LPA inhibitors and their uses

Abstract

Disclosed is an LPA RNA interference (RNAi) agent, which contains nucleotides that target a nucleic acid molecule encoding LPA (apo(a)), and the oligonucleotide contains at least 12 consecutive nucleotides of any one of the nucleotide sequences of SEQ ID NO:2 to SEQ ID NO:92. Pharmaceutical compositions containing one or more RNA interference agents and delivery of the RNA interference agents to liver cells in the body inhibit LPA gene expression, and such nucleic acid-based therapeutics are used to reduce circulating levels of lipoprotein(a) (Lp(a)) and treat or prevent cardiovascular-related diseases.

Description

[Technical field]

[0001] This application claims priority to Chinese Patent Application No. 202111110773.1, filed on September 18, 2021 and entitled "LPA Inhibitors and Uses Thereof," and to Chinese Patent Application No. 202210068123.3, filed on January 20, 2022 and entitled "siRNA Conjugates and Uses Thereof," the entire contents of which are incorporated herein by reference.

[0002] The present application relates to the technical field of biopharmaceuticals, specifically to LPA inhibitors and uses thereof. [Background technology]

[0003] RNA interference (RNAi) is a phenomenon that is highly conserved during evolution and is induced by double-stranded RNA (dsRNA) to efficiently and specifically degrade homologous mRNA. By using RNAi technology, the expression of a specific gene can be specifically knocked out or stopped (dsRNA with a length of more than 30 causes interferon toxicity), so the technology is widely used in the fields of gene function exploration and treatment of infectious diseases and malignant tumors. Short dsRNA can be silenced after inducing gene-specific transcription in many organisms, including vertebrates, making it a usable tool for studying gene function. RNAi is mediated by the RNA-induced silencing complex (RISC), which is a complex formed by complexing siRNA, Argonaute protein, and Dicer enzyme. First, it is cleaved by Dicer enzyme to obtain small dsRNA intermediate molecules, i.e., small RNA duplexes, and then these small RNA duplexes are melted to form "functional" single strands, which act as "guides" for the RISC complex. For each small dsRNA molecule, only one strand, the guide strand, can bind to a specific Argonaute protein to form an active RISC complex.RNA interference agents, such as siRNAs and microRNAs, are oligonucleotides that perform gene silencing, i.e., prevent the formation of proteins by degrading mRNA molecules and inhibiting gene translation of proteins.

[0004] Lipoprotein(a) [Lp(a)] is a heterogeneous low-density lipoprotein (LDL)-like particle that contains a lipid core, apolipoprotein B (apoB-100), and a unique component, apolipoprotein(a) (apo(a)), linked to apoB-100 via disulfide bonds.

[0005] The LPA (Apo(a)) gene is expressed primarily in the liver, and its expression is restricted to humans and non-human primates. Lp(a) levels in humans are genetically defined and do not vary significantly with diet, exercise, or other lifestyle changes. The length of LPA varies with the number of Kringle KIV2 domains present, and its expression is negatively correlated with the number of domains present.

[0006] Analysis of Lp(a) levels in multiple studies suggests that high Lp(a) levels are an independent risk factor for cardiovascular disease, stroke, and other related conditions, including atherosclerotic stenosis. Genome-wide association studies also suggest that LPA is a genetic risk factor for diseases such as atherosclerotic stenosis. Therefore, there is a need to develop therapeutic agents related to LPA-related diseases, especially pharmaceutical preparations that reduce LPA expression levels. Summary of the Invention [Problem to be solved by the invention]

[0007] One objective of the present application is to provide LPA RNAi agents and methods that can modulate (e.g., reduce) LPA (apo(a)) levels in cells and subjects, such as mammals (e.g., humans). LPA is the name of the gene that encodes apolipoprotein(a) (apo(a)), i.e., an important component of lipoprotein(a) particles (Lp(a)), and the human DNA sequence (SEQ ID NO.1) is shown in Figures 1a and 1b. Compositions containing LPA (also called apo(a)) RNA interference (RNAi) agents (also called RNAi triggers or triggers) and LPA RNAi agents selectively and effectively inhibit expression of the LPA gene.

[0008] Another object of the present application is to provide a pharmaceutical composition containing said LPA RNAi agent.

[0009] Another object of the present application is to further provide a use of said LPA RNAi agent in the prevention or treatment of a disease or condition, or in the preparation of a medicament for preventing or treating a disease or condition. [Means for solving the problem]

[0010] The LPA RNA interference (RNAi) agent according to a first aspect of the present application comprises a first nucleotide sequence, the first nucleotide sequence comprising a sequence of at least 12 consecutive nucleotides of any one of nucleotide sequences of SEQ ID NO:2 to SEQ ID NO:183, or a nucleotide sequence complementary thereto, or a sequence having a difference of 3 or less nucleotides from the at least 12 consecutive nucleotides, the nucleotides being in a modified or unmodified state.

[0011] Preferably, the first nucleotide sequence consists of 12 to 30 nucleotides, preferably 19 to 23 nucleotides.

[0012] Preferably, the first nucleotide sequence is a single-stranded oligonucleotide or a double-stranded nucleotide.

[0013] Preferably, one or more nucleotides of said first nucleotide sequence are modified to form modified nucleotides.

[0014] Preferably, the first nucleotide sequence comprises any one of the modified sense strand nucleotide sequences listed in Table 2, or a sequence which differs therefrom by no more than 3 nucleotides.

[0015] Preferably, the first nucleotide sequence is the sense strand or the antisense strand.

[0016] Preferably, the first nucleotide sequence comprises a double-stranded structure of an antisense strand and a sense strand.

[0017] Preferably, the sense strand and / or the antisense strand independently contain one or more modified nucleotides.

[0018] Preferably, the modified nucleotide is at least one of a 2'-fluoro modified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-O-methoxyethyl modified nucleotide, a 2'-O-alkyl modified nucleotide, a 2'-O-allyl modified nucleotide, a bicyclonucleic acid, a deoxyribonucleotide, an EVP, a UNA, and a GNA. Preferably, the antisense strand is modified with a 2'-fluoro modified nucleotide at at least one of positions 2, 5, 6, 8, 10, 14, and 16 from the 5' end, and preferably 5 to 7 positions are modified with 2'-fluoro modified nucleotides.

[0019] Preferably, the sense strand and / or the antisense strand independently contain one or more phosphorothioate bonds, preferably the sense strand contains two consecutive phosphorothioate bonds between the 3' and 5' terminal nucleotides, or alternatively the antisense strand contains two consecutive phosphorothioate bonds between the 3' and 5' terminal nucleotides.

[0020] In some embodiments, the antisense strand comprises any one of the modified antisense strand nucleotide sequences in Table 2, or a sequence that differs therefrom by no more than 3 nucleotides.

[0021] More preferably, the sense strand and the antisense strand have the feature (1), in which the sense strand contains or consists of a modified sense strand sequence listed in Table 2, and the antisense strand contains or consists of a modified antisense strand sequence listed in Table 2.

[0022] Preferably, the RNA interfering agent further comprises a ligand.

[0023] Preferably, the ligand comprises a targeting group.

[0024] Preferably, the targeting group comprises an asialoglycoprotein receptor ligand.

[0025] Preferably, the asialoglycoprotein receptor ligand contains a galactose cluster.

[0026] Preferably, said ligand is conjugated to said sense and / or antisense strand, preferably to the sense strand.

[0027] In one embodiment, the LPA RNA interfering agent has the structure: ZX (I), X is a nucleotide sequence, Z is a first linker portion of the nucleotide sequence, Z and X may be directly linked or linked via a chemical group, and the general formula of Z is shown in (Z-1), and one end of the O group is linked to the nucleotide sequence;

[0028] [ka] wherein R1 is O, S, NR3, or CR3R4, and R3 and R4 are each independently hydrogen, halogen, a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group, a substituted or unsubstituted heteroaryl group, a substituted or unsubstituted heterocycle, or a substituted or unsubstituted cycloalkyl group; R2 is -O-, -S-, -NH-, -CH2-, -C(O)-, -OC(O)-, -C(O)O-, -NHC(O)-, -C(O)NH-, -CH2NH-, -CHO-, -NH-C(O)-CH2-, -C(O)-CH2-NH-, or -NH(CO)NH-, wherein the -CH2- may be substituted with a substituent preferably selected from a halogen, an alkyl group, an alkoxy group, and an alkylamino group, and a1 and a2 are the same or different and each is an integer selected from 0 to 20, preferably 1 to 10.

[0029] Preferably, the nucleotide sequence represented by X is the first nucleotide sequence described above.

[0030] Preferably, said first linker moiety Z is linked to a second linker moiety L1, said second linker moiety L1 being linked to a branch point group E.

[0031] Preferably, the branch point group E is linked to a targeting complexes, where a is an integer selected from 0 to 10, preferably 1 to 5, and the targeting complexes comprise a 1:1 ratio of tethering moiety L2 to targeting moiety T.

[0032] Specifically, the structural formula of the LPA RNA interfering agent may be represented by the following formula:

[0033] [ka] (I-0) In one embodiment, the LPA RNA interfering agent has the structure:

[0034] [ka] (II), In general formula (II), L3 comprises a third linker moiety, and L4 is a targeting moiety, specifically, L3 and L4 may be the same or different, and preferably, L3 and L4 are each the following structure:

[0035] [ka] X is a nucleotide sequence, which may be the sense strand or the antisense strand; Y is O or S; b, c, d, and e are each an integer selected from 0 to 10, and b and e are not simultaneously 0. In one embodiment, b is 0, and e is an integer selected from 3 to 6.

[0036] In another aspect, the use of the LPA RNA interfering agent in the preparation of a medicament according to the present application, wherein the medicament reduces expression of LPA mRNA or protein in a mammal, prevents and / or treats an associated disease or condition, or reduces the risk of a disease or condition.

[0037] In some embodiments, the associated disease or condition refers to one in which the expression level of LPA protein is 100 nmol / L or greater.

[0038] In some embodiments, the disease or condition comprises liver disease.

[0039] In some embodiments, the disease or condition comprises inflammation, a cardiovascular disease, or a metabolic disease.

[0040] In some embodiments, the cardiovascular disease comprises hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic stenosis.

[0041] In some embodiments, the pharmaceutical preparation comprises a pharma- ceutically acceptable excipient, preferably, the pharma- ceutically acceptable excipient is PBS buffer or saline.

[0042] In some embodiments, the pharmaceutical agent is a composition and further comprises at least one of an LDL-C, cholesterol, and triglyceride lowering agent.

[0043] In some embodiments, the medicament is a composition and further comprises a PCSK9 RNAi inhibitor, a PCSK9 antibody inhibitor, and a PCSK9 small molecule inhibitor.

[0044] In another aspect, the method of reducing expression of LPA mRNA or protein in a cell or tissue according to the present application comprises contacting the cell or tissue with an effective amount of said LPA RNAi agent or said pharmaceutical composition.

[0045] In some embodiments, the cells are hepatocytes.

[0046] In some embodiments, the tissue is liver tissue.

[0047] In some embodiments, the cells and tissues are outside the body.

[0048] In some embodiments, the cells and tissues are within a subject.

[0049] In another aspect, the method of the present application for reducing expression of LPA mRNA or protein in a subject comprises administering to a subject in need thereof an effective amount of the LPA RNAi agent or the pharmaceutical composition.

[0050] In yet another aspect, a method of preventing or treating a disease or condition according to the present application comprises administering to a target subject an effective amount of said LPA RNAi agent or said pharmaceutical composition.

[0051] In some embodiments, the compound or pharmaceutical composition is administered to a subject via subcutaneous injection, intravenous injection, oral administration, rectal administration, or intraperitoneal administration. Effect of the Invention

[0052] The beneficial effects are as follows: Experiments have demonstrated that the LPA RNAi agent of the present application can significantly inhibit the expression of Apo(a) protein and corresponding mRNA in both in vitro and in vivo experiments (in mice). In mouse experiments, it can achieve up to 99% knockdown inhibition of Apo(a) protein expression at high doses. [Brief description of the drawings]

[0053] [Figure 1a] A specific sequence of SEQ ID NO.1. [Figure 1b] Continued from Figure 1a. [Diagram 2] 13 shows experimental results of Example 7 of the present invention. [Diagram 3] 13 shows experimental results of Example 8 of the present invention. [Figure 4] 13 shows the experimental results of Example 9 of the present invention. [Diagram 5] 13 shows the experimental results of Example 10 of the present invention. [Figure 6] 13 shows the experimental results of Example 11 of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0054] In order to clarify the technical problems to be solved, the technical solutions and the beneficial effects of the present invention, the present invention will be described in more detail with reference to the drawings, examples and chemical reaction formulas as follows. Note that the specific examples described herein are merely for interpreting the present invention and are not intended to limit the present invention.

[0055] Definition of Terms As used herein, the terms "LPA," "Apo(a)," or "apo(a)" are used interchangeably and generally refer to any nucleic acid or protein sequence encoding apo(a). For example, in some embodiments, apo(a) includes a DNA sequence encoding apo(a), an RNA sequence transcribed from DNA encoding apo(a) (including genomic DNA containing introns and exons), an mRNA sequence encoding apo(a), or a peptide sequence of apo(a).

[0056] As used herein, the term "apo(a) specific inhibitor" refers to any reagent capable of specifically inhibiting the expression of apo(a) nucleic acid and / or apo(a) protein. For example, apo(a) specific inhibitors include nucleic acids (including antisense oligonucleotides), peptides, antibodies, small molecules, and other reagents capable of inhibiting the expression of apo(a) nucleic acid and / or apo(a) protein. In some embodiments, apo(a) specific inhibitors can affect other components of the lipid transport system, including downstream components, by specifically modulating the expression of apo(a) nucleic acid and / or the expression of apo(a) protein. Similarly, in some embodiments, apo(a) specific inhibitors can affect other molecular processes in an animal.

[0057] In this application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length (deoxyribonucleotides or ribonucleotides or analogs thereof), both double-stranded and single-stranded molecules. Non-limiting examples of polynucleotides include genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNAi reagents, and primers. Polynucleotides may be modified or substituted at one or more bases, sugars, and / or phosphates with any modification or substitution known in the art. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications to the nucleotide structure may also be made before or after assembly of the polymer. Polynucleotides may be modified after polymerization, such as by conjugation with a labeling component. Unless otherwise stated or required, any embodiment of a polynucleotide of the present application includes the double-stranded form and each of the two complementary single-stranded forms that are known or predicted to constitute the double-stranded form.

[0058] In this application, "target nucleic acid" or "target sequence" generally refers to a nucleic acid molecule to which an antisense compound is intended to hybridize to produce a desired effect (e.g., antisense activity). Exemplary antisense compounds include antisense oligonucleotides, which have sufficient complementarity to their target nucleic acid to allow hybridization under physiological conditions. In some embodiments, "target nucleic acid" includes, but is not limited to, DNA or RNA encoding mammalian LPA, such as human LPA mRNA.

[0059] As used herein, the term "oligonucleotide" generally refers to a polymer of multiple nucleotide residues (deoxyribonucleotides or ribonucleotides, or related structural variants or synthetic analogs thereof) linked via phosphodiester bonds (or related structural variants or synthetic analogs thereof). Thus, the term "oligonucleotide" generally refers to a nucleotide polymer in which the nucleotide residues and the linkages between them are naturally occurring, but it is understood that the term also includes within its scope various analogs, including, but not limited to, peptide nucleic acid (PNA), phosphoramidate, phosphorothioate, methylphosphonate, 2-O-methyl ribonucleic acid, and the like. The appropriate size of the molecule depends on the specific application. Oligonucleotides are generally short in length, usually about 10-30 nucleotide residues, although the term may refer to molecules of any length. The terms "polynucleotide" or "nucleic acid" are generally used for larger oligonucleotides.

[0060] In some embodiments, an oligonucleotide comprises one or more unmodified nucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides. The term "modified oligonucleotide" generally refers to an oligonucleotide that comprises at least one modified nucleoside and / or at least one modified internucleoside linkage.

[0061] As used herein, the term "modified nucleoside" generally refers to a nucleoside that contains at least one chemical modification compared to a naturally occurring RNA or DNA nucleoside. Modified nucleosides include modified sugar moieties and / or modified nucleobases.

[0062] In this application, the term "nucleobase" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Nucleotides may include modified nucleotides or nucleotide analogs, abasic sites (Ab or X) or alternative moieties. As used herein, "nucleobase sequence" generally refers to the order of consecutive nucleobases, independent of any sugar, linkage or nucleobase modification. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally refers to the naturally occurring heterocyclic nucleobases of RNA or DNA, namely the purine bases (adenine (A) and guanine (G)) and the pyrimidine bases (thymine (T), cytosine (C) (including 5-methyl C) and uracil (U)). "Modified nucleobase" generally refers to any nucleobase that is not a naturally occurring nucleobase.

[0063] As used herein, the term "sugar moiety" refers generally to the naturally occurring sugar moiety of a nucleoside or a modified sugar moiety. The term "naturally occurring sugar moiety" refers generally to a ribofuranose found in naturally occurring RNA or a deoxyribofuranose found in naturally occurring DNA. The term "modified sugar moiety" refers to a substituted sugar moiety or sugar substitute.

[0064] In this application, the term "internucleoside linkage" generally refers to a covalent bond between adjacent nucleosides in an oligonucleotide. The term "naturally occurring internucleoside linkage" refers to a 3' to 5' phosphodiester linkage. The term "modified internucleoside linkage" refers to any internucleoside linkage other than a naturally occurring internucleoside linkage.

[0065] As used herein, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide molecule having a nucleobase sequence complementary to a corresponding fragment of a target nucleic acid (e.g., a target genomic sequence, pre-mRNA, or mRNA molecule). In some embodiments, the length of the antisense oligonucleotide is 12-30 nucleobases. In some embodiments, the antisense oligonucleotide is an unmodified or modified nucleic acid having a nucleotide sequence complementary to a target nucleic acid (e.g., an LPA polynucleotide) sequence.

[0066] In the present application, the term "antisense strand" generally refers to a strand that comprises a region that is substantially complementary to the target sequence of an RNAi agent (e.g., dsRNA). As used herein, the term "complementary region" generally refers to a region of the antisense strand that is substantially complementary to a sequence (e.g., a target sequence) defined in the present application. When the complementary region is not completely complementary to the target sequence, mismatches are tolerated in the internal or terminal regions of the molecule. Usually, the most tolerated mismatches are within the terminal regions, e.g., within 5, 4, 3 or 2 nucleotides from the 5'-end and / or 3'-end.

[0067] In this application, the term "sense strand" (S) generally refers to the strand of an RNAi agent that contains a region that is substantially complementary to a region of the term "antisense strand" as defined herein. The "sense" strand is sometimes referred to as the "significant" strand. Due to these sequences, the antisense strand targets the desired mRNA and the sense strand targets a different target. Thus, when the antisense strand is incorporated into RISC, the correct target is targeted. Incorporation of the sense strand can result in off-target effects. These off-target effects are limited by using modifications to the sense strand or by using a 5' end cap.

[0068] In this application, the term "complementary" when used to describe a first nucleotide sequence (e.g., an RNAi agent sense strand or an LPA mRNA) to a second nucleotide sequence (e.g., an RNAi agent antisense strand) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds) with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions to form a double-stranded or double helix structure. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide analogs, so long as the above requirements for hybridization ability are achieved. "Complementary" does not require nucleobase complementarity at each nucleoside. Conversely, some mismatches can be tolerated.

[0069] As used herein, the term "fully complementary" generally means that all (100%) of the bases of a contiguous sequence of a first polynucleotide hybridize with the same number of bases of a contiguous sequence of a second polynucleotide. The contiguous sequence may include all or a portion of the first nucleotide sequence or the second nucleotide sequence. As used herein, "partially complementary" generally means that in a hybridizing base sequence pair, at least about 70% of the bases of a contiguous sequence of a first polynucleotide hybridize with the same number of bases of a contiguous sequence of a second polynucleotide. As used herein, "substantially complementary" generally means that in a hybridizing base sequence pair, at least about 90% of the bases of a contiguous sequence of a first polynucleotide hybridize with the same number of bases of a contiguous sequence of a second polynucleotide. As used herein, the terms "complementary", "fully complementary" and "substantially complementary" are used in base matching between the sense strand and antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of an LPA mRNA. The identity or complementarity of sequences is not dependent on modification. For the purpose of determining identity or complementarity, for example, A and Af are complementary to U (or T) and identical to A.

[0070] As used herein, the term "ligand" generally refers to any compound or molecule that can be covalently or otherwise chemically bound to a biologically active agent (e.g., an oligonucleotide). In some embodiments, a ligand can directly or indirectly interact with another compound, such as a receptor, which may be present on the cell surface or alternatively may be an intracellular and / or intercellular receptor, and the interaction between the ligand and the receptor may result in a biochemical reaction or may be a physical interaction or binding.

[0071] In this application, the terms "induction", "inhibition", "enhancement", "elevation", "increase", "decrease", "reduction" and the like usually refer to a quantitative difference between two states. For example, "effectively inhibiting the activity or expression of apo(a)" means that the level of apo(a) activity or expression in a treated sample is lower than the level of apo(a) activity or expression in an untreated sample. The above terms apply, for example, to expression levels and activity levels. The terms "decrease" and "reduction" are used interchangeably and usually refer to any change that is smaller than the original. "Decrease" and "reduction" are relative terms and require a comparison of what is measured before and what is measured after. "Decrease" and "reduction" include complete depletion.

[0072] In some embodiments, the term "reduction" refers to an overall reduction in the expression level / amount of a gene, protein or gene product, such as a biomarker, in a first sample by about 5% to 95% or 100% compared to the expression level / amount of a corresponding gene, protein or gene product, such as a biomarker, in a second sample, as detected by standard methods known in the art (e.g., those described herein). In some embodiments, the term "reduction" refers to a reduction in the expression level / amount of a gene or biomarker in a test sample, which reduction refers to at least about 0.9-fold to 0.01-fold the expression level / amount of the corresponding gene or biomarker.

[0073] As used herein, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5' cap), and translation.

[0074] In this application, the term "pharmaceutical acceptable" generally means one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may generally include salts, excipients, buffers, preservatives, compatibility vectors, and any other therapeutic agents. When used in medicine and pharmaceuticals, the salts should be pharmaceutically acceptable salts, but non-pharmaceutically acceptable salts may also be used to prepare pharmaceutically acceptable salts and cannot be excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, and the like. Pharmaceutically acceptable salts may be prepared as alkali metal or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.

[0075] In the present application, the term "prevention and / or treatment" includes not only preventing and / or treating a disease, but also generally includes preventing the onset of a disease, alleviating or reversing the progression of a disease, preventing and / or alleviating the onset of one or more symptoms associated with a disease, reducing or alleviating one or more symptoms associated with a disease, reducing the severity and / or duration of a disease and / or any symptoms associated therewith, and / or preventing further increase in the severity of a disease and / or any symptoms associated therewith, preventing, reducing or reversing any physiological damage resulting from a disease, and generally includes any pharmacological action beneficial to the patient being treated. A possible therapeutic agent formed of an RNAi agent or pharmaceutical composition of the present application does not need to completely cure a disease or eradicate any symptoms or manifestations. As recognized in the relevant field, a pharmaceutical agent used as a therapeutic agent can reduce the severity of a given disease state, but does not need to eliminate all manifestations of the disease to be considered a useful therapeutic agent. Similarly, a treatment administered prophylactically does not need to be completely effective in preventing the onset of symptoms to constitute a viable prophylactic agent. It may simply be that the disease affects the subject less (e.g., by reducing the number or severity of symptoms, by improving the effectiveness of another treatment, or by producing another beneficial effect), or that the likelihood of the disease occurring or worsening.

[0076] In this application, the terms "disease" or "condition" may be used interchangeably and generally refer to any deviation from the normal state of a subject, such as any change in the state of the body or some organs, inhibition or impediment in the performance of functions, and / or causing symptoms such as discomfort, dysfunction, suffering or death to the patient or those in contact with it. A disease or condition may also be referred to as distemper, ailment, ailment, malady, disorder, sickness, illness, complaint, inderdisposion or affectation.

[0077] In the present application, the term "administration" generally refers to the introduction of the pharmaceutical formulation of the present application into the body of a subject via any route of introduction or delivery. Any method known to those skilled in the art for contacting a cell, organ or tissue with the pharmaceutical agent can be used. The administration may include, but is not limited to, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous, or oral administration. The daily dosage can be divided into one, two or more suitable dosage forms and administered at one, two or more times during a period of time.

[0078] In the present application, the term "contact" generally refers to contacting two or more different types of substances in any order, in any manner, and at any time. Contacting can be in vivo, ex vivo, or in vitro. In some embodiments, it may refer to directly contacting the RNAi agent or composition of the present application with a cell or tissue. In other embodiments, the term refers to indirectly contacting the RNAi agent or composition of the present application with a cell or tissue. For example, the present method includes contacting a subject with the RNAi agent or composition of the present application, and then contacting the RNAi agent or composition with the cell or tissue by diffusion or any other active or passive transport process known in the art, whereby the compound circulates in the body.

[0079] In this application, the term "effective amount" or "effective dosage" generally refers to an amount sufficient to achieve or at least partially achieve a desired effect. A "therapeutically effective amount" or "therapeutically effective dosage" of a pharmaceutical or therapeutic agent is generally an amount of any pharmaceutical agent that, when used alone or in combination with another therapeutic agent, promotes regression of a disease (as evidenced by a decrease in the severity of symptoms of the disease, an increase in the frequency and duration of symptom-free periods of the disease, or prevention of damage or disability due to disease affliction). A "prophylactically effective amount" or "prophylactically effective dosage" of a pharmaceutical agent generally refers to an amount of the pharmaceutical agent that inhibits disease progression or recurrence when administered alone or in combination with another therapeutic agent to a subject at risk of disease progression or disease recurrence. In some embodiments, an "effective amount" refers to an amount of an RNAi agent that achieves a desired pharmacological, therapeutic, or prophylactic result.

[0080] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) in need of diagnosis, prognosis, amelioration, prevention and / or treatment of a disease, such as humans, non-human primates (monkeys, gibbons, gorillas, chimpanzees, orangutans, rhesus monkeys), livestock (dogs and cats), farm animals (horses, cows, goats, sheep, pigs) and laboratory animals (mice, rats, rabbits, guinea pigs). Human subjects include fetal, neonatal, infant, adolescent, and adult subjects. Subjects include animal disease models.

[0081] In this application, the terms "comprise," "include," "have," "can," "contain," and variations thereof are generally intended to be open-ended transitional phrases, terms, or words that do not exclude the possibility of additional acts or structures. The term "consisting of" generally indicates that another component (or, equivalently, feature, integer, step, etc.) cannot be present. Nouns without numerical limitations include plural referents unless the context clearly dictates otherwise.

[0082] When the term "about" is used in connection with a numerical range, a cut-off value or a particular numerical value is used to indicate that the stated numerical value has a 10% difference from the recited numerical value. Thus, the term "about" can be used to encompass a variation of ±10% or less, a variation of ±5% or less, a variation of ±1% or less, a variation of ±0.5% or less, or a variation of ±0.1% or less from a particular value.

[0083] LPA RNAi Agent The RNAi agents that inhibit the expression of the LPA gene described herein (referred to herein as LPA RNAi agents) are delivered to cells expressing the LPA gene and then inhibit or knock down the expression of LPA in vitro and / or in vivo by the biological process of RNA interference (RNAi). As used herein, unless otherwise indicated, LPA may refer to the LPA gene, LPA mRNA, or LP(a) protein, as appropriate. RNAi agents include, but are not limited to, small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), and small hairpin RNA (shRNA).

[0084] In one aspect, the LPA RNAi agent of the present application may comprise an oligonucleotide targeted to a nucleic acid molecule encoding LPA (apo(a)), the oligonucleotide comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleotides of any one of SEQ ID NO:2 to SEQ ID NO:183. The nucleotide sequence may be in a modified state (and modified followed by addition of a ligand) and in an initial unmodified state.

[0085] In some embodiments, the oligonucleotide is comprised of 12 to 30 nucleotides. For example, the oligonucleotide may be 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. For example, the oligonucleotide may be 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.

[0086] In some embodiments, the oligonucleotide comprises a nucleotide sequence selected from the nucleotide sequence set forth in any one of SEQ ID NO:2 to SEQ ID NO:183, or a sequence that differs therefrom by no more than three nucleotides. For example, when up to one, two or three nucleotides are substituted (e.g., adenosine is replaced by uracil), deleted or added from the nucleotide sequence set forth in any one of SEQ ID NO:2 to SEQ ID NO:183, the derived RNAi agent still has reduced inhibitory activity and has an inhibitory effect of 20% or more compared to the nucleotide sequence set forth in any one of SEQ ID NO:2 to SEQ ID NO:183 from which it is derived.

[0087] In some embodiments, the oligonucleotide is a single-stranded oligonucleotide or a double-stranded oligonucleotide.

[0088] For example, the oligonucleotide may be an antisense oligonucleotide. For example, the oligonucleotide may be an siRNA.

[0089] For example, the oligonucleotide may comprise only the antisense strand. For example, the oligonucleotide may comprise both the sense strand and the antisense strand.

[0090] In some embodiments, the sense strand and antisense strand of the LPA RNAi agent are independently 17-30 nucleotides long. In some embodiments, the sense strand and antisense strand are independently 17-26 nucleotides long. In some embodiments, the sense strand and antisense strand are independently 19-26 nucleotides long. In some embodiments, the sense strand and antisense strand of the RNAi agent are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. The sense and antisense strands may be the same or different in length. In some embodiments, the sense and antisense strands are each 26 nucleotides long. In some embodiments, the sense strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand is 22 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand is 21 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long.

[0091] In some embodiments, the antisense strand sequence is 100% (fully) complementary or at least 90% (substantially) complementary to the nucleotide sequence present in the LPA mRNA (sometimes referred to as the target sequence). The sense strand sequence is 100% (fully) complementary or at least 90% (substantially) complementary to the sequence of the antisense strand, so that the sense strand sequence is completely identical or at least 90% identical to the nucleotide sequence present in the LPA mRNA (the target sequence).

[0092] In some embodiments, the sense strand and antisense strand of the LPA RNAi agent are annealed to form a duplex. The sense strand and antisense strand of the LPA RNAi agent are partially, substantially, or completely complementary to each other. Within the complementary duplex region, the sense strand core sequence is at least 90% complementary or 100% complementary to the antisense core sequence. In some embodiments, the sense strand core sequence contains a sequence of at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that are at least 90% or 100% complementary to the corresponding 17, 18, 19, 20, or 21 nucleotide sequence of the antisense strand core sequence (i.e., the sense strand and antisense core sequences of the LPA RNAi agent have a region of at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that are at least 90% base-paired or 100% base-paired).

[0093] In some embodiments, the sense strand and / or the antisense strand may contain another 1, 2, 3, 4, 5 or 6 nucleotides (extensions) at the 3' end, 5' end or both 3' and 5' ends of the core sequence, independently and arbitrarily. If there are additional nucleotides in the antisense strand, they may be complementary or not complementary to the corresponding sequence in LPA mRNA. If there are additional nucleotides in the sense strand, they may be identical or not identical to the corresponding sequence in LPA mRNA. If there are additional nucleotides in the antisense strand, they may be complementary or not complementary to the additional nucleotides in the corresponding sense strand.

[0094] In some embodiments, the LPA RNAi agent comprises a 3'-extended antisense strand having a length of 1, 2, 3, 4, 5, or 6 nucleotides. In other embodiments, the LPA RNAi agent comprises a 3'-extended antisense strand having a length of 1, 2, or 3 nucleotides. In some embodiments, one or more of the antisense strand extension nucleotides comprises a uracil or thymidine nucleotide, or a nucleotide complementary to the corresponding LPA mRNA sequence.

[0095] In some embodiments, the LPA RNAi agent comprises a 5'-extended antisense strand having a length of 1, 2, 3, 4 or 5 nucleotides. In other embodiments, the LPA RNAi agent comprises a 5'-extended antisense strand having a length of 1 or 2 nucleotides. In some embodiments, one or more of the antisense strand extension nucleotides comprises a uracil or thymidine nucleotide, or a nucleotide complementary to the corresponding LPA mRNA sequence. The antisense strand may have a combination of any of the above 3'-extended antisense strands and any of the above 5'-extended antisense strands.

[0096] In some embodiments, the LPA RNAi agent comprises a 3' extended sense strand having a length of 1, 2, 3, 4 or 5 nucleotides. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil or thymidine nucleotide, an AT dinucleotide or a nucleotide corresponding to a nucleotide of the LPA mRNA sequence.

[0097] In some embodiments, the LPA RNAi agent comprises a 5'-extended sense strand having a length of 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides, or nucleotides corresponding to nucleotides in the LPA mRNA sequence. The sense strand may have a 3' extension and / or a 5' extension.

[0098] In some embodiments, the antisense strand comprises a nucleotide sequence set forth in any one of SEQ ID NO:2 to SEQ ID NO:92, or a sequence that differs therefrom by no more than three nucleotides.

[0099] In some embodiments, the sense strand comprises a nucleotide sequence set forth in any one of SEQ ID NO:93 to SEQ ID NO:183, or a sequence that differs therefrom by no more than 3 nucleotides.

[0100] In some embodiments, the antisense and sense strand sequences of the LPA RNAi agents are shown in Table 1.

[0101] The LPA RNAi agents described herein can be formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 1 can be hybridized to any antisense strand, provided that the two sequences are at least 90% complementary over a contiguous sequence of 16, 17, 18, 19, 20, or 21 nucleotides.

[0102] In some embodiments, the antisense strand of an LPA RNAi agent comprises the nucleotide sequence of any of the antisense strand sequences in Table 1. In some embodiments, the antisense strand of an LPA RNAi agent comprises the sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 3-22, 1-23, 2-23, 3-23, or 4-23 of any of the antisense strand sequences in Table 1. In some embodiments, the sense strand of an LPA RNAi agent comprises the nucleotide sequence of any of the sense strand sequences in Table 1. In some embodiments, the sense strand of an LPA RNAi agent comprises the sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sense sequences in Table 1.

[0103] In some embodiments, the sense strand and the antisense strand of the LPA RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense strand and the antisense strand of the LPA RNAi agent described herein contain a different number of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the LPA RNAi agent form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the LPA RNAi agent form a blunt end. In some embodiments, the two ends of the RNAi agent form a blunt end. In some embodiments, the two ends of the LPA RNAi agent are not blunt ends. As used herein, blunt end refers to the ends of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (complementary base pairs are formed). In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the LPA RNAi agent form a free end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a free end. In some embodiments, the two ends of the LPA RNAi agent form a free end. In some embodiments, neither of the two ends of the LPA RNAi agent is a free end. As used herein, a free end generally refers to an end of a double-stranded RNAi agent where two annealed terminal nucleotides are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In this application, an overhang is a segment of one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent. The unpaired nucleotides may be in the sense strand or the antisense strand, forming a 3' overhang or a 5' overhang. In some embodiments, the LPA RNAi agent contains a blunt end and a free end, or contains a blunt end and a 5' overhang, or contains a blunt end and a 3' overhang, or contains a free end and a 5' overhang, or contains a free end and a 3' overhang, or contains two 5' overhangs, or contains two 3' overhangs, or contains a 5' overhang and a 3' overhang, or contains two free ends, or contains two blunt ends.

[0104] In some embodiments, the LPA RNAi agent is formulated as a salt, mixed salt, or free acid.

[0105] Modified Nucleotides The LPA RNAi reagents of the present application include unmodified nucleic acids, modified nucleic acids for improving the effect, and polymers of nucleoside substitutes. Unmodified nucleic acids means that the components of sugar, base, and phosphate structure are the same or substantially the same as the natural components, preferably natural components in the human body. The prior art considers rare or unusual but naturally occurring RNAs as modified RNAs (see Limbach et al. (1994) Nucleic Acids Res. 22:2183-2196). Such rare or unusual modified RNAs are often usually called modified RNAs (obviously they are post-transcriptionally modified), and belong to unmodified RNA in the present application. Modified RNA as used in the present application refers to nucleic acid components therein, i.e., one or more components of sugar, base, and phosphate structure, different from the natural components, preferably different from the natural components produced in the human body. Nucleoside surrogates are molecules in which the ribose phosphate backbone is replaced by a non-ribose phosphate structure which allows the bases to be in precise spatial relationship and hybridization is substantially similar to hybridization with a ribose phosphate backbone found, for example, as an analog of an uncharged ribose phosphate backbone.

[0106] In some embodiments, the LPA RNAi agent contains one or more modified nucleotides.

[0107] In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100% of the nucleotides of the LPA RNAi agent are modified.

[0108] In some embodiments, the sense strand and / or the antisense strand independently contain one or more modified nucleotides.

[0109] The two main purposes of modifying RNAi agents are to obtain stability against environmental degradation in organisms and to improve pharmacological properties, such as pharmacodynamic properties. RNAi agents may contain non-naturally occurring bases or non-naturally occurring sugars, such as non-saccharide compounds, circular vector molecules, to be used for typical properties of non-naturally occurring sugars in RNAi agents. RNAi agents may contain internucleotide bonds (e.g., chiral thiophosphate bonds) to improve nuclease resistance. RNAi agents may further or selectively contain ribose analogs to improve nuclease resistance.

[0110] Modified nucleotides include deoxynucleotides, nucleotide analogs, abasic nucleotides (referred to herein as X, Ab), 2'-modified nucleotides, 3'-3 linked (inverted) nucleotides (referred to herein as invdN, invN, invn, invX, invAb), nucleotides containing non-natural bases, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide analogs (unlocked nucleobase analogs, referred to herein as NUNA or NUNA), locked nucleotides (referred to herein as NLNA or NLNA), and the like. Examples of nucleotides that may be used include, but are not limited to, 3'-O-methoxy (2' internucleoside linked) nucleotides (referred to herein as 3'-OMen), 2'-F-arabinose nucleotides (referred to herein as NfANA or NfANA), 5'-Me,2'-fluoro nucleotides (referred to herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (referred to herein as vpdN), vinyl phosphonate-containing nucleotides, and cyclopropyl phosphonate-containing nucleotides (cPrpN). 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxy group at the 2' position of the 5-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (represented herein as lowercase n in nucleotide sequences), 2'-deoxy-2'-fluoro nucleotides (represented herein as Nf, also represented herein as 2'-fluoro nucleotides), 2'-deoxy nucleotides (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (represented herein as NM or 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. Specifically, two or more modifications may be incorporated into a single LPA RNAi agent or into a single nucleotide thereof. The sense and antisense strands of the LPA RNAi agent can be synthesized and / or modified by methods known in the art. A modification at one nucleotide is independent of a modification at another nucleotide.

[0111] Modified nucleotides further include nucleotides having modified bases, including synthetic and natural bases, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, 2-propyl and other alkyl derivatives of xanthine, adenine and guanine, 2-thiothymine and 2-thiocytosine, 5-halouracil and These include, but are not limited to, cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine.

[0112] In some embodiments, one or more nucleotides of the LPA RNAi agent are linked via a non-standard bond or backbone (i.e., a modified internucleoside bond or a modified backbone). In some embodiments, the modified internucleoside bond is a non-phosphate-containing covalent internucleoside bond. Modified internucleoside linkages or backbones include 5'-thiophosphate groups (represented herein as a lower case s preceding the nucleotide, e.g., sN, sn, sNf or sdN) with the normal 3'-5' linkage, chiral thiophosphates, thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl-phosphate triesters, methyl phosphonates, 3'-alkylene phosphonates and other alkyl esters including chiral phosphonates, phosphinates, aminophosphates including 3'-aminophosphates and aminoalkyl aminophosphates, thiocarbonyl aminophosphates, thiocarbonylalkyl-phosphonates, thiocarbonylalkyl phosphate triesters, morpholino linkages and borane phosphates, 2'-5' linked analogs of these materials, and those with inverted polarity where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In other embodiments, the modified internucleoside linkage or backbone does not have a phosphorus atom. Modified internucleoside linkages that do not have a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, and one or more short chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S and CH2 moieties.

[0113] Ligand In some embodiments, the LPA RNAi agent further comprises a ligand.

[0114] In some embodiments, the ligand alters the distribution, targeting, or lifetime of the RNAi agent to which it binds. In some examples, the ligand improves affinity for a selected target compared to a species without the ligand. The selected target can be, for example, a molecule, a cell, or a cell type, and a cell or cavity, such as an organ cavity, a tissue, an organ, or a region of the body.

[0115] In some embodiments, the ligands can improve the transport, hybridization, and specificity properties, improve the nuclease resistance of the resulting natural or modified oligoribonucleotides, or improve the nuclease resistance of polymer molecules containing any conjugate of the monomers and / or natural or modified oligoribonucleotides described herein.

[0116] For example, the ligand may further comprise a targeting group, such as a cell- or tissue-targeting reagent (e.g., a lectin, glycoprotein, lipid, or protein (e.g., an antibody that binds to a specific cell, such as a hepatocyte or jejunal cell)). The targeting group may be thyroid stimulating hormone, melanocyte stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent trehalose, glycosylated polyamino acids, polyvalent galactose, transferrin, diphosphonate esters, polyglutamate esters, polyaspartate esters, lipids, cholesterol, steroids, cholic acid, folic acid, vitamin B12, or biotin.

[0117] In some embodiments, the ligand comprises a targeting group.

[0118] In some embodiments, the targeting group can be monovalent, divalent, trivalent, tetravalent, or higher valency. Exemplary targeting groups include compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody analogs with affinity for somatic cell surface molecules.

[0119] In some embodiments, the targeting group is capable of targeting hepatocytes or the liver.

[0120] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand.

[0121] In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives or galactose clusters. In this application, the term "galactose derivative" includes both galactose and galactose derivatives that have affinity (greater than or equal to that of galactose) for the asialoglycoprotein receptor ligand. Galactose derivatives include galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, Nn-butyryl-galactosamine, and N-iso-butyrylgalactosamine. In vivo, the galactose derivative targets the molecule to hepatocytes via the asialoglycoprotein receptor ligand (ASGPr) bound to the hepatocyte surface. The ASGPr ligand binds to the ASGPr to facilitate cell-specific targeting to hepatocytes and facilitate endocytosis of the molecule into the hepatocytes. The galactose cluster can be attached to the 3' or 5' end of the RNAi polynucleotide by methods known in the art.

[0122] In some embodiments, the ligand is conjugated to the sense strand and / or the antisense strand. For example, the ligand can be attached to the 5' and / or 3' end of the sense strand and / or the antisense strand.

[0123] Delivery Vehicle In some embodiments, the delivery vehicle can deliver LPA RNAi agent to cells or tissues.The delivery vehicle is a compound that improves the delivery of LPA RNAi agent to cells or tissues.The delivery vehicle comprises or consists of a polymer such as an amphiphilic polymer, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

[0124] In some embodiments, the LPA RNAi agent can be combined with lipids, nanoparticles, polymers, liposomes, micelles, or other delivery systems available in the art.The LPA RNAi agent can also be chemically conjugated to targeting groups, lipids (including cholesterol and cholesterol derivatives), nanoparticles, polymers, or other delivery systems available in the art.

[0125] This application describes a method for delivering LPA RNAi agents to mammalian liver cells in vivo. In some embodiments, a delivery vehicle may be used. The delivery vehicle may be, but is not limited to, a polymer (e.g., an amphiphilic polymer, a membrane active polymer), a ligand, and the like. In some embodiments, the LPA RNAi agent is linked to a targeting ligand that includes an asialoglycoprotein ligand. For example, the LPA RNAi agent can be linked to a targeting ligand that includes or consists of a galactose cluster.

[0126] As described above, the siRNA conjugate of the present application has the general formula:

[0127] [ka] (I-0), or

[0128] [ka] (II), In general formula (I), X is a nucleotide sequence, which may be the sense strand or antisense strand of siRNA; Z is a first linker portion of a nucleotide sequence; Z and X may be directly linked or linked via a chemical group; the general formula of Z is shown in (Z-1), and one end of the O group is linked to the nucleotide sequence;

[0129] [ka] R1 is O, S, NR3, or CR3R4, and R3 and R4 are each independently hydrogen, halogen, a substituted or unsubstituted aliphatic group, a substituted or unsubstituted aryl group, a substituted or unsubstituted heteroaryl group, a substituted or unsubstituted heterocycle, or a substituted or unsubstituted cycloalkyl group; R2 is -O-, -S-, -NH-, -CH2-, -C(O)-, -OC(O)-, -C(O)O-, -NHC(O)-, -C(O)NH-, -CH2NH-, -CHO-, -NH-C(O)-CH2-, -C(O)-CH2-NH-, or -NH(CO)NH-, wherein the -CH2- may be substituted with a substituent preferably selected from halogen, an alkyl group, an alkoxy group, and an alkylamino group, and a1 and a2 are the same or different and each is an integer selected from 0 to 20, preferably 1 to 10, and more preferably 1 to 5.

[0130] Preferably, the nucleotide sequence represented by X is the first nucleotide sequence described above.

[0131] Preferably, the first linker moiety Z is linked to a second linker moiety L1, which in turn is linked to the branch point group E.

[0132] Preferably, the branch point group E is linked to a targeting complexes, where a is an integer selected from 0 to 10, preferably 1 to 5, and the targeting complexes comprise a 1:1 ratio of tethering moiety L2 to targeting moiety T.

[0133] In general formula (II), L3 comprises a third linker moiety, and L4 is a targeting moiety. Specifically, T in general formula (I) and L3 and L4 in general formula (II) may be the same or different, and preferably, L3 and L4 are respectively of the following structures:

[0134] [ka] X is a nucleotide sequence, which may be the sense strand or the antisense strand; Y is O or S; b, c, d, and e are each an integer selected from 0 to 10, and b and e are not simultaneously 0. In one embodiment, b is 0, and e is an integer selected from 3 to 6.

[0135] In another embodiment of the invention, the second linker moiety L1 has the following structure:

[0136] [ka]

[0137] [ka]

[0138] [ka] or

[0139] [ka] Here, f, g, h and i are each an integer selected from 1 to 20, preferably 1 to 10.

[0140] In one example, the position of L1 in the ligand is shown in the block structure below.

[0141] [ka]

[0142] In another embodiment of the invention, the tethering moiety L2 has the following structural formula:

[0143] [ka]

[0144] [ka]

[0145] [ka] or

[0146] [ka] Here, j, k, l, m, n and o are each an integer selected from 1 to 20, preferably 1 to 10.

[0147] Specifically, the location of L2 in the ligand is shown in the block structure below.

[0148] [ka]

[0149] An LPA RNA interference agent according to another embodiment of the present invention comprises a sense strand, an antisense strand, and the above-mentioned siRNA conjugate.

[0150] Another object of an embodiment of the present invention is to provide a composition comprising said RNA interfering agent.

[0151] The siRNA conjugate according to the embodiment of the present invention can improve the binding efficiency of the target moiety to cells or cell receptors, and improve the RNA interference effect.

[0152] In a preferred embodiment, the general formula of the compound Z in the targeting ligand is shown below in (Z-2):

[0153] [ka]

[0154] Preferably, R2 is -NH-, and then compound Z is

[0155] [ka] and Preferably, R2 is -C(O)-, and then compound Z is

[0156] [ka] It is.

[0157] Preferably, L1 has the following structure:

[0158] [ka]

[0159] [ka]

[0160] [ka] or

[0161] [ka]

[0162] In one embodiment, in the general formula (I), the compound E is one selected from the following five structures:

[0163] [ka]

[0164] In one embodiment, the compound L2 in the general formula (I) is

[0165] [ka]

[0166] [ka]

[0167] [ka] or

[0168] [ka] and Here, j, k, l, m, n, and o are each an integer of 1 to 20, Preferably, L2 has the following structural formula:

[0169] [ka]

[0170] [ka]

[0171] [ka]

[0172] [ka]

[0173] [ka]

[0174] [ka] or

[0175] [ka]

[0176] In a preferred embodiment, the targeting ligand of general formula (I) (not including the X moiety) has the following structure:

[0177] [ka] (II),

[0178] [ka] (I-II),

[0179] [ka] (I-III),

[0180] [ka] (I-IV),

[0181] [ka] (IV),

[0182] [ka] (I-VI),

[0183] [ka] (I-VII), or

[0184] [ka] (I-VIII).

[0185] In one embodiment, T of the targeting ligand is one selected from N-acetyl-galactosamine, galactose, galactosamine, N-formylgalactosamine, N-propionyl-galactosamine, Nn-butanoylgalactosamine and N-isobutyryl-galactosamine, preferably N-acetyl-galactosamine, having the structural formula:

[0186] [ka] It is.

[0187] In a preferred embodiment, the targeting ligand of general formula (I) is linked to the siRNA terminus via a phosphate or thiophosphate group, or a phosphonate group.

[0188] In a preferred embodiment, the targeting ligand has the structure:

[0189] [ka] (I-1), (Gal-5-3)

[0190] [ka] (I-2),

[0191] [ka] (I-3),

[0192] [ka] (I-4),

[0193] [ka] (I-5),

[0194] [ka] (I-6),

[0195] [ka] (I-7),

[0196] [ka] (I-8),

[0197] [ka] (I-9),

[0198] [ka] (I-10),

[0199] [ka] (I-11),

[0200] [ka] (I-12),

[0201] [ka] (I-13),

[0202] [ka] (I-14),

[0203] [ka] (I-15), or

[0204] [ka] (I-16).

[0205] In one embodiment of general formula (II), the targeting ligand HO-L3 is

[0206] [ka] (II-aI),

[0207] [ka] (II-a-II),

[0208] [ka] (II-a-III), or

[0209] [ka] (II-a-III) It is.

[0210] wherein R2 is each independently -O-, -S-, -NH-, -CH2-, -C(O)-, -OC(O)-, -C(O)O-, -NHC(O)-, -C(O)NH-, -CH2NH-, -CHO-, -NH-C(O)-CH2-, -C(O)-CH2-NH-, -NH(CO)NH-, wherein the -CH2- is optionally substituted with a halogen or an alkyl, and the alkyl is preferably optionally substituted with a substituent selected from hydroxyl, an amino group, a halogen, an alkoxy group, and an alkylamino group; The above p, q, r, s, t and u are each independently an integer selected from 0 to 20, preferably 1 to 10.

[0211] In a preferred embodiment, HO-L3 has the following structure:

[0212] [ka] (II-a-1),

[0213] [ka] (II-a-2),

[0214] [ka] (II-a-3),

[0215] [ka] (II-a-4),

[0216] [ka] (II-a-5), or

[0217] [ka] (II-a-6).

[0218] In another preferred embodiment of the general formula (II), the targeting ligand HO-L4 is

[0219] [ka] (II-a-IV),

[0220] [ka] (II-aV),

[0221] [ka] (II-a-VI), or

[0222] [ka] (II-a-VII).

[0223] In a preferred embodiment, HO-L4 has the following structure:

[0224] [ka] (II-a-7),

[0225] [ka] (II-a-8),

[0226] [ka] (II-a-9),

[0227] [ka] (II-a-10),

[0228] [ka] (II-a-11), or

[0229] [ka] (II-a-12).

[0230] In a preferred embodiment, general formula (II) has the following structure:

[0231] [ka] (II-1),

[0232] [ka] (II-2),

[0233] [ka] (II-3),

[0234] [ka] (II-4),

[0235] [ka] (II-5),

[0236] [ka] (II-6),

[0237] [ka] (II-7),

[0238] [ka] (II-8),

[0239] [ka] (II-9),

[0240] [ka] (II-10),

[0241] [ka] (II-11),

[0242] [ka] (II-12),

[0243] [ka] (II-13), or

[0244] [ka] (II-14),

[0245] Here, Y is O or S.

[0246] In another preferred embodiment, the siRNA conjugate has the following structure:

[0247] [ka] (II-15),

[0248] [ka] (II-16),

[0249]

change

[0250]

change

[0251]

change

[0252]

change

[0253]

change

[0254]

change

[0255]

change

[0256]

change

[0257]

change

[0258]

change

[0259] [ka] (II-27), or

[0260] [ka] (II-28),

[0261] Here, Y is O or S.

[0262] On the other hand, any of the above structures attached to the 3' end can be attached to the 5' end of X.

[0263] Pharmaceutical Composition Examples In another aspect, the pharmaceutical composition of the present application comprises an LPA RNAi agent as described above, and preferably a pharma- ceutically acceptable excipient.

[0264] In some embodiments, the LPA RNAi agent can inhibit expression of LPA in a cell, cell group, or tissue in a subject. In some embodiments, the LPA RNAi agent is prepared into a composition, i.e., a pharmaceutical composition or a medicament, to be administered to a subject. For example, the pharmaceutical composition or medicament may include a pharmacologically effective amount of at least one of the LPA RNAi agents and one or more pharma- ceutical acceptable excipients. A pharma-ceutical acceptable excipient (excipient) is a substance other than an active pharmaceutical ingredient (API, therapeutic product such as LPA RNAi agent) that has been appropriately evaluated for safety and is intentionally included in a pharmaceutical delivery system. An excipient does not exert a therapeutic effect at a given dosage, or is not intended to exert a therapeutic effect. An excipient a) aids in the processing of the pharmaceutical delivery system during manufacture, b) protects, supports, or enhances the stability, bioavailability, or patient acceptability of the API, c) aids in product identification, and / or d) enhances any other attribute, such as safety and efficacy of the overall delivery of the API during storage or use. A pharma- ceutically acceptable excipient may or may not be an inert substance.

[0265] Excipients include absorption enhancers, anti-adherents, antifoaming agents, antioxidants, adhesives, adhesives, buffers, carriers, coatings, pigments, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, flow aids, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, isotonicity agents, vehicles, hydrophobic agents, and wetting agents.

[0266] The pharmaceutical composition may contain other additional ingredients that are normally found in pharmaceutical compositions. Such additional ingredients include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or contain the RNAi agent defined herein can be used as a "pharmaceutical composition."

[0267] In some embodiments, the LPA RNAi agent is combined with one or more additional therapeutic agents or treatments, including but not limited to small molecule drugs, antibodies, antibody fragments, and / or vaccines.The pharmaceutical composition comprising the RNAi agent and the LPA RNAi agent disclosed herein can be packaged or included in a kit, container, package, or dispenser.The pharmaceutical composition comprising the LPA RNAi agent and the LPA RNAi agent can be packaged in a pre-filled syringe or vial.

[0268] The pharmaceutical composition of the present application can inhibit expression of the LPA gene in cells, tissues, or living organisms. In some embodiments, the pharmaceutical composition treats a subject suffering from a disease, disorder, or condition that would benefit from a reduction or inhibition of LPA expression. In some embodiments, the pharmaceutical composition treats a subject at risk of developing a disease, disorder, or condition that would benefit from a reduction or inhibition of LPA expression. Diseases, disorders, or conditions that would benefit from a reduction or inhibition of LPA expression include, but are not limited to, Buerger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable angina / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. In some embodiments, the subject is a mammal, including, but not limited to, a human.

[0269] Contemplated herein are cells, tissues and non-human organisms that contain at least one LPA RNAi agent as described herein. The cells, tissues or non-human organisms are prepared by delivering the LPA RNAi agent to the cells, tissues or non-human organisms by any method available in the art. In some embodiments, the cells are mammalian cells, including but not limited to human cells. The cells, tissues or non-human organisms can be used for research or research tools (e.g., pharmaceutical testing or diagnosis).

[0270] use In another aspect, the present application relates to the use of said LPA RNAi agent or said pharmaceutical composition in the preparation of a medicament, said medicament preventing and / or treating a disease or condition or reducing the risk of a disease or condition.

[0271] In some embodiments, the disease or condition includes a disease or condition associated with elevated levels of Lp(a)-containing particles. As used herein, the term "Lp(a)" generally includes apo(a)- and apoB-containing LDL-like particles. Apo(a) is linked to apoB via a disulfide bond.

[0272] In some embodiments, the disease or condition comprises liver disease.

[0273] In some embodiments, the disease or condition comprises inflammation, a cardiovascular disease, or a metabolic disease.

[0274] As used herein, the term "metabolic disease or condition" refers to a condition that is generally characterized by an alteration or disturbance in metabolic function. "Metabolic" and "metabolism" are terms well known in the art and generally include the full range of biochemical processes that occur in living organisms. Metabolic conditions include, but are not limited to, hyperglycemia, pre-diabetes, diabetes (types 1 and 2), obesity, insulin resistance, metabolic syndrome, and dyslipidemia resulting from type 2 diabetes.

[0275] As used herein, the term "inflammatory disease or condition" refers to a disease, disease state, syndrome, or other condition that causes inflammation. For example, rheumatoid arthritis and liver fibrosis are inflammatory conditions. Other examples of inflammatory conditions include sepsis, myocardial ischemia / reperfusion injury, adult respiratory distress syndrome, nephritis, transplant rejection, inflammatory bowel disease, multiple sclerosis, arteriosclerosis, atherosclerosis, and vasculitis.

[0276] As used herein, the term "symptoms of a cardiovascular disease or condition" refers to phenomena that are usually caused by, associated with, and indicative of a cardiovascular disease or condition.

[0277] In another aspect, the method of preventing or treating a disease and / or condition according to the present application comprises administering to a target subject an effective amount of the LPA RNAi agent and / or the pharmaceutical composition.

[0278] In some embodiments, the LPA RNAi agents described herein treat a disease or condition that would benefit from a decrease in LPA expression. Examples of such diseases or conditions include, but are not limited to, Buerger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobacteremia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. In some embodiments, the method comprises administering a composition, such as a pharmaceutical composition, containing the LPA RNAi agents described herein to a subject mammal.

[0279] In some embodiments, a therapeutically effective amount of one or more of the above LPA RNAi agents is administered to a subject to inhibit expression of LPA in the subject (e.g., effectively inhibiting the amount of LPA expressed in the subject).

[0280] In some embodiments, the method further comprises administering a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another LPA RNAi agent (e.g., an LPA RNAi agent that targets a different sequence within the LPA target). In other embodiments, the second therapeutic agent may be selected from a small molecule drug, an antibody, an antibody fragment, and a vaccine.

[0281] The route of administration is the route by which the RNAi agent is brought into contact with the body. In general, the administration methods of pharmaceuticals and nucleic acids for treating subjects are well known in the art and are applicable to the administration of the compositions described herein. The compounds described herein are administered via any suitable route, in a formulation that is appropriately customized for a particular route. Thus, the compounds described herein are administered by injection, such as intravenous injection, intramuscular injection, intradermal injection, subcutaneous injection or intraperitoneal injection.

[0282] In some embodiments, the LPA RNAi agent or composition described herein can be delivered to a cell, a group of cells, a tissue, or a subject using oligonucleotide delivery techniques known in the art. Generally, any suitable method for delivering a nucleic acid molecule (ex vivo or in vivo) known in the art is applicable to the LPA RNAi agent described herein. For example, delivery is by local administration (e.g., direct injection, implantation, or topical administering), systemic administration, or by subcutaneous, intravenous, oral, intraperitoneal, or parenteral routes, intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), intranasal, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the composition is administered by subcutaneous or intravenous infusion or injection.

[0283] In some embodiments, LPA RNAi agent can be combined with lipid, nanoparticle, polymer, liposome, micelle or other delivery system available in the art.RNAi agent can also be chemically conjugated to targeting group, lipid (including but not limited to cholesterol and cholesterol derivatives), nanoparticle, polymer, liposome, micelle or other delivery system available in the art.LPA RNAi agent can be conjugated to delivery polymer.In some embodiments, delivery polymer is reversibly masked / modified amphiphilic membrane active polyamine.

[0284] Inhibition of expression In another aspect, the method of the present application for reducing expression of LPA mRNA or protein in a cell or tissue comprises contacting the cell or tissue with an effective amount of the aforementioned LPA RNAi agent or the aforementioned pharmaceutical composition.

[0285] In some embodiments, the cell is a hepatocyte, hi some embodiments, the tissue is liver tissue.

[0286] In some embodiments, the cells and tissues are outside the body, hi other embodiments, the cells and tissues are inside the body.

[0287] In another aspect, the present application provides a method for reducing expression of LPA mRNA or protein in a subject, comprising administering to the subject an effective amount of the LPA RNAi agent described above or the pharmaceutical composition described above.

[0288] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knocking down gene expression," when referring to the LPA gene, mean that when a cell, group of cells, or tissue is treated with an LPA RNAi agent as described above, expression of the gene (e.g., as measured by levels of RNA transcribed from the gene or levels of polypeptide, protein, or protein subunit translated from the mRNA in a cell, group of cells, or tissue in which the LPA gene is transcribed) is decreased compared to the same cell, group of cells, or tissue prior to administration of the LPA RNAi agent.

[0289] In some embodiments, the gene expression level and / or mRNA level of LPA in the body of the subject to which the LPA RNAi agent is administered is reduced by at least about 5% or more, for example 5% to 98%, compared to the subject before the LPA RNAi agent is administered or the subject to which the LPA RNAi agent is not administered. The gene expression level and / or mRNA level in the body of the subject can be reduced in the cells, cell groups, and / or tissues of the subject. In some embodiments, the protein level of LPA in the body of the subject to which the LPA RNAi agent is administered is reduced by 5% or more, for example 5% to 98%, compared to the subject before the LPA RNAi agent is administered or the subject to which the LPA RNAi agent is not administered. The protein level in the body of the subject can be reduced in the cells, cell groups, tissues, blood, and / or other fluids of the subject. The reduction in gene expression, mRNA level, or protein level is assessed by any method known in the art. A decrease or reduction in LPA mRNA levels and / or protein levels is collectively referred to herein as a decrease or reduction in LPA, or an inhibition or reduction in the expression of LPA.

[0290] When referring to an LPA RNAi agent, introduction into a cell means functionally delivering the LPA RNAi agent to the cell. Functional delivery means that the RNAi agent is delivered to the cell and has the desired biological activity (e.g., sequence-specific inhibition of gene expression).

[0291] The present invention will now be further described with reference to specific examples.

[0292] Example 1 Synthesis of compound GENO-Gal-6

[0293] (1) Synthesis Route

[0294] [ka]

[0295] [ka]

[0296] [ka]

[0297] [ka]

[0298] (2) Specific synthesis process 1) Preparation of compound Int-11-2

[0299] [ka]

[0300] Int-11-1 (10 g) was dissolved in (140 mL) DCM (dichloromethane) and cooled to 0 ° C., and TMSCN (trimethylsilyl cyanide, trimethylsilyl cyanide (TMSCN)) (4.01 g) and BF3Et2O (2.83 mL) were added dropwise and reacted for 10 min. (Hexane: EtOAc = 5: 1, KMnO4 color development, raw material Rf = 0.3, α configuration Rf = 0.28, β configuration Rf = 0.27 used) The reaction was monitored on a TLC plate until the reaction of the raw material was completed. After the reaction was completed, 100mL of saturated NaHCO3 aqueous solution was added to the reaction solution, 100mL of DCM was added to separate the organic phase, the organic phase was washed once with saturated saline, the organic phase was concentrated, and then dissolved in EtOAc (200mL), washed once with NaHCO3 aqueous solution (100mL), washed once with saturated saline, the organic phase was dried over anhydrous sodium sulfate and concentrated. Then, it was purified with a normal phase silica gel column, and the polarity was gradually increased, and when Hexane / EtOAc = 20%, α configuration was shown, and when it was 25%, β configuration was shown, and a white solid (5.3g) was obtained in the α configuration, and a colorless oil (3.7g) was obtained in the β configuration. 1H NMR(400MHz,DMSO)δ6.03~6.06(dt,1H),5.91~5.94(dt,1H),5.35(dq,1H),5 .12(m,1H),4.30(dd,1H),4.30(dd,1H),3.82(ddd,1H),2.10~2.12(2s,6H).

[0301] 2) Preparation of compound Int-11-3

[0302] [ka]

[0303] Aqueous HCl (1M, 17.2mL) was added to a suspension of Int-11-2 (3.7g, β-configuration, colorless oil) and 10% Pd / C (377mg), and a mixture of ethyl acetate / 2-propanol / ethanol (2:1:1, total 90mL) was added and the reaction was stirred under hydrogen (40Psi) for 48 hours. The reaction was monitored by TLC, filtered through diatomaceous earth to remove the catalyst, and the solvent was concentrated under reduced pressure. The obtained crude product was washed twice with toluene, dissolved in 10mL of methanol, added with 28% NH3H2O ​​(30mL), stirred at room temperature for 16 hours, concentrated the reaction solution, and washed three times with a 1:1 toluene-acetonitrile mixture (50mL). 1g of the above crude product was dissolved in H2O (40mL) and cooled to 0°C, NaHCO3 (1.4g) and Na2CO3 (0.88g) were added, FmocOSu (2.13g) was dissolved in dioxane (40mL) solvent, and then added dropwise to the above aqueous solution and reacted at room temperature for 1 hour. The reaction (DCM:MeOH=10:1, 254nm, Rf=0.5) was monitored by TLC, purified on a normal phase column, and the product was generated by MeOH / DCM=5% to obtain a colorless solid of Int-11-3 (340mg). 1H NMR(CDCl3):δ7.76-7.78(d,2H),7.58-7.60(d,2H),7.39-7.42(t,2H),7.30-7.34(t,2H),5.12(t,1H),4.42-4.52(m ,2H),4.22(t,1H),3.84(br.s,2H).3.47-3.57(m,3H),3.11-3.24(m,2H),1.30-1.56,1.67-1.72,2.05-2.22(m,4H).

[0304] 3) Preparation of compound Int-11-4

[0305] [ka]

[0306] Int-11-3 (340 mg) was dissolved in 2 ml of pyridine and cooled to 0 ° C. DMTrCl (450 mg) was dissolved in 2 ml of pyridine, and then added dropwise to the solution, and the reaction was monitored by TLC until the reaction of the raw material was completed. The reaction was quenched by adding 5 ml of aqueous solution, and the product was purified by reverse phase column C18 and purified by MeCN / H2O = 80% to obtain int-11-4 (290 mg).

[0307] 4) Preparation of compound GENO-Int-11

[0308] [ka]

[0309] Int-11-4 (700 mg, 1.02 mmol) was dissolved in 2 mL of dichloromethane, then DBU (310 mg, 2.04 mmol) was added to the above solution, and the reaction was monitored by TLC until the reaction of the raw material was completed. The reaction was quenched by adding 5 ml of saturated Na2CO3 solution, extracted with 20 mL of dichloromethane, and the organic phase was concentrated with DCM:MeOH=10:1 (254 nm, Rf=0.5). The product was purified by normal phase column and purified by MeOH / DCM=5% to obtain GENO-Int-11 (550 mg) yellow solid.

[0310] 5) Preparation of compound Int-6-1

[0311] [ka]

[0312] Gal-3-5B (1.45g, 3.24mmol) was dissolved in anhydrous DMF (10mL) solvent, then HATU (1.64g, 4.32mmol), 3A molecular sieves (1g) and DIEA (1.07mL, 6.47mmol) were added, and the reaction solution was stirred at room temperature for 30min, after which GENO-int-11 (1g, 2.16mmol) was dissolved in DMF (10mL) and added to the reaction solution, and the reaction solution was stirred overnight at room temperature under argon protection. The reaction solution was filtered and purified with reverse phase column C18, and the product was purified with MeCN / H2O=60% to obtain Int-6-1 (1.8g). 1 H NMR:(400MHz,DMSO-d6)δ7.80(d,J=9.2Hz,1H),7.71-7.73(m,1H),7.39-7.41(m,2H),7.24-7.30(m,6H),7 .18-7.21(m,2H),6.87(d,J=8.8Hz,4H),5.21(d,J=3.6Hz,1H),4.95-4.98(m,1H),4.59(d,J=6.4Hz,1H),4 .47(d,J=8.4Hz,1H),4.00-4.05(m,2H),3.83-3.90(m,1H),3.64-3.73(m,7H),3.23-3.38(m,8H),2.97-3. 14(m,3H),2.04-2.14(m,5H),1.98(s,3H),1.89(s,3H),1.77(s,3H),1.64-4.66(m,1H)1.42-1.50(m,4H).

[0313] 5) Preparation of compound Geno-Gal-6

[0314] [ka]

[0315] Int-6-1 (2.1g, 2.35mmol) was dissolved in DCM (30mL), tetrazole (33mg, 0.47mmol), NMI (77.2mg, 0.94mmol) and 2g of molecular sieves were added, the reaction solution was replaced with argon three times, and stirred at room temperature for 20min. After that, phosphorus reagent (920.81mg, 3.06mmol) was dissolved in a small amount of dichloromethane and added to the reaction solution, and stirred at room temperature for 1h. The reaction solution was washed twice with saturated NaHCO3 aqueous solution, once with water, once with saline, concentrated at room temperature, purified with reverse phase column C18, and the product was purified with MeCN / H2O=65% to obtain GENO-Gal-6 (1.5g). 1 H NMR:(400MHz,CD3CN)δ7.48-7.50(m,2H),7.20-7.36(m,7H),6.83-6.87(m,4H),6.45-6.51(m, 1H),5.28(d,J=3.2Hz,1H),4.98-5.02(m,1H),4.49(d,J=8.4Hz,1H),3.90-4.12(m,4H),3.24- 3.76(m,20H),3.02-3.11(m,1H),2.49-2.59(m,1H),2.36-2.39(m,1H),2.08-2.25(m,9H),1.9 7(s,3H),1.91(s,3H),1.83(s,3H),1.71-1.74(m,1H),1.46-1.63(m,5H),0.85-1.39(m,20H).

[0316] 6) Preparation of compound Gal-5-1

[0317] [ka]

[0318] 1,12-Benzyloxycarbonylundecanoic acid (387 mg, 1.2 mmol) was dissolved in anhydrous DMF (N,N-Dimethylformamide) (10 mL) solvent, then HBTU (O-Benzotriazole-N,N,N',N'-tetramethyl-uronium-hexafluorophosphate) (546 mg, 1.44 mmol), DIEA (N,N-Diisopropylethylamine) (0.65 mL, 3.6 mmol), HOBT (1-Hydroxybenzotriazole) (324 mg, 2.4 mmol) and GENO-Int-11 (560 mg, 1.2 mmol) were added, and the mixture was stirred overnight at room temperature under argon protection. The reaction solution was purified with a reversed phase column C18, and the product was purified with MeCN / H2O = 70% to obtain Gal-5-1 (200 mg). 1 H NMR(400MHz,DMSO)δ7.68(t,1H),7.49-7.12(m,14H),6.86(d,4H),5.07(s,2H),4.58(d,1H),3.73(s,6H),3.38(dd,1H),3.28-3.16 (m,3H),3.22-2.85(m,3H),2.41-2.25(m,2H),2.11-2.00(m,2H),1.92(dd,1H),1.64(d,1H),1.57-1.41(m,4H),1.27-1.06(m,14H).

[0319] 7) Preparation of compound Gal-5-2

[0320] [ka]

[0321] Gal-5-1 (200 mg, 0.26 mmol) was dissolved in 5 mL of ethyl acetate, 50 mg of palladium on carbon and triethylamine (0.11 mL, 0.78 mmol) were added, and the reaction was stirred under hydrogen (15 psi) at room temperature for 16 h. The reaction was filtered and concentrated to give Gal-5-2 (150 mg).

[0322] 8) Preparation of compound Gal-5-3

[0323] [ka]

[0324] Gal-5-2 (corresponding to formula I-1) (150 mg, 0.22 mmol) was dissolved in 5 mL of anhydrous DMF, and HBTU (101 mg, 0.27 mmol), DIEA (0.16 mL), 3A molecular sieves (1 g) and Gal-3-4C (441 mg, 0.22 mmol) were added to the solution. The mixture was then stirred at room temperature for 16 hours, and the reaction solution was purified on a reversed-phase column C18 and the product was produced by MeCN / H2O=60% to obtain Gal-5-3 (380 mg). 1 H NMR(400MHz,DMSO)δ7.91-7.67(m,10H),7.42(d,2H),7.34-7.24(m,6H),7.20(d,1H),6.99(s,1H),6 .87(d,4H),5.21(d,3H),4.97(dd,3H),4.60(s,1H),4.48(d,3H),4.09-3.95(m,10H),3.93-3.82(m, 3H),3.77-3.66(m,9H),3.61-3.48(m,12H),3.45-3.20(m,16H),3.09-2.95(m,15H),2.27(t,6H),2. 10(s,9H),2.05(dd,10H),1.99(s,9H),1.89(s,9H),1.76(d,9H),1.63-1.38(m,24H),1.16(s,14H).

[0325] 9) Preparation of compound Gal-5-4

[0326] [ka]

[0327] Gal-5-3 (370 mg, 0.15 mmol), succinic anhydride (75 mg, 0.76 mmol), 3A molecular sieves (0.5 g) and DMAP (4-Dimethylaminopyridine) (46 mg, 0.38 mmol) were dissolved in 5 mL of THF (Tetrahydrofuran), and the reaction solution was stirred at 40°C overnight. The reaction solution was purified on a reversed-phase column C18 and the product was purified with MeCN / H2O = 40% to obtain Gal-5-4 (220 mg).

[0328] 10) Synthesis of the aminogalactose compound GENO-Gal-5 linked to a solid-phase vector

[0329] [ka]

[0330] Gal-5-4 (220 mg, 0.086 mmol) was suspended in 4 mL of CH3CN and 2 mL of DMF, and DIEA (0.035 mL, 0.216 mmol) and HBTU (49.07 mg, 0.129 mmol) were added dropwise. The mixture was stirred at room temperature for 5 minutes, and aminomethyl resin (99.51 mg, 100-200 mesh, amino loading amount 250 umol / g) was added to the reaction solution. The reaction was carried out at 25°C in a shaker at a rotation speed of 220 rpm. After reacting for 16 h, the mixture was filtered, rinsed with DCM 3 times at 30 ml each time, rinsed with acetonitrile 3 times at 30 ml each time, rinsed with n-hexane 3 times at 30 ml each time, dried with a vacuum oil pump for 2 h, and then capped by adding a mixed reagent (CapB1, 4-dimethylaminopyridine, N-methylimidazole, acetonitrile, 11.2 mL / 12.4 mg / 0.50 mL / 4.32 mL). Placed on a shaker at 25 ° C, rotated at 220 rpm, reacted for 16 h, filtered the reaction solution, rinsed the filter cake with acetonitrile 3 times at 30 ml each time, filtered by suction until dry, dried overnight under reduced pressure with a vacuum oil pump, and obtained 160 mg of the target product GNEO-Gal-5 compound.

[0331] Example 2 Synthesis of siRNA Unmodified siRNA was provided by Wuxi AppTech (see Table 1 for sequence). The synthesis process of modified siRNA (see Tables 2 and 3) is briefly described as follows. Starting from Universal CPG vector, nucleoside phosphoramidite monomers were linked in sequence according to the synthesis procedure on Dr.Oligo 48 synthesizer (Biolytic). Nucleoside phosphoramidite monomer raw materials such as 2'-F RNA, 2'-O-methyl RNA were purchased from Wuhu Huanren and Shanghai Zhaowei. 5-Ethylthio-1H-tetrazole (ETT) was used as an activator (0.6 M acetonitrile solution), 0.22 M PADS was dissolved in a mixed solvent of acetonitrile and trimethylpyridine (Shanghai Lingjiang) with a volume ratio of 1:1, and the resulting solution was used as the sulfurization reagent and iodopyridine / water solution (Shanghai Lingjiang) as the oxidizing agent.

[0332] In oligonucleotides, the nucleotide monomers are linked to each other by 5'-3'-phosphodiester bonds, including phosphorothioate and phosphodiester bonds.

[0333] After the solid-phase synthesis was completed, the oligoribonucleotide was decomposed from the solid support and soaked in a 3:1 solution of 28% aqueous ammonia and ethanol at 50°C for 15 hours. It was then centrifuged, the supernatant was transferred to another centrifuge tube, concentrated and evaporated to dryness, and purified by C18 reverse phase chromatography, with a mobile phase of 0.1M TEAA and acetonitrile, and a 3% trifluoroacetic acid solution was used to remove DMTr. The target oligonucleotide was collected, lyophilized, and identified as the target product by LC-MS and quantified by UV (260 nm).

[0334] The obtained single-stranded oligonucleotides are complementarily paired in an equimolar ratio and annealed, and the resulting double-stranded siRNA is dissolved in 1x PBS or sterile water and adjusted to the concentration required for the experiment before use.

[0335] In the sequences of Tables 1, 2 and 3, each symbol represents the following modified nucleotide (ester), respectively.

[0336] A = adenosine 3'-phosphate C=Cytidine-3'-phosphate G = guanyl-3'-phosphate U = Uridyl-3'-phosphate Am = 2'-O-methyladenosine-3'-phosphate Ams = 2'-O-methyl adenosine-3'-thiophosphate Cm = 2'-O-methylcytidine-3'-phosphate Cms = 2'-O-methylcytidine-3'-thiophosphate Gm = 2'-O-methylguanyl-3'-phosphate Gms = 2'-O-methylguanyl-3'-thiophosphate Um = 2'-O-methyluridyl-3'-phosphate ester Ums = 2'-O-methyluridyl-3'-thiophosphate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-thiophosphate Cf = 2'-fluorocytidine-3'-phosphate ester Cfs = 2'-fluorocytidine-3'-thiophosphate Gf = 2'-fluoroguanyl-3'-phosphate Gfs = 2'-fluoroguanyl-3'-thiophosphate Uf = 2'-fluorouridyl-3'-phosphate ester Ufs = 2'-fluorouridyl-3'-thiophosphate A lowercase m indicates that the one nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide, and a lowercase f indicates that the one nucleotide adjacent to the left of the letter f is a fluoro-modified nucleotide; When a lowercase letter s is in the center of an uppercase letter, it indicates that the two adjacent nucleotides on either side of the letter s are linked by a phosphorothioate group; When the lowercase letter s is at the first position of the 3' terminus, it indicates that the adjacent nucleotide terminus to the left of the letter s is a thiophosphate group;

[0337] Table 1 [Table 1] JPEG2024534508000128.jpg202170

[0338] Table 2 [Table 2] JPEG2024534508000130.jpg255159JPEG2024534508000131.jpg255160JPEG2024534508000132.jpg255163JPEG2024534508000133.jpg19170

[0339] Table 3 [Table 3] JPEG2024534508000135.jpg203170

[0340] The unmodified sequence of Geno-1-1002M is AUAACUCUGUCCAUUACCG (SEQ ID No. 184), and the unmodified sequence of the corresponding sense strand is CGGUAAUGGACAGAGUUAU (SEQ ID No. 188). The unmodified sequence of Geno-1-1003M is UCGUAUAACAAUAAGGGGCUG (SEQ ID No. 185), and the unmodified sequence of the corresponding sense strand is CAGCCCCUUAUUGUUAUACGA (SEQ ID No. 189). The unmodified sequence of Geno-1-1004M is AUAACUCUGUCCAUUACCG (SEQ ID No. 186), and the unmodified sequence of the corresponding sense strand is CGGUAAUGGACAGAGUUAU (SEQ ID No. 189).

[0341] [Gal-5] Structural formula:

[0342] [ka]

[0343] Gal-6 is an abbreviation for Geno-Gal-6, the target product prepared in step 5) of Example 1;

[0344] [Gal-6]s[Gal-6]s[Gal-6] Structural formula:

[0345] [ka]

[0346] [ST23sST23sST23sC6XLT]Structural formula:

[0347] [ka]

[0348] Example 3 In Vitro Experiments with LPA RNAi Agents We synthesized 91 computationally determined potential LPA RNAi agents (Table 1) and screened their in vitro effects.

[0349] For screening, the human LPA cDNA sequence (accession number NM_005577.1) or a fragment thereof was subcloned from a commercially available mammalian expression vector (Origene) into a commercially available reporter-based screening plasmid, psiCHECK2 (Promega), to generate Renilla luciferase / LPA fusion mRNA. To examine the effect of LPA RNAi agents in humans, Huh7 cells (a human hepatocellular carcinoma line) were plated in a 96-well format at approximately 10,000 cells / well. Each LPA RNAi agent was co-transfected at two concentrations (1 nM and 0.1 nM) with 25 ng of psiCHECK2-LPA plasmid DNA per well and 0.2 μL of LipoFectamine 2000 per well. Gene knockdown was determined by measuring the levels of Renilla luciferase normalized to the levels of constitutively expressed firefly luciferase also present in the psiCHECK2 plasmid using a dual luciferase reporter assay (Promega) (Table 4).

[0350] As shown in Table 4, 66 of the 91 sequences show a knockdown efficiency of greater than 60% at 1 nM, and 61 sequences show a knockdown efficiency of greater than 50% at 0.1 nM.

[0351] Table 4 [Table 4] JPEG2024534508000140.jpg255147

[0352] Example 4 EC50 Determination of LPA RNAi Agents Seven EC50 curves were generated using the same cells and transfection conditions as in Example 3, with LPA RNAi agent concentrations ranging from 0.1 fM-10 M. EC50 values ​​were determined using a dose-response curve fitted with "Sigmoidal dose response (variable slope)" in GraphPad Prism (Table 5).

[0353] As shown in Table 5, the EC50 of the measured compounds ranges from 1 pM to 60 pM.

[0354] Table 5 [Table 5]

[0355] Example 5 Analysis of in vitro results of modified LPA RNAi agents After modification of the sequences obtained from the initial screen, each LPA RNAi agent was co-transfected at a concentration of 1 nM with 25 ng psiCHECK2-LPA plasmid DNA per well and 0.2 μL LipoFectamine 2000 per well using the same cells and transfection conditions as in Example 3. Gene knockdown was determined by measuring the levels of Renilla luciferase normalized to the levels of constitutively expressed firefly luciferase also present in the psiCHECK2 plasmid using a dual luciferase reporter assay (Promega, Madison, WI) (Table 6).

[0356] As shown in Table 6, 41 of the 71 sequences show knockdown efficiency greater than 60%.

[0357] Table 6 [Table 6] JPEG2024534508000143.jpg164170

[0358] Example 6 Screening of unconjugated LPA RNAi agents by inhibition of LPA mRNA expression in human RT-4 cells Each LPA RNAi agent was incubated with 0.4 μL of RNAiMax (Invitrogen) per well at a concentration of 50 nM. RT-4 cells (human bladder transitional cell papilloma cell line) were plated in a 24-well plate format at approximately 70,000 cells / well and inoculated with the cultured transfection complexes. After 24 hours post-transfection, total RNA was extracted using RNeasy 96 kit (Qiagen). cDNA was synthesized using Vazyme Biotech cDNA reverse transcription kit and qPCR kit, and the expression of housekeeping transcript GAPDH mRNA in the corresponding samples was detected by real-time PCR, and LPA mRNA levels were measured by qRT-PCR (Table 7).

[0359] Table 7 [Table 7]

[0360] Example 7 Distribution ratio of conjugated LPA RNAi agents in the liver and kidney of wild-type mice after subcutaneous administration Thirty C57BL6 / J mice were divided into 10 groups, and the designated 5 groups of LPA RNAi agents were subcutaneously injected into the mice in each group on day 1 at a dose of 10 mg / kg. For the mice in 5 groups, tissues were collected 1 hour after administration, and for the mice in the other 5 groups, tissues were collected 24 hours after administration. The collected tissue samples were flash frozen and transferred to -80°C for storage. After homogenizing the tissues, the concentrations of the corresponding LPA RNAi agents in the liver tissue homogenates and kidney tissue homogenates were measured by hybridization fluorescent probe-enzyme-linked immunosorbent assay, and the liver to kidney ratio was calculated and evaluated by dividing the concentration in the liver tissue homogenates by the concentration in the kidney tissue homogenates. The results are shown in Table 8.

[0361] FIG. 2 shows the ratio of compound concentration in liver to compound concentration in kidney of wild-type mice after SC administration of 10 mg / kg LPA RNAi agent. The results show that the concentrations in the target organ liver of Geno-1-105M~Geno-1-108M are all much greater than the concentrations in the non-target organ kidney at different time points, and the ratio of drug concentration in liver to drug concentration in kidney is much greater than 1. And the concentrations in the non-target organ kidney of Geno-1-1004M are all greater than those in liver at two test time points, and the ratio of drug concentration in liver to drug concentration in kidney is less than 1.

[0362] Table 8 [Table 8]

[0363] Example 8 In vivo detection of the effect of LPA RNAi agents in C57 transient transgenic mice Two weeks prior to administration of the LPA RNAi agent, wild-type mice (male, C57BL / 6) were injected with a plasmid (the plasmid contains a human LPA gene target sequence clone) containing the SEAP gene expressed under the control of mouse albumin promoter by high pressure tail vein injection, and these mice are called SEAP-LPA-HDI mice. On day 0, SEAP-LPA-HDI mice were subcutaneously injected with 1 mg / Kg or 3 mg / Kg of LPA RNAi Geno-1-1001M or Geno-1-1002M solution, with an administration volume of 5 ml / Kg, and control group mice were administered with an equal volume of phosphate buffer solution (PBS). Mouse serum was collected on day 14 (Day-14) before administration, on the day of administration (Day0), and on days 7, 14, 21, 28, and 35 after administration (only serum of mice in the Geno-1-1001M group was collected on days 21 to 35).

[0364] LPA expression knockdown status was assessed by detecting SEAP protein levels in mouse serum using the chemiluminescence reporting system Phospha-Light® (Life Technologies). For normalization, the SEAP level of each animal at a given time point was divided by the pretreatment level in that animal to determine the ratio of expression "normalized to pretreatment", and then the expression at a particular time point was normalized to the control group by dividing the "normalized to pretreatment" ratio of each animal by the average "normalized to pretreatment" ratio of all mice in the control group. This normalizes the expression at each time point to the expression in the control group.

[0365] FIG. 3 shows the detection results of this example.

[0366] Conjugated LPA RNAi agents were administered to SEAP-LPA-HDI mice as described above. Each mouse was injected subcutaneously (SC) with a single dose of 1 mg / kg or 3 mg / kg of LPA RNAi agent Geno-1-1001M or Geno-1-1002M solution, and serum SEAP protein levels were monitored for 35 days. Knockdown levels and duration of response are shown in Table 9. After administration of 1 mg / kg and 3 mg / kg of LPA RNAi agent Geno-1-1002M, a maximum knockdown of SEAP protein levels of ≧57% and ≧67% was observed on day 7, and on day 14 after administration, SEAP protein levels returned to control levels, indicating no knockdown effect. After administration of 1 mg / kg and 3 mg / kg of LPA RNAi agent Geno-1-1001M, a maximum knockdown of ≧87% and ≧57% of SEAP protein level was observed on day 7, and after administration of 3 mg / kg of LPA RNAi agent Geno-1-1001M, a knockdown of ≧72% of SEAP protein level was observed by day 35. Compared with LPA RNAi agent Geno-1-1002M at the same dose, LPA RNAi agent Geno-1-1001M has obviously superior knockdown effect and knockdown duration on SEAP protein level.

[0367] Table 9 [Table 9]

[0368] Example 9 In vivo detection of the effect of LPA RNAi agents in NOD SCID transient transgenic mice On the 10th day before administration of the LPA RNAi agent, NOD SCID mice (male) were injected with minicircle DNA (MC hLPA) containing human LPA gene target sequence clone by high pressure tail vein injection, and these mice are called MC hLPA HDI mice. On day 0, these mice were subcutaneously injected with 0.3mg / Kg, 1mg / Kg, 3mg / Kg or 9mg / Kg of LPA RNAi agent (Geno-1-107M, Geno-1-1003M and Geno-1-1004M) solution, with an administration volume of 5ml / Kg, and control group mice were administered with an equal volume of phosphate buffer solution (PBS). Serum of the mice was collected on the 3rd day (Day-3) before administration, on the day of administration (Day0), and on the 4th, 7th, 14th, 21st, 28th and 35th days after administration.

[0369] Knockdown of LPA expression was assessed by detecting Apo(a) protein levels in mouse serum using an ELISA method (Apo(a), Abcam). For normalization, the Apo(a) level of each animal at a given time point was divided by the pretreatment level in that animal (Day 0) to determine the ratio of expression "normalized to pretreatment", and then the expression at a particular time point was normalized to the control group by dividing the "normalized to pretreatment" ratio of each animal by the average "normalized to pretreatment" ratio of all mice in the control group. Thus, the expression at each time point is normalized to the expression of the control group.

[0370] FIG. 4 shows the detection results of this example.

[0371] Conjugated LPA RNAi agents were administered to MC hLPA HDI mice as described above. Each mouse was injected subcutaneously (SC) with a single dose of 0.3 mg / Kg, 1 mg / Kg, 3 mg / Kg, or 9 mg / Kg of LPA RNAi agent (Geno-1-107M, Geno-1-1003M, and Geno-1-1004M) solution, and serum Apo(a) protein levels were monitored for 35 days. Knockdown levels and duration of response are shown in Table 10. Maximum knockdown of Apo(a) protein levels was observed on day 7 after administration of 0.3 mg / Kg, 1 mg / Kg, or 3 mg / Kg of LPA RNAi agent (Geno-1-1004M) solution, reaching 33%, 58%, and 79%, respectively. After administration, knockdown of Apo(a) protein levels by 0.3mg / Kg, 1mg / Kg or 3mg / Kg of LPA RNAi agent (Geno-1-1004M) reached 20%, 42% and 45%, respectively, on day 28. After administration of 3mg / Kg of LPA RNAi agent (Geno-1-1004M), knockdown of Apo(a) protein levels of ≧20% was observed by day 35. After administration of 1mg / Kg or 3mg / Kg of LPA RNAi agent (Geno-1-1003M) solution, maximum knockdown of Apo(a) protein levels was observed on day 7, reaching 79% and 92%, respectively. After administration, knockdown of Apo(a) protein levels by 1 mg / Kg or 3 mg / Kg of LPA RNAi agent (Geno-1-1003M) reached 52% and 90%, respectively, on day 28. After administration of 3 mg / Kg of LPA RNAi agent (Geno-1-1003M), knockdown of Apo(a) protein levels of ≧83% was shown by day 35. After administration of 0.3 mg / Kg, 1 mg / Kg, 3 mg / Kg or 9 mg / Kg of LPA RNAi agent (Geno-1-107M) solution, maximum knockdown of Apo(a) protein levels was shown on day 7, reaching 45%, 71%, 96% and 99%, respectively.After administration, knockdown of Apo(a) protein levels by 0.3mg / Kg, 1mg / Kg, 3mg / Kg or 9mg / Kg of LPA RNAi agent (Geno-1-107M) reached 33%, 45%, 88% and 98%, respectively, at 28 days. After administration of 3mg / Kg of LPA RNAi agent (Geno-1-107M), knockdown of Apo(a) protein levels of ≧74% was shown by day 35. After administration of 9mg / Kg of LPA RNAi agent (Geno-1-107M), knockdown of Apo(a) protein levels of ≧97% was shown by day 35. After administration of the same dose of 3mg / Kg LPA RNAi agent, at the same time point, the knockdown effect of Apo(a) protein level by Geno-1-107M is obviously superior to that of Geno-1-1004M and comparable to that of Geno-1-1003M.

[0372] Table 10 [Table 10]

[0373] Example 10 In vivo detection of the effect of LPA RNAi agents in NOD SCID transient transgenic mice (single dose) On day 10 before administration of the LPA RNAi agent, NOD SCID mice (male) were injected with minicircle DNA (MC hLPA) containing LPA gene target sequence clone by high pressure tail vein injection. These mice are called MC hLPA HDI mice. On day 0, these mice were subcutaneously injected with 1 mg / Kg of the LPA RNAi agent solution to be measured, with an administration volume of 5 ml / Kg, and control mice were administered with an equal volume of phosphate buffer solution (PBS). Serum of the mice was collected on day 3 (Day-3) before administration, on the day of administration (Day 0), and on days 4, 7, 14, 21, and 28 after administration (samples were collected only on days 21 and 28 for some groups).

[0374] Knockdown of LPA expression was assessed by detecting Apo(a) protein levels in mouse serum using an ELISA method (Apo(a), Abcam). For normalization, the Apo(a) level of each animal at a given time point was divided by the pretreatment level in that animal (Day 0) to determine the ratio of expression "normalized to pretreatment", and then the expression at a particular time point was normalized to the control group by dividing the "normalized to pretreatment" ratio of each animal by the average "normalized to pretreatment" ratio of all mice in the control group. Thus, the expression at each time point is normalized to the expression of the control group.

[0375] FIG. 5 shows the detection results of this example.

[0376] Conjugated LPA RNAi agents were administered to MC hLPA HDI mice as described above. Each mouse was injected subcutaneously (SC) with a single dose of 1 mg / Kg of LPA RNAi agent solution, and serum Apo(a) protein levels were monitored for 28 days. Knockdown levels and duration of response are shown in Table 11. Seven days after administration, 10 mice administered 1 mg / Kg of LPA RNAi agent showed greater than 50% knockdown, 3 mice administered 1 mg / Kg of LPA RNAi agent showed greater than 70% knockdown, and 1 mouse showed greater than 84% knockdown of Apo(a) protein levels with Geno-1-107M. At 14 days post-treatment, 8 mice treated with 1mg / Kg LPA RNAi agent showed greater than 50% knockdown, 1 mouse treated with 1mg / Kg LPA RNAi agent Geno-1-112M showed greater than 70% knockdown, and 2 mice treated with LPA RNAi agents Geno-1-107M and Geno-1-1003M showed greater than 80% knockdown in Apo(a) protein levels. At 28 days post-treatment, 2 mice treated with LPA RNAi agents Geno-1-107M and Geno-1-111M still showed 65% and 54% knockdown in Apo(a) protein levels.

[0377] Table 11 [Table 11]

[0378] Example 11 In vivo detection of the effect of LPA RNAi agents in NOD SCID transient transgenic mice On the 27th day before administration of LPA RNAi, NOD SCID mice (male) were injected with minicircle DNA (MC hLPA) containing a clone of the LPA gene target sequence by high pressure tail vein injection. These mice are called MC hLPA HDI mice. On day 0, these mice were subcutaneously injected with 1 mg / Kg of LPA RNAi to be measured, with an administration volume of 5 ml / Kg, and control mice were administered with an equal volume of phosphate buffer solution (PBS). Serum of the mice was collected on the 3rd day (Day-3) before administration, on the day of administration (Day 0), and on the 4th, 11th, and 18th days after administration.

[0379] Knockdown of LPA expression was assessed by detecting Apo(a) protein levels in mouse serum using an ELISA method (Apo(a), Abcam). For normalization, the Apo(a) level of each animal at a given time point was divided by the pretreatment level in that animal (Day 0) to determine the ratio of expression "normalized to pretreatment", and then the expression at a particular time point was normalized to the control group by dividing the "normalized to pretreatment" ratio of each animal by the average "normalized to pretreatment" ratio of all mice in the control group. Thus, the expression at each time point is normalized to the expression of the control group.

[0380] FIG. 6 shows the detection results of this example.

[0381] Gal-6 conjugated LPA RNAi agents were administered to MC hLPA HDI mice as described above. Each mouse was injected subcutaneously (SC) with a single dose of 1 mg / Kg of LPA RNAi agent solution, and serum Apo(a) protein levels were monitored for 18 days. The knockdown levels and duration of response are shown in Table 12. At day 4 after administration, 1 mg / Kg LPA RNAi agents Geno-1-107M and Geno-1-120M showed 69% and 66% knockdown, and at day 11 after administration, 1 mg / Kg LPA RNAi agents Geno-1-107M and Geno-1-120M showed 70% and 73% knockdown. At day 18 after administration, 1 mg / Kg LPA RNAi agents Geno-1-107M and Geno-1-1003M showed 64% and 56% knockdown.

[0382] Table 12 [Table 12]

[0383] The above is merely a preferred embodiment of the present invention, and does not limit the present invention. All modifications, equivalent replacements, improvements, etc. made within the principle of the present invention should be included within the protection scope of the present invention.

Claims

1. An LPA RNA interference agent containing a nucleotide sequence, wherein the nucleotide sequence includes at least 12 consecutive nucleotides of SEQ ID NO: 10, SEQ ID NO: 17, SEQ ID NO: 101 or SEQ ID NO: 108, or a nucleotide sequence having three or fewer nucleotide differences from it, or a nucleotide sequence complementary to it.

2. The RNA interference agent according to Claim 1, wherein the nucleotide sequence includes a double-stranded structure of an antisense strand and a sense strand.

3. The RNA interference agent according to Claim 2, wherein the sense strand and / or the antisense strand independently contain one or more 2'-modified nucleotides.

4. The nucleotide is at least one of 2'-fluoro-modified nucleotide, 2'-O-methyl-modified nucleotide, EVP, UNA and GNA. The RNA interference agent according to Claim 3, characterized in that it is at least one of them.

5. In the antisense strand, at least one site among the 2nd, 5th, 6th, 8th, 10th, 14th and 16th positions from the 5'-end is modified with 2'-fluoro or methoxy, preferably 5 to 7 sites are modified with 2'-fluoro or methoxy. The RNA interference agent according to Claim 3, characterized in that it is so modified.

6. The sense strand and / or the antisense strand independently contain one or more phosphorothioate bonds. Preferably, the sense strand contains two consecutive phosphorothioate bonds between the 3'-terminal nucleotide and the 5'-terminal nucleotide, or the antisense strand contains two consecutive phosphorothioate bonds between the 3'-terminal nucleotide and the 5'-terminal nucleotide. The RNA interference agent according to Claim 2, characterized in that it is so modified.

7. The antisense strand includes any one of the antisense strands in the following table, or the sense strand includes any one of the sense strands in the following table. Preferably, the antisense strand is 384AS: VP(U)sUfsAmAmCfUmCmUmGmUmCmCmAmUfUmAfCmCmAmUmGmsGmsUm, 385AS: AmsUfsAmAmCfUmCmUmGmUmCmCmAmUfUmAfCfAmUmGmsGmsUm, 387AS: Am sUfs Am Am Cf Um Cm Um Gm Um Cm Cm Am Uf Um Af Cm Cm Am Um Gm sGm sUm, 359AS: Am sUfs Am Am Cf Um Cm Um Gm Um Cm Cm Am Uf Um Af Cm Cm Am Um Gm sGm sUm, 498AS: Am sAf sGm Am Uf Um Gm Am Cm Am Um Gm Um Cf Cm Uf Um Cm Cm Um Gm sUm sGm comprising, more preferably, the antisense strand contains 359AS or 498AS, The RNA interference agent according to claim 2.

8. Further containing a conjugate ligand, The conjugate ligand includes at least one having a chemical formula of at least one of I-1 to I-16 or at least one having a structural formula of at least one of II-1 to II-28, 【Chemical Formula 1】 (I-1), [Chemical Formula 2] (I-2), 【Chemical Formula 3】 (I-3), 【Chemical Formula 4】 (I-4), 【Chemical Formula 5】 (I-5), 【Chemical Formula 6】 (I-6), 【Chemical Formula 7】 (I-7), 【Chemical 8】 (I-8), 【Chemical Formula 9】 (I-9), 【Chemical Formula 10】 (I-10), 【Chemical 11】 (I-11), 【Chemical Formula 12】 (I-12), 【Chemical 13】 (I-13), 【Chemical Formula 14】 (I-14), 【Chemical Formula 15】 (I-15), 【Chemical 16】 (I-16), 【Chemical 17】 (II-1), 【Chemical 18】 (II-2), 【Chemical 19】 (II-3), 【Chemical 20】 (II-4), 【Chemical 21】 (II-5), 【Chemical 22】 (II-6), 【Chemical 23】 (II-7), 【Chemical 24】 (II-8), 【Chemical Formula 25】 (II-9), 【Chemical 26】 (II-10), 【Chemical 27】 (II-11), 【Chemical 28】 (II-12), 【Chemical 29】 (II-13), 【Chemical Formula 30】 (II-14), 【Chemical 31】 (II-15), 【Chemical 32】 (II-16), 【Chemical 33】 (II-17), 【Chemical 34】 (II-18), 【Chemical Formula 35】 (II-19), 【Chemical Formula 36】 (II-20), 【Chemical 37】 (II-21), 【Chemical 38】 (II-22), 【Chemical 39】 (II-23), 【Chemical 40】 (II-24), 【Chemical 41】 (II-25), 【Chemical 42】 (II-26), 【Chemical 43】 (II-27), 【Chemical 44】 (II-28), wherein Y is O or S, and the RNA interference agent according to any one of claims 1 to 7.

9. The conjugate ligand is conjugated to the 5'-end and / or 3'-end of the sense strand, and the RNA interference agent according to claim 8.

10. a) The antisense strand is, 359AS: Am sUfs Am Am Cf Um Cm Um Gm Um Cm Cm Am Uf Um Af Cm Cm Am Um Gm sGm sUm including and / or, the sense strand is, Cm sAm sUm Gm Gm Um Am Am Uf Gf Gf Am Cm Am Gm Am Gm Um Um Am Um s[Gal-6]s[Gal-6]s[Gal-6] including, or, b) The antisense strand is, 498AS: Am s Af s Gm Am Um Gm Am Cm Am Um Gm Um Cf Cm Uf Um Cm Cm Um Gm s Um s Gm, comprising, and wherein the sense strand is Cms Am s Gm Gm Am Am Gm Gm Af Cf Af Um Gm Um Cm Am Am Um Cm Um Um s [Gal-6] s [Gal-6] s [Gal-6], including where [Gal-6] s [Gal-6] s [Gal-6] has a structure represented by 【Chemical 45】 The RNA interference agent according to claim 8. **Claim 11**: A pharmaceutical comprising the RNA interference agent according to any one of claims 1 to 10, wherein the pharmaceutical reduces the expression of LPA mRNA or protein in a mammal, prevents and / or treats a disease or symptom related to LPA expression, or reduces the risk of a disease or symptom. **Claim 12** The pharmaceutical according to claim 11, wherein the expression level of the Lp(a) protein is 34.100 nmol / L or more. **Claim 13** The disease or symptom includes liver disease, inflammation, cardiovascular disease, myocardial infarction, or metabolic disease, and preferably, the cardiovascular disease includes hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, cardiac stroke, cerebral stroke, or aortic stenosis. The pharmaceutical according to claim 11. **Claim 14** The pharmaceutical according to claim 11, wherein the pharmaceutical is a composition and further comprises at least one of an LDL-C, cholesterol, and triglyceride lowering agent. **Claim 15** The pharmaceutical according to claim 11, wherein the pharmaceutical is a composition and further comprises at least one of a PCSK9 RNAi inhibitor, a PCSK9 antibody inhibitor, and a PCSK9 small molecule inhibitor.

Images