A dual recombinant AAV8 vector system encoding otoferlin isoform 5 and uses thereof
Patent Information
- Application Number
- JP2024515645
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-01-27
- Filing Date
- 2022-09-09
- Publication Date
- 2025-08-05
AI Technical Summary
Current gene therapy approaches for hearing loss, particularly in DFNB9 deafness, face challenges in achieving efficient and targeted delivery and expression of otoferlin protein in inner ear hair cells, limiting therapeutic efficacy.
A dual AAV vector system is developed, dividing the otoferlin cDNA into two expression cassettes and using the CMV promoter in AAV8 capsids to enhance transduction efficiency and specificity in inner ear hair cells, allowing for optimal protein expression and restoration of hearing.
The dual AAV vector system effectively transfers and expresses otoferlin in inner ear hair cells, restoring hearing in DFNB9 mouse models, demonstrating significant therapeutic potential for treating hearing loss.
Smart Images

Figure 00000043_0000 
Figure 00000043_0001 
Figure 00000043_0002
Abstract
Description
Summary of the Invention
[0001] The present invention is based on the observation that a dual AAV vector strategy encoding isoform 5 of otoferlin cDNA split into two expression cassettes packaged in and delivered by AAV8 capsids can efficiently deliver otoferlin cDNA to inner ear hair cells (IHCs). Furthermore, the inventors emphasized that the use of a CMV promoter in one of the two AAV8 vectors results in significant expression of otoferlin in these specific cells. Since the AAV serotype and the type of promoter used are two major factors that have a significant effect on transduction efficiency, the development of the vector system of the present invention will give optimal therapeutic benefits to patients suffering from DFNB9 hearing loss. To further improve this therapeutic effect, the inventors finally tested several specific otoferlin-encoding dual vector constructs and identified enhanced transfection rates and highly effective in vitro and in vivo otoferlin expression in the mature cochlea of DFNB9 mouse models, resulting in the restoration of their hearing. [Background technology]
[0002] More than half of cases of nonsyndromic severe congenital hearing loss have a genetic cause, with most (approximately 80%) being autosomal recessive (DFNB) (Duman D. & Tekin M, Front Biosci (Landmark Ed) 17:2213-2236 (2012)). Genetic diagnosis of hearing loss provides essential information for cochlear gene therapy, and rapid advances have been made in both accuracy and accessibility of genetic testing in the past few years. Identification of mutations in syndromic hearing loss genes can occur years before a patient develops symptoms, allowing time to plan disease management.
[0003] Deafness genes code for proteins with a wide range of molecular functions essential for the functioning of the cochlea, such as sensory organ development, sound transduction in hair cell stereocilia, maintenance of endocochlear potential (EP) and high concentrations of extracellular potassium, and synaptic neurotransmission between hair cells and spiral ganglion neurons (SGNs). The major proteins made by deafness genes include ion channels and transporters, gap and tight junctions, protein subunits of the cytoskeleton and molecular motors, as well as transcription factors that are transiently expressed during cochlear development. Whether a mutation affects early cochlear development and causes significant cellular degeneration is a major factor in determining the "treatment window," a critical issue in this therapeutic field.
[0004] Although prosthetic cochlear implants are currently used for rehabilitation (Kral A & O'Donoghue GM N Engl J Med 363(15):1438-1450(2010)), hearing restoration is far from complete, especially for speech perception in noisy environments or for music perception, due to the inherent limitations in frequency resolution imposed by electrical interference between channels.
[0005] The main motivation for developing biological treatments is to restore hearing without implanting any prosthetic device and achieve a quality and unit cost of sound resolution much better than what is currently achievable by cochlear implants. In particular, gene therapy by localized adeno-associated virus (AAV)-mediated gene therapy has already been proposed to treat human forms of hearing loss (Zhang et al, Frontiers in Molecular Neuroscience, vol. 11, Art. 221, 2018). This approach is currently being tested in various preclinical and clinical trials for several genetic disorders, including Parkinson's disease, vision disorders and metabolic disorders.
[0006] Although such trials have not yet been performed for hearing loss in humans, the anatomy of the human inner ear is ideal for in vivo gene therapy approaches, as the relatively isolated, fluid-filled compartment offers the opportunity for localized virus application with low risk of dissemination.
[0007] In the last decade, AAV8 serotypes carrying a hybrid CMV enhancer / chicken β-actin promoter (CAG promoter) have been shown to specifically target the cochlea and vestibular hair cells (Emptoz et al. Proc Natl Acad Sci US A. 2017 Sep 5;114(36):9695-9700). Using this AAV construct, hearing was restored in the mouse DFNB59 model and both hearing and balance were improved in mouse models of Usher 1G and IIIA syndromes (Delmaghani et al. Cell. 2015 Nov 5;163(4):894-906; Emptoz et al. Proc Natl Acad Sci US A. 2017 Sep 5;114(36):9695-9700; Dulon et al. J Clin Invest. 2018 Aug 1;128(8):3382-3401). In addition, we provided the first proof of principle that dual AAV gene therapy reverses the deafness phenotype in the mouse DFNB9 model, a severe form of deafness, raising hopes for future gene therapy trials in DFNB9 patients. Remarkably, dual AAV therapy not only prevented these mutant mice from becoming deaf, but also restored hearing in mice injected after hearing development. These results offer hope for future gene therapy trials of DFNB9 (Akil et al. Proc Natl Acad Sci US A. 2019 Mar 5;116(10):4496-4501).
[0008] The development of vectors with optimized properties, including enhanced targeting specificity, to ensure specific infection of defective cells and high level expression of the diseased protein in these specific cells now appears to be an essential step in the development of a curative gene therapy for inherited inner ear disorders. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0009] In this context, the present inventors have designed novel therapeutic recombinant vectors that can be used in DFNB9 preclinical trials. These vectors differ from those of the prior art in that they express human otoferlin protein isoform 5 when placed under the control of a CMV promoter followed by an intron sequence as required, and are packaged into AAV8 capsids that specifically target inner ear hair cells (IHCs). The results of their comparison identified specific constructs that efficiently encode otoferlin protein isoform 5 in the right place, at the right level, and at the right time, resulting in optimal therapeutic effects.
[0010] It is well known that the otoferlin cDNA sequence (6 kb) exceeds the packaging capacity of AAV (5 kb). Therefore, a dual AAV vector strategy was employed, similar to the method successfully used in a previous mouse study (Akil et al. Proc Natl Acad Sci US A. 2019 Mar 5;116(10):4496-4501). The predicted cochlear isoforms of human otoferlin cDNA (isoform 5 and novel isoform) were split into two expression cassettes, both delivered by AAV8 vectors. Because the efficacy of dual AAV transduction may be affected by the split site within the otoferlin cDNA, several cleavage sites between the exons encoding the otoferlin transcript were examined. The corresponding 5' and 3' portions of human otoferlin cDNA were cloned into a shuttle vector with AAV inverted terminal repeats (ITRs), and a ubiquitous CMV promoter was inserted upstream of the 5' human otoferlin cDNA, followed by an intron sequence, if required. The different dual plasmids were then tested in vitro by transfecting HEK293 cells using liposomes as carriers, and OTOF expression was assessed 48 hours after transfection using immunocytochemistry and Western blot (Figures 3, 5, and 7). The recombination efficiency of various dual AAV OTOF vectors to produce full-length protein was further investigated by RT-PCR (Figure 7A). The dual vectors showing the best transfection rate and the most effective in vitro protein expression were further investigated by confirming the accuracy of the recombination-inducing regions that produced full-length protein. The dual expression cassettes were then packaged into AAV8 capsids and delivered in vivo to the cochlea of a DFNB9 mouse model. We used immunoconfocal microscopy to determine whether otoferlin protein was correctly targeted to IHCs after cochlear AAV delivery.Hearing recovery in mice was assessed by auditory evoked brainstem response recordings at various stages after AAV delivery.
[0011] Otoferlin is abundantly expressed in sensory IHCs in the cochlea. It is also expressed in other cells of the central nervous system. Otoferlin plays a key role in the final step of synaptic vesicle fusion at the cochlear hair cell synapse with the afferent spiral ganglion neuron. More precisely, otoferlin is important for exocytosis at the auditory ribbon synapse (Roux et al, Cell 127(2):277-89, 2006). In humans, mutations affecting the otoferlin gene ("OTOF gene") result in severe nonsyndromic bilateral hearing loss that occurs postnatally and before language acquisition. Some of them also result in thermosensitive non-syndromic neurological hearing impairments induced by large increases in body temperature (e.g., in the case of fever, see Marlin S.et al, Biochemical and Biophysical Research Communications, 394(2010)737-742; Varga R.et al, J.Med.Genet 2006;43:576-581; Zhang Q.et al, Hearing research, Volume 335, May 2016, Pages 53-63; Starr A.et al, Brain, Volume 119, Issue 3, June 1996, Pages 741-753).
[0012] At least 75 mutations have been identified so far, of which 7 (P.Q994VfsX6, P.I515T, p.G541S, PR1607W, p.E1804del, c.2975_2978delAG / c.4819C>T, c.4819C>T(c.R1607W)) are known to be temperature sensitive, as reviewed in Pangrsic T.et al, Trends in Neurosciences, 2012, col.35, No.11. These deafness phenotypes (constitutive and induced) are found worldwide and are known as "Deafness, Autosomal Recessive 9" or "DFNB9" deafness. DFNB9 deafness accounts for up to 10% of autosomal recessive nonsyndromic hearing loss, thereby still ranking within the top 5 of inherited hearing disorders requiring therapeutic intervention.
[0013] Importantly, the present inventors have shown that the AAV8 vector containing the 5' part of human otoferlin cDNA under the transcriptional control of the CMV promoter is optimal and efficient in target cells.Therefore, the present inventors have constructed a double AAV vector system that contains the identified promoter and two halves of the otoferlin gene for IHC, where trans-splicing and / or homologous recombination occurs, resulting in the expression of the full-length protein.
[0014] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For purposes of the present invention, the following terms are defined below.
[0015] definition As used herein, the terms "nucleic acid" and "nucleotide sequence" and "polynucleotide sequence" refer to deoxyribonucleotide or ribonucleotide polymers in either single- or double-stranded form and, unless otherwise limited, include known analogues of naturally occurring nucleotides that can function in a manner similar to naturally occurring nucleotides.
[0016] As used herein, the term "otoferlin" refers to the otoferlin polypeptide. It is abbreviated herein as "OTOF." This polypeptide is also known as "AUNB1," "DFNB6," "DFNB9," "NSRD9," and "FER1L2." The polypeptide is a member of the ferrin family of transmembrane proteins with C2 domains as synaptotagmins, PKC and PLC (Yasunaga S et al, J Hum Genet. 2000 Sep;67(3):591-600). The long form contains six C2 domains. As mentioned above, the polypeptide is involved in synaptic vesicle fusion between cochlear hair cells and afferent spiral ganglion neurons (Roux et al, Cell 127(2):277-89, 2006; Michalski et al, Elife, 2017 Nov 7;6 e31013).
[0017] As used herein, the term "otoferlin polypeptide" refers to isoform 5 (variant e) of the wild-type human otoferlin polypeptide of SEQ ID NO: 5 (corresponding to Genbank number NP_001274418) and homologous sequences. Otoferlin polypeptides are encoded, for example, by the cDNA sequences NM_001287489.1 (SEQ ID NO: 91, the coding sequence for said isoform begins at nucleotide 186) and SEQ ID NO: 15 (corresponding to the coding sequence for said isoform).
[0018] Also encompassed herein are homologous polypeptides whose amino acid sequence shares at least 70% identity and / or similarity with SEQ ID NO:5 and retain at least one biological function of the otoferlin polypeptide of SEQ ID NO:5. For example, this biological function is related to the regulation of vesicle fusion at ribbon synapses of cochlear inner hair cells that activate primary auditory neurons (Michalski et al, Elife, 2017 Nov 7;6 e31013). This regulation can be assessed by classical ex vivo electrophysiological measurements. The homologous sequence more preferably shares at least 75%, even more preferably at least 80%, at least 85%, or at least 90% identity and / or similarity with SEQ ID NO:5. If the homologous polypeptide is significantly shorter than SEQ ID NO:5, local alignment can be considered.
[0019] Said homologous polypeptide may, for example, have the amino acid sequence set forth in SEQ ID NO: 1 (corresponding to Genbank number NP_919224.1). Said sequence characterizes isoform a (variant 1) of the wild-type human otoferlin polypeptide. This variant has an alternating in-frame exon in the 3' coding region compared to SEQ ID NO: 5. It further contains a distinct C-terminus compared to SEQ ID NO: 5 (but its N-terminal portion is the same).
[0020] Said homologous polypeptides may also have the amino acid sequence shown in SEQ ID NO: 2 (corresponding to Genbank number NP_004793.2) or SEQ ID NO: 3 (corresponding to Genbank number NP_919303.1), which correspond to the short isoforms b and c (variants 2 and 3), respectively. More precisely, SEQ ID NO: 2 represents isoform b (variant 2, also called "truncated 1"), which has a shorter N-terminus and is missing one segment compared to SEQ ID NO: 1. On the other hand, SEQ ID NO: 3 represents isoform c (variant 3, also called "truncated 2"), which has a shorter and distinct C-terminus compared to SEQ ID NO: 1, and therefore differs in the 5'UTR and coding sequence compared to variant 1 (SEQ ID NO: 1).
[0021] Said homologous polypeptide may also have the amino acid sequence shown in SEQ ID NO: 4 (corresponding to Genbank number NP_919304.1), which corresponds to isoform d (variant 4). This variant differs in the 5'UTR and coding region, as well as the 3' coding region, compared to variant 1. The resulting isoform (d) has a shorter N-terminus and a different C-terminus compared to the isoform of SEQ ID NO: 1. It is encoded by SEQ ID NO: 14 (corresponding to Genbank number NM_194323.3).
[0022] In one embodiment, the vector system of the present invention may allow the expression of a functional fragment of the otoferlin polypeptide of SEQ ID NO: 5. The term "functional fragment" in this specification means any fragment of the human otoferlin polypeptide or any fragment of a polypeptide having a homologous sequence as defined above, said fragment retaining at least one biological function of the otoferlin polypeptide for this context. For example, this biological function is related to the regulation of vesicle fusion at ribbon synapses of cochlear inner hair cells that activate primary auditory neurons (Michalski et al, Elife, 2017 Nov 7; 6 e31013). This regulation can be evaluated by classical ex vivo electrophysiological measurements.
[0023] In another embodiment, the vector system of the present invention may allow the expression of three specific homologous proteins of variant 5 (see Example 2 and related Figure 6). These three alternative OTOF isoforms have the amino acid sequences of SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8. They may be encoded by the cDNA sequences of SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:18, respectively. Therefore, the vector system of the present invention preferably uses any of these novel isoforms, as they are believed to have the potential to restore hearing in humans.
[0024] After recombination, these novel isoforms, in addition to the current human isoform 5 transcript, can in situ encode proteins of SEQ ID NO:6, SEQ ID NO:7 and / or SEQ ID NO:8 that have the potential to restore hearing in humans.
[0025] In certain embodiments, the vector system of the invention thus allows the expression of SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, or their functional homologous polypeptides that retain the activity of these novel isoforms and / or SEQ ID NO:5. These functional homologs are those whose amino acid sequence shares at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% identity and / or similarity with SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8. In case the homologous polypeptide is significantly shorter than SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, local alignments can be considered.
[0026] The present invention provides systems that code for homologous amino acid sequences that are "analogous" to these sequences as defined above. In this case, they contain coding sequences that can be, for example, the long cDNA sequence NM_194248.3 (isoform a or variant 1, SEQ ID NO: 1), the shorter cDNA sequence NM_004802.4 (isoform b or variant 2, SEQ ID NO: 12), the cDNA sequence NM_194322.3 (isoform c or variant 3, SEQ ID NO: 13) or the cDNA sequence NM_194323.3 (isoform d or variant 4, SEQ ID NO: 14). The coding sequences can also have the sequences SEQ ID NO: 16, 17 or 18, which correspond to the cDNAs of the novel isoforms of the OTOF gene described below.
[0027] In a preferred embodiment, said coding sequence is from the human otoferlin gene of SEQ ID NO: 91 (NM_001287489.1), which encodes transcript variant 5, the coding sequence of which starts at nucleotide 186. The coding sequence is more preferably as disclosed in SEQ ID NO: 15. Thus, in the vector system of the invention, the coding sequence is preferably SEQ ID NO: 15. It is also possible to use any homologous sequence thereof having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 15.
[0028] In the context of the present invention, the identity percentage between two homologous sequences is preferably determined by global alignment of the entire sequences when the sequences are approximately the same size. This alignment can be performed by algorithms well known to those skilled in the art, for example the algorithm disclosed in Needleman and Wunsch (1970). Thus, the sequence comparison between two amino acid sequences or two nucleotide sequences can be performed by using any software well known to those skilled in the art, for example the "needle" software, using a "gap open" parameter of 10, a "gap extension" parameter of 0.5 and the "Blosum62" matrix.
[0029] When local alignment of sequences is to be considered (e.g., in the case of a homologue having a smaller size than the sequence of the present invention), said alignment can be performed by conventional algorithms, for example the algorithm disclosed in Smith and Waterman (J. Mol. Evol. 1981; 18(1) 38-46).
[0030] The "similarity" of two targeting amino acid sequences can be determined by calculating the similarity score of the two amino acid sequences. As used herein, "similarity score" refers to the score generated for two sequences using the BLOSUM62 amino acid substitution matrix, gap presence penalty of 11 and gap extension penalty of 1 when the two sequences are optimally aligned. Two sequences are "optimally aligned" when aligned to generate the maximum score possible for the sequence pair, which may require the introduction of gaps in one or both sequences to achieve the maximum score. Two amino acid sequences are substantially similar if their similarity score exceeds a certain threshold. The threshold may be any integer ranging from at least 1190 to the maximum score possible for a particular reference sequence (e.g., SEQ ID NO: 15). For example, the threshold similarity score may be 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, 1500 or more. In certain embodiments of the invention, if the threshold score is set at, for example, 1300 compared to a reference sequence, then any amino acid sequence that can be optimally aligned with said reference sequence to generate a similarity score greater than 1300 is "similar" to said reference sequence. Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well known in the art and are described, for example, in Dayhoff et al. (1978), "A model of evolutionary change in proteins", "Atlas of Protein Sequence and Structure," Vol. 5, Suppl. 3 (ed. MO Dayhoff), pp. 345-352. Natl. Biomed. Res. Found., Washington, DC and in Henikoff et al. (1992) Proc. Natl. Acad. Sci. USA 89:10915-10919.Optimal alignment and scoring can be performed manually, but this process is facilitated by the use of computer-implemented alignment algorithms, such as Gapped BLAST 2.0 (described in Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402 and publicly available on the National Center for Biotechnology Information website). To generate accurate similarity scores using NCBI BLAST, it is important to turn off any filtering, such as low complexity filtering, and disable the use of composition based statistics. Also, one should ensure that the correct substitution matrix and gap penalties are used. Optimal alignments that include multiple alignments can be prepared, for example, using PSI-BLAST, available through the NCBI Internet site and described by Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402.
[0031] As shown in Example 1 below, it is also possible to use the sequences of the mouse otoferlin gene, in particular SEQ ID NO: 79 and SEQ ID NO: 80, which code for the N-terminal and C-terminal parts of isoform 1 of the mouse otoferlin gene (NM_001100395.1).
[0032] Vector systems of the invention In a first aspect, the present invention provides a method for producing at least two different AAV particles, namely: a) at least one AAV8 particle comprising a first polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3', a partial coding sequence containing: a CMV promoter sequence followed by an N-terminal coding portion of an otoferlin gene; and b) a vector system comprising at least one AAV8 particle comprising a second polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between said inverted terminal sequences, from 5' to 3': a partial coding sequence containing a C-terminal coding portion of the otoferlin gene, optionally followed by a polyadenylation sequence, the first and second polynucleotides comprise recombination-derived polynucleotide sequences; the coding sequences in the first and second polynucleotides, when combined, encode isoform 5 of the otoferlin polypeptide as defined above, a homologue or a functional fragment thereof; Concerning vector systems.
[0033] The vector system of the present invention contains at least one AAV8 particle containing a polynucleotide as defined in a) (i.e., encoding the N-terminal coding portion of otoferlin), and at least one AAV8 particle containing a polynucleotide as defined in b).In other words, the vector system contains the first and second polynucleotides, each of which is preferably contained in a separate AAV8 particle.The two different types of AAV8 particles can be contained in the same composition or in different compositions, and can be administered together or separately.
[0034] It is understood that "first" and "second" do not imply any particular order or importance herein. However, what is necessary is that the vector system of the present invention contains two different recombinant AAV vectors, one containing the above polynucleotide a) and the other containing the above polynucleotide b), so that the two polynucleotides are simultaneously present in the target cell and can produce the otoferlin polypeptide in situ.
[0035] AAVs are small, replication-deficient, adenovirus-dependent viruses of the Parvoviridae family. They have an icosahedral capsid with a diameter of 20-25 nm and a genome of 4.7 kb flanked by two inverted terminal repeats (ITRs). After uncoating in the host cell, the recombinant AAV genome can persist in a stable episomal state by forming high molecular weight head-to-tail circular concatemers, providing long-term, high-level transgene expression. In the context of the present invention, the preferred AAV serotype, AAV8, is currently being tested in vivo.
[0036] AAV8 can be genetically modified to enhance the efficiency of gene expression and prevent the virus from spreading unintentionally.These genetic modifications include the deletion of E1 region, the deletion of E1 region together with either the deletion of E2 or E4 region, or the deletion of the entire adenovirus genome except for cis-acting terminal inverted sequence and packaging signal.Such modified vectors are advantageously included in the present invention.
[0037] Furthermore, it is also possible to use genetically modified AAV8 with mutant capsid proteins to direct gene expression to specific tissue types, such as auditory cells. For this purpose, AAV8 vectors in which tyrosine residues in the viral envelope are replaced with alanine residues can be used. For example, tyrosine 733 can be replaced with alanine residues (AAV8-Y733A). By using AAV8-Y733A, it is possible to increase transfection up to 10,000-fold and reduce the amount of AAV required to infect sensory hair cells in the cochlea. It is also possible to use AAV8 vectors in which any tyrosine residues in the viral envelope are replaced with alanine residues. In addition, the efficacy of AAV8 serotypes can be further improved using peptide ligand insertions, as disclosed in Michelfelder, PLoS One. 2011; 6(8): e23101.
[0038] The method of preparing virus and virion containing heterologous polynucleotide or construct is known in the art.In the case of AAV, adenovirus or polynucleotide construct containing suitable adenovirus genes for AAV helper function can be co-infected or transfected into cells.Examples of materials and methods are described in, for example, U.S. Patent No. 8,137,962 and U.S. Patent No. 6,967,018.Based on the information provided herein and common knowledge, it is routine for those skilled in the art to generate AAV particles that are essential for the vector system of the present invention.
[0039] As used herein, the term "promoter of the invention" refers to a CMV promoter having SEQ ID NO:9 and its homologous sequences which retain the promoter function of SEQ ID NO:9 in the otoferlin polypeptide. It is indeed possible to use any homologous sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with SEQ ID NO:9.
[0040] In particular, it is possible to insert an intron sequence downstream of the CMV promoter to stabilize the mRNA and improve cytoplasmic export, thus enhancing the efficiency of said CMV promoter. This additional sequence may be, for example, the sequence of SEQ ID NO: 10, which represents a chimera between an intron from human β-globin and an immunoglobulin heavy chain.
[0041] The promoter (optionally followed by an intron sequence) can be incorporated into the vector of the invention using standard techniques known in the art. The promoter should be located upstream of the first exon of the otoferlin gene. In one embodiment, the promoter (and, optionally, the intron sequence) is positioned at approximately the same distance from the transcription start site as it is from the transcription start site in its natural genetic environment. However, variation in this distance is tolerated without substantially reducing promoter activity. The transcription start site is usually included in the vector.
[0042] The polynucleotide contained in the vector system of the present invention, when recombined, contains an N-terminal or C-terminal coding portion of the otoferlin gene encoding isoform 5 of the otoferlin polypeptide of the sequence number defined above (corresponding to Genbank number NP_001274418) or a functional fragment and homologous sequence thereof.
[0043] In a preferred embodiment, the polynucleotide comprised in the vector system of the invention comprises a part of the cDNA sequence NM_001287489.1 (isoform 5 or variant e, SEQ ID NO: 91), more preferably the coding portion thereof, the sequence of which is presented on SEQ ID NO: 15.
[0044] In another preferred embodiment, the polynucleotide contained in the vector system of the invention contains parts of the cDNA sequences of SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, allowing the expression of three specific homologous proteins of isoform 5 of SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8, respectively (see Example 2 and related Figure 6).
[0045] Cutting site The dual vector approach is advantageous for splitting a long coding sequence into two parts for easier packaging in virions with limited packaging capacity. When AAV capsid is used herein, it is preferred to use a polynucleotide containing an OTOF coding sequence that contains 5 kilobases or less, preferably 4.7 kilobases or less.
[0046] The vector system of the present invention must therefore contain two different polynucleotides each comprising a coding sequence portion of the otoferlin gene encoding an otoferlin polypeptide as described above, for example the sequence shown in SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18, or any homologous sequence thereof having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18.
[0047] The partial coding sequences contained in the polynucleotides described herein are designed such that, upon delivery of the polynucleotide, the partial coding sequences are joined together, for example by homologous recombination, to form a complete coding sequence encoding an otoferlin polypeptide as defined above (also referred to as an "otoferlin gene").
[0048] In a preferred embodiment, the coding sequence (or "otoferlin gene") has the sequence set forth in nucleotides 186 to 6179 of SEQ ID NO:91, or the coding sequence has the sequence set forth in SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18, or a homologous sequence thereof as defined above.
[0049] The coding sequence of the human OTOF gene is preferably cleaved at the natural splice sites. For example, human OTOF gene isoform 5 of SEQ ID NO: 15 can be split between exons 18 and 19 into an N-terminal coding portion having nucleotides 1 to 2214 of SEQ ID NO: 15 and a C-terminal coding portion having nucleotides 2215 to 5991 of SEQ ID NO: 15. Alternatively, human OTOF gene isoform 5 of SEQ ID NO: 15 can be split between exons 20 and 21 into an N-terminal coding portion having nucleotides 1 to 2406 of SEQ ID NO: 15 and a C-terminal coding portion having nucleotides 2407 to 5991 of SEQ ID NO: 15. Alternatively, human OTOF gene isoform 5 of SEQ ID NO: 15 can be split between exons 21 and 22 into an N-terminal coding portion having nucleotides 1 to 2523 of SEQ ID NO: 15 and a C-terminal coding portion having nucleotides 2524 to 5991 of SEQ ID NO: 15. Alternatively, human OTOF gene isoform 5 of SEQ ID NO: 15 can be split between exons 22 and 23 into an N-terminal coding portion having nucleotides 1 to 2676 of SEQ ID NO: 15 and a C-terminal coding portion having nucleotides 2677 to 5991 of SEQ ID NO: 15. Similarly, human OTOF gene isoform 5 of SEQ ID NO: 15 can be divided between exons 24 and 25 into an N-terminal coding portion having nucleotides 1 to 2991 of SEQ ID NO: 15 and a C-terminal coding portion having nucleotides 2992 to 5991 of SEQ ID NO: 15. Finally, human OTOF gene isoform 5 of SEQ ID NO: 15 can be divided between exons 25 and 26 into an N-terminal coding portion having nucleotides 1 to 3126 of SEQ ID NO: 15 and a C-terminal coding portion having nucleotides 3127 to 5991 of SEQ ID NO: 15. The same cleavage site was used to split the novel isoforms of SEQ ID NOs: 16-18 into two parts, thereby allowing for easy encapsulation into the AAV8 capsid and favoring facile in situ recombination.
[0050] In the vector system of the invention, the N-terminal coding portion of the otoferlin gene contained in one of the two polynucleotides is preferably located at nucleotides 1 to 2214, nucleotides 1 to 2406, nucleotides 1 to 2523, nucleotides 1 to 2676, nucleotides 1 to 2991 or nucleotides 1 to 3126 of the otoferlin gene of SEQ ID NO: 15. And, the C-terminal coding portion of the otoferlin gene contained in the other polynucleotide is therefore preferably located at nucleotides 2215 to 5991, nucleotides 2407 to 5991, nucleotides 2524 to 5991, nucleotides 2677 to 5991, nucleotides 2992 to 5991 or nucleotides 3127 to 5991 of the otoferlin gene of SEQ ID NO:15.
[0051] Exemplary polynucleotides that can be used as the first and second polynucleotides in the vector system of the present invention are, for example, SEQ ID NO: 47&48 or 47&49, 50&51 or 50&52, 53&54 or 53&55, 56&57 or 56&58, 59&60 or 59&61, and 62&63 or 62&64, each SEQ ID NO: of said pairs containing the CMV promoter of SEQ ID NO: 9, and the sequences respectively encoding the N-terminal and C-terminal portions of isoform 5 of the aforementioned otoferlin human protein in a hybrid AP vector. SEQ ID NO: 48, 51, 54, 57, 60 and 63 contain the WPRE sequence of SEQ ID NO: 23, whereas SEQ ID NO: 49, 52, 55, 58, 61 and 64 do not.
[0052] The nucleotides of SEQ ID NOs: 70 to 75, which contain the CMV promoter of SEQ ID NO: 9, the intron sequence of SEQ ID NO: 10, and nucleotides 1 to 2214, 1 to 2406, 1 to 2523, 1 to 2676, 1 to 2991, or 1 to 3126 of SEQ ID NO: 15, respectively, and thereby encode the N-terminal portion of isoform 5 of human otoferlin (SEQ ID NO: 15), can also be used as the first polynucleotide of the vector system of the present invention.
[0053] A polynucleotide whose sequence is SEQ ID NO: 73 containing the CMV promoter of SEQ ID NO: 9, the intron sequence of SEQ ID NO: 10 and the N-terminal part of isoform 5 of otoferlin human protein, more precisely nucleotides 1 to 2676 of SEQ ID NO: 15, can also be used as the first polynucleotide of the vector system of the present invention.
[0054] A polynucleotide containing the AAV cassette of SEQ ID NO: 90, which contains the CMV promoter of SEQ ID NO: 9, the intron sequence of SEQ ID NO: 10 and the N-terminal part of isoform 5 of the otoferlin human protein, more precisely nucleotides 1 to 2676 of SEQ ID NO: 15, can also be used as the first polynucleotide of the vector system of the present invention.
[0055] Other exemplary polynucleotides that can be used as the first and second polynucleotides in the hybrid AP vector system of the present invention are, for example, SEQ ID NO: 79&80, which in a hybrid AP vector contains the CMV promoter of SEQ ID NO: 9 and a sequence encoding the N-terminal portion of isoform 1 of the otoferlin mouse protein. SEQ ID NO: 80 contains a sequence encoding the C-terminal portion of isoform 1 of the otoferlin mouse protein without the WPRE sequence.
[0056] Other components of the vectors of the invention As explained in WO 2013 / 075008, the first and second polynucleotides used in this particular embodiment should contain certain genetic elements (inverted terminal sequences, polyadenylation sequences, recombinogenic regions, etc.) to induce proper recombination and expression of the otoferlin protein in the target cell.
[0057] More specifically, these genetic components are: ·ITR The vector system of the present invention can contain wild-type or engineered ITR sequences. Those skilled in the art are well aware of which ITRs can be advantageously used in a dual-modality AAV system. When using an AAV8 vector, the ITR sequences of the polynucleotides described herein can be derived from any AAV serotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10), or from two or more serotypes. In some embodiments of the polynucleotides provided herein, the ITR sequences are derived from AAV8. ITR sequences and plasmids containing ITR sequences are known in the art and commercially available. An exemplary AAV8 ITR sequence adjacent to the 5' end of the expression construct comprises the sequence of SEQ ID NO: 19. An exemplary AAV8 ITR sequence adjacent to the 3' end of the expression construct comprises the sequence of SEQ ID NO: 20. Any homologous sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 19 and / or SEQ ID NO: 20 can be used. Recombination induction region The two polynucleotides of the present invention (the first and second polynucleotides) also contain a so-called "recombinogenic region" that can promote recombination, including homologous recombination, between the two polynucleotides after delivery to a cell, resulting in the entire coding sequence of the OTOF polypeptide and its expression in the transfected inner ear hair cell (see, for example, Ghosh et al. Hum Gene Ther. 2011 Jan;22(l):77-83). The recombinogenic region can typically be in a first region of a first polynucleotide that has a homologous region in a second polynucleotide, or vice versa. The two regions preferably have a threshold level of sequence identity, as defined above, having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity with each other. This recombination induction region preferably has a size of 50 to 500, 50 to 400, 50 to 300, 100 to 500, 100 to 400, 100 to 300, 200 to 500, 200 to 400, or 200 to 300 nucleotides. In a preferred embodiment, the two regions are identical and have a size of 200 to 300 nucleotides. These recombinogenic sequences may also have sequences that are sufficiently homologous to permit hybridization to one another under standard stringent conditions and standard methods.
[0058] As used herein, "stringent" conditions for hybridization refer to conditions in which the hybridization is performed at temperatures below the melting temperature (T) of the DNA hybrid in 6xSSPE, 5x Denhardt's solution, 0.1% SDS, 0.1 mg / mL denatured DNA. m ) overnight at 20-25°C lower than the melting temperature. The melting temperature is described by the following formula: Tm=81.5C+16.6Log[Na+]+0.41(%G+C)-0.61(%formamide)-600 / length of duplex in base pairs. Washing is usually performed as follows: (1) 2 times in 1xSSPE, 0.1% SDS at room temperature for 15 minutes (low stringency wash); (2) 1 time in 0.2xSSPE, 0.1% SDS at Tm-20°C for 15 minutes (medium stringency wash).
[0059] In a preferred embodiment, the recombinogenic sequences present in the two polynucleotides of the vector system of the invention, in particular the overlapping recombinogenic sequences, are foreign fragments or fragments of otoferlin. Said recombinogenic sequences can be fragments of coding or non-coding foreign genes or ITRs present in the polynucleotides. In particular, it can be the sequence of SEQ ID NO: 69 (from the gene for alkaline phosphatase AP) or a homologous sequence thereof, preferably having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 69.
[0060] Transport strategy for OTOF fragments Herein, the inventors propose several strategies to deliver the two portions of the otoferlin polynucleotide and allow them to recombine appropriately in the target cell. "Trans-splicing strategy", in this case a splice donor (SD) signal is placed at the 3' end of the 5' half vector and a splice acceptor (SA) signal is placed at the 5' end of the 3' half vector. Upon coinfection of the same cell with dual AAV vectors, inverted terminal repeat (ITR)-mediated head-to-tail concatemerization of the two halves induces trans-splicing of the two polynucleotides, resulting in the production of the desired mature mRNA and full-sized protein (Duan D.et al,Molecular Therapy 2001,vol.4,N°4,pp.383-391). "Overlap strategy", in this case the recombination-inducing sequence is part of the otoferlin cDNA itself. Indeed, in this case the two halves of the large transgene expression cassette contained in the double AAV vector contain homologous overlapping sequences (at the 3' end of the 5' half vector and at the 5' end of the 3' half vector, see bottom of Figure 4) that mediate the reconstitution of a single large gene by homologous recombination (see WO 2013 / 075008). In this case splice sites are not necessary (although it is possible to use them to facilitate the recombination process). "Hybrid strategy", where a highly recombinogenic sequence is added to the trans-splicing vector of the present disclosure, possibly from an exogenous gene (e.g., alkaline phosphatase, AP). This second recombinogenic sequence is placed downstream of the SD signal in the 5' half vector and upstream of the SA signal in the 3' half vector, for example, to increase recombination between the double AAVs (see Ghosh et al, Hum Gene Ther. 2011.22:77-83). In this latter strategy, the two exogenous recombination-inducing sequences are preferably identical and more preferably have the sequence SEQ ID NO: 69 (derived from the alkaline phosphatase AP gene) or a homologous sequence thereof as defined above. In the trans-splicing and hybrid strategies, the polynucleotides contained in the dual vector system of the present invention contain a splice donor site or a splice acceptor site, which, upon in vivo recombination, can excise the exogenous recombinogenic region. In a preferred embodiment, the splice donor site and / or the splice acceptor site contain a splice consensus sequence. In a more preferred embodiment, the splice donor site and / or the splice acceptor site carried by the polynucleotides contained in the vector system of the present invention contain a splice consensus sequence derived from the alkaline phosphatase enzyme (see SEQ ID NO: 21 and SEQ ID NO: 22).
[0061] In a preferred embodiment, the polynucleotide comprised in the dual vector system of the present invention comprises SEQ ID NO:21 and / or SEQ ID NO:22 as splice donor and splice acceptor sites, respectively, or comprises splice sites comprising sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:21 and / or SEQ ID NO:22.
[0062] The polynucleotide of the present invention may contain several recombinogenic sequences, i.e., for example, splice donor / acceptor sites and exogenous recombinogenic sequences. The presence of two recombinogenic regions is actually preferred to ensure accurate and precise recombination in vivo without residual undesired nucleotides. The use of any suitable combination or other recombinogenic sequences than those disclosed above can be considered as soon as it allows efficient recombination in target cells such as inner ear hair cells.
[0063] The polynucleotide sequence present in the vector system of the present invention may contain other regulatory elements that are functional in the inner ear hair cells in which the vector can be expressed.Those skilled in the art can select regulatory elements for use in human inner ear hair cells.Regulatory elements include, for example, internal ribosome entry sites (IRES), transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements.
[0064] The polynucleotide sequence present in the vector system of the invention may contain, for example, a WHV post-transcriptional regulatory element (WPRE), which may stabilize mRNA and enhance protein yield. Said WPRE sequence may be the sequence of SEQ ID NO: 23. It may also contain a Kozak consensus sequence, for example the sequence of GCCGCCACCAUGG (SEQ ID NO: 89), as disclosed in the exemplary sequences proposed herein (SEQ ID NOs: 47, 50, 53, 56, 59, 62, SEQ ID NOs: 70-75, SEQ ID NOs: 81, 82, 85 and SEQ ID NO: 86). Alternatively, it is possible to use the 5'-(gcc)gccRccAUGG-3' sequence (SEQ ID NO: 92), where the capital letters indicate highly conserved bases, R indicates that a purine (adenine or letter) is always observed at this position (adenine is more frequent according to Kozak), and the lower case letters indicate the most common base at the position where the base may nevertheless vary. It should be noted that the sequences in brackets (gcc) are sequences of unknown clinical significance.
[0065] The polynucleotide containing the C-terminal sequence of the otoferlin gene preferably contains a DNA sequence that directs the polyadenylation of the mRNA encoded by the structural gene. This polyadenylation DNA sequence can also be included in the vector of the present invention. For example, the polyA of bovine growth hormone (SEQ ID NO: 24) can be used in this respect.
[0066] Transcription termination regions can usually be obtained from the 3' untranslated region of eukaryotic or viral gene sequences. Transcription termination sequences can be placed downstream of coding sequences to provide efficient termination. Signal peptide sequences are amino-terminal sequences that code for information involved in relocating operably linked polypeptides to a wide range of post-translational cellular destinations, from specific organelle compartments to the protein's site of action and the extracellular environment. Enhancers are cis-acting elements that increase the transcription of genes and can be included in the vectors of the present invention. Enhancer elements are known in the art and include, but are not limited to, CaMV35S enhancer element, cytomegalovirus (CMV) early promoter enhancer element, and SV40 enhancer element.
[0067] Specific vector systems Particular vector systems of the present invention are described in more detail below. In a preferred embodiment of the invention, the vector system of the invention comprises at least two different recombinant AAV8 particles: a) an AAV8 particle comprising a first polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide, and between the inverted terminal sequences, from 5' to 3', the following: a CMV promoter, optionally followed by a Kozak sequence of SEQ ID NO: 89 or 92, followed by a partial coding sequence containing the N-terminal coding portion of the otoferlin gene, and a splice donor site as a recombinogenic sequence; and b) A trans-splicing vector system comprising one AAV8 particle comprising a second polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, in a 5' to 3' direction: a splice acceptor site as a recombination-inducing sequence, a partial coding sequence containing the C-terminal coding portion of the otoferlin gene, optionally followed by a polyadenylation sequence (e.g., the polyA of bovine growth hormone of SEQ ID NO: 24). Preferably, the CMV promoter is SEQ ID NO: 9, optionally followed by an intron sequence of SEQ ID NO: 10 and / or a Kozak sequence of SEQ ID NO: 89 or 92. In this case, the partial coding sequence encoding otoferlin is located downstream of this additional intron sequence. The two different types of AAV8 particles can be contained in the same composition or in different compositions and may be administered together or separately.
[0068] This vector system can be used in the trans-splicing strategy described above. The enclosed list provides preferred vectors (SEQ ID NO: 85 to SEQ ID NO: 88) that can be used accordingly. SEQ ID NO: 85 and SEQ ID NO: 86 code for the N-terminal portion of otoferlin human isoform 5 (up to amino acid 892) under the control of a CMV promoter or CMV followed by an intron sequence, respectively, while SEQ ID NO: 87 and SEQ ID NO: 88 code for the C-terminal portion of otoferlin human isoform 5 (starting at amino acid 893) with or without the WPRE sequence, respectively.
[0069] In another embodiment, the vector system of the invention comprises at least two different AAV8 particles, namely: a) one AAV8 particle comprising a first polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3', the following: a CMV promoter, optionally followed by a Kozak sequence of SEQ ID NO: 89 or 92, followed by a partial coding sequence containing an N-terminal coding portion of an otoferlin gene; and b) an overlap vector system comprising one AAV8 particle comprising a second polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3': a partial coding sequence containing a C-terminal coding portion of an otoferlin gene, optionally followed by a polyadenylation sequence (e.g., the polyA of bovine growth hormone of SEQ ID NO: 24); It is an overlap vector system in which the N- and C-terminal coding portions of the otoferlin gene contain homologous portions that can act as recombinogenic sequences.
[0070] Preferably, the CMV promoter is SEQ ID NO: 9, optionally followed by an intron sequence of SEQ ID NO: 10 and / or a Kozak sequence of SEQ ID NO: 89 or 92. In this case, the partial coding sequence encoding otoferlin is located downstream of this additional intron sequence.
[0071] The two different types of AAV8 particles can be contained in the same composition or in different compositions and may be administered together or separately. Such vector systems can be used in the overlap strategy described above. The enclosed list provides preferred overlap vectors (SEQ ID NO: 81 to SEQ ID NO: 84). SEQ ID NO: 81 and SEQ ID NO: 82 code for the N-terminal portion of otoferlin human isoform 5 (up to amino acid 892) under the control of a CMV promoter or CMV followed by an intron, respectively, while SEQ ID NO: 83 and SEQ ID NO: 84 code for the C-terminal portion of otoferlin human isoform 5 (with respect to amino acid 893) with or without the WPRE sequence, respectively.
[0072] In another preferred embodiment, the vector system of the invention comprises at least two different recombinant AAV8 particles, namely: a) an AAV8 particle comprising a first polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3': a CMV promoter followed by a partial coding sequence containing the N-terminal coding portion of the otoferlin gene, and a splice donor site; and b) a hybrid vector system comprising one AAV8 particle comprising a second polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between said inverted terminal sequences, from 5' to 3', the following: a splice acceptor site, a partial coding sequence containing the C-terminal coding portion of the otoferlin gene, optionally followed by a polyadenylation sequence (e.g., the polyA of bovine growth hormone of SEQ ID NO: 24), the first and second polynucleotides also contain a second recombinogenic sequence located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide, It is a hybrid vector system.
[0073] Preferably, the CMV promoter is SEQ ID NO: 9, optionally followed by an intron sequence of SEQ ID NO: 10 and / or a Kozak sequence of SEQ ID NO: 89 or 92. In this case, the partial coding sequence encoding otoferlin is located downstream of this additional intron sequence. The two different types of AAV8 particles can be contained in the same composition or in different compositions and may be administered together or separately. Such vector systems can be used in the hybrid strategy described above. The enclosed list provides some exemplary vectors (SEQ ID NO: 47&48 or 47&49, 50&51 or 50&52, 53&54 or 53&55, 56&57 or 56&58, 59&60 or 59&61, and 62&63 or 62&64) corresponding to the cleavage sites between exons 18-19, 20-21, 21-22, 22-23, 24-25 and 26-27, respectively, that can be used in this respect (C-terminal vectors with or without WPRE sequences). The C-terminal vector of SEQ ID NO: 97 can be advantageously used. Also, the N-terminal vectors of SEQ ID NO: 70-75 and 90, in which the CMV promoter is followed by an intron sequence, can be advantageously used. In any of these vector systems, the first polynucleotide may contain nucleotides 1 to 2214, nucleotides 1 to 2406, nucleotides 1 to 2523, nucleotides 1 to 2676, nucleotides 1 to 2991, or nucleotides 1 to 3126 of the otoferlin gene of SEQ ID NO: 15. And, therefore, the second polynucleotide may contain nucleotides 2215 to 5991, 2407 to 5991, nucleotides 2524 to 5991, nucleotides 2677 to 5991, nucleotides 2992 to 5991, or nucleotides 3127 to 5991 of the otoferlin gene of SEQ ID NO: 15. It is also possible to split the otoferlin gene into two parts by any equivalent cleavage site that corresponds to a natural exon junction in the gene under consideration.
[0074] Particularly preferred vector systems of the present invention are: a) a first polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, from 5' to 3' between the inverted terminal sequences: a CMV promoter of the invention, optionally an intron sequence (typically SEQ ID NO: 10), optionally a Kozak sequence of SEQ ID NO: 89 or 92, followed by nucleotides 1 to 2214, nucleotides 1 to 2406, nucleotides 1 to 2523, nucleotides 1 to 2676, nucleotides 1 to 2991 or nucleotides 1 to 3126 of the otoferlin gene of SEQ ID NO: 15, and a splice donor site; b) a second polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3': a splice acceptor site, nucleotides 2215 to 5991, nucleotides 2407 to 5991, nucleotides 2524 to 5991, nucleotides 2677 to 5991, nucleotides 2992 to 5991 or nucleotides 3127 to 5991 of the otoferlin gene of SEQ ID NO: 15, optionally followed by a polyadenylation sequence (e.g., polyA of bovine growth hormone of SEQ ID NO: 24); Each polynucleotide comprises a second recombinant sequence of SEQ ID NO:69 derived from the gene encoding alkaline phosphatase. Preferably, the first polynucleotide of the vector system is selected from among: SEQ ID NOs: 47, 50, 53, 56, 59, and 62 (without intron sequences), or from among SEQ ID NOs: 70, 71, 72, 73, 74, and 75 (within intron sequences), wherein said polynucleotide contains nucleotides 1 to 2214, nucleotides 1 to 2406, nucleotides 1 to 2523, nucleotides 1 to 2676, nucleotides 1 to 2991, or nucleotides 1 to 3126 of SEQ ID NO: 15, respectively, thereby encoding the N-terminal portion of human otoferlin isoform 5. Preferably, the second polynucleotide of the vector system is selected from among: SEQ ID NOs: 48, 51, 54, 57, 60 and 63 (without enhancer WPRE), or from among SEQ ID NOs: 49, 52, 55, 58, 61 and 64 (without WPRE), wherein said polynucleotide contains nucleotides 2215 to 5991, nucleotides 2407 to 5991, nucleotides 2524 to 5991, nucleotides 2677 to 5991, nucleotides 2992 to 5991, or nucleotides 3127 to 5991 of SEQ ID NO: 15, respectively, thereby encoding the C-terminal portion of isoform 5 of human otoferlin. The construction of these polynucleotides is described in detail in Example 1 below.
[0075] Particularly preferred vector systems are: a) one AAV8 particle comprising a first polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3': a CMV promoter of SEQ ID NO: 9, and optionally an intron sequence of SEQ ID NO: 10, and / or a Kozak sequence of SEQ ID NO: 89 or 92, followed by nucleotides 1 to 2214, nucleotides 1 to 2676, or nucleotides 1 to 2991, more preferably nucleotides 1 to 2676, and a splice donor site of the otoferlin gene of SEQ ID NO: 15; and b) a vector system comprising one AAV8 particle comprising a second polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3': a splice acceptor site, nucleotides 2215 to 5991, nucleotides 2677 to 5991, or nucleotides 2992 to 5991 (more preferably nucleotides 2677 to 5991) of the otoferlin gene of SEQ ID NO: 15, optionally followed by a polyadenylation sequence (e.g., the polyA of bovine growth hormone of SEQ ID NO: 24), the first and second polynucleotides also comprise an AP recombinogenic sequence of SEQ ID NO:69 located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide; The second polynucleotide is a vector system that does not contain the WPRE sequence of SEQ ID NO:23.
[0076] Another particularly preferred vector system is a) one AAV8 particle comprising a first polynucleotide comprising an inverted terminal sequence at each end of said polynucleotide, and from 5' to 3' between said inverted terminal sequences: a CMV promoter of SEQ ID NO: 9, and optionally an intron sequence of SEQ ID NO: 10, and optionally a Kozak sequence of SEQ ID NO: 89 or 92, followed by nucleotides 1 to 2214, nucleotides 1 to 2676, or nucleotides 1 to 2991, more preferably nucleotides 1 to 2676, and a splice donor site of the otoferlin gene of SEQ ID NO: 15; and b) a vector system comprising one AAV8 particle comprising a second polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3': a splice acceptor site, nucleotides 2215 to 5991, nucleotides 2677 to 5991, or nucleotides 2992 to 5991 (more preferably nucleotides 2677 to 5991) of the otoferlin gene of SEQ ID NO: 15, optionally followed by a polyadenylation sequence (e.g., the polyA of bovine growth hormone of SEQ ID NO: 24), the first and second polynucleotides also comprise an AP recombinogenic sequence of SEQ ID NO:69 located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide; The second polynucleotide is a vector system that does not contain the WPRE sequence of SEQ ID NO:23. A particularly preferred vector system according to the present invention contains SEQ ID NO:56 (without intron sequences) encoding the N-terminal portion of human otoferlin isoform 5, and SEQ ID NO:58 (without enhancer WPRE) encoding the C-terminal portion of human otoferlin isoform 5.
[0077] Pharmaceutical Compositions of the Present Invention In another aspect, the present invention is directed to a pharmaceutical composition comprising a vector system of the present invention as described above (i.e., a virion comprising a polynucleotide as described above) and a pharma- ceutically acceptable carrier. The present invention is also directed to pharmaceutical compositions comprising a unique population of viruses of the invention, said viruses comprising a "first" or "second" polynucleotide as fully described above. Said pharmaceutical composition typically contains any of the trans-splicing, hybrid or overlap vectors disclosed above.
[0078] In particular, and by way of example, the composition of the invention comprises a particle comprising the hybrid vector of the invention, i.e. - an AAV8 particle comprising a polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between said inverted terminal sequences, from 5' to 3': a CMV promoter, optionally a Kozak sequence, followed by a partial coding sequence containing the N-terminal coding portion of the otoferlin gene, and a splice donor site as a recombinogenic sequence, and a pharma- ceutically acceptable carrier; or - an AAV8 particle comprising a polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3', a splice acceptor site as a recombination-inducing sequence, a partial coding sequence containing the C-terminal coding portion of the otoferlin gene, optionally followed by a polyadenylation sequence (e.g., the polyA of bovine growth hormone of SEQ ID NO: 24), and a pharmaceutically acceptable carrier.
[0079] In another embodiment, the composition comprises: a) an AAV8 particle comprising a first polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3': a CMV promoter, optionally a Kozak sequence, followed by a partial coding sequence containing an N-terminal coding portion of an otoferlin gene, and a splice donor site; b) one AAV8 particle comprising a second polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3', the following: a splice acceptor site, a partial coding sequence containing the C-terminal coding portion of the otoferlin gene, optionally followed by a polyadenylation sequence (e.g., the polyA of bovine growth hormone of SEQ ID NO: 24); The first and second polynucleotides also include a second recombinogenic sequence located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide.
[0080] In a preferred embodiment, the present invention is also directed to a pharmaceutical composition comprising, apart from a pharma- ceutically acceptable carrier, an AAV8 particle comprising a polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, in a 5' to 3' direction: a CMV promoter, followed by a partial coding sequence containing the N-terminal coding portion of the otoferlin gene, and a splice donor site, wherein the polynucleotide also contains a second recombination-inducing sequence located after the splice donor site of the polynucleotide.
[0081] In another preferred embodiment, the present invention is also directed to a pharmaceutical composition comprising, apart from a pharma- ceutical carrier, an AAV8 particle comprising a polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3': a splice acceptor site, a partial coding sequence containing the C-terminal coding portion of the otoferlin gene, optionally followed by a polyadenylation sequence (e.g., the polyA of bovine growth hormone of SEQ ID NO: 24), wherein the polynucleotide also contains a second recombination-inducing sequence located before the splice acceptor site of the polynucleotide.
[0082] All the constituent parts of such polynucleotides (promoter sequences, translation enhancers, recombinogenic sequences, partial coding parts, etc.) have been described in detail above and need not be repeated here. All the embodiments disclosed for the vector system of the invention (trans-splicing, hybrid and overlap) apply here mutatis mutandis.
[0083] As used herein, "pharmaceutical acceptable carrier" includes any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc. Examples of pharmaceutical acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, etc., and combinations thereof. In many cases, it may be preferable to include an isotonic agent, such as sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride, in the composition. Pharmaceutically acceptable carriers may further include minor amounts of auxiliary substances, such as wetting or emulsifying agents, preservatives, or buffers, that enhance the shelf life or effectiveness of the vector system or pharmaceutical compositions containing it. The pharmaceutical composition of the present invention can be in various forms. These include liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories. The form used depends on the intended mode of administration and therapeutic application. Typical compositions are in the form of injectable or infusible solutions. Pharmaceutical compositions should be generally sterile and stable under the conditions of manufacture and storage. The pharmaceutical compositions of the present invention are preferably formulated as solutions, microemulsions, dispersions, liposomes or other ordered structures suitable for high drug concentration. Sterile injectable solutions can be prepared by incorporating the vector of the present invention in the required amount in an appropriate solvent with one or a combination of ingredients as required above, followed by filter sterilization. In general, dispersions are prepared by incorporating the vector or virus of the present invention into a sterile vehicle containing a basic dispersion medium and other required ingredients from those listed above. In the case of sterile lyophilized powders for preparing sterile injectable solutions, the preferred preparation methods are vacuum drying and spray drying, which yield a powder of the active ingredient plus any additional desired ingredients from its previously sterile-filtered solution. The proper fluidity of the solution can be maintained, for example, by the use of coatings such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prolonged absorption of the injectable compositions can be achieved by including an agent that delays absorption, for example, monostearate salts and gelatin, in the composition. The pharmaceutical compositions of the invention typically contain a "therapeutically effective amount" or a "prophylactically effective amount" of a vector or virus of the invention. A "therapeutically effective amount" refers to an amount of a vector or virus of the invention that is effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, in this case for both prevention and treatment of hearing loss, without unacceptable toxicity or undesirable side effects. In a specific embodiment, a pharmaceutical composition of the invention contains a therapeutically effective amount of a virus comprising SEQ ID NO:56 (not including intron sequences), which encodes the N-terminal portion of human otoferlin isoform 5, and SEQ ID NO:58 (not including enhancer WPRE), which encodes the C-terminal portion of human otoferlin isoform 5. In a specific embodiment, a pharmaceutical composition of the invention contains a therapeutically effective amount of a virus comprising SEQ ID NO:56 (not including intron sequences) encoding the N-terminal portion of human otoferlin isoform 5, and SEQ ID NO:57 (including enhancer WPRE) encoding the C-terminal portion of human otoferlin isoform 5. In a specific embodiment, a pharmaceutical composition of the invention contains a therapeutically effective amount of a virus comprising SEQ ID NO: 75 (including an intron sequence) encoding the N-terminal portion of human otoferlin isoform 5, and SEQ ID NO: 57 (including enhancer WPRE) encoding the C-terminal portion of human otoferlin isoform 5. In a specific embodiment, a pharmaceutical composition of the invention contains a therapeutically effective amount of a virus comprising SEQ ID NO: 75 (including intron sequences), which encodes the N-terminal portion of human otoferlin isoform 5, and SEQ ID NO: 58 (excluding enhancer WPRE), which encodes the C-terminal portion of human otoferlin isoform 5.
[0084] In a particularly preferred embodiment, the pharmaceutical composition of the invention comprises: - AAV8 particles comprising a polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, in the 5' to 3' direction: a CMV promoter followed by an intron sequence of SEQ ID NO: 10, a Kozak sequence of SEQ ID NO: 89, an N-terminal coding portion of the human otoferlin gene (isoform 5, exons 1 to 22), a splice donor site and a recombinogenic sequence of SEQ ID NO: 69, together with a pharma- ceutically acceptable carrier, wherein the polypeptide has, for example, a sequence as set forth in SEQ ID NO: 73 or SEQ ID NO: 90; and / or - an AAV8 particle comprising a polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3': a recombination-inducing sequence of SEQ ID NO: 69, a splice acceptor site, a C-terminal coding portion of the human otoferlin gene (isoform 5, starting from exon 23), followed by a polyadenylation sequence (e.g. bovine growth hormone polyA of SEQ ID NO: 24), together with a pharma- ceutically acceptable carrier, wherein the polypeptide has, for example, a sequence as set forth in SEQ ID NO: 97; The therapeutically effective amount of the virus comprises
[0085] In a particularly most preferred embodiment, the pharmaceutical composition of the present invention comprises: - AAV8 particles comprising a polynucleotide whose sequence is set forth in SEQ ID NO: 90, together with a pharma- ceutically acceptable carrier; and / or - a therapeutically effective amount of a virus comprising an AAV8 particle comprising a polynucleotide whose sequence is set forth in SEQ ID NO:97, together with a pharma- ceutically acceptable carrier.
[0086] The therapeutically effective amount of the vector or virus of the present invention may vary depending on factors such as the disease state, age, sex and weight of the subject, and the ability of the compound to induce a desired response in the subject. The therapeutically effective amount may also be an amount in which the toxic or harmful effects of the claimed compound are outweighed by the therapeutically beneficial effects. "Prophylactically effective amount" refers to an amount of the virus or vector of the present invention that is effective at the dosage and for the period required to achieve the desired prophylactic result. Typically, a prophylactic dose may be used in subjects before the disease stage or at an early stage of the disease, so that the prophylactically effective amount is usually less than the therapeutically effective amount.
[0087] The dosage regimen can be adjusted to provide the optimal desired response (e.g., therapeutic or prophylactic response). For example, a single bolus can be administered, several divided doses can be administered over time, or the dose can be relatively reduced or increased as indicated by the exigencies of the therapeutic situation. As used herein, dosage unit form refers to a physically discrete unit suitable as a unitary dosage for the mammalian subject to be treated, each unit containing a predetermined amount of the vector or virus of the present invention calculated to produce a desired therapeutic or prophylactic effect in association with the required pharmaceutical carrier. The specifications of dosage unit form are governed by and can directly depend on (a) the intrinsic properties of the vector or virus and the specific therapeutic or prophylactic effect to be achieved, and (b) the inherent limitations of the technology of formulating such vector or virus to treat or prevent hearing loss in a subject.
[0088] In some embodiments in which a first and a second AAV polynucleotide / particle are used, the first and second AAV polynucleotides / particles may be contained within the same composition or different compositions and may be administered together or separately. In some embodiments, the composition of the present invention comprises 10 6 ~10 14 particles / mL or 10 10 ~10 15 particles / mL, or any value between any ranges, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 or 10 14 In one embodiment, the composition of the present invention contains 10 13 Contains more than AAV particles / mL. In some embodiments, when a first AAV particle comprising a first polynucleotide and a second AAV particle comprising a second polynucleotide are administered, the amount administered is the same for both particles.
[0089] Therapeutic Uses and Methods of Treatment In another aspect, the present invention also relates to the virus or vector system of the present invention, or to a pharmaceutical composition as defined above, for use in the treatment of patients suffering from DFNB9 hearing loss or for the prevention of DFNB9 hearing loss in patients carrying a DFNB9 mutation. The present invention also relates to methods of treatment or prevention which involve administering the virus or vector system of the present invention, or a pharmaceutical composition comprising same, to a patient suffering from DFNB9 hearing loss or carrying a DFNB9 mutation, respectively.
[0090] More generally, these viral or vector systems or pharmaceutical compositions of the invention can be administered to human subjects suffering from congenital hearing loss due to altered DFNB59 gene expression or defects, such as may be observed when otoferlin is expressed at normal levels but is non-functional. In other words, the present invention relates to the use of the above-mentioned inventive virus or vector system for the manufacture of a pharmaceutical composition intended to prevent and / or treat patients suffering from a disorder associated with altered or defective DFNB9 gene expression.
[0091] As used herein, the term "treat" is intended to mean administering a therapeutically effective amount of the virus or vector system of the present invention to a patient suffering from DFNB9 hearing loss to restore the patient's hearing partially or completely. Said restoration can be assessed by testing the auditory brainstem response (ABR) with an electrophysiological device. "Treatment of DFNB9 hearing loss" is intended to specifically refer to the complete restoration of hearing function, regardless of the cellular mechanism involved. In the case of patients with temperature sensitive mutations, the virus or vector system or composition of the invention can also be administered to prevent thermoregulation induced hearing loss. In the context of the present invention, the term "prevent" means to attenuate or slow the hearing loss in the audible frequency range. In these and other DFNB9 patients, the virus or vector systems or compositions of the invention can be administered both to prevent hearing loss before it occurs, and to at least partially restore hearing when hearing loss has already occurred. In this aspect of the invention, the virus or vector system or composition of the invention is administered to a patient suffering from DFNB9 deafness. By "patient suffering from DFNB9 deafness" herein is meant a patient, particularly a human patient, suspected of (or diagnosed as) having a mutation in the constitutive otoferlin gene, said mutation causing abnormal expression, function, or both of the otoferlin protein. In certain embodiments, said mutation may be temperature sensitive.
[0092] To date, more than 75 pathogenic mutations in otoferlin have been reported, including at least seven temperature-sensitive mutations identified in patients suffering from fever-conditioned sudden hearing loss (PQ994VfsX6, P.I515T, p.G541S, PR1607W, pE1804del, c.2975_2978delAG / c.4819C>T, c.4819C>T(c.R1607W)). These patients can be identified by a skilled physician using, for example, a combination of electrophysiological testing of auditory brainstem response (ABR) and / or genetic testing to identify mutations in the OTOF gene. In some embodiments, the patient has one or more of the following nonsense or missense mutations in the OTOF gene: TYR730TER, GLN829TER, PR01825ALA, PRO50ARG, LEU1011PRO, ILE515THR, ARG1939GLN, or GLY541SER. In some embodiments, the patient has an A to G transition (IVS8-2A-G) at the intron 8 / exon 9 junction, or a G to A transition at position +1, the first intron nucleotide, in the splice donor site of exon 5, or a G to C transversion at the donor splice site of intron 39. In some embodiments, the patient has a one base pair deletion (1778G) in exon 16 resulting in a stop codon and a 6141G-A change in exon 48 resulting in an ARG to GLN substitution.
[0093] The time of administration of the virus, virus system or composition of the present invention will be within the understanding of a person skilled in the art who has the benefit of the present teachings.The composition of the present invention can be administered up to the age of 12 or later, but can also be administered as soon as a disease or mutation is detected, for example, to an embryo or fetus in utero, or immediately after birth, for example, within 3 months after birth, preferably within 1 month after birth.
[0094] The patient to whom the virus or vector system or composition of the present invention is administered is preferably a patient, particularly a human patient, whose auditory system, particularly the cochlea, has already developed and matured. In this case, these patients, particularly human patients, are therefore not human embryos or fetuses. Thus, the target patient of the present invention is preferably a human newborn, typically less than 6 months old, or even less than 3 months old, when DFNB9 hearing loss is diagnosed at that young age. These human infants are more preferably between 3 months and 1 year old.
[0095] Notably, the human cochlea as a whole reaches its adult size at 17-19 weeks of gestation and is fully morphologically mature at 30-36 weeks (corresponding to postnatal day 12 in mice). Functional maturation of the ribbon synapses of the cochlea can be assessed by monitoring the I-wave of ABR measurements, which can be recorded around 28 weeks of gestation in humans. Recording and analysis of the I-wave of ABR (reflecting the function of the cochlea synapses with primary auditory neurons) indicates full functional maturation of human infants at birth (corresponding to postnatal day 20 in mice). This is well known in the art (see, for example, Pujol et Lavigne-Rebillard, Acta oto-laryngologica. Supplementum·February 1991).
[0096] We have previously shown that gene therapy with otoferlin is effective even when the mature auditory system is reached (Akil el al. 2019, PNAS; Hardelin et al., Medecine / Sciences 2019;35:1213-25). Thus, the vector system of the invention can also be administered to older human patients, such as infants (2-6 years), children (6-12 years), teenagers (12-18 years) or adults (18 years and older). The patient of the present invention may in particular be a human infant diagnosed with DFNB9 hearing loss after language acquisition.
[0097] In another specific embodiment, the patient of the present invention is a human aged 6 years or older, ie, administration of treatment occurs when their central nervous system is fully mature. In a particular embodiment, the virus or vector system or composition of the invention is preferably administered to a human patient suffering from DFNB9 hearing loss induced by a temperature sensitive mutation selected from PQ994VfsX6, P.I515T, p.G541S, PR1607W, pE1804del, c.2975_2978delAG / c.4819C>T, c.4819C>T, (c.R1607W), more preferably a teenager or a human adult carrying at least one of the aforementioned otoferlin temperature sensitive mutations.
[0098] In the context of the present invention, typical methods of administration of the pharmaceutical composition of the present invention are intratympanic (intratympanic), intracochlear or parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, intrathecal). In one example, the pharmaceutical composition of the present invention is administered by intravenous infusion or injection. In another example, the pharmaceutical composition of the present invention is delivered to a specific location using stereotactic delivery, in particular via the tympanic membrane or mastoid process of the middle ear. More precisely, the virus, vector system or pharmaceutical composition of the present invention may be administered using a microcatheter performed via the oval window using a laser stapedotomy (via the stapes) or via the transmastoid / transround window (Dai C. et al, JARO, 18:601-617, 2017).
[0099] In a preferred embodiment of the invention, the virus, vector system or pharmaceutical composition of the invention is administered to the human ear via intracochlear administration, more precisely by targeting the endolymphatic space in the vestibular system, or by the semicircular canal approach described above. Multiple delivery routes to the inner ear have been explored. These include injection into the perilymphatic space via the round window membrane (RWM) and oval window, as well as injection into the scala tympani or scala vestibuli via cochleotomy. Distribution throughout the perilymphatic space has been demonstrated for all of these delivery routes. Furthermore, it has been demonstrated that advection within the cochlea and vestibular organs can facilitate distribution of therapeutics from the injection site to more distant regions of the inner ear. Delivery to the endolymphatic space has also been explored through cochlear fenestration into the scala media, canalostomy, and injection into the endolymphatic sac. These approaches have also resulted in wide distribution, but face the additional challenge of puncturing the barrier between the endolymph and perilymph of high potassium. Disruption of the barrier creates two potential problems. First, leakage of high potassium into the perilymphatic space, which bathes the basal outer surface of hair cells and neurons, can chronically depolarize these cells, resulting in cell death. Second, the breaking of tight junctions between the endolymph and perilymph can result in attenuation of the endocochlear potential, which is normally in the range of +80 to +120 mV. Attenuation of the endocochlear potential reduces the driving force for sensory transduction in hair cells, thus resulting in reduced cochlear sensitivity and elevated hearing thresholds. Avoiding these complications is particularly challenging in the adult cochlea. However, by targeting the endolymphatic space of the vestibular system, which does not have an endocochlear direct current potential but is continuous with the endolymphatic space of the cochlea, these confounding issues can be minimized while still providing sufficient distribution within the cochlea (Ahmed et al,JARO 18:649-670(2017)).
[0100] The cochlea is highly compartmentalized and separated from the rest of the body by the blood-cochlear barrier (BCB). This minimizes therapeutic infusion volume and leakage into the body's systemic circulation, protects the immune privilege of the cochlea, and reduces the chance of a systemic adverse immune response. Cochlear hair cells and supporting cells do not normally divide, so the cells of the cochlea remain stable, and therefore it is possible to use non-integrating viral vectors (e.g., AAV) for sustained transgene expression. Because the posterior semicircular canal is also believed to be accessible in humans, the semicircular canal approach has been proposed as a promising injection route for future cochlear gene therapy in human trials (Suzuki et al., Sci. Rep. 7:45524 (2017); Yoshimura et al., Sci. Rep. 8:2980 (2018)).
[0101] In a preferred embodiment of the invention, the virus, vector system or composition of the invention is administered to the human ear via one of two common and well-established techniques routinely used in clinical ear surgery practice. More precisely, these techniques are adopted to target the perilymphatic space. For this purpose, injections using a microcatheter are performed through the oval window using laser stapedotomy (via the stapes) or via the transmastoid / transround window (Dai C. et al, JARO, 18:601-617, 2017). Systemic administration by intravenous injection or infusion is also possible. A person skilled in the art will easily determine whether or not it is necessary to increase the permeability of the round window membrane as proposed in WO 2011 / 075838 prior to administration of a virus, vector or composition of the invention, depending on the target cell.
[0102] The novel isoform of the present invention In another aspect, the present invention relates to three specific homologous proteins of variant 5 that have been identified by the inventors (see Example 2 below). These three alternative OTOF isoforms have the amino acid sequences of SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8. They can be encoded by the cDNA sequences of SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:18, respectively. Each of them may have the potential to restore hearing in humans, and therefore they can be used in gene therapy in place of the conventional OTOF isoform proteins 1-5 disclosed in the art. The present invention also relates to homologous polypeptides thereof, the amino acid sequences of which share at least 70%, at least 75%, and even more preferably at least 80%, at least 85%, or at least 90% identity and / or similarity with SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8. If the homologous polypeptide is significantly shorter than SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, local alignments can be considered. The present invention also relates to any vector or vector system encoding SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8 or a homologous polypeptide thereof as defined above. In particular, the present invention relates to any vector comprising the cDNA sequence of SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18. These vectors are preferably useful for gene therapy.They include, but are not limited to, DNA plasmid vectors and DNA and RNA viral vectors.In the present invention, such vectors can be used to express the novel isoforms of OTOF in the cells of the auditory pathway, such as cochlear hair cells.These vectors are well known in the art.Vector is, for example, a viral vector, such as lentivirus, adenovirus and adeno-associated virus (AAV). [Brief description of the drawings]
[0103] [Figure 1-1] Figure 1: A and B. Transduction profile of AAV8-CMV-GFP after cochlear delivery into wild-type mice at P12. A. Low and high magnification photomicrographs of a P30 organ of Corti immunolabeled for GFP after RWM injection. Note that AAV8-CMV-GFP transduced all IHCs. B. Confocal images of mid-apical wild-type cochleae injected with AAV8-GFP, Anc80-GFP, and AAV2-GFp through the RWM at P20. Scale bar: 100 μm; inset, 10 μm. [Figure 1-2]Figure 1: C and D. In vivo transduction of cochlear cells with AAV8 and AAV2 vectors in NHPs. Representative confocal images of cochleae receiving AAV8- (C) or AAV2-CMV-GFP (D) injections through the RWM in combination with the oval window fenestration delivery approach. GFP-expressing cells (green) run along the length of the cochlea. Cell nuclei were stained with DAPI (blue). Red is phalloidin stained actin. Scale bar: 100 μm; inset, 10 μm. [Figure 2-1]Figure 2: Dual-AAV8 CMV promoter drives mouse otoferlin expression in Otof- / - mouse cochlea. (A) Maximum intensity projection of confocal z-sections of P64 organ of Corti of Otof- / - mouse injected at P10 and immunostained for otoferlin. Almost all IHCs expressed mouse otoferlin. (B) ABR recordings at day 42 of Otof- / - uninjected mouse (black dotted line), wild type uninjected mouse (grey dotted line) and Otof- / - mouse injected at p10 with dual AAV of the invention encoding mouse otoferlin (solid line) in response to tone bursts of 8, 10, 15, and 20 kHz. Hearing in Otof- / - AAV otoferlin treated mice is restored to near normal thresholds. (C) Hearing lifetimes for 15 kHz frequency (at which the best hearing thresholds were observed) in p10 Otof- / - treated mice were recorded for at least 47 weeks after injection of the dual vector of the invention encoding mouse otoferlin. Time-lapse recordings of individual ABRs in response to tone bursts at 15 kHz in uninjected Otof- / - mice (dashed and dotted line) and in Otof- / - mice treated with p10 (n=6) are shown. (D) ABR recordings between 28 and 319 days after intracochlear injection of the dual otoferlin vector of the invention encoding mouse otoferlin in 10-day-old Otof- / - mice (n=8, solid line, mean ± SEM), uninjected wild-type mice (dotted line, mean ± SEM, n=3) and uninjected Otof- / - mice (dashed and dotted line, mean ± SEM, n=3) in response to tone bursts of 5, 10, 15, 20, 32, and 40 kHz. (E) ABR recordings 18 weeks after treatment in 21 / 22 day old Otof− / − mice injected with PBS (dashed line, mean±SEM, n=5), 21 / 22 day old wild type mice injected with PBS (dashed line, mean±SEM, n=6), uninjected wild type mice (dark dashed line, mean±SEM, n=3), mice injected with the inventive dual AAV vector encoding mouse otoferlin at p21 / p22 (dotted line, mean±SEM, n=9), and Otof− / − mouse #8 injected with the inventive dual vector encoding mouse otoferlin at p21 / p22 (solid line, n=1), which show the best recovery in response to tone bursts of 5, 10, 15, 20, 32, and 40 kHz.(F) ABR recordings 18 weeks after injection in 18-25 day old Otof- / - mice injected with PBS (dashed line, mean ± SEM, n = 5), PBS injected wild type 18-25 day old mice (dashed line, mean ± SEM, n = 7), non-injected wild type 18-25 day old mice (dark dashed line, mean ± SEM, n = 3), and Otof- / - mice injected at p18 to p25 with the dual AAV vector of the invention encoding human otoferlin (dotted line, mean ± SEM, n = 4). Among these, ABR recordings 18 weeks after injection in Otof- / - mouse #3 injected at p18 to p25 with the dual vector of the invention (solid line, n = 1). The mice show the best recovery in response to tone bursts of 5, 10, 15, 20, 32, and 40 kHz. (G) Lifetime of hearing recovery at 15 kHz in mice treated with dual AAV8-CMV-muOTOF (n=8) or AAV8-smCBAmuOTOF (n=15). Mean ± SEM at 15 kHz is shown. dB = decibels; SPL = sound pressure level; kHz = kilohertz. (H) Maximum intensity projection of confocal z-sections of the apex, MT, and basal turn of the injected left cochlea immunostained for mouse otoferlin (blue) from one of the best responder mice (#8). IHCs and their nuclei are stained with Ribeye (green). Scale bar: 10 μm. (I) Maximum intensity projection of confocal z-sections of the apex, MT, and basal turn of the injected left cochlea immunostained for human otoferlin (blue) from one of the best responder mice (#3). IHCs and their nuclei are stained with Ribeye (green). Scale bar: 10 μm. [Figure 2-2] Same as above. [Figure 2-3] Same as above. [Figure 2-4] Same as above. [Figure 2-5] Same as above. [Figure 2-6] Same as above. [Diagram 2-7] Same as above. [Diagram 3]Figure 3: Schematic diagram of the recombination, transcription, splicing and translation processes producing the full-length human protein otoferlin in transduced cells. pA = polyadenylation site, SD = splice donor element, SA = splice acceptor element, AP = alkaline phosphatase recombinase inducible region, ITR = inverted terminal repeat. [Figure 4] Figure 4: Schematic diagram of the dual AAV OTOF vector strategy. pA = polyadenylation site, SD = splice donor element, SA = splice acceptor element, AP = alkaline phosphatase recombinogenic region, ITR = inverted terminal repeat. [Figure 5-1] Figure 5: A. Scheme of in vitro ubiquitous CMV promoter-driven expression of human otoferlin protein after dual vector delivery using lipofectamine-based transfection. B. Efficacy evaluation of the three human otoferlin cleavage sites in the dual plasmid configuration. HEK293 cells were transfected with Dual OTOF Nter-Cter 738-739 (black), 892-893 (dark grey), and 997-998 (light grey) plasmids and their respective controls (Nter or Cter alone). For each condition, experiments were performed in triplicate with at least two independent wells. For each condition, quantification of cells positive for otoferlin (Nter+Cter) was performed in at least three regions of 200-300 DAPI-positive cells per well. [Figure 5-2] Same as above. [Figure 6] Figure 6: Summary of exons present in the mouse cochlea, highlighting the exons present on the mouse transcript (A1-B2-C2) and the exons present on the human isoform 5 transcript (A2-B1-C2). [Figure 7-1]Figure 7: A. RT-PCR analysis of otoferlin transcripts produced by reconstituted full-length human cDNA in HEK293 cells cotransfected with recombinant plasmid pairs. RNA extracts were reverse transcribed and subjected to PCR amplification with primers designed to amplify 898 or 946 bp fragments of otoferlin cDNA encompassing the junction between Otof Nter and Otof Cter cDNA. Negative (untransfected HEK293 cells) and positive (pcDNA3 containing HuOTOF cDNA under the control of the CMV promoter) controls are shown. M: DNA molecular weight markers. The positions of the 0.5 and 1.5 kb molecular weight markers of the DNA ladder are shown on the left side of the electrophoretic gel. B. Expression of full-length otoferlin after double otof plasmid transfection of HEK293 cells. M: For each of the double plasmids, the corresponding Nter and Cter or only the Nter or Cter portion was used for transfection. An otoferlin-specific antibody was used to identify the full-length otoferlin protein. HEK293 cells transfected with HuOTOF (Hu cDNA) plasmid were used as positive control. M: prestained protein marker. TOT: input (soluble protein extract). IP: extract from HEK293 cells subjected to immunoprecipitation with FP2 otoferlin antibody. NT: cell lysate from non-transfected cells. ACTB: anti-human β-actin monoclonal antibody was used as internal loading control between different lanes. The positions of the different molecular weight markers of the protein ladder are indicated on the left side of the electrophoretic gel. Asterisks indicate non-specific antibody detection (bands were also observed in non-transfected cells). [Figure 7-2] Same as above. [Figure 7-3] Same as above. EXAMPLES
[0104] Example 1: Activity of AAV8 vectors of the invention 1. Materials and Methods Generation of AAV vector peptides All AAV otoferlin recombinant vectors were synthesized (GenScript). To generate the dual otoferlin vector construct, the human otoferlin coding sequence (OTOF transcript variant 5; NM_001287489.2) was cloned into the OTOF vector at different naturally occurring exon-exon junctions: exons 18-19 (nt 1~2214 / 2215~5991, aa 738-739), exons 20-21 (nt 1~2406 / 2407~5991), exons 21-22 (nt 1~2523 / 2524~5991, aa 841-842), exons 22-23 (nt 1~2676 / 2677~5991, aa 892-893), exons 24-25 (nt 1~2991 / 2992~5991, aa 893-894), and exons 26-27 (nt 1~2991 / 2992~5991, aa 895-896). 997-998), and exons 25-26 (nt 1-3126 / 3127~5991, aa 1042-1043).
[0105] To generate the 5' vector p0101-CMV-NterhuOTOF892 (SEQ ID NO: 56), a synthetic fragment was synthesized (GenScript) and cloned into the p0101_CMV_eGFP plasmid (SEQ ID NO: 77). To generate p0101-CMV-NterhuOTOF1042, a 450 pb insert (nucleotides 3617 to 4066) was synthesized and cloned into p0101-CMV-NterhuOTOF892-AP. Plasmids P0101_CMV-huOTOF738, 841 and 997 were then generated by mutagenesis from p0101-CMV-NterhuOTOF1042 (Genscript).
[0106] The 5' vectors p0101-CMV-intron-NterhuOTOF738, 802, 841, 892, 997, and 1042 were generated by mutagenesis from the p0101-CMV-NterhuOTOF738, 802, 841, 892, 997, and 1042 constructs described above (Genscript). To generate the 3' vector (human OTOF transcript variant 5; NM_001287489.2), a synthetic fragment was synthesized (GenScript) and cloned into the p0101_CMV_eGFP plasmid (SEQ ID NO: 77), which was digested with NheI
[0205] -HindIII
[1702] (4007 bp fragment) or NheI
[0205] -BglII
[2256] (3453 bp fragment).
[0107] The full-length coding sequence of mouse otoferlin cDNA sequence (Otof1 isoform 1; NM_001100395.1) was divided into a 5' fragment (nucleotides 1 to 2448) and a 3' fragment (nucleotides 2449 to 5979), and these fragments were synthesized (GenScript). The 5' and 3' fragments were cloned into the p0101_CMV_eGFP plasmid (SEQ ID NO: 77). The 5' vector p0101-CMV-Nter mouse OTOF816_AP (SEQ ID NO: 79) and the 3' vector Cter OTOF mouse 817_AP (SEQ ID NO: 80) were generated (see Akil et al. 2019). The 5' fragment was also cloned into the p0101_smCBA_eGFP plasmid (SEQ ID NO: 96) to generate the 5' vector p0101-smCBA-Nter mouse OTOF816_AP (SEQ ID NO: 95) (see Akil et al. 2019).
[0108] AAV production AAV vectors were produced by either the University of Pennsylvania Vector Core (UPenn) or the ETH (Zurich) Vector Core facilities. AAV titers were given in viral genomes per ml (vg / ml) as determined by a ddPCR-based method (UPenn) or fluorometric analysis (ETH). Final concentrated AAV vector stocks were stored in PBS containing Pluronic-F68 (0.001%) (UPenn) or in PBS containing MgCl2 (1 mM) and KCl (2.5 mM) (ETH).
[0109] Expression of transgenes in transfected HEK293 cells HEK293 cells were cultured at 37°C in a humidified chamber containing 5% CO2. HEK293 cells were grown on polylysine-coated coverslips in DMEM / F12 (ThermoFisher) supplemented with 1x non-essential amino acids, 10% fetal bovine serum (Gibco) and penicillin / streptomycin (Pen / Strep, Invitrogen) in 6-well plates. For immunocytochemistry analysis, cells were grown on polylysine-coated coverslips. The next day, cells were transfected with Lipofectamine 3000® (ThermoFisher) at 70-80% confluency. Briefly, Lipofectamine® 3000 reagent was diluted in Opti-MEM® Medium.Mix. A master mix of DNA was prepared by diluting DNA (0.25-10 μg) in OptiMEM® Medium followed by the addition of P3000™ Reagent. The diluted DNA was added to each tube of diluted Lipofectamine® 3000 Reagent (1:1 ratio). After 5 min incubation at room temperature, the DNA-lipid complexes were added to the cells. The day after transfection, the medium was replaced. Between 24 and 48 h after transfection, cells were harvested for immunocytochemistry and RT-PCR analysis.
[0110] OTOF expression by RT-PCR Transfected HEK293 cells were scraped and total RNA was extracted using Nucleospin RNA kit (Macherey Nagel, 740955). RNA dosage was then assessed using Nanovue Plus spectrophotometer. Reverse transcription PCR of the otoferlin gene was performed on the extracted RNA with SuperScript™ III One-Step RT-PCR System (Thermofisher, 12574018) using different primer pairs designed to amplify specific junction fragments (forward 4F TGGAGGCCTCAATGATCGAC, SEQ ID NO: 45 and reverse 4R AGCCACAGGGCAGGCCGCAC, SEQ ID NO: 46 for exon 18-19 junction, and forward 5F GAGCTGAGCTGTGGCTGCTG, SEQ ID NO: 93 and reverse 5R AGTACGCCTCGTCTGCCATC, SEQ ID NO: 94 for exon 22-23 and 24-25 junction). For each RT-PCR reaction, 1 μg of RNA extract was used as template. PCR products were then run on a 0.8% agarose gel containing ethidium bromide. Sanger sequencing of PCR products was performed by Transnetyx automated sequencing service.
[0111] OTOF Expression Analysis by Immunoblot Proteins were extracted by mechanical homogenization in RIPA buffer supplemented with protease inhibitor cocktail. Samples were incubated on ice for 30 min with vortex shaking, followed by centrifugation at 12,000xg for 30 min at 4°C. Supernatants were collected, frozen in liquid nitrogen, and kept at -80°C. Protein concentration of each lysate was assessed using a colorimetric BCA protein assay (commercially available kit). Immunoprecipitation (IP) was performed using 14CC antibody preincubated with Protein A agarose (Pharmacia). Immunoprecipitates were resuspended in 50 μl of a 1:1 ratio of NuPAGE™ LDS Sample Buffer (4X) (Invitrogen) and NuPage Sample Reducing Agent (10X) (Invitrogen) and then incubated at 70°C for 10 min. Samples were mixed with a 1:1 ratio of NuPAGE™ LDS sample buffer (4X) (Invitrogen) and NuPage sample reducing agent (10X) (Invitrogen) and then incubated at 70°C for 10 min. These denatured proteins were loaded onto 3-8% NuPAGE™ Tris-Acetate Novex Mini Gels (Invitrogen) (15 μL per well) and run at 150 V for 1 h in NuPAGE™ Tris-Acetate SDS running buffer (1X). Proteins were transferred to nitrocellulose membranes using a Power Blotter-Semi Dry Transfer System for 15 min according to the commercial protocol. After incubation in blocking buffer (PBS-Tween (0.1%) and milk solution (1%)) for 1 h, the membranes were probed overnight at 4°C with the primary antibody (rabbit polyclonal antibody FP2 against the N-ter portion of otoferlin protein, diluted 1:100) in blocking buffer. After several washes with PBS-Tween (0.1%), the membrane was probed with secondary HRP antibody (goat anti-rabbit IgG(H+L)HRP, 1:5000 dilution) in blocking buffer. Chemiluminescence was developed with Clarity™ Western ECL Substrate (Biorad) for 5 min at room temperature and detected with ChemiDoc Imaging Systems (Biorad).The transfected otoferlin was estimated to be approximately 230 kDa. The membrane was then incubated in stripping buffer (Thermo Scientific), washed with PBS-Tween (0.1%) and blocked in blocking buffer for 1 h. Housekeeping protein assessment was performed by blotting with a monoclonal antibody against β-actin. The membrane was probed with a primary antibody (mouse β-actin antibody, 1:5000 dilution, Sigma) in blocking buffer for 1 h, followed by anti-mouse HRP-antibody (1:5000 dilution, Jackson ImmunoResearch) in the same blocking buffer. Chemiluminescence was developed with ECL substrate for 5 min at room temperature and detected with a ChemiDoc Imaging Systems (Biorad).
[0112] Vector delivery to the mouse cochlea All surgical procedures and virus injections were performed in a biosafety level 2 laboratory. C57BL / 6 wild-type or Otof mice at different postnatal stages (P10–P25) were cultured in a 10-well plate. - / - Mice were anesthetized with isoflurane (4% for induction and 2% for maintenance). To reduce pain, mice received a subcutaneous injection of analgesic, meloxicam (Metacam®, 0.2 mg / kg / day), at the beginning of surgery, and a subcutaneous injection of local anesthesia (Laocaine®, 5 mg / kg) in the retroauricular region. Anesthetized animals were placed on a thermopad throughout the entire surgery until the mouse was fully awake. Intracochlear injections were performed as described in Akil et al. (2019). The left ear was approached through a retroauricular incision. After incision of the cervical muscles, the auditory organ was exposed and punctured with a 25G needle. The opening was widened with forceps as necessary to visualize the stapedial artery and the round window membrane (RWM). After lightly puncturing the central part of the RWM with a glass pipette, a fixed volume (2 microliters) of AAV8-CMV_GFP with sequence number 77 (5.6x10 13 vg / ml), or Anc80L65-CMV-GFP of SEQ ID NO: 77 (5.5x10 12 vg / ml), or AAV2-CMV-GFP of SEQ ID NO: 77 (1.2x10 13vg / ml) or AAV8-CMV-NterOTOFmu816_AP of SEQ ID NO: 79 (1.3x10 13 vg / ml) and AAV8-CterOTOFmu817_AP of SEQ ID NO: 80 (1.5x10 13 vg / ml) vector pair, or AAV8-smCBA NterOTOFmu816_AP of SEQ ID NO: 95 (1.5x10 13 vg / ml) and AAV8-CterOTOFmu817_AP of SEQ ID NO: 80 (1.5x10 13 vg / ml) vector pair, or AAV8-CMVNterOTOFhu892_AP of SEQ ID NO:56 (1.1x10 13 vg / ml) and AAV8-CterOTOFhu893_AP of SEQ ID NO: 58 (0.85x10 13 PBS or virus solution containing either the vector pair (1000 ng / ml) was injected through the RWM using a pump system coupled to a glass micropipette. After withdrawing the pipette, the RW pit was quickly sealed with a small plug of muscle fixed with a small drop of biological adhesive (Vetbond® 3M) placed on the muscle to avoid leakage through the round window, and the bubble opening was closed with a small plug of fat. GFP or OTOF expression in the cochlea was assessed by immunofluorescence.
[0113] Vector delivery to the cochlea of non-human primates After an overnight fast, animals were anesthetized by intramuscular injection of a mixture of ketamine (10 mg / kg) and propofol (5–10 mg / kg), intubated, and maintained with oxygen and isoflurane throughout surgery. Animals were given prophylactic injections of antibiotics (Duphamox 15 mg / kg, IM) and anti-inflammatory drugs (Torfezin 4 mg / kg, IM). Using a transcanal approach, the round window pit (RW) of the left or right ear was exposed. Access to the ear canal was achieved through a preauricular incision. The skin of the ear canal and tympanic membrane was elevated. Canal plasty was performed by drilling holes in the posterior and anterior parts of the ear canal to access the middle ear and expose the RW pit and stapes. The round window pit was punctured and its membrane was exposed without opening it, after which a platinotomy was performed using a diode laser and a 300 micrometer outer diameter fiber. The opening of the platinum was checked by visualization of perilymph leakage from the oval window using a perforator. The RW membrane was incised with the tip of a 25 gauge needle under a surgical binocular microscope to gain access to the cochlea, and a 1 mm long thin catheter (Medel catheter) was inserted into the RW. The total time of surgery for one pinna was 1 hour on average. After injection, sealing of the oval window and round window opening was performed with a small muscle graft. A viral preparation expressing GFP under the control of the CMV promoter (AAV8-CMV-GFP 2.8x10 13 vg / ml, AAV2-CMV-GFP 1.4x10 13Injections of 100 mg ... Animals were anesthetized by injection of ketamine (10 mg / kg; IM) to enter deep anesthesia, which was maintained with propofol (1 ml / kg; IV) after placement of an intravenous catheter. After opening the thorax while under deep anesthesia (without awakening), animals were administered intracardiac perfusion first with PBS (200 mL), followed by 4% paraformaldehyde (pH 7.4) (500 mL) while under deep anesthesia.
[0114] Dissected cochleae were perfused with the same fixative and then transferred to EDTA solution for decalcification for 10 days (Kos microwave). The EDTA was refreshed twice and the decalcified bone was trimmed after each replacement. The cochlear sensory epithelium (organ of Corti) was microdissected and then processed for GFP immunodetection. The organ of Corti was preincubated in PBS containing 20% horse serum, 0.3% TritonX-100, and 0.3% saponin in PBS for 1 h at room temperature, and then incubated with the primary antibody (chicken anti-GFP, Invitrogen) in diluted blocking buffer (dilution 1:20) at room temperature overnight. The samples were rinsed three times with PBS and incubated with the appropriate secondary antibody (Alexa Fluor488 goat anti-chicken IgG, Invitrogen) in PBS for 1 h at room temperature. The samples were then stained with phalloidin-Atto565 (Sigma) and 4',6-diamidino-2-phenylindole (DAPI) to visualize cell nuclei, mounted on glass slides with one drop of Fluorsave solvent, and observed under a Zeiss confocal immunofluorescence microscope.
[0115] Hearing Test Anesthetized Otof + / + Mouse, Otof - / - Mice, and rescued Otof - / - Hearing tests were performed in mice at various time points in a soundproof chamber as previously described ( Akil O. et al., 2019 ). Pure tone stimuli were used at frequencies of 5, 10, 15, 20, 32, and 40 kHz. Hearing thresholds were defined as the lowest stimulus level at which ABR peaks of waves I–V were clearly defined and repeatedly present upon visual inspection. ABRs were analyzed with Matlab software.
[0116] Fluorescence microscopy In vitro testing Transfected cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS), pH 7.4, for 20 min at room temperature, rinsed three times with PBS, and incubated with 0.25% TritonX-100 for 15 min at room temperature. Cells were rinsed twice with PBS and blocked with horse serum (20%) in PBS for 1 h at room temperature. Cells were then incubated with a mixture of rabbit polyclonal antibody FP2 against the C-terminal part of otoferlin (Institut Pasteur, dilution 1:200) and mouse monoclonal antibody against the N-terminal part of otoferlin (Institut Pasteur, dilution 1:100) for 1 h at room temperature. Samples were washed twice with PBS and incubated with secondary antibodies (AlexaFluor goat anti-rabbit 488, goat anti-mouse 555, Life Technologies, dilution 1:500) in PBS for 1 h at room temperature. Samples were then rinsed twice with PBS, stained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize cell nuclei, mounted on glass slides with a drop of Fluorsave medium (EMB Millipore), and observed using an Olympus confocal immunofluorescence microscope.
[0117] In vivo testing Mouse cochleae were perfused with 4% paraformaldehyde in 0.1 M PBS (pH 7.4) and incubated in the same fixative for 45 min at RT at 4° C. Cochleae were rinsed three times with PBS and decalcified by incubation with 0.5 M ethylenediaminetetraacetic acid (EDTA) overnight at 4° C. After several rinses (three times with PBS), the cochlear sensory epithelium (organ of Corti) was microdissected into superficial preparations, preincubated in 0.03% TritonX-100 and 20% horse serum in PBS (blocking buffer) for 1 h at RT, and incubated with primary antibodies overnight at 4° C. The following antibodies were used: chicken polyclonal GFP (1:400 dilution, Abcam), or rabbit anti-otoferlin (1:100 dilution, Institut Pasteur), mouse (IgG1) anti-CtBP2 (1:200 dilution, Millipore) and anti-glutamate receptor subunit A2 (1:2000 dilution; Millipore). Samples were rinsed three times with PBS and incubated with the appropriate secondary antibodies: Fluor488-labeled anti-chicken lgY (1:500 dilution; Life Technologies) or Atto Fluor647-labeled anti-rabbit IgG (1:200 dilution; Sigma), Fluor488-labeled anti-mouse IgG1 and Alexa Fluor568-labeled anti-mouse lgG2a (1:500 dilution; Life Technologies). Samples were rinsed three times with PBS and incubated with the appropriate secondary antibodies: samples were washed three times with PBS and mounted on glass slides with one drop of Fluorsave, with DAPI (1:7500 dilution) to stain cell nuclei. Fluorescent confocal z-stacks of the organ of Corti were acquired using an LSM700 confocal microscope (Zeiss) equipped with a high-resolution objective (63x oil immersion objective). Images were then analyzed using FIJI software.
[0118] Transfection rate The percentage of otoferlin protein-expressing cells was calculated as follows: number of cells with detectable green fluorescent signal / total number of cells (DAPI stained cell nuclei). The counting was performed on all coverslips or slides by NIS Element 3.1 imaging software (Nikon).
[0119] 2.Results 2.1. In vivo testing of AAV8 vector tropism by the CMV promoter (WT animals) 2.1.1. We first analyzed the ability of AAV8-CMV-GFP to transduce inner ear cells at the mature stage (P12) after a single intracochlear injection in C57BL / 6 mice. AAV8-CMV-GFP was found to primarily target IHCs where otoferlin is expressed, and the transduction rates were 89 and 100% in the base and apex, respectively (Figure 1A). These results indicate that this AAV capsid / promoter combination is suitable for delivering therapeutic genes to IHCs.
[0120] 2.1.2. Inner ear tropism of some AAV serotypes in mice We assessed the ability of several adeno-associated virus (AAV) serotypes (AAV2, AAV8, and Anc80) to transduce mature mouse hair cells. We examined the IHC transduction rates achieved after a single viral intracochlear injection of each recombinant vector, in which the CMV promoter drives expression of GFP as a reporter gene. Adult stage (P20) C57BL / 6 wild-type mice were injected (2 microliters) with AAV recombinant vectors via the RWM. More precisely, the left ear was approached via a dorsal incision and the virus was delivered to the cochlea as previously described (Akil et al., (2019)). Anesthetized C57BL / 6 wild-type or Otof mice were injected with AAV recombinant vectors via the RWM. More precisely, the left ear was approached via a dorsal incision and the virus was delivered to the cochlea as previously described (Akil et al., (2019)). - / - Mice were injected with 2 microliters of AAV8-CMV-GFP containing SEQ ID NO:77 (5.6x10 13 vg / ml), Anc80L65-CMV-GFP containing SEQ ID NO: 77 (5.5x10 12vg / ml), or AAV2-CMV-GFP containing SEQ ID NO:77 (1.2x10 13 The mice were administered a virus solution containing 1000 ng / ml of GFP (Figure 1B). GFP expression in the cochlea was evaluated by immunofluorescence.
[0121] The analysis shows that AAV8-CMV-GFP primarily targeted IHCs throughout the entire cochlear spiral (IHC transduction 94%) and did not target outer hair cells (OHCs) (<1%). Anc80L65 transduced primarily IHCs (97%) and to a lesser extent OHCs (13%) throughout the entire cochlear spiral. AAV2 transduced not only IHCs (95%) but also OHCs (60-80%) (see example images in Figure 1B). Thus, AAV8 in combination with the ubiquitous CMV promoter is a highly efficient recombinant vector for targeting mature IHCs in vivo.
[0122] 2.1.3. AAVS Tropism in the Non-Human Primate (NHP) Inner Ear The tropism of some AAVS tested in mice was further investigated in non-human primates. Viral preparations were injected into the cochleae of non-human primates via the round window (transcanal tympanotomy approach) in combination with small fenestration at the oval window (injection volume: 30 microliters). All injected cochleae were fixed 3 weeks after transgene delivery and processed for immunolabeling for the GFP reporter gene. Importantly, the results (see Figures 1C and 1D for example images) show that the transduction rate and pattern profile of AAV8-CMV-GFP are similar to those obtained in mice: AAV8 vectors efficiently and specifically transduced IHCs (up to 95%) and, to a lesser extent, supporting cells of the injected cochlea. None of the OHCs were transduced by the AAV8 vector. In contrast, AAV2 was able to transduce OHCs (40%) as well as IHCs (79%), as observed in mice (see 2.1.1.). This nonspecific infectivity may increase the risk of nonspecific expression of the therapeutic gene, even though a comparable targeting of OHCs, these cells are not defective in the case of DFNB9 deafness.
[0123] Thus, these results demonstrate that the AAV8 capsid / CMV promoter combination of the present invention delivered to the NHP cochlea very efficiently and specifically transduces IHCs but not OHCs (contrary to AAV2-CMV-GFP).
[0124] 2.2. Evaluating the Efficacy of Different Human Otoferlin Cleavage Sites in Dual Vector Constructs We employed the same strategy used for the dual mouse otoferlin CMV vector and the modified dual AAV vector expressing human otoferlin protein (Figure 3). Because the efficacy of the dual AAV can be affected by the cleavage site within the cDNA, we generated several human otoferlin fragments using various cleavage sites and compared their ability to recombine to reconstitute the full-length otoferlin protein in vitro. To generate the dual human otoferlin vector constructs, the full-length coding sequence of the cochlear isoform of human otoferlin cDNA (transcript variant 5, and the novel transcript variant) was split into distinct 5' fragments (nt 1-2214, nt 1-2406, nt 1-2523, nt 1-2676, nt 1-2991, and nt 1-3126) and 3' fragments (nt 2215-5991, nt 2407-5991, nt 2524-5991, nt 2677-5991, nt 2992-5991, and nt 3127-5991). The 5' construct contained a 5' fragment of hOTOF cDNA (encoding amino acids (aa) 1-738, aa 1-802, aa 1-841, aa 1-892, aa 1-997, and aa 1-1042) under the control of the CMV promoter, optionally followed by intron sequences and / or Kozak sequences, followed by a splice donor site (SD), and the 3' construct contained the 3' portion of hOTOF cDNA (encoding aa 739-1997, aa 803-1997, aa 842-1997, aa 893-1997, aa 998-1997, and aa 1043-1997) and a splice acceptor (SA) site (Figure 3). All fragments containing the alkaline phosphatase recombinant bridging sequence (AP) were inserted into the AAV-p0101 plasmid, designated p0101-CMV-Nter huOTOF (738, 802, 841, 892, 997, and 1042) and p0101-hOTOF Cter huOTOF (739, 803, 842, 893, 998, and 1043) constructs.
[0125] The sequences of these constructs are given in the enclosed list SEQ ID NOs: 47-64 and SEQ ID NOs: 70-75, which code for the N-terminal or C-terminal parts of isoform 5 of human OTOF.
[0126] [Table 1] TIFF2024534991000002.tif45159
[0127] HEK293 cells were transfected using lipofectamine with either p0101 CMV-NTerhuOTOF alone (738, 802, 841, 892, 997 and 1042, Left panel), p0101 CTerhuOTOF alone (739, 803, 842, 893, 998 and 1043, Right panel), or both p0101 CMV-NTerhuOTOF and p0101 CTerhuOTOF (738-739, 802-803, 892-893, 997-998 and 1042-1043).
[0128] Cells were stained for otoferlin expression 48 h after transfection with the previously characterized mouse monoclonal antibody 10H9 (red) and rabbit polyclonal antibody FP2 (green) against the N- and C-terminal portions of human otoferlin, respectively (dilution 1:200). ACTIN filaments were labeled with phalloidin (orange) and cell nuclei with DAPI (blue) (not shown). Results for only three cleavage sites are shown.
[0129] The results showed that all tested double plasmid constructs, including junctions 738-739, 892-893, and 997-998, were able to reconstitute otoferlin protein. Although the proportion of cells expressing otoferlin at a given junction site showed variation, statistical tests showed that these proportions were not significantly different, implying that the efficiency of recombination involving the three cleavage sites was quite similar (Figure 5B). These results indicated that co-transfection of dual OTOF plasmids resulted in recombination of the full-length cassette, resulting in human otoferlin protein expression, regardless of the junction site used. We conclude that reconstitution of the otoferlin full-length cDNA will occur as long as the cleavage site yields a DNA fragment that remains within the limits of the packaging capacity of AAVS.
[0130] 2.3. In vitro evaluation of recombination efficacy of different dual AAV8-CMV-huOTOF constructs To evaluate the recombination efficiency of the various dual AAV OTOF vector pairs (examples of which are given with the dual human OTOF Nter-Cter 738-739, 892-893, and 997-998 vectors containing the CMV promoter), transfected cells were harvested and RNA transcript expression was evaluated by RT-PCR using specific primers encompassing the splice junctions. RNA extracts were reverse transcribed and subjected to PCR amplification with primers designed to amplify 898 or 946 bp fragments of otoferlin cDNA encompassing the junction between Otof Nter and Otof Cter cDNA. Negative (untransfected HEK293 cells) and positive (pcDNA3 containing HuOTOF cDNA under the control of the CMV promoter) controls are shown. M: DNA molecular weight marker. The positions of the 0.5 and 1.5 kb molecular weight markers of the DNA ladder are shown to the left of the electrophoretic gel (Figure 7A).
[0131] RT-PCR amplified fragments of the predicted size, which were 946 bp (Nter-Cter 738-739) or 898 bp (Nter-Cter 892-893 and NTer-Cter 997-998), similar to the fragments amplified from the huOTOF cDNA control (Figure 7A). No amplicons were obtained when only the 5' or 3' part of huOTOF was used as a template. Sanger sequencing after purification of the specific amplicons showed perfect sequence alignment of the 738-739, 892-893, or 997-998 junctions with the native cDNA sequence of huOTOF, confirming that the vector pairs had recombined (not shown). More precisely, the recombination events of the double AAV OTOF vector pair in the transfected cells allow the precise excision of the splice donor (SD), splice acceptor (SA) and ITR sequences originally contained in the 5' and 3' vector sequences. Sanger sequencing of the transcripts amplified by RT-PCR shows perfect homology of the amplicons with otoferlin exon sequences. These results indicated that precise homologous recombination and mRNA splicing occurred in HEK293 cells transfected with the double OTOF vector pair.
[0132] Recombination of full-length huOTOF protein was also assessed by Western blot. The dual 738-739, 892-893, and 997-998 plasmids were transfected into HEK293 cells. Cells were harvested for 48 h and subjected to Western immunoblotting using anti-otoferlin antibody after efficient protein extraction and lysis (Figure 7B). For each of the dual plasmids, the corresponding Nter and Cter or only the Nter or Cter portion was used for transfection. Otoferlin-specific antibody was used to identify full-length otoferlin protein. HEK293 cells transfected with HuOTOF (Hu cDNA) plasmid were used as a positive control.
[0133] The results shown in Figure 7B show that all dual plasmid constructs resulted in the expression of a protein with an apparent molecular weight of approximately 230 kDa, which is equivalent to the molecular weight of the human otoferlin protein. As expected, no bands of the predicted size were observed when only Nter or Cter dual plasmids were used for transfection. In conclusion, the various dual OTOF plasmid constructs tested herein led to the assembly of two otoferlin cDNA fragments and the in vitro expression of the full-length human OTOF protein.
[0134] 2.4. In vivo validation of dual AAV8 huOTOF vectors The next step was aimed at examining the efficacy of gene therapy treatments using dual AAV8 vectors containing CMV promoters to drive expression of human or mouse otoferlin proteins to rescue hearing when administered prior to hearing development (at P10) and to reverse the hearing loss phenotype when administered into the cochleae of DFNB9 mice at the mature stage (i.e., P18–P25, well after hearing development). For this purpose, dual vectors according to the invention encoding mouse or human otoferlin protein were engineered as disclosed in Materials and Methods.
[0135] 2.4.1. Otof using the CMV promoter - / - Dual AAV8 expression of mouse Otof in the mouse cochlea AAV8 dual mouse CMV vector (AAV8-CMV-NterOTOFmu816_AP of SEQ ID NO: 79 (1.3x10 13 vg / ml) and AAV8-CterOTOFmu817_AP of SEQ ID NO: 80 (1.5x10 13 A single unilateral injection of 100 mg / ml of 1000 mg ... - / -The study was performed in mice. 54 days after injection of the recombinant vector pairs, the sensory epithelium of treated cochleae was microdissected and immunolabeled for otoferlin to estimate the transduction rate of IHC. The mouse protein was detected in almost all of the IHC (Figure 2A). This result provides evidence that mouse otoferlin cDNA can be efficiently reconstituted in cochlear sensory cells when the two halves of otoferlin cDNA are co-delivered in vivo using the dual AAV8 capsid / CMV promoter combination.
[0136] ABR recordings 52 days after P10 injection showed substantial recovery of hearing thresholds (up to 40 dB) in response to tone burst stimuli (5, 10, 15, and 20 kHz) in treated mice (n = 6), but not in non-injected Otof - / - We demonstrated that hearing thresholds were not restored in mice (Figure 2B). The long-term efficacy of gene therapy was assessed by performing ABR recordings in response to 15 kHz tone bursts at time points between 4 and 47 weeks (Figure 2C). Hearing lifetimes to the 15 kHz frequency between 4 and 47 weeks post-injection were comparable between responsive treated mice (6 of 8) and non-injected WT mice. The long-term efficacy of gene therapy in treated mice was similarly assessed using ABR recordings in response to tone burst stimuli at other frequencies (5, 10, 15, 20, 32, and 40 kHz) at various time points between 4 and 47 weeks post-injection (Figure 2D). ABR analysis showed that restored hearing thresholds were maintained over time in all responding mice (6 of 8) and were near wild-type levels, except for the high frequencies (32 and 40 kHz).
[0137] The longevity of hearing recovery is also related to the Otof - / - Following intracochlear injection of dual AAV8-CMV-muOTOF vs. AAV8-smCBA-muOTOF vectors in mice, an acoustic frequency of 15 kHz was tested. P10 OTOF - / -Mice were injected through the round window membrane with 2 μL of AAV8-smCBA-muOTOF (SEQ ID NO:95 and SEQ ID NO:80) (n=15; circles) or AAV8-CMV-muOTOF (SEQ ID NO:79 and SEQ ID NO:80) (n=8; squares) at 3.0E+10 and 2.8E+10 total vg (1:1 ratio), respectively. Auditory brainstem response (ABR) thresholds were measured periodically at different frequencies over a period of one year. From weeks 4 (ABR1) to 40 (ABR14) after injection, ABR thresholds at 15 kHz frequency were higher in mice treated with the AAV8-smCBA-muOTOF vector than in mice injected with the dual AAV8-CMV-muOTOF vector (Figure 2G).
[0138] AAV8-CMV-NterOTOFmu816_AP (1.3x10 13 vg / ml) and AAV8-CterOTOFmu817_AP of SEQ ID NO: 80 (1.5x10 13 A vector pair consisting of 1000 ng / ml was also administered to 20 Otof mice after auditory development (p21-p22). - / - More precisely, these double vectors were used to treat P21-P22 day old Otof mice, as described in the "Materials and Methods" section. - / - were delivered into the cochleae of DFNB9 mice after hearing development in mice (n=20). At 18 weeks post-injection, ABR analysis showed robust hearing recovery, which was maintained over time in all responsive treated mice (9 of 20) with an average threshold of 70 dB (Figure 2E). Mouse #8's hearing was significantly rescued to wild-type levels 18 weeks post-injection. We next examined IHC transduction rates and otoferlin expression in adult-stage mice injected with the dual AAV8-CMV-muOTOF vector. Mice were euthanized, and their cochleae were microdissected and immunolabeled for otoferlin and ribeye, a synaptic marker but which also stains IHC nuclei. Injected cochleae of all responder mice showed variable IHC transduction rates. In the cochleae of the best responder mouse (mean ABR threshold 40 dB, 15 kHz frequency), 60–81% of IHCs were transduced throughout the entire cochlear spiral (from apex to base, Figure 2H). None of the OHCs in the responder mice expressed otoferlin, confirming the specificity of our treatment vector.
[0139] These results suggest that the expression of a fragmented mouse otoferlin cDNA using a dual AAV8 vector and a CMV promoter before or after hearing development was significantly correlated with the expression of the Otof - / - We show that delivery to the mouse cochlea results in production of the full-length protein, which is restricted to IHCs. Despite variability in transduction rates, AAV gene therapy successfully transduces Otof protein into the cochlea of mice that would otherwise be left severely deaf. - / - The mice's hearing was restored, and importantly, the hearing recovery lasted for at least nearly a year.
[0140] 2.4.2. Otof using the CMV promoter - / - Dual AAV8 expression of human Otof in the mouse cochlea We next tested the efficacy of gene therapy using a dual AAV8 vector containing a CMV promoter that drives expression of human otoferlin and reverses the hearing loss phenotype when administered into the cochlea of DFNB9 mice at a mature stage (well after hearing development). One of the best performing double plasmids (double OTOF Nter 892-893) based on in vitro reconstruction of the full-length human otoferlin protein was also tested. AAV8-CMVNterOTOFhu892_AP (1.1x10 13vg / ml) and AAV8-CterOTOFhu893_AP of SEQ ID NO: 57 (0.85x10 13 A vector consisting of 1000 mg / ml was administered to 17 otofilia after auditory development (P18-P25). - / - was administered to mice. More precisely, these dual vectors were transfected into P18-P25 day old Otofocytes as described in the Materials and Methods section. - / - The cells were delivered to the cochlea of DFNB9 mice after mouse hearing development. At 18 weeks post-injection, ABR analysis showed that hearing rescue was maintained in responsive treated mice (4 of 14) with an average threshold of 90 dB (Figure 2F). However, ABR thresholds in treated mice did not reach WT levels. Mouse (#3) was significantly rescued to wild-type levels 18 weeks post-injection (Figure 2F). IHC transduction rates and otoferlin expression were examined in mature stage mice treated with dual AAV8-CMV-huOTOF vectors. Mice were euthanized and their cochleae were microdissected and immunolabeled for otoferlin and with ribeye, a synaptic marker but which also stains IHC nuclei. Injected cochleae of all responder mice showed transduced IHC with variable transduction rates. In the cochlea of the best responder mouse (#3, average 60 dB, 15 kHz frequency), 60-80% of IHCs were transduced throughout the entire cochlear spiral (from apex to base, Figure 2I). Importantly, none of the OHCs from the responder mice expressed human otoferlin, further confirming the efficiency (high transfection rates of >60% were achieved by IHC) and specificity of the therapeutic vector of the invention. In conclusion, mature Otof of dual AAV8 vectors encoding human otoferlin therapeutic transgenes - / - Delivery to the cochlea was performed using adult Otof - / -These results suggest that dual AAV8 / CMV promoters driving human otoferlin, just like mouse otoferlin, restore hearing in the DFNB9 mouse model, confirming the suitability of this combination for delivering therapeutic genes to mature IHCs.
[0141] Example 2: Identification of novel isoforms of OTOF in humans The mouse transcript for which hearing restoration was demonstrated in the PNAS publication (AKil et al., PNAS 2019) differs from the human isoform 5 transcript in two ways: The mouse transcript has an additional exon (exon 6 in the mouse sequence), and Exon 31 in the mouse transcript is shorter than the equivalent human exon 30 in the human isoform 5 transcript (numbering relates to the absence of exon 6 reported in humans). Therefore, a similar sequence of exon 6 was searched for in human intron 5 sequences. A nearly identical region was identified in the human sequence. They then examined the splice donor and acceptor sites flanking the newly discovered sequences and found that they were present.Finally, they compared the amino acid sequences obtained by translation of the identified sequences and found that the sequences are highly conserved between humans and mice. mouse_Otof-202_exon6_genomic_seq = SEQ ID NO: 65 CAAAGGCAGAGAGAAGACCAAGGGAGGCAGAGATG G CGAGCACAA 45 human_OTOF-205_putative_exon6_genomic_seq=SEQ ID NO:66 CAAAGGCAGAGAGAAGACCAAGGGAGGCAGAGATG A CGAGCACAA 45 All nucleotides are the same except for those underlined. mouse_Otof-202_exon6_protein_seq = SEQ ID NO: 67 KGREKTKGGRD G EH 14 human_OTOF-205_putative_exon6_protein_seq=SEQ ID NO:68 KGREKTKGGRD D EH 14 All amino acids are the same except for those underlined. These elements together constitute very strong evidence supporting the presence of exon 6 in the human OTOF gene.
[0142] In addition, the presence of a truncated exon 30 has been observed in other human isoforms of OTOF reported in the database (e.g., isoforms 2 and 3). Thus, human therapeutic cDNAs may also contain a truncated exon 30 (and future exon 31, taking into account the supplementary exons).
[0143] According to a previous publication (Yasunaga et al., J Hum Genet 2000), alternative exon arrangements have been observed in the mouse cochlea and three associated exons (arrangements are shown in Figure 6): C2 is unique to the cochlea, and A1 and A2 are present in the cochlea, as are B1 and B2. The human functional OTOF may in fact be encoded by a cDNA sequence comprising: - A1-B2-C2 (identical to the mouse transcript): contains exon 6 and a shorter exon 30 (SEQ ID NO: 16) and encodes the protein of SEQ ID NO: 6; -A1-B1-C2: contains exon 6 and normal size exon 30 (SEQ ID NO: 17) and encodes the protein of SEQ ID NO: 7; -A2-B2-C2: does not contain exon 6 but contains the shorter exon 30 (SEQ ID NO: 18) and encodes the protein of SEQ ID NO: 8. These novel isoforms, in addition to the current human isoform 5 transcript, may encode proteins of SEQ ID NO:6, SEQ ID NO:7 and / or SEQ ID NO:8 that have the potential to restore hearing in humans.
[0144] References Ahmed et al, JARO 18:649-670(2017) Akil et al. Proc Natl Acad Sci U S A. 2019 Mar 5;116(10):4496-4501 Dai C.et al, JARO, 18:601-617, 2017 Delmaghani et al. Cell. 2015 Nov 5;163(4):894-906 Duan D.et al, Molecular Therapy 2001, vol.4, N°4, pp.383-391 Dulon et al. J Clin Invest. 2018 Aug 1;128(8):3382-3401 Duman D.& Tekin M, Front Biosci(Landmark Ed)17:2213-2236(2012) Emptoz et al. Proc Natl Acad Sci U S A. 2017 Sep 5;114(36):9695-9700 Ghosh et al. Hum Gene Ther. 2011 Jan;22(l):77-83 Hardelin et al., medicine / sciences 2019;35:1213-25 Kral A & O’Donoghue GM N Engl J Med 363(15):1438-1450(2010) Lock et al. 2014 Human Gene Therapy Methods 25:115-125 Marlin S.et al, Biochemical and Biophysical Research Communications, 394(2010)737-742 Michalski et al, Elife, 2017 Nov 7;6 e31013 Pangrsic T.et al,Trends in Neurosciences,2012,col.35,No.11 Pujol et Lavigne-Rebillard,Acta oto-laryngologica.Supplement · February Roux et al,Cell 127(2):277-89,2006 Starr A.et al,Brain,Volume 119,Issue 3,June 1996,Pages 741-753 Suzuki et al., Sci.Rep.7:45524(2017); Varga R.et al,J.Med.Genet 2006;43:576-581 J Hum Genet.2000 Sep;67(3):591-600 Yoshimura et al., Sci.Rep.8:2980(2018) Zhang et al,Frontiers in Molecular Neuroscience,vol.11,Art.221,2018 Zhang Q.et al,Hearing research,Volume 335,May 2016,Pages 53-63
Claims
1. A vector system comprising at least two different AAV particles, namely: a) at least one AAV8 particle comprising a first polynucleotide, the first polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide and, between the inverted terminal sequences, from 5' to 3', a CMV promoter sequence followed by a partial coding sequence containing an N-terminal coding portion of an otoferlin gene; and b) at least one AAV8 particle comprising a second polynucleotide, said second polynucleotide comprising an inverted terminal sequence at each end of said polynucleotide and, 5' to 3' between said inverted terminal sequences, a partial coding sequence containing a C-terminal coding portion of an otoferlin gene; Including, the first and second polynucleotides also comprise recombinogenic sequences; the coding sequences in the first and second polynucleotides, when combined, encode isoform 5 of otoferlin polypeptide or a functional fragment thereof; Vector system.
2. The vector system described in claim 1, wherein the second polynucleotide comprises an inverted terminal sequence at each end of the polynucleotide, and between the inverted terminal sequences, from 5' to 3', a partial coding sequence containing the C-terminal coding portion of the otoferlin gene followed by a polyadenylation sequence, and the second polynucleotide also comprises a recombination-inducing sequence.
3. The vector system of claim 1 , wherein the otoferlin gene has the sequence of SEQ ID NO: 15 or a homologous sequence thereof.
4. a) at least one AAV8 particle comprising a first polynucleotide, the first polynucleotide comprising an inverted terminal sequence at each end of the polynucleotide, and between the inverted terminal sequences, from 5' to 3', a CMV promoter followed by a partial coding sequence containing an N-terminal coding portion of an otoferlin gene and a splice donor site; and b) at least one AAV8 particle comprising a second polynucleotide, said second polynucleotide comprising an inverted terminal sequence at each end of said polynucleotide and, between said inverted terminal sequences, from 5' to 3', a partial coding sequence containing a splice acceptor site and a C-terminal coding portion of the otoferlin gene, followed by a polyadenylation sequence; Including, the first and second polynucleotides also comprise a recombinogenic sequence located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide; The vector system of claim 1 .
5. The vector system of claim 1 , wherein the recombination-inducing sequence is the foreign sequence of SEQ ID NO: 69 or a homologous sequence thereof.
6. 2. The vector system of claim 1, wherein the CMV promoter has SEQ ID NO: 9 or a homologous sequence thereof.
7. 2. The vector system of claim 1, wherein the CMV promoter is followed by an intron sequence, the intron sequence being located upstream of the N-terminal coding portion of the otoferlin gene.
8. The vector system described in Claim 7, wherein the intron sequence is sequence number 10.
9. The vector system of claim 1 , wherein the second polynucleotide also comprises the WPRE sequence of SEQ ID NO:
23.
10. 2. The vector system of claim 1, wherein the N-terminal coding portion of the otoferlin gene is located at nucleotides 1 to 2214, nucleotides 1 to 2406, nucleotides 1 to 2523, nucleotides 1 to 2676, nucleotides 1 to 2991, or nucleotides 1 to 3126 of the otoferlin gene of SEQ ID NO: 15 or a homologous sequence thereof.
11. a) at least one AAV8 particle comprising a first polynucleotide, the first polynucleotide comprising, in 5' to 3' order between the inverted terminal sequences, a CMV promoter of SEQ ID NO:9 followed by nucleotides 1-2214, nucleotides 1-2406, nucleotides 1-2523, nucleotides 1-2676, nucleotides 1-2991, or nucleotides 1-3126 of the otoferlin gene of SEQ ID NO:15 and a splice donor site; and b) at least one AAV8 particle comprising a second polynucleotide, said second polynucleotide comprising, in a 5' to 3' direction between said inverted terminal sequences, a splice acceptor site and nucleotides 2215 to 5991, nucleotides 2407 to 5991, nucleotides 2524 to 5991, nucleotides 2677 to 5991, nucleotides 2992 to 5991, or nucleotides 3127 to 5991 of the otoferlin gene of SEQ ID NO: 15; Including, the first and second polynucleotides also comprise a recombinogenic sequence of SEQ ID NO: 69 located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide; The vector system of claim 1 .
12. The vector system of claim 11, wherein the first polynucleotide comprises an inverted terminal sequence at each end of the polynucleotide, and between the inverted terminal sequences, from 5' to 3', a CMV promoter of SEQ ID NO: 9, an intron sequence of SEQ ID NO: 10, followed by nucleotides 1 to 2214, nucleotides 1 to 2406, nucleotides 1 to 2523, nucleotides 1 to 2676, nucleotides 1 to 2991 or nucleotides 1 to 3126 of the otoferlin gene of SEQ ID NO: 15, a splice donor site and a recombination induction sequence of SEQ ID NO:
69.
13. The vector system of claim 11, wherein the second polynucleotide comprises an inverted terminal sequence at each end of the polynucleotide, and between the inverted terminal sequences, from 5' to 3', a recombination-inducing sequence of SEQ ID NO: 69, a splice acceptor site, and nucleotides 2215 to 5991, 2407 to 5991, 2524 to 5991, 2677 to 5991, 2992 to 5991, or 3127 to 5991 of the otoferlin gene of SEQ ID NO: 15, followed by a WPRE sequence and / or a polyadenylation sequence.
14. a) at least one AAV8 particle comprising a first polynucleotide, the first polynucleotide comprising, from 5' to 3' between the inverted terminal sequences, a CMV promoter of SEQ ID NO:9 followed by nucleotides 1-2214, nucleotides 1-2676, or nucleotides 1-2991 of the otoferlin gene of SEQ ID NO:15 and a splice donor site; and b) at least one AAV8 particle comprising a second polynucleotide, said second polynucleotide comprising an inverted terminal sequence at each end of said polynucleotide and, between said inverted terminal sequences, from 5' to 3', a splice acceptor site and nucleotides 2215 to 5991, 2677 to 5991 or 2992 to 5991 of the otoferlin gene of SEQ ID NO: 15 followed by a polyadenylation sequence; Including, the first and second polynucleotides also comprise a recombinogenic sequence of SEQ ID NO:69 located after the splice donor site in the first polynucleotide and before the splice acceptor site in the second polynucleotide; The second polynucleotide does not contain the WPRE sequence of SEQ ID NO: 23; The vector system of claim 1 .
15. The vector system described in claim 14, wherein the first polynucleotide comprises an inverted terminal sequence at each end of the polynucleotide, and between the inverted terminal sequences, from 5' to 3', the CMV promoter of SEQ ID NO: 9, an intron sequence of SEQ ID NO: 10, followed by nucleotides 1 to 2214, nucleotides 1 to 2676 or nucleotides 1 to 2991 of the otoferlin gene of SEQ ID NO: 15, a splice donor site and a recombination induction sequence of SEQ ID NO:
69.
16. A pharmaceutical composition comprising a vector system according to any one of claims 1 to 15 and a pharmaceutically acceptable vehicle.
17. 17. The pharmaceutical composition of claim 16, for use in treating patients suffering from DFNB9 hearing loss or a patient suffering from a disorder associated with altered DFNB9 gene expression or deficiency, or for use in preventing DFNB9 hearing loss in patients with a DFNB9 mutation.
18. 18. The pharmaceutical composition of claim 17, wherein the patient is a human patient diagnosed with DFNB9 hearing loss after language acquisition.
19. 18. The pharmaceutical composition of claim 17, wherein the patient is a human teenager or human adult suffering from DFNB9 hearing loss induced by a temperature-sensitive mutation.
20. 20. The pharmaceutical composition of claim 19, wherein the temperature-sensitive mutation is selected from PQ994VfsX6, p.I515T, p.G541S, PR1607W, pE1804del, c.2975_2978delAG / c.4819C>T, c.4819C>T (c.R1607W).