Proteolytic substances

Abstract

The present invention relates to a method of degrading a target protein by forming a fusion protein comprising a hole-modified mutant BET bromodomain conjugated to the target protein and using a degradation compound to initiate protein degradation.

Description

[Technical field]

[0001] The present invention relates to a method for degrading a target protein by forming a fusion protein comprising a hole-modified mutant BET bromodomain conjugated to the target protein and using a degradation compound to initiate protein degradation. The present invention also provides a compound of formula (I) capable of binding to a hole-modified mutant BET bromodomain, in particular a mutant Brd4 bromodomain tagged to a target protein. Furthermore, the present invention relates to a degradation compound of formula (IA) comprising a segment derived from the compound of formula (I) and capable of binding to a hole-modified mutant Brd4 bromodomain, a linker, and a segment capable of binding to an E3 ubiquitin ligase. The present invention relates to the use of the compound of formula (IA) for degrading proteins, in particular proteins endogenously tagged with a hole-modified mutant Brd4 bromodomain. [Background technology]

[0002] Targeted protein degradation has been established as a powerful modality in chemical biology and drug discovery. Proteolysis targeting chimeras (PROTACs) are heterologous bifunctional molecules that disrupt the ubiquitin proteasome system by recruiting E3 ubiquitin ligases to a target protein of interest, promoting protein polyubiquitination and subsequent proteasomal degradation (Bond, MJ; Crews, CM, RSC Chemical Biology 2021, 2 (3), 725-742). The ability to completely and rapidly remove a protein, as opposed to simply blocking a single activity or interaction, provides an attractive mechanism of action to study the biological properties, therapeutic potential, and pharmacologically act on a target protein. However, PROTAC approaches are limited by the availability of small molecule ligands involved in protein targeting. Although good ligands are available for many target proteins, the majority of the human proteome lacks such binding ligands (Oprea, TI et al., Nat Rev Drug Discov. 2018, 17 (5), 317-332). It is therefore important to develop novel methodologies to address unligandable proteins, many of which remain unexplored in biology and disease.

[0003] To act on proteins that have no binding ligand, a complementary strategy involves modifying the gene encoding the protein of interest by adding a tag, also called a "degron tag," that allows the small molecule to bind to an E3 ligase and directly recruit the E3 ligase to ubiquitinate and degrade the target protein. Examples of tag-based degron systems include the auxin-inducible degron (AID), whereby a target protein is fused to the AID / IAA17 degron sequence recognized by the plant quince RING E3 ligase TIR1 in the presence of the molecular adhesive auxin (Natsume, T.; Kiyomitsu, T.; Saga, Y.; Kanemaki, MT, Cell Reports 2016, 15 (1), 210-218.) or in the presence of a bumped analogue that selectively targets mutant TIR1 (Yesbolatova, A. et al., Nat Comm. 2020, 11 (1), 5701.); HaloPROTAC, a bifunctional molecule with a chloroalkane warhead that forms a covalent bond with a Halo tag fused to the target protein at one end and to the E3 ligase von Hippel-Lindau (VHL) at the other end (Tovell, H. et al., ACS Chem Biol. 2019, 14 (5), 882-892); and FKBP12 fused to a target protein at one end. F36Vand dTAG (Nabet, B. et al., Nat. Chem. Biol. 2018, 14 (5), 431-441), a bifunctional molecule that binds to cereblon (CRBN) or VHL ligase at the other end. Although these approaches have been successfully used to induce degradation of target proteins in cells and in vivo, they all have recognized disadvantages and limitations. For example, the AID method can be leaky (background target degradation occurs even before auxin dosing), requires high concentrations of auxin to work, and also requires inconvenient additional manipulations to allow expression of foreign plant E3 ligases; all limitations that can lead to potential off-target effects. HaloPROTACs react covalently with tagged proteins and therefore require stoichiometric modification of the tagged protein to induce maximal degradation, and therefore lack the substoichiometric catalytic mode of action that is an advantage of noncovalent degraders; consequently, HaloPROTACs tend not to achieve complete target degradation, even at high doses. max It tends to plateau at about 85-90%. CRBN-based dTAGs have phthalimide-based ligands that can exhibit chemical instability and off-target effects (Ishoey, M. et al., ACS Chem Biol. 2018, 13 (3), 553-560).

[0004] Compared to classical inhibition with small molecules, PROTACs offer several potential advantages: (1) Because the downstream outcome is the same in all cases (i.e., depletion at the intracellular protein level), PROTACs are expected to exert phenotypes similar to those observed via knockdown using genetic tools, e.g., small interfering RNA (siRNA), short hairpin RNA (shRNA), or clustered regularly interspaced short repeats (CRISPR). Loss of the target protein can impart additional effects by perturbing the formation of a biologically functional complex. (2) PROTACs can act catalytically (i.e., recyclable so that one PROTAC molecule can replace multiple POI molecules) and therefore can act "quasi-stoichiometrically" (i.e., with partial occupancy of the target protein). As a result of this, PROTACs often exhibit higher target protein degradation than would be expected based on their binding affinity to the target protein alone. (3) PROTAC degradation of the target protein can suppress resistance mutations and / or upregulation of the POI.

[0005] It has been recently reported that proteins can be endogenously tagged with hole-modified mutant bromodomains so that such proteins can be degraded by compounds that contain a segment that can bind to the hole-modified mutant bromodomain. XY-06-007 is a compound that contains a "bump" as part of the segment that binds to Brd4 and CRBN-based ligands and has been developed by RP Nowak et al. in J. Med. Chem., 2021, 64, 15, 11637-11650. XY-06-007 binds Brd4 BD1 It is used to degrade proteins containing the L94V tag.The present invention provides an alternative tag-based degron system. Summary of the Invention

[0006] In the above mentioned cases, the PROTAC approach for the degradation of targeted proteins is limited to the availability of small molecule ligands that bind to the targeted proteins, and it is important to develop novel methodologies to address proteins that cannot be bound by ligands. The inventors of the present invention endogenously tagged proteins with hole-modified mutant Brd4 bromodomains. The resulting proteins can be degraded by a degradation compound that includes a segment that can bind to the hole-modified mutant BET bromodomain, a linker, and a segment that can bind to an E3 ubiquitin ligase. The degradation compound binds non-covalently and is selective for the tagged protein over other proteins that may be present. Such a system is suitable for the evaluation of the functional consequences of targeted protein degradation in genetically engineered models. In a first teaching, a method for studying the effect of degrading a target protein in a cell, comprising endogenously expressing a fusion protein comprising the target protein fused to a polypeptide comprising a hole-modified mutant bromodomain; contacting the fusion protein with a degradation compound comprising a segment capable of specifically binding to the hole engineered mutant bromodomain of the fusion protein, a linker, and a von Hippel-Lindau (VHL) ligand capable of binding to a protein complex having E3 ubiquitin ligase activity, the protein complex comprising Elongin B, Elongin C, and Cullin-2; and Observing any effects on cells of targeted protein degradation A method is provided that includes:

[0007] In one embodiment, the decomposition compound is a compound or embodiment according to formula 1A as defined herein, and selected compounds as defined herein. In one embodiment, the target protein is endogenously tagged with one or more hole-engineered mutant bromodomains from the bromo- and extraterminal domain (BET) proteins, Brd2, Brd3, Brd4 and BrdT (to generate a fusion protein), and mutations can be present in one or more bromodomains present in the protein, or in bromodomains including fragments thereof. In one embodiment, the hole engineered mutant bromodomain is Brd4 BD2 L387A, Brd4 BD2 L387V, Brd4 BD1 L94A, Brd4 BD1 L94V, Brd2 BD2 L383A, Brd2 BD2 L383V, Brd2 BD1 L110A, Brd2 BD1 L110V, Brd3 BD2 L344A, Brd3 BD2 L344V, Brd3 BD1 L70A, Brd3 BD1 L70V, BrdT BD2 L306A, BrdT BD2 L306V, BrdT BD1 L63A or BrdT BD1 In one embodiment, the hole modified mutant Brd4 bromodomain is Brd4L63V bromodomain. BD2 L387A or Brd4 BD2 L387V bromodomain. Numbering is according to UniProt.

[0008] It will be appreciated that upon binding to the E3 ubiquitin ligase, ubiquitin is recruited and attached to the fusion protein, resulting in degradation of the fusion protein within the cell via the ubiquitin-proteasome pathway. A target protein can be any protein expressed by a cell. Exemplary target proteins include enzymes, structural proteins, hormones, cell surface receptors, tumor-associated proteins, and the like. A target protein can be a protein associated with a disease and / or a mutant or wild-type protein. For example, a particular disease may be associated with the expression of a mutant protein, and the present teachings allow one to study what happens to a cell when the mutant protein is degraded. The cell may be any suitable eukaryotic cell. In one embodiment, the eukaryotic cell is a mammalian (e.g., human) cell. The cell may be, for example, a normal cell (non-diseased) or a diseased cell. The diseased cell may be a cell from a subject exhibiting a disease. For example, the subject may be afflicted with cancer and the cell may be a cancer cell; the subject may be afflicted with liver disease and the cell may be a liver cell obtained from the subject; the subject may have kidney disease and the cell may be a kidney cell obtained from the subject. The cell may also be a cell line from a previous suitable subject.

[0009] The methods described herein allow the study of any effect of degrading a target protein in a cell. It will be understood that a comparison may be made with a corresponding cell to which no degrading compound has been added, so that any effect of degrading the target protein may be observed. Any degraded protein may be quantified by measuring non-degraded or degraded fusion protein in or on the surface of said cells, using standard methods for identifying and quantifying proteins. These methods include, among others, the use of protein-specific antibodies linked to reporters, such as fluorescent or other reporters, such as immunoassays (e.g., ELISAs, among others) and immunoblots, absorbance assays, mass spectrometry, and proteomics methods, among many others. Methods for quantifying specific proteins in a sample are well known in the art and are easily adapted to the methods according to the present disclosure. Assaying for degraded proteins and the effect of such degradation on cellular function, e.g., cell growth and / or proliferation (e.g., cell death) or other characteristics of the cell (e.g., biological, physiological), will demonstrate the importance of the protein of interest to cell growth and function and establish, for example, whether the target protein is a modulator of a disease state or condition and thus a potential target (bioactive agent, including drug) for treating said disease state or condition. Identification of the target protein as a pharmaceutical target will enable the development of assays to identify compounds and other bioactive agents that exhibit activity as potential inhibitors and / or agonists of the target protein.

[0010] In the above cases, the target protein is endogenously tagged (fused) with a polypeptide comprising one or more hole-modified mutant bromodomains contained within the BET proteins, Brd2, Brd3, Brd4 and BrdT, prior to contact with the degrading compound. In some embodiments, the polypeptide comprising the hole-modified mutant bromodomain is from Brd2, Brd3, Brd4 or BrdT, and the mutation is from Brd4. BD2 L387A, Brd4 BD2 L387V, Brd4BD1 L94A, Brd4 BD1 L94V, Brd2 BD2 L383A, Brd2 BD2 L383V, Brd2 BD1 L110A, Brd2 BD1 L110V, Brd3 BD2 L344A, Brd3 BD2 L344V, Brd3 BD1 L70A, Brd3 BD1 L70V, BrdT BD2 L306A, BrdT BD2 L306V, BrdT BD1 L63A or BrdT BD1 It is L63V. Conventional single letter amino acid abbreviations are used throughout this disclosure, for example, L387V is understood to mean that the leucine at position 387 of the protein is substituted with a valine.

[0011] The cells may be modified using well-known recombinant nucleic acid techniques, such that the endogenous nucleic acid encoding the target protein is modified to express a fusion protein comprising the target protein fused to (or tagged with) a polypeptide comprising a hole modified mutant bromodomain. The nucleic acid encoding the target protein may be modified by having a 5' or 3' in-frame insertion of a nucleic acid encoding a hole modified mutant bromodomain. Thus, the polypeptide comprising the hole modified mutant bromodomain may be fused, for example, to the N- or C-terminus of the target protein. Suitable methods for achieving this include homologous recombination (including CRISPR / Cas9 and transposon-mediated systems techniques known in the art) and non-homologous end joining techniques known in the art. The fusion protein according to the invention is a recombinant fusion protein created by engineering a fusion gene. This typically involves removing the stop codon from the sequence encoding the target protein, and then adding in frame the sequence encoding the hole modified mutant bromodomain protein or a fragment thereof by recombinant techniques described herein. The introduced hole modified mutant bromodomain sequence will then be expressed by the cell together with the target protein sequence as a single protein. The fusion protein can be engineered to contain the entire sequence of both the target and hole modified bromodomain proteins, or only a portion of one of them. If the two entities are proteins, a spacer peptide may be added to increase the likelihood that the proteins will fold independently and behave as expected.

[0012] Thus, in one aspect, there is provided a nucleic acid sequence encoding a fusion protein comprising a target protein and fused to a polypeptide comprising a hole modified mutant bromodomain as defined herein, the nucleic acid sequence comprising a nucleic acid sequence encoding the target protein and having a 5'- or 3'-in-frame insertion of a nucleic acid encoding a polypeptide comprising a hole modified mutant bromodomain, which when expressed results in a fusion protein that can be bound by a degradation compound as described herein. In one embodiment, the nucleic acid sequence is intended to replace an endogenous nucleic acid sequence encoding a target protein in a cell. Further provided is a vector, such as a plasmid or viral vector, comprising the nucleic acid sequence of the above aspects.

[0013] Further provided are cells (including somatic cells, embryonic stem cells, induced pluripotent cells) and animals, including non-human animals in particular, whose genomes are modified to express the nucleic acid sequences of the above aspects. As mentioned above, in some embodiments, the nucleic acid sequence encoding the fusion protein of the present teachings can replace the nucleic acid encoding the endogenous target protein. In this way, the target protein can only be expressed in the cell or animal in the form of the fusion protein described herein. In addition to developing the fusion protein described herein, the inventors have found that the compound of formula (I) can selectively bind to the hole-modified mutant Brd4 bromodomain in tagged fusion protein.Furthermore, the decomposition compound of formula (IA) can selectively bind to the hole-modified mutant Brd4 bromodomain in tagged protein and promote its degradation.As a result, the decomposition compound of formula (IA) is a suitable decomposition agent for evaluating the functional outcome of target protein degradation in genetically engineered models.

[0014] Viewed from another aspect, the disclosure therefore provides compounds of formula (I) for use in a method (such as those described above) for studying the effect of degrading a target protein in a cell. [ka] (In the formula, G is a 5-membered heteroarene optionally substituted with one or two substituents selected from the group consisting of methyl, halo, hydroxy, thiol, halomethyl, amino, methoxy, methylamino, dimethylamino, ethyl, haloethyl, amido, isopropyl, and methylthio, or G is a 6-membered arene or heteroarene optionally substituted with methyl, halo, hydroxy, and thiol; R is C 1-4 Alkyl or C 1-4 is haloalkyl; R 1 is C 1-4 Alkyl, C 1-4any one selected from the group consisting of haloalkyl, H, and halo; R 2 , H, C 1-3 Alkyl, C 1-3 haloalkyl or halo; R 3 is halo, hydroxyl, thiol, amide, NR 4 R 5 , C(O)NR 4 R 5 , C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy and C 1-6 independently selected from alkylthio; R 4 and R 5 H and C 1-3 independently selected from alkyl; n is 0, 1, 2, 3 or 4; D is a reactive group; X is a halo)

[0015] In the above case, the compound of formula (I) can selectively bind to the hole-modified mutant Brd4 bromodomain in the tagged fusion protein.Therefore, in a further aspect, there is provided a decomposition compound of formula (IA) for use in a method (such as the above method) for studying the effect of decomposing target protein in cells. [ka] (In the formula, G, R, R 1 , R 2 , R 3 , X and n are as defined above, D' is the product of a reactive group D (as defined above) and a prolinker to form D'-L, L is a molecule capable of linking D' to B, and B is a molecule capable of binding to an E3 ubiquitin ligase.

[0016] Without being bound by theory, the inventors have found that molecules with a similar structure to formula (IA), but where G is a methoxy-substituted benzene ring, are unable to form a stable structure with the von Hippel-Lindau (VHL) substrate recognition subunit of the E3 ligase. The inventors have found that the methoxy substituent of the benzene ring sterically clashes with His110 of the VHL subunit of the E3 ligase, and no detectable proteolysis can be obtained when using a VHL binder. Thus, the size characteristics of G are surprisingly important. When the methoxy-substituted benzene is replaced with dimethylthiophene, the resulting compound of formula (IA) is a highly effective proteolyzer. In the above case, the decomposition compound of formula (IA) can selectively bind to the hole modified mutant Brd4 bromo domain in the tagged fusion protein and promote its degradation.Therefore, in yet another aspect, there is provided the use of the above decomposition compound for decomposing a protein of interest, for example, a protein comprising a hole modified mutant Brd4 bromo domain tag.

[0017] Detailed Description The present invention uses a PROTAC approach for the degradation of a target protein. A PROTAC comprises two active domains and a linker. One active domain can bind to an E3 ubiquitin ligase, and the other binds to a target protein with the intention of degrading the target protein. In general, this approach is limited to the availability of a small molecule ligand that binds to the target protein. The inventors have found that a compound of formula (I) can selectively bind to a hole-modified mutant Brd4 bromodomain in a tagged fusion protein. A compound of formula (I) can bind to any protein that can be tagged with a hole-modified mutant Brd4 bromodomain. Furthermore, a degradation compound of formula (IA) can selectively bind to a hole-modified mutant Brd4 bromodomain in a tagged fusion protein and promote its degradation. Thus, a degradation compound of formula (IA) can degrade a target protein that would normally be difficult or impossible to degrade by a conventional PROTAC approach (e.g., when a small molecule ligand that binds to the target protein is not available). The degrading compounds of formula (IA) are suitable degraders for assessing the functional consequences of targeted protein degradation in genetically engineered models.

[0018] In the following discussion, a number of terms are referred to, which should be understood to have the following meanings unless the context indicates otherwise. The nomenclature used herein to define compounds, particularly the compounds described herein, is intended to comply with the International Union of Pure and Applied Chemistry (IUPAC) rules for chemical compounds, particularly the "IUPAC Compendium of Chemical Terminology (Gold Book)" (see AD Jenkins et al., Pure & Appl. Chem., 68, 2287-2311 (1996)). For the avoidance of doubt, in the event that the IUPAC rules are contrary to the definitions provided herein, the definitions herein shall prevail. It will be understood that the term "comprising" or variations thereof implies the inclusion of a specified element, integer or step, or group of elements, integers or steps, but does not exclude other elements, integers or steps, or groups of elements, integers or steps.

[0019] It will be understood that the term "consisting of" or variations thereof implies the inclusion of a specified element, integer or step, or group of elements, integers or steps, and the exclusion of other elements, integers or steps, or group of elements, integers or steps. The term "alkyl" is well known in the art and defines a monovalent group derived from an alkane by removing a hydrogen atom from any carbon atom, and the term "alkane" refers to a group having the general formula C n H 2n+2 where n is an integer equal to or greater than 1. 1-4 Alkyl refers to any one selected from the group consisting of methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl and tert-butyl. The term "haloalkyl" refers to an alkyl group in which at least one hydrogen atom has been replaced with a halo atom, such as fluoro, chloro or bromo, typically fluoro. Trifluoromethyl is an example of a haloalkyl.

[0020] The term "arene" defines a monocyclic or polycyclic aromatic hydrocarbon, and "aromatic" defines a cyclic conjugated molecular entity with a stability (due to delocalization) significantly greater than that of a hypothetical localized structure. Hückel's rule is often used in the art to assess aromatic character; a monocyclic planar (or nearly planar) system of three-way (or sometimes two-way) hybridized atoms containing (4n+2) pi-electrons, where n is not a negative integer, will exhibit aromatic character. The rule is generally restricted to n=0-5. The term "heteroarene" defines a monocyclic or polycyclic aromatic hydrocarbon containing one or more heteroatoms. The term "alkoxy" defines a monovalent group derived from an alcohol by removing the hydrogen atom of a hydroxy group. The term "alcohol" refers to an alkane in which one hydrogen atom has been replaced with a hydroxy group. Methoxy is an example of a C1 alkoxy group. The term "alkylthio" defines a monovalent group derived from an alkylthiol by removing a hydrogen atom from the thio group. The term "alkylthiol" refers to an alkane in which one hydrogen atom has been replaced with a thio group. Methylthio is an example of a C1 alkylthio group.

[0021] The term "haloalkoxy" refers to an alkoxy group in which at least one hydrogen atom is replaced with a halo atom, e.g., fluoro, chloro or bromo, typically fluoro. Trifluoromethoxy is an example of a C1 haloalkoxy. The term "stereoisomers" is used herein to refer to isomers that have identical molecular formulas and sequences of bonded atoms, but differ in the arrangement of their atoms in space. The term "enantiomer" defines one of a pair of molecular entities that are mirror images of each other and are non-superimposable, i.e., cannot be matched by translation and rigid rotation transformations. Enantiomers are chiral molecules, i.e., distinguishable from their mirror images. The term "racemic" is used herein in reference to a racemate, which defines a substantially equimolar mixture of a pair of enantiomers. The term "diastereoisomers" (also known as diastereomers) defines stereoisomers that are not related as mirror images.

[0022] The term "solvate" is used herein to refer to a complex comprising a solute, e.g., a compound or a salt of a compound, and a solvent. When the solvent is water, the solvate may be referred to as a hydrate, e.g., a monohydrate, a dihydrate, a trihydrate, etc., depending on the number of water molecules present per molecule of substrate. The term "isotopes" is used herein to define variations of a particular chemical element that necessarily have the same atomic number of their nuclei, but different mass numbers due to different numbers of neutrons. The terms "binding" or "accommodating into" as used herein in reference to the interaction of a hole-modified mutant bromodomain of a fusion protein with a compound of the invention (e.g., the "bump" of a compound of the invention accommodated by the "hole" of a hole-modified mutant Brd4 bromodomain) refer to the association of the hole-modified mutant bromodomain with the compound. Association includes any attractive interaction between the hole-modified mutant bromodomain and the compound. Examples of attractive interactions include hydrogen bonds, van der Waals forces, dipole-dipole forces, dipole-induced dipole forces, ion-dipole forces, ion-induced dipole forces, and ionic bonds.

[0023] As mentioned above, there is provided a compound of formula (I) for use in a method of studying the effect of degrading a target protein in a cell. [ka] (In the formula, G is a 5-membered heteroarene optionally substituted with one or two substituents selected from the group consisting of methyl, halo, hydroxy, thiol, halomethyl, amino, methoxy, methylamino, dimethylamino, ethyl, haloethyl, amido, isopropyl, and methylthio, or G is a 6-membered arene or heteroarene optionally substituted with methyl, halo, hydroxy, and thiol; R is C 1-4 Alkyl or C 1-4 is haloalkyl; R 1 is C1-4 Alkyl, C 1-4 any one selected from the group consisting of haloalkyl, H, and halo; R 2 , H, C 1-3 Alkyl, C 1-3 haloalkyl or halo; R 3 is halo, hydroxyl, thiol, amide, NR 4 R 5 , C(O)NR 4 R 5 , C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy and C 1-6 independently selected from alkylthio; R 4 and R 5 H and C 1-3 independently selected from alkyl; n is 0, 1, 2, 3 or 4; D is a reactive group; X is a halo)

[0024] In the above case, without being bound by theory, the inventors have found that, although having a structure similar to that of formula (IA), when G is a methoxy-substituted benzene ring, the molecule cannot form a stable structure with the von Hippel-Lindau (VHL) substrate recognition subunit of E3 ligase. The inventors have found that the methoxy substituent of the benzene ring sterically clashes with His110 of the VHL subunit of E3 ligase, and no detectable proteolysis can be obtained when using a VHL binder. However, when the methoxy-substituted benzene is replaced with a smaller group, e.g., dimethylthiophene, the resulting compound of formula (IA) is a very effective proteolytic agent. Thus, G of compounds (I) and (IA) is less sterically bulky than methoxybenzene.

[0025] Thus, in some embodiments, when G is a 6-membered arene or heteroarene, it is unsubstituted. Examples of suitable 6-membered arenes and heteroarenes include benzene, pyridine, pyrimidine, pyrazine and pyridazine. In some embodiments, the 6-membered arene or heteroarene of G is benzene, pyridine, pyrimidine or pyrazine, typically benzene. Examples of suitable 5-membered heteroarenes include thiophene, furan, pyrrole, thiazole, imidazole, pyrazole, oxazole, isothiazole, and isoxazole. In some embodiments, the 5-membered heteroarenes of G are any one selected from the group consisting of thiophene, furan, pyrrole, and thiazole, e.g., thiophene. When G is a 5-membered heteroarene, it may be substituted with one or two substituents selected from the group consisting of methyl, halo, hydroxy, thiol, halomethyl, amino, methoxy, methylamino, dimethylamino, ethyl, haloethyl, amido, isopropyl, and methylthio. Sometimes, the 5-membered ring of G may be substituted with one or more substituents selected from the group consisting of methyl, halo (e.g., fluoro), hydroxy, thiol, halomethyl (e.g., trifluoromethyl), and amino. Often, the 5-membered ring of G may be substituted with one or more substituents selected from the group consisting of methyl, fluoro, hydroxy, thiol, and trifluoromethyl. Typically, the 5-membered ring of G may be substituted with methyl.

[0026] In some embodiments, G is an optionally substituted 5-membered heteroarene, typically an optionally substituted thiophene. In some embodiments, G is a thiophene substituted once or twice. In some embodiments, G is a thiophene substituted once or twice with methyl. Typically, G is a thiophene substituted twice with methyl. In the above cases, X is halo, such as chloro, fluoro, bromo, or iodo. In some embodiments, X is chloro. R3 is halo (e.g., fluoro), hydroxyl, thiol, amide, NR 4 R 5 , C(O)NR 4 R 5 , C 1-6 Alkyl, C 1-6 Haloalkyl (e.g., C 1-6 Fluoroalkyl), C 1-6 Alkoxy and C 1-6 alkylthio; R 4 and R 5 H and C 1-3 alkyl. In many cases, R 3 is halo (e.g., fluoro), hydroxyl, thiol, amide, NH 2 , N(CH 3 ) 2 , C(O)NH 2 , C(O)N(CH 3 ) 2 , C 1-3 Alkyl, C 1-3 Haloalkyl (e.g., C 1-3 Fluoroalkyl), C 1-3 Alkoxy and C 1-3 alkylthio. In many cases, R 3 is halo (e.g., fluoro), hydroxyl, thiol, amide, NH 2 , N(CH 3 ) 2 , C(O)NH 2 , C(O)N(CH 3 ) 2 , methyl, trifluoromethyl, methoxy and methylthio. Typically, R 3 is fluoro, hydroxyl, thiol, amide, NH 2 , and N(CH 3 ) 2 are independently selected from

[0027] In the above case, R 3 The number of substituents, n, is 0, 1, 2, 3, or 4. Often, n is 0, 1, or 2, for example, 0 or 1. In some embodiments, n is 0. R 1 is C 1-4 Alkyl, C 1-4 Haloalkyl (e.g., C 1-4 fluoroalkyl), H, and halo (e.g., fluoro). In many cases, R 1 is C 1-4 Alkyl or C 1-4 Haloalkyl (e.g., C 1-4 In some embodiments, R 1 is methyl or trifluoromethyl, typically methyl. R 2 , H, C 1-3 Alkyl, C 1-3 Haloalkyl (e.g., C 1-3 fluoroalkyl) or halo (e.g., fluoro). In many cases, R 2 is H, methyl, ethyl, trifluoromethyl or fluoro. In some embodiments, R 2 is H, methyl, trifluoromethyl or fluoro. Typically, R 2 is H.

[0028] In the above case, R is C 1-4 Alkyl or C 1-4 The R group provides a "bump" that is accommodated by the "hole" of the hole-modified mutant Brd4 bromodomain. Without being bound by theory, the inventors have found that compounds of formula (I) and (IA) (containing R groups that are not hydrogen) are capable of binding to or being accommodated by the "hole" of the hole-modified mutant Brd4 bromodomain, but are unable to bind to or be accommodated by the binding site of the unmodified Brd4 bromodomain. Thus, compounds of formula (I) and formula (IA) can selectively bind to or be accommodated by the hole-modified mutant Brd4 bromodomain, whereas analogous compounds in which R is hydrogen are not selective. Large R groups (e.g., C 5-8 Alkyl or C 5-8It is envisioned that haloalkyl) can be used to bind to or be accommodated by hole-modified mutant Brd4 bromodomains containing large holes. In many cases, R is C 1-3 Alkyl or C 1-3 Fluoroalkyl. Typically, R is any one selected from the group including ethyl, propyl, fluoroethyl, and fluoropropyl. In some embodiments, R is ethyl. D is a reactive group. The term "reactive group" refers to any group that can react with a second compound (typically a prolinker compound) to form a bond with the second compound. However, it is not important what D is exactly, provided that D is capable of connecting compound (I) with the prolinker molecule to form a bond to the linker, and the compounds of formula (I) need not be limited to a particular D group.

[0029] In many cases, D is (CH 2 ) p C(O)OH, (CH 2 ) p C(O)Cl, (CH 2 ) p C(O)Br, (CH 2 ) q NH 2 , (CH 2 ) q N(C 1-3 Alkyl)H, (CH 2 ) q SH, (CH 2 ) q OH, (CH 2 ) q Br, (CH 2 ) q I, (CH 2 ) q N 3 and (CH 2 ) qCCH; wherein p is an integer from 0 to 4, and q is an integer from 1 to 4. In many cases, p is 0, 1, or 2, and typically 0. In many cases, q is 1 or 2, and typically 1. In some embodiments, p is 0, and q is 1. D is (CH 2 ) p C(O)OH, (CH 2 ) p C(O)Cl, (CH 2 ) p C(O)Br, (CH 2 ) q NH 2 , (CH 2 ) q N(C 1-3 Alkyl)H, (CH 2 ) q SH and (CH 2 ) q OH. Usually, D is any one selected from the group consisting of (CH 2 ) p C(O)OH, (CH 2 ) p C(O)Cl and (CH 2 ) p C(O)Br. In some embodiments, D is C(O)OH.

[0030] For the avoidance of doubt, groups that function in the same manner as the functional groups listed above are included as equivalent groups of said functional groups. For example, if D is C(O)OH, then protonated variants such as C(O) + HOH, where the carbonyl group is protonated at the oxygen atom. When G is a thiophene it may be attached to the diazepine ring at positions 2 and 3 or at positions 3 and 4. For the avoidance of doubt, positions 2, 3 and 4 are as shown below. [ka]

[0031] When G is a thiophene, it is typically attached to the diazepine ring at the 2- and 3-positions, ie, in some embodiments, the compound is of formula (II). [ka] In the formula, R 6 is a substituent on G (when G is a 5-membered heteroarene) and m is the number of substituents. For the avoidance of doubt, the embodiment described herein with respect to the substituents on G when G is a 5-membered heteroarene is the same as R 6 For example, R 6 may be independently selected from the group consisting of methyl, halo (eg fluoro), hydroxy, thiol, halomethyl (eg trifluoromethyl) and amino, typically methyl.

[0032] In some embodiments, R 1 is methyl, R 2 is hydrogen, n is 0, G is a thiophene attached to the diazepine at the 2- and 3-positions, and X is chloro, i.e., the compound is of formula (III). [ka]

[0033] In some embodiments, R 1 is methyl, R 2 is hydrogen, n is 0, G is a thiophene attached to the diazepine at the 2- and 3-positions, X is chloro, and D is C(O)OH, i.e., the compound is of formula (IIIa). [ka]

[0034] Typically the compound is of any one of formulae (IV), (IVa) and (IVb). [ka] In some embodiments, the compound is of formula (IV). The compounds of the present invention exist in diastereomeric forms which differ depending on the chirality at the carbon atoms identified with an asterisk below. [ka]

[0035] All stereoisomers and mixtures thereof, including enantiomers and racemic mixtures, are included within the scope of the invention. Individual stereoisomers of the compounds of formula I, i.e., compounds containing less than 5%, less than 2%, or less than 1% (e.g., less than 1%) of other stereoisomers, are also included within the scope of the invention. Mixtures of stereoisomers in any proportion, such as racemic mixtures containing substantially equal amounts of two enantiomers, are also included within the scope of the invention. Diastereoisomers may be separated using conventional techniques, such as chromatography or fractional crystallization. The various stereoisomers may be isolated by separating a racemic or other mixture of the compounds using conventional techniques, such as fractional crystallization or HPLC techniques. Alternatively, the desired optical isomer may be prepared by reaction of appropriate optically active starting materials under conditions which do not result in racemization or epimerization.

[0036] In many cases, the compounds of the invention are enantiomerically pure. In many cases, the compounds are of formula (Ia): [ka]

[0037] Typically the compound is of any one of formulae (V), (Va) and (Vb). [ka] In some embodiments, the compound is of formula (V). In the above case, the compound of formula (I) can selectively bind or be accommodated to the hole modified mutant Brd4 bromodomain in the tagged protein.Therefore, from another aspect, there is provided a decomposition compound of formula (IA) for use in a method for studying the effect of degrading a target protein in a cell.

[0038] [ka] (In the formula, G, R, R 1 , R 2 , R 3 , X and n are as defined above, D' is the product of a reactive group D (as defined above) and a prolinker to form D'-L, L is a molecule capable of linking D' to B, and B is a molecule capable of binding to an E3 ubiquitin ligase).

[0039] For the avoidance of doubt, the embodiments described herein with respect to formula (I) apply mutatis mutandis to formula (IA). For example, the decomposition compound may be any one of formulae (II), (III), (IIIa), (IV), (IVa), (IVb), (IVc), (Ia), (V), (Va), (Vb) or (Vc), where D or C(O)OH is replaced by D'-LB or C(O)-LB, respectively. The inventors have found that molecules with a similar structure to formula (IA), but where G is a methoxy-substituted benzene ring, are unable to form a stable structure with the von Hippel-Lindau (VHL) substrate recognition subunit of the E3 ligase. Without wishing to be bound by theory, the methoxy substituent on the benzene ring sterically clashes with His110 of the VHL subunit of the E3 ligase, resulting in no detectable proteolysis when using a VHL binder. Thus, the size characteristic G is surprisingly important. When the methoxy-substituted benzene is replaced with dimethylthiophene, the resulting compound of formula (IA) is a highly effective proteolyzer. In the above case, D' is the product of a reactive group D (as defined above) and a prolinker to form D'-L. A prolinker is defined herein as a molecule that can react with D' to form D'-L, where L is a molecule that can attach D' to B. However, it is not important what D' exactly is, provided that D' is capable of attaching to L, and compounds of formula (IA) need not be limited to a particular D' group.

[0040] However, in some embodiments, D' is (CH 2 ) p C(O), (CH 2 ) q NH, (CH 2 ) q S, (CH 2 ) q O, (CH 2 ) q and 1,2,3-triazolylene, where p is an integer of 0 to 4, and q is an integer of 1 to 4. In many cases, D' is a group represented by the formula (CH 2 ) p C(O), (CH 2 ) q NH, (CH 2 ) q S, and (CH 2 ) q O, typically (CH 2 ) p C(O). Often, p is an integer from 0 to 2, and q is 1 or 2. In some embodiments, p is 0 and q is 1. Thus, in some embodiments, D' is C(O). In the above case, L is a molecule capable of linking D' to B and may be any one of the linkers described in RI Troup, C. Fallan and MGJ Baud, Explo. Target Anitiumor Ther. 2020, 1, 273-312. In some embodiments, L is of formula (VIA).

[0041] [ka] (In the formula, Wavy lines indicate binding sites for D' and B; X 1 may be present, O(CH 2 ) s , NH(CH 2 ) s and C(O)(CH 2 ) s any one selected from the group consisting of: X 2 may be present, O(CH 2 ) u C(O), (CH 2 ) u NH, (CH 2 ) u O and (CH 2 ) u C(O); L' is O(CH 2 ) t , C.H. 2 , alkynylene, triazolylene, piperazinylene, and piperidinylene; s is an integer from 0 to 4, u is an integer from 1 to 4, and t is an integer from 1 to 4. To avoid any misunderstanding, X in formula (VIA) 1 is bonded to D', and X 2 is bonded to B. X 1 If does not exist, D' is (L') r Directly bonded to X 2 If does not exist, (L') r is directly attached to B. In some embodiments, X 1 and X 2 exists.

[0042] In some embodiments, X 1 is O(CH 2 ) s and HN(CH 2 ) sIn many cases, s is 0 to 2, typically 2. In some embodiments, X 1 is O(CH 2 ) 2 It is. L' is O(CH 2 ) t , C.H. 2 and alkynylene, where t is an integer from 1 to 4. Typically, L' is O(CH 2 ) t t is often 2 or 3, and thus in some embodiments, L' is O(CH 2 ) 2 or O(CH 2 ) 3 It is. In some embodiments, X 2 is O(CH 2 ) u C(O) or (CH 2 ) u NH. Often, u is 1 or 2, typically 1. Thus, in some embodiments, X 2 OCH 2 C(O) or CH 2 It is NH.

[0043] In some embodiments, the decomposition compound is according to any of the above teachings, wherein B is selected from the following structures represented by any one of formulas (VIIA)-(XVA): [ka] (In the formula, R 7 is H or methyl, and Z is F or CN, for example F.

[0044] In some embodiments, B is a structure represented by any one of formulas (VIIA)-(IXA). In some embodiments, B is a structure represented by formula (VIIA). In some embodiments of structures (VIIA), (VIIIA), (IXA), (XA) and (XIA), R 7 is H. In some embodiments, the decomposition compound is any one of formulas (XIIA)-(XIVA). [ka]

[0045] In some embodiments, the decomposition compound is of formula (XIIA). In a more particular embodiment, the decomposition compound is any one of formulas (XVA)-(XVIIA). [ka]

[0046] In one embodiment, the decomposition compound is of formula (XVA). The degradation compounds of the present disclosure may find particular use in the degradation of proteins in vitro or in vivo. Thus, the degradation compounds may be used in a method of degrading a target protein, comprising contacting the degradation compound with a suitable hole-modified bromodomain tagged fusion protein for a period of time to degrade the target protein that is part of a fusion protein. In the above mentioned cases, the compounds of the present disclosure (including R groups that are not hydrogen) can selectively bind to or be accommodated by hole-modified mutant bromodomains (e.g., mutant Brd4 bromodomains), whereas similar compounds in which R is hydrogen are not selective. By "selectively bind" it is meant that the compound binds to or is accommodated by hole-modified mutant bromodomains (e.g., mutant Brd4 bromodomains) more strongly (e.g., with a larger association constant and a smaller dissociation constant) than non-hole-modified mutant bromodomains, e.g., those of BET proteins, e.g., endogenous proteins Brd2, Brd3, and Brd4. Advantageously, the compounds of the present invention are much more selective for hole-modified mutant bromodomains (e.g., mutant Brd4 bromodomains) than non-hole-modified wild-type bromodomains (e.g., BET bromodomains). For example, degradation of proteins that contain bromodomains that are not hole modified mutants, such as the BET bromodomain containing proteins Brd2, Brd3 and Brd4, by the degradation compounds of the invention may not be detectable (e.g., when analyzed by Western blot, there may be no decrease in the signal corresponding to proteins that contain bromodomains that are not hole modified mutants).

[0047] Advantageously, the degradation compounds of the invention are potent degraders of the target protein (when the target protein is part of a hole-modified bromodomain tagged fusion protein). For example, the degradation compounds of the invention have an on-target degradation potency (half maximal degradation concentration (DC 50 )) values ​​can be shown. Advantageously, the degradation compounds of the invention are highly efficient degraders of the target protein (when the target protein is part of a hole-modified bromodomain tagged fusion protein). For example, the degradation compounds of the invention have an efficiency (maximum degradation (D)) of 50-100%, such as 65-100% or 70-100%. max )) values ​​can be shown. Additionally, the degradation compounds of the present invention can act quickly to degrade a target protein (when the target protein is part of a hole-modified bromodomain tagged fusion protein). For example, the half-life (t 1 / 2 ) may be less than 3 hours, for example, 0.001 to 150 minutes or 0.01 to 140 minutes.

[0048] Suitable methods for protein degradation analysis, such as Western blotting, as well as DC 50 , D max and t 1 / 2を The method for the calculation is described in the experimental section below. Any discussion in this specification of documents, acts, materials, devices, articles or the like should not be construed as an admission that any or all of such matters formed part of the prior art base or were common general knowledge in the field relevant to this disclosure as if they existed prior to the priority date of each claim of this application. It will be understood by those skilled in the art that numerous variations and / or modifications may be made to the invention described herein without departing from the scope of the invention as described. Therefore, the present embodiment should be considered for illustrative purposes, and not restrictive, and should not be limited in scope to that described in the embodiment. It should be understood by those skilled in the art that the present embodiment may be read alone or in combination, and may be combined with any one or combination of the features described herein.

[0049] The subject matter of each patent and non-patent reference cited herein is hereby incorporated by reference in its entirety. The present invention may be further understood with reference to the following non-limiting clauses: 1. A method for studying the effect of degrading a target protein in a cell, comprising: endogenously expressing a fusion protein comprising a target protein fused to a polypeptide comprising a hole-modified mutant bromodomain; contacting the fusion protein with a degradation compound comprising a segment capable of specifically binding to the hole engineered mutant bromodomain of the fusion protein, a linker, and a von Hippel-Lindau (VHL) ligand capable of binding to a protein complex having E3 ubiquitin ligase activity, the protein complex comprising Elongin B, Elongin C, and Cullin-2; and Observing any effects on cells of targeted protein degradation The method includes: 2. The method of claim 1, wherein the target protein is endogenously tagged with a bromodomain, including one or more hole-engineered mutant bromodomains from bromo- and extraterminal domain (BET) proteins, Brd2, Brd3, Brd4 and BrdT, or fragments thereof.

[0050] 3. The method of claim 2, wherein the mutation is present in one or more bromodomains present in the protein, or in a bromodomain including a fragment thereof. 4. Hole-modified mutant bromodomain of Brd4 BD2 L387A, Brd4 BD2 L387V, Brd4 BD1 L94A, Brd4 BD1 L94V, Brd2 BD2 L383A, Brd2 BD2 L383V, Brd2 BD1 L110A, Brd2 BD1 L110V, Brd3 BD2 L344A, Brd3 BD2 L344V, Brd3 BD1 L70A, Brd3 BD1 L70V, BrdT BD2 L306A, BrdT BD2 L306V, BrdT BD1 L63A or BrdT BD1 The method according to claim 2 or 3, wherein the domain is L63V bromodomain. 5. Hole-modified mutant Brd4 bromodomain is Brd4 BD2 L387A or Brd4 BD2The method of claim 2 or 3, comprising the L387V bromodomain. 6. A nucleic acid sequence encoding a fusion protein for use in the method of any one of paragraphs 1 to 5, wherein the fusion protein comprises a target protein fused to a polypeptide comprising a hole modified mutant bromodomain as defined herein, the nucleic acid sequence comprising a nucleic acid sequence encoding the target protein and having a 5'- or 3'-in-frame insertion of a nucleic acid encoding a polypeptide comprising a hole modified mutant bromodomain, which when expressed results in a fusion protein that can be bound by a degradation compound as described herein.

[0051] 7. A vector, such as a plasmid or viral vector, comprising a nucleic acid sequence according to paragraph 6. 8. A cell (including a somatic cell, an embryonic stem cell, or an induced pluripotent cell) whose genome has been modified to express a nucleic acid sequence according to paragraph 6. 9. A non-human animal comprising or derived from a cell according to paragraph 8. 10. A compound of formula (I) for use in a method for studying the effect of degrading a target protein in a cell. [ka] (In the formula, G is a 5-membered heteroarene optionally substituted with one or two substituents selected from the group consisting of methyl, halo, hydroxy, thiol, halomethyl, amino, methoxy, methylamino, dimethylamino, ethyl, haloethyl, amido, isopropyl, and methylthio, or G is a 6-membered arene or heteroarene optionally substituted with methyl, halo, hydroxy, and thiol; R is C 1-4 Alkyl or C 1-4 is haloalkyl; R 1 is C 1-4 Alkyl, C 1-4 any one selected from the group consisting of haloalkyl, H, and halo; R 2, H, C 1-3 Alkyl, C 1-3 haloalkyl or halo; R 3 is halo, hydroxyl, thiol, amide, NR 4 R 5 , C(O)NR 4 R 5 , C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy and C 1-6 independently selected from alkylthio; R 4 and R 5 H and C 1-3 independently selected from alkyl; n is 0, 1, 2, 3 or 4; D is a reactive group; X is a halo)

[0052] 11. A compound for use according to claim 10, wherein the method is a method according to any one of claims 1 to 5. 12. A compound for use according to paragraph 10 or 11, wherein the 6-membered arene or heteroarene of G is unsubstituted. 13. A compound for use according to any one of paragraphs 10 to 12, wherein the 6-membered arene or heteroarene of G is benzene, pyridine, pyrimidine or pyrazine. 14. A compound for use according to any one of claims 10 to 12, wherein the six-membered arene of G is benzene. 15. The compound for use according to any one of items 10 to 14, wherein the 5-membered heteroarene of G is any one selected from the group consisting of thiophene, furan, pyrrole and thiazole.

[0053] 16. A compound for use according to any one of clauses 10 to 15, wherein G is a 5-membered heteroarene. 17. The compound for use according to item 16, wherein G is thiophene. 18. The compound for use according to paragraph 16 or 17, wherein G is substituted with one or more substituents selected from the group consisting of methyl, halo, hydroxy, thiol, halomethyl, amino, methoxy, methylamino, dimethylamino, ethyl, haloethyl, amido, isopropyl, tert-butyl and methylthio. 19. The compound for use according to paragraph 16 or 17, wherein G is substituted with one or more substituents selected from the group consisting of methyl, halo, hydroxy, thiol, halomethyl and amino. 20. The compound for use according to paragraph 16 or 17, wherein G is substituted with one or more substituents selected from the group consisting of methyl, fluoro, hydroxy, thiol and fluoromethyl.

[0054] 21. The compound for use according to paragraph 16 or 17, wherein G is substituted with methyl. 22. A compound for use according to any one of clauses 10 to 21, wherein G is substituted once or twice. 23. A compound for use according to any one of clauses 10 to 21, wherein G is substituted twice. 24. The compound for use according to any one of clauses 10 to 23, wherein X is chloro. 25. A compound for use according to any one of clauses 10 to 24, wherein n is 0. 26.R 1 But, C 1-4 Alkyl and C 1-4 The compound for use according to any one of items 10 to 25, wherein the compound is any one selected from the group consisting of fluoroalkyl. 27.R 1 27. The compound for use according to any one of items 10 to 26, wherein is methyl or trifluoromethyl.

[0055] 28.R 1 28. The compound for use according to any one of clauses 10 to 27, wherein is methyl. 29.R 229. The compound for use according to any one of clauses 10 to 28, wherein is H, methyl, trifluoromethyl or fluoro. 30.R 2 30. The compound for use according to any one of clauses 10 to 29, wherein is H. 31.R 3 Fluoro, hydroxyl, thiol, amide, NR 4 R 5 , C(O)NR 4 R 5 , C 1-4 Alkyl, C 1-4 Fluoroalkyl, C 1-4 Alkoxy and C 1-4 31. The compound for use according to any one of claims 10 to 30, independently selected from alkylthio. 32. R is C 1-3 Alkyl or C 1-3 32. The compound for use according to any one of claims 10 to 31, which is fluoroalkyl. 33. R is C 2-3 Alkyl or C 2-3 32. The compound for use according to any one of claims 10 to 31, which is fluoroalkyl. 34. The compound for use according to any one of clauses 10 to 31, wherein R is ethyl.

[0056] 35.D is (CH 2 ) p C(O)OH, (CH 2 ) p C(O)Cl, (CH 2 ) p C(O)Br, (CH 2 ) q NH 2 , (CH 2 ) q N(C 1-3 Alkyl)H, (CH 2 ) q SH, (CH 2 ) q OH, (CH 2 ) q Br, (CH 2 ) q I, (CH2 ) q N 3 and (CH 2 ) q CCH; p is an integer of 0 to 4, and q is an integer of 1 to 4. 36. A compound for use according to paragraph 35, wherein p is 0 and q is 1. 37. The compound for use according to any one of clauses 10 to 34, wherein D is C(O)OH. 38. A compound for use according to any one of clauses 17 to 23, wherein the compound is of formula (II). [ka] (In the formula, R 6 is a substituent of G, m is the number of substituents, R, R 1 , R 2 , R 3 , D, X and n are as defined in any one of paragraphs 10 and 24 to 37.

[0057] 39. The compound for use according to item 10, wherein the compound is of formula (III). [ka] (wherein R and D are defined in any one of items 10 and 32 to 37)

[0058] 40. The compound for use according to paragraph 10, wherein the compound is of formula (IV). [ka] 41. The compound for use according to paragraph 10, wherein the compound is of formula (V). [ka]

[0059] 42. A degrading compound of formula (IA) for use in a method for studying the effect of degrading a target protein in a cell. [ka] (In the formula, G, R, R 1 , R 2 , R 3 , X and n are as defined in any one of paragraphs 10 and 12 to 37, D' is a product of a reactive group D and a prolinker to form D'-L, L is a molecule capable of binding D' to B, and B is a molecule capable of binding to an E3 ubiquitin ligase.

[0060] 43. A decomposition compound for use according to paragraph 42, wherein the method is as described in any one of paragraphs 1 to 5. 44.D' is (CH 2 ) p C(O), (CH 2 ) q NH, (CH 2 ) q S, (CH 2 ) q O, (CH 2 ) q and 1,2,3-triazolylene, wherein p is an integer of 0 to 4, and q is an integer of 1 to 4. 45. A decomposition compound for use according to paragraph 44, wherein p is 0 and q is 1. 46. ​​A decomposition compound for use according to any one of claims 42 to 45, wherein D' is C(O).

[0061] 47. A decomposition compound for use according to any one of claims 42 to 46, wherein the decomposition compound is of formula (IIA). [ka] (In the formula, R 6 is a substituent of G, m is the number of substituents, R, R 1 , R 2 , R3 , X and n are as defined in any one of paragraphs 10 and 18 to 37.

[0062] 48. A decomposition compound for use according to any one of claims 42 to 46, wherein the decomposition compound is of formula (IIIA). [ka] (wherein R is as defined in any one of items 10 and 32 to 34). 49. A decomposition compound for use according to paragraph 42 or 43, wherein the decomposition compound is of formula (IVA). [ka]

[0063] 50. A decomposition compound for use according to paragraph 42 or 43, wherein the decomposition compound is of formula (VA). [ka]

[0064] 51. A decomposition compound for use according to any one of claims 42 to 50, wherein L is of formula (VIA). [ka] (In the formula, Wavy lines indicate binding sites; X 1 may be present, O(CH 2 ) s , NH(CH 2 ) s and C(O)(CH 2 ) s any one selected from the group consisting of: X 2 may be present, O(CH 2 ) u C(O), (CH 2 ) u NH, (CH 2 )u O and (CH 2 ) u C(O); L' is O(CH 2 ) t , C.H. 2 , alkynylene, triazolylene, piperazinylene, and piperidinylene; s is an integer from 0 to 4, u is an integer from 1 to 4, and t is an integer from 1 to 4.

[0065] 52.X 1 and X 2 52. The degradation compound for use according to claim 51, wherein 53.X 1 But O(CH 2 ) s and HN(CH 2 ) s 53. The decomposition compound for use according to claim 51 or 52, which is any one selected from the group consisting of: 54. A decomposition compound for use according to any one of claims 51 to 53, wherein s is 2. 55.X 1 is O(CH 2 ) 2 54. The decomposition compound for use according to any one of items 51 to 53, 56.L' is O(CH 2 ) t 56. The decomposition compound for use according to any one of items 51 to 55, 57. A decomposition compound for use according to any one of claims 51 to 56, wherein t is 2 or 3. 58.X 2 But O(CH 2 ) u C(O) or (CH 2 ) u 58. The decomposition compound for use according to any one of claims 51 to 57, which is NH. 59. A decomposition compound for use according to any one of claims 51 to 58, wherein u is 1.

[0066] 60. A decomposition compound for use according to any one of paragraphs 42 to 59, wherein B is any one of the structures represented by any one of formulas (VIIA) to (XIIIA). [ka] (In the formula, R 7 is H or methyl, and Z is F or CN.

[0067] 61. A decomposition compound for use according to paragraph 60, wherein B is a structure represented by any one of formulas (VIIA) to (IXA). 62. The decomposition compound for use according to paragraph 60, wherein B is a structure represented by formula (VIIA). 63.R 7 63. The decomposition compound for use according to any one of claims 60 to 62, wherein is H.

[0068] 64. The decomposition compound for use according to any one of claims 42 to 63, wherein the decomposition compound is any one of formulas (XIXA) to (XXIA). [ka]

[0069] 65. A decomposition compound for use according to item 64, wherein the decomposition compound is of formula (XIIA). 66. Use of a degrading compound as defined in any one of paragraphs 42 to 65 for degrading a target protein. 67. The use according to paragraph 66, wherein the target protein is endogenously tagged with a polypeptide comprising one or more hole-modified mutant Brd4 bromodomains. 68. Hole-modified mutant Brd4 bromodomain is Brd4 BD2 L387A, Brd4 BD2 L387V, Brd4 BD1 L94A, Brd4 BD1 L94V, Brd2 BD2 L383A, Brd2 BD2L383V, Brd2 BD1 L110A, Brd2 BD1 L110V, Brd3 BD2 L344A, Brd3 BD2 L344V, Brd3 BD1 L70A, Brd3 BD1 L70V, BrdT BD2 L306A, BrdT BD2 L306V, BrdT BD1 L63A or BrdT BD1 68. The use according to clause 67, wherein the L63V bromodomain.

[0070] 69. Hole-modified mutant Brd4 bromodomain is Brd4 BD2 L387A or Brd4 BD2 68. The use according to clause 67, wherein the domain is the L387V bromodomain. 70. Hole-modified mutant Brd4 bromodomain is Brd4 BD2 68. The use according to paragraph 67, wherein the domain is a L387A bromodomain. 71. The use according to any one of clauses 66 to 70, wherein the protein is a BET protein. 72. The use according to item 71, wherein the BET protein is the Brd2 protein.

[0071] 73. A protein comprising one or more Brd4 bromodomains, each of which contains a L387A mutation. 74. The protein according to paragraph 73, wherein the protein is as defined in paragraph 71 or 72.

[0072] The present disclosure will be further defined, by way of example only, with reference to the following drawings, in which: [Brief description of the drawings]

[0073] [Figure 1](A) Pan-selective BET degraders, MZ1 and ARV-771. (B) Pan-selective BET inhibitors, (+)-JQ1 and I-BET762 (top). Allele-specific bump BET inhibitors, ME, ET, 9-ME-1 and 9-ET-1 (bottom). (C) Tailoring the "bump and hole" approach to BET bromodomains to generate high-affinity selective pairings that can be utilized as degron systems. (D) Conceptualization of the bromotag degron approach. [Diagram 2] Design and development of heterozygous knock-in bromotag-Brd2 HEK293 cell lines. (A) Design of the knock-in construct used in the development of CRISPR constructs. (B) FACS single cell sorting of HEK293 cells based on GFP expression. Consecutive single cells were sorted into individual wells of a 96-well plate. (C) Junction PCR using genomic DNA of expanded GFP expressing paired clones to parental HEK293. (D) Western blot demonstrating the selectivity of the polyclonal Brd4BD2L387A antibody. [Diagram 3] (A) Ternary complex between Brd4BD2 (green, schematic / surface representation) and MZ1 (7, rods, grey carbon) and VCB (VHL: blue; Elongin C: pink; Elongin B-light orange; schematic / surface representation). Leu387 (rods, green) (PDB code: 5T35) is highlighted with an arrow. Alignment of Brd4BD2 (light green, schematic image, 5T35) with (B) Brd2BD2 L383A (orange, schematic image, 4QEW) and (C) Brd2BD2 L383V (yellow, schematic image, 5O3C) co-crystallized with MZ1 (7, rods, grey carbon), ET (4, rods, pink carbon) and 9-ME-1 (5, rods, blue carbon), respectively. Brd4BD2 WTLeu387 (rods, light green carbon) and mutants Brd2BD2 L383AAla383 (rods, orange carbon) and Brd2BD2 L383VVal383 (rods, yellow carbon) are highlighted. [Figure 4]First generation IBET-762-based B&H-PROTACs are inactive against Bromotag-Brd2 due to a steric clash presented in the MZ1-like ternary complex. (A) Western blot data for BET protein levels after 6 hours of PROTAC treatment in heterozygous Bromotag-Brd2 HEK293 cells. Bands are normalized to tubulin to derive DC50 values ​​that allow ordering of each PROTAC relative to vehicle control (DMSO). (B) Alignment of the ternary complex between Brd4BD2 (green, surface representation), MZ1 (1, rod, grey carbon) and VHL (cyan, surface representation) with ET (6,8-OMe, rod, pink carbon, 4QEW) and 9-ME-1 (7,9-OMe, rod, blue carbon, 5O3C) to show potential clashes with VHL through the bulkier 8 / 9-methoxyphenyl groups (PDB code: 5T35). His110 is highlighted (rod, cyan carbon). [Diagram 5] Biological evaluation of second generation B&H-PROTACs in Bromotag-Brd2 HEK293 cells. Western blot data for BET protein levels monitoring 10 μM to 1 nM compound treatment over 6 hours in heterozygous Bromotag-Brd2 HEK293 cells. Bands are normalized to tubulin and negative control (cis-MZ1) to derive DC50 values ​​that allow ordering of each PROTAC. [Figure 6]Biological evaluation of AGB1, AGB2 and AGB3 in Bromotag-Brd2 HEK293 cells. (A) Western blot data for BET protein levels monitoring 10μM-1nM compound treatment over 6 hours in heterozygous Bromotag-Brd2 HEK293 cells. (B) Time course Western blot data for Brd2 levels in heterozygous Bromotag-Brd2 HEK293 cells treated with AGB1 and AGB2 at 500nM and AGB3 at 1μM over 36 hours. (C and D) Plots for calculating (C) DC50 and (D) t1 / 2 values ​​for compounds allowing to determine that AGB1 was the best choice for further validation. Western blots from (A) and (B) were normalized to tubulin to derive pDC50 or t1 / 2 values ​​allowing to rank order each PROTAC compared to vehicle control (DMSO). [Figure 7] Fluorescence polarization (FP) of B&H-PROTAC binary and ternary complex binding. Binary and ternary complex formation FP data for 46 (A), 47 (B) and 48 (C) against VHL alone (black solid lines) or against VHL when pre-incubated with Brd4BD2 L387A (colored dashed lines). Error bars and Kd values ​​are means (± SEM) from N=4 for binary and ternary binding to VHL. A shift to the left between binary and ternary data indicates positive cooperativity. Cooperativity (α) is calculated as the ratio of Kd binary / Kd ternary. [Figure 8]Cellular mechanistic characterization of AGB1 degradation activity. (A) Western blot showing that on-target degradation activity of 46 depends on activity of CRL2VHL, proteasome, and bromotag target binding. Bromotag-Brd2 HEK293 cells were treated with 200 nM 46 (3 h) after pretreatment (1 h) with proteasome inhibitor MG132, neddylation inhibitor MLN4924, VHL inhibitor VH298 or bromotag inhibitor ET-JQ1-OMe or DMSO vehicle. (B) Western blot demonstrating recovery of bromotag-Brd2 after removal of 200 nM 46 after 3 h treatment in heterozygous bromotag-Brd2 HEK293 cells. Control experiments for no wash and vehicle treatment are included. Bands are normalized to tubulin protein levels and compared to vehicle control (DMSO) to quantify final protein levels of bromotag-Brd2. (C) Antiproliferative effects of 46 compared to MZ1 and non-degraded control 52 and cis-MZ1. Staurosporine was used as a positive control for cytotoxicity. MV-4-11, 22Rv1 and HEK293 cells were treated with different concentrations of compounds and Promega CellTiter-Glo cell viability assay was performed after 24, 48 and 48 hours, respectively. pEC50 values ​​(±SEM) are the mean from N=2 for MV-4-11 and 22Rv1 cells and N=3 for HEK293 cells, from data normalized to vehicle control (DMSO). [Figure 9] Plasma stability and in vivo pharmacokinetic studies of AGB1 in mice. (A) Percentage of AGB1 remaining in mouse plasma at 37°C after 0, 5, 15, 30, 45, and 60 min normalized to the 0 min time point with two independent replicates per time point. (B) Male C57BL / 6 mice were treated with a single 5 mg / kg dose of 46 by either intravenous (IV, black dots) or subcutaneous (SC, white squares) injection, and plasma concentrations of 46 were measured at seven time points. Data are the mean (±SD) from three independent replicates at each time point. The red dashed line indicates the DC50 of 46 for Bromotag-Brd2 degradation, 6h. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0074] Experimental procedure chemicals. Synthesis. Commercially available chemicals were purchased from Apollo Scientific, Sigma-Aldrich, Fluorochem, or Manchester Organics and used without any further purification. All reactions were performed using anhydrous solvents. Reactions were monitored using either: an Agilent Technologies 1200 Series analytical HPLC (high performance liquid chromatography) coupled to an Agilent Technologies 6130 quadrupole LC / MS containing an Agilent diode array detector and a Waters XBridge C18 column (50 mm x 2.1 mm, particle size 3.5 μm). Samples were eluted with a gradient of 5% to 95% MeCN:water with 0.1% formic acid, 3 min, flow rate 0.7 mL / min; or a Shimadzu HPLC / MS 2020 equipped with a photodiode array detector and a Hypersil Gold column (1.9 μm 50 x 2.1 mm). Samples were eluted with a gradient of 5%-95% MeCN:water with 0.1% formic acid in 3 min at a flow rate of 0.8 mL / min. Intermediates were purified by flash column chromatography using a Teledyne Isco Combiflash Rf or Rf200i equipped with a normal phase RediSep Rf disposable column or a reverse phase RediSep Rf Gold C18 reusable column. Final compounds were purified by HPLC using a Gilson preparative HPLC system equipped with a Waters X-Bridge C18 column (100 mm x 19 mm; particle size 5 μm) using a gradient of 5%-95% acetonitrile in water with 0.1% formic acid or ammonia over 10 min at a flow rate of 25 mL / min unless otherwise stated. Characterization of compounds using NMR was performed on either a Bruker 500 Ultrashield or a Bruker Ascend 400 spectrometer. Proton ( 1 H) and carbon ( 13C) The standard solvent is: d1-chloroform-CDCl 3 ((δH=7.26ppm / δC=77.15ppm), d4-CD 3 OD (δH=3.31 ppm / δC=49.00 ppm). Signal patterns are described as singlet (s), doublet (d), triplet (t), quartet (q), quintet (quint.), multiplet (m), broad (br.), or combinations of the listed splitting patterns. Coupling constants (J) are measured in Hertz (Hz). NMR spectra for all compounds were processed using Bruker TopSpin 4.1.1. High-resolution mass spectral (HRMS) data were obtained on a Bruker MicrOTOF II focus ESI Mass spectrometer in parallel with a Dionex Ultimate 3000 RSLC system equipped with a diode array detector and a Waters XBridge C18 column (50 mm×2.1, particle size 3.5 μm). Samples were eluted with a gradient of 5% to 95% acetonitrile:water with 0.1% formic acid in 6 min at a flow rate of 0.6 mL / min. All compounds are greater than 95% pure by HPLC.

[0075] General procedure A. Azide 9 (synthesized according to Zengerle, M.; Chan, K.-H.; Ciulli, A., ACS Chem Biol. 2015, 10 (8), 1770-1777) (1 eq.) was dissolved in MeOH (125 mL / mmol). A catalytic amount of 10 wt.% Pd / C was added and the reaction was purified by H 2 The mixture was stirred under reduced pressure for 3 h. The reaction mixture was then filtered through a PTFE syringe filter and evaporated to dryness to give a quantitative yield of the desired amine. The resulting amine (1 eq.) was added to a solution of acid (1 eq.), HATU (1 eq.), HOAt (1 eq.) and DIPEA (3 eq.) in DCM or DMF (2 mL) and left under stirring at room temperature for 18 h. It was then purified by HPLC.

[0076] General procedure B. The azide (1 eq.) was dissolved in MeOH (125 mL / mmol). A catalytic amount of 10 wt.% Pd / C was added and the reaction was refluxed with H 2 The mixture was stirred under 50° C. for 3 h. The reaction mixture was then filtered through a PTFE syringe filter and evaporated to dryness to give the desired amine in quantitative yield. The resulting amine was added to a solution of alkylated JQ1 acid (1 eq.), COMU (1.5 eq.) and DIPEA (3 eq.) in THF (8 L / mol) and stirred at room temperature for 4 h. The mixture was then concentrated in vacuo and the residue was purified by HPLC using a linear gradient of 5% to 95% MeCN in 0.1% formic acid in water over 12 min to give the amide as a mixture of two diastereomers.

[0077] General procedure C. Alkylated JQ1 acid (1 eq.), EDC.HCl (2 eq.) were dissolved in THF (15 mL / mmol) and stirred at room temperature for 5 min. DMAP (3 eq.) and alcohol (2 eq.) were then added and the reaction was left stirring at room temperature for 16 h. The mixture was then concentrated in vacuo and the residue was purified by HPLC using a linear gradient of 5% to 95% MeCN in 0.1% formic acid in water over 12 min to give the amide as a mixture of two diastereomers. General procedure D. Compound 29 (120 mg, 0.29 mmol) was dissolved in THF (5.2 mL) and cooled to -78 °C. A solution of 0.5 M KHMDS in toluene (812 μL, 0.41 mmol) was added dropwise and the reaction was left with stirring at -78 °C for 1 h. Alkyl iodide (0.41 mmol) was then added and the reaction was further stirred at -78 °C for 10 min before warming to room temperature and left with stirring for 16 h. The mixture was then concentrated in vacuo and purified by HPLC using a linear gradient of 30% to 70% MeCN in 0.1% formic acid in water over 12 min to give the alkylated JQ1-OMe derivative.

[0078] General Procedure E. The (2S,3S) diastereomer (1 eq.) and NaOMe (10 eq.) were mixed in a sealed, 2Dissolved in MeOH (60 L / mol) in a purged microwave vial and heated to 120° C. under microwave irradiation for 40 min. The reaction was stirred at 60° C. and then acidified with a few drops of AcOH. The reaction was then cooled to room temperature and concentrated in vacuo. The residue was purified by HPLC using a linear gradient of 30% to 70% MeCN in 0.1% formic acid in water over 12 min. General procedure F. ET-JQ1-OH (45, synthesized according to Bond, AG; Testa, A.; Ciulli, A., Org Biomol Chem. 2020, 18 (38), 7533-7539) (1 eq.) was reacted with N 2 The acid chloride was dissolved in DCM (9 L / mol) under reduced pressure. Thionyl chloride (15 eq.) was then added and the reaction was left stirring at room temperature for 3 h and the conversion to the acid chloride was monitored by LCMS in MeOH (monitored by mass of methyl ester (ca. 443)). The mixture was evaporated to dryness to quantitatively obtain the acid chloride intermediate. Alcohol (1 eq.) was dissolved in DCM (9 L / mol) and added to the acid chloride. This was left stirring at room temperature for 16 h. The mixture was then concentrated in vacuo and purified.

[0079] (2S,4R)-1-((2S)-2-(tert-butyl)-17-(6-(4-chlorophenyl)-8-methoxy-1-methyl-4H-benzo[f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)-4,16-dioxo-6,9,12-trioxa-3,15-diazaheptadecanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (MZP-15) (14). Following general procedure A, compound 14 was obtained using acid 10 (synthesized according to Chung, C.-W et al. J Med Chem. 2011, 54 (11), 3827-3838) in DCM without HOAt and purified by HPLC using a linear gradient of 5%-95% MeCN in 0.1% formic acid in water over 12 min to give 14 as a mixture of two diastereomers. Yield: 16.5 mg (47%); 1H NMR (400 MHz, CDCl 3 ): δ = 8.70 (s, 1H), 8.63-8.61 (m, 1H), 8.31-8.28 (m, 1H), 8.10-8.03 (m, 1H), 7.52-7.45 (m, 3H), 7.41-7.28 (m, 8H), 7.20-7.16 (m, 1H), 6.86-6.84 (m, 1H), 4.87-4.81 (m, 1H), 4.71-4.63 (m, 2H), 4.57-4.48 (m, 2H), 4.41-4.28 (m, 2H), 4.22-4.06 (m, 3H), 3.78 (s, 3H), 2.57-2.54 (m, 3H), 2.51-2.49 (m, 3H), 2.46-2.35 (m, 1H), 2.27-2.20 (m, 1H), 1.01-0.99 ppm (m, 9H); 13 C NMR (101 MHz, CDCl 3 ): δ = 171.7, 171.5, 171.3, 171.1, 171.04, 171.01, 170.9, 170.7, 166.6, 166.4, 158.3, 156.74, 156.70, 150.6, 150.3, 148.3, 138.7, 138.6, 137.2, 137.1, 137.0, 131.1, 131.0, 130.62, 130.55, 130.4, 130.3, 129.51, 129.47, 129.2, 128.7, 128.6, 128.2, 128.1, 126.2, 124.95, 124.91, 120.3, 118.2, 118.1, 116.0, 71.7, 71.2, 70.9, 70.8, 70.6, 70.5, 70.4, 70.3, 70.22, 70.15, 59.2, 59.1, 57.5, 57.3, 56.9, 56.0, 53.6, 53.5, 43.2, 40.0, 39.9, 38.1, 38.0, 36.9, 36.7, 35.8, 35.6, 26.6, 16.0, 12.11, 12.07; HRMS m / z C 50 H 61 ClN 9 O 9S [M+H] + Calculated value: 998.3996, measured value: 998.3996.

[0080] (2S,4R)-1-((2S,17R*)-2-(tert-butyl)-17-((S*)-6-(4-chlorophenyl)-8-methoxy-1-methyl-4H-benzo[f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)-4,16-dioxo-6,9,12-trioxa-3,15-diazanonadecanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (DAT487) (15). Following general procedure A, compound 15 was obtained using acid 11 (synthesized according to Runcie, AC et al. Chem Sci. 2018, 9 (9), 2452-2468) in DMF and purified by HPLC using a linear gradient of 5% to 95% MeCN in 0.1% ammonia in water over 12 min to give 15 as a mixture of two diastereomers. Yield: 8.3 mg (23%); 1 H NMR (400 MHz, MeOD): δ = 8.86 (d, J = 1.3 Hz, 1H), 7.72-7.67 (m, 1H), 7.56 (d, J = 8.5 Hz, 2H), 7.46-7.34 (m, 7H), 6.93-6.91 (m, 1H), 4.79-4.32 (m, 5H), 4.29-4.25 (m, 1H), 4.11-4.02 (m, 2H), 3.90-3.85 (m, 1H), 3.82-3.77 (m, 4H), 3.74-3.40 (m, 13H), 3.30-3.14 (m, 1H), 2.59-2.58 (m, 3H), 2.47-2.46 (m, 3H), 2.27-2.17 (m, 2H), 2.11-2.03 (m, 1H), 1.75-1.63 (m, 1H), 1.07-1.01 ppm (m, 12H); 13C NMR (101 MHz, MeOD): δ = 175.9, 174.42, 174.39, 172.1, 171.6, 168.8, 168.7, 159.9, 157.3, 152.8, 152.6, 149.0, 140.3, 140.2, 138.6, 138.14, 138.11, 133.4, 132.1, 131.5, 131.3, 130.3, 129.6, 129.0, 128.9, 127.5, 126.8, 119.2, 116.8, 72.3, 72.2, 71.75, 71.67, 71.5, 71.4, 71.0, 70.5, 70.4, 60.8, 58.5, 58.4, 58.1, 56.4, 49.84, 49.76, 43.8, 43.7, 40.4, 39.0, 37.2, 37.1, 26.99, 26.96, 24.53, 24.46, 15.9, 11.7, 11.6; LCMS m / z C 52 H 66 ClN 9 O 9 S [M+2H] 2+ Calculated value: 513.7, measured value: 514.1.

[0081] (2S,4R)-1-((2S,17R*)-2-(tert-butyl)-17-((S*)-6-(4-chlorophenyl)-9-methoxy-1-methyl-4H-benzo[f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)-4,16-dioxo-6,9,12-trioxa-3,15-diazaoctadecanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (DAT488) (16). Following general procedure A, compound 16 was obtained using acid 12 (synthesized according to Runcie, AC et al., 2018 (see above)) in DMF and purified by HPLC using a linear gradient of 5% to 95% MeCN in 0.1% ammonia in water over 12 min to give 16 as a mixture of two diastereomers. Yield: 13.8 mg (28%); 1H NMR (400 MHz, MeOD): δ = 8.87-8.86 (m, 1H), 7.49-7.34 (m, 9H), 7.31-7.29 (m, 1H), 7.16-7.11 (m, 1H), 4.71-4.69 (m, 1H), 4.62-4.56 (m, 1H), 4.55-4.46 (m, 2H), 4.38-4.32 (m, 1H), 4.25-4.21 (m, 1H), 4.09-4.00 (m, 2H), 3.97-3.96 (m, 3H), 3.90-3.72 (m, 3H), 3.71-3.59 (m, 11H), 3.53-3.42 (m, 2H), 2.66-2.64 (m, 3H), 2.47-2.45 (m, 3H), 2.25-2.18 (m, 1H), 2.11-2.04 (m, 1H), 1.36-1.32 (m, 3H), 1.05-1.02 ppm (m, 9H); 13 C NMR (101 MHz, MeOD): δ = 177.4, 174.39, 174.36, 172.1, 171.7, 171.6, 168.1, 168.0, 163.6, 156.8, 152.9, 152.8, 149.0, 140.3, 140.2, 138.9, 137.9, 135.8, 134.34, 134.32, 133.4, 132.4, 131.5, 130.4, 129.4, 128.9, 122.5, 115.2, 110.6, 72.2, 71.7, 71.6, 71.4, 71.1, 71.0, 70.7, 60.8, 60.7, 58.1, 56.7, 43.9, 43.7, 40.5, 38.9, 37.1, 27.0, 20.0, 16.1, 16.0, 15.9, 11.9; LCMS m / z C 51 H 64 C1N 9 O 9 S [M+2H] 2+ The calculated value is 506.7, and the measured value is 507.1.

[0082] (2S,4R)-1-((2S,17R*)-2-(tert-butyl)-17-((S*)-6-(4-chlorophenyl)-9-methoxy-1-methyl-4H-benzo[f][1,2,4]triazolo[4,3-a][1,4]diazepin-4-yl)-4,16-dioxo-6,9,12-trioxa-3,15-diazanonadecanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (DAT489 17). Following general procedure A, compound 17 was obtained using acid 13 (synthesized according to Runcie, AC et al., 2018 (see above)) in DMF and purified by HPLC using a linear gradient of 5% to 95% MeCN in 0.1% ammonia in water over 12 min to give 17 as a mixture of two diastereomers. Yield: 4.8 mg (20%); 1 H NMR (400 MHz, MeOD): δ = 8.87-8.86 (m, 1H), 7.54-7.50 (m, 2H), 7.46-7.37 (m, 7H), 7.26 (d, J = 2.5 Hz, 1H), 7.15-7.12 (m, 1H), 4.74-4.70 (m, 1H), 4.69-4.51 (m, 2H), 4.50-4.46 (m, 1H), 4.42-4.32 (m, 1H), 4.29-4.25 (m, 1H), 4.11-4.02 (m, 2H), 3.96 (s, 3H), 3.89-3.78 (m, 2H), 3.74-3.39 (m, 13H), 3.29-3.14 (m, 1H), 2.63-2.62 (m, 3H), 2.47-2.46 (m, 3H), 2.28-2.18 (m, 2H), 2.11-2.02 (m, 1H), 1.75-1.62 (m, 1H), 1.06-1.01 ppm (m, 12H); 13C NMR (101 MHz, MeOD): δ = 176.0, 174.42, 174.39, 172.1, 171.6, 169.3, 169.2, 163.71, 163.69, 157.27, 157.26, 152.8, 152.6, 149.0, 140.3, 140.2, 139.1, 138.0, 138.0, 136.0, 134.30, 134.28, 133.4, 132.3, 131.5, 130.3, 129.5, 129.02, 128.95, 122.6, 115.1, 110.6, 72.4, 72.2, 71.75, 71.68, 71.50, 71.48, 71.4, 71.09, 71.06, 70.5, 70.4, 60.80, 60.78, 58.4, 58.3, 58.14, LCMS m / z C 52 H 66 ClN 9 O 9 S [M+2H] 2+ Calculated value: 513.7, measured value: 514.2.

[0083] (2S,4R)-1-((2S,17R*)-2-(tert-butyl)-17-((S*)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-4,16-dioxo-6,9,12-trioxa-3,15-diazaoctadecanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (ME-MZ1) (18). According to general procedure B, compound 18 was synthesized according to azide 9 (Chung, C.-W et al., 2011 (see above)) and alkylated JQ1 acid 32 to give 18 as a mixture of two diastereomers. Yield: 1.6 mg (19%); 1 H NMR (400 MHz, CDCl3 ): δ = 8.67 (s, 1H), 8.07 (t, J = 5.4 Hz, 1H), 7.89 (t, J = 5.1 Hz, 1H), 7.68 (t, J = 6.0 Hz, 1H), 7.46-7.24 (m, 9H), 4.85-4.79 (m, 1H), 4.77-4.63 (m, 1H), 4.63-4.47 (m, 2H), 4.42-4.36 (m, 1H), 4.31-4.23 (m, 2H), 4.18-4.01 (m, 3H), 3.96-3.85 (m, 1H), 3.81-3.36 (m, 16H), 2.65-2.60 (m, 3H), 2.51 (s, 3H), 2.50-2.37 (m, 4H), 2.26-2.11 (m, 1H), 1.73-1.64 (m, 3H), 1.42-1.35 (m, 3H), 1.01-0.94 ppm (m, 9H); 13 C NMR (101 MHz, CDCl 3 ): δ = 175.2, 171.51, 171.49, 171.2, 170.7, 170.5, 163.3, 163.2, 158.2, 155.14, 155.09, 150.4, 149.8, 148.6, 138.6, 138.5, 136.9, 136.8, 136.69, 136.65, 131.9, 131.25, 131.15, 130.8, 130.2, 129.6, 129.5, 128.9, 128.8, 128.2, 128.0, 71.6, 71.4, 70.9, 70.6, 70.5, 70.4, 70.3, 70.25, 70.20, 70.1, 60.5, 60.1, 59.1, 58.9, 57.5, 57.3, 56.8, 56.7, 43.3, 43.2, 42.7, 42.6, 39.9, 36.4, 36.3, 35.9, 35.8, 26.6, 26.5, 16.4, 16.2, 16.1, 14.6, 13.3, 11.91, 11.87; HRMS m / z C 50 H 63 ClN 9 O 8 S 2 [M+H]+ Calculated value: 1016.3924, Measured value: 1016.3905.

[0084] (2S,4R)-1-((2S,17R*)-2-(tert-butyl)-17-((S*)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-4,16-dioxo-6,9,12-trioxa-3,15-diazanonadecanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (ET-MZ1) (19). According to general procedure B, compound 19 was synthesized according to azide 9 (Chung, C.-W et al., 2011 (see above)) and alkylated JQ1 acid 33 to give 19 as a mixture of two diastereomers. Yield: 5.3 mg (47%); 1 H NMR (500 MHz, CDCl 3 ): δ = 8.68-8.66 (m, 1H), 8.10-8.05 (m, 1H), 7.83-7.79 (m, 1H), 7.69-7.65 (m, 1H), 7.40-7.26 (m, 8H), 7.21-7.16 (m, 2H), 4.87-4.76 (m, 2H), 4.68-4.49 (m, 2H), 4.49-4.36 (m, 1H), 4.28-4.24 (m, 1H), 4.18-4.00 (m, 3H), 3.81-3.74 (m, 1H), 3.74-3.34 (m, 13H), 2.65-2.62 (m, 3H), 2.53-2.51 (m, 3H), 2.49-2.44 (m, 1H), 2.41-2.38 (m, 3H), 2.36-2.30 (m, 1H), 2.25-2.11 (m, 1H), 1.97-1.89 (m, 1H), 1.71-1.59 (m, 4H), 1.03-0.93 ppm (m, 12H); 13 C NMR (126 MHz, CDCl 3): δ = 174.2, 173.9, 171.7, 171.6, 171.2, 170.4, 170.3, 163.8, 163.2, 155.3, 155.1, 150.3, 149.9, 149.8, 148.6, 138.7, 138.6, 136.95, 136.91, 136.8, 136.7, 132.1, 131.94, 131.90, 131.3, 131.1, 131.0, 130.9, 130.8, 130.7, 130.2, 130.1, 129.9, 129.6, 129.5, 129.0, 128.8, 128.3, 127.6, 71.3, 71.2, 71.1, 70.9, 70.8, 70.7, 70.50, 70.47, 70.3, 70.18, 70.15, 59.8, 59.4, 59.2, 58.9, 57.63, 57.59, 56.8, 50.3, 50.1, 43.3, 43.0, 39.9, 39.8, 36.9, 36.4, 35.90, 35.85, 26.6, 23.7, 23.2, 16.21, 16.19, 14.6, 14.5, 13.2, 12.0; HRMS m / z C 51 H 65 ClN 9 O 8 S 2 [M+H] + Calculated value: 1030.4081, Measured value: 1030.3943.

[0085] (2S,4R)-1-((2S,15R*)-2-(tert-butyl)-15-((S*)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-4,14-dioxo-6,10-dioxa-3,13-diazahexadecanoyl)-4-hydroxy-N-((S)-1-(4-(4-methylthiazol-5-yl)phenyl)ethyl)pyrrolidine-2-carboxamide (ME-ARV-771) (20). Following general procedure B, compound 20 was obtained using azide 42 (synthesized according to Klein, V. et al., ChemRxiv 2021) and alkylated JQ1 acid 32 to give 20 as a mixture of two diastereomers. Yield: 5.2 mg (31%); 1 H NMR (500 MHz, CDCl 3 ): δ = 8.71-8.69 (m, 1H), 7.66-7.61 (m, 1H), 7.57-7.21 (m, 9H), 5.14-4.98 (m, 1H), 4.86-4.80 (m, 1H), 4.65-4.47 (m, 2H), 4.34-4.24 (m, 1H), 4.21-3.77 (m, 4H), 3.75-3.33 (m, 11H), 2.69-2.63 (m, 3H), 2.53-2.50 (m, 3H), 2.41 (s, 3H), 2.38-2.28 (m, 1H), 2.23-2.10 (m, 1H), 1.92-1.71 (m, 2H), 1.67 (d, J = 3.1 Hz, 3H), 1.48 (d, J = 21.4 Hz, 3H), 1.43-1.35 (m, 3H), 1.10-1.05 ppm (m, 9H); 13 C NMR (126 MHz, CDCl 3): δ = 175.3, 175.0, 171.5, 171.4, 170.8, 170.6, 170.42, 170.38, 164.1, 163.9, 155.0, 154.9, 150.5, 150.22, 150.16, 148.2, 143.9, 143.7, 137.3, 136.4, 136.1, 132.0, 131.8, 131.33, 131.26, 130.6, 130.5, 130.3, 129.6, 129.55, 129.48, 128.92, 128.88, 126.6, 70.4, 70.32, 70.29, 70.2, 69.6, 69.4, 69.2, 67.84, 67.77, 59.9, 59.8, 58.9, 58.8, 57.5, 57.3, 57.1, 57.0, 49.1, 48.9, 42.6, 42.3, 39.7, 39.5, 36.6, 36.5, 35.5, 35.3, 29.53, 29.46, 26.7, 22.4, 22.1, 16.5, 16.3, 16.1, 14.6, 13.3, 11.8, 11.7; HRMS m / z C 50 H 63 ClN 9 O 7 S 2 [M+H] + Calculated value: 1000.3975, Measured value: 1000.3975.

[0086] (2S,4R)-1-((2S,15R*)-2-(tert-butyl)-15-((S*)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-4,14-dioxo-6,10-dioxa-3,13-diazaheptadecanoyl)-4-hydroxy-N-((S)-1-(4-(4-methylthiazol-5-yl)phenyl)ethyl)pyrrolidine-2-carboxamide (ET-ARV-771) (21). According to general procedure B, compound 21 was obtained using azide 42 (synthesized according to Klein, V. et al., 2021 (see above)) and alkylated JQ1 acid 33 to give 21 as a mixture of two diastereomers. Yield: 3.4 mg (27%); 1 H NMR (400 MHz, CDCl 3 ): δ = 8.68 (s, 1H), 7.94-7.90 (m, 1H), 7.71-7.65 (m, 1H), 7.44-7.31 (m, 7H), 7.25-7.22 (m, 1H), 7.17-7.13 (m, 1H), 5.14-4.87 (m, 1H), 4.75-4.58 (m, 1H), 4.53-4.44 (m, 1H), 4.09-3.98 (m, 1H), 3.94-3.87 (m, 2H), 3.80-3.31 (m, 11H), 2.67-2.61 (m, 2H), 2.54-2.49 (m, 3H), 2.41 (s, 2H), 2.37-2.14 (m, 2H), 1.98-1.47 (m, 11H), 1.11-0.94 ppm (m, 12H); 13 C NMR (101 MHz, CDCl 3): δ = 174.04, 174.00, 172.3, 171.5, 170.59, 170.55, 170.32, 170.25, 163.6, 163.2, 162.4, 155.3, 155.1, 150.4, 144.0, 143.4, 137.1, 136.9, 136.6, 131.3, 131.2, 131.1, 130.64, 130.59, 130.5, 130.10, 130.07, 130.0, 129.6, 129.4, 128.84, 128.80, 128.7, 126.6, 126.5, 70.4, 70.30, 70.26, 70.2, 69.6, 69.4, 69.1, 68.1, 67.7, 59.6, 59.0, 58.8, 58.6, 57.4, 57.1, 57.0, 50.3, 50.2, 49.1, 48.8, 39.8, 39.4, 36.6, 35.7, 35.6, 29.8, 29.6, 29.5, 26.7, 23.9, 23.4, 22.5, 21.9, 16.2, 14.61, 14.56, 13.3, 12.00, 11.97, 11.91, 11.87; HRMS m / z C 51 H 65 ClN 9 O 7 S 2 [M+H] + Calculated value: 1014.4131, Measured value: 1014.4126.

[0087] (S)-13-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidine-1-carbonyl)-14,14-dimethyl-11-oxo-3,6,9-trioxa-12-azapentadecyl(R*)-2-((S*)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)propanoate (ME-OMZ1) (22). According to general procedure C, compound 22 was obtained using alkylated JQ1 acid 32 and alcohol 41 (synthesized according to Klein, V. et al., 2021 (see above)) to give 22 as a mixture of two diastereomers. Yield: 1.1 mg (17%); 1 H NMR (400 MHz, CDCl 3 ): δ = 8.69-8.67 (m, 1H), 7.67-7.65 (m, 1H), 7.44-7.28 (m, 10H), 4.78-4.73 (m, 1H), 4.69-4.50 (m, 3H), 4.41-4.24 (m, 3H), 4.13-3.81 (m, 5H), 3.77-3.49 (m, 12H), 2.63 (d, J = 15.9 Hz, 3H), 2.59-2.50 (m, 4H), 2.42 (s, 3H), 1.73-1.66 (m, 3H), 1.58-1.48 (m, 3H), 0.99-0.94 ppm (m, 9H); 13 C NMR (101 MHz, CDCl 3): δ = 175.4, 171.6, 170.9, 170.6, 170.5, 163.2, 154.5, 150.4, 149.8, 148.7, 142.1, 140.3, 138.4, 136.9, 136.6, 132.4, 131.7, 131.1, 131.0, 131.0, 130.0, 129.6, 128.9, 128.8, 128.3, 71.30, 71.28, 71.0, 70.93, 70.89, 70.7, 70.6, 70.5, 70.44, 70.36, 69.3, 64.1, 64.0, 61.8, 61.7, 60.2, 60.1, 58.7, 58.6, 57.3, 56.8, 56.7, 43.4, 42.7, 42.6, 36.1, 36.0, 35.2, 26.6, 16.2, 16.1, 15.4, 15.3, 14.60, 14.56, 13.3, 11.9; HRMS m / z C 50 H 62 ClN 8 O 9 S 2 [M+H] + Calculated value: 1017.3764, Measured value: 1017.3780.

[0088] (S)-13-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidine-1-carbonyl)-14,14-dimethyl-11-oxo-3,6,9-trioxa-12-azapentadecyl(R*)-2-((S*)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)butanoate (ET-OMZ1) (23). According to general procedure C, compound 23 was obtained using alkylated JQ1 acid 33 and alcohol 41 (synthesized according to Klein, V. et al., 2021 (see above)) to give 23 as a mixture of two diastereomers. Yield: 0.7 mg (10%); 1 H NMR (500 MHz, CDCl 3): δ = 8.67 (s, 1H), 7.41-7.23 (m, 10H), 4.77 (t, J = 7.9 Hz, 1H), 4.60-4.31 (m, 6H), 4.24 (d, J = 10.9 Hz, 1H), 4.15-4.11 (m, 1H), 4.05-3.89 (m, 3H), 3.80-3.74 (m, 2H), 3.72-3.52 (m, 10H), 2.65 (s, 3H), 2.60-2.51 (m, 4H), 2.41 (s, 3H), 2.17-2.10 (m, 2H), 1.71-1.64 (m, 4H), 1.05-0.93 ppm (m, 12H); 13 C NMR (126 MHz, CDCl 3 ): δ = 174.8, 174.1, 171.5, 171.1, 170.5, 163.2, 163.0, 154.6, 150.4, 149.9, 148.7, 141.2, 136.9, 136.7, 132.2, 131.8, 131.0, 130.7, 130.0, 129.7, 128.8, 128.4, 128.3, 71.32, 71.30, 70.98, 70.96, 70.91, 70.85, 70.8, 70.7, 70.6, 70.54, 70.51, 70.3, 69.3, 63.9, 63.8, 59.4, 58.5, 57.3, 56.8, 49.8, 49.7, 43.44, 43.41, 36.0, 35.1, 26.6, 23.4, 16.2, 14.6, 13.3, 11.9, 11.7, 16.1, 15.4, 15.3, 14.60, 14.56, 13.3, 11.9; HRMS m / z C 51 H 64 C1N 8 O 9 S 2 [M+H] + Calculated value: 1031.3921, measured value: 1031.4061.

[0089] 2-(3-(2-(((S)-1-((2S,4R)-4-hydroxy-2-(((S)-1-(4-(4-methylthiazol-5-yl)phenyl)ethyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-2-oxoethoxy)propoxy)ethyl (R*)-2-((S*)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)propanoate (ME-OARV-771) (24). According to general procedure C, compound 24 was obtained using alkylated JQ1 acid 32 and alcohol 44 (synthesized according to Klein, V. et al., 2021 (see above)) to give 24 as a mixture of two diastereomers. Yield: 1.8 mg (25%); 1 H NMR (500 MHz, CDCl 3 ): δ = 8.68-8.66 (m, 1H), 7.51-7.44 (m, 1H), 7.42-7.28 (m, 8H), 7.23-7.16 (m, 1H), 5.52 (br. s, 1H), 5.14-5.06 (m, 1H), 4.81-4.71 (m, 1H), 4.70-4.51 (m, 2H), 4.43-4.31 (m, 2H), 4.27 (d, J = 10.5 Hz, 1H), 4.13-4.08 (m, 1H), 4.07-3.81 (m, 4H), 3.75-3.54 (m, 8H), 3.19 (br. s, 1H), 2.66-2.62 (m, 3H), 2.59-2.52 (m, 4H), 2.42 (s, 3H), 2.17-2.08 (m, 1H), 1.96-1.85 (m, 2H), 1.69 (d, J = 4.8 Hz, 3H), 1.56-1.47 (m, 6H), 1.08-1.05 ppm (m, 9H); 13 C NMR (126 MHz, CDCl 3): δ = 175.4, 174.3, 171.8, 171.5, 170.3, 169.8, 169.7, 169.5, 163.1, 154.5, 150.3, 149.8, 148.7, 136.9, 136.7, 132.2, 131.8, 131.0, 130.7, 130.0, 129.7, 128.9, 128.8, 126.65, 126.60, 73.2, 72.2, 70.5, 70.4, 70.3, 69.3, 69.0, 68.9, 68.0, 67.9, 63.9, 61.9, 60.1, 59.6, 58.8, 58.5, 57.2, 56.8, 56.6, 53.6, 49.1, 49.0, 42.6, 35.6, 35.3, 33.5, 30.0, 26.7, 26.6, 22.4, 22.3, 16.2, 15.3, 14.60, 14.55, 14.3, 13.2, 11.9; HRMS m / z C 50 H 62 ClN 8 O 8 S 2 [M+H] + Calculated value: 1001.3815, Measured value: 1001.3967.

[0090] 2-(3-(2-(((S)-1-((2S,4R)-4-hydroxy-2-(((S)-1-(4-(4-methylthiazol-5-yl)phenyl)ethyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-2-oxoethoxy)propoxy)ethyl(R*)-2-((S*)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)butanoate (ET-OARV-771) (25). According to general procedure C, compound 24 was obtained using alkylated JQ1 acid 32 and alcohol 44 (synthesized according to Klein, V. et al., 2021 (see above)) to give 24 as a mixture of two diastereomers. Yield: 1.7 mg (24%); 1 H NMR (500 MHz, CDCl 3): δ = 8.66 (s, 1H), 7.47-7.28 (m, 10H), 7.20-7.13 (m, 1H), 5.12-5.04 (m, 1H), 4.81-4.75 (m, 1H), 4.70-4.52 (m, 2H), 4.49-4.31 (m, 2H), 4.28-4.22 (m, 1H), 4.18-4.11 (m, 1H), 4.07-3.94 (m, 2H), 3.91-3.81 (m, 2H), 3.80-3.64 (m, 3H), 3.63-3.54 (m, 5H), 3.07 (s, 1H), 2.67-2.65 (m, 3H), 2.59-2.52 (m, 4H), 2.41 (s, 3H), 2.19-2.05 (m, 2H), 1.96-1.85 (m, 2H), 1.72-1.64 (m, 4H), 1.49-1.46 (m, 3H), 1.07-1.01 ppm (m, 12H); 13 C NMR (126 MHz, CDCl 3 ): δ = 175.0, 174.9, 171.9, 171.8, 170.42, 170.38, 169.8, 169.7, 163.2, 154.6, 154.5, 150.3, 149.89, 149.85, 148.7, 143.42, 143.36, 136.92, 136.90, 136.71, 136.67, 131.8, 131.0, 130.1, 130.0, 129.7, 128.8, 126.6, 72.2, 70.32, 70.26, 70.2, 69.3, 69.0, 68.9, 68.0, 67.9, 63.8, 62.0, 59.4, 58.45, 58.40, 57.2, 56.8, 56.7, 49.8, 49.7, 49.0, 35.6, 35.4, 35.2, 35.1, 30.1, 26.7, 26.6, 23.43, 23.39, 22.4, 16.2, 14.6, 13.3, 12.0, 11.7; HRMS m / z C 51 H 64 ClN 8 O 8 S 2 [M+H] +Calculated value: 1015.3972, Measured value: 1015.4032.

[0091] Methyl 2-(5-(4-chlorophenyl)-6,7-dimethyl-2-oxo-2,3-dihydro-1H-thieno[2,3-e][1,4]diazepin-3-yl)acetate (28). Fmoc-Asp(OMe)-OH (26) (1.92 g, 5.19 mmol) was dissolved in DCM (25 mL). Thionyl chloride (3.76 mL, 51.9 mmol) was added and the reaction was placed at reflux for 2 h. The reaction mixture was then concentrated in vacuo to give the intermediate acid chloride. The acid chloride (2.01 g, 5.19 mmol) was dissolved in chloroform (10 mL). (2-Amino-4,5-dimethylthiophen-3-yl)(4-chlorophenyl)methanone (27) (1.38 g, 5.19 mmol) was then added and the flask was heated to reflux and stirred for 1 h. The mixture was then cooled to room temperature before adding TEA (2.89 mL, 20.76 mmol). The flask was heated to reflux for a further 16 h. The reaction mixture was then concentrated in vacuo, redissolved in 1,2-DCE (50 mL) and acidified with AcOH (3.5 mL). It was left stirring at 80 °C for 1 h. The mixture was then evaporated to dryness before being redissolved in DCM (50 mL) and washed with 1.0 M HCl solution (40 mL). The aqueous phase was extracted with DCM (3 x 50 mL) and the combined organic layers were washed with MgSO 4 The mixture was dried at 77° C., filtered and concentrated in vacuo. The residue was purified by flash column chromatography (24 g silica column) using a linear gradient of 0% to 80% EtOAc in heptane to give 28. Yield: 1.06 g (54%); 1 H NMR (500 MHz, CDCl 3): δ = 7.43 (d, J = 8.6 Hz, 2H), 7.34 (d, J = 8.7 Hz, 2H), 4.26 (dd, J = 6.6, 7.4 Hz, 1H), 3.74 (s, 3H), 3.44 (dd, J = 7.5, 16.8 Hz, 1H), 3.17 (dd, J = 6.5, 16.8 Hz, 1H), 2.29 (s, 3H), 1.60 ppm (s, 3H); LCMS m / z C 18 H 18 ClN 2 O 3 S [M+H] + Calculated value: 377.1, Measured value: 377.0.

[0092] Methyl 2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate ((±)-JQ1-OMe) (29). Compound 28 (344 mg, 0.91 mmol) was dissolved in THF (7 mL), cooled to -78 °C, and then dissolved in 1.0 M KO in THF (1.37 mL, 1.37 mmol). t A solution of Bu was added and stirred for 30 min. Diethyl chlorophosphate (198 μL, 1.37 mmol) was then added and the reaction was warmed to −10° C. and stirred for 45 min. Acetylhydrazine (135 mg, 1.82 μmol) was then added and the reaction was left stirring at room temperature for 1 h. n-BuOH (7.8 mL) was then added before heating to 90° C. for 1 h. The reaction was concentrated in vacuo and the residue was purified by flash column chromatography (40 g silica column) using a linear gradient of 30% to 50% EtOAc in heptane to remove starting material, and 20% MeOH in DCM was run through the column. Several fractions were further purified by HPLC using a linear gradient of 35% to 55% MeCN in 0.1% formic acid in water over 12 min to give 29. Yield: 173 mg (46%); 1 H NMR (400 MHz, CDCl 3): δ = 7.41 (d, J = 8.2 Hz, 2H), 7.33 (d, J = 8.4 Hz, 2H), 4.62 (dd, J = 6.9, 6.9 Hz, 1H), 3.77 (s, 3H), 3.70-3.57 (m, 2H), 2.67 (s, 3H), 2.41 (s, 3H), 1.69 ppm (s, 3H); ); LCMS m / z C 20 H 20 ClN 4 O 2 S [M+H] + Calculated value: 415.1, Measured value: 415.0.

[0093] (±)-Methyl (R)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)propanoate ((±)-(3S,2R)-ME-JQ1-OMe) (30a). Following general procedure D, compound 30a was obtained using the alkylating agent methyl iodide. Yield 8.9 mg (7%); following general procedure E, compound 30a may also be obtained from epimerization of 30b. Isolated yield: 12 mg (31%); 1 H NMR (500 MHz, CDCl 3 ): δ = 7.34 (d, J = 8.7 Hz, 2H), 7.31 (d, J = 8.8 Hz, 2H), 4.25 (d, J = 10.7 Hz, 1H), 4.07 (qd, J = 6.9, 10.7 Hz, 1H), 3.83 (s, 3H), 2.67 (s, 3H), 2.42 (s, 3H), 1.69 (s, 3H), 1.51 ppm (d, J = 6.9 Hz, 3H); 13 C NMR (126 MHz, CDCl 3 ): δ = 176.1, 163.2, 154.5, 149.8, 136.9, 136.7, 132.3, 131.1, 130.9, 130.7, 130.0, 128.8, 60.4, 51.9, 42.6, 15.4, 14.6, 13.2, 12.0; LCMS m / z C21 H 22 ClN 4 O 2 S [M+H] + Calculated value: 429.1, Measured value: 429.0. (±)-Methyl (S)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)propanoate ((±)-(3S,2S)-ME-JQ1-OMe) (30b). Following general procedure D, compound 30b was obtained using the alkylating agent methyl iodide. Yield 35.4 mg (29%); 1 H NMR (500 MHz, CDCl 3 ): δ = 7.43 (d, J = 8.4 Hz, 2H), 7.33 (d, J = 8.5 Hz, 2H), 4.31 (d, J = 9.8 Hz, 1H), 3.88 (qd, J = 7.2, 9.7 Hz, 1H), 3.72 (s, 3H), 2.64 (s, 3H), 2.41 (s, 3H), 1.70 (s, 3H), 1.62 ppm (d, J = 7.2 Hz, 3H); 13 C NMR (126 MHz, CDCl 3 ): δ = 176.1, 163.9, 155.5, 149.6, 136.95, 136.90, 132.7, 130.8, 130.4, 129.9, 128.8, 58.5, 52.1, 41.2, 15.4, 14.5, 13.2, 11.9; LCMS m / z C 21 H 22 ClN 4 O 2 S [M+H] + Calculated value: 429.1, Measured value: 429.0.

[0094] (±)-Methyl (R)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)butanoate ((±)-(3S,2R)-ET-JQ1-OMe) (31a). According to general procedure D, compound 31a was obtained using the alkylating agent ethyl iodide. Yield 20 mg (16%); according to general procedure E, compound 31a may also be obtained from epimerization of 31b. Isolated yield: 11 mg (37%); 1 H NMR (500 MHz, CDCl 3 ): δ = 7.35-7.29 (m, 4H), 4.24 (d, J = 10.9 Hz, 1H), 3.99 (dt, J = 3.7, 10.7 Hz, 1H), 3.84 (s, 3H), 2.66 (s, 3H), 2.41 (s, 3H), 2.23-2.13 (m, 1H), 1.73-1.63 (m, 4H), 1.02 ppm (t, J = 7.4 Hz, 3H); 13 C NMR (126 MHz, CDCl 3 ): δ = 175.5, 163.2, 154.6, 149.8, 136.9, 136.7, 132.3, 131.0, 130.9, 130.6, 129.9, 128.8, 59.5, 51.6, 49.8, 23.4, 14.6, 13.2, 12.0, 11.7; LCMS m / z C 22 H 24 ClN 4 O 2 S [M+H] + Calculated value: 443.1, Measured value: 443.1.

[0095] (±)-Methyl (S)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)butanoate ((±)-(3S,2S)-ET-JQ1-OMe) (31b). Following general procedure B, compound 31b was obtained using the alkylating agent ethyl iodide. Yield 29.2 mg (23%); 1H NMR (500 MHz, CDCl 3 ): δ = 7.42 (d, J = 8.4 Hz, 2H), 7.33 (d, J = 8.5 Hz, 2H), 4.31 (d, J = 10.9 Hz, 1H), 3.83 (dt, J = 3.6, 10.1 Hz, 1H), 3.73 (s, 3H), 2.64 (s, 3H), 2.41 (s, 3H), 2.37-2.26 (m, 1H), 1.93-1.82 (m, 1H), 1.69 (s, 3H), 1.05 ppm (t, J = 7.5 Hz, 3H); 13 C NMR (126 MHz, CDCl 3 ): δ = 175.5, 163.9, 155.4, 149.6, 136.95, 136.90, 132.7, 130.8, 130.7, 130.3, 129.9, 128.8, 57.6, 51.9, 47.6, 23.4, 14.5, 13.2, 11.9, 11.2; LCMS m / z C 22 H 24 C1N 4 O 2 S [M+H] + The calculated value is 443.1, the measured value is: 443.1.

[0096] (±)-(R)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)propanoic acid ((±)-(3S,2R)-ME-JQ1-OH) (32). Compound 30a (8.2 mg, 19 μmol) was dissolved in THF (400 μL). LiOH (1 mg, 38 μmol) was then dissolved in water (100 μL) and added to the flask. The flask was heated to 35° C. and stirred for 48 h. Water (25 μL) and 0.6 M LiOH solution (25 μL) were added at regular intervals (every 12 h) to aid in the conversion. The conversion of the ester to the acid was monitored by LC-MS. After 100% conversion, the solution was neutralized with 2.0 M HCl solution and freeze-dried to give acid 32. The acid was used crude for the next step and the yield was considered quantitative. Yield: 7.9 mg, (quantitative); 1 H NMR (500 MHz, CDCl 3 ): δ = 7.34 (d, J = 8.8 Hz, 2H), 7.31 (d, J = 8.9 Hz, 2H), 4.25 (d, J = 10.6 Hz, 1H), 4.07 (m, 1H), 3.83 (s, 3H), 2.67 (s, 3H), 2.42 (s, 3H), 1.69 (s, 3H), 1.51 ppm (d, J = 7.0 Hz, 3H); 13 C NMR (126 MHz, CDCl 3 ): δ = 175.8, 164.8, 154.6, 150.3, 137.7, 135.7, 132.4, 131.6, 131.4, 130.9, 130.3, 129.0, 59.1, 41.5, 15.6, 14.6, 13.4, 11.8; LCMS m / z C 20 H 20 ClN 4 O 2 S [M+H] + Calculated value: 415.1, Measured value: 415.1.

[0097] (±)-(R)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)butanoic acid ((±)-(3S,2R)-ET-JQ1-OH) (33). Compound 31a (35.2 mg, 80 μmol) was dissolved in THF (1.2 mL). LiOH (4.8 mg, 200 μmol) was then dissolved in water (300 μL) and added to the flask. The flask was heated to 40° C. and stirred for 6 days. Water (50 μL) and 0.65 M LiOH solution (50 μL) were added at regular intervals (every 12 hours) to aid the conversion. The conversion of the ester to the acid was monitored by LC-MS. After 100% conversion, the solution was neutralized with 2.0 M HCl solution and freeze-dried to give acid 33. The acid was used crude for the next step and the yield was considered quantitative. Yield: 34.3 mg, (quantitative); 1 H NMR (500 MHz, CDCl 3 ): δ = 7.41 (d, J = 8.5 Hz, 2H), 7.32 (d, J = 8.7 Hz, 2H), 4.24 (d, J = 6.5 Hz, 1H), 3.75-3.70 (m, 1H), 2.69 (s, 3H), 2.43 (s, 3H), 2.03-1.95 (m, 2H), 1.71 (s, 3H), 1.10 ppm (t, J = 7.4 Hz, 3H); 13 C NMR (126 MHz, CDCl 3 ): δ = 175.2, 164.6, 154.9, 150.1, 137.5, 136.1, 132.5, 131.5, 131.2, 130.2, 130.1, 129.0, 58.2, 48.6, 23.8, 14.6, 13.3, 11.9; LCMS m / z C 21 H 22 ClN 4 O 2 S [M+H] + Calculated value: 429.1, Measured value: 429.1.

[0098] (S)-13-((2S,4R)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidine-1-carbonyl)-14,14-dimethyl-11-oxo-3,6,9-trioxa-12-azapentadecyl (R)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)butanoate (AGB1) (46). Following general procedure F, compound 46 was obtained using alcohol 41 (synthesized according to Klein, V. et al., 2021 (see above)) and purified by reversed-phase flash column chromatography (15.5 g C18 gold column) using a linear gradient of 5% to 100% MeCN in 0.1% formic acid in water over 12 min to give AGB1 (46). Yield: 29 mg (30%); 1 H NMR (500 MHz, CDCl 3 ): δ = 8.67 (s, 1H), 7.42 (t, J = 5.9 Hz, 1H), 7.36-7.28 (m, 9H), 4.74 (t, J = 7.9 Hz, 1H), 4.56-4.49 (m, 3H), 4.44-4.30 (m, 3H), 4.23 (d, J = 10.9 Hz, 1H), 4.06 (d, J = 11.3 Hz, 1H), 4.01 (d, J = 15.7 Hz, 1H), 3.98-3.92 (m, 2H), 3.81-3.72 (m, 2H), 3.69-3.59 (m, 10H), 2.65 (s, 3H), 2.53-2.45 (m, 4H), 2.41 (s, 3H), 2.18-2.09 (m, 2H), 1.73-1.62 (m, 4H), 1.01 (t, J = 7.4 Hz, 3H), 0.95 ppm (s, 9H); 13 C NMR (126 MHz, CDCl 3): δ = 174.8, 171.4, 171.1, 170.5, 163.2, 162.9, 154.5, 150.5, 149.9, 148.5, 138.4, 136.9, 136.6, 132.1, 131.8, 131.1, 131.0, 130.9, 130.7, 130.0, 129.6, 128.8, 128.2, 71.3, 70.9, 70.8, 70.6, 70.5, 70.2, 69.3, 63.8, 59.3, 58.7, 57.2, 56.8, 49.7, 43.3, 36.2, 35.3, 26.5, 23.3, 16.1, 14.5, 13.2, 11.9, 11.7; 51 H 64 ClN 8 O 9 S 2 [M+H] + Calculated value: 1031.3921, Measured value: 1031.3961.

[0099] 2-(3-(2-(((S)-1-((2S,4R)-4-hydroxy-2-(((S)-1-(4-(4-methylthiazol-5-yl)phenyl)ethyl)carbamoyl)pyrrolidin-1-yl)-3,3-dimethyl-1-oxobutan-2-yl)amino)-2-oxoethoxy)propoxy)ethyl (R)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)butanoate (AGB2) (47). Following general procedure F, compound 47 was obtained using alcohol 44 (synthesized according to Klein, V. et al., 2021 (see above)) and purified by HPLC using a linear gradient of 5% to 95% MeCN in 0.1% formic acid in water over 12 min to give AGB2 (47). Yield: 1.2 mg (10%); 1 H NMR (500 MHz, CDCl 3): δ = 8.66 (s, 1H), 7.47 (d, J = 7.3 Hz, 1H), 7.39 (d, J = 8.4 Hz, 2H), 7.36 (d, J = 8.4 Hz, 2H), 7.33 (d, J = 8.5 Hz, 2H), 7.29 (d, J = 8.8 Hz, 2H), 7.20 (d, J = 8.6 Hz, 1H), 5.08 (dq, J = 7.2, 7.2 Hz, 1H), 4.78 (t, J = 7.9 Hz, 1H), 4.56 (d, J = 8.6 Hz, 1H), 4.55-4.51 (m, 1H), 4.49-4.43 (m, 1H), 4.35-4.30 (m, 1H), 4.25 (d, J = 10.8 Hz, 1H), 4.12 (d, J = 11.3 Hz, 1H), 4.00-3.93 (m, 2H), 3.87 (d, J = 15.4 Hz, 1H), 3.80-3.75 (m, 1H), 3.75-3.69 (m, 1H), 3.64-3.58 (m, 5H), 2.65 (s, 3H), 2.58-2.52 (m, 4H), 2.41 (s, 3H), 2.20-2.12 (m, 1H), 2.09 (dd, J = 8.3, 13.6 Hz, 1H), 1.93-1.86 (m, 2H), 1.73-1.63 (m, 4H), 1.47 (d, J = 6.9 Hz, 3H), 1.06 (s, 9H), 1.02 ppm (t, J = 7.4 Hz, 3H); 13 C NMR (126 MHz, CDCl 3): δ = 174.9, 171.8, 170.4, 169.8, 163.2, 154.6, 150.3, 149.9, 148.7, 143.4, 136.9, 136.6, 131.02, 130.99, 130.0, 129.7, 128.8, 126.6, 70.3, 70.2, 69.0, 68.9, 68.0, 63.8, 59.4, 58.5, 57.1, 56.8, 49.8, 49.0, 35.6, 35.2, 30.0, 29.8, 26.7, 23.4, 22.4, 16.2, 14.6, 13.3, 11.9, 11.7; HRMS m / z C 51 H 64 ClN 8 O 8 S 2 [M+H] + Calculated value: 1015.3972, Measured value: 1015.4197.

[0100] (2S,4R)-1-((2S,17R)-2-(tert-butyl)-17-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-4,16-dioxo-6,9,12-trioxa-3,15-diazanonadecanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (AGB3) (48). Azide 9 (synthesized according to Zengerle, M, 2015 (see above)) (30 mg, 46 μmol) was dissolved in MeOH (2 mL). A catalytic amount of 10 wt.% Pd / C was added and the reaction was stirred under hydrogen for 3 h. The reaction mixture was then filtered through a PTFE syringe filter and evaporated to dryness to give a quantitative yield of the desired amine. The resulting amine (7.4 mg, 12 μmol) was dissolved in DMF (96 μL) and added to a solution of ET-JQ1-OH (45, synthesized according to Bond, AG, 2020 (see above)) (5 ​​mg, 12 μmol), COMU (5.1 mg, 12 μmol) and DIPEA (4.18 μL, 12 μmol) in DMF (96 μL) and stirred at room temperature for 2 h. The mixture was then concentrated in vacuo and the residue was purified by HPLC using a linear gradient of 5% to 95% MeCN in 0.1% formic acid in water over 12 min to give AGB3 (48). Yield: 2.2 mg (18%); 1 H NMR (400 MHz, CDCl 3): δ = 8.68 (s, 1H), 8.18 (t, J = 5.5 Hz, 1H), 7.36 (d, J = 8.3 Hz, 2H), 7.31-7.24 (m, 5H), 7.17-7.12 (m, 3H), 4.99 (d, J = 4.9 Hz, 1H), 4.85 (t, J = 8.2 Hz, 1H), 4.80 (d, J = 9.7 Hz, 1H), 4.51 (br. s, 1H), 4.46 (dd, J = 7.2, 15.8 Hz, 1H), 4.26 (d, J = 10.5 Hz, 1H), 4.19-4.11 (m, 2H), 4.09 (d, J = 15.9 Hz, 1H), 3.83-3.63 (m, 15H), 3.50-3.42 (m, 1H), 2.64 (s, 3H), 2.53 (s, 3H), 2.39 (s, 3H), 2.34-2.27 (m, 1H), 2.16 (dd, J = 7.5, 13.5 Hz, 1H), 1.96-1.89 (m, 1H), 1.64-1.56 (m, 4H), 1.03-0.96 ppm (m, 12H); 13 C NMR (101 MHz, CDCl 3 ): δ = 173.8, 171.7, 171.6, 170.3, 163.9, 155.0, 150.3, 149.9, 148.5, 138.6, 136.9, 136.7, 132.0, 131.9, 131.31, 131.28, 130.9, 130.6, 130.1, 129.4, 129.0, 127.5, 71.3, 71.1, 70.75, 70.69, 70.4, 70.3, 59.8, 59.4, 57.7, 56.7, 50.3, 42.9, 39.8, 36.9, 36.0, 26.6, 23.1, 16.2, 14.6, 13.3, 12.0, 11.9; HRMS m / z C 51 H 65 C1N 9 O 8 S 2 [M+H] + Calculated value: 1030.4081, Measured value: 1030.4589.

[0101] (2S,4S)-1-((S)-17-(tert-butyl)-2,2-dimethyl-15-oxo-3,3-diphenyl-4,7,10,13-tetraoxa-16-aza-3-silaoctadecano-18-yl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (50). Acid 37 (synthesized according to Klein, V. et al., 2021 (see above)) (161 mg, 0.36 mmol), COMU (154 mg, 0.36 mmol), DIPEA (334 μL, 1.92 mmol) were dissolved in DMF (1.92 mL) and stirred at room temperature for 10 min. Amine 49 (synthesized according to Zengerle, M, 2015 (see above)) (112 mg, 0.24 mmol) was added and the reaction was left with stirring at room temperature for 2 h. The mixture was then purified by reverse-phase flash column chromatography (2 × 15.5 g C18 columns) using a linear gradient of 5% to 100% MeCN in 0.1% formic acid in water over 10 min with a 3 min plateau to give 50. Yield: 103 mg (50%); 1 H NMR (500 MHz, CDCl 3): δ = 8.65 (s, 1H), 7.69-7.65 (m, 4H), 7.57 (t, J = 6.1 Hz, 1H), 7.43-7.31 (m, 10H), 7.20 (d, J = 9.1 Hz, 1H), 5.52 (d, J = 9.8 Hz, 1H), 4.71 (d, J = 9.0 Hz, 1H), 4.60 (dd, J = 7.0, 14.9 Hz, 1H), 4.52 (d, J = 9.1 Hz, 1H), 4.49-4.43 (m, 1H), 4.29 (dd, J = 5.1, 14.9 Hz, 1H), 4.01 (d, J = 15.6 Hz, 1H), 3.98-3.91 (m, 2H), 3.82-3.77 (m, 3H), 3.70-3.59 (m, 8H), 3.57 (t, J = 5.4 Hz, 2H), 2.50 (s, 3H), 2.34 (d, J = 14.0 Hz, 1H), 2.19-2.10 (m, 1H), 1.04 (s, 9H), 0.93 ppm (s, 9H); 13 C NMR (126 MHz, CDCl 3 ): 172.7, 171.9, 169.9, 150.4, 148.7, 137.5, 135.7, 133.8, 131.6, 131.3, 129.7, 128.3, 127.7, 72.6, 71.3, 71.2, 70.9, 70.8, 70.54, 70.51, 63.5, 60.0, 58.7, 56.6, 43.6, 35.2, 35.1, 30.4, 26.9, 26.4, 19.3, 16.1; LCMS m / z C 46 H 63 N 4 O 8 SSi [M+H] + Calculated value: 859.4, measured value: 859.3.

[0102] (2S,4S)-1-((S)-2-(tert-butyl)-14-hydroxy-4-oxo-6,9,12-trioxa-3-azatetradecanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (51). To a solution of compound 50 (51 mg, 59 μmol) in THF (11.9 mL) was added a 1.0 M solution of TBAF in THF (178 μL, 178 μmol). This was left with stirring for 6 h. The mixture was then concentrated in vacuo and the residue was purified by reverse phase flash column chromatography (15.5 g C18 column) using a linear gradient of 5% to 100% MeCN in 0.1% formic acid in water over 10 min to give alcohol 51. Yield: 36.6 mg (quantitative); 1 H NMR (500 MHz, CDCl 3 ): δ = 8.66 (s, 1H), 8.01 (t, J = 5.9 Hz, 1H), 7.38-7.32 (m, 4H), 7.29 (d, J = 9.4 Hz, 1H), 4.67 (d, J = 8.7 Hz, 1H), 4.64-4.58 (m, 2H), 4.44 (t, J = 4.3 Hz, 1H), 4.30 (dd, J = 5.1, 15.0 Hz, 1H), 4.04 (d, J = 15.6 Hz, 1H), 3.97 (d, J = 15.3 Hz, 1H), 3.89 (dd, J = 4.2, 10.9 Hz, 1H), 3.84 (d, J = 10.7 Hz, 1H), 3.71-3.52 (m, 12H), 3.51-3.44 (m, 1H), 2.50 (s, 3H), 2.26 (d, J = 14.3 Hz, 1H), 2.23-2.15 (m, 1H), 0.96 ppm (s, 9H); 172.8, 171.8, 169.8, 150.4, 148.6, 137.7, 131.7, 131.2, 129.6, 128.2, 72.7, 71.2, 71.1, 70.9, 70.5, 70.35, 70.29, 61.7, 60.1, 58.8, 56.5, 43.6, 35.7, 35.5, 26.4, 16.1; LCMS m / z C 30H 45 N 4 O 8 S [M+H] + Calculated value: 621.3, Measured value: 621.2.

[0103] (S)-13-((2S,4S)-4-hydroxy-2-((4-(4-methylthiazol-5-yl)benzyl)carbamoyl)pyrrolidine-1-carbonyl)-14,14-dimethyl-11-oxo-3,6,9-trioxa-12-azapentadecyl (R)-2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)butanoate (cis-AGB1) (52). Following general procedure F, compound 52 was obtained using alcohol 51 and purified by HPLC using a linear gradient of 5% to 95% MeCN in 0.1% formic acid in water over 12 min to give cis-AGB1 (52). Yield: 8.4 mg (51%); 1 H NMR (500 MHz, CDCl 3): δ = 8.67 (s, 1H), 7.63 (t, J = 5.8 Hz, 1H), 7.38-7.27 (m, 8H), 7.18 (d, J = 9.3 Hz, 1H), 5.54 (d, J = 10.1 Hz, 1H), 4.75 (d, J = 9.1 Hz, 1H), 4.61 (dd, J = 7.0, 14.9 Hz, 1H), 4.54 (d, J = 9.2 Hz, 1H), 4.49-4.33 (m, 3H), 4.30 (dd, J = 5.3, 15.0 Hz, 1H), 4.24 (d, J = 10.9 Hz, 1H), 4.01 (d, J = 15.8 Hz, 1H), 3.99-3.91 (m, 3H), 3.81 (d, J = 11.1 Hz, 1H), 3.79-3.75 (m, 2H), 3.70-3.62 (m, 8H), 2.65 (s, 3H), 2.51 (s, 3H), 2.41 (s, 3H), 2.34 (d, J = 14.3 Hz, 1H), 2.21-2.13 (m, 2H), 1.72-1.64 (m, 4H), 1.02 (t, J = 7.5, 3H), 0.95 ppm (s, 9H); 13 C NMR (126 MHz, CDCl 3 ): δ = 174.9, 172.9, 171.7, 169.9, 163.2, 154.5, 150.5, 149.9, 148.6, 137.6, 136.8, 136.5, 132.1, 131.6, 131.2, 131.0, 130.9, 130.5, 130.0, 129.7, 128.8, 128.3, 71.3, 71.2, 70.84, 70.81, 70.5, 69.3, 63.8, 60.0, 59.3, 58.7, 56.5, 49.8, 43.6, 35.30, 35.26, 26.4, 23.3, 16.2, 14.6, 13.3, 12.0, 11.7; HRMS m / z C 51 H 64 ClN 8 O 9 S 2 [M+H] +Calculated value: 1031.3921, Measured value: 1031.3987.

[0104] Biology. Cell culture. HEK293 human embryonic kidney adherent cell line (ATCC, Manassas, VA, USA) was cultured at 37°C and 5% CO in DMEM (Invitrogen, Carlsebad, CA, USA) supplemented with 10% (v / v) fetal bovine serum (FBS) (Thermo Fisher, Waltham, MA, USA) and 1% (v / v) penicillin / streptomycin (pen / strep) (#15140122, Thermo Fisher, Waltham, MA, USA). 2 22RV1, a human prostate carcinoma epithelial adherent cell line (ATCC, Manassas, VA, USA), was cultured at 37°C, 5% CO in RPMI-1640 (Invitrogen, Carlsebad, CA, USA) supplemented with 10% (v / v) fetal bovine serum (FBS) (Thermo Fisher, Waltham, MA, USA) and 1% (v / v) penicillin / streptomycin (pen / strep) (#15140122, Thermo Fisher, Waltham, MA, USA). 2 MV-4-11 human acute monocytic leukemia suspension cell line (ATCC, Manassas, VA, USA) was cultured at 37°C, 5% CO in IMDM (Invitrogen, Arlesbad, CA, USA) supplemented with 10% (v / v) fetal bovine serum (FBS) (Thermo Fisher, Waltham, MA, USA) and 1% (v / v) penicillin / streptomycin (pen / strep) (#15140122, Thermo Fisher, Waltham, MA, USA). 2 , and 95% humidity.

[0105] Generation of CRISPR Bromotag-Brd2 knock-in cell lines. HEK293 cells were cultured at 37°C and 5% CO in DMEM (Invitrogen, Carlsebad, CA, USA) supplemented with 10% (v / v) fetal bovine serum (FBS) (Thermo Fisher, Waltham, MA, USA) and 1% (v / v) penicillin / streptomycin (pen / strep) (#15140122, Thermo Fisher, Waltham, MA, USA). 2 and 95% humidity. 5 HEK293 cells were plated in 1mL of DMEM (Invitrogen, Carlsebad, CA, USA) in individual wells of a 6-well plate 24 hours prior to the start of the experiment. The following day, transfected HEK293 cells in the presence of cells were transfected using Fugene HD Lipofectamine (Madison, Wisconsin, USA) simultaneously with three custom vectors, including a px335 custom vector containing a U6-snRNA & Cas9D10A expression cassette, a pBABED vector carrying another U6-sgRNA and puromycin expression cassette, and finally a pcDNA5 vector containing an eGFP-P2A-bromotag-Brd2 donor knock-in sequence. To increase the relative population of cells undergoing homologous recombination, this transfection was performed in the presence of 0.1μM of the DNA ligase IV inhibitor SCR7. The following day, cells were washed and then fresh DMEM medium containing 0.1μM SCR7 and 2μg / ml of puromycin was applied. This was repeated the next day, with the cells washed and then fresh DMEM medium containing 0.1 μM SCR7 and 2 μg / mL puromycin applied. The next day, the cells were washed a third time and harvested by applying fresh medium without both SCR7 and puromycin. The next day, the HEK293 cells were then subsequently washed and the next day fresh DMEM containing 2.5 μg / mL puromycin and 0.1 μM SCR7 was again applied. This process was continued for another 2 days. The cells were then washed with PBS and then harvested in DMEM for another 20 days. The cells were then prepared for FACS sorting.

[0106] Fluorescence-activated cell sorting of GFP-positive CRISPR knock-in BromoTag-Brd2 HEK293 cells. HEK293 cells that were subjected to CRISPR lipofection and selection in the previous step were then trypsinized using tTrypsin-EDTA (0.05%), phenol red (Thermo Fisher, Waltham, MA, USA). Once in suspension, the trypsin-cell mixture was neutralized with FBS (Thermo Fisher, Waltham, MA, USA). Cells were pelleted at 1500 rpm for 5 min. The resulting cell pellet was then diluted at 5 × 10 cells per mL in DMEM medium supplemented with 1% FBS. 6 Cells were resuspended at a concentration of 100x1000 cells. Wild-type HEK293 cells were used as a baseline control for GFP expression. Single cell clones were generated by fluorescence activated cell sorting (FACS) using a Sony Biotechnology SH800 cell sorter at the University of Dundee Flow Cytometry and Cell Sorting Facility. A 488 nm laser was used to excite fluorescence and generate light scatter. Forward angle light scatter (FSC) and backscatter (BSC) were detected using a 488 ± 17 nm bandpass filter. Cells were differentiated from debris based on FSC-Area (A) and SSC-A measurements. Single cells were differentiated from doublets and clumps based on FSC-A and FSC-Width (W) measurements. GFP fluorescence was detected using a 525 ± 50 nm bandpass filter and autofluorescence was detected using a 600 ± 60 nm bandpass filter. GFP positive cells were identified by first assessing background GFP and autofluorescence of a control sample of cells not expressing GFP. The GFP and autofluorescence measurements of this sample were used to set a collection gate that identified GFP-positive cells. The sample to be sorted was then analyzed and the GFP-positive cells were sorted and collected.

[0107] Single GFP+ve cells were sorted into each well of three 96-well plates (Thermo Fisher, Waltham, MA, USA), which contained 50% filtered pre-conditioned medium from healthy cells and 200 μL of 50% fresh DMEM with 10% FBS and 1% (v / v) penicillin / streptomycin (pen / strep) (#15140122, Thermo Fisher, Waltham, MA, USA) at 37 °C, 5% CO 2 The cultures were then stored at 4°C for 2 weeks at 95% humidity and 95% CO. After 2 weeks, all colonies observed were expanded and then frozen.

[0108] Genomic DNA extraction. Brd2 expression in the expanded cell lines was analyzed by Western blot, after which suspected cell lines were harvested for genomic extraction. Cells were cultured at 2 × 10 6 The clones were plated at a cell density of 1000 x 1000. After 48 hours, the cells were trypsinized using trypsin-EDTA (0.05%), phenol red (Thermo Fisher, Waltham, MA, USA). Once in suspension, the trypsin-cell mixture was neutralized with FBS (Thermo Fisher, Waltham, MA, USA). The cells were pelleted at 1500 rpm for 5 min. The remaining pellets from each clone were subjected to genomic extraction following a solution-based extraction approach using PROMEGA's Wizard® Genomic DNA Purification Kit according to the provided instructions. The extracted DNA was then analyzed using a Nanodrop spectrophotometer and stored at -20°C before use.

[0109] Junction PCR. Junction PCR was performed using the following primers: forward, AGTCTGTCCACCCCCTCTAC and reverse, ACTCCACTCCACCGTCAAAC. The extracted genomic DNA from the previous step was used as template for the subsequent PCR reaction. Thirty cycles of PCR were performed using Phusion high fidelity polymerase and 250 ng of template DNA of either clones or HEK293 wild type genomic DNA, with a melting temperature of 98°C, an annealing temperature of 60°C, and an extension step of 2 min at 72°C. These PCR products were then run consecutively for 30 min at 100 volts on a 2% agarose gel containing 1× Sybersafe DNA stain (Invitrogen, Carlsebad, CA, USA) in 1× DNA loading stain (Thermo Fisher, Waltham, MA, USA) and 1× Generuler 1Kb plus DNA marker (Thermo Fisher, Waltham, MA, USA). The run gels were imaged using a Bio-Rad Gel Doc system (Bio-Rad, Hercules, California).

[0110] Genotyping. Using an agarose gel containing the junction PCR products, bands of appropriate size were picked from the agarose gel using a UV imager and a scalpel. The selected bands corresponded to the HEK293 wild-type Brd2 junction product of 1 kb, the bromotag-Brd2 clone wild-type Brd2 junction product of 1 kb, and the bromotag-Brd2 clone knock-in junction product of 2 kb. The excised bands were then removed from the agarose using a Monarch® DNA Gel Extraction Kit (NEB, Ipswich, Massachusetts). After extraction, the PCR products were ligated into blunt-end vectors using a Strataclone Blunt PCR Cloning Kit (Agilent, Santa Clara, California), then transfected into Cre recombinase-expressing E. coli (Agilent, Santa Clara, California) and plated on kanamycin 50 μg / mL agar plates. The day after plating, visible colonies were picked and grown for 16 hours in 5 ml of LB standard formulation with 50 ug / mL kanamycin. Overnight bacterial growth was then subjected to plasmid miniprep extraction using Monarch® Plasmid Miniprep Kit (NEB, Ipswich, Massachusetts). The vector products recovered after extraction were then analyzed using a Nanodrop spectrophotometer. These products were sequenced using commercially available M13-forward, M13-reverse, and eGFP-C1-forward primers using an Applied Biosystems 3730 DNA analyzer. Sequencing was performed at University of Dundee DNA sequencing and services. Raw data from sequencing was then analyzed using Jalview software.

[0111] Dose-response degradation assays. All dose-response degradation assays were performed in genotype-validated heterozygous BromoTag-Brd2 HEK293 cell lines. Heterozygous BromoTag-Brd2 HEK293 cells were plated at 5x10 per well in six healthy plates the day before the start of the titration experiments. 5 Cells were plated at a density of 10 mM. PROTAC compounds were dissolved in DMSO at a concentration of 10 mM, and from these stock concentrations, PROTAC compounds were diluted using DMSO to the appropriate concentrations ranging from 10 μM to 1 nM. Compounds were then added to 2 mL of DMEM (Invitrogen, Carlsebad, CA, USA) supplemented with 10% (v / v) fetal bovine serum (FBS) (Thermo Fisher, Waltham, MA, USA) and 1% (v / v) penicillin / streptomycin (pen / strep) (#15140122, Thermo Fisher, Waltham, MA, USA) and added to cells at the start of the experiment. Control compounds, e.g., MZ1, cis-MZ1, were similarly dissolved in DMSO to the appropriate concentrations. All titration experiments were performed for a total of 6 hours before harvest, and once treatments were applied, they were incubated at 37 °C and 5% CO until just before harvest. 2 The cells were then washed twice with PBS and then harvested.

[0112] Time course resolution assay. Time course resolution assays using PROTACs AGB1, AGB2, and AGB3 were performed in genotype-validated heterozygous BromoTag-Brd2 HEK293 cell lines. Heterozygous BromoTag-Brd2 HEK293 cells were seeded at 5x10 per well of six healthy plates the day before the start of the time course assay. 5 Cells were plated at a density of 100 mM. PROTACs AGB1 and AGB2 were diluted in DMSO to a concentration of 1 mM and then further diluted 1:2000 in 2 mL of DMEM to a concentration of 500 nM per time point. PROTAC AGB3 was diluted in DMSO to a concentration of 2 mM and then further diluted 1:2000 in 2 mL of DMEM to a concentration of 1 μM per time point. Time points ranged from 0 to 36 hours. Treatments were applied in a staggered manner to allow all time points to be collected simultaneously.

[0113] Recovery assay. Recovery assays were performed with 200 nM AGB1 for 72 hours. This was performed in a genotype-validated heterozygous BromoTag-Brd2 HEK293 cell line. Heterozygous BromoTag-Brd2 HEK293 cells were cultured at 5 × 10 per well of a 6-well plate the day before the start of the recovery assay. 5 Cells were plated at a density of 100 mM. On the day of the experiment, cells were washed with PBS and then fresh DMEM containing either DMSO or 200 nM AGB1 was added. During the treatment, cells were incubated at 37°C, 5% CO 2 The cells were maintained at 4°C, 95% humidity, and 95% CO. After 3 hours, cells in the harvest and vehicle control conditions were re-washed with PBS before application of 200 nM AGB1 or fresh DMEM without DMSO. For the positive control conditions, they were left with 200 nM AGB1 for the remainder of the treatment time. Polyclonal Brd4 BD2 L387A Obtaining antibodies: Polyclonal Brd4 BD2 L387A To generate antibodies, sheep were purified as previously described (Gadd, MS et al., Nat. Chem. Biol. 2017, 13 (5), 514-521;Baud, MGJ et al., Science 2014, 346 (6209), 638-641). His-Brd4 BD2 L387A Immunization was performed with 0.35 mg of domain protein, prepared in a buffer containing 20 mM HEPES pH 7.5, 0.5 M NaCl, 1 mM DTT. Four further injections were then performed at 28 day intervals. Bleeding was performed 7 days after each injection. Antibodies were affinity purified from serum, eluted with 50 mM glycine pH 2.5, neutralized with 1 M Tris pH 8, and purified using His-Brd4 BD2 L387A The protein was dialyzed into PBS buffer.

[0114] Competition assay. Heterozygous BromoTag-Brd2 HEK293 cells were plated at 5 × 10 per well in 2 mL DMEM medium. 5Cells were plated in 6-well plates at a density of 1000 x g / ml. At the start of the experiment, cells were treated with either 3 μM MLN4924, 50 μM MG132, 10 μM VH298, 10 μM ET-JQ1-OMe, or 0.1% DMSO. After 1 h, 200 nM AGB1 was added to the compound-pretreated cells. After 3 h, cells were harvested for further processing by Western blot. Each treatment was performed in parallel with two technical replicates per condition. The 6-well plates were incubated at 37°C and 5% CO throughout the experiment. 2 The mixture was incubated at RT for 4 hours.

[0115] Western blotting. All cells were harvested on ice using RIPA lysis and extraction buffer (ThermoFisher Scientific, 89901) supplemented with protease inhibitor cocktail (Merck, 11697498001) and Benzonase® nuclease (Sigma, E1014), then stored at -20°C before use. Total protein was determined using a BCA protein assay (#23225, Pierce, Rockford, Illinois). Protein concentration was determined using a BCA assay (ThermoFisher Scientific, 23225). Samples were then prepared and loaded onto NuPAGE™ 4-12% Bis-Tris Midi gels (ThermoFisher Scientific, WG1403A), followed by protein transfer onto nitrocellulose membranes (EMD Millipore). Membranes were blocked for 1 hour before incubation with primary antibodies using 5% Milk TBST. Membranes were stained with either Brd2 (Abcam, Ab139690, 1:1000), Brd3 (Abcam, Ab50818, 1:4000), Brd4 (Abcam, Ab128874, 1:1000) or our polyclonal Brd4 BD2 L387AAfter overnight incubation at 4°C with primary antibodies, membranes were incubated with secondary antibodies (anti-rabbit, Abcam AB216773, 1:5000 or anti-mouse, Abcam AB216774, 1:5000) and hFABTM rhodamine anti-tubulin antibody (Biorad, 12004165, 1:10000) for 1 hour and then imaged on a Bio-Rad imager (LI-COR Biosciences). All Western blots were analyzed for band intensity using Image Lab from Bio-Rad (LI-COR, Biosciences). Data extracted from these blots were then plotted and analyzed using Prism (v.8.2.0, GraphPad).

[0116] Cell viability assay. MV-4-11 cells were plated at 2 × 10 per well in a 96-well white-bottom plate. 4 The cells were plated at a cell density of 100 x 100 and incubated at 37 °C in 5% CO in 50 μL of IMDM (Invitrogen, Arlesebad, CA, USA) supplemented with 10% (v / v) fetal bovine serum (FBS) (Thermo Fisher, Waltham, MA, USA) and 1% (v / v) penicillin / streptomycin (pen / strep) (#15140122, Thermo Fisher, Waltham, MA, USA). 2 The cells were then incubated overnight at 37° C., 5% CO, and 95% humidity for 10 min. The cells were then treated with 50 μL of IMDM supplemented with two compound treatments including DMSO, AGB1, cis-AGB1, MZ1, cis-MZ1, or staurosporine. The cells were then incubated at 37° C., 5% CO 2 The cells were incubated at 4°C for 1 day at 95% humidity and then spectrophotometrically analyzed. 22RV1 cells were cultured at 2 × 10 per well in a 96-well white-bottom plate. 4The cells were plated at a cell density of 100 μL in RPMI-1640 (Invitrogen, Carlsebad, CA, USA) supplemented with 10% (v / v) fetal bovine serum (FBS) (Thermo Fisher, Waltham, MA, USA) and 1% (v / v) penicillin / streptomycin (pen / strep) (#15140122, Thermo Fisher, Waltham, MA, USA) at 37°C and 5% CO 2 The cells were then left undisturbed overnight with growth at 37° C., 5% CO, and 95% humidity. The cells were then washed twice with PBS before being treated with 100 μL of fresh RPMI-1640 medium supplemented with one compound treatment containing DMSO, AGB1, cis-AGB1, MZ1, cis-MZ1, or staurosporine. The cells were then incubated at 37° C., 5% CO, and 95% humidity for 1 h. 2 HEK293 wild-type cells were grown at 2 × 10 per well in a 96-well white-bottom plate. 4 and incubated at 37°C in 5% CO in 100 μL of DMEM (Invitrogen, Carlsebad, CA, USA) supplemented with 10% (v / v) fetal bovine serum (FBS) (Thermo Fisher, Waltham, MA, USA) and 1% (v / v) penicillin / streptomycin (pen / strep) (#15140122, Thermo Fisher, Waltham, MA, USA). 2 The cells were then left undisturbed overnight with growth at 37° C., 5% CO, and 95% humidity. The cells were then washed twice with PBS before being treated with 100 μL of fresh DMEM supplemented with one compound treatment containing DMSO, AGB1, cis-AGB1, MZ1, cis-MZ1, or staurosporine. The cells were then incubated at 37° C., 5% CO, and 95% humidity for 1 h. 2The cells were incubated at 4°C for 2 days at 4°C and 95% humidity before spectrophotometric analysis. All cell lines were treated with compounds at 1x concentration in 0.1% DMSO in duplicate (and triplicate for DMSO control). Compounds were serially diluted to perform a 7-point, 10-fold titration. Cells were treated with 50:100 μL of compound to a final concentration of 10 μM:10 pM in 0.1% DMSO. At the time of spectrophotometric analysis, cells were treated with 100 μL of Promega CellTiter-Glo® 2.0 Cell Viability Assay Reagent. Plates were placed on an orbital shaker for 2 minutes to promote lysis and left undisturbed for an additional 5 minutes to achieve peak luminescence. Luminescence was then recorded on a BMG Labtech PHERAstar luminescence plate reader at the recommended settings. Data extracted from this analysis was analyzed with Graphpad Prism (v.8.2.0, GraphPad) and normalized to the DMSO vehicle control. EC 50 Values ​​were derived from these plots.

[0117] Sample processing, TMT labeling and fractionation. CRISPR-modified BromoTag-Brd2 HEK293 cells were plated at 5 × 10 on 100 cm plates 24 h prior to treatment. 6Cells were seeded on 100 mM TEAB, 1 μM AGB1 or 1 μM cis-AGB1. After 2 h of treatment, cells were washed twice with PBS. Cells were lysed in 150 μL of 100 mM TEAB, 5% (w / v) SDS. Lysates were sonicated for 10 s and then centrifuged at 15,000 g for 5 min, and the supernatant was collected after centrifugation. Samples were then quantified using a Micro-BCA Protein Assay Kit (Thermo Fisher Scientific); 300 μg of each sample was then reduced, alkylated, and then digested using the Strap mini protocol (Protifi) protocol as described by the manufacturer (protifi) with some modifications. Samples were double digested in 50 mM TEAB buffer, first with trypsin (1:40) overnight and then with the same ratio (1:40) for an additional 6 h. Peptides were quantified using a quantitative fluorescent peptide assay (Thermo Fisher Scientific). Samples (90 μg each) were labeled with TMT10-plex Isobaric Label Reagent Set (Thermo Fisher Scientific) according to the manufacturer's instructions. After labeling, samples were checked for labeling efficiency, then mixed, desalted, and dried in a speed vacuum at 30 °C. Samples were redissolved in 200 μL of ammonium formate (10 mM, pH 9.5) and peptides were fractionated using high pH RP chromatography. A Waters C18 column (XBridge peptide BEH, 130 Å, 3.5 μm 2.1 × 150 mm, Waters, Ireland) and a guard column (XBridge, C18, 3.5 μm, 2.1 × 10 mm, Waters) were used on an Ultimate 3000 HPLC (Thermo-Scientific). Buffers A and B used for fractionation consisted of (A) 10 mM ammonium formate in milliQ water pH 9.5 and (B) 10 mM ammonium formate in 90% acetonitrile, pH 9.5, respectively. Fractions were collected at 1 min intervals using a WPS-3000FC autosampler (Thermo-Scientific). The column and guard column were equilibrated with 2% buffer B for 20 min at a constant flow rate of 0.2 ml / min.100 μL of TMT-labeled peptide was injected into the column and the separation gradient was started 1 min after loading the sample onto the column. The peptide was eluted from the column with a gradient from 2% buffer B to 20% buffer B in 6 min, then 20% buffer B to 45% buffer B in 51 min, and finally 45% buffer B to 100% buffer B within 1 min. The column was washed with 100% buffer B for 15 min. Fraction collection started 1 min after injection and stopped after 80 min (a total of 80 fractions, 200 μL each). To acidify the eluted peptides, 30 μL of 10% formic acid was added to each of the 80 fraction vials. The total number of fractions combined was set to 20.

[0118] LC-MS Analysis. Peptide analysis was performed on a Q-exactive-HF (Thermo Scientific) mass spectrometer coupled to a Dionex Ultimate 3000RS (Thermo Scientific). The LC buffers were as follows: Buffer A (0.1% formic acid (v / v) in Milli-Q water) and Buffer B (80% acetonitrile and 0.1% formic acid (v / v) in Milli-Q water). A 7 μL aliquot of each sample was loaded at 10 μL / min onto a capture column (100 μm×2 cm, PepMap nanoViper C18 column, 5 μm, 100 Å, Thermo Scientific) equilibrated with 0.1% TFA. The capture column was washed with 0.1% TFA for 3 min at the same flow rate and then transferred to a Thermo Scientific, split C18 column (75 μm×50 cm, PepMap RSLC A C18 column, 2 μm, 100 Å) was switched in-line. Peptides were eluted from the column at a constant flow rate of 300 nl / min using a linear gradient of 5% buffer B (for fractions 1-10, 7% for fractions 11-20) to 35% buffer B, 125 min, then 35% buffer B to 98% buffer B, 2 min. The column was then washed with 98% buffer B for 20 min and re-equilibrated with 5% or 7% buffer B for 17 min. The column was kept at a constant temperature of 50 °C the entire time. The Q-exactive HF was operated in data-dependent positive ionization mode. The power supply voltage was set at 2.25 Kv and the capillary temperature was 250 °C. The scan cycle consisted of an MS1 ​​scan (m / z range 335-1600, maximum ion injection time 50 ms, resolution 120000 and automatic gain control (AGC) value 3 × 10 6 ), followed by 15 sequential dependent MS2 scans (resolution 60000) (AGC 1 × 10 5 , Maximum ion injection time 200 ms, Isolation window 0.7 m / z, Fixed initial mass 100 m / z, Spectral data type: centroid, Intensity threshold 5 × 10 4The HCD collision energy was set to 32% of the normalized collision energy. Mass accuracy was checked before the start of sample analysis.

[0119] Peptide and protein identification. Raw data files for all fractions were merged and searched against the Uniprot-human-canconical database by MaxQuant software v.1.6.0.16 to identify proteins and to quantify TMT reporter ions. The following MaxQuant parameters were used: enzyme used, trypsin / P; maximum number of failed cleavages equals 2; precursor mass tolerance equals 10 ppm; fragment mass tolerance equals 20 ppm; variable modifications, oxidation (M), acetyl (N-terminus), deamidation (NQ), Gln→pyroGlu (QN-terminus); fixed modifications, carbamidomethyl (C). Data were filtered by applying a 1% false discovery rate followed by excluding proteins with less than two unique peptides. Quantified proteins were filtered if the difference in absolute fold change between three DMSO replicates was ≥ 1.5.

[0120] Protein expression and purification. VCB was expressed and purified as previously described (Gadd, MS et al., Nat Chem Biol 2017, 13 (5), 514-521). Briefly, the VCB was modified with an N-terminal His 6 Tags VHL(54-213), elongin C(17-112) and elongin B(1-104) were co-expressed in E. coli and the complex was isolated using Ni-affinity chromatography with TEV protease to remove the His6 tag. The complex was further purified by ion exchange followed by gel filtration chromatography. Brd4-BD2 L387A was expressed and purified as previously described (Gadd, MS, 2017, supra; Baud, MGJ, 2014, supra). Briefly, N-terminal His 6 TagBrd4-BD2L387A (333–460) was expressed in E. coli and isolated by Ni-affinity chromatography using TEV protease to remove the His6 tag, followed by gel filtration chromatography.

[0121] Fluorescence polarization binding assay. Fluorescence polarization (FP) competitive binding assays were performed as previously described (Van Molle et al., Chem. Biol. 2012, 19 (10), 1300-1312; Roy, MJ et al. ACS Chem Biol. 2019, 14 (3), 361-368), and all measurements were performed using a PHERAstar FS (BMG LABTECH) with fluorescence excitation and emission wavelengths (λ) of 485 and 520 nm, respectively. The assay was performed in triplicate using 384-well plates (Corning 3820), with each well solution containing 15 nM VCB protein, 10 nM 5,6-carboxyfluorescein (FAM)-labeled HIF-1α peptide (FAM-DEALAHypYIPMDDDFQLRSF, "JC9"), and decreasing concentrations of PROTAC (14 points, 2-fold serial dilutions, starting with 20 μM PROTAC) or PROTAC:bromodomain (14 points, 2-fold serial dilutions, starting with 20 μM PROTAC: 50 μM bromodomain into buffer containing 10 μM bromodomain). All components were dissolved from stock solutions using 100 mM Bis-Trispropane, 100 mM NaCl, 1 mM DTT, pH 7.0 to give a final assay volume of 15 μL. DMSO was added as necessary to ensure a final concentration of 2% v / v. Control wells containing VCB and JC9 without compound (zero displacement), or JC9 in the absence of protein (maximum displacement) were also included to allow for normalization. Percentage displacement values ​​were obtained by normalizing to the controls and plotted against Log[compound]. IC 50 Values ​​were determined for each titration using nonlinear regression analysis with Prism (v.9.1.0, GraphPad). i The value was calculated as K, as previously described. d The IC was calculated by back-calculation from forJC9 (approximately 1.5-2.5 nM, determined from direct binding).50 The cooperativity values ​​(α) for each PROTAC were calculated as the ratio: α = binary K d (-bromodomain) / ternary K d (+bromodomain) was used for the calculation.

[0122] Plasma stability. Plasma stability studies were outsourced to Shanghai ChemPartner Co., Ltd. Preparation of buffer solution: 0.05 M sodium phosphate and 0.07 M NaCl buffer, pH 7.4, was prepared by adding 14.505 g / L NaCl in deionized water. 2 HPO 4 .12H 2 O, 1.483 g / L NaH 2 PO 4 .2H 20 and 4.095 g / L NaCl, and pH was adjusted with phosphoric acid. Preparation of plasma: Frozen mouse plasma was placed at 37 °C for rapid thawing. Thawed plasma was centrifuged at 3,000 rpm for 8 min to remove clots, and the supernatant was pooled and used as plasma in the experiment. Plasma (pH 7.4-8.0) was stored on ice until use. AGB1 (46) and the reference compound procaine were prepared as spike solutions (0.02 mM compound in 0.05 mM sodium phosphate buffer containing 0.5% BSA (bovine serum albumin), 4% v / v / DMSO). Plasma and spike solutions were pre-warmed at 37 °C for 5 min, and then 10 μL of pre-warmed spike solution B was added to the designated wells for all time points (5, 15, 30, 45, 60 min). For 0 min, 400 μL of acetonitrile containing internal standards (imipramine, glipizide) was added to the wells of the 0 min plate, followed by the addition of 90 μL of plasma. For time points (0, 5, 15, 30, 45, 60 min), 90 μL of pre-warmed plasma was added to start the measurement. At 5, 15, 30, 45, 60 min, 400 μL of acetonitrile containing internal standards (imipramine, glipizide) was added to the corresponding wells of the plate, respectively, to stop the reaction. After quenching, the plate was shaken for 10 min (600 rpm / min) on a vibrator (IKA, MTS2 / 4) and then centrifuged at 5594 g for 15 min (Thermo Multifuge×3R). 50 μL of the supernatant from each well of the centrifuged plate was transferred to a new 96-well sample plate containing 50 μL of ultrapure water (Millipore, ZMQS50F01) for LC / MS analysis (LC-MS / MS-49 (API6500+), UPLC-MSMS-32 (Triple Quad 6500+)). Data were analyzed in Microsoft Excel.

[0123] In vivo PK profiling. Pharmacokinetic profiling was outsourced and undertaken by Shanghai ChemPartner Co., Ltd., and 6-8 week old C57BL / 6 male mice purchased from Jihui Laboratory Animal Co.LTD were used in the study. AGB1 (46) was formulated at 1 mg / mL in 5% DMSO + 5% Solutol HS15 + 90% saline. For IV injection, 5 mg / kg of AGB1 (46) was administered into the tail vein of nine mice. For SC injection, 5 mg / kg of AGB1 (46) was administered by subcutaneous injection to nine mice. Animals were manually restrained at the designated time points (0.083, 0.25, 0.5, 1, 2, 4, and 8 hours) and approximately 110 μL of blood samples were collected via the facial vein for K administration. 2 Blood was collected in EDTA tubes. Three mice were used per time point, resulting in a total of 18 mice. Blood samples were placed on ice and centrifuged at 2000 g for 5 min to obtain plasma samples within 15 min. Plasma samples were stored at approximately 70° C. until analysis. To a 30 μL aliquot of plasma, 200 μL of internal standard (diclofenac, 40 ng / mL) in 1% formic acid in MeCN was added. The mixture was then vortexed for 1 min and then centrifuged at 5800 rpm for 10 min. 100 μL of supernatant was transferred to a new plate. 0.5 μL of solvent was injected into the LC-MS / MS. The LC-MS / MS instrument used was a SCIEX LC-MS / MS-45 (Triple Quad 6500+). Data was analyzed by WinNonLin and Microsoft Excel.

[0124] Results and Discussion Bromotag background and design rationale. To design the bromotag, we hypothesized that we could leverage a potent and selective BET bromodomain that recruits the PROTAC MZ1 (1, FIG. 1A) and its target BET bromodomain as a degron tag (Zengerle, M, 2015, see above). Our extensive mechanistic and structural characterization of MZ1 mode of action revealed that MZ1, with its E3 ligase VHL bound, is composed of the pan-selective BET bromodomain ligand (+)-JQ1 (3, FIG. 1B), yet is not specifically targeted by the second bromodomain of Brd4 (Brd4 BD2 ) form the most stable, cooperative, and long-lived ternary complex. This preferential recruitment leads to productive ubiquitination and preferential degradation of endogenous Brd4 (Gadd, MS, 2017 (see above); Roy, MJ, 2019 (see above)). These findings suggest that Brd4 BD2 Although these results suggest that MZ1 could provide an attractive degron tag for ligand-induced degron technology, the use of MZ1 would induce confounding downstream effects from the potent induced degradation of all endogenous BET proteins.

[0125] To circumvent this limitation, we took advantage of our previously described engineered variants of the BET bromodomain in which a cavity (or "hole") was created in the BET bromodomain to allow allele-selective binding by bulkier synthetic BET ligands with "bumps" (Baud, MGJ, 2014, see above). Our previous extensive work developing such a "bump-and-hole" approach identified a Leu residue in the ligand-binding site that is strictly conserved across all BET family members. Using site-directed mutagenesis, this Leu was mutated to a smaller Ala or Val to generate a hole that maintains domain stability and ligand-binding capacity. Concurrently, the pan-selective BET inhibitor I-BET762 (4, Figure 1B) was modified by introducing methyl or ethyl "bumps" to obtain ME and ET (5 and 6, respectively, Figure 1B), and subsequently 9-ME-1 and 9-ET-1 (7 and 8, respectively, Figure 1B), which differ in that the methoxy is shifted from the 8' to the 9' position of the fused phenyl ring in the I-BET762 scaffold (Runcie, AC, 2018 (see above); Baud, MGJ, 2014 (see above)). The steric "bump" was accommodated in the newly formed hole and simultaneously crashed with the wild-type protein, allowing exquisite allelic selectivity to be engineered within the BET bromodomain (Runcie, AC, 2018 (see above); Baud, MGJ, 2014 (see above)). Thus, we show that using such bumped BET ligands within the context of MZ1 PROTAC degraders inhibits the expression of mutant Brd4 BD2 We determined that this would allow for the selective degradation of target proteins fused to the domains without deleterious degradation of endogenous wild-type BET proteins, and thus such custom-made "bump-and-hole"-PROTACs (B&H-PROTACs) provide a complementary and generalizable system to the PROTAC-triggered degron tag technology.

[0126] Development of knock-in cell lines with bromotags fused to endogenous Brd2 using CRISPR. To establish the bromotag platform and support degrader structure-activity relationships (SAR) to identify the best compounds, we sought a practical and simple system that would allow us to best triage not only the degrader efficiency but also the selectivity profile of our degraders. To this end, the endogenous BET family protein Brd2 was selected as a model target due to the availability of well-established antibodies for Brd2 detection and the expression of a single protein isoform as a well-detected band in Western blots (Filippakopoulos, P.; Knapp, S., Nat Rev Drug Discov. 2014, 13 (5), 337-356). Since Brd2 contains an endogenous bromodomain and is degraded by one and other BET PROTACs, we reasoned that a heterozygous knock-in cell line would allow for the simultaneous monitoring of both on-target (bromo-tagged-Brd2) and off-target (untagged) degradation using the same antibody. Thus, along with potential off-target degradation of the other BET proteins Brd3 and Brd4, this system would allow for best monitoring of proteolytic selectivity. We therefore decided to use CRISPR knock-in methodology to add a bromotag to the N-terminus of the endogenous Brd2 gene locus, thus allowing the addition of the three bromodomains (endogenous Brd2) to the N-terminus of the Brd2 gene locus. BD1 and Brd2 BD2 In this study, we obtained a chimeric protein with an exogenous bromo-tag in addition to the tagged Brd2. Hereafter, we refer to the degradation of bromo-tag-Brd2 as the on-target activity, and the degradation of both untagged Brd2 and endogenous Brd3 and Brd4 as the off-target activity.

[0127] The bromotag itself was designed based on our previous work to develop a bump and hole (B&H) strategy for BET family proteins (Baud, MGJ, 2014, see above). To maximize the chances of generating a good, complementary degron for our MZ1-based B&H-PROTAC, we used Brd4 as the degron "bromotag" construct. BD2 L387A We chose to use the specific bromodomain Brd4 (approximately 15 kDa in size, containing residues 368–440 of human Brd4) because it forms the strongest and most cooperative ternary complex with 1 and VCB (VHL:elongin C:elongin B), promoting productive ubiquitination of endogenous Brd4 by MZ1 and rapid and robust degradation. BD2 was selected (Gadd, MS, 2017 (see above)). In addition, Brd4 BD2 The specific L387A mutation in was chosen instead of L387V because it exhibits much lower binding affinity for acetylated histone tail partners compared to the wild-type or LV domains (Runcie, AC, 2018 (see above)), suggesting that it would be less likely to introduce undesired new functionality or protein-protein interactions when used as a tag.

[0128] At the outset of the project, we chose HEK293 cells for our CRISPR knock-in experiments to establish a model bromo-tagged cell line due to the ease of transfection, good levels of CRISPR efficiency (Tovell, H. et al., ACS Chem Biol. 2019, 14 (5), 882-892), and high levels of expression of all three BET proteins. HEK293 cells were co-transfected with three plasmid constructs, two of which were cas9 D10A Both plasmids carried an N-terminal Brd2-specific gRNA. The other plasmid carried Brd4 BD2 L387AThe knock-in sequence of the bromotag was retained. The complete knock-in construct contained the eGFP fluorescent marker, the P2A splice sequence, and then the Brd4 BD2 L387A The knock-in construct contained the sequence in a 5'-3' orientation (Figure 2A). After transfection, cells were subjected to fluorescence-activated cell sorting (FACS) to identify GFP-expressing single cells that showed good integration of the knock-in construct (Figure 2B). Cells were expanded from the GFP-expressing single cells, and optimal heterozygous knock-in clones were identified and selected. Junction PCR was then performed to demonstrate good heterozygous integration of the bromotag N-terminus into Brd2 (Figure 2C). Because HEK293 is a hypotriploid cell line, we suspect that the difference in band intensity present in the junction PCR between wild-type and knock-in is due to a single allele integration of our knock-in, potentially leaving two wild-type unmodified alleles (Figure 2C). This heterozygous clone was further verified by western blot using a Brd2 antibody and independent observation of bromotag-Brd2 expression using an antibody against the bromotag (Figure 2D). This antibody was used to detect recombinantly expressed Brd4BD2 in E. coli as antigen. L387A The heterozygous Bromotag-Brd2 HEK293 cell line was then genotyped and showed successful in-frame knock-in of eGFP-P2A-Bromotag knock-in at the N-terminus of Brd2. This cell line is referred to herein as Bromotag-Brd2 HEK293.

[0129] Development of the first generation I-BET762-based B&H-PROTAC. To combine both bump-and-hole and PROTAC technologies, we used MZ1 as a template and replaced its BET-targeting ligand with various bump-I-BET762 derivatives that we had previously developed, to begin generating an initial series of B&H-PROTACs (Runcie, AC, 2018 (see above); Baud, MGJ, 2014 (see above)). First, we used our Brd4BD2 We investigated the crystal structure of the ternary complex between 1 and VCB (Figure 3A) and Brd2 BD2 L383A and Brd2 BD2 L383V Co-crystal structures of the bump-I-BET chemical probes 6 (Figure 3B) and 7 (Figure 3C), respectively complexed with Brd4 BD2 The chemical structures of 1 and 6 (Figure 3B), and 1 and 7 (Figure 3C), incorporate very similar binding modes, with the carbon adjacent to the methyl ester in 6 and 7 bearing an ethyl or methyl bump, respectively, which aligns nicely with the non-bumped bromodomain binding moiety of 1. With these structural insights, we proceeded with the synthesis of the first generation I-BET-based B&H-PROTACs (Scheme 1).

[0130] We first reduced VH032-PEG3 azide 9 (Zengerle, M, 2015 (see above)) under hydrogen gas with a suspension of 10% palladium on carbon in methanol to give the terminal amine, which was then coupled with racemic I-BET762-derived acids 10–13 via standard amide coupling conditions using 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU), 1-hydroxy-7-azabenzotriazole (HOAt), and diisopropylethylamine (DIPEA) in dimethylformamide (DMF) or dichloromethane (DCM) to give the bumped-I-BET PROTACs, DAT487–489 (15–17), and the non-bumped control, MZP-15 (14), as a mixture of two diastereomers, respectively (Scheme 1).

[0131] Scheme 1. Synthesis of I-BET762-based B&H-PROTACs and non-bumped control compounds [ka] a Reaction conditions: (a) 10% Pd / C, H 2(b) 10, HATU, DIPEA, DCM, rt, 18 h; (c) bumped I-BET acid 11, 12 or 13, HATU, HOAt, DIPEA, DMF, rt, 18 h. * indicates the relative configuration at the indicated stereocenter of the molecule.

[0132] With this initial library underway, we began evaluating the activity and selectivity of our I-BET-based B&H-PROTACs by treating our heterozygous bromo-tagged-Brd2 HEK293 cells with 1 μM of compounds 15-17 or 1 μM of control compounds MZP-15 (14), MZ1 (1) and cis-MZ1 for 6 h, a time sufficient to achieve effective MZ1-induced BET protein degradation (Figure 4A). Cells were harvested and subsequent lysates were analyzed by Western blot using antibodies against the BET proteins; Brd2, Brd3 and Brd4 (Figure 4A). Unfortunately, the initial B&H-PROTAC compounds did not induce detectable degradation of bromo-tagged-Brd2.

[0133] In understanding the potential reasons for the inactivity of our initial series of compounds, we were intrigued to observe the apparent significantly lower activity of non-bumped 14 compared to 1 across all three BET family members (Figure 4A). Although its existence as a diastereomeric mixture may contribute to the apparent lower activity of 14 compared to enantiomerically pure 1, the chemical structures of the two compounds drew our attention. In another respect, compounds 1 and 14 are structurally identical except for the different BET bromodomain binding moieties: 1 (JQ1-based) has a dimethylthiophene group fused to the diazepine ring, while 14 (I-BET762-based) has an 8-OMe-phenyl group at the equivalent position (see Figure 1B and Scheme 1). Thus, the ternary crystal structure Brd4 BD2We embarked on our structural superposition between the binary structures of :1:VHL and the bumped BET ligand to investigate the structural regions around the different groups in more detail. This analysis indicated that the methoxy group of the fused phenyl ring present in the I-BET762-derived ligand would clash with His110 present in VHL (Figure 4B). The oxygen atom of 8-OMe in 6 would be about 3.0 Å away from the carbon atom between the two nitrogen atoms of the His110 side chain, which is below the lower limit for van der Waals interactions. We reasoned that such a structural clash would destabilize the MZ1-like PROTAC ternary complex and explain the low degradation activity of I-BET762-based compounds. This observation led us to decide to replace the 8-OMe-phenyl group in the BET binding moiety of the PROTAC with a dimethyl-thiophene group to minimize any potential perturbations in the desired ternary complex and develop compounds that resemble even more closely the overall chemical structure of MZ1 as a design strategy to enhance bromotag degradation activity.

[0134] Development of second generation JQ1-based B&H-PROTACs. To overcome the limitations exhibited by our I-BET762-based B&H-PROTACs, we next designed a series of eight novel JQ1-based compounds (Table 1). Around the time of project development, we learned of another BET-targeting PROTAC, ARV-771 (2, Figure 1A), which is structurally similar to 1 and also potently degrades BET proteins (Raina, K. et al., Proc Natl Acad Sci US A. 2016, 113 (26), 7124-7129). Chemically, 2 consists of the same panselective BET bromodomain ligand, (+)-JQ1 (3, Figure 1B), but with a shorter, more lipophilic linker (-CH) in the VHL ligand VH032, known to enhance VHL binding affinity (Hu, J. et al., J Med Chem. 2019, 62 (3), 1420-1442). 21 differs from 1 in that it lacks a methyl group (O-) and has an extra benzylic methyl group (Galdeano, C. et al., J Med Chem. 2014, 57 (20), 8657-8663). To maximize chemical diversity and therefore our chances of identifying potent bromotag degraders, we designed four bumped PROTAC compounds based on 1 and four based on 2 (Raina, K., 2016 (see above)). For the set of four, two compounds will contain either the more sterically conserved methyl bump or the more sterically demanding ethyl bump. Each methyl or ethyl bumped BET bromodomain ligand will then be conjugated to a linker via an amide bond or via an ester bond similar to the parent compound. Our reasoning for the choice of the less conventional ester conjugate was based on our previous observation that bumped BET ligands bearing an ester group in close proximity to the alkyl bump group were significantly more stable compared to their parent non-bumped analogues (Runcie, AC, 2018, see above).

[0135] [Table 1]

[0136] To synthesize our bump-JQ1 ligand, we adapted the route described by Filippakopoulos, P. et al. in Nature 2010, 468, 1067-73, utilizing the late-stage alkylation described by Baud, MGJ, 2014 (see above) and Runcie, AC, 2018 (see above) (Scheme 2). First, (±)-Fmoc-Asp(OMe)-OH (26) was treated with thionyl chloride in dichloromethane (DCM) and converted to the acid chloride, which was then refluxed with aminoketone 27 in chloroform to form the "ring-opened" amide Fmoc-protected intermediate. This "ring-opened" intermediate was then refluxed in triethylamine to remove the Fmoc protecting group, revealing the free amine, which was ring-closed in the presence of acetic acid to form thieno-1,4-diazepine 28. Deprotonation of amide 28 with potassium tert-butoxide in the presence of diethyl chlorophosphate, followed by treatment with acetylhydrazine, leads to the formation of the methyltriazole ring, affording the triazolothienodiazepine (±)-JQ1-OMe (29) as a racemic mixture.

[0137] To introduce either the methyl or ethyl bump, 29 was deprotonated with potassium hexamethyldisilazane (KHMDS) in tetrahydrofuran (THF) at −78° C. The ensuing enolate was then treated with either methyl or ethyl iodide to give the racemic bump-JQ1-OMe derivatives 30a and 30b or 31a and 31b, respectively, as diastereomeric mixtures that were easily separated after HPLC. Methylation proceeded with a diastereomeric ratio (dr) of 1:4 for the desired (2S*,3R*) isomer versus the undesired (2S*,3S*) isomer. Ethylation proceeded with a dr of 1:1.5. The undesired (2S*,3S*) isomers, 30b and 31b, can be epimerized to give a further 1:1 mixture of diastereomers by treatment with sodium methoxide in methanol under microwave irradiation, which gives more of the desired (2S*,3R*) isomers 30a and 31a after HPLC separation.

[0138] To enable further functionalization and linker conjugation, the methyl esters 30a and 30b were hydrolyzed under mild conditions using lithium hydroxide in THF and water to give the conjugable carboxylic acids 32 and 33 as racemic mixtures (Scheme 2).

[0139] Scheme 2. Synthesis of racemic BUMP-JQ1 ligand a [ka] a Reaction conditions: (a) i) SOCl 2 , DCM, reflux, 2 h; ii) 27, CHCl 3 , reflux, 1 h; iii) TEA, reflux, 16 h; iv) AcOH, 1,2-DCE, 80 °C, 1 h; (b) i) KO t Bu, THF, -78℃~-10℃, 30 minutes; ii)(EtO) 2 P(O)Cl, -78℃~-10℃, 45 min; iii) AcNHNH 2 , room temperature, 1 hour; iv) n-BuOH, 90°C, 1 hour; (c) i) KHMDS, THF, -78°C, 1 hour; ii) MeI / EtI, -78°C to room temperature, 16 hours, iii) HPLC separation; (d) i) NaOMe, MeOH, 120°C mw, 40 minutes; ii) HPLC separation; (e) LiOH, THF:H 2 O 4:1, 30a, room temperature, 48-72 hours, 30b, 45°C, 1 week. * indicates the relative configuration at the indicated stereocenter in the molecule.

[0140] Linkers 36 and 37 were then attached to VH032-amine 34, and linkers 38 and 39 to methylated VH032-amine 35 using standard amide coupling conditions with HATU and DIPEA in DMF to give amides 9, 40, 42, and 43 (Scheme 3). Silyl ethers 40 and 43 were cleaved using a solution of tetrabutylammonium fluoride (TBAF) in THF to give terminal alcohols 41 and 44, respectively, as suitable precursors for ester conjugates.

[0141] Scheme 3. Conjugation of the linker to the VHL ligand a [ka] a Reaction conditions: (a) HATU, DIPEA, DMF, room temperature, 2 h; (b) TBAF, THF, room temperature, 6 h.

[0142] Azides 9 and 42 were then reduced under hydrogen gas using a suspension of 10% palladium on carbon in methanol to give the terminal amines, which were then coupled to racemic Bump-JQ1 acids 32 and 33 using (1-cyano-2-ethoxy-2-oxoethylideneaminooxy)dimethylamino-morpholino-carbenium hexafluorophosphate (COMU) and DIPEA in THF to give the amides B&H-PROTACs 18–21 as diastereomeric mixtures (Scheme 4).

[0143] Finally, alcohols 41 and 44 were coupled with BAMP-JQ1 acids 32 and 33 using N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC.HCl) and 4-(dimethylamino)pyridine (DMAP) in THF to give the esters B&H-PROTACs 22-25 as a mixture of two diastereomers (Scheme 4). In the case of each amide and ester, the diastereomers formed could not be separated by HPLC and were carried forward as diastereomeric mixtures for preliminary in cellulo evaluation to screen for Bromotag-Brd2 degradation and selectivity against wild-type BET protein.

[0144] Scheme 4. Synthesis of JQ1-based B&H-PROTAC as a mixture of two diastereomers a [ka] a Reaction conditions: (a) 10% Pd / C, H 2, MeOH, rt, 3 hr; (b) bump JQ1-acid (32 or 33), COMU, DIPEA, THF, rt, 4 hr; (c) bump JQ1-acid (32 or 33), EDC.HCl, DMAP, THF, rt, 16 hr. *Indicates the relative configuration at the indicated stereocenters in the molecule. We next assessed the cellular activity of all eight B&H-PROTACs (18-25) in our heterozygous bromo-tagged-Brd2 knock-in HEK293 cell line at concentrations ranging from 1 nM to 10 μM (Figure 5). Strikingly, all compounds showed a pronounced effect on the degradation of bromo-tagged-Brd2 isoforms, achieving observable and often complete depletion of bromo-tagged-Brd2 protein. This allowed us to determine the on-target degradation potency (DC 50 ) and the effectiveness for constructing SAR (D max ) allowed quantitative analysis and quantification was achieved by detection with both independent antibodies, which compared very well in all cases (Table 2).

[0145] The best compounds were found to be 19, 23 and 25, all of which had ethyl bumps, which showed both potent and complete degradation of the bromotag-Brd2 isoform and were associated with DC 50 The values ​​are 250-360nM, 13-80nM, and 13-16nM. max The overall yield of the esters was >75%. Importantly, except for slight off-target degradation of Brd3 observed with 25 at 1 μM, no observable off-target degradation of untagged Brd2 or other endogenous BET proteins could be observed (Figure 5), suggesting that these compounds successfully enable highly selective bromotag degradation. Interestingly, when used at high concentrations of 1-10 μM (Figure 5), esters 23 and 25 showed a strong expression of the hook effect, a well-known phenomenon in bifunctional PROTAC degraders where a binary interaction between the PROTAC:target and PROTAC:E3 ligase negates productive ternary complex formation. In contrast, no hook effect was observed with amide 19. The last ethyl-bump compound 21 was the least complete (D max<70%) showed the weakest degradation activity (DC 50 Approximately 1 μM), but also showed a very narrow degradation range due to the strong hook effect at 10 μM.

[0146] All methyl-bumped compounds 18, 20, 22, and 24 also exhibited potent on-target degradation activity, on average 2-fold more potent than their ethyl-bumped counterparts, with DC values ​​between 100-160 nM, 320-400 nM, 20-80 nM, and 5-10 nM, respectively. 50 However, we observed that all methyl bump compounds also induced undesired off-target degradation and therefore showed low selectivity. These results suggest that the methyl group does not provide sufficient steric clash with the conserved Leu residue of wild-type BET protein to block off-target degradation, and is even more tolerated than the larger ethyl bump. Since selectivity against endogenous BET protein is a strictly required criterion for a good bromo tag system, we decided to discontinue development of all methyl bump compounds at this stage.

[0147] All esters (22–25) had higher DC than their respective amide counterparts (18–21). 50 It is interesting to note that the esters (22-25) were shown to be 2-fold and 126-fold more potent in the DCs at high concentrations compared to their amide counterparts (Table 2). Recently, we have shown that amide-to-ester substitution can provide a simple strategy to increase PROTAC degrading activity due to increased lipophilicity and cell permeability while maintaining remarkable intracellular stability (Klein, V. et al., 2021 (see above)). This trend is consistent with the results that all esters (22-25) exhibited cellular activity and were more potent at high concentrations compared to their amide counterparts. 50 and exhibited a pronounced hook effect and are therefore well reflected in this compound set.

[0148] [Table 2] Taken together, results from this screen identified three compounds, ET-MZ1 (19), ET-OMZ1 (23), and ET-OARV-771 (25), as the most selective bromotag-Brd2 degraders, fulfilling the criteria for potent on-target activity while largely avoiding off-target BET degradation, and we therefore advanced these three compounds into the pipeline.

[0149] Synthesis of ET-OMZ1, ET-OARV-771 and ET-MZ1 as single stereoisomers. We realized that our second generation B&H-PROTACs have shown promising results, but have all been synthesized as diastereomeric mixtures, meaning that they will contain not only active species, but also inactive or less active species, which would be expected to lead to apparently weaker activity and narrower selectivity therapeutic window of the compounds. To obtain a true degradation profile of the biologically active isomers (eutomers), we next attempted to synthesize our current best degraders as enantiomerically pure single diastereomers. To achieve enantiomerically pure PROTACs, we have developed a novel stereoselective synthesis for bumping BET ligands, which we have recently disclosed in Bond, AG, 2020 (see above). Briefly, our novel stereoselective route allowed us to incorporate alkyl bumps much earlier in the synthesis of BET-ligand scaffolds. To achieve this, we optimized the lithium hexamethyldisilazane (LHMDS)-mediated diastereoselective alkylation of doubly protected aspartate derivatives, leading to the final bump-JQ1-acid analogues with full retention of stereochemistry and >99% ee (Bond, AG, 2020, see above). Thus, at this stage in the project, we decided to use enantiomerically pure ET-JQ1-OH (45) to generate novel B&H-PROTACs, AGB1 (46), AGB2 (47), and AGB3 (48) (Scheme 5).

[0150] For esters 46 and 47, acid 45 was quantitatively converted to the acid chloride intermediate with thionyl chloride in DCM, which was then reacted with alcohols 41 and 44 to give the final compounds 46 and 47 as single stereoisomers. For amide 48, azide 9 was first reduced under hydrogen gas with a suspension of 10% palladium on carbon in methanol to give the intermediate amine, which was immediately coupled with 45 using COMU and DIPEA in DMF to give 48 as a single stereoisomer.

[0151] Scheme 5. Synthesis of enantiomerically pure AGB1, AGB2, and AGB3 a [ka] a Reaction conditions: (a) i) SOCl 2 , DCM, rt, 3 h; ii) 41 or 44, DCM, rt, 16 h; (b) 10% Pd / C, H 2 , MeOH, room temperature, 3 hours; (c)45, COMU, DIPEA, DMF, room temperature, 2 hours.

[0152] Next, we evaluated the activity of 46-48 cells using our previously described bromotag-Brd2 knock-in cell line (Figures 6A and 6C, Table 3). At this stage, we aimed to obtain a more accurate DC 50 and D. max To obtain values, it was decided to quantify protein degradation over a broad 8-point concentration range from 10 μM to 1 nM. Each compound showed potent, highly selective and nearly complete (Dmax > 92%) degradation of bromotag-Brd2 relative to endogenous BET proteins. Ester 46 (DC 50 13-15nM) and 47(DC 50 Both amide 48 (DC 50 210-290 nM) and exhibited stronger on-target degradation activity and a DC 50 and DC below 1 / 81 50, respectively (Figure 6A and C, Table 3). As expected, the enantiomerically pure compounds were found to be on average 5-fold more potent than those tested as diastereomeric mixtures, showing more complete on-target degradation (23, 25 and 19, respectively, see Figure 5, Table 2). The large difference in potency exhibited by the esters is exemplified by the pronounced hook effect at concentrations above 1 μM. From our recent work on amide to ester substitution in related non-bump BET PROTACs, the observed increase in potency is likely due to an increase in cell permeability as a result of increased lipophilicity by switching from the amide in 48 to the ester in 46 (Klein, V. et al., 2021 (see above)).

[0153] [Table 3]

[0154] To assess the speed at which our B&H-PROTACs can completely deplete BromoTag-Brd2, we next performed a time-dependent degradation assay by treating heterozygous BromoTag-Brd2 HEK293 cells with 500 nM of 46 or 47, or 1 μM of 48, and measuring BromoTag-Brd2 protein levels over a 36-h period (Figure 6B and D, Table 3). Compound 46 was the fastest and most complete degrader, completely degrading BromoTag-Brd2 within 6 h and with a protein half-life (t) of only 40 min. 1 / 2 Compound 48 was a slightly slower decomposer, with a protein t of 113 min. 1 / 2 induced a maximal degradation of the protein, only able to degrade up to about 80% of the protein in this experiment (Figure 6D). Thus, 48 ​​clearly demonstrates the more potent, faster and more sufficient activity of the ester-bumped PROTAC, despite being used at twice the treatment concentration of 46. The other ester compound, 47, showed a near-complete target degradation similar to 46, but not as fast (t 1 / 2= 142 min), albeit slightly, leaving off-target degradation of Brd3 at 100–1,000 nM (Figure 6), leading to a decreased preference for 47. Taken together, the cellular data suggest that 46 is the best degrader of the three evaluated as a single stereoisomer.

[0155] To better understand the mode of action of our three B&H-PROTACs, we next investigated recombinant purified Brd4 BD2 L387A We sought to investigate the ability of each compound to form a ternary complex between bromodomain proteins and VHL. Therefore, we used a previously published competitive fluorescence polarization (FP) assay (Roy, MJ, 2019 (see above)) by titrating the compound alone (for binary binding) or Brd4. BD2 L387A By titrating compounds pre-incubated with the protein (in the case of ternary complex binding), we displaced the fluorescently labeled HIF-1α peptide probe bound to VHL. The cooperativity (α) of ternary complex formation can then be calculated (α = K d binary / K d ternary ) (Figure 7). Ternary complexes are said to have positive or negative cooperativity when α>1 or α<1, respectively, and are non-cooperative when α=1. PROTACs 46, 47, and 48 have equipotent ternary binding affinities (K d = 11 nM, 12 nM, and 9 nM), MZ1-based 46 and 48 gave the most cooperative ternary complexes (α = 11.1 and 10.9, respectively). ARV-771-based 47 formed the least cooperative ternary complexes (K for 46 and 48, respectively) due to its 2-3-fold higher binary affinity for VHL (α = 3.6, Figure 7B). d = 125 nM and 102 nM for 47. d = 45 nM). This decrease in ternary complex cooperativity and stability may be due to the slower rate of degradation observed, consistent with what has been previously seen with BET PROTACs (Roy, MJ, 2019 (see above)). Taking all this biological data together, we decided to select 46 as our best B&H-PROTAC and advance it for further biological evaluation.

[0156] Further biological and mechanistic characterization of AGB1. Having established AGB1 (46) as the best potent and selective degrading compound for our bromotag system, we next sought to further characterize its predicted mechanism of action for this compound class. To demonstrate that the on-target degrading activity of 46 is mechanistically as expected due to its PROTAC mode of action, we performed pharmacological competition experiments (Figure 8A). To demonstrate VHL and proteasome dependency, we pretreated with the NAE1 inhibitor MLN4924, which inhibits neddylation of cullin2, the VHL inhibitor VH298, and the proteasome inhibitor MG132. To further demonstrate that the on-target activity for bromotag-Brd2 is due to recruitment of the bromotag, we pretreated Brd4 with the NAE1 inhibitor MLN4924, which inhibits neddylation of cullin2, the VHL inhibitor VH298, and the proteasome inhibitor MG132. BD2 L387A High affinity (K d = 65 nM) but showed no detectable binding to the wild-type domain ET-JQ1-OMe (Bond, AG, 2020 (see above). In this experiment, our heterozygous bromotag-Brd2 HEK293 cells were individually exposed to the different inhibitors for a short period of 1 h before subsequent treatment with 200 nM 46, and treatment was continued for an additional 3 h to minimize potential confounding effects due to inhibitor cytotoxicity. As expected, on-target degradation activity by 46 was completely abolished upon pretreatment with MLN4924 or VH298, and CRL2 VHLWe demonstrated a dependence of on-target activity on the IL-1α-dependent IL-1α signaling pathway (Figure 8A). The cellular activity of MLN4924 and VH298 in this experiment was confirmed by observing a significant accumulation of HIF-1α and a block in Cul2 neddylation upon MLN4924 treatment. On-target degradation activity was blocked upon pretreatment with MG132, demonstrating its proteasome dependency. Similar results were observed upon pretreatment with ET-JQ1-OMe (Figure 8A), confirming that on-target degradation was exquisitely driven by target binding using the bromo-tag and not the contribution of a potentially incidental weaker recruitment of the wild-type bromodomain of the endogenous Brd2 protein.

[0157] We next sought to monitor the persistence of 46's on-target degradation activity using washout experiments. Bromotag-Brd2 HEK293 cells were treated with 200 nM 46 for 3 h, rinsed twice with phosphate-buffered saline (PBS), and replenished with fresh medium without PROTAC. After complete depletion after 3 h, bromotag-Brd2 protein levels showed recovery 24 h after washout (Figure 8B). This effect was in stark contrast to the complete and permanent on-target degradation for up to 72 h without washout. This result supports the reversible nature of our bromotag system. Of note, Brd2 expression began to decrease 24 h after harvest, possibly reflecting long-term regulation of Brd2 protein levels.

[0158] To qualify our degrader 46 as a suitable chemical probe for cell biological investigations, we considered it important to evaluate potential cytotoxicity that could perturb biological effects and responses and mask the desired on-target pharmacology. To this end, we chose as a probe criterion that the compound did not show any cytotoxicity at approximately up to 10-fold higher concentrations than the concentrations at which it would be used in cells. Although the remarkable selectivity and lack of off-target BET degrading activity of 46 convinced us that the compound should not be cytotoxic, we decided to perform this test in parental HEK293 cells, as well as in the more BET-sensitive MV-4-11 and 22RV1 cell lines. To allow a suitable control to discount any potential non-degrading off-target binding activity, a compound with a cis hydroxyproline instead of a trans hydroxyproline group, cis-AGB1 (52), was synthesized to abolish binding to VHL (Scheme 6), which is a well-established strategy to obtain negative non-degrading control compounds (Zengerle, M, 2015 (see above)). To monitor cell viability, HEK293, MV-4-11 and 22RV1 cells were plated in a 96-well plate format and treated with vehicle control (DMSO), 46, its non-degraded control (52), and their non-bumped control compounds MZ1 and cis-MZ1, as well as the positive control cytotoxic drug staurosporine in a dose-dependent manner up to ∼10 μM. Cellular ATP levels, as a surrogate for viable cells, were then measured using Cell Titre Glo® 2.0 luminescence reagent (Figure 8C). Reassuringly, 46, as expected, showed a lack of cytotoxicity in all three cell lines up to the high concentrations used, from 1 to 10 μM. The striking lack of off-target degradation of endogenous BET proteins by 46 makes it more potent than MZ1 (EC of ∼20 nM) in highly BET-sensitive MV-4-11 cells. 50 ), which is fully demonstrated by comparison with 46. Taken together, this data validates 46 as a mechanistically complete and true bromotag degrader for cellular interrogation.

[0159] Scheme 6. Synthesis of negative control cis-AGB1 (52)a [ka] a Reaction conditions: (a) 37, COMU, DIPEA, DMF, room temperature, 2 h; (b) TBAF, THF, room temperature, 6 h; (c) i) 45, SOCl 2、 DCM, room temperature, 3 hours; ii) 51, DCM, room temperature, 16 hours;

[0160] The plasma stability of 46 was then assessed by incubating in mouse plasma at 37° C. and measuring the levels of remaining 46 at several time points over the course of 1 hour. Compound 46 demonstrated excellent plasma stability throughout the experiment, with no significant changes in the levels of 46. Finally, to further qualify 46 for suitability for in vivo studies, its pharmacokinetic (PK) profile in mice is next assessed ( FIG. 9 , Tables 4 and 5 ). 46 was shown to have a good PK profile in mice both via intravenous (IV) 5 mg / kg injection (Table 4 ) and subcutaneous (SC) 5 mg / kg injection (Table 5 ). 46 had a PK profile comparable to that seen with the parent compound MZ1 (1), with a relatively low clearance rate (CL) of 47.2 mL / min / kg and a short half-life (T 1 / 2 ) is well tolerated by IV and SC at 1.49 and 1.65 hours, respectively (compared to 1.05 and 2.95 hours for 1) (Tables 4 and 5) (Boehringer Ingelheim- opnMe. https: / / opnme.com / molecules / bet-mz-1 (accessed 24 / 08 / 2021). Remarkably, 46 outperforms its bromotag-Brd2DC counterpart when administered IV at 5 mg / kg for approximately 4 hours and SC at 5 mg / kg for over 8 hours. 50、6h The assay can maintain plasma concentrations of bromo-tagged target protein at less than 15 nM (Figure 9), making it suitable for in vivo studies assessing the functional consequences of bromo-tagged target protein degradation in genetically engineered mouse models.

[0161] [Table 4] [Table 5]

[0162] Degradation of various target proteins. We used the above-mentioned technique to demonstrate the general applicability of the described process to the degradation of various target proteins. As described, we performed CRISPR knock-in of bromotags into endogenous loci of five additional proteins. The results are shown in Table 6 below, where it can be seen that CRISPR knock-in of bromotags demonstrates the broad range of proteins that can be targeted by the bromotag degron system. The target proteins in Table 6 are all different, and are known to all have different cellular roles and functions, intracellular expression, and different turnover rates within cells.

[0163] [Table 6]

[0164] As can be seen in the above table, in all cases where tagging was successful, we were able to induce the degradation of our bromotag conjugates in cells using our PROTAC compound AGB1. These results also show that our tag can induce the degradation of the bromotag at both the N-terminal and C-terminal loci. They also demonstrate that the degradation of our bromotag-protein conjugates can result in a reduction of more than 95% of the total target protein within a treatment therapeutic window of 100 nM to 1 nM. For the targets tested, we show that AGB1 can produce a half-life degradation between 13 and 40 minutes.

[0165] To assess the proteome-wide cellular selectivity of AGB1 for its bromo-tagged target proteins, multiplex tandem mass tag (TMT) labeling mass spectrometry proteomics experiments were performed to monitor protein levels in a quantitative and unbiased manner. Bromo-tagged-BRD2 CRISPR knock-in HEK293 cells were treated in triplicate with DMSO, 1 μM AGB1, or 1 μM cis-AGB1 for 2 hours. Of over 6,621 proteins quantified, BRD2 was found to be the most significantly degraded by SIM1, while no depletion could be detected for BRD3, BRD4, or indeed any other endogenous protein. No significant changes in BRD2 protein abundance were observed in cells treated with cis-AGB1. The same selectivity pattern was observed in a second bromo-tagged target CRISPR knock-in cell line. Taken together, the data support AGB1 as a degrader with exquisite selectivity for bromo-tags and no detectable off-target effects.

[0166] Conclusions and future prospects Through careful structure-guided design, we developed AGB1 (46) as our ultrafast, highly selective, and potent B&H-PROTAC degrader for our novel inducible degron system, Bromotag. We demonstrated that AGB1 (46) inhibits VHL and Bromotag (Brd4 BD2 L387A), but also show complete degradation of bromo-tagged target proteins with low nanomolar potency and exquisite selectivity against wild-type BET proteins and the entire proteome. AGB1 (46) also shows no cytotoxicity in several cancer-associated cell lines, further demonstrating its excellent selectivity against off-target endogenous BET proteins. AGB1 (46) also shows excellent plasma stability and acceptable pharmacokinetics, making it suitable for subsequent in vivo studies in mouse models. Thus, we qualify AGB1 (46) and our novel bromo-tag system as a useful tool to probe the living organism. We envision that bromo-tags can also be used in parallel with other inducible degrons, e.g., dTAG, AID, or HaloPROTAC, as an orthogonal system to simultaneously deplete more than one protein at a time.

[0167] XY-06-007, a compound described in the Background section that contains a "bump" as part of the segment that binds to Brd4 and CRBN-based ligands, has been developed by RP Nowak et al. (2021, see above). Our data suggest that the MZ1-like highly cooperative and stable ternary complex formed by AGB1 with VHL and our bromotag highlights its rapid and sufficient tagged target protein degradation, which is more significant for AGB1 than for XY-06-007. XY-06-007 and AGB1 are unique in their chemistry (I-BET762 instead of JQ1-based, methyl bump instead of ethyl bump, respectively) and biology (CRBN-based instead of VHL-based, Brd4-based, respectively). BD2 Brd4 instead of L387A tag BD1 Thus, the methods described herein and those of Nowak et al. provide two methods for inducing the degradation of bromodomain-tagged proteins, which join the growing body of inducible degron technologies available for studying the effects and implications of rapid and highly selective degradation of targeted proteins.

Claims

1. Decomposition compounds of formula (IA). 【Chemical 1】 (In the formula, G is a 5-membered heteroarene optionally substituted with one or two substituents selected from the group consisting of methyl, halo, hydroxy, thiol, halomethyl, amino, methoxy, methylamino, dimethylamino, ethyl, haloethyl, amido, isopropyl, and methylthio, or G is a 6-membered arene or heteroarene optionally substituted with methyl, halo, hydroxy, and thiol; R is C 1-4 Alkyl or C 1-4 haloalkyl; R 1 is C 1-4 Alkyl, C 1-4 any one selected from the group consisting of haloalkyl, H, and halo; R 2 is H, C 1-3 Alkyl, C 1-3 haloalkyl or halo; R 3 is halo, hydroxyl, thiol, amide, NR 4 R 5 , C(O)NR 4 R 5 , C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy and C 1-6 independently selected from alkylthio; R 4 and R 5 is H and C 1-3 independently selected from alkyl; n is 0, 1, 2, 3 or 4; X is halo; D' is the product of a reactive group D and a prolinker to form D'-L, L is a molecule capable of linking D' to B, and B is a molecule capable of binding to an E3 ubiquitin ligase.

2. The compound of claim 1 , wherein G is a five-membered heteroarene.

3. The compound of claim 1 , wherein G is thiophene.

4. G, (i) one or more substituents selected from the group consisting of methyl, halo, hydroxy, thiol, halomethyl, amino, methoxy, methylamino, dimethylamino, ethyl, haloethyl, amido, isopropyl, tert-butyl, and methylthio; or (ii) one or more substituents selected from the group consisting of methyl, halo, hydroxy, thiol, halomethyl, and amino; 4. The compound of claim 2 or 3, substituted with:

5. The compound of any one of claims 1 to 3, wherein G is substituted twice with methyl.

6. R 3 Fluoro, hydroxyl, thiol, amide, NR 4 R 5 , C(O)NR 4 R 5 , C 1-4 Alkyl, C 1-4 Fluoroalkyl, C 1-4 Alkoxy and C 1-4 2. The compound of claim 1, wherein the alkyl is independently selected from alkylthio.

7. 2. The compound of claim 1, wherein X is chloro and n is 0.

8. R 1 but, (i) C 1-4 Alkyl and C 1-4 fluoroalkyl; or (ii) methyl or trifluoromethyl The compound of claim 1, which is any one selected from the group consisting of:

9. R 2 The compound of claim 1 , wherein is H.

10. 2. The compound of claim 1, wherein R is ethyl.

11. D' is (CH 2 ) p C(O), (CH 2 ) q NH, (CH 2 ) q S, (CH 2 ) q O, (CH 2 ) q and 1,2,3-triazolylene, wherein p is an integer of 0 to 4 or 0, and q is an integer of 1 to 4 or 1.

12. 2. The decomposition compound of claim 1, wherein D' is C(O).

13. 2. The decomposition compound of claim 1, wherein the decomposition compound is of formula (IVA): 【Chemistry 2】

14. 2. The decomposition compound of claim 1, wherein L is of formula (VIA). 【Chemistry 3】 (In the formula, Wavy lines indicate binding sites; X 1 may be present, and O(CH 2 ) s , NH(CH 2 ) s and C(O)(CH 2 ) s any one selected from the group consisting of: X 2 may be present, and O(CH 2 ) u C(O), (CH 2 ) u NH, (CH 2 ) u O and (CH 2 ) u C(O); L' is O(CH 2 ) t , C.H. 2 , alkynylene, triazolylene, piperazinylene, and piperidinylene; s is an integer of 0 to 4, u is an integer of 1 to 4, and t is an integer of 1 to 4.

15. X 1 But O(CH 2 ) 2 and HN(CH 2 ) 2 and X is any one selected from the group consisting of 2 OCH 2 C(O) or CH 2 NH; L' is O(CH 2 ) t and t is 2 or 3.

16. 2. The decomposition compound of claim 1, wherein B is any one of the structures represented by any one of formulas (VIIA) to (XIA). 【Chemistry 4】 (In the formula, R 7 is H or methyl, and Z is F or CN.

17. 2. The decomposition compound of claim 1, which is any one of formulas (XIXA) to (XXIA). 【Chemistry 5】

18. 10. Use of the degradation compound of claim 1 for degrading a target protein.

19. 19. The use of claim 18, wherein the target protein is endogenously tagged with a polypeptide comprising one or more hole-modified mutant Brd4 bromodomains.

20. Hole-modified mutant Brd4 bromodomain is Brd4 BD2 L387A or Brd4 BD2 20. The use of claim 19, wherein the L387V bromodomain is a BET protein.

21. 1. A method for studying the effect of degrading a target protein in a cell, comprising: endogenously expressing a fusion protein comprising a target protein fused to a polypeptide comprising a hole-modified mutant bromodomain; contacting the fusion protein with the degradation compound of claim 1; and Observing any effects on cells of target protein degradation A method comprising:

22. 22. The method of claim 21, wherein the target protein is endogenously tagged with a bromodomain comprising one or more hole-engineered mutant bromodomains from bromo- and extra-terminal domain (BET) proteins, Brd2, Brd3, Brd4, and BrdT, or fragments thereof.

23. 23. The method of claim 22, wherein the mutation is present in one or more bromodomains present in the protein, or in bromodomains including fragments thereof.

24. Hole-engineered mutant bromodomains are Brd4 BD2 L387A,Brd4 BD2 L387V,Brd4 BD1 L94A, Brd4 BD1 L94V, Brd2 BD2 L383A,Brd2 BD2 L383V,Brd2 BD1 L110A,Brd2 BD1 L110V, Brd3 BD2 L344A, Brd3 BD2 L344V, Brd3 BD1 L70A, Brd3 BD1 L70V, BrdT BD2 L306A, BrdT BD2 L306V, BrdT BD1 L63A, or BrdT BD1 The method of claim 22 or 23, wherein the L63V bromodomain is an L63V bromodomain.

25. Hole-modified mutant Brd4 bromodomain is Brd4 BD2 L387A or Brd4 BD2 24. The method of claim 22 or 23, comprising the L387V bromodomain.

Images