Treatment of Cardiovascular Disease

Abstract

The present disclosure relates to a nucleic acid comprising a double-stranded RNA molecule comprising a sense strand and an antisense strand, and further comprising a single-stranded DNA molecule covalently linked to at least the 5' end of either the sense RNA portion or the antisense RNA portion of the molecule, wherein the double-stranded inhibitory RNA targets a gene associated with cardiovascular disease in the treatment of hypercholesterolemia and diseases associated with hypercholesterolemia, such as cardiovascular disease.

Description

[Technical field]

[0001] Field of Disclosure The present disclosure relates to nucleic acids comprising double stranded RNA molecules comprising a sense strand and an antisense strand, and further comprising a single stranded DNA molecule covalently attached to at least the 5' end of either the sense RNA portion or the antisense RNA portion of the molecule, wherein the double stranded inhibitory RNA targets a cardiovascular disease gene; pharmaceutical compositions comprising the nucleic acid molecules; and methods for the treatment of diseases associated with increased levels of expression of cardiovascular disease genes, such as hypercholesterolemia. [Background technology]

[0002] Background of the disclosure Cardiovascular diseases associated with hypercholesterolemia, such as ischemic cardiovascular disease, are common conditions that lead to heart disease and high mortality and morbidity rates and can be the result of poor diet, obesity, or inherited dysfunctional genes. For example, high levels of lipoprotein(a) and other lipoproteins are associated with atherosclerosis. Cholesterol is essential for membrane biogenesis in animal cells. Lack of water solubility means that cholesterol is transported around the body in association with lipoproteins. Apolipoproteins are formed with phospholipids, cholesterol, and lipids that facilitate the transport of lipids such as cholesterol through the bloodstream to various parts of the body. Lipoproteins can be classified by size to form HDL (high density lipoprotein), LDL (low density lipoprotein), IDL (intermediate density lipoprotein), VLDL (very low density lipoprotein), and ULDL (ultra low density lipoprotein) lipoproteins.

[0003] Lipoproteins change composition throughout their circulation and contain various ratios of apolipoproteins A (ApoA), B (ApoB), C (ApoC), D (ApoD) or E (ApoE), triglycerides, cholesterol and phospholipids. For example, ApoB is the major apolipoprotein of ULDL and LDL and has two isoforms apoB-48 and apoB-100. Both ApoB isoforms are encoded by a single gene, with the shorter ApoB-48 gene being produced after RNA editing of the ApoB-100 transcript at residue 2180, which results in the generation of a stop codon. ApoB-100 is the main structural protein of LDL and serves as a ligand for a cellular receptor that allows, for example, the transport of cholesterol into cells.

[0004] Familial hypercholesterolemia is an incurable disease caused by elevated blood LDL cholesterol (LDL-C) levels. The disease is an autosomal dominant disorder, with both heterozygous (LDL-C between 350-550 mg / dL) and homozygous (LDL-C between 650-1000 mg / dL) states resulting in elevated LDL-C. Heterozygous forms of familial hypercholesterolemia occur in approximately 1:500 of the population. The homozygous state is much rarer, occurring at approximately 1:1 million. Normal levels of LDL-C are in the region of 130 mg / dL.

[0005] Hypercholesterolemia is particularly acute in pediatric patients, and if not diagnosed early, it can lead to accelerated coronary heart disease and early death. If diagnosed and treated early, children can have a normal life expectancy. In adults, high LDL-C, either due to mutations or other factors, is directly associated with an increased risk of atherosclerosis, which can lead to coronary artery disease, stroke, or kidney disease. It is known that lowering the level of LDL-C reduces the risk of atherosclerosis and related conditions. LDL-C levels can be initially lowered by administration of statins, which block the de novo synthesis of cholesterol by inhibiting HMG-CoA reductase. Some subjects can benefit from combination therapy, combining statins with other therapeutic agents such as ezetimibe, colestipol, or nicotinic acid. However, the expression and synthesis of HMG-CoA reductase adapt in response to statin inhibition and increase over time, so that the beneficial effect is only temporary or limited after statin resistance is established.

[0006] Therefore, it is desirable to identify alternative therapies that can be used alone or in combination with existing therapeutic approaches to control cardiovascular disease due to elevated LDL-C.

[0007] A technique for specifically eliminating gene function is by introducing into cells double-stranded inhibitory RNA, also called small inhibitory or interfering RNA (siRNA), which leads to the destruction of mRNAs that are complementary to the sequence contained in the siRNA molecule. siRNA molecules contain two complementary strands of RNA (sense and antisense strands) that anneal to each other to form a double-stranded RNA molecule. siRNA molecules are typically, but not necessarily, derived from exons of the gene to be eliminated. Many organisms respond to the presence of double-stranded RNA by activating a cascade that leads to the formation of siRNAs. The presence of double-stranded RNA activates a protein complex that includes RNase III, which processes the double-stranded RNA into smaller fragments (siRNAs, approximately 21-29 nucleotides long) that become part of a ribonucleoprotein complex. The siRNA acts as a guide for the RNase complex to cleave the mRNA that is complementary to the antisense strand of the siRNA, thereby resulting in the destruction of the mRNA.

[0008] Inhibition of lipoprotein (a) expression is known, as is the use of inhibitory RNA to stop lipoprotein (a) expression. For example, WO 2019 / 092283 discloses the identification of specific siRNA sequences that target the knockdown of mRNA encoding lipoprotein (a) and their use in treating cardiovascular diseases associated with elevated lipoprotein (a) expression, such as coronary heart disease, aortic valve stenosis or stroke. Similarly, U.S. Patent No. 9,932,586 discloses specific siRNA sequences that target lipoprotein (a) expression and their use in treating cardiovascular diseases associated with elevated lipoprotein (a) expression, such as Buerger's disease, coronary heart disease, renal artery stenosis, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis.

[0009] Overexpression of APOC III is associated with atherosclerosis and type 2 diabetes.For example, WO 2003 / 020765 discloses a vaccination approach for controlling atherosclerosis using immunogens derived from ApoCIII polypeptides and its use in controlling atherosclerotic plaques in coronary and cerebrovascular diseases.Similar vaccination approaches are disclosed in WO 2004 / 080375 and WO 2001 / 0640085.WO 2014 / 205449 and WO 2014 / 179626 disclose the use of antisense oligonucleotides to improve insulin sensitivity and treat type II diabetes by targeting APOCIII expression.

[0010] Furthermore, WO 2007 / 136989 and WO 2005 / 019418 each disclose the use of antisense compounds directed to DGAT to regulate the expression of DGAT2 and treat conditions that benefit from reduced DGAT2 expression in the context of conditions that benefit from reduced serum triglyceride levels, such as hypercholesterolemia, cardiovascular disease, type II diabetes, and metabolic syndrome. WO 2018 / 093966 discloses the use of RNA silencing 10 directed to DGAT2 and diglyceride acyltransferase 1 (DGAT1) to treat obesity and obesity-related diseases, such as hypercholesterolemia, cardiovascular disease, type II diabetes, and metabolic syndrome. Similarly, WO 2005 / 044981 discloses the use of siRNAs to target DGAT2, among many other gene targets, and their use in treating diseases that benefit from triglyceride regulation.

[0011] The present disclosure relates to nucleic acid molecules that include double-stranded inhibitory RNAs that are modified by the inclusion of a short DNA segment linked to at least the 5' end of either the sense or antisense inhibitory RNA, forming a hairpin structure. The double-stranded inhibitory RNAs use exclusively or primarily natural nucleotides and do not require modified nucleotides or sugars that prior art double-stranded RNA molecules typically utilize to improve pharmacodynamics and pharmacokinetics. The disclosed double-stranded inhibitory RNAs have the activity of silencing cardiovascular gene targets with potentially fewer side effects. [Prior art documents] [Patent documents]

[0012] [Patent Document 1] International Publication No. 2019 / 092283 [Patent Document 2] U.S. Patent No. 9,932,586 [Patent Document 3] International Publication No. 2003 / 020765 [Patent Document 4] International Publication No. 2004 / 080375 [Patent Document 5] International Publication No. 2001 / 064008 [Patent Document 6] International Publication No. 2014 / 205449 [Patent Document 7] International Publication No. 2014 / 179626 [Patent Document 8] International Publication No. 2007 / 136989 [Patent Document 9] International Publication No. 2005 / 019418 [Patent Document 10] International Publication No. 2018 / 093966 [Patent Document 11] International Publication No. 2005 / 044981 Summary of the Invention [Means for solving the problem]

[0013] Description of the Invention According to one aspect of the invention, there is provided a nucleic acid molecule comprising: a first portion comprising a double-stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand; a second portion comprising a single-stranded deoxyribonucleic acid (DNA) molecule, the 3' end of which is covalently linked to the 5' end of the sense strand of the double-stranded inhibitory RNA molecule, or the 3' end of which is covalently linked to the 5' end of the antisense strand of the double-stranded inhibitory RNA molecule, the double-stranded inhibitory RNA comprising a sense nucleotide sequence encoding a portion of a cardiovascular gene target associated with cardiovascular disease, the single-stranded DNA molecule comprising over at least a portion of its length a nucleotide sequence adapted to anneal to a portion of the single-stranded DNA by complementary base pairing to form a double-stranded DNA structure, and the double-stranded inhibitory RNA consisting of naturally occurring nucleotides; A nucleic acid molecule is provided comprising:

[0014] According to one aspect of the invention, there is provided a nucleic acid molecule comprising: a first portion comprising a double-stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand and an antisense strand; a second portion comprising a single-stranded deoxyribonucleic acid (DNA) molecule, the 3' end of the single-stranded DNA molecule being covalently linked to the 5' end of the sense strand of the double-stranded inhibitory RNA molecule, or the 3' end of the single-stranded DNA molecule being covalently linked to the 5' end of the antisense strand of the double-stranded inhibitory RNA molecule, the double-stranded inhibitory RNA comprising a sense nucleotide sequence encoding a portion of a cardiovascular gene target associated with cardiovascular disease or a polymorphic sequence variant thereof, the single-stranded DNA molecule comprising a nucleotide sequence over at least a portion of its length adapted to anneal to a portion of the single-stranded DNA by complementary base pairing to form a double-stranded DNA structure comprising a stem and loop domain, the nucleic acid molecule comprising N-acetylgalactosamine, and the double-stranded inhibitory RNA being composed of naturally occurring nucleotides; A nucleic acid molecule is provided comprising:

[0015] A "polymorphic sequence variant" is a genetic sequence in which one, two, three or more nucleotides are altered.

[0016] In a preferred embodiment of the invention, the 3' end of the single-stranded DNA molecule is covalently linked to the 5' end of the sense strand of the double-stranded inhibitory RNA molecule.

[0017] In a preferred embodiment of the invention, the 3' end of said single-stranded DNA molecule is covalently linked to the 5' end of the antisense strand of the double-stranded inhibitory RNA molecule.

[0018] In a preferred embodiment of the invention, a single-stranded DNA molecule is covalently linked to the 5' end of said sense strand and to the 5' end of said antisense strand.

[0019] In an alternative embodiment of the invention, the single stranded DNA molecule is covalently linked to the 5' end of the sense strand and to the 3' end of the sense strand.

[0020] In a preferred embodiment of the invention, the loop portion comprises a region comprising the nucleotide sequence GNA or GNNA, where each N independently represents guanine (G), thymidine (T), adenine (A) or cytosine (C).

[0021] In a preferred embodiment of the invention, the loop domain comprises G and C nucleotide bases.

[0022] In an alternative embodiment of the invention, the loop domain comprises the nucleotide sequence GCGAAGC.

[0023] In a preferred embodiment of the invention, said single stranded DNA molecule comprises the nucleotide sequence 5'TCACCTCATCCCGCGAAGC 3' (SEQ ID NOs 387 and 251). In a preferred embodiment of the invention, said single stranded DNA molecule comprises the nucleotide sequence 5' CGAAGCGCCCTACTCCACT 3' (SEQ ID NO 130).

[0024] In a preferred embodiment of the invention, said single stranded DNA molecule comprises the nucleotide sequence 5' GCGAAGCCCCTACTCCACT 3' (SEQ ID NO 400).

[0025] The inhibitory RNA molecule comprises or consists of natural nucleotide bases that do not require chemical modification. Furthermore, in some embodiments of the present invention, a crooked DNA molecule is linked to the 3' end of the sense strand of the double-stranded inhibitory RNA, and the antisense strand may be provided with at least a two-nucleotide base overhang sequence. The two-nucleotide overhang sequence may correspond to a nucleotide encoded by the target or may be non-coding. The two-nucleotide overhang may be two nucleotides of any sequence and order, for example, UU, AA, UA, AU, GG, CC, GC, CG, UG, GU, UC, CU, and TT.

[0026] In a preferred embodiment of the invention, the inhibitory RNA molecule comprises a di-nucleotide overhang that comprises or consists of deoxythymidine dinucleotide (dTdT).

[0027] In a preferred embodiment of the invention, the dTdT overhang is located at the 5' end of the antisense strand.

[0028] In an alternative preferred embodiment of the invention, said dTdT overhang is located at the 3' end of said antisense strand.

[0029] In a preferred embodiment of the invention, the dTdT overhang is located at the 5' end of the sense strand.

[0030] In an alternative preferred embodiment of the invention, said dTdT overhang is located at the 3' end of the sense strand.

[0031] In a preferred embodiment of the invention, the sense strand and / or the antisense strand comprises internucleotide phosphorothioate bonds.

[0032] In a preferred embodiment of the invention, the sense strand comprises phosphorothioate internucleotide linkages.

[0033] Preferably, the two nucleotides at the 5' and / or 3' terminus of the sense strand contain two internucleotide phosphorothioate linkages.

[0034] In a preferred embodiment of the present invention, the antisense strand comprises internucleotide phosphorothioate linkages.

[0035] Preferably, the two nucleotides at the 5' and / or 3' terminus of the antisense strand contain two internucleotide phosphorothioate linkages.

[0036] In an alternative preferred embodiment of the invention, said single stranded DNA molecule comprises one or more internucleotide phosphorothioate linkages.

[0037] In a preferred embodiment of the invention, the nucleic acid molecule comprises a vinylphosphonate modification.

[0038] In a preferred embodiment of the invention, the vinylphosphonate modification is a modification to the 5' terminal phosphate of the sense RNA strand.

[0039] In a preferred embodiment of the invention, the vinylphosphonate modification is a modification to the 5' terminal phosphate of the antisense RNA strand.

[0040] In a preferred embodiment of the invention, the double-stranded inhibitory RNA molecule is 10-40 nucleotides in length.

[0041] In a preferred embodiment of the invention, the double-stranded inhibitory RNA molecule is 17-29 nucleotides in length.

[0042] In a preferred embodiment of the present invention, the double-stranded inhibitory RNA molecule is 19 to 21 nucleotides in length, preferably 19 nucleotides in length.

[0043] In a preferred embodiment of the invention, the cardiovascular gene target is human lipoprotein(a).

[0044] In an alternative embodiment of the invention, the double-stranded inhibitory RNA molecule comprises an antisense nucleotide sequence selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 or 34.

[0045] In a preferred embodiment of the invention, the double-stranded inhibitory RNA molecule comprises an antisense nucleotide sequence comprising SEQ ID NO:41 and a sense nucleotide sequence comprising SEQ ID NO:49, and the single-stranded DNA molecule is covalently linked to the 5' end of the sense strand of the double-stranded inhibitory RNA molecule.

[0046] In a preferred embodiment of the invention, the double-stranded inhibitory RNA molecule comprises an antisense nucleotide sequence comprising SEQ ID NO:4 and a sense nucleotide sequence comprising SEQ ID NO:44, and the single-stranded DNA molecule is covalently linked to the 5' end of the antisense strand of the double-stranded inhibitory RNA molecule.

[0047] In a preferred embodiment of the invention, the double-stranded inhibitory RNA molecule comprises an antisense nucleotide sequence comprising SEQ ID NO:5 and a sense nucleotide sequence comprising SEQ ID NO:46, and the single-stranded DNA molecule is covalently linked to the 5' end of the antisense strand of the double-stranded inhibitory RNA molecule.

[0048] In an alternative preferred embodiment of the present invention, said cardiovascular gene target is human apolipoprotein C III (Apo C III).

[0049] Preferably, the nucleic acid molecule comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 and 79.

[0050] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249 and 250.

[0051] Preferably, the nucleic acid molecule comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:50, 51, 52, 53, 54, 55, 56, 57, 58, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89.

[0052] In an alternative preferred embodiment of the present invention, the cardiovascular gene target is human diglyceride acyltransferase 2 (DGAT2).

[0053] Preferably, the nucleic acid comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118 and 119.

[0054] Preferably, the nucleic acid comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169 and 170.

[0055] Preferably, the nucleic acid comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 120, 121, 122, 123, 124, 125, 126, 127, 128 and 129.

[0056] In a preferred embodiment of the invention, the cardiovascular gene target is human PCSK9.

[0057] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 189 and 190.

[0058] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209 and 210.

[0059] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 255, 256, 257, 258, 259, 260, 261, 262, 263 and 264.

[0060] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 265, 266, 267, 268, 269, 270, 271, 272, 273 and 274.

[0061] In a preferred embodiment of the invention, the nucleic acid molecule has the sequence NO:275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 292, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, and 330.

[0062] In a preferred embodiment of the invention, the nucleic acid molecule has the sequence NO:331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 285 and 386.

[0063] In a preferred embodiment of the invention, the cardiovascular gene target is human apolipoprotein B.

[0064] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 499, 500, 453, 502, 503, 457, 505, 506, 462, 508, 509, 467, 511, 512, 472, 514, 515, 477, 517 518, 482, 520, 521, 487, 523, 524 and 492.

[0065] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand comprising a nucleotide sequence selected from the group consisting of 450, 501, 455, 504, 460, 507, 465, 510, 470, 513, 475, 516, 480, 519, 485, 522, 490 and 525. In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand that comprises or consists of a nucleotide sequence or polymorphic sequence variant set out in Table 1. In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand that comprises or consists of a nucleotide sequence or polymorphic sequence variant set out in Table 2.

[0066] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand that comprises or consists of a nucleotide sequence or polymorphic sequence variant set out in Table 3.

[0067] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand that comprises or consists of a nucleotide sequence or polymorphic sequence variant set out in Table 4.

[0068] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand that comprises or consists of a nucleotide sequence or polymorphic sequence variant set out in Table 5.

[0069] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand that comprises or consists of a nucleotide sequence or polymorphic sequence variant set out in Table 8.

[0070] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand that comprises or consists of a nucleotide sequence or polymorphic sequence variant set out in Table 10.

[0071] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand that comprises a nucleotide sequence or polymorphic sequence variant set out in Table 14 or that consists of a nucleotide sequence or polymorphic sequence variant set out in Table 14.

[0072] In a preferred embodiment of the invention, the nucleic acid molecule comprises an RNA strand that comprises a nucleotide sequence or polymorphic sequence variant set out in Table 15 or that consists of a nucleotide sequence or polymorphic sequence variant set out in Table 15.

[0073] In a preferred embodiment of the invention, the nucleic acid molecule comprises 19 to 21 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO:388 or consists of 19 to 21 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO:388.

[0074] In a preferred embodiment of the invention, the nucleic acid molecule is covalently linked to N-acetylgalactosamine.

[0075] In a further embodiment of the invention, N-acetylgalactosamine is attached to either the antisense portion of the inhibitory RNA or the sense portion of the inhibitory RNA.

[0076] Preferably, N-acetylgalactosamine is attached to the 5' end of the sense RNA.

[0077] In an alternative embodiment of the invention, N-acetylgalactosamine is attached to the 3' end of said sense RNA.

[0078] In an alternative preferred embodiment of the invention, said N-acetylgalactosamine is attached to the 3' end of said antisense RNA.

[0079] In a preferred embodiment of the invention, the N-acetylgalactosamine is monovalent.

[0080] In a preferred embodiment of the invention, the N-acetylgalactosamine is divalent.

[0081] In an alternative embodiment of the invention, the N-acetylgalactosamine is trivalent.

[0082] In a preferred embodiment of the invention, the nucleic acid molecule is covalently linked to a molecule comprising the following structure: [ka]

[0083] In an alternative embodiment of the invention, the nucleic acid molecule is covalently linked to a molecule comprising the following structure: [ka]

[0084] In an alternative embodiment of the invention, the nucleic acid molecule is covalently linked to a molecule comprising the following structure: [ka]

[0085] In an alternative embodiment of the invention, the nucleic acid molecule is covalently linked to a molecule comprising the following structure: [ka]

[0086] In an alternative preferred embodiment of the invention, said nucleic acid molecule is covalently linked to a molecule containing N-acetylgalactosamine 4-sulfate.

[0087] According to a further aspect of the present invention there is provided a pharmaceutical composition comprising at least one nucleic acid molecule according to the present invention.

[0088] In a preferred embodiment of the invention, the composition further comprises a pharmaceutical carrier and / or excipient.

[0089] When administered, the compositions of the present invention are administered in pharma- ceutically acceptable preparations, which may typically contain pharma- ceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, and may optionally contain other therapeutic agents, such as cholesterol-lowering agents, which may be administered separately from the nucleic acid molecules of the present invention or in combined preparations, if the combination is compatible.

[0090] Combinations of the nucleic acids according to the invention with other different therapeutic agents may be administered simultaneously, sequentially or as chronologically separate doses.

[0091] The therapeutic agents of the invention may be administered by any conventional route, including injection or gradual infusion over time. Administration may be, for example, oral, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, transdermal, or transepithelial.

[0092] The composition of the present invention is administered in an effective amount. An "effective amount" is the amount of the composition that produces the desired response, either alone or together with further doses. When treating a disease such as cardiovascular disease, the desired response is to inhibit or reverse the progression of the disease. This may include only slowing the progression of the disease temporarily, but more preferably, it includes permanently stopping the progression of the disease. This can be monitored by routine methods.

[0093] Such amounts will of course depend on the specific condition being treated, the severity of the condition, individual patient parameters including age, physical condition, size and weight, duration of treatment, nature of concomitant therapy (if any), specific route of administration, and similar factors that belong to the knowledge and expertise of the medical practitioner. These factors are well known to those skilled in the art and can be addressed with only routine experimentation. It is generally preferred that the maximum dose of each component or combination thereof is used, i.e., the highest safe dose according to sound medical judgment. However, it will be understood by those skilled in the art that for medical reasons, psychological reasons, or virtually any other reason, a patient may require a lower dose or a dose that can be tolerated.

[0094] The pharmaceutical compositions used in the aforementioned methods are preferably sterile and contain an effective amount of a nucleic acid molecule according to the invention in a unit of weight or volume suitable for administration to a patient, to produce a desired response, which can be measured, for example, by determining regression of cardiovascular disease and reduction in disease symptoms.

[0095] The dose of the nucleic acid molecule according to the present invention administered to a subject can be selected according to various parameters, in particular according to the mode of administration used and the condition of the subject. Other factors include the desired duration of treatment. If the response in the subject is insufficient at the initial dose applied, a higher dose (or an effectively higher dose by a different, more localized delivery route) can be used to the extent that patient tolerance allows. It will be clear that the method of detecting nucleic acid according to the present invention facilitates the determination of the appropriate dosage for a subject in need of treatment.

[0096] Generally, a dose of the nucleic acid molecule disclosed herein between 1 nM and 1 μM is formulated and administered according to standard procedures. Preferably, the dose may be in the range of 1 nM to 500 nM, 5 nM to 200 nM, 10 nM to 100 nM. Other protocols for administration of the composition are known to those skilled in the art, and may differ from the above in terms of dosage amount, injection schedule, injection site, mode of administration, etc. Administration of the composition to mammals other than humans (e.g., for testing purposes or veterinary therapeutic purposes) is carried out under substantially the same conditions as described above. Subject, as used herein, is a mammal, preferably a human, including non-human primates or transgenic mammals adapted for expression of human lipoprotein(a).

[0097] When administered, the pharmaceutical preparations of the present invention are applied in pharma- ceutically acceptable amounts and in pharma-ceutically acceptable compositions. The term "pharma-ceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient. Such preparations may usually contain salts, buffers, preservatives, compatible carriers, and may optionally contain other therapeutic agents, such as statins. When used in medicine, the salts should be pharma-ceutically acceptable, but pharma-ceutically unacceptable salts may be conveniently used to prepare pharma-ceutically acceptable salts thereof and are not excluded from the scope of the present invention. Such pharmacologically and pharma-ceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, and the like. Pharmaceutically acceptable salts may also be prepared as alkali metal or alkaline earth salts, such as sodium, potassium, or calcium salts.

[0098] The composition may be combined with a pharma- ceutically acceptable carrier if desired. The term "pharma-ceutically acceptable carrier" as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances suitable for administration to humans. The term "pharma-ceutically acceptable carrier" in this context refers to a natural or synthetic organic or inorganic component that is combined with the active ingredient, for example, to promote solubility and / or stability. The components of the pharmaceutical composition may also be mixed with the molecules of the present invention and with each other such that there is no interaction that would substantially impair the desired pharmaceutical effectiveness.

[0099] The pharmaceutical compositions may contain suitable buffering agents, including acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt. The pharmaceutical compositions may also contain suitable preservatives.

[0100] Pharmaceutical compositions can be conveniently provided in unit dosage form and can be prepared by any method well known in the field of pharmacy.All methods include the step of mixing an active agent with a carrier that constitutes one or more accessory ingredients.Generally, the compositions are prepared by uniformly and intimately mixing an active compound with a liquid carrier or a finely divided solid carrier or both, and then, if necessary, shaping the product.Compositions suitable for oral administration can be provided as discrete units such as capsules, tablets, lozenges, each of which contains a predetermined amount of active compound.

[0101] Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of the nucleic acid, which is preferably isotonic with the blood of the recipient. This preparation can be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations can also be sterile injectable solutions or suspensions in non-toxic parenterally acceptable diluents or solvents, for example, solutions in 1,3-butanediol. Acceptable solvents that can be used include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally used as solvents or suspending media. For this purpose, any non-irritating fixed oil can be used, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables. Carrier formulations suitable for oral, subcutaneous, intravenous, intramuscular, and other administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

[0102] In a further preferred embodiment of the invention said pharmaceutical composition comprises at least one further distinct therapeutic agent.

[0103] In a preferred embodiment of the invention, said further therapeutic agent is a statin.

[0104] Statins are commonly used to control cholesterol levels in subjects with elevated LDL-C. Statins are effective in preventing and treating predisposed and cardiovascular disease. Typical dosages of statins are in the range of 5-80 mg, depending on the statin and the desired level of LDL-C reduction required for subjects suffering from high LDL-C. However, the expression and synthesis of HMG-CoA reductase, the target of statins, adapts in response to statin administration, so the beneficial effects of statin treatment are only temporary or limited after statin resistance is established.

[0105] Preferably, the statin is selected from the group consisting of atorvastatin, fluvastatin, lovastatin, pitovastatin, pravastatin, rosuvastatin and simvastatin.

[0106] In a preferred embodiment of the invention, the further therapeutic agent is ezetimibe. Ezetimibe may be combined with at least one statin, such as simvastatin.

[0107] In an alternative preferred embodiment of the invention, said further therapeutic agent is selected from the group consisting of a fibrate, nicotinic acid, cholestyramine.

[0108] In a further alternative preferred embodiment of the invention, said further therapeutic agent is a therapeutic antibody, e.g., evolocumab, bococizumab or alirocumab.

[0109] According to a further aspect of the invention there is provided a nucleic acid molecule or a pharmaceutical composition of the invention for use in the treatment or prophylaxis of a subject having or susceptible to hypercholesterolemia or a hypercholesterolemia associated disease.

[0110] In a preferred embodiment of the invention, the subject is a pediatric subject.

[0111] Pediatric subjects include newborns (0-28 days old), infants (1-24 months old), toddlers (2-6 years old), and prepubertal children [7-14 years old].

[0112] In an alternative preferred embodiment of the present invention, said subject is an adult / mature subject.

[0113] In a preferred embodiment of the invention, the hypercholesterolemia is familial hypercholesterolemia.

[0114] In a preferred embodiment of the invention, familial hypercholesterolemia is associated with elevated levels of lipoprotein(a) expression.

[0115] In a preferred embodiment of the invention, said subject is resistant to statin treatment.

[0116] In a preferred embodiment of the present invention, said disease associated with hypercholesterolemia is selected from the group consisting of stroke prevention, hyperlipidemia, cardiovascular disease, atherosclerosis, coronary heart disease, aortic valve stenosis, cerebrovascular disease, peripheral arterial disease, hypertension, metabolic syndrome, type II diabetes mellitus, non-alcoholic fatty acid liver disease, non-alcoholic steatohepatitis, Buerger's disease, renal artery stenosis, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis.

[0117] According to a further aspect of the present invention there is provided a method for treating a subject having or susceptible to hypercholesterolemia comprising the step of administering an effective amount of a nucleic acid or pharmaceutical composition according to the present invention, thereby treating or preventing hypercholesterolemia.

[0118] In a preferred method of the invention, said subject is a pediatric subject.

[0119] In another preferred method of the invention, said subject is an adult / mature subject.

[0120] In a preferred method of the invention, the hypercholesterolemia is familial hypercholesterolemia.

[0121] In a preferred method of the invention, familial hypercholesterolemia is associated with elevated levels of lipoprotein(a) expression.

[0122] In a preferred method of the invention, said subject is resistant to statin treatment.

[0123] In a preferred method of the present invention, said disease associated with hypercholesterolemia is selected from the group consisting of stroke prevention, hyperlipidemia, cardiovascular disease, atherosclerosis, coronary heart disease, aortic valve stenosis, cerebrovascular disease, peripheral arterial disease, hypertension, metabolic syndrome, type II diabetes mellitus, non-alcoholic fatty acid liver disease, non-alcoholic steatohepatitis, Buerger's disease, renal artery stenosis, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis.

[0124] Throughout the description and claims of this specification, the terms "comprise" and "contain" and variations of these terms, such as "comprising" and "comprises," mean "including but not limited to" and are not intended to (and do not) exclude other moieties, additives, ingredients, integers or steps.

[0125] Throughout the description and claims of this specification, the singular encompasses the plural unless the context requires otherwise. In particular, where the indefinite article is used, it is to be understood that the specification contemplates the plural as well as the singular, unless the context requires otherwise.

[0126] It is to be understood that any feature, integer, property, compound, chemical moiety or group described in connection with any aspect, embodiment or example of the invention is applicable to any other aspect, embodiment or example described herein, except where not consistent therewith.

[0127] One aspect of the invention will now be described, by way of example only, with reference to the following figures. [Brief description of the drawings]

[0128] [Figure 1]Serum stability assay showing target PCSK9 mRNA levels in HepG2 cells after transfection of siRNA compounds. After 30 min or 2 h incubation at 37° C. in water, 10% FBS or 10% human serum, HepG2 cells were transfected with the following siRNAs: modified inclisiran [white bars], unmodified "inclisiran" without bend [gray bars], unmodified inclisiran with 3'SS bend [checkered bars], unmodified inclisiran with 5'SS "inverted hairpin" bend [spotted bars], or unmodified inclisiran with 5'SS bend [checkered bars]. PCSK9 mRNA levels were quantified by RT-qPCR analysis. Controls included "no siRNA" treatment [black bars]; [Diagram 2] Serum stability assay showing target PCSK9 mRNA levels in HepG2 cells after transfection of siRNA compounds. After 2 hours of incubation at 37°C in water, 10%, 20% or 50% FBS, HepG2 cells were transfected with the following siRNAs: modified inclisiran [white bars], unmodified "inclisiran" without bend [gray bars], unmodified inclisiran with 5'SS "inverted hairpin" bend [spotted bars], or unmodified inclisiran with 5'SS bend [striped bars]. PCSK9 mRNA levels were quantified by RT-qPCR analysis. Controls included "no siRNA" pretreatment [black bars]; [Diagram 3] Serum stability assay showing target PCSK9 mRNA levels in HepG2 cells after transfection of siRNA compounds. After 4 hours of incubation at 37°C in water, 10% FBS or 10% human serum, HepG2 cells were transfected with the following siRNAs: modified inclisiran [white bars], unmodified "inclisiran" without bend [gray bars], unmodified inclisiran with 5'SS "inverted hairpin" bend [spotted bars], or unmodified inclisiran with 5'SS bend [striped bars]. PCSK9 mRNA levels were quantified by RT-qPCR analysis. Controls included "no siRNA" pretreatment [black bars]; [Figure 4]Serum stability assay showing target PCSK9 mRNA levels in HepG2 cells after transfection of siRNA (named PC8-PC18) compounds. After 2 hours of incubation at 37° C. in water, 10% FBS, or 10% human serum, HepG2 cells were transfected with the following unmodified PC8-18 siRNAs: siRNA35 with no bend [white bars], siRNA36 with no bend but containing dTdT overhangs on the 3′SS and 3′AS [gray bars], siRNA37 with a bend on the 3′SS [spotted bars], siRNA38 with a bend on the 3′AS [vertical striped bars], siRNA39 with a bend on the 3′SS and a dTdT overhang on the 3′AS [checkered bars], siRNA41 with a 5′SS “inverted hairpin” bend [horizontal striped bars], or siRNA42 with a bend on the 5′SS and a dTdT overhang on the 3′AS [spotted bars on black background]. PCSK9 mRNA levels were quantified by RT-qPCR analysis. Controls included "no siRNA" pretreatment [black bars]; [Diagram 5]Figure 5A In vivo silencing of hepatic PCSK9 mRNA after administration of unmodified siRNA compounds (designated PC2-PC12). Groups of five mice for each treatment group were subcutaneously (SC) injected with either vehicle [black bars], compound A (uncurved; white bars), compound G (curved at the 5' end of the sense strand (SS); spotted bars) or compound H (curved at the 3' end of the SS; grey bars). Each compound was given at either 2 mg / kg or 10 mg / kg, and after sacrifice, hepatic PCSK9 mRNA levels by RT-qPCR were measured at two time points (days 2 and 7). Figure 5B Serum stability assay showing target PCSK9 mRNA levels in HepG2 cells after transfection of siRNA compounds A, G and H used in the in vivo study (Figure 5A) in mice. HepG2 cells were transfected with siRNA compounds A, G or H after 30 min or 2 h incubation at 37° C. in water, 10% FBS or 10% human serum: compound A (uncurved; white bars), compound G (curved at the 5′ end of the sense strand (SS); spotted bars) or compound H (curved at the 3′ end of the SS; grey bars). PCSK9 mRNA levels were quantified by RT-qPCR analysis. Controls include “no siRNA” [black bars] and “no serum” pretreatment. FIG. 5C Serum stability assay showing target PCSK9 mRNA levels in HepG2 cells after transfection of siRNA compounds A, G and H used in mice in the in vivo study (FIG. 5A). After 2 hours of incubation at 37°C in water, 20% or 50% human serum, HepG2 cells were transfected with siRNA Compound A, G or H: Compound A (uncurved; white bars), Compound G (curved at the 5' end of the sense strand (SS); spotted bars) or Compound H (curved at the 3' end of the SS; grey bars). PCSK9 mRNA levels were quantified by RT-qPCR analysis. Controls included "no siRNA" [black bars] and "no serum" pretreatment. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0129] Materials and Methods HepG2 reverse transfection Duplex siRNA (Table 1) synthesized by Bio-Synthesis (Lewisville, TX) was resuspended in nuclease-free water (Invitrogen™ AM9932) to generate a 10 μM stock solution. For serum stability assays, stock siRNA was incubated in vehicle (nuclease-free water), 10% fetal bovine serum (FBS) or various concentrations (10%-80%) of human serum (HS) for 2 hours at 37°C. After preincubation in serum or vehicle, siRNA was transfected into HepG2 cells in 384-well plates (Thermo Scientific™ 164688) at a concentration of 25 nM using 0.15 μL Lipofectamine RNAiMAX (Invitrogen™ 13778075) / well. Transfected cells were incubated at 37°C and 5% CO2. Cells not receiving siRNA treatment were used as controls. Free uptake and transfection in primary mouse hepatocytes

[0130] Mouse hepatocytes (MSCP10, Lonza) were thawed and seeded in 384-well plates (Thermo Scientific™ 164688) in Williams E medium (Gibco™ A1217601) supplemented with Primary Hepatocyte Thawing and Plating Supplements (Gibco™ CM3000). For free uptake, cells were treated with 25 nM siRNA or 100 nM GalNAc-siRNA using 0.15 μL per well of Lipofectamine. Double-stranded RT-qPCR

[0131] Cells-to-CT 1-step TaqMan Kit (Invitrogen™ A25603) was used to process cells for RT-qPCR reading. Briefly, cells were washed with 50 μL ice-cold PBS and lysed in 20 μL lysis solution containing DNase I. Lysis was stopped after 5 min by adding 2 μL STOP solution for 2 min. For RT-qPCR analysis, 1 μL of lysate per well was dispensed into a 96-well PCR plate in a 20 μL RT-qPCR reaction volume. RT-qPCR was performed using TaqMan® 1-Step qRT-PCR Mix from the Cells-to-CT 1-step TaqMan Kit with TaqMan probes for GAPDH (VIC_PL, Assay Id Hs00266705_g1) and PCSK9 (FAM, Assay Id Hs00545399-m1) or ApoB (FAM, Assay Id Mm01545150_m1). RT-qPCR was performed using a QuantStudio 5 thermocycling instrument (Applied BioSystems). GAPDH was used as an internal control and expression changes were normalized to the reference sample (no siRNA treatment), and relative quantification was determined using the ΔΔCT method. In vivo mouse study animals

[0132] Male C57BL / 6J mice (20–25 g) were group-housed in the Saretius Animal Unit at the University of Reading and maintained under a 12-h light / dark cycle at 23°C with humidity control in accordance with Home Office regulations. Mice were fed a standard rodent chow SDS rat extended diet (RM3-E-FG) for the duration of the study. Formulation of siRNA Compounds

[0133] Compound A, Compound G and Compound H were formulated in RNAse-free PBS at concentrations of 0.4 and 2 mg / mL, respectively, to provide doses of 2 and 10 mg / kg when given subcutaneously (SC) at a dose volume of 5 mL / kg. A control group (n=5) received vehicle (RNase-free PBS) subcutaneously at a dose volume of 5 mL / kg. Liver processing for RT-qPCR

[0134] Samples were finally collected from each treatment group by cardiac puncture under isoflurane on days 2 (48 hours) and 7 (168 hours) after siRNA compound or vehicle injection (n=5). Liver tissue was excised and snap-frozen in liquid N2. Total RNA was extracted from snap-frozen whole liver homogenates using the GenElute™ Total RNA Purification Kit (RNB100-100RXN).

[0135] Duplex RT-qPCR was performed using ThermoFisher TaqMan Fast 1-Step Master Mix with TaqMan probes for GAPDH (VIC_PL), PCSK9 (FAM) and mTTR (FAM). GAPDH was used as an internal control and the relative quantification (RQ) of PCSK9 was determined using the ΔΔCT method where the expression changes of the target genes were normalized to the vehicle control. [Example 1] Testing the 5' vs. 3' arrangement of bends on the sense strand (SS) of unmodified "Inclisiran" sequences in serum stability assays

[0136] After 2 hours of incubation in 10% FBS or 10% human serum, unmodified "Inclisiran" with a bend located at either the 5' or 3' end of the SS shows increased target mRNA (PCSK9) knockdown (KD) compared to "no bend" siRNA. However, after pretreatment in human serum, a better KD is observed when the bend is at the 5' end compared to the 3' end of the SS.

[0137] This is demonstrated in Figure 1, where a 5'SS curved siRNA containing the hairpin sequence GCGAAGC [striped bar] maintains a high level of target KD (85%) in HepG2 cells after 2 h treatment with 10% human serum, comparable to the target KD observed with modified inclisiran (80%) [white bar]. Similar results can be shown when an "inverted" curved hairpin (CGAAGCG) is placed at the 5' end of the SS [spotted bar]. In contrast, a curve placed at the 3'SS [checkered bar] shows -18.75% (reduced target KD); 65% KD (compared to 80% KD without serum incubation) in HepG2 cells after pretreatment in human serum. As expected, unmodified "Inclisiran" with no bend attached [gray bar] shows reduced levels of the target KD after pretreatment in either FBS or human serum; at 50% and 60% KD, respectively, this equates to a -26.8% and -39% reduction in the KD. [Example 2] Testing the 5' placement of the bend on the sense strand (SS) of the unmodified "Inclisiran" sequence in a serum stability assay with increasing concentrations of FBS

[0138] After 2 h of incubation at 37 °C in increasing concentrations of FBS, the unmodified "inclisiran" sequence with a bend placed at the 5' end of the SS [striped bars] exhibits sustained target mRNA (PCSK9) knockdown (70-80% KD) at all concentrations of FBS tested (10%, 20% and 50%), comparable to the levels observed with the modified inclisiran (70-80% KD) [white bars]. Similarly, an "inverted" bend hairpin (CGAAGCG) on the 5' end of the SS provides a 65-75% KD with no reduction in KD [spotted bars]. In contrast, the "no bend" compound [gray bars] shows a maximum -85% reduction in KD, with only 20-50% of the target KD evident after serum treatment. [Example 3] Testing the 5' placement of the bend on the sense strand (SS) of the unmodified "Inclisiran" sequence in a serum stability assay over a 4-hour incubation period

[0139] After 4 hours of incubation in either 10% FBS or 10% human serum, the unmodified "Inclisiran" with the bend located at the 5' end of the SS shows sustained levels of target mRNA (PCSK9) knockdown (KD) of approximately 75% and 65% KD, respectively [striped bars]. Similarly, there is no apparent reduction in KD for the "inverted" bent hairpin (CGAAGCG) at the 5' end of the SS [spotted bars], equivalent to the modified "Inclisiran", where a KD of approximately 70% is observed [white bars]. In contrast, the absence of the bend [gray bars] results in a significantly lower level of KD, equivalent to a reduction in KD of -36% and -50%, respectively, after 4 hours of pretreatment in 10% FBS (45% KD) or 10% human serum (35% KD). [Example 4] Testing the 5' vs. 3' configuration of the bend on an unmodified siRNA sequence targeting PCSK9 (sequence named PC8-18) in a serum stability assay

[0140] After 2 hours of incubation in 10% FBS or 10% human serum, PC8-18 with a curvature located at the 5' end of the sense strand (SS) shows superior levels of knockdown (KD) of the target mRNA (PCSK9) compared to curvatures located 3' of either the SS or AS. This is shown in Figure 4, where there is sustained on-target KD (~85%) for PC8-18 siRNA with a 5'SS curvature: [horizontal striped bars and black spotted bars], compared to the 60-70% KD (equivalent to a 30% KD reduction compared to no serum treatment) seen with curvatures located at the 3'SS: [spotted and checkered bars on white background]. Similarly, when the curvature is placed on the 3'AS, the reduction in KD is 6-16%, resulting in a 65-75% on-target KD [vertical striped bars]. In the absence of curvature on PC8-18 siRNA, the target KD is reduced to only 35% after 2 hours of incubation in FBS, corresponding to a significant reduction in KD (-63% compared to no serum treatment) and to only 25% KD (-77%) in human serum. Similarly, non-curved molecules containing 3'dTdT overhangs show reduced KD levels of -44% and -72% (compared to no serum treatment) after pretreatment in FBS and human serum, respectively. [Example 5] Testing the in vivo silencing effect of 5' versus 3' configurations of bends on unmodified siRNA compounds (PC2 sequences) targeting PCSK9

[0141] Groups of five mice for each treatment group were injected subcutaneously (SC) with either vehicle (PBS), Compound A (no curve), Compound G (curve on the 5' end of the sense strand (SS)) or Compound H (curve on the 3' end of the SS). Each compound was given at either 2 mg / kg or 10 mg / kg, and liver PCSK9 mRNA levels were measured at two time points (days 2 and 7) after sacrifice.

[0142] Compound G (5'SS bend) results in 40% KD of PCSK9 mRNA in liver at 2 and 10 mg / kg after 48 hours and 30% KD at 10 mg / kg after 7 days compared to vehicle control (Figure 5A). For compound H (3'SS bend), a comparable liver target KD was seen at 48 hours, approximately 50% KD at 2 mg / kg (30% KD at 10 mg / kg), and no significant KD was observed at 7 days (Figure 5A). Compound A, which does not contain a bend, shows a significantly lower target KD and there is no silencing after SC injection of a 2 mg / kg dose on either 2 or 7 days. At a dose of 10 mg / kg, compound A shows less than 20% KD after 48 hours and 40% after 7 days (Figure 5A). [Example 6] Testing Compounds A, G and H in a Serum Stability Assay (HepG2 Cells)

[0143] Similar results are shown for both the 5' and 3' bends on the SS. Compound G (5'SS bend) and Compound H (3'SS bend) maintain a PCSK9 mRNA KD of over 50% (compared to no serum treatment) after 2 hours of incubation in either 10% FBS or human serum. In contrast, there is a reduction in the target KD seen for Compound A (no bend) from 50% to only 20% KD after 2 hours of serum treatment; Figure 5B.

[0144] Further validation of these siRNA compounds at increasing serum concentrations (20% and 50%) over a 2-hour period showed that compound G (5'SS bend) performed better in human serum than the bend located at the 3'SS (H). This is shown in Figure 5C, where sustained levels of target mRNA KD (approximately 50%) are only evident in compound G [spotted bar] after 2 hours of incubation in 50% human serum. This corresponds to the absence of a reduction in KD for G compared to its "no serum" treatment KD level. In contrast, compound H [gray bar] shows a complete loss of KD (0%) and performs identically to the "no bend" compound A [white bar] after 2 hours in 50% human serum. [Table 1] [Table 2] TIFF2024531728000007.tif230153TIFF2024531728000008.tif77152 [Table 3] TIFF2024531728000010.tif230153TIFF2024531728000011.tif230153TIFF2024531728000012.tif147152 [Table 4] TIFF2024531728000014.tif221153 [Table 5] TIFF2024531728000016.tif192152TIFF2024531728000017.tif56141[Example 7] (Inclisiran, PCSK9 sequence)

[0145] When the bend was attached to the 5' end of the sense strand (siRNA15-5'C), the siRNA sequence maintained full KD activity against the target PCSK9, comparable to the chemically modified version (siRNA14m) after 2 hours of incubation in 10% FBS or human serum. The bend at the 3' end of the sense strand (siRNA 15b) showed partial protection in HS. The siRNA with a short bend (only the hairpin part) at the 3' end (siRNA15s7) and a short bend (only the hairpin part) at the 5' end (Inc_03) as well as the siRNA with a 12 nucleotide stem part only at the 5' end (INC_02) all showed a significant reduction in KD when transfected into HepG2 at 25 nM, compared to the full 19 nucleotide bend (Tables 6 and 7). [Table 6] [Table 7] [Table 8] [Example 8] (PC8-18 PCSK9 sequence)

[0146] When the bend was attached to the 5' end of the sense strand (PC8_05), the siRNA sequence maintained full KD activity against the target PCSK9 after 2 hours of incubation in 80% HS, which was comparable to the KD level observed without serum preincubation. A bend at the 3' end of the sense strand (PC8_01) provided significantly reduced protection in HS, showing a 72% reduction in KD compared to no serum preincubation. siRNAs with short bends (only the hairpin portion) at the 3' end (PC8_03) and siRNAs with short bends (only the hairpin portion) at the 5' end (PC8_11) as well as siRNAs with 12 nucleotide stem portions only at the 5' end (PC8_10) all showed a significant reduction in KD when transfected into HepG2 at 25 nM, compared to the full 19 nucleotide bends (Table 9). [Table 9] [Table 10] TIFF2024531728000023.tif126152 [Example 9] (Compound G-PCSK9 sequence)

[0147] When the bend was attached to the 5' end of the sense strand (siRNA_G), the siRNA sequence maintained full KD activity against PCSK9 after 8 hours of incubation in 80% HS, comparable to the level of KD observed without serum preincubation (Table 11). In contrast, siRNA_A (no bend) or siRNA_H (bend at the 3' end of the sense strand) showed no protection in 80% HS when transfected into HepG2 at 25 nM, showing a reduction in %KD of 70.8% and 100%, respectively. In a free uptake assay, siRNA_G showed better KD levels compared to siRNA_H in primary mouse hepatocytes cultured in 10% FBS and treated with 100 nM siRNA for 24, 48, and 72 hours (Table 12). [Table 11] [Table 12] [Example 10] (ApoB sequence)

[0148] A total of 11 siRNAs carrying sequences against mouse ApoB were exposed to 20% and 50% human serum and then transfected at 25 nM into primary mouse hepatocytes, and siRNA variants carrying a 5' bend on the sense strand generally showed a superior ability to induce KD of ApoB after exposure to serum compared to siRNA variants carrying a bend at the 3' end (Table 13). [Table 13] [Table 14] TIFF2024531728000028.tif233153TIFF2024531728000029.tif232153TIFF2024531728000030.tif174153 [Table 15] TIFF2024531728000032.tif230153TIFF2024531728000033.tif230154TIFF2024531728000034.tif230153TIFF2024531728000035.tif230153TIFF2024531728000036.tif232153TIFF2024531728000037.tif234153TIFF2024531728000038.tif231153TIFF2024531728000039.tif116152References

[0149] Nair, J.K., Willoughby, J.L., Chan, A., Charisse, K., Alam, M.R., Wang, Q., Hoekstra, M., Kandasamy, P., Kel’in, A.V., Milstein, S. and Taneja, N., 2014. Multivalent N-acetylgalactosamine-conjugated siRNA localizes in hepatocytes and elicits robust RNAi-mediated gene silencing. Journal of the American Chemical Society, 136(49), pp. 16958-16961. Soutschek, J., Akinc, A., Bramlage, B., Charisse, K., Constien, R., Donoghue, M., Elbashir, S., Geick, A., Hadwiger, P., Harborth, J. and John, M., 2004. Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature, 432(7014), p. 173

Claims

**Claim 1** A nucleic acid molecule comprising: a first portion comprising a double-stranded inhibitory ribonucleic acid (RNA) molecule containing a sense strand and an antisense strand; a second portion comprising a single-stranded deoxyribonucleic acid (DNA) molecule, wherein the 3'-end of the single-stranded DNA molecule is covalently bound to the 5'-end of the sense strand of the double-stranded inhibitory RNA molecule or the 3'-end of the single-stranded DNA molecule is covalently bound to the 5'-end of the antisense strand of the double-stranded inhibitory RNA molecule, and the double-stranded inhibitory RNA contains a sense nucleotide sequence encoding a part of a cardiovascular gene target associated with a cardiovascular disease or a polymorphic sequence variant thereof, and the single-stranded DNA molecule contains, over at least a part of its length, a nucleotide sequence adapted to anneal to a part of the single-stranded DNA by complementary base pairing to form a double-stranded DNA structure containing a stem and a loop domain, and the nucleic acid molecule contains N-acetylgalactosamine and the double-stranded inhibitory RNA consists of natural nucleotides, a second portion comprising a nucleic acid molecule. **Claim 2** The nucleic acid molecule according to claim 1, wherein the 3'-end of the single-stranded DNA molecule is covalently bound to the 5'-end of the sense strand of the double-stranded inhibitory RNA molecule or covalently bound to the 5'-end of the antisense strand of the double-stranded inhibitory RNA molecule. **Claim 3** The nucleic acid molecule according to claim 1, wherein the loop domain contains the nucleotide sequence GCGAAGC. **Claim 4** The single-stranded DNA molecule of claim 3, wherein the single-stranded DNA molecule is 5'TCACCTCATCCCCGCGAAGC 3' (SEQ ID NO 387 and 251); is 5'CGAAGCGCCCTACTCCACT 3' (SEQ ID NO 130); and is 5'GCGAAGCCCCCTACTCCACT 3' (SEQ ID NO 400) and contains a nucleotide sequence selected from the group consisting of. **Claim 5** The double-stranded inhibitory RNA molecule of claim 1, wherein the double-stranded inhibitory RNA molecule i) contains at least one deoxythymidine dinucleotide (dTdT) or consists of at least one deoxythymidine dinucleotide (dTdT) of a 2-nucleotide overhang; ii) contains at least one internucleotide phosphorothioate bond; or iii) contains a vinylphosphonate modification and is the nucleic acid molecule according to claim 1. **Claim 6** The nucleic acid molecule according to claim 1, wherein the double-stranded inhibitory RNA molecule is 17 to 29 nucleotides or 19 to 21 nucleotides in length.

7. The nucleic acid molecule according to any one of claims 1 to 6, wherein the cardiovascular gene target is human lipoprotein (a).

8. The double-stranded inhibitory RNA molecule is i) an antisense nucleotide sequence selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 and 34; ii) an antisense nucleotide sequence containing SEQ ID NO: 41 and a sense nucleotide sequence containing SEQ ID NO: 49, wherein the single-stranded DNA molecule is covalently bonded to the 5'-end of the sense strand of the double-stranded inhibitory RNA molecule; iii) an antisense nucleotide sequence containing SEQ ID NO: 4 and a sense nucleotide sequence containing SEQ ID NO: 44, wherein the single-stranded DNA molecule is covalently bonded to the 5'-end of the antisense strand of the double-stranded inhibitory RNA molecule; or iv) an antisense nucleotide sequence containing SEQ ID NO: 5 and a sense nucleotide sequence containing SEQ ID NO: 46, wherein the single-stranded DNA molecule is covalently bonded to the 5'-end of the antisense strand of the double-stranded inhibitory RNA molecule The nucleic acid molecule according to claim 7, comprising.

9. The nucleic acid molecule according to any one of claims 1 to 6, wherein the cardiovascular gene target is human apolipoprotein C III (Apo C III).

10. The nucleic acid molecule is i) an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 and 79; ii) an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249 and 250; or iii) an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 50, 51, 52, 53, 54, 55, 56, 57, 58, 80, 81, 82, 83, 84, 85, 86, 87, 88 and 89 The nucleic acid molecule according to claim 9, comprising.

11. The nucleic acid molecule according to any one of claims 1 to 6, wherein the cardiovascular gene target is human diglyceride acyltransferase 2 (DGAT2).

12. The nucleic acid molecule is i) an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118 and 119; ii) an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169 and 170; or iii) an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 120, 121, 122, 123, 124, 125, 126, 127, 128 and 129 The nucleic acid molecule according to claim 11, comprising.

13. The nucleic acid molecule according to any one of claims 1 to 6, wherein the cardiovascular gene target is human PCSK9.

14. The nucleic acid molecule is i) an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 189, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209 and 210; or ii) an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209 and 210 The nucleic acid molecule according to claim 13, comprising.

15. The nucleic acid molecule according to any one of claims 1 to 6, wherein the cardiovascular gene target is human apolipoprotein B.

16. The nucleic acid molecule is i) an RNA strand comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 499, 500, 453, 502, 503, 457, 505, 506, 462, 508, 509, 467, 511, 512, 472, 514, 515, 477, 517 518, 482, 520, 521, 487, 523, 524 and 492; or ii) an RNA strand comprising a nucleotide sequence selected from the group consisting of 450, 501, 455, 504, 460, 507, 465, 510, 470, 513, 475, 516, 480, 519, 485, 522, 490 and 525 The nucleic acid molecule according to claim 15, comprising.

17. A pharmaceutical composition comprising at least one nucleic acid molecule according to any one of claims 1 to 6.

Images