2A-mScarlet coding sequence:

[0293] IKZF1, IKZF2, and IKZF3 constructs were cloned into the UCOE hygromycin expression vector (Millipore Sigma). Reporter constructs were transfected into adherent HEK293T cells using cationic lipid reagents, and stable integrants were selected by treatment with 200 μg / mL hygromycin B. Clonal populations were obtained from the stable integrant populations by either limiting dilution or fluorescence-activated cell sorting.

[0294] Stable clonal cell lines were maintained under constant 200 μg / mL hygromycin B selection during passaging for use in degradation assays. Flow analysis on a BD Accuri C6 showed that the HEK293T CMV-IKZF1 clone 7 cell line had a mean fluorescein isothiocyanate mean fluorescence intensity (FITC MFI) of 230,000 and a phycoerythrin mean fluorescence intensity (PE MFI) of 33,000. HEK293T EF1a-IKZF2 clone 9 had a mean FITC MFI of 150,000 and a PE MFI of 26,000. HEK293T EF1a-IKZF3 clone 9 had a mean FITC MFI of 400,000 and a PE MFI of 60,000. The fluorescence intensity of IKZF1 / 2 / 3-mNeonGreen (FITC channel) and mScarlet (PE channel) reporters was routinely analyzed by flow cytometry to confirm consistent expression levels between experiments.

[0295] IKZF1 / 2 / 3 reporter degradation assay IKZF1 / IKZF2 / IKZF3 degradation assays were performed by harvesting HEK293T reporter cell lines and resuspending the cells in media formulated to reduce background fluorescence (FluoroBrite, Thermo Fisher). Each cell line was seeded into black-walled 384-well optical grade assay tissue culture plates at a density of 4000 cells per well. Cells were incubated overnight at 37° C. to allow attachment to the assay plates. Compound dilutions were prepared from 10 mM compound stocks in DMSO. Assay plates were treated with appropriate concentrations of compounds by dispensing DMSO dilutions into quadruplicate wells up to a final DMSO of 0.5%.

[0296] After 24 hours of incubation with compounds, the assay plates were imaged in an ImageXpress Pico microscopy system (cells were kept at 37°C during imaging) to obtain fluorescence readings. The assay plates were imaged in the FITC and tetramethylrhodamine (TRITC) channels to obtain mNeonGreen fluorescence intensity (reporter degradation data) and mScarlet fluorescence intensity (for cell segmentation). The 293T-IKZF1 and 293T-IKZF3 reporter cell lines were imaged with a 500 millisecond (ms) exposure for both the FITC and TRITC channels, whereas the 293T-IKZF2 reporter cell line was imaged with a 1000ms exposure for FITC and a 1250ms exposure for TRITC. The resulting data was analyzed using a two-channel cell scoring analysis with a "percent positive" reading using Cell Reporter Xpress software. For "nuclei" segmentation the TRITC channel was chosen with a threshold of 20, whereas for "marker 1" segmentation the FITC channel was chosen with a threshold of 100 for the IKZF1 and IKZF3 reporter lines. The IKZF2 reporter line had a threshold of 120 set for the FITC channel and a threshold of 20 for TRITC. For all cell lines the minimum segmentation width was set at 6 micrometers and the maximum segmentation width at 15 micrometers. DC 50 was calculated by regression to a best-fit four-parameter logistic curve using GraphPad Prism.

[0297] Table 3 shows the results from the above assays.

[0298] [Table 11]

[0299] Table 4 further shows the results from the above assays.

[0300] [Table 12] TIFF2024529298000168.tif255170

[0301] GSPT1 degradation assay Generation of stable cell lines CRISPR-Cas12a technology was used to generate HEK293_hGSPT1_HiBiT tagged cells. Briefly, approximately 400000 HEK293 cells were transiently co-transfected with pre-complexed ribonucleoprotein (RNP) consisting of 80 pmol crRNA (IDT), 62 pmol Cas12a protein (IDT), 3 μg ssODN donor (IDT, AltR™ modified), 78 pmol electroporation enhancer (IDT), and 200 ng pMaxGFP (Lonza). Transfection was performed via nucleofection (Lonza, 4D-Nucleofector X-unit) using solution P3 and program CM-130 in a (20 μL) cuvette. Five days after nucleofection, cells were single-cell sorted for GFP+ (transfected) cells by FACs in 96-well plates and clonally selected. Clones were screened and verified for the desired modifications via targeted deep sequencing using gene-specific primers with partial Illumina adapter overhangs as described above. Briefly, clonal cell pellets were harvested, lysed, and used to generate gene-specific amplicons with partial Illumina adapters in a first round of PCR. Amplicons were indexed in a second round of PCR and pooled with other targeted amplicons for other loci to provide sequence diversity. Additionally, samples were run on a Miseq sequencer system (Illumina) to generate paired 2x250bp reads after adding 10% PhiX sequencing control V3 (Illumina) to the pooled amplicon library. Samples were demultiplexed using index sequences, fastq files were generated, and NGS analysis was performed using CRIS.py. Final clones were confirmed using the PowerPlex Fusion System (Promega) and tested negative for mycoplasma by MycoAlert™ Plus Mycoplasma Detection Kit (Lonza).

[0302] The editing construct sequence and screening primers are outlined below (5' to 3' sequences). hGSPT1Cas12acrRNA, CAGE635.GSPT1.g1: TTTCTCTGGAACCAGTTTCAGAACT; CAGE635.g1.anti.ssODN: ttcctcacagtattgtgcagggtcatcaagaaaatgcttaGCTAATCTTCTTGAACAGCCGC CAGCCGCTCACgtcCttctctggaaccagtttcagaacttttccaattgcaatggtcttacctagaaatgaaattttaa (HiBiT tag and silent blocking modifications that prevent re-cutting of Cas12a after integration are in uppercase); CAGE635.hGSPT1.DS.F: GGTTTGGCAGTAAAGCTAGTTAAT; CAGE635.hGSPT1.DS.R: GTGAA GTAGGCTTCTGCAGTC.

[0303] GSPT1 reporter degradation assay GSPT1 degradation assays were performed by harvesting HEK293T reporter cell lines and resuspending the cells in media formulated to reduce background fluorescence (FluoroBrite, Thermo Fisher). Each cell line was seeded at a density of 8000 cells per well into white opaque 384-well optical grade assay tissue culture plates (Greiner 781080-20). Cells were incubated overnight at 37°C to allow attachment to the assay plate. Compound dilutions were prepared from 10 mM compound stocks in DMSO. Test compounds were added in a 10-point dilution series (typically 10 μM to 100 pM) with a final DMSO cap of 0.5% using a TECAN D300e digital dispenser. Plates were centrifuged at 320×g for 2 minutes at room temperature and subsequently incubated at 37°C.

[0304] After 24 hours of incubation with compounds, plates were allowed to cool to room temperature for 10 minutes. 30 μL of HiBiT lysis buffer + 1:50 HiBiT substrate solution was added to each well. Plates were centrifuged at 320×g for 2 minutes at room temperature, then covered with foil and incubated at room temperature with shaking for 10 minutes. Plates were read on a CLARIOstar microplate reader (BMG LabTech) measuring at 450 nm (donor emission) and 610 nm or 630 nm (acceptor emission). DC 50 Values ​​were determined by regression to a best-fit four-parameter logistic curve using GraphPad Prism.

[0305] Table 5 shows the results from the above assays for certain compounds described herein, thus demonstrating selectivity.

[0306] [Table 13]

[0307] Certain compounds of formula I described herein are believed to selectively modulate IKZF proteins relative to GSPT1 when compared to compounds having oxygen-linked phenyls described in the art. Additionally, certain compounds of formula I described herein are believed to selectively modulate IKZF2 relative to GSPT1.

[0308] This data is further supported by immunoblot analysis described below.

[0309] Immunoblot analysis (KG-1 cells) Cells were seeded in 6-well plates (5 × 10 per well). 5After overnight incubation, cells were treated with the indicated concentrations for 24 hours. Harvested cells were spun down, washed with PBS, and lysed with RIPA lysis and extraction buffer (Thermo Scientific Cat. No. 89900) according to the manufacturer's instructions. Protein quantification was performed using the Pierce Rapid Gold BCA Protein Assay Kit (Cat. No. A53225) using a microplate procedure according to the manufacturer's instructions. Cell lysates were analyzed using the Simple Western System from WES / Jess according to the manufacturer's instructions. Primary antibodies used were anti-IKZF2 (Abcam, ab129434, 1:25), anti-GSPT1 (Abcam, ab49878).

[0310] Compounds of the present disclosure tested in the above assay induced significant degradation of IKZF2 in KG-1 cells after 24 hours of treatment, but had no detectable activity against GSPT1, a result consistent with the degradation data in IKZF2 GFP reporter cells and GSPT1 HiBiT-tagged cells.

Claims

1. Formula I: 【Chemical Formula 1】 (wherein, m, n, and p are independently 0, 1, 2, or 3, q is 1, 2, or 3, r is 0, 1, or 2, s is 0 when r is not 0 and 1 when r is 0, t is 0 or 1, X is hydrogen, deuterium, or fluoro) Y is oxygen or NR, where R is hydrogen or C １ ~C ４ alkyl, Z and Z １ are each independently CR １ or N, and Each R １ is independently hydrogen, amino, unsubstituted or substituted with 1 to 3 R ５ substituents of (C １ -C ４ alkyl)amino, unsubstituted or substituted on each alkyl group with 1 to 3 R ５ substituents of di(C １ -C ４ alkyl)amino, cyano, halo, hydroxyl, unsubstituted or substituted with 1 to 3 R ５ substituents of C １ -C ４ alkyl, and unsubstituted or substituted with 1 to 3 R ５ substituents of C １ -C ４ alkoxy, or Z １ is CR １ In the case where, two adjacent Rs １ together with the carbon atom to which they are attached, form a C ３ -C ７ cycloalkyl, C ６ -C １０ aryl, a 4- to 7-membered heterocycloalkenyl having 1 to 3 heteroatoms selected from oxygen, nitrogen, or sulfur, or a 5- to 6-membered heteroaryl having 1 to 3 heteroatoms selected from oxygen, nitrogen, and sulfur, where each of the cycloalkyl, heterocycloalkenyl, aryl, and heteroaryl is independently substituted with 1 to 3 R ６ groups, Each R ２ is independently cyano, halo, hydroxyl, amino, unsubstituted or substituted with 1 to 3 R ５ substituents of C １ to C ４ alkylamino, unsubstituted or substituted on each alkyl group with 1 to 3 R ５ substituents of di(C １ to C ４ alkyl)amino, unsubstituted or substituted with 1 to 3 R ５ substituents of C １ to C ４ alkyl, and unsubstituted or substituted with 1 to 3 R ５ substituents of C １ to C ４ alkoxy, and is selected from R ３ is unsubstituted or C ７ substituted with one to three R ６ -C １０ -aryl, and R ４ is selected from hydrogen and -CH ２ -OR ８ , where R ８ is C(O)-R ９ or -P(O)(OR １０ ) ２ , and R ９ is C １ to C ４ alkyl or C １ to C ４ alkoxy, and each R １０ is independently H or C １ to C ４ alkyl, Each R ５ is, independently, hydrogen, amino, (C １ ~C ４ alkyl)amino, di(C １ ~C ４ alkyl)amino, cyano, halo, hydroxyl, or C １ ~C ４ alkoxy, Each R ６ is independently selected from amino, (C １ -C ４ alkyl)amino, di(C １ -C ４ alkyl)amino, cyano, halo, hydroxyl, and oxo; Each R ７ is independently amino, C which is unsubstituted or substituted with 1 to 3 halos １ to C ４ alkyl, C which is unsubstituted or substituted with 1 to 3 halos １ to C ４ alkoxy, (C １ to C ４ alkyl)amino, di(C １ to C ４ alkyl)amino, cyano, halo, hydroxyl, nitro, oxo, O, NR, and / or S, and is selected from C having 1 to 3 heteroatoms ５ to C ６ heteroaryl, 4- to 7-membered heterocycloalkyl having 1 to 3 heteroatoms selected from oxygen, nitrogen, and / or sulfur, and -C(O)CH ３ is selected from, and R １１ is a compound that is hydroxyl, halo, or cyano), or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

2. Formula II: 【Chemical Formula 2】 The compound according to Claim 1 having the structure of, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

3. The compound according to Claim 1, wherein X is hydrogen or deuterium, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

4. The compound according to Claim 1, wherein X is fluoro, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

5. The compound according to Claim 1, wherein p is 2, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

6. The compound according to Claim 1, wherein n is 0, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

7. The compound according to Claim 1, wherein n is 1, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

8. R ４ is hydrogen, the compound according to claim 1, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof.

9. R ４ is -CH ２ -O-C(O)-R ９ or -CH ２ -O-P(O)(OR １０ ) ２ The compound according to claim 1, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof.

10. Z and Z １ each represent C-R １ The compound according to claim 1

11. Z and Z １ The compound according to claim 1, wherein each of Z and Z is N.

12. Z or Z １ One of them is C—R １ and the other of Z or Z １ is N. The compound according to claim 1

13. R １ The compound according to claim 1, wherein R is H.

14. The compound according to Claim 1, wherein m is 0.

15. The compound according to Claim 1, wherein q is 1 and r is 1.

16. Formula III: [Chemical Formula 3] The compound according to Claim 1 having the structure of, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

17. Formula IV: 【Chemical 4】 The compound according to Claim 16 having the structure of, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

18. Formula V: 【Chemical Formula 5】 The compound according to Claim 1 having the structure of, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

19. Formula VI: ​ The compound according to Claim 18 having the structure of, or a pharmaceutically acceptable salt, solvate, deuterated analog, stereoisomer, and / or tautomer thereof.

20. 【Fig. 7】 is 【Chemical 8】 [Chemical] The compound according to claim 1, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof, selected from

21. The compound according to claim 1, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof, wherein Y is O.

22. The compound according to claim 1, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof, wherein Y is NR.

23. A compound selected from Table 1, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof.

24. A compound selected from Table 1A, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof.

25. A compound selected from Table 1B, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof.

26. 【Fig. 9】 【Chem.】 A compound, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof, selected from

27. A pharmaceutical composition comprising the compound according to any one of claims 1 to 26, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof, and a pharmaceutically acceptable additive.

28. A method of modulating cereblon activity, comprising contacting cereblon with an effective amount of the compound according to any one of claims 1 to 26, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, or tautomer thereof, in vitro under conditions in which cereblon is modulated.

29. A method of degrading IKZF2, comprising contacting IKZF2 with an effective amount of the compound according to any one of claims 1 to 26, or a pharmaceutically acceptable salt, solvate, deuterated analogue, stereoisomer, and / or tautomer thereof, in vitro under conditions in which IKZF2 is degraded.

30. The pharmaceutical composition according to claim 27 for degrading IKZF2.

31. The pharmaceutical composition according to claim 27 for treating cancer, wherein the cancer is a cancer at least partially mediated by IKZF2.

Images