Biotherapeutic Enterococcus spp. Isolates

Abstract

The present invention relates to novel strains of Enterococcus sp. that are useful for bacteriotherapy. The inventors have identified a non-inflammatory strain of Enterococcus sp. Thus, in one aspect, the present invention provides a method of reducing or preventing gastrointestinal mucosal inflammation in a subject, comprising administering to the subject a therapeutically effective amount of a biotherapeutic composition comprising a non-inflammatory strain of Enterococcus sp.

Description

[Technical Field]

[0001] FIELD OF THE INVENTION The present invention provides Enterococcus that are useful for bacteriotherapy. Genus This paper deals with a novel strain of Enterococcus sp. [Background technology]

[0002] Background of the Invention The human gut microbiota consists of trillions of microorganisms, including at least 100 common bacterial species and at least 1,000 less common bacterial species, and contains over 100 times more genes than the human genome. The gut microbiota is primarily composed of bacteria, but also contains archaea, protozoa, and viruses. The gut microbiota performs important functions essential for maintaining health, including food processing, digestion of complex indigestible polysaccharides, and vitamin synthesis. It also secretes bioactive metabolites with diverse functions ranging from inhibiting pathogens and metabolizing toxic compounds to regulating host metabolism.

[0003] Inflammatory bowel disease (IBD) is an increasingly prevalent and currently incurable condition thought to be caused by an aberrant immune response to the resident gut microbiome in genetically susceptible individuals (Graham and Xavier, 2020). While it affects both adults and children, adult cohorts are often confounded by comorbidities, disease course, existing medications, and lifestyle factors that are typically absent in newly diagnosed pediatric populations. High-throughput sequencing of both adult and pediatric patient cohorts has now provided a detailed taxonomic understanding of the microbiome composition in IBD (Schirmer et al., 2019). However, existing studies have been dominated by fecal sampling from adult cohorts, and phenotypic investigations of human bacteria have been primarily limited to genomic predictions and correlations (reviewed by Ni et al., 2017). The variability in disease states throughout the gastrointestinal tract, combined with confounding factors in adult patient cohorts, necessitates detailed host and microbiome investigations of mucosal samples in pediatric patient cohorts.

[0004] Various studies have shown that bacteriotherapy using beneficial bacterial isolates can be used to treat and / or prevent diseases / disorders such as irritable bowel syndrome, inflammatory bowel disease, ulcers or gastric cancer.Therefore, there is a need to identify additional bacteria for use in bacteriotherapy. Summary of the Invention [Means for solving the problem]

[0005] Summary of the Invention The present inventors have discovered novel Enterococcus strains that are useful for bacteriotherapy. Genus was isolated.

[0006] The present inventors have Genus Thus, in one aspect, the present invention provides a method for reducing or preventing gastrointestinal mucosal inflammation in a subject, the method comprising: Genus and administering to the subject a therapeutically effective amount of a biotherapeutic composition comprising a non-inflammatory strain of B. diffusa.

[0007] In one embodiment, the non-inflammatory strain comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 through 44, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 1 through 44. Examples of such strains include, but are not limited to, the following: i) Enterococcus Genus CC00149 (deposited at the National Measurement Institute (Australia) on September 9, 2019 under V19 / 018754), ii) Enterococcus Genus CC00259 (deposited at the National Measurement Institute (Australia) on September 9, 2019 under V19 / 018755), and iii) Enterococcus Genus CC00620 (deposited with the National Measurement Institute (Australia) on 29 June 2021 under V21 / 013048).

[0008] In a further aspect, the present invention provides a method for treating or preventing gastrointestinal dysbiosis in a subject, comprising immunizing an Enterococcus bacterium containing a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 74, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 1 to 74. Genus The method comprises administering to the subject a therapeutically effective amount of a biotherapeutic composition comprising a strain of Bacillus subtilis.

[0009] In one embodiment, Enterococcus Genusis a non-inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 44, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NO: 1 to SEQ ID NO: 44.

[0010] In an alternative embodiment, Enterococcus Genus is an inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 45 to 74. Examples of such strains include, but are not limited to: i) Enterococcus Genus CC00064 (deposited at the National Measurement Institute (Australia) on June 29, 2021 under V21 / 013046); ii) Enterococcus Genus CC00619 (deposited at the National Measurement Institute (Australia) on June 29, 2021 under V21 / 013047); iii) Enterococcus Genus CC00262 (deposited at the National Measurement Institute (Australia) under V20 / 006238 on March 18, 2020), and iv) Enterococcus Genus CC0002 (deposited at the National Measurement Institute (Australia) on 20 July 2021 under V21 / 014119).

[0011] In one embodiment, the imbalance and / or inflammation is associated with one or more of inflammatory bowel disease (IBD), pouchitis, irritable bowel syndrome (IBS), enterobacterial infection, metabolic disease, neuropsychiatric disorder, autoimmune disease, allergic disorder, hepatic encephalopathy, or cancer. In one embodiment, the IBD is ulcerative colitis (UC) or Crohn's disease.

[0012] In one embodiment, the composition further comprises a prebiotic agent.

[0013] In one embodiment, the composition further comprises a carrier.

[0014] In one embodiment, the composition further comprises an insoluble fiber, a buffering agent, an osmotic agent, an antifoaming agent, and / or a preservative.

[0015] In one embodiment, in this case the composition comprises a chemostat medium.

[0016] In one embodiment, the composition is a saline composition.

[0017] In one embodiment, the composition is administered orally or rectally.

[0018] In one embodiment, the composition further comprises a stabilizer and / or a cryoprotectant.

[0019] In one embodiment, the composition is lyophilized.

[0020] In one embodiment, the composition is in the form of a capsule, tablet, or enema. In one embodiment, the capsule or tablet is enteric coated, pH dependent, sustained release, and / or gastroresistant.

[0021] In one embodiment, the strain is present in the composition at about 10 per gram. 3 cfu ~ approx. 10 13 cfu, or approximately 10 per gram4 cfu ~ approx. 10 12 cfu, or approximately 10 per gram 5 cfu ~ approx. 10 11 cfu, or approximately 10 per gram 6 cfu ~ approx. 10 10 cfu, or approximately 10 per gram 7 cfu ~ approx. 10 9 It exists in cfu.

[0022] In one embodiment, the subject is a human.

[0023] In a further aspect, the present invention provides Enterococcus Genus In one embodiment, the non-inflammatory bacterial strain comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 44, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 1 to 44.

[0024] In another aspect, the present invention provides an Enterococcus strain comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 74, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 1 to 74. Genus In one embodiment, an isolated strain of Enterococcus is provided. Genus The strain is an inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 45 to 74.

[0025] In a further aspect, the present invention provides a composition comprising at least one strain of the invention. In one embodiment, the composition is a biotherapeutic composition.

[0026] In one aspect, the invention provides a method for preparing a biotherapeutic composition, comprising: i) Enterococcus of the present invention Genus Cultivating at least one strain of ii) Enterococcus obtained in i) Genus mixing with a pharmaceutically acceptable carrier. The present invention provides a method comprising:

[0027] In a further aspect, the present invention provides a method for analyzing the microbiome of the gastrointestinal tract of a subject, comprising: i) obtaining a sample containing bacteria from the gastrointestinal tract of said subject; ii) The sample is subjected to the Enterococcus Genus To analyze for the presence of strains of The present invention provides a method comprising:

[0028] In one embodiment, the DNA of the sample, or DNA extracted from the sample, is analyzed.

[0029] In one embodiment, the sample is analyzed by DNA amplification and / or DNA hybridization.

[0030] In one embodiment, an Enterococcus comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 45 to 74. Genus The presence of this strain suggests that the gastrointestinal tract is inflamed or that the previously detected imbalance and / or gastrointestinal inflammation is at least partly due to said strain.

[0031] In one embodiment, an Enterococcus comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 44, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 1 to 44. Genus The presence of strains of Enterococcus indicates that the gastrointestinal tract is not inflamed and / or that the gastrointestinal tract is not infected with Enterococcus. Genus It is suggested that the pathogen contains non-inflammatory strains of bacteria.

[0032] In one embodiment, the non-inflammatory strains of the present invention are or can be detected using the following primer pair: [ka]

[0033] In one embodiment, the inflammatory strains of the present invention are or can be detected using the following primer pair: [ka]

[0034] Enterococcus of the present invention for the manufacture of a medicament for treating or preventing imbalances in the gastrointestinal tract. Genus Also provided is the use of at least one strain of

[0035] Enterococcus for use in the manufacture of a medicament for reducing or preventing gastrointestinal mucosal inflammation in a subject Genus Also provided is the use of at least one non-inflammatory strain of:

[0036] Enterococcus of the present invention for use in treating or preventing gastrointestinal imbalances Genus Also provided is at least one strain of

[0037] Any embodiment herein should be construed as applying to any other embodiment, mutatis mutandis, unless specifically stated otherwise.

[0038] The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for illustrative purposes only. Functionally equivalent products, compositions and methods are clearly within the scope of the invention as described herein.

[0039] Throughout this specification, unless specifically stated otherwise or the context dictates otherwise, a reference to a single step, composition, group of steps or compositions should be construed to encompass one and multiple (i.e., one or more) of that step, composition, group of steps or compositions.

[0040] The invention will now be described by way of the following non-limiting examples and with reference to the accompanying drawings, in which: In certain embodiments, for example, the following items are provided: (Item 1) A method for reducing or preventing gastrointestinal mucosal inflammation in a subject, comprising administering to the subject a therapeutically effective amount of a biotherapeutic composition comprising a non-inflammatory strain of Enterococcus. (Item 2) 2. The method according to item 1, wherein the strain comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 44, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 to 44. (Item 3) A method of treating or preventing a gastrointestinal imbalance in a subject, comprising administering to the subject a therapeutically effective amount of a biotherapeutic composition comprising a strain of Enterococcus comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 74, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 to 74. (Item 4) 4. The method according to Item 3, wherein the Enterococcus genus is a non-inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 44, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 to 44. (Item 5) 4. The method according to item 3, wherein the Enterococcus is an inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 45 to 74. (Item 6) 4. The method according to item 3, wherein the Enterococcus is an inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 50, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 45 to 50. (Item 7) 4. The method of claim 3, wherein the Enterococcus bacterium is an inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 74, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 to 74, provided that the 16s ribosomal RNA (rRNA) gene having the given nucleotide sequence or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 to 74 does not comprise a nucleotide sequence as set forth in any one of SEQ ID NOs: 89 to 217. (Item 8) 8. The method according to any one of items 1 to 7, wherein the imbalance and / or inflammation is associated with one or more of inflammatory bowel disease (IBD), pouchitis, irritable bowel syndrome (IBS), enterobacterial infection, metabolic disease, neuropsychiatric disorder, autoimmune disease, allergic disorder, hepatic encephalopathy or cancer. (Item 9) 9. The method of claim 8, wherein the IBD is ulcerative colitis (UC) or Crohn's disease. (Item 10) 10. The method according to any one of items 1 to 9, wherein the composition further comprises a prebiotic agent. (Item 11) 11. The method according to any one of items 1 to 10, wherein the composition further comprises a carrier. (Item 12) 12. The method according to any one of items 1 to 11, wherein the composition further comprises insoluble fiber, a buffering agent, an osmotic agent, an antifoaming agent and / or a preservative. (Item 13) 13. The method of any one of items 1 to 12, wherein the composition comprises a chemostat medium. (Item 14) 14. The method according to any one of items 1 to 13, wherein the composition is a saline composition. (Item 15) 15. The method according to any one of items 1 to 14, wherein the composition is administered orally or rectally. (Item 16) 16. The method according to any one of items 1 to 15, wherein the composition further comprises a stabilizer and / or a cryoprotectant. (Item 17) 17. The method according to any one of items 1 to 16, wherein the composition is in the form of a capsule, tablet or enema. (Item 18) 18. The method of claim 17, wherein the capsule or tablet is enteric coated, pH dependent, sustained release, and / or gastroresistant. (Item 19) 19. The method according to any one of items 1 to 18, wherein the subject is a human. (Item 20) Isolated non-inflammatory strains of Enterococcus spp. (Item 21) An isolated strain of Enterococcus, comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 74, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 to 74. (Item 22) A composition comprising at least one strain according to item 20 or 21. (Item 23) 23. The composition of item 22, which is a biotherapeutic composition. (Item 24) 23. The composition of claim 22, comprising a cryoprotectant. (Item 25) 1. A method for preparing a biotherapeutic composition, comprising: i) culturing at least one strain of Enterococcus according to item 20 or 21; and ii) mixing the Enterococcus bacterium obtained in i) with a pharmaceutically acceptable carrier. A method comprising: (Item 26) 1. A method for analyzing the gastrointestinal microbiome of a subject, comprising: i) obtaining a sample containing bacteria from the gastrointestinal tract of said subject; ii) analyzing the sample for the presence of the Enterococcus strain according to item 20 or 21. A method comprising: (Item 27) 27. The method of claim 26, wherein DNA of the sample or DNA extracted from the sample is analyzed. (Item 28) 28. The method of claim 27, wherein the sample is analyzed by DNA amplification and / or DNA hybridization. (Item 29) 29. The method of any one of items 26 to 28, wherein the presence of a strain of Enterococcus comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 45 to 74, indicates that the gastrointestinal tract is inflamed or that a previously detected imbalance and / or gastrointestinal inflammation is at least partially attributable to said strain. (Item 30) 22. Use of at least one strain of Enterococcus according to item 21 for the manufacture of a medicament for treating or preventing imbalances in the gastrointestinal tract. (Item 31) Use of at least one non-inflammatory strain of Enterococcus for the manufacture of a medicament for reducing or preventing gastrointestinal mucosal inflammation in a subject. (Item 32) 22. At least one strain of Enterococcus according to item 21 for use in treating or preventing gastrointestinal imbalances. (Item 33) At least one non-inflammatory strain of Enterococcus for use in reducing or preventing gastrointestinal mucosal inflammation in a subject. (Item 34) The steps, features, integers, compositions and / or compounds disclosed herein or indicated individually or collectively in the specification of this application, and any and all combinations of two or more of said steps or features. [Brief explanation of the drawings]

[0041] [Figure 1] A workflow for microbial culture and sequencing directly from patient-derived intestinal biopsy samples. A workflow for culturing bacterial communities directly from mucosal samples to minimize the amount of eukaryotic DNA present. [Figure 2] Subsets of IBD samples reveal clade-specific bacterial enrichment. Differences in the relative proportions of key Enterococcus clades in control and IBD patients (P<0.05; KS) highlight the existence of distinct subsets of IBD patients. [Figure 3] Fewer virulence genes are associated with isolates that achieve high cytotoxicity in stimulated Caco-2 cells. The number of virulence genes in isolates of interest from each clade was assessed using a percent identity cutoff of >70% (P<0.01; Mann-Whitney U test). [Figure 4]In vitro phenotypic validation of candidate bacteria reveals clade-specific differences in cytotoxicity. Cytotoxicity by LDH assay in Caco2 intestinal epithelial cells stimulated at a multiplicity of infection (MOI) of 10:1 with one of 12 isolates representing IBD clades (six isolates on the right) and a control clade at 24 hours (n = 3 biological replicates, mean ± SEM). Bacterial clades are represented by a phylogenetic tree below the graph, showing the relationships between isolates. Statistics represent the comparison of clades associated with IBD to the control clade (P = 0.0006; paired t-test). SEM images of each isolate also allow for morphological visualization of each candidate bacterium. [Figure 5] Scanning electron microscopy (SEM) of 12 isolates used to stimulate Caco2 cells. a) Six isolates in the control-related clade caused greater cytotoxicity upon Caco2 cell stimulation. b) Six isolates in the IBD-enriched clade caused less cytotoxic activity upon Caco2 cell stimulation. [Figure 6] Viability of bacterial isolates is essential for achieving a cytotoxic phenotype. Representative isolates from each of the clades under investigation (CC00064 and CC00149) were selected and used to stimulate Caco2 cells after heat inactivation of the isolates at 99°C for 60 minutes. Concentrations of both 1 mg / ml and 1 μg / ml heat-killed bacteria were used, and cytotoxicity was assessed at 0, 4, 6, 8, and 24 hours after stimulation. A paired t-test was used; no significant differences were observed. n = 3 biological replicates. [Figure 7] Significantly differentially expressed genes identified after stimulation of Caco2 epithelial cells with CC00064 and CC00149. a, 4 hours after stimulation. b, 8 hours after stimulation. c, 24 hours after stimulation. [Figure 8]In vitro clade-specific gene signatures present in biopsies from patients with inflammation. a) Genes showing significant differential expression in the in vitro Caco2 experiment between isolates CC00149 and CC00064 at 8 hours were compared to differential expression results between inflamed and non-inflamed mucosal samples from each intestinal region. Vertical lines represent genes in the set that showed upregulation in strain CC00149 compared to CC00064 (weighted by log2 fold change). Genes are ranked according to the conservative t-statistic in the clinical group of interest, with significantly upregulated genes at the far right, while downregulated genes appear at the far left. Overall gene set enrichment is represented by the enrichment line shown above. b, Heatmap showing all genes that were significantly differentially expressed between CC00149 and CC00064 at 8 hours post-stimulation and that also changed significantly in the same direction between molecularly inflamed samples compared to non-inflamed samples within any of the three clinical sample sites. The top six genes all decreased, and the rest increased, except for LMO4 and EPHA2 in the terminal ileum. Significance (P<0.05) is indicated by an asterisk (*) within the box. Values ​​shown are log2 fold changes and are truncated to ±3. [Figure 9] Quantitative real-time PCR cycle threshold (CT) values ​​for cytotoxic specific primers (A) and non-cytotoxic specific primers (B) revealing clade specificity with both primer sets. DETAILED DESCRIPTION OF THE INVENTION

[0042] Sequence summary list SEQ ID NO:1 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00149 SEQ ID NO:2 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00259 SEQ ID NO:3 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00261 SEQ ID NO:4 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00260 SEQ ID NO:5 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00620 SEQ ID NO:6 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00152 SEQ ID NO:7 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_3d_mc056_57_d3 SEQ ID NO:8 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc022rnx_e1 SEQ ID NO:9 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_3h_mc056_57_h3 SEQ ID NO: 10 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_3f_mc056_57_f3 SEQ ID NO: 11 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc036cna_f03 SEQ ID NO: 12 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_4a_mc056_57_a4 SEQ ID NO: 13 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_3e_mc056_57_e3 SEQ ID NO: 14 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056cix_8d_mc056_57_d8 SEQ ID NO: 15 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056cix_8e_mc056_57_e8 SEQ ID NO: 16 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_3a_mc056_57_a3 SEQ ID NO: 17 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_1c_mc056_57_c1 SEQ ID NO: 18 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_3b_mc056_57_b3 SEQ ID NO: 19 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc036rna2_h03 SEQ ID NO:20 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056cix_5f_mc056_57_f5 SEQ ID NO:21 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056cix_6d_mc056_57_d6 SEQ ID NO:22 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_3g_mc056_57_g3 SEQ ID NO:23 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056cix_8c_mc056_57_c8 SEQ ID NO:24 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056cix_7h_mc056_57_h7 SEQ ID NO:25 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc056tix_2b_mc056_57_b2 SEQ ID NO:26 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc017tn_x_b6 SEQ ID NO:27 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc017cn_x_d3 SEQ ID NO:28 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc017cn_x_d2 SEQ ID NO: 29 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc026cna2_e06 SEQ ID NO: 30 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc026rna2_g06 SEQ ID NO: 31 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc059rn_fx_g10 SEQ ID NO: 32 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc017rn_x_f4 SEQ ID NO: 33 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc017rn_12f_a SEQ ID NO: 34 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc017tn_12a_ma SEQ ID NO: 35 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc017tn_1a_ma SEQ ID NO: 36 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc017rn_12e_ma SEQ ID NO: 37 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc017cn_12c_ma SEQ ID NO: 38 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc026rnm2_a08 SEQ ID NO: 39 - Enterococcus Genus 16s of isolate mc017tn_x_a1 rRNA nucleotide sequence SEQ ID NO: 40 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc127rifx_b11 SEQ ID NO: 41 - Enterococcus Genus16s rRNA nucleotide sequence of isolate mc026tnm2_c07 SEQ ID NO: 42 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc097cnfx_h6 SEQ ID NO: 43 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc127tnfx_c2 SEQ ID NO: 44 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc127rifx_c10 SEQ ID NO: 45 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00064 SEQ ID NO: 46 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00262 SEQ ID NO: 47 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00264 SEQ ID NO: 48 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00263 SEQ ID NO: 49 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00619 SEQ ID NO: 50 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00002 SEQ ID NO:51 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate CC00066 SEQ ID NO:52 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_zx_b3 SEQ ID NO:53 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071cn_fx_e6 SEQ ID NO:54 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071cn_fx_f8 SEQ ID NO: 55 - Enterococcus Genus16s rRNA nucleotide sequence of isolate mc001tny_c01 SEQ ID NO:56 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_zx_d11 SEQ ID NO: 57 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_zx_d8 SEQ ID NO: 58 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc026tna2_b06 SEQ ID NO: 59 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_zx_c7 SEQ ID NO: 60 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071cn_fx_h7 SEQ ID NO: 61 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_fx_c5 SEQ ID NO: 62 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_zx_b4 SEQ ID NO: 63 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_fx_d4 SEQ ID NO: 64 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_fx_d5 SEQ ID NO: 65 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc026cnm1_e07 SEQ ID NO: 66 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_fx_c10 SEQ ID NO: 67 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_fx_a9 SEQ ID NO: 68 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_fx_a4 SEQ ID NO: 69 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_zx_c2 SEQ ID NO: 70 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071cn_zx_g1 SEQ ID NO: 71 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_zx_b7 SEQ ID NO:72 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_fx_c1 SEQ ID NO:73 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc026cna1_d06 SEQ ID NO:74 - Enterococcus Genus 16s rRNA nucleotide sequence of isolate mc071tn_fx_b1 SEQ ID NO: 75 to SEQ ID NO: 88 - Oligonucleotide primers SEQ ID NO:89 to SEQ ID NO:217 - Further nucleotide sequences

[0043] Where applicable, an n in a sequence indicates that the base was not resolved during the sequencing process, and can be any base.

[0044] The sequences are listed below under the heading "Nucleotide Sequence."

[0045] Detailed Description of the Invention General Techniques and Definitions Unless specifically defined otherwise, all technical and scientific terms used herein should be construed to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., those skilled in the art of biotherapeutics, prebiotics, and the treatment of gastrointestinal imbalances and mucosal inflammation).

[0046] The term "and / or," e.g., "X and / or Y," should be understood to mean either "X and Y" or "X or Y," and should be interpreted as providing explicit support for both meanings or for either meaning.

[0047] As used herein, the term about, unless otherwise specified, refers to + / - 10%, more preferably + / - 5% of the specified value.

[0048] Throughout this specification the word "comprise" or variations such as "comprises" or "comprising" will be understood to imply that the specified element, integer or step, or group of elements, integers or steps, is included but not to the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0049] As used herein, the term "bacterial therapy" refers to the use of a bacterial isolate to treat or prevent a disease or condition in a subject, or to provide a health benefit in a subject.

[0050] As used herein, the term "biotherapeutic agent" refers to a microorganism (e.g., a bacterial isolate, etc.) that is useful for treating or preventing a disease or condition in a subject, or for providing a health benefit in a subject.

[0051] The term "biotherapeutic composition," as used herein, refers to a formulation that includes a biotherapeutic preparation that is formulated with one or more additional formulation components to obtain a finished formulation that is suitable for delivery to a subject.

[0052] As used herein, the "gastrointestinal tract" refers to the tract from the mouth to the anus, including all organs of the digestive system, e.g., the esophagus, stomach, pancreas, liver, gallbladder, small intestine (including the ileum), cecum, large intestine, colon, and rectum. Various strains of the present invention are useful for various conditions of at least the terminal ileum, cecum, or rectum.

[0053] As used herein, "non-inflammatory strain" refers to a strain of the present invention that is associated with an absence of inflammation when present in the gastrointestinal tract of a subject, preferably a human. The non-inflammatory strain of the present invention has little or no cytotoxicity to mammalian epithelial cells in culture, such as Caco2 cells as described in Example 2. In one embodiment, the strain causes cell death in less than 15%, less than 10%, or less than 5% of mammalian epithelial cells in culture. In one embodiment, the non-inflammatory strain of the present invention, when exposed to a given cell type, causes less cell death than does a strain containing a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45-74, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 45-74 (e.g., CC00064, CC00619, CC00262, CC0002, etc., as described herein). In one embodiment, a non-inflammatory strain of the invention is a member of Clade 149 as described herein (see, e.g., the clade in Figure 4 that encompasses strains CC00620, CC00261, CC00260, CC00149, and CC00259). Members of this clade have a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1-44, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 1-44. In one embodiment, after 8 hours of incubation with epithelial cells (e.g., Caco2 cells), one, two, or more, or all of the upregulated genes in Table 1 (designated as 1 in the last column) are upregulated by the non-inflammatory strain. In one embodiment, after 24 hours of incubation with epithelial cells (e.g., Caco2 cells), one or more or all of the upregulated genes in Table 2 (indicated as 1 in the last column) are upregulated by the non-inflammatory strain.In another embodiment, the non-inflammatory strains of the present invention can be detected using the following primer pair: [ka]

[0054] As used herein, "inflammatory strain" refers to a strain of the invention that, when present in the gastrointestinal tract of a subject, preferably a human, is associated with an inflammatory state. The inflammatory strain of the invention is cytotoxic to mammalian epithelial cells in culture, such as Caco2 cells as described in Example 2. In one embodiment, the strain causes cell death of at least 40%, at least 45%, or at least 50% of mammalian epithelial cells in culture. In one embodiment, the inflammatory strain of the invention, when exposed to a given cell type, causes more cell death than does a strain containing a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1-44, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs: 1-44 (e.g., CC00620, CC00261, CC00260, CC00149, and CC00259, as described herein). In one embodiment, the proinflammatory strains of the invention are members of Clade 64 as described herein (see, e.g., the clade in Figure 4 that encompasses strains CC00620, CC00261, CC00260, CC00149, and CC00259). Members of this clade have a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs:45-74, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NOs:45-74. In one embodiment, the proinflammatory strains of the invention are members of Clade 64 as described herein (see, e.g., the clade in Figure 4 that encompasses strains CC00064, CC00619, CC00262, CC00263, and CC00264). Members of this clade have a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 45 to SEQ ID NO: 74, or a nucleotide sequence that is at least 90% identical to one or more of SEQ ID NO: 45 to SEQ ID NO: 74.In one embodiment, after 8 hours of incubation with epithelial cells (such as Caco2 cells), one, two or more, or all of the upregulated genes in Table 1 (designated as -1 in the last column) are upregulated by the inflammatory strain. In one embodiment, after 24 hours of incubation with epithelial cells (such as Caco2 cells), one, two or more, or all of the upregulated genes in Table 2 (designated as -1 in the last column) are upregulated by the inflammatory strain. In another embodiment, the inflammatory strains of the invention are detectable using the following primer pair: [ka]

[0055] The term "prebiotic agent," as used herein, means an ingredient for inclusion in a biotherapeutic composition that is capable of inducing microbial growth or activity in the gastrointestinal system.

[0056] As used herein, a "carrier" can be any solvent, diluent, excipient or other vehicle, dispersing or suspending aid, surfactant, isotonicity agent, thickening or emulsifying agent, preservative, solid binder, lubricant, and the like, as appropriate for the particular dosage form desired.

[0057] The term "subject" as used within the context of the present invention refers to mammals, including humans, livestock (e.g., horses, cows, sheep, goats, chickens, etc.), dogs, and cats. In one embodiment, the subject is a human.

[0058] As used herein, the term "pharmaceutically acceptable carrier" can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into the biotherapeutic compositions of the invention and administered to a subject as described herein without causing any significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. The component generally meets required toxicological and manufacturing standards.

[0059] As used herein, the terms "treat," "treating," "treatment," and grammatical variations thereof mean subjecting an individual subject to a protocol, regimen, process, or countermeasure desired to produce a physiological response or outcome in the subject. Treating does not require that a desired physiological response or outcome be achieved in every single subject or population of subjects, as every treated subject may not respond to a particular protocol, regimen, process, or countermeasure of treatment. Thus, a particular subject or population of subjects may not respond, or may respond poorly, to treatment.

[0060] As used herein, the terms "prevent," "prevented," or "preventing," when used in reference to the treatment of gastrointestinal mucosal inflammation, refer to a preventative treatment that increases a subject's resistance to gastrointestinal mucosal inflammation, in other words, a preventative treatment that reduces the likelihood that a subject will develop gastrointestinal mucosal inflammation, as well as treatment after gastrointestinal mucosal inflammation has begun to combat the inflammation, for example, to reduce or eliminate the inflammation entirely or to prevent the inflammation from getting worse.

[0061] As used herein, the term "reducing" or variations thereof refers to a reduction, but not necessarily a complete elimination, of gastrointestinal mucosal inflammation in a subject.

[0062] As used herein, the term "sample" refers to a collection of biological material obtained from a subject or the subject's environment (e.g., soil or water in an area where a subject lives). In some embodiments, the sample is obtained directly from the subject. For example, the sample can be a fecal sample or can be obtained during a colonoscopy. The sample may be in a form directly collected from the subject or the environment, or may be at least partially purified to remove at least some non-nucleic acid material. Purification may be slight, for example, amounting to merely concentrating the sample's solids or cells into a smaller volume or separating cells from some or all of the remainder of the sample. In some embodiments, nucleic acids are isolated from the sample. Such isolated preparations include reverse transcription products and / or PCR amplification products of nucleic acids in the sample. In some embodiments, the predominant nucleic acid is DNA. The nucleic acid preparation can be a pure or partially purified nucleic acid preparation. Techniques for isolating nucleic acids from samples, including complex samples, are numerous and well known in the art.

[0063] The unit "cfu" stands for "colony forming unit," which is the number of bacterial cells as revealed by a microbiological count on an agar plate.

[0064] Enterococcus Genus Biotherapeutic strains of The present invention relates to Enterococcus Genus provides numerous biotherapeutic strains of

[0065] In one embodiment, the non-inflammatory bacterial strain of the present invention, or for use in the present invention, has a nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 44, or has at least 90% identity to one or more of SEQ ID NO: 1 to SEQ ID NO: 44, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least At least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% of the nucleotide sequence.

[0066] In one embodiment, the non-inflammatory bacterial strain of the present invention, or for use in the present invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 44, or a nucleotide sequence that is at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to one or more of SEQ ID NOs: 1 to 44.

[0067] In one embodiment, a non-inflammatory bacterial strain of the invention, or a non-inflammatory bacterial strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 44, or a nucleotide sequence that is at least 95% identical to one or more of SEQ ID NO: 1 to SEQ ID NO: 44.

[0068] In one embodiment, a non-inflammatory bacterial strain of the invention, or a non-inflammatory bacterial strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO:1 to SEQ ID NO:44, or a nucleotide sequence that is at least 96% identical to one or more of SEQ ID NO:1 to SEQ ID NO:44.

[0069] In one embodiment, a non-inflammatory bacterial strain of the invention, or a non-inflammatory bacterial strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO:1 to SEQ ID NO:44, or a nucleotide sequence that is at least 97% identical to one or more of SEQ ID NO:1 to SEQ ID NO:44.

[0070] In one embodiment, a non-inflammatory bacterial strain of the invention, or a non-inflammatory bacterial strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO:1 to SEQ ID NO:44, or a nucleotide sequence that is at least 98% identical to one or more of SEQ ID NO:1 to SEQ ID NO:44.

[0071] In one embodiment, a non-inflammatory bacterial strain of the invention, or a non-inflammatory bacterial strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO:1 to SEQ ID NO:44, or a nucleotide sequence that is at least 99% identical to one or more of SEQ ID NO:1 to SEQ ID NO:44.

[0072] In one embodiment, a non-inflammatory bacterial strain of the invention, or a non-inflammatory bacterial strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO:1 to SEQ ID NO:44, or a nucleotide sequence that is at least 99.5% identical to one or more of SEQ ID NO:1 to SEQ ID NO:44.

[0073] In one embodiment, the proinflammatory strain of the invention, or the proinflammatory strain for use in the invention, has a nucleotide sequence as set forth in any one of SEQ ID NO: 45 to SEQ ID NO: 74, or has at least 90% identity to one or more of SEQ ID NO: 45 to SEQ ID NO: 74, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least At least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% of the nucleotide sequence.

[0074] In one embodiment, the proinflammatory strain of the invention, or for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence that is at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to one or more of SEQ ID NOs: 45 to 74.

[0075] In one embodiment, an inflammatory strain of the invention, or an inflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 45 to SEQ ID NO: 74, or a nucleotide sequence that is at least 95% identical to one or more of SEQ ID NO: 45 to SEQ ID NO: 74.

[0076] In one embodiment, an inflammatory strain of the invention, or an inflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 45 to SEQ ID NO: 74, or a nucleotide sequence that is at least 96% identical to one or more of SEQ ID NO: 45 to SEQ ID NO: 74.

[0077] In one embodiment, an inflammatory strain of the invention, or an inflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 45 to SEQ ID NO: 74, or a nucleotide sequence that is at least 97% identical to one or more of SEQ ID NO: 45 to SEQ ID NO: 74.

[0078] In one embodiment, an inflammatory strain of the invention, or an inflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 45 to SEQ ID NO: 74, or a nucleotide sequence that is at least 98% identical to one or more of SEQ ID NO: 45 to SEQ ID NO: 74.

[0079] In one embodiment, an inflammatory strain of the invention, or an inflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 45 to SEQ ID NO: 74, or a nucleotide sequence that is at least 99% identical to one or more of SEQ ID NO: 45 to SEQ ID NO: 74.

[0080] In one embodiment, an inflammatory strain of the invention, or an inflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 45 to SEQ ID NO: 74, or a nucleotide sequence that is at least 99.5% identical to one or more of SEQ ID NO: 45 to SEQ ID NO: 74.

[0081] In one embodiment, the proinflammatory strain of the invention, or the proinflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence that is at least 97% identical to nucleic acid residues 1100 to 1210 of SEQ ID NOs: 45 to 74.

[0082] In one embodiment, the proinflammatory strain of the invention, or the proinflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence that is at least 98% identical to nucleic acid residues 1100 to 1210 of SEQ ID NOs: 45 to 74.

[0083] In one embodiment, the proinflammatory strain of the invention, or the proinflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence that is at least 99.5% identical to nucleic acid residues 1100 to 1210 of SEQ ID NOs: 45 to 74.

[0084] In one embodiment, the proinflammatory strain of the invention, or the proinflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence that is at least 100% identical to nucleic acid residues 1100 to 1210 of SEQ ID NOs: 45 to 74.

[0085] In one embodiment, the proinflammatory strain of the invention, or the proinflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence that is at least 100% identical to nucleic acid residues 1100 to 1210 of SEQ ID NOs: 45 to 50.

[0086] In one embodiment, an inflammatory strain of the invention, or an inflammatory strain for use in the invention, comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 45 to SEQ ID NO: 74, or a nucleotide sequence that is at least 100% identical to nucleic acid residues 1100 to 1210 of SEQ ID NO: 45.

[0087] In one embodiment, the proinflammatory strain of the invention, or for use in the invention, has a nucleotide sequence as set forth in SEQ ID NO:45, or a nucleotide sequence which has at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 110%, at least 111.5%, at least 112%, at least 113%, at least 114%, at least 115%, at least 116%, at least 117%, at least 118%, at least 119%, at least 119.5 ... 6%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%.

[0088] In one embodiment, a strain of the invention, or a strain for use in the invention, has a nucleotide sequence as set forth in any one of SEQ ID NO:1 to SEQ ID NO:74, or has at least 90% identity to one or more of SEQ ID NO:1 to SEQ ID NO:74, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, or at least 95% identity to one or more of SEQ ID NO:1 to SEQ ID NO:74. 5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%.

[0089] In one embodiment, the strain of the invention, or for use in the invention, has a nucleotide sequence as set forth in any one of SEQ ID NO:1 to SEQ ID NO:74, or has identity to one or more of SEQ ID NO:1 to SEQ ID NO:74 of at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%. %, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, with the proviso that the 16s ribosomal RNA (rRNA) gene does not comprise any one of SEQ ID NOs: 89 to 217. Alternatively, the 16s ribosomal RNA (rRNA) gene comprises any one of SEQ ID NOs: 89 to 217.

[0090] In one embodiment, the strain of the invention, or for use in the invention, has a nucleotide sequence as set forth in any one of SEQ ID NO:1 to SEQ ID NO:44, or has at least 90% identity to one or more of SEQ ID NO:1 to SEQ ID NO:44, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%. %, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, with the proviso that the 16s ribosomal RNA (rRNA) gene does not comprise any one of SEQ ID NOs: 89 to 217. Alternatively, the 16s ribosomal RNA (rRNA) gene comprises any one of SEQ ID NOs: 89 to 217.

[0091] In one embodiment, the strain of the invention, or strain for use in the invention, has a nucleotide sequence as set forth in any one of SEQ ID NO:45 to SEQ ID NO:74, or has at least 90% identity to one or more of SEQ ID NO:45 to SEQ ID NO:74, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, or at least 96% identity to one or more of SEQ ID NO:45 to SEQ ID NO:74. 5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, with the proviso that the 16s ribosomal RNA (rRNA) gene does not comprise any one of SEQ ID NOs: 89 to 217. Alternatively, the 16s ribosomal RNA (rRNA) gene comprises any one of SEQ ID NOs: 89 to 217.

[0092] In one embodiment, a strain of the invention, or a strain for use in the invention, has a nucleotide sequence as set forth in any one of SEQ ID NO:45 to SEQ ID NO:50, or has at least 90% identity to one or more of SEQ ID NO:45 to SEQ ID NO:50, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, or at least 96% identity to one or more of SEQ ID NO:45 to SEQ ID NO:50. 5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, with the proviso that the 16s ribosomal RNA (rRNA) gene does not comprise any one of SEQ ID NOs: 89 to 217. Alternatively, the 16s ribosomal RNA (rRNA) gene comprises any one of SEQ ID NOs: 89 to 217.

[0093] In one embodiment, the strain of the invention, or for use in the invention, has a nucleotide sequence of SEQ ID NO:45 or has at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 110%, at least 111.5%, at least 112%, at least 113%, at least 114%, at least 115%, at least 116%, at least 117%, at least 118%, at least 119%, at least 119.5 ... and a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence that is at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, with the proviso that the 16s ribosomal RNA (rRNA) gene does not comprise any one of SEQ ID NOs: 89 to 217. Alternatively, the 16s ribosomal RNA (rRNA) gene comprises any one of SEQ ID NOs: 89 to 217.

[0094] In one embodiment, the percent identity of polynucleotides is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty of 5 and a gap extension penalty of 0.3. Preferably, in GAP analysis, two sequences are aligned over their entire length.

[0095] Bacterial strains for use in the present invention can be cultured using standard microbiological techniques as detailed, for example, in Handbook of Microbiological Media, 4th Edition (2010, Ronald Atlas, CRC Press), Maintaining Cultures for Biotechnology and Industry (1996, Jennie C. Hunter-Cevera, Academic Press), as well as the methods detailed in the Examples using YCFA medium.

[0096] Method Treatment or Prevention The various methods of the present invention can be used to treat or prevent gastrointestinal imbalance in a subject. "Imbalance" in the context of the present invention refers to a state in which the normal diversity and / or function of the microbiota or microbiome, particularly the normal diversity and / or function of the human gastrointestinal microbiota, is disrupted. Any disruption from the normal state of the microbiota in a healthy individual can be considered an imbalance, even if the imbalance does not result in a detectable decrease in the individual's health. In a preferred embodiment, the imbalance may be associated with one or more pathological symptoms. For example, the "imbalance" may indicate a decrease in the microbial diversity of the microbiota. Additionally or alternatively, the "imbalance" may indicate an increase in the abundance of one or more bacteria (e.g., one or more pathogenic bacteria) in an individual's microbiota relative to the abundance of the one or more bacteria (e.g., one or more pathogenic bacteria) in the microbiota of a healthy individual, i.e., an individual without an imbalance. The pathogenic bacteria present during imbalance are often Proteobacteria and are resistant to one or more antibiotics. Examples of Proteobacteria include species of the genera Escherichia coli, Salmonella, Campylobacter, Vibrio, Helicobacter, and Yersinia.

[0097] The imbalance may be an imbalance associated with enterobacteria infection (for example, gastrointestinal infection caused by pathogenic bacteria).Many bacteria are known to cause gastrointestinal infection in humans, including gram-positive bacteria and gram-negative bacteria.The pathogenic bacteria is preferably a pathogenic species of Clostridium, Escherichia coli, Enterococcus, Klebsiella, Enterobacter, Proteus, Salmonella, Shigella, Staphylococcus, Vibrio, Aeromonas, Campylobacter, Plesiomonas, Bacillus, Helicobacter, Listeria or Yersinia. Preferred examples of such pathogenic bacteria include Clostridium difficile, Clostridium perfringens, Clostridium botulinum, Escherichia coli, Salmonella typhi, Staphylococcus aureus, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Campylobacter fetus, Campylobacter jejuni, Aeromonas hydrophila, Plesiomonas shigelloides, Bacillus cereus, Helicobacter pylori, Listeria monocytogenes, and Yersinia enterocolitica. More preferably, the pathogenic bacteria are pathogenic species of the genus Clostridium or Escherichia. Most preferably, the pathogenic bacteria is Clostridium difficile or Escherichia coli.

[0098] The various methods of the present invention can be used to alleviate or prevent gastrointestinal disorders.

[0099] The various methods of the present invention can be carried out by using Enterococcus GenusNon-inflammatory (non-cytotoxic) strains of can be used to reduce or prevent gastrointestinal mucosal inflammation in a subject.

[0100] In one embodiment, the subject has or is prone to have inflammatory bowel disease (IBD), such as Crohn's disease, ulcerative colitis, or pouchitis. As used herein, the term "inflammatory bowel disease (IBD)" has its general meaning in the art, and includes a group of inflammatory diseases of the colon and small intestine, such as the group of inflammatory diseases of the colon and small intestine as revised in the World Health Organization Classification K20 to K93 (ICD-10), including Crohn's disease (e.g., granulomatous enteritis; Crohn's disease of the small intestine; Crohn's disease of the large intestine; granulomatous colitis and regional colitis; Crohn's disease of the colon, large intestine, and rectum; Crohn's disease of both the small intestine and large intestine), ulcerative colitis (e.g., ulcerative (chronic) pancolitis; reflux ileitis; ulcerative (chronic) proctitis; ulcerative (chronic) rectosigmoiditis; inflammatory pouchitis), and the like. IBD refers to gastroenteritis and colitis, including but not limited to: gastroenteritis, left-sided colitis, left hemicolitis, etc.), as well as non-infectious gastroenteritis and colitis (such as radiation-induced gastroenteritis and colitis; toxic gastroenteritis and colitis; allergic and dietary-related gastroenteritis and colitis; food hypersensitivity gastroenteritis or colitis; unclassifiable colitis; designated non-infectious gastroenteritis and colitis, such as collagenous colitis; eosinophilic gastritis or gastroenteritis; lymphocytic colitis, microscopic colitis (collagenous colitis or lymphocytic colitis); non-infectious gastroenteritis and colitis, such as diarrhea; enteritis; ileitis; jejunitis; sigmoid colitis), and post-procedural disorders of the digestive system, such as pouchitis. In one embodiment, the IBD is pediatric IBD.

[0101] In a further aspect, the present invention also relates to a fecal microbial transplant composition comprising the strains of the present invention. The term "fecal microbial transplant composition" has its general meaning in the art and refers to any composition capable of restoring the fecal microbiota.

[0102] In a further aspect, there is provided a method for reducing the growth of pathogenic bacteria, comprising administering to a patient in need thereof an Enterococcus bacillus of the present invention. Genus In a preferred embodiment, the method reduces the relative abundance of or prevents colonization by pathogenic bacteria.

[0103] In a further aspect, a method for increasing the growth of healthy bacteria comprises administering to a patient in need thereof an Enterococcus strain of the present invention. Genus In one embodiment, a method includes administering a composition comprising a non-inflammatory (non-cytotoxic) strain of B. diffusa.

[0104] Administration to humans includes administration by a medical professional and self-administration. Generally, to achieve a health benefit, multiple doses of the biotherapeutic composition are administered daily for a period of, for example, at least 1 week, at least 2 weeks, at least 3 weeks, at least 6 weeks, at least 9 weeks, or at least 12 weeks. In one embodiment, the biotherapeutic can be administered for the remainder of the subject's life.

[0105] In further embodiments, the composition is administered to the patient using a dosing regimen selected from the group consisting of: hourly; every 2 hours; every 3 hours; every 4 hours; every 5 hours; every 6 hours; every 12 hours; once a day; twice a day; every 2 days; every 3 days; every 4 days; every 5 days; every 6 days; weekly; twice a week; every 2 weeks; every 3 weeks; every 4 weeks; every 5 weeks; every 6 weeks; once a month; twice a month; every 2 months; every 3 months; every 4 months; every 5 months; every 6 months; annually; twice a year; every 2 years; every 3 years; every 4 years; and every 5 years.

[0106] In one embodiment, the method reduces the relative abundance of members of a bacterial genus or prevents colonization by members of a bacterial genus.Preferably, the method suppresses unwanted inflammation.Preferably, the method reduces inflammation in a subject as measured by a parameter selected from the group consisting of TNFα signaling via NF-κB; IFNα signaling; IFNγ signaling; IL6 JAK STAT3 signaling; activation of pro-apoptotic pathways; and inhibition of unfolded protein response.Preferably, the method upregulates genes associated with pro-apoptotic pathways and unfolded protein response, including genes selected from the group consisting of CHAC1, CEBPB, TRIB3, PPP1R15A, DDIT3, ATF4, and XBP1.

[0107] Preferably, the compositions are administered orally or rectally.

[0108] composition The therapeutic compositions of the present invention may contain pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials that are well known to those skilled in the art. Such materials must be non-toxic and must not interfere with the efficacy of the isolated bacteria present in the therapeutic composition. The exact nature of the pharmaceutically acceptable excipients or other materials will depend on the route of administration, which may be, for example, oral or rectal. Many methods for preparing therapeutic compositions are known to those skilled in the art (e.g., Robinson, ed., Sustained and Controlled Release Drug Delivery Systems, Marcel Dekker, Inc., New York, 1978).

[0109] Therapeutic compositions of the present invention may include a prebiotic agent, a carrier, an insoluble fiber, a buffering agent, an osmotic agent, an antifoaming agent, and / or a preservative.

[0110] The therapeutic composition may be prepared or provided in a chemostat medium. Alternatively, the therapeutic composition may be prepared or provided in saline, for example, 0.9% saline. It will be understood that any carrier or solution may be used that does not impair the viability of the bacteria present in the therapeutic composition and is compatible with administration to an individual.

[0111] Therapeutic compositions may be made or provided under a reducing atmosphere, i.e., in the absence of oxygen. Synthetic fecal preparations may be made or provided under N, CO, H, or mixtures thereof, optionally with controlled levels of N:CO:H partial pressure.

[0112] The therapeutic composition may be for oral or rectal administration to an individual. When the therapeutic composition is for oral administration, it may be in the form of a capsule or tablet. When the therapeutic composition is for rectal administration, it may be in the form of an enema. The preparation of suitable capsules, tablets, and enemas is widely known in the art. The capsules or tablets may include a coating to protect the capsules or tablets from stomach acid. For example, the capsules or tablets may be enteric-coated, pH-dependent, sustained-release, and / or gastroresistant. Such capsules and tablets are used, for example, to minimize dissolution of the capsules or tablets in the stomach but allow dissolution in the small intestine.

[0113] Orally ingestible formulations can contain, for example, in addition to viable microorganisms, an inert compression aid (such as microcrystalline cellulose or an oligosaccharide), a flow aid (such as silica gel), or a lubricant such as magnesium stearate (vegetable source) or stearic acid (vegetable source).

[0114] The compositions disclosed herein can be used, for example, as a food supplement, an edible product, or a pharmaceutical product. When the composition is a food supplement, the biotherapeutic composition can further comprise a conventional food supplement filler and / or bulking agent. The biotherapeutic compositions disclosed herein can also be included in any edible product, such as dairy products (including, for example, dairy products, milk, yogurt, curd, ice cream, dressings, and cheese), beverage products, meat products, and baked goods.

[0115] Suppository formulations, e.g., for rectal use, can contain, in addition to the biotherapeutic agent, e.g., cocoa butter, polyethylene glycol, glycerin or gelatin.

[0116] The composition may contain a disintegrant, a glidant, and / or a lubricant. The disintegrant helps break up compacted masses when placed in a fluid environment. The disintegrant may be any suitable disintegrant, such as a disintegrant selected from the group consisting of sodium croscarmellose, crospovidone, gellan gum, hydroxypropyl cellulose, starch, and sodium starch glycolate. The glidant may be any suitable glidant, such as a glidant selected from the group consisting of silicon dioxide, colloidal silicon dioxide, and talc. A lubricant is generally always used in the manufacture of dosage forms by direct compression to prevent compacted powder masses from sticking to the equipment during the tableting or encapsulation process. The lubricant may be any suitable lubricant, such as a lubricant selected from the group consisting of calcium stearate, magnesium stearate, stearic acid, sodium stearyl fumarate, and vegetable fatty acids. In the compositions and methods of the present invention, the carrier may be present in the composition in a range of approximately 30% (w / w) to approximately 98% (w / w); this weight percentage is a cumulative weight percentage taking into account all components present in the carrier.

[0117] Various coatings can be used to control the solubility of the composition. Examples of coatings include carrageenan, cellulose acetate phthalate, ethyl cellulose, gellan gum, matodextrin, methacrylates, methyl cellulose, microcrystalline cellulose, and shellac.

[0118] The compositions may include one or more preservatives. Exemplary preservatives include antioxidants, chelating agents, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives.

[0119] Exemplary antioxidants include alpha tocopherol, ascorbic acid, acorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite.

[0120] Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA) and its salts and hydrates (e.g., edetate sodium, edetate disodium, edetate trisodium, edetate calcium disodium, edetate dipotassium, and the like), citric acid and its salts and hydrates (e.g., citric acid monohydrate), fumaric acid and its salts and hydrates, malic acid and its salts and hydrates, phosphoric acid and its salts and hydrates, and tartaric acid and its salts and hydrates. Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal.

[0121] Exemplary antifungal preservatives include butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid.

[0122] Exemplary alcohol preservatives include ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and phenylethyl alcohol.

[0123] Exemplary acidic preservatives include vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid.

[0124] Other preservatives include tocopherol, tocopheryl acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, Phenonip, methylparaben, Germall 115, Germaben II, Neolone, Kathon, and Euxyl.I. The therapeutic composition may be a liquid. The therapeutic composition may be lyophilized. The lyophilized therapeutic composition may include one or more stabilizers and / or cryoprotectants. The lyophilized therapeutic composition may be reconstituted using a suitable diluent prior to administration to an individual. Preferably, the cryoprotectant is selected from the group consisting of trehalose; mannitol; sucrose; glycerol; sorbitol; DMSO; propylene glycol; ethylene glycol; saccharose; galactose-lactose; inulin; maltodextrin; and any combination thereof. Preferably, the cryoprotectant further comprises a compound selected from the group consisting of glycerol; polyethylene glycol (PEG); glycerin; erythritol; arabitol; xylitol; sorbitol; glucose; lactose; ribose; and any combination thereof. Preferably, the cryoprotectant is trehalose at a concentration of 2% to 15% in the lyophilized formulation. Preferably, the cryoprotectant is trehalose at a concentration of at least 5% in the lyophilized formulation. Preferably, the cryoprotectant is trehalose at a concentration of at least 10% in the lyophilized formulation. The composition of any one of claims X to Y, wherein the at least one strain of bacteria is diluted with an inert powdered diluent.

[0125] In one embodiment, after storage at room temperature for at least 4 weeks, the composition is capable of maintaining at least 10% cell viability relative to the initial cell viability immediately prior to storage and pre-lyophilization.

[0126] In one embodiment, after storage at room temperature for at least 4 weeks, the composition is capable of maintaining at least 50% cell viability relative to the initial cell viability immediately prior to storage and pre-lyophilization.

[0127] In one embodiment, after at least 4 weeks of storage at room temperature, the composition is capable of maintaining cell viability of about 60% to about 80% relative to the initial cell viability immediately prior to the start of the storage.

[0128] In one embodiment, the composition reduces inflammation in a subject as measured by a parameter selected from the group consisting of: TNFα signaling via NF-κB; IFNα signaling; IFNγ signaling; IL6 JAK STAT3 signaling; activation of pro-apoptotic pathways; and inhibition of the unfolded protein response.

[0129] In one embodiment, the composition downregulates genes associated with pro-apoptotic pathways and the unfolded protein response, including genes selected from the group consisting of CHAC1, CEBPB, TRIB3, PPP1R15A, DDIT3, ATF4, and XBP1.

[0130] In one embodiment, the bacteria are cultured from a fecal sample or a colon biopsy sample. In one embodiment, the bacteria comprise a community of bacterial cells derived from the stool or biopsies of one or more human donors. In one embodiment, the community of bacterial cells comprises cultured bacterial cells. In one embodiment, the cultured bacterial cells are derived from multiple human donors. In one embodiment, the community of bacterial cells comprises uncultured bacterial cells. In one embodiment, the uncultured bacterial cells are derived from a single human donor. In one embodiment, the composition is a fecal transplant microbiota composition.

[0131] Therapeutic compositions according to the present invention may be administered alone, simultaneously, or sequentially in combination with other treatments or as a combined preparation with another therapeutic agent(s) to treat imbalances or diseases associated with imbalances as described herein. For example, the strains of the present invention may be used in combination with existing therapeutic agents for inflammatory bowel disease, irritable bowel syndrome, metabolic disorders, neuropsychiatric disorders, autoimmune diseases, allergic disorders, cancer, or hepatic encephalopathy.

[0132] For example, if the therapeutic composition is for treating an imbalance associated with cancer, the therapeutic composition may be administered to an individual in combination with cancer immunotherapy, such as an immune checkpoint inhibitor, if necessary. Examples of checkpoint inhibitors that may be used in this context include programmed cell death protein 1 (PD-1) inhibitors, programmed death-ligand 1 (PD-L1) inhibitors, and cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) inhibitors. Manipulation of the gut microbiota in combination with immune checkpoint inhibitor treatment has been shown to improve the efficacy of immune checkpoint inhibitors in treating cancer. In a preferred embodiment, the cancer in this context is lung cancer or melanoma.

[0133] In another embodiment, the composition of the invention further comprises an immunomodulatory compound, hi other embodiments, the immunomodulatory compound is a cytokine, chemokine, or complement component, their receptors, or a combination thereof, that enhances the expression of an accessory or adhesion molecule of the immune system. In some embodiments, immunomodulatory compounds include interleukins (e.g., interleukins 1-15), interferon alpha, interferon beta, or interferon gamma, tumor necrosis factor, granulocyte-macrophage colony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF), granulocyte-colony-stimulating factor (G-CSF), chemokines (e.g., neutrophil-activating protein (NAP), macrophage chemotactic / activating factor (MCAF), RANTES, macrophage inflammatory peptides (MIP-1a and MIP-1b), complement components, or combinations thereof. In other embodiments, immunomodulatory compounds stimulate expression or enhanced expression of OX40, OX40L (gp34), lymphotactin, CD40, CD40L, B7.1, B7.2, TRAP, ICAM-1, 2, or 3, cytokine receptors, or combinations thereof.

[0134] In another embodiment, the immunomodulatory compound induces or enhances the expression of costimulatory molecules that participate in the immune response, which in some embodiments include CD40 or its ligand, CD28, CTLA-4, or B7 molecules. In another embodiment, the immunomodulatory compound induces or enhances the expression of heat-stable antigen (HSA), chondroitin sulfate-modified MHC invariant chain (Ii-CS), or intracellular adhesion molecule 1 (ICAM-1).

[0135] Therapeutic compositions of the present invention may be administered to an individual, preferably a human individual. The administration may be a "therapeutically effective amount," sufficient to demonstrate benefit to the individual. Such benefit may be at least the alleviation of at least one symptom. Thus, "treatment" of a specified disease refers to the alleviation of at least one symptom. The actual amount administered, as well as the rate and duration of administration, will depend on the nature and severity of what is being treated, the particular patient being treated, the individual patient's clinical condition, the cause of the imbalance, the site of delivery of the composition, the type of therapeutic composition, the method of administration, the scheduling of administration, and other factors known to medical professionals. Decisions regarding treatment prescriptions, such as dosage, are within the responsibility of general practitioners and other physicians and may depend on the severity of the symptoms of the disease being treated and / or the progression of the disease being treated. The therapeutically effective amount or suitable dose of a therapeutic composition of the present invention can be determined by comparing its in vitro and in vivo activity in animal models. Various methods are known for extrapolating effective dosages in mice and other test animals to humans. The exact dose will depend on numerous factors, including whether the therapeutic composition is for prophylactic or treatment.

[0136] The various formulation components can be contacted with the biotherapeutic preparation and mixed or prepared until a biotherapeutic formulation is obtained. As will be apparent to one skilled in the art, various formulation conditions will generally be such that viable microorganisms are maintained. In particular, high temperatures, e.g., temperatures above 40°C, are avoided.

[0137] The amount of viable microorganism included in a biotherapeutic composition can vary and can be adjusted and optimized as would be understood by one of skill in the art. Such optimization can be achieved, for example, by preparing a series of different doses of a viable microorganism. The bacterial concentration in the composition can be, for example, 10 million cfu / mL to 100 billion cfu / mL, 10 million to 50 million cfu / mL, more preferably 50 million to 100 million cfu / mL, 100 million to 500 million cfu / mL, 500 million to 1 billion cfu / mL, 1 billion to 5 billion cfu / mL, 5 billion to 10 billion cfu / mL, 10 billion to 15 billion cfu / mL, 15 billion to 20 billion cfu / mL, 20 billion to 25 billion cfu / mL, 25 billion to 30 billion cfu / mL, 30 billion to 35 billion cfu / mL, 35 The cfu / mL may be 0 to 40 billion, 40 to 45 billion, 45 to 50 billion, 50 to 55 billion, 55 to 60 billion, 60 to 65 billion, 65 to 70 billion, 70 to 75 billion, 75 to 80 billion, 80 to 85 billion, 85 to 90 billion, 90 to 95 billion, or 95 to 100 billion.

[0138] In one embodiment, the strain of the present invention is, for example, 0.01 to 100 × 10 11 Cell / body, 0.1~10×10 11 cells / body, or 0.3–5 × 10 11 It can be administered in a cell / body dosage. Furthermore, for example, the amount ingested per day as bacteria is 0.01 to 100 × 10 11 Cells / 60kg body weight, 0.1~10×10 11 cells / 60 kg body weight, or 0.3–5 × 10 11 It is possible to have 60 kg of cells per 1000 kg of body weight.

[0139] The content of the biotherapeutic agent contained in the orally ingestible composition of the present invention may be appropriately determined depending on the application form. As the dried microbial cells for the biotherapeutic agent, the content can be, for example, 5 to 50 w / w%, 1 to 75 w / w%, 0.1 to 100 w / w%, or 1 to 100 w / w%.

[0140] In one embodiment, for every 200 mg of the composition, 10 3 ~10 14 ;10 4 ~10 14 ;10 5 ~10 14 ;10 6 ~10 14 ;10 7 ~10 14 ;10 8 ~10 14 ;10 4 ~10 13 ;10 5 ~10 12 ;10 6 ~10 11 ;10 7 ~10 10 ;10 8 ~10 9 ;10 3 ~10 13 ;10 3 ~10 12 ;10 3 ~10 11 ;10 3 ~10 10 ;10 3 ~10 9 ;10 3 ~10 8 ;10 3 ~10 7 ;10 3 ~10 6 ;10 3 ~10 5 , and 10 3 ~10 4 The bacterial cell or spore preparation comprises a pharmacologically active dose selected from the group consisting of colony forming units (cfu) or total cell counts.

[0141] In one embodiment, the composition comprises a serotonin concentration of 10 million cfu / mL to 100 billion cfu / mL, 10 million to 50 million cfu / mL, more preferably 50 million to 100 million cfu / mL, 100 million to 500 million cfu / mL, 500 million to 1 billion cfu / mL, 1 billion to 5 billion cfu / mL, 5 billion to 10 billion cfu / mL, 10 billion to 15 billion cfu / mL, 15 billion to 20 billion cfu / mL, 20 billion to 25 billion cfu / mL, 25 billion to 30 billion cfu / mL, 30 billion to 35 billion cfu / mL, 35 billion to 40 billion cfu / mL L, 40 to 45 billion cfu / mL, 45 to 50 billion cfu / mL, 50 to 55 billion cfu / mL, 55 to 60 billion cfu / mL, 60 to 65 billion cfu / mL, 65 to 70 billion cfu / mL, 70 to 75 billion cfu / mL, 75 to 80 billion cfu / mL, 80 to 85 billion cfu / mL, 85 to 90 billion cfu / mL, 90 to 95 billion cfu / mL, and 95 to 100 billion cfu / mL. In one embodiment, the composition comprises a pharmacologically active dose of bacterial cells or spores, wherein the concentration of the bacterial cells or spores as dry microbial matter is selected from the group consisting of 5-50 w / w%, 1-75 w / w%, 0.1-100 w / w%, and 1-100 w / w%.

[0142] In one embodiment, the composition is a controlled-release composition. As used herein, the term "controlled-release" indicates that the strain of the present invention is released from or administered in a controlled manner from a given dosage form to achieve a desired pharmacokinetic profile in vivo. One aspect of "controlled" delivery is that the formulation and / or dosage form can be manipulated to establish the desired kinetics of biotherapeutic release.

[0143] Various techniques for preparing tablets, caplets, capsules and other forms of the compositions of the present invention are known to those skilled in the art and include, but are not limited to, wet granulation, dry granulation, and direct compression (in the case of tablets and caplets).

[0144] Wet and dry granulation are used to produce tablets, caplets, or capsules. Along with various granulation techniques, chilsonation is used to produce powders for dosage forms. A chilsonator contains rotating rollers with interlocking grooves that are hydraulically pressed tightly together. Raw materials are placed in the chilsonator's hopper and fed into the rollers by a system of horizontal and vertical screws. As the material passes through the grooves in the rollers, it is compacted under very high pressure and emerges from the chilsonator as a dense sheet. The sheet is milled into a fine granular powder using a Fitz mill and then passed through a sieve to create uniform, free-flowing granules. The chilsonation process results in a finished powder that is two to four times denser than the starting material, a feature that allows the ingredients to be formed into the desired dosage form.

[0145] In the case of dry granulation, the powder may be incorporated into a gelatin capsule or mixed with gelatin to form a tablet or caplet. In the case of wet granulation, the powder is moistened, thus creating a large "chunk" of material that is subsequently dried and milled to convert it into particles of the desired size for the manufacturing process. Once the desired size of particles is obtained, the particles are incorporated into a gelatin capsule or mixed with gelatin to form a tablet or caplet.

[0146] General considerations in formulation and / or manufacturing can be found, for example, in Remington's Pharmaceutical Sciences, 16th Edition, E. W. Martin (Mack Publishing Co., Easton, Pa., 1980), and Remington: The Science and Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005).

[0147] In a further aspect, there is provided a method for preparing a composition of the invention, comprising: Genus and combining said at least one strain with a pharmaceutically acceptable carrier.

[0148] Prebiotics The compositions of the present invention can include prebiotic agents. Prebiotic agents have a chemical structure that resists digestion through the digestive tract, so that they reach the colon as intact molecules that can induce physiological functions throughout the body and act as fermentable substrates for the colonic microflora. When a prebiotic agent is combined with a biotherapeutic agent, the resulting composition may be referred to as a "synbiotic agent."

[0149] Examples of suitable prebiotic agents include, but are not limited to, oligosaccharides such as fructooligosaccharides, such as P95 Nutaflora®, including galactooligosaccharides, xylooligosaccharides, isomaltooligosaccharides, human milk oligosaccharides, inulin oligosaccharides, mannan oligosaccharides, pyrodextrin, levan, maltotriose, pectin-derived oligosaccharides, bimuno-galactooligosaccharides, arabinoxylan, and fucoidan. Fructooligosaccharides can be extracted from, for example, chicory, artichoke, asparagus, dandelion, dahlia, endive, garlic, leek, lettuce, and onion.

[0150] In one embodiment, the prebiotic agent comprises an amino acid such as one or more or all of alanine, aspartic acid, glutamic acid, glycine, leucine, isoleucine, proline, serine, threonine, and valine.

[0151] In one embodiment, the prebiotic agent comprises a simple sugar, which can be a monosaccharide (such as, for example, glucose, galactose, or fructose) and / or a disaccharide (such as, for example, sucrose, maltose, or lactose).

[0152] In one embodiment, the prebiotic agent comprises from about 5% (w / w) to about 50% (w / w), from about 7.5% (w / w) to about 30% (w / w), or from about 10% (w / w) to about 15% (w / w) of the composition.

[0153] Other microorganisms It may be advantageous to include one or more additional biotherapeutic microorganisms in the composition to achieve a desired health benefit to the subject. Thus, the composition may include more than one species / strain of microorganisms in addition to the strain of the present invention, such as two, three, four, five, or more species / strains of microorganisms. Non-limiting examples of biotherapeutic agents are suitable strains of the genera Aerococcus, Adlercreutzia, Allobaculum, Bacillus, Bifidobacterium, Carnobacterium, Clostridium, Eubacterium, Enterococcus (in addition to the Enterococcus strains of the present invention), Oenococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, Propionibacterium, Sporolactobacillus, Staphylococcus, Streptococcus, and Tetragenococcus, Vagococcus, and Weissella. It should be understood that the foregoing list is intended to be illustrative only and is not intended to be an exclusive representation of the biotherapeutic agents that may be included in the compositions of the present invention. In this regard, any additional biotherapeutic bacterial species may also be used in the compositions of the present invention.

[0154] In one embodiment, Enterococcus Genus Enterococcus faecalis or Enterococcus faecium.

[0155] In one embodiment, the Lactobacillus sp. is Lactobacillus rhamnosus (e.g., strain GG (ATCC53103), strain CGMCC1.3724 or strain SP1 (DSM21690)), Lactococcus lactis, Lactococcus cremoris, Lactococcus diacetylactis, Lactobacillus sp. paracasei, Lactobacillus reuteri (e.g. strain ATCC55730 or strain DSM17938), Lactobacillus acidophilus, Lactobacillus murinus, Lactobacillus helveticus, Lactobacillus bulgaricus, Lactobacillus casei, Lactobacillus salivarius, Lactobacillus plantarum, Lactobacillus fermentum, Lactobacillus Lactobacillus taiwanensis, Lactobacillus animalis, Lactobacillus johnsonii (for example, NCC533 strain; CNCM1-1225 strain, etc.), and Lactobacillus gasseri.

[0156] In one embodiment, the Bifidobacterium sp. is selected from the group consisting of Bifidobacterium lactis (e.g., strain BB-12, strain BI-04, or strain CNCM1-3446 (Bb12)), Bifidobacterium longum (e.g., strain NCC3001, strain ATCC BAA-999 (BB536)), Bifidobacterium breve (e.g., strain Bb-03, strain M-16V, or strain R0070), Bifidobacterium infantis, Bifidobacterium animalis, Bifidobacterium bifidum, and Bifidobacterium adolescentis.

[0157] In one embodiment, the Streptococcus sp. is Streptococcus thermophilus, such as Streptococcus thermophilus ST-21.

[0158] In one embodiment, the Clostridium sp. is Clostridium difficile.

[0159] Some yeasts are also useful as biotherapeutics and are sometimes included in biotherapeutic compositions. One non-limiting example of a yeast used in a biotherapeutic is Saccharomyces boulardii.

[0160] Dosage Forms and Kits In a further aspect of the present invention, there is a dosage form comprising a composition according to the previous aspects of the present invention.

[0161] In a further aspect of the invention, there is a kit comprising the dosage form together with instructions for its use.

[0162] use In a further aspect of the invention, there is the use of a composition according to the preceding aspects of the invention in the manufacture of a medicament for alleviating or preventing gastrointestinal disorders in a subject.

[0163] Detection Method The bacterial strains of the present invention can be detected using a wide variety of known techniques. Advantageously, the strains are detected using nucleic acid-based detection systems.

[0164] In one embodiment, nucleic acid sequencing is used. Illustrative non-limiting examples of various nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. In some embodiments, the technology provided herein is found to be used in second-generation (also known as next-generation or Next-Gen), third-generation (also known as Next-Next-Gen) or fourth-generation (also known as N3-Gen) sequencing technology, including (but not limited to) pyrosequencing technology, sequencing-by-ligation technology, single-molecule sequencing technology, sequence-by-synthesis (SBS) technology, massively parallel clonal technology, massively parallel single-molecule SBS technology, massively parallel single-molecule real-time technology, massively parallel single-molecule real-time nanopore technology.

[0165] In some embodiments, hybridization is used in the detection method of the present invention.The illustrative and non-limiting examples of various nucleic acid hybridization techniques include but are not limited to in situ hybridization (ISH), microarray, and Southern blot or Northern blot.In one embodiment, FISH assay is used.

[0166] In other embodiments, nucleic acid amplification is used. Nucleic acids may be amplified prior to or simultaneously with detection. Performing one or more amplification reactions may include one or more PCR-type amplifications, non-PCR-type amplifications, or a combination thereof. Illustrative, non-limiting examples of various nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), nested PCR, linear amplification, multiple displacement amplification (MDA), real-time SDA, rolling circle amplification, circle-to-circle amplification, transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence-based amplification (NASBA). Those skilled in the art will recognize that certain amplification techniques (e.g., PCR) require RNA to be reverse transcribed into DNA prior to amplification (e.g., RT-PCR), whereas other amplification techniques directly amplify RNA (e.g., TMA and NASBA).

[0167] The unamplified or amplified nucleic acid can be detected by any conventional means. For example, the nucleic acid can be detected by hybridization with a detectably labeled probe and measurement of the resulting hybrid. In another example, the nucleic acid is detected by sequencing. Illustrative, non-limiting examples of various detection methods are described herein.

[0168] "Real-time" evaluation of the amplification process requires determining the amount of amplicon in the reaction mixture either continuously or periodically during the amplification reaction, and using the determined value to calculate the amount of target sequence originally present in the sample.Various methods based on real-time amplification for determining the amount of initial target sequence present in a sample are widely known in the art.These include the methods disclosed in U.S. Patent Nos. 6,303,305 and 6,541,205.Another method for determining the amount of target sequence originally present in a sample, but which is not based on real-time amplification, is disclosed in U.S. Patent No. 5,710,029.

[0169] Amplification products may be detected in real time by using various self-hybridizing probes, most of which have stem-loop structures. Such self-hybridizing probes are labeled to emit different detectable signals depending on whether the probe is in a self-hybridized state or in an altered state upon hybridization to a target sequence. As a non-limiting example, a "molecular torch" is a type of self-hybridizing probe that includes separate self-complementary regions (referred to as a "target binding domain" and a "target termination domain") connected by a linking region (e.g., a non-nucleotide linker) and hybridizing to each other under predetermined hybridization assay conditions. In a preferred embodiment, the molecular torch contains a single-stranded base region in the target binding domain, ranging from 1 base to about 20 bases in length, that is accessible for hybridization to a target sequence present in an amplification reaction under strand-displacing conditions. Under strand displacement conditions, the hybridization of these two complementary regions of molecular torch, which may be fully or partially complementary, is favored, except for the presence of a target sequence that will bind to the single-stranded region present in the target binding domain and replace all or part of the target termination domain.The target binding domain and target termination domain of molecular torch contain a detectable label, or a pair of interacting labels (e.g., luminescent / quencher) arranged so that when the molecular torch self-hybridizes, a signal different from when the molecular torch hybridizes to the target sequence is generated, thereby allowing the detection of probe:target duplex in test sample in the presence of unhybridized molecular torch.Molecular torches and various types of interacting label pairs are disclosed in U.S. Patent No. 6,534,274 (which is incorporated herein by reference in its entirety).

[0170] Another example of a detection probe having self-complementarity is a "molecular beacon." A molecular beacon includes a nucleic acid molecule having a target-complementary sequence, an affinity pair (or nucleic acid arm) that holds the probe in a closed conformation in the absence of the target sequence present in the amplification reaction, and a label pair that interacts when the probe is in the closed conformation. Hybridization between the target sequence and the target-complementary sequence separates the components of the affinity pair, thereby changing the probe to an open conformation. The change to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Various molecular beacons are disclosed in U.S. Patent Nos. 5,925,517 and 6,150,097.

[0171] In one embodiment, the method includes quantifying the amount of the strain present in the sample.

[0172] In a further aspect, a method for analyzing the microbiome of the gastrointestinal tract of a subject includes obtaining a sample containing bacteria from the gastrointestinal tract of the subject, filtering the sample for Enterococcus. Genus In one embodiment, the method comprises analyzing for the presence of at least one strain of the biotherapeutic agent strain.

[0173] In a further aspect, there is a method of analyzing the microbiome of a gastrointestinal tract of a subject, the method comprising obtaining a sample from the gastrointestinal tract of the subject comprising bacteria, and analyzing the sample for the presence of at least one strain of pathogenic bacteria. [Example]

[0174] Example 1 - Materials and Methods Sampling Fresh mucosal samples were obtained during pediatric endoscopy from consenting patients undergoing clinically indicated colonoscopy. Six mucosal samples were obtained from each patient by collecting paired samples from three intestinal regions (terminal ileum, cecum, and rectum) to allow for matched mucosal culture and transcriptional profiling. Samples for bacterial culture were placed under anaerobic conditions within 15 minutes of collection. Samples for RNA sequencing were collected in 200 μl of RNAlater stabilizing solution (QIAGEN; Hilden, Germany) and stored at -80°C.

[0175] bacterial culture Sample processing was performed under anaerobic conditions at 37°C in a Whitley A95 workstation (Don Whitley Scientific; Yorkshire, UK). All reagents required for bacterial culture were pre-deoxygenated in an anaerobic environment 24 hours before sample processing. For processing, samples were weighed and diluted 10-fold with sterile, pre-deoxygenated PBS. -6The plates were serially diluted to 100°C and plated directly on YCFA agar (see International Publication WO2021 / 163758). The samples were then grown under anaerobic, microaerophilic, and aerobic conditions. Plates for culturing anaerobic bacteria were incubated at 37°C in a Whitely A95 anaerobic workstation (Don Whitley Scientific; Yorkshire, UK) containing 10% carbon dioxide, 10% hydrogen, and 80% nitrogen. Plates for culturing aerobic bacteria were incubated at 37°C in a Bio Concept incubator (Froilabo; Lionel Terray, Meyzieu, France). Plates for culturing microaerophilic bacteria were stored in 2.5 L gas jars (Thermo Scientific; Waltham, Massachusetts, USA) containing 2.5 L CampyGen gas packs (Oxoid; Basingstoke, Hampshire, UK) and incubated at 37 °C in a BioConcept incubator (Froilabo). Bacterial colonies were selected by picking 24 h after plating using plates with clear, uncoalesced bacterial colonies. For culture for metagenomic analysis, 50 μl aliquots of each dilution factor were applied to YCFA agar plates and spread evenly across the plate using a disposable plate spreader (International Scientific Group). The plates were incubated at 37 °C in an appropriate environment. Plate scraping was performed for metagenomic analysis 24 h after plating using plates with clear, uncoalesced bacterial colonies.

[0176] Bacterial purification and storage Isolates were restreaked onto YCFA agar plates three times at 24-hour intervals for purification. After purification, single colonies were transferred to 15-ml Falcon tubes containing 14 ml of YCFA broth and incubated at 37°C for 24 hours. Pure bacterial isolates were stored at -80°C in cryogenic storage tubes containing 25% (v / v) sterile glycerol.

[0177] Bacterial identification Selected isolates were identified by PCR amplification of the 16S rRNA gene followed by capillary sequencing. Broad-range bacterial 16S gene primers were used, including the forward 7F primer 5'-AGAGTTTGATYMTGGCTCAG-3' (SEQ ID NO: 87) and the reverse 1510R primer 5'-ACGGYTACCTTGTTACGACTT-3' (SEQ ID NO: 88). After sequencing, BLASTn searches were performed using SILVA_138.1 to define each isolate as either a previously characterized species or a candidate novel species, with 97% sequence similarity between operational taxonomic units (OTUs) designated as the species-level cutoff.

[0178] Genome sequencing A selection of 463 phylogenetically diverse representative isolates was selected for whole-genome sequencing. DNA was extracted using the MP Biomedicals FastDNA SPIN kit for soil and sequenced on either an Illumina NextSeq2000 or Illumina NextSeq550. Sequencing reads were trimmed using Trimmomatic v0.38 and assembled using SPAdes v3.13.0. Assembled genomes underwent quality control using CheckM v1.1.3 (Parks et al., 2014) to look for completeness (>95%) and contamination (<5%). Genomes that passed quality control were annotated using Prokka v1.13 (Seeman, 2014).

[0179] Metagenomic sequencing and genome comparison DNA was also extracted from metagenomic communities scraped from non-confluent agar plates using the same DNA isolation process.

[0180] For candidate genomes of interest, genome annotation files were used as input into Roary v3.13.0 (Page et al., 2015) to identify and align core genes within the genome cluster. The core gene alignment was used to generate a maximum likelihood phylogenetic tree using RAxML v8.2.11 (Stamatakis, 2014) with the GTR GAMMA model. The phylogenetic tree was visualized using interactive tree of life (iTOL). Differences in gene abundance between clades were determined using the Roary output and by examining the data for genes present in every strain of the selected clade and genes absent from any other strain. The presence of virulence genes within the genome was determined using diamond (Buchfink et al., 2021) with the VFDB (Liu et al., 2019) list of virulence proteins and a percent identity cutoff of >70%.

[0181] RNA sequencing RNA was extracted from both patient-derived mucosal samples and stimulated Caco2 cells using the QIAGEN RNeasy Mini Kit, following a protocol modified to include the use of a FastPrep96 high-throughput homogenizer (MP Biomedicals) for mucosal samples. For sequencing, libraries were generated using an in-house multiplex RNA-seq method (MHTP, Medical Genomics Facility), and paired-end sequencing (R1, 19 bp; R2, 72 bp) was performed on a NextSeq550 (Illumina) using the v2.5 High Output kit. Bcl2fastq (v2.20.0.422, Illumina) was used for base calling.

[0182] RNA sequencing analysis of patients RNA sequencing analysis was performed in R (v3.5.1). The scPipe package (v1.2.1) was used to process and demultiplex the data. Read alignment was performed using the RSubread package (v1.30.9). An index was constructed using the Ensembl Homo sapiens GRCh38 primary assembly genome file, and alignment was performed using default settings. Aligned reads were mapped to exons using the sc_exon_mapping function with the Ensembl Homo sapiens GRCh38 v98 GFF3 genome annotation file. The resulting BAM files were demultiplexed, and the mapping of reads to exons was associated with each individual sample using the sc_demultiplex function. Total counts for each gene for each sample were obtained using the sc_gene_counting function (with UMI_cor=1). Additional gene annotation was obtained using the biomaRt package (v2.36.1), and DGEList objects were created with counts and gene annotations using the edgeR package (v3.28.1).

[0183] Various gene set collections were obtained from the Broad Institute Molecular Signature database (v5.2) using the EGSEA package (v1.14.0). The HALLMARK_INFLAMMATORY_RESPONSE gene set from the Hallmark gene set collection was used to classify samples as inflammatory (IR) or non-inflammatory (NR). The log2CPM expression values ​​for the 166 detected genes, inflammatory response genes, were used for k-means clustering using the kmeans function from the R stats package with two centers and 100 random starts. Multidimensional scaling plots were generated based on the log2CPM expression values ​​using plotMDS from the limma package (v3.42.0). Pairwise gene selection was performed using the top 500 genes to show the overall distance between samples. Common gene selection using all 166 detected HALLMARK_INFLAMMATORY_RESPONSE genes was used to reveal k-means clustering classification.

[0184] Differential expression analysis was performed using limma. Samples were assigned to six groups based on site (T, C, or R) and inflammatory status (IR or NR) as determined from k-means clustering of inflammatory genes. Groups and sequencing batches were incorporated into a design matrix. Counts were transformed to also incorporate sample weights, and associated weights were calculated using the voomWithQualityWeights function. The output of voomWithQualityWeights was used for each patient as a blocking factor in the duplicateCorrelation function to calculate the within-patient consensus correlation. The value of voomWithQualityWeights was then recalculated with the blocking factor and consensus correlation included, and the output was then used in duplicateCorrelation to update the consensus correlation. A linear model was fitted using the lmFit function using the final voomWithQualityWeights output, the design matrix, the blocking factor, and the consensus correlation. Regions with and without inflammation within each intestinal site were compared using the contrast.fit function.

[0185] For differential expression analysis, conservative t-statistics were calculated using the treat function with a 1.2-fold cutoff. Differentially expressed genes were determined using a false discovery rate (FDR)-adjusted p-value of less than 0.05. The fry rotational gene set test was used to examine the Caco-2 gene set, incorporating the log2 fold change values ​​of S149.v.64_8hr as gene weights. Both up- and down-regulated genes or only up-regulated genes were used. As with lmFit, expression values ​​and associated weights were obtained from the output of voomWithQualityWeights, and block values ​​and consensus correlation values ​​were also used. Gene set enrichment was displayed using the barcode plot function, and t-statistics were recalculated using eBayes without the fold change threshold. Gene set testing for different contrasts was performed using the cameraPR function, which uses a pre-ranked unobtrusive t-statistic (recalculated using the eBayes function, but not treat, without a fold-change cutoff). Relative log2 counts per million (CPM) expression values ​​were used for heatmaps. The edgeR cpm function was used to obtain log2 CPM values. Relative values ​​were obtained for each cell line by subtracting the mean log2 CPM value for each untreated sample, obtained using the cpmByGroup function. Heatmap scales were truncated as indicated.

[0186] RNA sequencing analysis of Caco2 scPipe, biomaRt, and edgeR were used as described above. Lowly expressed genes were instead filtered using the filterByExpr function. A linear model was fitted based on expression values ​​from the voom and design matrices. Differential expression was again performed using treat and a 1.2-fold threshold. The original multiplexed R1 and R2 FASTQ files were demultiplexed using cutadapt v3.0 (error rate: 1, action: none) and the accession numbers...= / * Uploaded by...

[0187] Metagenomic and RNA sequencing analyses Metagenomic read data were analyzed using a reference database for taxonomic classification of metagenomes, constructed using complete RefSeq genomes for archaea, viruses, and bacteria, a vector collection (NCBI's UniVec db), and the human genome, as well as 463 high-quality genome sequences isolated from our PIBD cohort. Taxonomic assignment was performed using the CCMetagen pipeline v.1.2.5 (Marcelino et al., 2020). Indexing to the reference sequence was performed using KMA v.1.3.13 (Clausen et al., 2018) using the "-NI-Sparse TG" option. Mapping was performed using KMA using the "-1t1-mem_mode-and-apm p-ef" option, and taxonomic assignment was obtained using CCMetagen using the "-du fr-off y" option, which enabled abundance estimates to be calculated in terms of read counts. Bacterial species identified by fewer than 100 sequence reads were excluded from the analysis, and a Center logratio transformation was applied using the MixOmics R package (Rohart et al., 2017). We next sought to identify bacterial species most correlated with intestinal inflammation (as identified by RNA sequencing analysis) using sparse partial least squares regression (Cao et al., 2009), and visualized the results using clustered image maps (MixOmics R package).

[0188] Bacterial preparation for cell culture Bacterial isolates were streaked onto YCFA agar plates and incubated in an anaerobic environment for 24 hours. For each isolate of interest, a single colony was grown overnight in pre-deoxygenated YCFA broth, then pelleted twice by centrifugation and washed with PBS. The pellet was then resuspended in 1 mL of DMEM, and an optical density reading was obtained.

[0189] Heat-killed isolates For experiments involving heat-killed isolates, bacteria were prepared as described above. After the isolates were washed twice, they were divided into 1 mL aliquots and heated to 99°C for 60 minutes. The isolates were then plated onto YCFA agar plates and incubated in an anaerobic environment for 24 hours to ensure no viable cells remained.

[0190] Correlation of optical density with colony forming unit counts To ensure an accurate multiplicity of infection (MOI) for bacterial stimulation, it was necessary to correlate optical density (OD) measurements obtained after washing the bacterial pellet with counts in colony-forming units (CFU). Therefore, bacterial pellets were washed and resuspended as described above, then incubated at an OD of 1. 600 After this, they were diluted with PBS until 10 -6 The isolates were serially diluted to 0.05 and plated directly onto YCFA agar. The isolates were incubated in an anaerobic environment for 24 hours, after which they were counted at the dilution factor where clear, uncoalesced colonies were observed. This resulted in an OD of 1. 600 We were able to obtain CFU counts that correlated with the

[0191] Culture and maintenance of human colon adenocarcinoma (Caco2) cells Caco2 epithelial cells (ATCC HTB-37) were maintained in complete Dulbecco's modified Eagle's medium (cDMEM; low glucose, GlutaMAX™ supplement, pyruvate) containing 10% (v / v) fetal calf serum (FCS). Cells were cultured at 175 cm 2 The cells were grown in flasks for 48 hours at 37°C in 5% CO2.

[0192] Seeding of Caco2 cells For bacterial stimulation, cells were plated at 1 x 10 per well in a final volume of 2 mL of cDMEM per well. 6 Cells were seeded in 6-well plates at 1000 x g for 48 hours before stimulation.

[0193] Serum starvation of Caco2 cells Caco2 cells were serum starved by replacing cDMEM with unmodified DMEM (low glucose, GlutaMAX™ supplement, pyruvate) 3 hours before stimulating the cells with the bacterial isolates.

[0194] Stimulation of Caco2 cells with bacterial isolates Bacterial cultures were prepared as described under "Bacterial Preparation." Stock cultures for each isolate were prepared at 1 x 10. 7 The bacterial isolates were then inoculated into Caco2 cells at a multiplicity of infection (MOI) of 10:1 by adding 200 μl of the bacterial stock solution to the Caco2 cells.

[0195] Collection of cell supernatants and cell lysates At 0, 2, 4, 6, 8, and 24 hours post-infection, 1 mL of cell supernatant was collected from each well and then stored at -80°C immediately after collection.

[0196] Cell lysates were collected at 0, 2, 4, 6, 8, and 24 hours postinfection. 350 μl of RLT lysis buffer containing 1% (v / v) β-mercaptoethanol was added to the cells, after which the cells were scraped off the surface of the plate, homogenized by pipetting, and immediately stored at -80°C.

[0197] Cytotoxicity: Lactate dehydrogenase (LDH) assay The CytoTox96® assay (Promega) was used according to the manufacturer's instructions to determine LDH release from cells after stimulation with bacterial isolates. In addition, an unstimulated cell control was used to determine any background cell death by using cells seeded in wells at the same concentration, but without the addition of bacterial isolates. Finally, a cell culture medium control was also used to account for any influence of the DMEM used.

[0198] Colony forming unit counts For each sample, 50 μl of cell supernatant was collected and diluted 10-fold with sterile pre-deoxygenated 1×PBS. -6 The cultures were serially diluted to 10 μl and plated directly onto YCFA agar. To allow for colony-forming unit (CFU) counts between samples, 10 μl aliquots of each dilution factor were plated in triplicate onto YCFA agar. Plates were counted after 24 hours of incubation in an anaerobic environment. Calculations were performed to determine CFU counts per milliliter of cell supernatant.

[0199] Scanning electron microscopy Images of candidate bacterial strains to be investigated were generated using scanning electron microscopy (SEM). Bacterial isolates were prepared by streaking isolates from previously purified glycerol stocks stored at -80°C. After 24 hours of incubation in an anaerobic environment, a single colony was inoculated into 15 mL of sterile, pre-deoxygenated YCFA broth and incubated for an additional 24 hours. The culture was then pelleted by centrifugation at 4000 × g for 10 minutes. The supernatant was discarded, and the pellet was resuspended in 10 mL of sterile 1× PBS. The resuspended pellet was repelleted by centrifugation at 4000 × g for 10 minutes. This process was repeated twice for each bacterial isolate. After a second PBS wash, the resuspended pellet was again pelleted by centrifugation at 4000 × g for 10 minutes. The pellet was then resuspended in 1 mL of Karnovsky's fixative solution and imaged on a Monash Micro Imaging system.

[0200] Example 2 - Identification of Biotherapeutic Strains A comprehensive bacterial culture collection offers the possibility of cohort-specific, reference-based metagenomic sequencing and experimental validation (Forster et al., 2019). To construct a pediatric inflammatory bowel disease (PIBD)-specific culture collection, 286 mucosal biopsies were obtained from 100 pediatric patients (PIBD: 58 patients, control: 42 patients) across three intestinal regions (terminal ileum: 93 samples; cecum: 96 samples; rectum: 97 samples). In total, 6,416 isolates representing 207 different species, including 53 novel species, were identified by 16S rRNA capillary sequencing (Bacteroidetes: 3,226 isolates, Firmicutes: 1,480 isolates, Actinobacteria: 370 isolates, Proteobacteria: 1,321 isolates, Fusobacteria: 17 isolates, and Verrucomicrobium: 2 isolates). To provide cohort-specific reference genome databases for reference-based metagenomic analysis, 463 phylogenetically diverse representative isolates were also subjected to whole-genome sequencing.

[0201] In addition to accurately defining the microbial community, establishing a detailed understanding of the cellular and molecular state at specific tissue sites is essential to fully elucidate host-microbe interactions. While endoscopy, when combined with histological assessment, is the gold standard for diagnosing IBD, these methods remain subjective and lack molecular insights that may influence microbial composition and interactions in the mucosal layer. To overcome these limitations, we complemented visual and histological assessments with RNA-sequencing-based transcriptional profiling of 231 matched samples from the terminal ileum, cecum, and rectum of 77 patients.

[0202] First, we examined the top 500 most variable genes across sample pairs, and found that the intestinal region had the greatest impact on gene expression, followed by the histologically defined inflammatory status of the samples. However, while the inflammatory status of a sample is histologically defined and correlates independently with the variation in gene expression seen across samples, many histologically inflamed samples clustered with non-inflamed samples. Therefore, we sought to define molecular inflammatory status using k-means consensus clustering, using genes from the Hallmark inflammatory gene set (Liberzon et al., 2015) to define inflammation. This method identified 69 molecularly inflamed samples (58 IBD, 11 non-IBD) and 162 molecularly non-inflamed samples (74 IBD, 88 non-IBD). Overall, 51 IBD samples (39%) and 10 non-IBD samples (10%) were reclassified from their histological classification according to their molecular profile; classification is based on this molecular status from here on.

[0203] Having established a comprehensive genome-sequenced culture collection and accurate classification of molecular inflammatory status within biopsy samples, we next sought to understand the microbial composition within these 231 intestinal samples. While shotgun metagenomic sequencing can provide high-resolution measurements at disease sites, the predominance of human DNA within biopsy samples limits the application of this best practice approach. To overcome this challenge, we applied a culture-based eukaryotic DNA depletion process to remove human DNA and enable shotgun metagenomic sequencing of these samples (Figure 1). This approach resulted in a median eukaryotic DNA representation of 0.01% of the total sample DNA composition (maximum: 0.03%, minimum: 0%), providing metagenomic sequencing data suitable for detailed reference-based metagenomic analysis.

[0204] To understand the host-microbe interactions that underpin phenotypic variation in disease manifestation, we undertook an integrated analysis of metagenomic and transcriptomic sequencing in the context of our 463 cohort-specific high-quality reference genomes and the RefSeq reference dataset (O'Leary et al., 2016). This revealed a significant correlation between TNFα signaling via the NF-κB response (P = 1.6 × 10 -22 ), TNFα signaling via IFNα response ( P = 2.8 × 10 -34 ), and TNFα signaling via IFNγ responses ( P = 2.3 × 10 -50 ), IL6 JAK STAT3 signaling ( P = 1 × 10 -39 ), as well as other Hallmark inflammatory response genes ( P = 4.9 × 10 -33 ) (Liberzon et al., 2015), while accounting for the compositional nature of microbiome species abundance data, allowed for the identification of bacterial clades associated with the upregulation of inflammation-related transcriptional pathways, including Bacteroides, Parabacteroides, and Phocaeicola. Notably, known health-related bacteria, including members of the genera Bacteroides, Parabacteroides, and Phocaeicola, were negatively correlated with genes associated with inflammation as defined by the Hallmark inflammatory signature, whereas pathogenic and opportunistic pathogens, including members of the genera Klebsiella and Salmonella, and Clostridium perfringens, showed a positive correlation with the inflammation-related Hallmark signature (Liberzon et al., 2015). In addition to these common pathogens, this analysis also identified an Enterococcus clade that was positively correlated with inflammatory signaling. Detailed analysis of Enterococcus isolates cultured from this cohort identified subclades enriched in IBD patients (P = 0.0077) and clades with comparable representation in both control and IBD patients (Fig. 2).

[0205] Six representative bacterial isolates with concordant genome sequences were selected from a cohort-specific bacterial culture collection (n = 12, six IBD-associated clades, six control clades) to undertake isolate-level genomic analysis and phenotypic characterization. Consistent with a more severe disease phenotype, genomic assessment of virulence factors in the IBD-associated and control clades identified a higher number of virulence genes in the IBD clade (median: 14 genes) compared with the control clade (median: 11.5 genes) (P < 0.01; Mann-Whitney U test) (Figure 3). These observations are consistent with previous data from a smaller cohort showing that predicted enterococci from IBD patients harbor more virulence factors than enterococci in control patients (Golinska et al., 2013). To validate these genomic predictions, cytotoxicity, as determined by lactate dehydrogenase (LDH) release into the extracellular medium, was assessed after 24 h of stimulation (multiplicity of infection: 10) of Caco2 intestinal epithelial cells with the bacterial candidate strains. Contrary to the genomic predictions, isolates from the control clade induced significantly greater cytotoxicity (mean = 42.59%) than isolates within the IBD-associated clade (mean = 11.14%) (P = 0.0006; paired t-test) (Figure 4). Notably, no clade-specific morphological differences were detected by scanning electron microscopy (SEM) (Figures 4 and 5), and cytotoxicity was lost after heat treatment, suggesting that the observed phenotypes were dependent on bacterial viability (Figure 6).

[0206] To further explore host-microbe interactions, isolates CC00149 (IBD-associated clade) and CC00064 (control clade) were selected as representative isolates from the identified subclades. RNA sequencing of the transcriptional response to each of these isolates in Caco2 cells was performed at 4, 8, and 24 hours after stimulation. While the majority of differentially expressed genes were induced in response to both isolates and no differences were observed at 4 hours, 76 isolate-specific genes were differentially expressed at 8 hours (57 increased in CC00149 and 19 increased in CC00064) (Table 1), and 86 genes were differentially expressed at 24 hours (33 increased in CC00149 and 53 increased in CC00064) (Table 2; Figure 7). In addition, the Hallmark hypoxic response was most significantly upregulated in response to stimulation with CC00064 (P = 1.41 × 10 -10 ), Hallmark TNFα signaling via the NF-κB response was most significantly upregulated in response to CC00149 at 8 hours post-stimulation ( P = 7.9 × 10 -15 ) (Liberzon et al., 2015) (Table 3).

[0207] To understand the relationship between clade-specific transcriptional changes observed at 24 hours and cytotoxicity, we focused on 76 genes that were either significantly up- or down-regulated in CC00149 versus CC00064 at 8 hours post-stimulation. Differences at this time point could represent important, unconfounded responses associated with broad cytotoxicity at 24 hours. Consistent with this hypothesis, examination of the gene set revealed that TNFα signaling via NF-κB (P=7.3×10) was significantly down-regulated. -16 ), activation of pro-apoptotic pathways ( P = 2.91 × 10 -2 ), and initiation of the endoplasmic reticulum stress response ( P = 2.42 × 10 -7 ) were identified as being significantly upregulated in response to CC00149 compared to CC00064 (Table 4).

[0208] To assess the clinical relevance of these significant clade-specific responses, we next compared the transcriptional profiles measured in our Caco2 in vitro model with those observed in mucosal samples (n=231) from our patient cohort (n=77). Focusing on the 76 genes that were significantly differentially expressed in in vitro Caco2 cells at 8 hours, we found that within the patient cohort dataset, significant enrichment was observed in patient biopsy samples from the cecum (P=3.6×10 -8 ) and patient biopsy samples from the rectum (P = 8.6 × 10 -9 ) were observed in both the Caco2 model system and the primary biopsy samples. However, no such relationship was detected in the terminal ileum (P = 0.82) (Figure 8), which may be explained by the colonic origin of Caco2 cells in our co-culture model. Overall, 34.2% (n = 26) of the 76 genes were statistically differentially expressed in both the Caco2 model system and the primary biopsy samples, showing expression changes in the same direction (20 up-regulated and 6 down-regulated) (Figure 8). Importantly, these included CHAC1 (P = 1.53 × 10 -8 ), CEBPB (P = 3.37 × 10 -7 ), TRIB3 (P = 5.25 × 10 -6 ), PPP1R15A (P=0.011), DDIT3 (P=4.5×10 -5 Genes known to be associated with cell death and the unfolded protein response were included, including IL-1 (P = 0.020), ATF4 (P = 0.020), and XBP1 (P = 0.043). Collectively, these results suggest clade-specific differential regulation of cell death pathways associated with IBD mucosal immune status, which may be suitable for clinical intervention in selected patients.

[0209] Overall, 44 novel strains of a novel clade of non-inflammatory Enterococcus, designated herein as clade 149, were identified: these are represented by the 16s rRNA gene sequences provided as SEQ ID NO: 1 to SEQ ID NO: 44, and include the Enterococcus strain V19 / 018754 deposited with the National Measurement Institute (Australia) on September 9, 2019. Genus Enterococcus deposited under CC00149 and V19 / 018755 Genus CC00259, as well as Enterococcus, deposited with the National Measurement Institute (Australia) on June 29, 2021 under number V21 / 013048. Genus Additionally, 30 novel strains of a novel clade, designated herein as Clade 64, of the inflammatory Enterococcus genus, which is closely related to the non-inflammatory Enterococcus genus described above, have been identified; these are represented by the 16s rRNA gene sequences provided as SEQ ID NOs: 45 to 74, and include the Enterococcus strain deposited with the National Measurement Institute (Australia) under V21 / 013046 on June 29, 2021. Genus Enterococcus deposited under CC00064 and V21 / 013047 Genus CC00619, as well as Enterococcus, deposited with the National Measurement Institute (Australia) on March 18, 2020 under number V20 / 006238. Genus CC00262, and Enterococcus deposited with the National Measurement Institute (Australia) under V21 / 014119 on July 20, 2021. Genus Contains CC0002. [Table 1-1] [Table 1-2] [Table 1-3] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 3-1] [Table 3-2] [Table 4-1] [Table 4-2]

[0210] Example 3 - Detection of Biotherapeutic Strains The detection and differentiation of bacterial strains of the present invention allows beneficial therapeutic interventions (both conventional and microbiome-based) to be directed to best suit the needs of patients. This capability has the potential for use as a companion diagnostic for, for example, stratifying IBD patients. Numerous methods could be applied to achieve this differentiation, including various assays based on DNA, RNA, metabolic signatures, and proteins. The data below demonstrate that this method can be implemented for specific detection using DNA and qPCR-based implementation.

[0211] method qPCR was performed on a QuantStudio™ 6 Flex Real-Time PCR System using the following primers: Non-inflammatory (non-cytotoxic) strains Forward: CGAGGTACACCGTAAGTTGTTGCT (SEQ ID NO: 75) Reverse: ACCAGGACACGTAGACTTCACAGT (SEQ ID NO: 76) Inflammatory (cytotoxic) strains Forward: CCTTTACCATGGCCGTGTAGC (SEQ ID NO: 83) Reverse: CCATGAATGGTGTTCCTCCTTCTC (SEQ ID NO: 84)

[0212] DNA was diluted 1:5 in DEPC-treated water (Applied Biosystems). Applied Biosystems SYBR Magic Master Mix (Applied Biosystems; Foster City, California, USA) was used in a total reaction volume of 10 μl. Each reaction contained 5 μl of SYBR Magic Master Mix, 0.2 μl each of the appropriate forward and reverse primers (final concentration of 0.2 mM each), 2 μl of DNA, and 2.6 μl of DEPC water. Samples were loaded in triplicate into a MicroAmp Optical 384-well reaction plate (Applied Biosystems) and sealed with a MicroAmp Optical adhesive cover. A no-template negative control was included on every plate.

[0213] Both primer sets were found to be clade-specific, thereby distinguishing between the non-inflammatory and inflammatory strains of the present invention (Figure 9).

[0214] Example 4 - Sequence Identity Comparison Because the strains of the present invention contain a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 74 (and in particular SEQ ID NO: 45), the strains of the present invention were compared to SEQ ID NO: 89 to SEQ ID NO: 217 using sequence identity analysis.

[0215] In preferred embodiments of the invention, a bacterial strain of the invention comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 74 does not comprise any one of SEQ ID NOs: 89 to 217 as set forth in Table 5. As discussed above under preferred embodiments, in further embodiments, a bacterial strain of the invention, or a strain for use in the invention, has at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96% or more identity to a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 74, or to one or more of SEQ ID NOs: 1 to 74. 9.5%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, with the proviso that the 16s ribosomal RNA (rRNA) gene does not comprise any one of SEQ ID NOs: 89 through 217. In alternative embodiments, the 16s ribosomal RNA (rRNA) gene comprises any one of SEQ ID NOs: 89 through 217.

[0216] It will be understood by those skilled in the art that numerous changes and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described, and the present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

[0217] All publications discussed and / or referenced herein are incorporated herein in their entirety.

[0218] Any discussion of documents, acts, materials, devices, articles, or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. Such discussion is not to be construed as an admission that any or all of these matters form part of the prior art or were common general knowledge in the art relevant to the present invention as they existed before the priority date of each claim of this application.

[0219] [ka]

[0220] Nucleotide sequence [Table 5]

[0221] array: The list shown above in Table 5 is used to interpret the information presented below. [ka] [ka] [ka]

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

change

Claims

1. 1. A biotherapeutic composition for use in reducing or preventing gastrointestinal mucosal inflammation in a subject, said composition comprising a non-inflammatory strain of Enterococcus, preferably wherein the subject is a human.

2. 2. The composition of claim 1, wherein the strain comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs:1 through 44, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs:1 through 44.

3. 1. A biotherapeutic composition for use in treating or preventing a gastrointestinal imbalance in a subject, said composition comprising a strain of Enterococcus comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NO:1 through SEQ ID NO:74, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NO:1 through SEQ ID NO:74, preferably wherein the subject is a human.

4. 4. The composition of claim 3, wherein the Enterococcus is a non-inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 44, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 to 44.

5. 4. The composition of claim 3, wherein the Enterococcus is an inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs:45 through 74, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs:45 through 74.

6. 4. The composition of claim 3, wherein the Enterococcus is an inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs:45-50, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs:45-50.

7. 4. The composition of claim 3, wherein the Enterococcus is an inflammatory strain and comprises a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 through 74, or a nucleotide sequence with at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 through 74, with the proviso that the 16s ribosomal RNA (rRNA) gene having a given nucleotide sequence or a nucleotide sequence with at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 through 74 does not comprise a nucleotide sequence as set forth in any one of SEQ ID NOs: 89 through 217.

8. 8. The composition of any one of claims 1 to 7, wherein the imbalance and / or inflammation is associated with one or more of inflammatory bowel disease (IBD), pouchitis, irritable bowel syndrome (IBS), enterobacterial infection, metabolic disease, neuropsychiatric disorder, autoimmune disease, allergic disorder, hepatic encephalopathy or cancer.

9. 9. The composition of claim 8, wherein the IBD is ulcerative colitis (UC) or Crohn's disease.

10. 8. The composition of any one of claims 1 to 7, wherein the composition further comprises a prebiotic agent, preferably wherein the composition further comprises a carrier, more preferably wherein the composition further comprises insoluble fiber, a buffering agent, an osmotic agent, an antifoaming agent and / or a preservative.

11. The composition of claim 1, wherein: - the composition comprises a chemostat medium, - the composition is a saline composition, - the composition is formulated for oral or rectal administration; - the composition further comprises a stabilizer and / or a cryoprotectant, - the composition is in the form of a capsule, tablet or enema; The composition according to any one of claims 1 to 7, characterized by one or more of the following:

12. The composition of any one of claims 1 to 7, wherein the composition is in the form of a capsule or tablet, and the capsule or tablet is enteric coated, pH dependent, sustained release, and / or gastroresistant.

13. 1. An isolated, non-inflammatory strain of Enterococcus, preferably comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 1 to 74, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 1 to 74.

14. 14. A composition comprising at least one strain of bacteria according to claim 13, preferably said composition being a biotherapeutic composition, more preferably said composition comprising a cryoprotectant.

15. 1. A method for preparing a biotherapeutic composition, comprising: i) culturing at least one strain of Enterococcus according to claim 13, and ii) mixing the Enterococcus bacterium obtained in i) with a pharmaceutically acceptable carrier. A method comprising:

16. 1. An in vitro method for analyzing the microbiome of the gastrointestinal tract of a subject, comprising: i) obtaining a sample containing bacteria from the gastrointestinal tract of said subject; ii) analyzing said sample for the presence of the Enterococcus strain of claim 13. wherein preferably said sample is a DNA sample, more preferably said sample is analysed by DNA amplification and / or DNA hybridisation.

17. 17. The method of claim 16, wherein the presence of a strain of Enterococcus comprising a 16s ribosomal RNA (rRNA) gene having a nucleotide sequence as set forth in any one of SEQ ID NOs: 45 to 74, or a nucleotide sequence having at least 99%, at least 97%, or at least 95% sequence identity to one or more of SEQ ID NOs: 45 to 74, indicates that the gastrointestinal tract is inflamed or that previously detected imbalance and / or gastrointestinal inflammation is at least partially attributable to the bacterial strain.

18. Use of at least one strain of Enterococcus according to claim 13 for the manufacture of a medicament for treating or preventing an imbalance in the gastrointestinal tract of a subject.

19. 14. Use of at least one non-inflammatory strain of Enterococcus according to claim 13 for the manufacture of a medicament for reducing or preventing gastrointestinal mucosal inflammation in a subject.

Images