Method for rejuvenating glial progenitor cells and rejuvenated glial progenitor cells themselves

JP2024539140A5Pending Publication Date: 2025-10-10UNIVERSITY OF ROCHESTER
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024523626
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-10-20
Filing Date
2022-10-16
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

Existing methods for replacing diseased glial cells with healthy human glial progenitor cells (hGPCs) face challenges in competing effectively with endogenous populations in the host brain, limiting therapeutic efficacy for neurological disorders.

Method used

Genetically modify glial progenitor cells to enhance expression of specific genes such as ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195, conferring a competitive advantage over native glial cells.

Benefits of technology

The modified glial progenitor cells demonstrate increased migration, proliferation, and lineage plasticity, effectively outcompeting and replacing diseased cells in the brain, thereby rejuvenating glial cells and potentially treating conditions like ALS, Huntington's disease, schizophrenia, and bipolar disorder.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Disclosed is a method for rejuvenating glial progenitor cells and rejuvenated cells glial progenitor cells rejuvenated by such method. Glial cells in the brain and / or brainstem are rejuvenated in a subject by introducing a population of genetically modified glial progenitor cells into the brain and / or brainstem of the subject, the genetically modified glial progenitor cells having increased expression of one or more genes compared to the same type of glial progenitor cells that are not genetically modified, and the increased expression of one or more genes in the genetically modified glial progenitor cells confers a competitive advantage over native or already resident glial progenitor cells in the subject.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] This application claims priority from U.S. Provisional Application No. 63 / 257,853, filed October 20, 2021, which is incorporated herein by reference.

[0002] This invention was made with government support under awards NS110776 and AG072298 from the National Institutes of Health. The Government has certain rights in this invention.

[0003] Field The present invention relates to genetically modified glial progenitor cells and methods of utilizing genetically modified glial progenitor cells to rejuvenate glial cells and treat a variety of conditions amenable to cell therapy. [Background technology]

[0004] background Glial dysfunction is a causative contributor to a wide range of neurological conditions. In addition to the many disorders of myelin, it is now apparent that astrocyte and oligodendrocyte pathology underlie the development and progression of many both neurodegenerative and neuropsychiatric disorders, including amyotrophic lateral sclerosis (ALS) (Giorgio, FPD et al., "Non-Cell Autonomous Effect of Glia on Motor Neurons in an Embryonic Are Sensitive to the Toxic Effect of Glial Cells Carrying an ALS-Causing Mutation," Cell Stem Cell 3:637-648 (2008); Yamanaka, K. et al., "Astrocytes as determinants of disease progression in inherited amyotrophic lateral sclerosis," Nat Neurosci 11:251-253 (2008); Lee, Y. et al., "Oligodendroglia Metabolically Support Axons and Contribute to Neurodegeneration," Nature 11:251-253 (2008)). 487:443-448 (2012); and Meyer, K. et al., "Direct Conversion of Patient Fibroblasts Demonstrates Non-Cell Autonomous Toxicity of Astrocytes to Motor Neurons in Familial and Sporadic ALS," Proc National Acad Sci 111:829-832 (2014)) and Huntington's Disease (HD) (Shin, J.-Y. et al., "Expression of Mutant Huntingtin in Glial Cells Contributes to Neuronal Excitotoxicity," J Cell Biology 171:1001-1012 (2005); Faideau, M."In Vivo Expression of Polyglutamine-Expanded Huntingtin by Mouse Striatal Astrocyte Impairs Glutamate Transport: A Correlation with Huntington's Disease Subjects", Hum Mol Genet 19:3053~3067 (2010); Tong, X. et al. "Astrocyte Kir4.1 Ion Channel Deficits Contribute to Neuronal Dysfunction in Huntington's Disease Model Mice", Nat Neurosci 17, 694~703(2014); Benraiss, A. et al., Human Glia can both Induce and Rescue Aspects of Disease Phenotype in Huntington Disease", Nat Commun 7, 11758(2016); Diaz-Castro, B. et al., "Astrocyte Molecular Signatures in Huntington's Disease", Sci Transl Med 11, eaaw8546(2019);Benraiss, A. et al. "Cell-intrinsic Glial Pathology is Conserved Across Human and Murine Models of Huntington's Disease", Cell Reports 36, 109308(2021)), and schizophrenia and bipolar disorders (Tkachev, D. et al. "Oligodendrocyte Dysfunction in Schizophrenia and Bipolar Disorder", Lancet 362, 798-805(2003);Katsel, P.et al., "Astrocyte and Glutamate Markers in the Superficial, Deep, and White Matter Layers of the Anterior Cingulate Gyrus in Schizophrenia", Neuropsychopharmacol 36, 1171-1177 (2011); Voineskos, AN et al., "Oligodendrocyte Genes, White Matter Tract Integrity, and Cognition in Schizophrenia", Cereb Cortex 23, 2044~2057 (2013); Aleksovska, K. et al., “Systematic Review and Meta-Analysis of Circulating S100B Blood Levels in Schizophrenia”, Plos One 9, e106342 (2014); Windrem, MS et al., “Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia”, Cell Stem Cell 21, 195-208.e6 (2017) includes many states such as.

[0005] In such conditions, replacement of diseased glia by healthy wild-type glial progenitors is due to the migration and expansion competence of human glial progenitor cells (hGPCs) and their ability to generate both astrocytes and myelinating oligodendrocytes in a lineage plastic and context-dependent manner (Nunes, MC, et al., "Identification and Isolation of Multipotential Neural Progenitor Cells from the Subcortical White Matter of the Adult Human Brain," Nat Med 9, 439-447 (2003); Sim, FJ, et al., "CD140a Identifies a Population of Highly Myelinogenic, Migration-competent and Efficiently Engrafting Human Oligodendrocyte Progenitor cells," Nat Biotechnol 29, 934-941 (2011); Windrem, MS, et al., "A Competitive Advantage by Neonatally Engrafted Human Glial Progenitors "Yields Mice Whose Brains Are Chimeric for Human Glia", J Neurosci 34, 16153-16161 (2014); and Windrem, MS et al., "Human Glial Progenitor Cells Effectively Remyelinate the Demyelinated Adult Brain", Cell Reports 31, 107658 (2020)), which may provide substantial therapeutic benefit (Goldman, SA, "Stem and Progenitor Cell-Based Therapy of the Central Nervous System: Hopes, Hype, and Wishful Thinking", Cell Stem Cell 18, 174-188 (2016) and Franklin, RJM(Givogri, M. I. et al., "Remyelination in the CNS: from Biology to Therapy," Nat Rev Neurosci 9, 839-855 (2008)). However, to provide therapeutic replacement, allogeneic hGPCs must compete for and displace endogenous pools and ultimately relocate to diseased regions of the host brain. In previous studies of mouse-to-mouse allogeneic transplantation, competitive interactions between healthy glial progenitor cells (GPCs) and diseased glial progenitor cells favor the expansion and integration of the healthy donor population (Givogri, M. I. et al., "Oligodendroglial Progenitor Cell Therapy Limits Central Neurological Deficits in Mice with Metachromatic Leukodystrophy," J Neurosci 26, 3109-3119 (2006); U.S. Patent No. 10,279,051 to Goldman, and U.S. Patent No. 10,779,519 to Goldman). Nevertheless, it remains unclear whether healthy human GPCs can outcompete and replace their diseased human counterparts. Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention is directed to overcoming these and other deficiencies in the art. [Means for solving the problem]

[0007] overview One aspect of the invention relates to a method of rejuvenating brain and / or brainstem glial cells in a subject, the method comprising introducing a population of genetically modified glial progenitor cells into the brain and / or brainstem of the subject, wherein the genetically modified glial progenitor cells have increased expression of one or more genes compared to non-genetically modified glial progenitor cells of the same type, wherein the one or more genes are selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3 and ZNF195, and wherein said increased expression of one or more genes in the genetically modified glial progenitor cells confers a competitive advantage over native or already resident glial progenitor cells in the subject.

[0008] Another aspect of the present invention relates to an isolated population of genetically modified glial progenitor cells, wherein the genetically modified glial progenitor cells have increased expression of one or more genes compared to non-genetically modified glial progenitor cells of the same type, wherein the one or more genes are selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3 and ZNF195. [Brief description of the drawings]

[0009] [Figure 1-1] Panels A-B of Figure 1 show representative images of WT-mCherry and HD-EGFP expression. Panel A shows the workflow used in the genetic engineering of the adeno-associated virus integration site (AAVS1) locus of hESC lines that constitutively express a transgene of interest. [Figure 1-2]Panels A-B of Figure 1 show representative images of WT-mCherry and HD-EGFP expression. Panel A' shows the mechanism of CRISPR-Cas9-mediated transgene integration into the AAVS1 locus (located in the first intron of the protein phosphatase 1 regulatory subunit 12C (PPP1R12C) gene). [Figure 1-3] Panels A and B in Figure 1 show representative images of the expression of WT-mCherry and HD-EGFP, and Panels B to B' show representative images of the expression of WT-mCherry and HD-EGFP. [Figure 1-4] Panels C-D depict transgene constructs driving expression of either mCherry or EGFP (enhanced green fluorescent protein) inserted into the AAVS1 safe harbor locus of WT GENEA019 (mcherry) and HD GENEA020 (EGFP) hESCs. [Figure 1-5] Panel E shows representative images of WT-mCherry (Panel B) and HD-EGFP expression (Panel B') in the brain. [Figure 2-1] FIG. 2, panel A, shows representative karyotypes from WT-mCherry and HD-EGFP to assess acquired copy number variations (CNVs) and loss of heterozygosity (LOH). [Figure 2-2] Panels B-C show karyotype analysis. [Figure 3-1] FIG. 3, panel A, illustrates the generation of HD chimeric mice. [Figure 3-2] Panels B-C show the characterization of cells in HD chimeric mice. [Figure 3-3] Panels B-C show the characterization of cells in HD chimeric mice. [Diagram 3-4] Panel D shows representative images and characterization of cells in HD chimeric mice. [Figure 4-1]FIG. 4 shows that adult transplanted WT human GPCs outcompete and replace neonatally resident HD hGPCs. Panel A: Experimental design and analytical endpoints. Panel B: Engraftment of WT glia (mCherry+, red) into the striatum of HD chimeras resulted in progressive replacement of HD glia (EGFP+, green) creating extensive exclusive domains in their development. The dashed outline (white) demarcates the striatal border within which human cells were mapped and quantified. [Figure 4-2] Panels C-D: The border between developing WT and repopulating HD hGPCs is typically well delineated, such that exclusive domains are formed as WT GPCs (Olig2+, white) replace their HD counterparts. Panel E: GPC replacement precedes astrocyte replacement, as stray HD astrocytes (hGFAP+, white) can still be found within areas colonized by WT hGPCs. [Figure 4-3] Panel F: Distribution of mapped human glia in the host striatum. Human glia were mapped in 15 equal sections (five shown as examples) and reconstructed in 3D. Their distribution was easily measured as a function of distance to the injection site. Panel G: Example display of mapped striatum. Panel H: Volumetric quantification shows that WT gradually replaced their HD counterparts as they expanded and proliferated from their replacement site; H1: WT vs. HD (allograft; n=8 for 54 weeks, n=7 for 72 weeks). The progression of WT cells was accompanied by progressive elimination of HD glia from the tissue compared to untransplanted HD chimeras (HD control); H2: HD (allograft; n=8 for 54 weeks, n=7 for 72 weeks) vs. HD control (n=4 for both time points; 2-way ANOVA with Sidak's multiple comparison test. ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05; data are expressed as mean ± SEM). [Figure 4-4]Panel I: At the border between WT and HD glia, a high incidence of Ki67+ (white) cells can be seen exclusively within the WT glial population. Panel I': Higher magnification of two WT daughter cells at the edge of the competitive border. Panel J: Quantification of Ki67+ glia within each population as a function of time showing a significant proliferation benefit by WT glia, sustained throughout the experiment. HD control: 54 weeks (n=4), 72 weeks (n=4); WT control: 54 weeks (n=5), 72 weeks: n=3; WT vs. HD allografts: 54 weeks (n=5), 72 weeks (n=3). Comparisons by 2-way ANOVA with Sidak's multiple comparison test; mean ± SEM. STR, striatum (caudate putamen); LV, lateral ventricle; CTX, cortex. Dashed rectangle (orange) represents insert (Panel B'). Scale: panel B, 500 μm; panel C', 100 μm; panel D, 50 μm; panel E, 10 μm; panel I, 100 μm; panel I', 10 μm. [Diagram 5] FIG. 5 illustrates the experimental design of HD versus WT and HD control mice. [Figure 6-1] Panels A-C of Figure 6 show that human wild-type glia outcompete pre-integrated human HD glia. Panel A provides stereological estimates demonstrating that the total number of HD glia progressively decreases relative to HD chimeric controls as WT glia expand and proliferate within the humanized striatum; 2-way ANOVA with Sidak's multiple comparison test. Panels B and C show that the proportion of GPCs (Olig2+, Panel B) and astrocytes (GFAP+, Panel C) in both populations was maintained as they competed for striatal dominance; HD control-n=4 for both time points; WT control-n=4 for 54 weeks, n=3 for 72 weeks; HD vs. WT-n=5 for 54 weeks, n=3 for 72 weeks; orange arrows point to co-labeled cells. Data are presented as mean ± sem with individual data points. [Figure 6-2]Panels D-E show representative images of HD glia (panel D) and WT glia (panel E) in which Olig2+ (white) GPCs expanded as they replaced their HD counterparts, and within the areas where they became dominant, they further differentiated into hGFAP+ (white) astrocytes. [Figure 7-1] Panels A-B of Figure 7 illustrate the experimental design and analysis time points of the WT control group (Panel A). Panel B shows representative images demonstrating that engraftment of WT glia (mCherry+, red) into the adult striatum of Rag1(- / -) mice results in substantial humanization of the mouse striatum over time. [Figure 7-2] Panels C-D show volumetric quantification demonstrating that WT glia infiltrate and disperse throughout the mouse striatum over time and that they are more widespread than those transplanted into HD chimeras; WT (HD vs. WT group)—n=8 for 54 weeks, n=7 for 72 weeks vs. WT control—n=7 for 54 weeks, n=5 for 72 weeks; 2-way ANOVA with Sidak's multiple comparison test; main effects are shown as numerical P values; data are presented as mean ± sem. [Figure 8] FIG. 8 illustrates the experimental design for mice receiving a 1:1 mixture of mCherry-tagged (WT-mCherry) and untagged (WT-untagged) WT glia. [Figure 9]Panels A-D of FIG. 9 show that co-engrafted isogenic clones of wild-type glia develop and intermix, replacing HD glia. Panel A shows that immunolabeling for human nuclear antigen (hN) shows that both WT-mCherry (mCherry+hN+, red, white) and WT untagged (mCherry-EGFP-hN+, white) glia expand and proliferate within the previously humanized striatum, progressively replacing HD glia (EGFP+hN+, green, white). Scale bar 500 μm. Panel B shows that extensive homotypic domains are formed as the mixed WT glia expand and replace resident HD glia. Scale bar 100 μm. Panel C shows that isogenic WT-mCherry and WT untagged are found intermixed. Scale bar 100 μm. Panel D shows that within domains dominated by WT glia, only more complex astrocyte-like HD glia are typically found within white matter tracts. Scale bar: 10 μm. [Figure 10] FIG. 10 shows that quantification of the proportion of WT-mCherry and WT untagged glia in the striatum showed no significant differences between the two populations at any of the quantification time points (n=6 for each time point); 2-way ANOVA with Sidak's multiple comparison test; mean±sem. [Figure 11] FIG. 11 illustrates the experimental design for co-engraftment of WT and HT glia in neonatal mice. [Figure 12-1] Panels A-C of Figure 12 show representative images of the percentage of WT and HD glia within the striatum in mice co-engrafted with WT and HT glia. The images show no significant growth advantage for either cell population; n=5; two-tailed paired t-test. [Figure 12-2] Panel B: Representative images of the percentage of WT and HD glia in the striatum in mice co-engrafted with WT and HT glia. [Figure 12-3] Panel B: Representative images of the percentage of WT and HD glia in the striatum in mice co-engrafted with WT and HT glia. [Figure 12-4]Panel C: Representative images of the percentage of WT and HD glia in the striatum in mice co-engrafted with WT and HT glia. [Figure 13] Figure 13, panels A-B, demonstrates that equal growth of WT and HD glia engrafted in neonates is sustained by a similarly proliferative Ki67+ (white) glial pool; HD control-n=3; WT control-n=4; HD vs. WT-n=5; one-way ANOVA with Tukey's multiple comparison test. [Figure 14] FIG. 14, panels A-B, demonstrate that differences in cellular age are sufficient to drive human glial repopulation. [Figure 15-1] Panels A-D of Figure 15 show that mouse chimeras with striatum substantially humanized by HD glia were created to provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. hGPCs derived from mHTT-expressing hESCs engineered to express EGFP were implanted into the neostriatum of immunocompromised Rag1(- / -) mice and their expression was monitored histologically. [Figure 15-2] Panel B shows that mouse chimeras with a striatum substantially humanized by HD glia were created to thereby provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. [Figure 15-3] Panels C,D show that mouse chimeras with a striatum substantially humanized by HD glia were created to thereby provide an in vivo model to assess the replacement of diseased human glia by their healthy counterparts. [Figure 15-4]Panels E, F show that mouse chimeras with striatum substantially humanized by HD glia were created to provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. hGPCs derived from mHTT-expressing hESCs engineered to express EGFP were implanted into the neostriatum of immunocompromised Rag1(- / -) mice and their expression was monitored histologically. [Figure 15-5] Panels G-I show that mouse chimeras with striatum substantially humanized by HD glia were created to thereby provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. [Figure 15-6] Panel J shows that mouse chimeras with striatum substantially humanized by HD glia were created to thereby provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. [Figure 16] FIG. 16, panels AB, show that a proliferative benefit drives WT glia to progress through the humanized HD striatum. [Figure 17-1] Panels A-E of FIG. 17 show that differences in cell age are sufficient to drive competitive glial repopulation in humanized striatum. Panel A: Experimental design and analysis endpoints. Panel B: Engraftment of younger WT glia (EGFP+, green) into the striatum of WT chimeras resulted in selective replacement of their aged counterparts (mCherry+, red). The dashed contour demarcates the striatal region within which human cells were mapped and quantified. [Figure 17-2] Panel C: WT chimeric control, engrafted only at birth. Panel D: Example display of a mapped striatum. Volumetric quantification shows that younger WT glia replace their older isogenic counterparts as they expand and proliferate from their injection site; [Figure 17-3]Panel E: old vs. young (syngeneic), n=3. Their development tracked the progressive elimination of old WT glia from tissues compared to control WT chimeras (old control); Panel F: old (syngeneic) vs. old (control), n=3 each; 2-way ANOVA with Sidak's multiple comparison test; interactions or main effects are shown as numerical P values, while post hoc comparisons are shown as ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05; data are presented as mean ± SEM. [Figure 17-4] Panel G: At the interface between young and aged WT glia, a higher incidence of Ki67+ (white) cells can be seen within the younger population. The dashed rectangle represents the inset color division (H). Panel I: Quantification of Ki67+ cells shows that younger WT glia are significantly more proliferative than their aged counterparts; n=3 for all experimental groups; one-way ANOVA with Sidak's multiple comparison test; data are presented as mean ± SEM with individual data points. Panels B-C. STR, striatum (caudate-putamen); LV, lateral ventricle; CTX, cortex). Scale: Panel B, 500 μm; Panel C, 100 μm; Panel E-100 μm; Panel G-50 μm. [Figure 18-1] FIG. 18, panel A, shows the gating strategy for flow cytometry analysis. [Figure 18-2] Panel B of Figure 18 shows the gating strategy for flow cytometry analysis. [Figure 19-1] Figure 19 shows that WT glia acquire a dominant competitor transcriptional profile in the face of resident HD glia. Panel A: Experimental design. Panels B and C: Uniform manifold approximation and projection (UMAP) visualization of integrated (Panel B) and partitioned by groups (Panel C) scRNA-seq data identifies six major cell populations. [Figure 19-2]Panel D: Stacked bar plots of percentage of cell types in each group. Panel E: Notched box plots of cell cycle analysis of cycling GPCs and G2 / M phase GPCs. Boxes indicate interquartile ranges, notches indicate 95% confidence intervals with median at center of notch, error bars represent minimum and maximum non-outliers. Panel F. Venn diagram of pairwise differentially expressed GPC genes (Log2 fold change >0.15, adjusted p-value <0.05). [Figure 19-3] Panel G: Curated ingenuity pathway analysis of differentially expressed genes between GPC groups. Circle size represents p-value while shading indicates activation Z-score, with red being more active in the upper group and green being more active in the lower group. [Figure 19-4] Panel H: Heatmap of selected pairwise differentially expressed GPC genes. Panel I: Violin plot of log2 fold change of pairwise differentially expressed GPC ribosomal genes. Comparisons between groups in Panel E utilized Dunn's test followed by Kruskal-Wallis test with multiple comparisons adjusted via the Benjamini-Hochberg method. *=<0.05, **<0.01, ***=<0.001, ****=<0.0001 adjusted p-values. [Figure 20-1] Figure 20 shows that aged human glia are eliminated by their younger counterparts by induced apoptosis. Panel A: At the border between young (EGFP+, green) and aged WT glia (mCherry+, red), a higher incidence of apoptotic TUNEL+ (white) cells is evident in the aged population. Panel B: Higher magnification of the competitive interface between these distinct populations shows resident glia selectively undergoing apoptosis. [Figure 20-2]Panel C: Quantification of TUNEL+ cells shows a significantly higher incidence of TUNEL+ cells among aged resident WT glia compared to both their younger isogenic counterparts and to aged WT chimeric controls that were not challenged with younger cells. Quantification was performed on pooled samples (n=5 for all experimental groups) at 60-80 weeks. One-way ANOVA with Sidak's multiple comparison test; data are presented as mean ± SEM with individual data points. Scale: Panel A, 100 μm; Panel B, 50 μm. [Figure 21-1] Figure 21 shows that WT glia gain a transcriptional advantage when confronted with their aged counterparts. Panel A. Experimental design. Panels B-C. Uniform manifold approximation and projection (UMAP) visualization of integrated (Panel B) and group-partitioned (Panel C) scRNA-seq data identifies six major cell populations. [Figure 21-2] Panel D: Stacked bar plots of percentage of cell types in each group. Panel E: Notched box plots of cell cycle analysis of cycling GPCs and G2 / M phase GPCs. Boxes indicate interquartile ranges, notches indicate 95% confidence intervals with median at center of notches, error bars represent minimum and maximum non-outliers. Panel F: Venn diagram of pairwise differentially expressed GPC genes (Log2 fold change >0.15, adjusted p-value <0.05). [Figure 21-3] Panel G: Ingenuity Pathway analysis of curated genes differentially expressed between GPC groups. Circle size represents p-value while shading indicates activation Z-score, red is more active in the upper group and green is more active in the lower group. [Figure 21-4] Panel H: Heatmap of selected pairwise differentially expressed GPC genes. Panel I. Violin plot of log2 fold change of pairwise differentially expressed GPC ribosomal genes. Comparisons between groups in E utilized Dunn's test followed by Kruskal-Wallis test with multiple comparisons adjusted via the Benjamini-Hochberg method. *=<0.05, **<0.01, ***=<0.001, ****=<0.0001 adjusted p-values. [Figure 22-1] Figure 22 shows the transcriptional signature of competitive advantage. Panel A: Schematic of candidate transcription factor identification. [Figure 22-2] Panel B: Violin plot of the first principal component of the identified WGCNA modules per condition. Significant modules (black, green, blue, brown, red, cyan) are depicted whose members are enriched for downstream targets of the five transcription factors in panel E. Panel C: Relative importance analysis to estimate the differential contribution of each biological factor (age vs. genotype) to the first principal component of each module. [Figure 22-3] Panel D: Gene Set Enrichment Analysis (GSEA) highlighting these prioritized transcription factors enriched for upregulated genes in young WT cells where their regulon dominates. Panel E: Key transcription factors predicted via SCENIC to establish competitive advantage and their relative activity across groups. [Figure 22-4] Panel F:—Regulatory networks representing downstream targets and their functional signaling pathways. The targets belong to the highlighted modules in panel B and their expression is controlled by at least one other important transcription factor in panel E. NES: Network enrichment score. [Figure 23-1] Figure 23 shows bulk RNA-Seq characterization of human fetal GPC. Panel A: Bulk and scRNA sequencing workflow of selected second trimester human fetal brain isolates CD140a+, CD140a-, and A2B5+ / PSA-NCAM. Panel B: Principal component analysis of all samples across two batches. [Figure 23-2] Panel C: Venn diagram of CD140a+ vs. CD140a- and CD140+ vs. A2B5+ / PSA-NCAM- differentially expressed gene sets (p<0.01 and absolute log2 fold change>1). [Figure 23-3] Panel D: Significant Ingenuity Pathway Analysis terms for both gene sets. Size represents -log10p value and color represents activation Z-score (blue, CD140a+; red, A2B5+ or CD140a-). [Figure 23-4] Panel E: Log2 fold change of significant genes for both gene sets. Missing bars are not significant. [Figure 23-5] Panel F: Heatmap of transformed transcripts per million (TPM) of selected genes in panel E. [Figure 24-1] Figure 24 shows single cell RNA sequencing of CD140a and A2B5 selected human fetal GPCs. Panel A: UMAP plot of primary cell types identified during scRNA-Seq analysis of FACS-isolated hGPCs derived from human fetal VZ / SVZ at 20 weeks gestation. [Figure 24-2] Panels B-C: UMAP of PSA-NCAM- / A2B5+ (B) only or CD140a+ (C) human fetal cells. [Figure 24-3] Panel D: Violin plot of cell type selectable marker genes. [Figure 24-4] Panel E: Volcano plot of GPC vs. pre-GPC populations. [Figure 24-5] Panel F: Signature plot of selected differentially expressed genes between the GPC and pre-GPC. [Figure 24-6] Panel G: Selected significantly enriched GPC and pre-GPC IPA terms showing their -log10p values ​​and activation Z-scores. [Figure 24-7] Panel H: Selected feature plot of transcription factors predicted to be significantly activated in fetal hGPCs. Relative transcription factor regulon activation is shown as calculated using the SCENIC package. [Figure 25-1] Figure 25 shows that adult human GPC is transcriptionally and functionally distinct from fetal GPC. Panel A: Workflow for bulk RNA-Seq analysis of human adult and fetal GPC. Panel B: Principal component analysis of all samples across three batches. [Figure 25-2]Panel C: Venn diagram of both adult vs. fetal differentially expressed gene sets. Panel D: IPA network of curated terms and genes. Node size is proportional to the degree of the node. Label color corresponds to enrichment in either the adult (red) or fetal (blue) populations. [Figure 25-3] Panel E: Bar plot of significant IPA terms by module. Z-scores indicate predicted activation in fetal (blue) or adult (red) hGPCs. [Figure 25-4] Panel F: Bar plot of log2 fold change and heat map of TPM of network genes. [Figure 26-1] Figure 26 shows that inference of transcription factor activity implicates a set of transcriptional repressors in establishing the identity of adult hGPCs. Panel A: Normalized enrichment score plot of significantly enriched transcription factors predicted to be active in fetal and adult GPCs. Each dot is a motif, the size of which indicates how many genes the motif is predicted to be active in, and the color represents the window around the promoters in which the motif was found to be enriched. Panel B: Heatmap of enriched TF TPMs. Panel C: Log fold change for both fetal hGPC isolates vs. adult GPCs. [Figure 26-2] Panels D-G show the predicted direct transcription factor activity of selected genes. Panel D: fetal activators. Panel E: fetal repressors. [Figure 26-3] Panels D-G show predicted direct transcription factor activity of selected genes. Panel F: adult activators. Panel G: adult repressors. Color indicates differential expression in either adult (red) or fetal (blue) hGPCs; shape dictates node type (octagon, repressors; rectangle, activators; oval, other target genes). Boxed and circled genes indicate functionally related genes that contribute to either glial progenitor / oligodendrocyte identity, senescence / proliferation targets, or upstream or downstream TFs that were also considered to be activated. [Figure 27]Figure 27 shows induction of the aged GPC transcriptome via adult hGPC-enriched repressors. Panel A: Schematic outlining the construction of four separate doxycycline (Dox)-inducible EGFP lentiviral expression vectors, each encoding one of the transcriptional repressors: E2F6, IKZF3, MAX, or ZNF274. Panel B: Induced pluripotent stem cell (iPSC)-derived hGPC cultures (line C27 (Chambers et al., 2009; Wang et al., 2013)) were transduced with a single lentivirus or vehicle for one day and then treated with Dox for the remainder of the experiment. Three, seven, and ten days after the initiation of Dox-induced transgene expression, hGPCs were isolated via FACS for qPCR. Panel C: qPCR of Dox-treated cells showing expression of each transcription factor versus matched time points of interest. Panel D: qPCR fold change heatmap of selected aging-associated genes. Within time points, comparisons to control were calculated via post hoc least squares means tests of linear models after regression of cell batch effects. FDR adjusted p-values: *<0.05, **<0.01, ***<0.001. [Figure 28-1] Figure 28 shows that miRNAs drive adult GPC transcriptional differences in parallel to transcription factor activity. Panel A: Principal component analysis of miRNA microarray samples from human A2B5+ adult and CD140a+ fetal GPCs. Panel B: Bar plot of Log2 fold change and heat map of differentially expressed miRNAs. [Figure 28-2] Panel C: Characterization bubble plot of the enrichment of miRNAs against the mean log2 FC of their predicted gene targets. [Figure 28-3] Panels D-E: Curated signaling networks of enriched miRNAs and their predicted targets in fetal (top) and adult (bottom) tissues in Panel D. [Figure 28-4] Panels D-E: Curated signaling networks of enriched miRNAs and their predicted targets in fetal (top) and adult (bottom) tissues in Panel D. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] Detailed Description Reference will now be made in detail to certain aspects and exemplary embodiments of the invention, examples of which are illustrated in the accompanying structures and drawings. Aspects of the invention are described in conjunction with exemplary embodiments, including methods, materials, and examples, and such description is non-limiting, and the scope of the invention is intended to encompass all equivalents, alternatives, and modifications generally known or incorporated herein. The described aspects, features, benefits, and characteristics of the invention may be combined in any suitable manner with one or more additional embodiments. Those skilled in the art will recognize that the invention may be practiced without one or more of the specific aspects or benefits of a particular embodiment. In other instances, additional aspects, features, and benefits may be recognized in certain embodiments that may not be present in all embodiments of the invention and may be claimed. Moreover, those skilled in the art will recognize many techniques and materials similar or equivalent to those described herein, which may be used in the practice of the aspects and embodiments of the invention. The described aspects and embodiments of the invention are not limited to the methods and materials described.

[0011] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0012] Ranges may be expressed herein as from "about" one particular value and / or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values ​​are expressed as approximations by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that each of the endpoints of a range is meaningful in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are several values ​​disclosed herein, and that each value is also disclosed herein as "about" that particular value, in addition to the value itself. For example, if a value of "10" is disclosed, "about 10" is also disclosed. When a value is disclosed, it is also understood that "less than or equal to" the value, "greater than or equal to" the value, and possible ranges between the values ​​are also disclosed, as appropriately understood by one of ordinary skill in the art. For example, if a value of "10" is disclosed, "less than or equal to 10" and "greater than or equal to 10" are also disclosed.

[0013] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a peptide" includes "one or more" peptides or "multiple" such peptides.

[0014] I. Definition As used herein, the following terms or phrases (in parentheses) shall have the following meanings:

[0015] The term "about" or "approximately" includes within a statistically meaningful range of values. Such ranges may be within an order of magnitude, preferably within 50%, more preferably within 20%, even more preferably within 10%, and even more preferably within 5% of a given value or range. The allowable variation encompassed by the term "about" or "approximately" depends on the particular system under study and can be readily discerned by one of ordinary skill in the art.

[0016] As used herein, the term "and / or" means that the listed items may be present or utilized either individually or in combination. In practice, the term means that "at least one" or "one or more" of the listed items may be present or utilized.

[0017] As will be understood by those skilled in the art, for any and all purposes, including in terms of providing a specification, all ranges disclosed herein also encompass any and all possible subranges and combinations thereof. The recited ranges can be easily recognized as fully descriptive and allowing the same range to be broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be easily broken down into a lower third, middle third, upper third, etc. Also, as will be understood by those skilled in the art, all terms such as "up to," "at least," etc. refer to ranges that include the recited numbers and can be broken down into subsequent subranges as discussed above. Finally, as will be understood by those skilled in the art, a range includes each individual number.

[0018] In understanding the scope of this application, the term "comprising" and its derivatives, as used herein, are intended to be open-ended terms that describe the presence of stated features, elements, components, groups, integers, and / or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers, and / or steps. The foregoing also applies to phrases having similar meanings, such as terms such as "including," "involving," "having," and their derivatives. The term "consisting" and its derivatives, as used herein, are intended to be closed terms that describe the presence of stated features, elements, components, groups, integers, and / or steps, but exclude the presence of other unstated features, elements, components, groups, integers, and / or steps. The term "consisting essentially of," as used herein, is intended to describe the presence of stated features, elements, components, groups, integers, and / or steps, as well as things that do not materially affect the basic and novel characteristics of the features, elements, components, groups, integers, and / or steps. In embodiments or claims where the term comprising (and the like) is used as a transitional phrase, such embodiments may also envision the replacement of the term "comprising" with "consisting of" or "consisting essentially of." The methods, kits, systems, and / or compositions of the invention may comprise, consist essentially of, or consist of the disclosed components.

[0019] In embodiments that include an "additional" or "second" component, the second component, as used herein, is distinct from the other component or the first component. A "third" component is distinct from the other, first, and second components, and further envisioned or "additional" components are similarly distinct.

[0020] The term "complementary," when used in conjunction with nucleic acids, refers to base pairing of A with T or U, and G with C. The term "complementary" refers to nucleic acid molecules that are fully complementary, i.e., A pairs with T or U, and G pairs with C, throughout the reference sequence, as well as molecules that are partially (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary.

[0021] The terms "nucleic acid," "nucleotide," and "polynucleotide" encompass both DNA and RNA, unless otherwise specified.

[0022] The terms "polypeptide", "peptide" or "protein" are used interchangeably and refer to a polymer of amino acid residues. This term encompasses all kinds of naturally occurring and synthetic proteins, including protein fragments of all lengths, fusion proteins and modified proteins, including but not limited to glycoproteins, as well as all other types of modified proteins (e.g., proteins resulting from phosphorylation, acetylation, myristoylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, ADP-ribosylation, pegylation, biotinylation, etc.).

[0023] The terms "abrogate," "abrogation," "eliminate," or "elimination" of expression of a gene or gene product (e.g., RNA or protein) refer to the complete loss of transcription and / or translation of the gene or the complete loss of the gene product (e.g., RNA or protein). Expression of the gene or gene product (e.g., RNA or protein) relative to a control, e.g., an unmodified cell, can be detected by standard art known methods such as those described herein.

[0024] The terms "express" and "expression" mean to enable or cause the information in a gene or DNA sequence to be produced, e.g., to produce an RNA or protein by activating cellular functions involved in the transcription and / or translation of the corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an "expression product," e.g., an RNA or protein. The expression product itself, e.g., the resulting protein, is sometimes said to be "expressed" by the cell. Expression products may be characterized as intracellular, extracellular, or transmembrane.

[0025] The term "competitive advantage" as referred to herein encompasses preferential proliferation, population expansion, durable survival and / or stable integration of a cell population arranged in tandem or admixture with a genetically and / or epigenetically distinct cell population over a disadvantage and ultimately subsequent partial or complete replacement.

[0026] As used herein, the term "glial cells" refers to a population of non-neuronal cells that provide support and nutrition, maintain homeostasis, form or promote myelination, and participate in signal transduction in the nervous system. As used herein, "glial cells" encompasses fully differentiated cells of the glial lineage, such as oligodendrocytes or astrocytes, and glial progenitor cells, each of which may be referred to as macroglial cells.

[0027] Certain terms used in the specification, examples, and claims are summarized herein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0028] Preferences and options for a given aspect, feature, embodiment, or parameter of the invention should be considered as disclosed in combination with any and all preferences and options for all other aspects, features, embodiments, and parameters of the invention, unless the context dictates otherwise.

[0029] II. Genetically Modified Cell Populations A first aspect of the present invention is directed to an isolated population of progenitor cells that have been genetically modified to have a competitive advantage over non-genetically modified progenitor cells. As explained above, progenitor cells that have been genetically modified to have a "competitive advantage" are cells that have been modified to exhibit preferential proliferation, population expansion, durable survival and / or stable integration of a cell population arranged in tandem or in admixture with a genetically and / or epigenetically distinct cell population, versus a disadvantage and ultimately a subsequent partial or complete replacement.

[0030] In one embodiment, the isolated population of progenitor cells is a population of central nervous system progenitor cells. Thus, in some embodiments, the genetically modified cell population is an isolated population of neural, neuronal, or glial progenitor cells that have been genetically modified to have a competitive advantage over corresponding progenitor cells that are not genetically modified.

[0031] In one embodiment, the isolated population of progenitor cells is a population of glial progenitor cells.Thus, in one embodiment, the genetically modified cell population is an isolated population of glial progenitor cells that are genetically modified to have a competitive advantage over non-genetically modified progenitor cells.Suitable glial progenitor cell populations include bipotential glial progenitor cells, oligodendrocyte-biased glial progenitor cells, and astrocyte-biased glial progenitor cells.

[0032] Other populations of progenitor cells that may be genetically modified as described herein include, but are not limited to, bone marrow progenitor cells, cardiac progenitor cells, endothelial progenitor cells, epithelial progenitor cells, mesenchymal progenitor cells, hematopoietic progenitor cells, liver progenitor cells, bone progenitor cells, muscle progenitor cells, pancreatic progenitor cells, lung progenitor cells, kidney progenitor cells, vascular progenitor cells, and retinal progenitor cells. In accordance with the present disclosure, any one of the aforementioned progenitor cell populations may be genetically modified as described herein to have a competitive advantage over non-genetically modified progenitor cells.

[0033] In some embodiments, the population of progenitor cells is genetically modified to increase the expression of one or more genes that code for proteins that give the cells a competitive advantage over non-genetically modified progenitor cells.In other embodiments, the progenitor cells are genetically modified to reduce, suppress, inhibit, or silence one or more genes that code for proteins associated with a competitive disadvantage over non-genetically modified progenitor cells.In yet another embodiment, the progenitor cells of the population described herein are genetically modified to express one or more genes that give the cells a competitive advantage and to suppress or silence one or more genes associated with a competitive disadvantage.

[0034] In some embodiments, the population of glial precursor cells is genetically modified to express one or more genes that give the glial precursor cells a competitive advantage over non-genetically modified glial precursor cells.In other embodiments, the glial precursor cells are genetically modified to reduce, suppress or silence one or more genes associated with a competitive disadvantage over non-genetically modified glial precursor cells.In yet another embodiment, the glial precursor cells of the population described herein are genetically modified to express one or more genes that give the cells a competitive advantage, and are genetically modified to suppress or silence one or more genes associated with a competitive disadvantage.

[0035] According to all aspects of the present disclosure, the population of progenitor cells genetically modified as described herein is a mammalian progenitor cell. In some embodiments, the population of glial progenitor cells is a population of human progenitor cells. In some embodiments, the population of glial progenitor cells is a population of human glial progenitor cells.

[0036] In some embodiments, the progenitor cells genetically modified as described herein are glial progenitor cells. In some embodiments, the genetically modified glial progenitor cells are genetically modified bipotent glial progenitor cells. In some embodiments, the genetically modified glial progenitor cells are genetically modified oligodendrocyte-biased glial progenitor cells. In some embodiments, the genetically modified glial progenitor cells are genetically modified astrocyte-biased glial progenitor cells. Described herein are methods and markers for generating and identifying bipotent glial progenitor cells, astrocyte-biased glial progenitor cells, and oligodendrocyte-biased glial progenitor cells.

[0037] Glial progenitor cells suitable for the genetic modifications described herein can be derived from multipotent cells (e.g., neural stem cells) or pluripotent cells (e.g., embryonic stem cells and induced pluripotent stem cells) using methods known in the art or described herein.

[0038] In some embodiments, the glial precursor cells are derived from embryonic stem cells. Embryonic stem cells are derived from the totipotent cells of early mammalian embryos and are capable of unlimited undifferentiated proliferation in vitro. As used herein, the term "embryonic stem cells" refers to cells isolated from an embryo, placenta, or umbilical cord, or immortalized versions of such cells, i.e., embryonic stem cell lines. Suitable embryonic stem cell lines include, but are not limited to, lines WA-01 (H1), WA-07, WA-09 (H9), WA-13, and WA-14 (H14) (Thomson et al., "Embryonic Stem Cell Lines Derived from human Blastocytes," Science 282(5391):1145-47 (1998) and U.S. Patent No. 7,029,913 to Thomson et al., which are incorporated herein by reference in their entireties). Other suitable embryonic stem cell lines include the HAD-C100 cell line (Tannenbaum et al., "Derivation of Xeno-free and GMP-grade Human Embryonic Stem Cells-Platforms for Future Clinical Applications", PLoS One 7(6):e35325 (2012), which is incorporated by reference in its entirety), the WIBR4, WIBR5, WIBR6 cell lines (Lengner et al., "Derivation of Pre-x Inactivation Human Embryonic Stem Cell Line in Physiological Oxygen Conditions", Cell 141(5):872-83 (2010), which is incorporated by reference in its entirety), and the human embryonic stem cell line (HUES) line 1-17 (Cowan et al., "Derivation of Embryonic Stem-Cell Lines from Human Embryonic Stem Cells-Platforms for Future Clinical Applications", PLoS One 7(6):e35325 (2012), which is incorporated by reference in its entirety). Blastocytes," N. Engl. J. Med. 350:1353-56 (2004), which is incorporated herein by reference in its entirety.

[0039] In some embodiments, the glial progenitor cells are derived from induced pluripotent cells (iPSCs). As used herein, "induced pluripotent stem cells" refers to pluripotent cells derived from non-pluripotent cells, such as somatic or tissue stem cells.For example, but not limited to, iPSCs can be derived from embryonic, fetal, neonatal, and adult tissues from peripheral blood, umbilical cord blood, and bone marrow (see, e.g., Cai et al., "Generation of Human Induced Pluripotent Stem Cells from Umbilical Cord Matrix and Amniotic Membrane Mesenchymal Cells," J. Biol. Chem. 285(15):11227-11234 (2010); Giorgetti et al., "Generation of Induced Pluripotent Stem Cells from Human Cord Blood Cells with only Two Factors: Oct4 and Sox2," Nature Protocols, 5(4):811-820 (2010); Streckfuss-Bomeke et al., "Comparative Study of Human-Induced Pluripotent Stem Cells Derived from Bone Marrow Cells, Hair Keratinocytes, and Skin Fibroblasts," Eur. Heart. J. doi:10.1093 / eurheartj / ehs203 (July 12, 2012); Hu et al., "Efficient Generation of Transgene-Free Induced Pluripotent Stem Cells from Normal and Neoplastic Bone Marrow and Cord Blood Mononuclear Cells," Blood doi:10.1182 / blood-2010-07-298331 (February 4, 2011); Sommer et al., "Generation of Human Induced Pluripotent Stem Cells from Peripheral Blood using the STEMCCA Lentiviral Vector," J. Vis. Exp. 68:e4327 doi:10.3791 / 4327 (2012), which are incorporated by reference in their entireties.Exemplary somatic cells that may be used include fibroblasts, e.g., skin fibroblasts obtained by skin sample or biopsy, synoviocytes from synovial tissue, keratinocytes, mature B cells, mature T cells, pancreatic beta cells, melanocytes, hepatocytes, foreskin cells, cheek cells, or lung fibroblasts (see, e.g., Streckfuss-Bomeke et al., "Comparative Study of Human-Induced Pluripotent Stem Cells Derived from Bone Marrow Cells, Hair Keratinocytes, and Skin Fibroblasts," Eur. Heart J. doi:10.1093 / eurheartj / ehs203 (2012), which is incorporated herein by reference in its entirety). While skin and cheek provide a readily available and easily attainable source of suitable cells, virtually any cell can be used. Exemplary stem or progenitor cells suitable for iPSC generation include, but are not limited to, bone marrow progenitor cells, hematopoietic stem cells, adipose-derived stem cells, neural stem cells, and hepatic progenitor cells.

[0040] Autologous, allogeneic, or xenogeneic non-pluripotent cells can be used to generate the iPSCs used to create genetically modified glial progenitor cells. Autologous cells for the generation of iPSCs are, for example, collected from healthy non-recipient donors and / or donor sources with suitable immune tissue compatibility. Xenogeneic cells can be collected from pigs, monkeys, or any other suitable mammals for the generation of iPSCs. Autologous non-pluripotent cells can also be collected from the same subject to be treated. Autologous cells are genetically modified as described herein so that they exhibit normal, non-disease-associated expression and / or activity in addition to pre-administration levels, and may need to be further genetically modified and / or otherwise treated to correct certain dysregulations.

[0041] Induced pluripotent stem cells can be generated by expressing a combination of reprogramming factors in somatic cells. Suitable reprogramming factors that promote and induce iPSC generation include one or more of Oct4, Klf4, Sox2, c-Myc, Nanog, C / EBPα, Esrrb, Lin28, and Nr5a2. In certain embodiments, at least two reprogramming factors are expressed in somatic cells to successfully reprogram somatic cells. In other embodiments, at least three reprogramming factors are expressed in somatic cells to successfully reprogram somatic cells. In other embodiments, at least four reprogramming factors are expressed in somatic cells to successfully reprogram somatic cells.

[0042] iPSCs may be derived by methods known in the art, including the use of integrative viral vectors (e.g., lentiviral vectors, inducible lentiviral vectors, and retroviral vectors), excisable vectors (e.g., transposon and loxP-introduced lentiviral vectors), and non-integrative vectors (e.g., adenoviral and plasmid vectors) to deliver the aforementioned genes that promote cell reprogramming (see, e.g., Takahashi and Yamanaka, Cell 126:663-676 (2006); Okita. et al., Nature 448:313-317 (2007); Nakagawa et al., Nat. Biotechnol. 26:101-106 (2007); Takahashi et al., Cell 131:1-12 (2007); Meissner et al. Nat. Biotech. 25:1177-1181 (2007); Yu et al. Science 318:1917-1920 (2007); Park et al. Nature 451:141-146 (2008); and U.S. Patent Application Publication No. 2008 / 0233610, which are incorporated by reference herein in their entireties.Other methods for generating iPS cells include those described in WO2007 / 069666, WO2009 / 006930, WO2009 / 006997, WO2009 / 007852, WO2008 / 118820, U.S. Patent Application Publication Nos. 2011 / 0200568 to Ikeda et al., 2010 / 0156778 to Egusa et al., 2012 / 0276070 to Musick, and 2012 / 0276636 to Nakagawa, Shi et al., Cell Stem Cell 3(5):568-574 (2008), Kim et al., Nature 454:646-650 (2008), Kim et al., Cell 136(3:411-419 (2009); Huangfu et al., Nature Biotechnology 26:1269-1275 (2008); Zhao et al., Cell Stem Cell 3:475-479 (2008); Feng et al., Nature Cell Biology 11:197-203 (2009); and Hanna et al., Cell 133(2):250-264 (2008), which are incorporated by reference in their entireties.

[0043] Integration-free approaches to derive iPSCs that do not contain transgene sequences, ie, approaches using non-integrative and excisable vectors, are particularly suitable in therapeutic contexts. Suitable methods of iPSC generation utilizing non-integrating vectors include adenoviral vectors (Stadtfeld et al., "Induced Pluripotent Stem Cells Generated without Viral Integration", Science 322:945-949 (2008), and Okita et al., "Generation of Mouse Induced Pluripotent Stem Cells without Viral Vectors", Science 322:949-953 (2008), which are incorporated by reference in their entireties), Sendai virus vectors (Fusaki et al., "Efficient Induction of Transgene-Free Human Pluripotent Stem Cells Using a Vector Based on Sendi Virus, an RNA Virus That Does Not Integrate into the Host Genome", Proc Jpn Acad. 85:348-362 (2009), which are incorporated by reference in their entireties), polycistronic minicircle vectors (Jia et al., "A Nonviral Minicircle Vector Methods 7:197-199 (2010), which is incorporated herein by reference in its entirety), and self-replicating selectable episomes (Yu et al., "Human Induced Pluripotent Stem Cells Free of Vector and Transgene Sequences," Science 324:797-801 (2009), which is incorporated herein by reference in its entirety).Suitable methods for iPSC generation using excisable vectors are described in Kaji et al., "Virus-Free Induction of Pluripotency and Subsequent Excision of Reprogramming Factors," Nature 458:771-775 (2009); Soldner et al., "Parkinson's Disease Patient-Derived Induced Pluripotent Stem Cells Free of Viral Reprogramming Factors," Cell 136:964-977 (2009); Woltjen et al., "PiggyBac Transposition Reprograms Fibroblasts to Induced Pluripotent Stem Cells," Nature 458:766-770 (2009); and Yusa et al., "Generation of Transgene-Free Induced Pluripotent Mouse Stem Cells by the PiggyBac Transposon," Nat. Methods. 6:363-369 (2009), which are incorporated herein by reference in their entirety. Suitable methods for iPSC generation also include direct delivery of reprogramming factors as recombinant proteins (Zhou et al., "Generation of Induced Pluripotent Stem Cells Using Recombinant Proteins," Cell Stem Cell 4:381-384 (2009), which is incorporated herein by reference in its entirety) or as whole cell extracts isolated from ESCs (Cho et al., "Induction of Pluripotent Stem Cells from Adult Somatic Cells by Protein-Based Reprogramming without Genetic Manipulation," Blood 116:386-395 (2010), which is incorporated herein by reference in its entirety).

[0044] The methods of iPSC generation described above can be modified to include small molecules that enhance reprogramming efficiency, or even substitutions for reprogramming factors.

[0045] These small molecules include, but are not limited to, epigenetic modulators such as the DNA methyltransferase inhibitor 5'-azacytidine, the histone deacetylase inhibitor VPA, and the G9a histone methyltransferase inhibitors BIX-01294 and BayK8644, L-type calcium channel agonists. Other small molecule reprogramming factors include those that target signaling pathways, such as TGF-β inhibitors and kinase inhibitors (e.g., Kenpaullone) (see review by Sommer and Mostoslavsky, "Experimental Approaches for the Generation of Induced Pluripotent Stem Cells," Stem Cell Res.Ther.1:26 doi:10.1186 / scrt26 (2010), which is incorporated herein by reference in its entirety).

[0046] Methods for obtaining highly enriched preparations of glial progenitor cells from iPSCs or embryonic stem cells (e.g., human embryonic stem cells), which are suitable for treating the neuropsychiatric disorders described herein, are disclosed in WO 2014 / 124087 to Goldman and Wang, and in Wang et al., “Human iPSC-Derived Oligodendrocyte Progenitors Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination,” Cell Stem Cell 12(2):252-264 (2013), which are incorporated by reference in their entireties.

[0047] In yet another embodiment, glial progenitor cells can be extracted directly from embryonic, fetal, or adult brain tissue containing a mixed population of cells by using promoter-specific isolation techniques, as described in U.S. Patent Application Publication Nos. 20040029269 and 20030223972 to Goldman, which are incorporated by reference in their entireties. In accordance with this embodiment, glial progenitor cells are isolated from the ventricular or subventricular zones of the brain, or from subcortical white matter.

[0048] In some embodiments, it may be preferable to enrich cell preparations containing glial progenitor cells before or after genetic modification to increase the concentration and / or purity of glial progenitor cells that exhibit a competitive advantage for therapeutic administration. Thus, in one embodiment, glial progenitor cells are isolated from a mixed population of cells using the A2B5 monoclonal antibody (mAb), which recognizes and binds to gangliosides that are initially present on glial progenitor cells in the developmental or differentiation process (Nunes et al., "Identification and Isolation of Multipotential Neural Progenitor Cells From the Subcortical White Matter of the Adult Human Brain." Nat Med. 9(4):439-47 (2003), which is incorporated herein by reference in its entirety). Using the A2B5 mAb, glial progenitor cells can be isolated, enriched, or purified from a mixed population of cell types. In another embodiment, a purified or enriched preparation of bipotential glial progenitor cells is generated using selection of CD140α / PDGFRα positive cells. In another embodiment, CD9 positive cell selection is used to generate a purified or enriched preparation of oligodendrocyte-biased glial progenitor cells. In yet another embodiment, both CD140α / PDGFRα and CD9 positive cell selection is used to generate a purified or enriched preparation of oligodendrocyte-biased glial progenitor cells. In another embodiment, CD44 positive cell selection is used to generate a purified or enriched preparation of astrocyte-biased glial progenitor cells (Liu et al., "CD44 Expression Identifies Astrocyte-Restricted Precursor Cells," Dev. Biol. 276(1):31-46 (2004), which is incorporated herein by reference in its entirety). In another embodiment, both CD140α / PDGFRα and CD44 positive cell selection is used to generate a purified or enriched preparation of oligodendrocyte-biased glial progenitor cells.In another embodiment, purified or enriched preparations of oligodendrocyte-biased glial progenitor cells are generated using CD140α / PDGFRα, CD9, and CD44 positive cell selection.

[0049] The genetically modified glial progenitor cell population described herein is preferably negative for the PSA-NCAM marker and / or other neuronal lineage markers, and / or negative for one or more inflammatory cell markers, such as negative for the CD11 marker, negative for the CD32 marker, and / or negative for the CD36 marker (which is a marker for microglia). Optionally, the preparation of glial progenitor cells is negative for any combination or subset of these additional markers. Thus, for example, the preparation of glial progenitor cells is negative for any one, two, three, or four of these additional markers.

[0050] In accordance with the present invention, the population of genetically modified glial progenitor cells described herein comprises at least about 80% glial progenitor cells, including, for example, about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% glial progenitor cells. The population of genetically modified glial progenitor cells is preferably devoid of other cell types (e.g., containing less than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1%), such as neurons or cells of neuronal lineage, fibrous astrocytes and cells of fibrous astrocyte lineage, multipotent cells, and pluripotent stem cells (such as ES cells). Optionally, the exemplary cell population is a substantially pure population of glial progenitor cells.

[0051] Positive and / or negative selection for the cell marker of interest (e.g., PDGFRα, A2B5, and / or CD44 markers) can be performed sequentially or sequentially, and can be performed using conventional methods known in the art, such as immunopanning. The selection method optionally includes the use of fluorescent sorting (FACS), magnetic sorting (MACS), or any other method that allows for rapid and efficient cell sorting. Examples of methods for cell sorting, at least with respect to compositions and methods for cell selection and sorting, are taught in U.S. Patent No. 6,692,957 to Goldman, which is incorporated herein by reference in its entirety.

[0052] Generally, cell sorting methods use detectable moieties. Detectable moieties include any suitable direct or indirect label, including but not limited to enzymes, fluorophores, biotin, chromophores, radioisotopes, colored beads, electrochemical moieties, chemically modified moieties, or chemiluminescent moieties. Common fluorescent moieties include fluorescein, cyanine dyes, coumarin, phycoerythrin, phycobiliproteins, dansyl chloride, Texas Red, and lanthanide complexes, or derivatives thereof.

[0053] The genetically modified glial progenitor cell populations described herein, including enriched preparations, can optionally be expanded in culture to increase the total number of cells for therapeutic administration. The cells can be expanded by either continuous or pulsed exposure to PDGF-AA or AB as mitogens that support the expansion of oligodendrocyte progenitor cells, and they can be exposed to fibroblast growth factors, including FGF2, FGF4, FGF8, and FGF9, which can support the mitotic expansion of glial progenitor cells but bias their differentiation into a mixed population of astrocytes and oligodendrocytes. Cells can also be expanded in medium supplemented with a combination of FGF2, PDGF, and NT3, which can optionally be supplemented with either platelet-depleted serum or whole serum (see Nunes et al., "Identification and Isolation of Multipotent Neural Progenitor Cells from the Subcortical White Matter of the Adult Human Brain," Nature Medicine 9:239-247; Windrem et al., "Fetal and Adult Human Oligodendrocyte Progenitor Cell Isolates Myelinate the Congenitally Dysmyelinated Brain," Nature Medicine 10:93-97 (2004), which are incorporated by reference for the methods and compositions described therein).

[0054] As described above, in some embodiments, the population of glial progenitor cells described herein is genetically modified to have a competitive advantage over non-genetically modified glial progenitor cells.In some embodiments, the cells of the isolated population are modified to increase the expression of one or more genes that give the modified cells a competitive advantage compared to non-genetically modified glial progenitor cells.In some embodiments, the cells of the isolated population are modified to decrease or silence the expression of one or more genes that give the modified cells a competitive disadvantage compared to non-genetically modified glial progenitor cells.

[0055] In some embodiments, the isolated populations of glial progenitor cells described herein contain cells that have been modified to express one or more genes that confer a competitive advantage to the cells, and cells that have been modified to reduce expression of one or more genes that confer a competitive disadvantage to the cells.

[0056] In some embodiments, the cells of the isolated population are genetically modified to express one or more genes that confer a competitive advantage and are modified to reduce expression of one or more genes that confer a competitive disadvantage to the glial progenitor cells compared to non-genetically modified glial progenitor cells.

[0057] Genetic modification to express one or more genes that confer a competitive advantage Genes whose expression provides a competitive advantage to progenitor cells were identified using a model of cell competition described in the Examples herein. In particular, differential gene expression between the various cell populations utilized in the model (e.g., healthy glial progenitor cells vs. diseased glial progenitor cells, and similarly, aged healthy progenitor cells vs. diseased progenitor cells) was analyzed and compared to identify genes that confer a competitive advantage and genes that confer a competitive disadvantage to transplanted cells compared to resident cells.

[0058] One or more genes identified herein that provide cells with a competitive advantage over resident cells upon transplantation (advantageous genes) are provided in Table 1 below by their gene names. The Entrez ID accession numbers and Ensembl IDs for each gene are also provided in Table 1, which are each incorporated by reference in their entirety for their disclosure of the gene sequences and the corresponding proteins encoded by each sequence. All gene products referred to in the present invention include wild-type gene products and functional variants thereof. A "functional variant of a gene product" refers to a modified gene product (e.g., by deletion, substitution, insertion, glycosylation, etc.) that retains at least 50% of the biological activity of the unmodified (wild-type) gene product in a competitive assay.

[0059] [Table 1-1]

[0060] [Table 1-2]

[0061] [Table 1-3]

[0062] [Table 1-4]

[0063] In some embodiments, the glial progenitor cells of the isolated population described herein are genetically modified to increase expression of one or more genes listed in Table 1 compared to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population described herein are genetically modified to increase expression of any two of the above-mentioned genes compared to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any three of the above-mentioned genes. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any four of the above-mentioned genes. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more of the above-identified genes.

[0064] In addition to the genes provided in Table 1, a set of top ranked genes is provided in Table 2 below, which additionally includes genes that are upregulated in favored cells (winners) but simultaneously repressed in unfavored cells ("losers"). In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any one of the genes provided in Table 2 below, compared to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any one, two, or more genes selected from the genes in Table 2, compared to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any three of the genes described below. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any four of the genes described below. In some embodiments, the isolated population of glial progenitor cells are modified to increase expression of any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or all 24 of these genes compared to non-genetically modified progenitor cells.

[0065] [Table 2]

[0066] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more genes selected from the genes listed in Table 2 relative to non-genetically modified progenitor cells.

[0067] Table 3 provides another embodiment of transcripts conferring benefit, which include top ranked genes that show significant transcriptional upregulation in WT cells representing diseased and unfavourable HD-derived cells compared to WT cells engrafted alone, which also show significant transcriptional downregulation in unfavourable HD cells compared to HD cells engrafted alone.

[0068] [Table 3]

[0069] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more genes selected from the genes listed in Table 3 relative to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any 3, 4, 5, 6, 7, 8, 9, 10 or 11 of the genes in Table 3.

[0070] Table 4 provides another set of genes that confer competitive advantage.

[0071] [Table 4]

[0072] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more genes selected from the genes listed in Table 4 relative to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 of the genes in Table 4.

[0073] Table 5 provides another set of genes that confer a competitive advantage. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more genes selected from the genes listed in Table 5 relative to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 of the genes in Table 5.

[0074] [Table 5]

[0075] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more genes selected from the genes listed in Table 5 relative to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of any 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 of the genes in Table 5.

[0076] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more genes selected from the group consisting of LY6H, MIA, GADD45A, ITM2A and ITM2B.

[0077] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more genes at the mRNA level by 50% or more, 100% or more, 150% or more, 200% or more, 300% or more, 400% or more, 500% or more, 600% or more, 700% or more, 800% or more, 900% or more, or 1000% or more.

[0078] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more genes at the protein level by 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100% or more.

[0079] In order to express one or more genes that confer a competitive advantage in glial progenitor cells as described herein, the polynucleotides encoding one or more genes are ligated into a nucleic acid construct suitable for glial progenitor cell expression.The nucleic acid construct is then introduced into glial progenitor cells or into less differentiated progenitor / stem cell populations from which glial progenitor cells are derived, such as neural progenitor cells, embryonic stem cells, induced pluripotent stem cells, etc.

[0080] Nucleic acid constructs comprising one or more polynucleotides encoding any one or more of the genes in Table 1 or Table 2 further comprise one or more promoter and / or enhancer sequences for directing transcription of the polynucleotide sequences in a cell in a constitutive or inducible manner.

[0081] In some embodiments, the promoter sequence for directing the transcription of polynucleotide sequences in glial precursor cells includes a constitutive promoter.Constitutive promoters suitable for use with some embodiments described herein include promoter sequences that are active under most environmental conditions and in most types of cells, such as cytomegalovirus (CMV) and Rous sarcoma virus (RSV).Other suitable promoters for inclusion in the genetically modified glial precursor cells of the present disclosure include, but are not limited to, human elongation factor 1 alpha promoter ("EF1A"), human ubiquitin C promoter ("UBC"), and phosphoglycerokinase ("PGK") promoter.

[0082] In some embodiments, the promoter sequence for directing the transcription of the polynucleotide sequence in the glial precursor cell includes an inducible promoter and / or operator system. Suitable inducible promoter and / or operator systems for inclusion in the genetically modified cells of the present disclosure are well known in the art and include, but are not limited to, tetracycline-controlled operator systems, cumate-controlled operator systems, rapamycin-inducible systems, FKCsA-inducible systems, and ABA-inducible systems (see, for example, Kallunki et al., "How to Choose the Right Inducible Gene Expression System for Mammalian Studies?" Cells 8(8):796(2019); US Patent No. 8,728,759; and US Patent No. 7,745,592, which are incorporated herein by reference in their entirety).

[0083] In some embodiments, the inducible promoter is a tetracycline-controlled operator system comprising a repression-based construct, where a Tet operator ("TetO") is inserted between the constitutive promoter and the gene of interest, and binding of a Tet repressor ("TetR") to the operator represses downstream transcription of the nucleic acid sequence of interest (see, e.g., Kallunki et al., "How to Choose the Right Inducible Gene Expression System for Mammalian Studies?" Cells 8(8):796 (2019), which is incorporated by reference in its entirety). According to such an embodiment, addition of tetracycline (or the synthetic tetracycline derivative doxycycline) results in disruption of the association between TetR and TetO, thereby causing TetO-dependent transcription of the nucleic acid sequence of interest.

[0084] In some embodiments, the tetracycline-controlled operator system comprises a Tet-off configuration, where tandem TetO sequences are located upstream of a minimal promoter followed by a nucleic acid sequence of interest (see, e.g., Kallunki et al., "How to Choose the Right Inducible Gene Expression System for Mammalian Studies?" Cells 8(8):796 (2019), which is incorporated by reference in its entirety). According to such an embodiment, a chimeric protein consisting of TetR and VP16, a eukaryotic transactivator from Herpes Simplex Virus Type 1 ("tTA"), is converted into a transcriptional activator, and an expression plasmid is transfected together with the operator plasmid. Thus, culturing cells with tetracycline (or the synthetic tetracycline derivative doxycycline) switches off expression of the nucleic acid sequence of interest, while removing tetracycline switches it on.

[0085] In some embodiments, the tetracycline-controlled operator system comprises a Tet-on configuration, in which the nucleic acid sequence of interest is transcribed in the presence of tetracycline (see, e.g., Kallunki et al., "How to Choose the Right Inducible Gene Expression System for Mammalian Studies?" Cells 8(8):796 (2019), which is incorporated by reference in its entirety). According to such an embodiment, tandem TetO sequences are located upstream of the minimal promoter, followed by the nucleic acid sequence of interest. In the presence of tetracycline (or the synthetic tetracycline derivative doxycycline), mutant rTa ("rtTa") binds to the TetO sequences, thereby activating the minimal promoter.

[0086] In some embodiments, the inducible promoter and / or operator system is a cumate-controlled operator system. Similar to the tetracycline-controlled operator system, the cumate-controlled operator system, the cumate operator ("CuO") and its repressor ("CymR"), may be engineered into repressor, activator, and inverse activator configurations (see, e.g., Kallunki et al., "How to Choose the Right Inducible Gene Expression System for Mammalian Studies?" Cells 8(8):796 (2019), which is incorporated herein by reference in its entirety).

[0087] In some embodiments, the cumate control operator system comprises a repression-based construct, where a cumate operator ("CuO") is inserted between a constitutive promoter and a gene of interest, where binding of a cumate repressor ("CymR") to the operator represses downstream transcription of the nucleic acid sequence of interest. According to such embodiments, addition of cumate releases CymR, thereby causing CuO-dependent gene expression.

[0088] In some embodiments, the cumate controlled operator system comprises an activator construct, in which a chimeric molecule ("cTA") is formed via the fusion of CymR and VP16. In this construct, a minimal promoter is placed downstream of a multimerized operator binding site (e.g., 6xCuO). Transcription of the nucleic acid sequence of interest is controlled by the minimal promoter, which is activated in the absence of cumate.

[0089] In some embodiments, the cumate control operator system comprises a reverse activator construct, in which the nucleic acid sequence is transcribed when cumate is present. According to such an embodiment, the tandem CuO sequence is located upstream of the minimal promoter, followed by the nucleic acid sequence of interest. In the presence of cumate, the cTA mutant ("rcTA") binds to the CuO sequence, thereby activating the minimal promoter.

[0090] Eukaryotic promoters typically contain two types of recognition sequences: the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription start site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. Other upstream promoter elements determine the rate at which transcription is initiated.

[0091] In embodiments where it is desirable to restrict the expression of a particular gene to only glial progenitor cells and not to differentiated cells arising from glial progenitor cells, the promoter utilized in the nucleic acid construct to generate genetically modified glial progenitor cells, including bipotential glial progenitor cells, oligodendrocyte-biased glial progenitor cells, and astrocyte-biased glial progenitor cells, is a promoter of a gene selectively or specifically expressed by glial progenitor cells. Suitable promoter sequences for driving the expression of genes providing a competitive advantage as described herein include, but are not limited to, platelet-derived growth factor alpha (PDGFRA) promoter, zinc finger protein 488 (ZNF488), G protein-coupled receptor (GPR17) promoter, oligodendrocyte transcription factor 2 (OLIG2) promoter, chondroitin sulfate proteoglycan 4 (CSPG4) promoter, and SRY box transcription factor 10 (SOX10).

[0092] The nucleic acid constructs utilized to genetically modify the glial precursor cells described herein can further include enhancer elements. Enhancer elements can stimulate transcription from linked homologous or heterologous promoters up to 1,000-fold. Enhancers are active when placed downstream or upstream from the transcription start site. Many enhancer elements derived from viruses have a wide host range and are active in a variety of tissues. Suitable enhancer elements for use in generating genetically modified glial precursor cells described herein include, for example, the SV40 early gene enhancer, which is suitable for many cell types. Other enhancer / promoter combinations suitable for use include those derived from polyoma virus, human or mouse cytomegalovirus (CMV), various retroviruses, such as murine leukemia virus, mouse or Rous sarcoma virus, and long terminal repeats from HIV (see, for example, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, NY 1983, which is incorporated herein by reference in its entirety).

[0093] In constructing the nucleic acid construct, the promoter is preferably located approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural context, however, as is known in the art, some variation in this distance can be accommodated without loss of promoter function.

[0094] Suitable expression vectors for introducing the nucleic acid construct of interest to genetically modify glial precursor cells as described herein can optionally contain other special elements intended to increase the level of expression of the cloned nucleic acid or to facilitate the identification of cells carrying recombinant DNA. For example, many animal viruses contain DNA sequences that promote extrachromosomal replication of the viral genome in permissive cell types. Plasmids carrying these viral replicons are replicated episomally as long as the appropriate factors are provided by genes carried on the plasmid or by the genome of the host cell.

[0095] The vector may or may not contain a eukaryotic replicon. If a eukaryotic replicon is present, the vector is amplified in eukaryotic cells using a suitable selection marker. If a vector does not contain a eukaryotic replicon, episomal amplification is not possible. Instead, recombinant DNA is integrated into the genome of the engineered cell, where the promoter directs the expression of the desired nucleic acid.

[0096] Examples of mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, pZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 (which are available from Invitrogen), pCI (which is available from Promega), pMbac, pPbac, pBK-RSV and pBK-CMV (which are available from Strategene), pTRES (which is available from Clontech) and derivatives thereof.

[0097] Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can also be used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-1MTHA, and vectors derived from Epstein-Barr virus include pHEBO and p2O5. Other exemplary vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vector that allows expression of proteins under the direction of the SV-40 early promoter, SV-40 late promoter, metallothionein promoter, mouse mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters that have been shown to be effective for expression in eukaryotic cells.

[0098] As described above, viruses are very specialized infectious agents that often evolve to evade host defense mechanisms. Typically, viruses infect and propagate in specialized cell types. The targeting specificity of viral vectors exploits their natural specificity to specifically target a given cell type, thereby introducing recombinant genes into the infected cell. Therefore, the type of vector used by some embodiments of the present invention depends on the cell type to be transformed. The ability to select a suitable vector according to the cell type to be transformed is well within the capabilities of a person skilled in the art, and a general description of such selection considerations is not provided herein.

[0099] Suitable viral expression vectors include, but are not limited to, adenoviral vectors, adeno-associated viral ("AAV") vectors, retroviral vectors, lentiviral vectors, vaccinia viral vectors, herpes viral vectors, and any other vector suitable for the introduction of the encoded nucleic acid inhibitors described herein into a given organism or genetic background by any means that facilitates expression of the encoded nucleic acid inhibitor.

[0100] In some embodiments, the vector is a lentiviral vector (see, e.g., U.S. Patent No. 748,529 to Fang et al.; Ura et al., "Developments in Viral Vector-Based Vaccines," Vaccines 2:624-641 (2014); and Hu et al., "Immunization Delivered by Lentiviral Vectors for Cancer and Infection Diseases," Immunol. Rev. 239:45-61 (2011), which are incorporated by reference in their entireties).

[0101] In some embodiments, the vector is a retroviral vector (see, e.g., U.S. Pat. No. 748,529 to Fang et al., and Ura et al., "Developments in Viral Vector-Based Vaccines," Vaccines 2:624-641 (2014), which are incorporated by reference in their entireties), vaccinia virus, replication-deficient adenoviral vectors, and gutless adenoviral vectors (see, e.g., U.S. Pat. No. 5,872,005, which is incorporated by reference in its entirety).

[0102] In other embodiments, the vector is an adeno-associated virus (AAV) vector (see, e.g., Krause et al., "Delivery of Antigens by Viral Vectors for Vaccination," Ther. Deliv. 2(1):51-70 (2011); Ura et al., "Developments in Viral Vector-Based Vaccines," Vaccines 2:624-641 (2014); Buning et al., "Recent Developments in Adeno-associated Virus Vector Technology," J. Gene Med. 10:717-733 (2008), each of which is incorporated by reference in its entirety).

[0103] Methods for creating and isolating viral expression vectors suitable for use as vectors are known in the art (see, e.g., Bulcha et al., "Viral Vector Platforms within the Gene Therapy Landscape," Nature 6:53 (2021); Bouard et al., "Viral Vectors: From Virology to Transgene Expression," Br. J. Pharmacol. 157(2):153-165 (2009); Grieger and Samulski, "Adeno-associated Virus as a Gene Therapy Vector: Vector Development, Production and Clinical Applications," Adv. Biochem. Engin / Biotechnol. 99:119-145 (2005); Buning et al., "Recent Developments in Adeno-associated Virus Vector Technology," J. Gene Med. 10:717-733 (2008), each of which is incorporated by reference in its entirety).

[0104] A variety of methods can be used to introduce the expression vectors of some embodiments of the present invention into glial precursor cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989); Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995); Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995); Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988); and Gilboa et al. Biotechniques 4(6):504-512, 1986, which are incorporated herein by reference in their entireties, and include, for example, stable or transient transfection, lipofection, electroporation, and infection with recombinant viral vectors. Additionally, for positive-negative selection methods, see U.S. Patent Nos. 5,464,764 and 5,487,992. Introduction of nucleic acids by viral infection offers several advantages over other methods, such as lipofection and electroporation, since higher transfection efficiencies can be obtained due to the infectivity of the virus.

[0105] Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers. Nanoparticles are also contemplated.

[0106] The genetically modified glial progenitor cells described herein are modified according to the present invention to contain a recombinant gene vector at any point prior to transplantation into a subject in need thereof. For example, in one embodiment, the recombinant gene construct is introduced into a bipotential glial progenitor cell, an oligodendrocyte-biased progenitor cell, or an astrocyte-biased progenitor cell immediately prior to transplantation. In another embodiment, the recombinant gene construct is introduced into a precursor cell of a glial progenitor cell, such as a neural progenitor cell or a pluripotent stem cell.

[0107] Genetic modifications that suppress the expression of one or more genes that confer a competitive disadvantage As described above, in some embodiments, the population of glial progenitor cells described herein is genetically modified to suppress, i.e., suppress or silence, one or more genes encoding proteins that confer a competitive disadvantage to the modified cells compared to non-genetically modified glial progenitor cells (disadvantageous genes). One or more genes identified herein that provide cells with a competitive disadvantage against resident cells upon transplantation are provided below in Table 6 by their gene names. The Entrez ID accession numbers and Ensembl IDs for each gene are also provided in Table 3, which are each incorporated by reference in their entirety for their disclosure of gene sequences and the corresponding proteins encoded by each sequence. All gene products referred to in the present invention include wild-type gene products and functional variants thereof. A "functional variant of a gene product" refers to a modified gene product (e.g., by deletion, substitution, insertion, glycosylation, etc.) that retains at least 50% of the biological activity of the unmodified (wild-type) gene product in a competitive assay.

[0108] [Table 6-1]

[0109] [Table 6-2]

[0110] Thus, in some embodiments, the glial progenitor cells of the isolated population described herein are genetically modified to reduce or silence the expression of one or more genes listed in Table 6 compared to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population described herein are genetically modified to reduce or silence the expression of any two or more of the above-mentioned genes in Table 6 compared to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence the expression of any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more of the above-identified genes. In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence the expression of any three of the above-mentioned genes. In some embodiments, the glial progenitor cells of the isolated population are modified to suppress or silence the expression of any four of the above-mentioned genes.

[0111] In addition to the genes provided in Table 6, a group of top ranked genes is provided in Table 7 below, which additionally includes top ranked genes that are downregulated in favored cells (winners) but simultaneously upregulated in unfavored cells ("losers"). In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence expression of any one of the genes provided in Table 6 compared to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence expression of any two or more of the genes provided in Table 6 compared to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence expression of any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty-one, twenty-two, twenty-three, or all twenty-four of these genes. In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence expression of any three of the genes in Table 7. In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence expression of any four of the genes in Table 7.

[0112] [Table 7]

[0113] In some embodiments, the glial progenitor cells of the isolated population are modified to reduce expression of one or more genes selected from the genes listed in Table 7 compared to non-genetically modified progenitor cells.

[0114] Table 8 provides another embodiment of the transcripts conferring disadvantage and includes the top ranked genes that show significant transcriptional downregulation in WT cells represented by diseased HD-derived cells compared to WT cells engrafted alone, and also show significant transcriptional upregulation in disadvantaged HD cells compared to HD cells engrafted alone.

[0115] [Table 8]

[0116] In some embodiments, the glial progenitor cells of the isolated population are modified to reduce expression of one or more genes selected from the genes listed in Table 8. In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence expression of any 3, 4, 5, 6, 7, 8, 9 or 10 of the genes in Table 8.

[0117] Table 9 provides another set of genes that confer a competitive disadvantage.

[0118] [Table 9]

[0119] In some embodiments, the glial progenitor cells of the isolated population are modified to reduce expression of one or more genes selected from the genes listed in Table 9 relative to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence expression of any 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 of the genes in Table 9.

[0120] Table 10 provides another set of genes that confer a competitive disadvantage.

[0121] [Table 10]

[0122] In some embodiments, the glial progenitor cells of the isolated population are modified to reduce expression of one or more genes selected from the genes listed in Table 10 relative to non-genetically modified progenitor cells. In some embodiments, the glial progenitor cells of the isolated population are modified to reduce or silence expression of any 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 of the genes in Table 10.

[0123] In some embodiments, the glial progenitor cells of the isolated population are modified to reduce expression of one or more adverse genes at the mRNA level by 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more.

[0124] In some embodiments, the isolated population of glial progenitor cells are modified to reduce expression of one or more adverse genes at the protein level by 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more.

[0125] In some embodiments, the glial progenitor cells of the isolated population described herein are genetically modified using a nuclease-based gene editing system to suppress the expression of one or more of the aforementioned genes involved in conferring a competitive disadvantage to glial progenitor cells.As used herein, the term "nuclease-based gene editing system" refers to a system that includes a nuclease or its derivative, including a catalytically inactivated nuclease, which is recruited to a target sequence in the genome.Suitable nuclease-based systems that can be utilized to genetically modify the glial progenitor cell population described herein include, but are not limited to, clustered regularly interspaced short palindromic repeats associated ("Cas") protein (e.g., Cas9, Cas12a, and Cas12b) system, zinc finger nuclease ("ZFN") system, or transcription activator-like effector nuclease ("TALEN") system.

[0126] In some embodiments, the nuclease-based gene editing system is a CRISPR / Cas system targeted to suppress or silence expression of one or more of the above identified genes that confer a competitive disadvantage to glial progenitor cells. The CRISPR / Cas system may comprise a Cas protein or a nucleic acid molecule encoding a Cas protein, and a guide RNA comprising a nucleotide sequence that is complementary to a portion of the target DNA sequence of one or more of the identified genes in Table 3 or Table 4.

[0127] As described herein, Cas proteins form ribonucleoprotein complexes with guide RNAs that guide the Cas proteins to target DNA sequences. Suitable Cas proteins include Cas nucleases (i.e., Cas proteins that can introduce double-stranded breaks in target nucleic acid sequences), Cas nickases (i.e., Cas protein derivatives that can introduce single-stranded breaks in target nucleic acid sequences), and nuclease-dead Cas (dCas) proteins (i.e., Cas protein derivatives that do not have any nuclease activity).

[0128] In some embodiments, the Cas protein is a Cas9 protein. As used herein, the term "Cas9 protein" or "Cas9" includes either recombinant or naturally occurring forms of CRISPR associated protein 9 (Cas9), or variants or homologs thereof. In some embodiments, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to a naturally occurring Cas9 protein. In some embodiments, the Cas9 protein is substantially identical to a protein identified by UniProt reference numbers Q99ZW2, G3ECR1, J7RUA5, A0Q5Y3, or J3F2B0 (which are incorporated herein by reference in their entirety), or a variant or homolog having substantial identity thereto. In some embodiments, the Cas9 protein is selected from the group consisting of Cas9 nuclease, Cas9 nickase, and nuclease-dead Cas9 ("dCas9").

[0129] In some embodiments, the Cas protein is a Cas12a protein. As used herein, the term "Cas12a protein" or "Cas12a" includes any recombinant or naturally occurring form of CRISPR associated protein 12 (Cas12a), or a variant or homolog thereof. In some embodiments, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to a naturally occurring Cas12a protein. In some embodiments, the Cas12a protein is substantially identical to a protein identified by UniProt reference numbers A0Q7Q2, U2UMQ6, A0A7C6JPC1, A0A7C9H0Z9, or A0A7J0AY55, which are incorporated by reference herein in their entireties, or a variant or homolog having substantial identity thereto. In some embodiments, the Cas12a protein is selected from the group consisting of Cas12a nuclease, Cas12a nickase, and nuclease-dead Cas12a ("dCas12a").

[0130] In some embodiments, the Cas protein is a Cas12b protein. As used herein, the term "Cas12b protein" or "Cas12b" includes any recombinant or naturally occurring form of CRISPR-associated protein 12 (Cas12b), or a variant or homolog thereof. In some embodiments, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to a naturally occurring Cas12b protein. In some embodiments, the Cas12b protein is substantially identical to a protein identified by UniProt reference numbers T0D7A2, A0A6I3SPI6, A0A6I7FUC4, A0A6N9TP17, A0A6M1UF64, A0A7Y8V748, A0A7X7KIS4, A0A7X8X2U5, or A0A7X8UMW7, which are incorporated by reference herein in their entireties, or a variant or homolog having substantial identity thereto. In some embodiments, the Cas12b protein is selected from the group consisting of Cas12b nuclease, Cas12b nickase, and nuclease-dead Cas12b ("dCas12b").

[0131] As used herein, the term "guide RNA" or "gRNA" refers to a ribonucleotide sequence that can bind to a nucleoprotein, thereby forming a ribonucleoprotein complex. Guide RNA includes (i) a DNA targeting sequence that is complementary to a target nucleic acid sequence (e.g., a sequence of a specified gene that confers a competitive disadvantage to glial progenitor cells), and (ii) a binding sequence for a Cas protein (e.g., Cas9 nuclease, Cas9 nickase, dCas9, Cas12a nuclease, Cas12a nickase, or dCas12a).

[0132] In some embodiments, the guide RNA is a single guide RNA molecule (single RNA nucleic acid), which may include "single guide RNA" or "sgRNA". In other embodiments, the nucleic acid of the present disclosure includes two RNA molecules (e.g., connected together via hybridization at a linker sequence). Thus, the term guide RNA is inclusive and refers to both bi-molecule and single molecule nucleic acids (e.g., sgRNA).

[0133] In some embodiments, the gRNA is 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more nucleic acid residues in length. In some embodiments, the gRNA is 10-30 nucleic acid residues in length. In some embodiments, the gRNA is 20 nucleic acid residues in length. In some embodiments, the gRNA is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 , 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more nucleic acid or sugar residues in length. In some embodiments, the gRNA is 5-50, 10-50, 15-50, 20-50, 25-50, 30-50, 35-50, 40-50, 45-50, 5-75, 10-75, 15-75, 20-75, 25-75, 30-75, 35-75, 40-75, 45-75, 50-75, 55-75, 60-75, 65-75, 70-75, The gRNA is 5, 5-100, 10-100, 15-100, 20-100, 25-100, 30-100, 35-100, 40-100, 45-100, 50-100, 55-100, 60-100, 65-100, 70-100, 75-100, 80-100, 85-100, 90-100, 95-100, or more residues in length. In some embodiments, the gRNA is 10-15, 10-20, 10-30, 10-40, or 10-50 residues in length.

[0134] In some embodiments, the CRISPR / Cas system is targeted to silence any one or more genes selected from the genes provided in Table 3. In some embodiments, the CRISPR / Cas system is targeted to silence any one or more genes selected from the genes provided in Table 4.

[0135] In some embodiments, the nuclease-based gene editing system utilized to suppress or silence the expression of one or more genes identified above in Table 3 or Table 4 is a CRISPR interference or "CRISPRi" system. The CRISPRi system allows sequence-specific suppression of gene expression. The CRISPRi system includes a nuclease-dead Cas ("dCas") protein (i.e., a nuclease-inactivated Cas protein) to block transcription of a target gene without cleaving the target DNA sequence. Nuclease-inactivated Cas proteins and methods for making nuclease-inactivated Cas proteins are well known in the art (see, for example, Qi et al., "Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression," Cell 152(5):1173-1183 (2013), which is incorporated herein by reference in its entirety).

[0136] A CRISPRi system suitable for genetically modifying glial progenitor cells as described herein may comprise: (i) a nuclease-dead Cas (dCas) protein (i.e., a nuclease-inactivated Cas protein) or a nucleic acid molecule encoding a dCas protein; and (ii) a target gene, i.e., a guide RNA comprising a nucleotide sequence complementary to a portion of any one or more of the above-identified genes that confer a competitive disadvantage to glial progenitor cells.

[0137] In some embodiments, the nuclease death Cas (dCas) protein is selected from the group consisting of dCas9, dCas12a, and dCas12b.

[0138] In some embodiments, the nuclease death Cas (dCas) protein is a fusion protein comprising a Cas protein and one or more epigenetic modulators suitable for inhibiting or silencing expression of one or more genes identified above in Table 3 or identified in Table 4. Suitable epigenetic modulators include, but are not limited to, DNA methyltransferase enzymes (e.g., DNA methyltransferase 3 alpha ("DNMT3A") and DNA methyltransferase 3-like ("DNMT3L")), histone demethylases (e.g., lysine-specific histone demethylase 1 ("LSD1")), histone methyltransferase enzymes (e.g., G9A and SuV39h1), transcription factor recruitment domains (e.g., Krüppel-associated box domain ("KRAB"), KRAB-methyl-CpG binding protein 2 domain ("KRAB-MeCP2"), enhancer of Zeste2 ("EZH2")), zinc finger transcriptional repressor domains (e.g., spalt-like transcription factor 1 ("SALL1") and suppressor of defective silencing protein 3 ("SDS3")) (see, e.g., Brezgin et al., "Dead Cas Systems: Types, Principles, and Applications,” Int. J. Mol. Sci. 20:6041 (2019), which is incorporated by reference in its entirety.

[0139] In some embodiments, the epigenetic modulator is selected from the group consisting of DNMT3A, DNMT2L, LSD1, KRAB, KRAB-MeCP2, EZH2, SALL1, SDS3, G9A, and Suv39h1 (see, e.g., Yeo et al., "An Enhanced CRISPR Repressor for Targeted Mammalian Gene Regulation," 15(8):611-616 (2018); Alerasool et al., "An Efficient KRAB Domain for CRISPRi Applications in Human Cells," Nature Methods 17:1093-1096 (2020); and Duke et al., "An Improved CRISPR / dCas9 Interference Tool for Neuronal Gene Suppression," Frontiers in Genome Editing 2:9 (2020), which are incorporated by reference in their entireties).

[0140] In some embodiments, the isolated glial progenitor cell population described herein is genetically modified using a targeted CRISPRi system to silence one or more genes selected from the genes provided in Table 3 or the genes provided in Table 4.

[0141] In some embodiments, the nuclease-based gene editing system suitable for the genetically modified glial progenitor cells described herein comprises a FokI nuclease editing system. In this system, the glial progenitor cells are genetically modified to contain a first nucleic acid molecule encoding a first sequence-specific gene editing nuclease and a first DNA-binding motif, where the first DNA-binding motif hybridizes to a first DNA sequence of any one of the genes in Table 3 or Table 4 identified as conferring a competitive disadvantage to the glial progenitor cells. The glial progenitor cells further comprise or contain a second nucleic acid molecule encoding a second sequence-specific gene editing nuclease and a second DNA-binding motif, where the second DNA-binding motif binds to a second DNA sequence, which is a gene that binds to the first DNA-binding motif. The first, second, or both nucleotide sequences further comprise an inducible promoter system sequence operably linked to the respective sequences to allow for controlled suppression of one or more target genes.

[0142] Suitable sequence-specific gene editing nuclease systems for use in preparing the genetically modified cells described herein are well known in the art and include, but are not limited to, zinc finger nucleases ("ZFNs") and transcription activator-like effector nucleases ("TALENs").

[0143] In some embodiments, the first and second gene editing nucleases are ZFNs. According to such embodiments, the first and second DNA binding motifs are zinc finger motifs. ZFNs are artificial endonucleases that contain at least one zinc finger motif (e.g., at least 2, 3, 4, or 5 zinc finger motifs) fused to a nuclease domain (e.g., the cleavage domain of FokI restriction enzyme). Heterodimerization of two individual ZFNs at a target nucleic acid sequence can result in the cleavage of the target sequence. For example, two individual ZFNs can bind to opposite strands of a target DNA sequence to induce double-strand breaks in the target nucleic acid sequence. Methods for designing suitable ZFN genetically modified glial progenitor cells as described herein are well known in the art (e.g., Urnov et al., "Genome Editing with Engineered Zinc Finger Nucleases," Nat. Rev. Genet. 11(9):636-646 (2010); Gaj et al., "Targeted Gene Knockout by Direct Delivery of Zinc-Finger Nuclease Proteins," Nat. Methods 9(8):805-807 (2012); U.S. Patent No. 6,534,261; U.S. Patent No. 6,607,882; U.S. Patent No. 6,746,838; U.S. Patent No. 6,794,136; U.S. Patent No. 6,824,978; U.S. Patent No. 6,866,997; U.S. Patent No. 6,933,113; U.S. Patent No. 6,979,539; U.S. Patent No. 7,013,219; U.S. Patent No. 7,030,215; U.S. Patent No. 7,220,719; U.S. Patent No. 7,241,573; U.S. Patent No. 7,241,574; U.S. Patent No. 7,585,849; U.S. Patent No. 7,595,376; U.S. Patent No. 6,903,185; and U.S. Patent No. 6,479,626, which are incorporated by reference herein in their entireties. In some embodiments, the first and second gene-editing nucleases are ZFNs. According to such embodiments, the first and second DNA-binding motifs are zinc finger motifs.

[0144] In some embodiments, the first and second gene editing nucleases are transcription activator-like effector nucleases (TALENs). TALENs are engineered transcription activator-like effector nucleases that contain a DNA binding domain and a nuclease domain (e.g., the cleavage domain of FokI restriction enzyme). The DNA binding domain contains a series of 33-35 amino acid repeat domains that each recognize a single bp. Heterodimerization of two individual TALENs at a target nucleic acid sequence can result in cleavage of the target sequence. For example, two individual TALENs can bind to opposite strands of a target DNA sequence to induce a double-strand break in the target nucleic acid sequence. Methods for designing suitable TALENs for inclusion in genetically modified cells as disclosed herein are well known in the art (e.g., Scharenberg et al., "Genome Engineering with TAL-Effector Nucleases and Alternative Modular Nuclease Technologies," Curr. Gene Ther. 13(4):291-303 (2013); Gaj et al., "Targeted Gene Knockout by Direct Delivery of Zinc-Finger Nuclease Proteins," Nat. Methods 9(8):805-807 (2012); Beurdeley et al., "Compact Designer TALENs for Efficient Genome Engineering," Nat. Methods 9(8):805-807 (2012). "Engineering", Nat. Commun. 4:1762 (2013); U.S. Patent No. 8,440,431; U.S. Patent No. 8,440,432; U.S. Patent No. 8,450,471; U.S. Patent No. 8,586,363; and U.S. Patent No. 8,697,853, which are incorporated herein by reference in their entirety). In some embodiments, the first and second gene editing nucleases are TALENs. According to such embodiments, the first and second DNA binding motifs are TAL motifs.

[0145] In some embodiments, the first and second sequence-specific gene editing nucleases comprise a FokI nuclease domain.

[0146] The genetically modified glial precursor cells according to this embodiment are generated by introducing one or more expression vectors comprising a first and a second nucleotide sequence encoding a nuclease editing protein linked to a DNA-binding motif. Suitable expression vectors and methods for introducing such vectors into glial precursor cells are described above. As mentioned above, in some embodiments, these nucleotide sequences may be operably linked to an inducible promoter / operator sequence. Suitable inducible promoter sequences for use in the system according to the present invention are well known in the art and are described in more detail above.

[0147] Genetic modification to express one or more youth-associated genes that confer a competitive advantage in young GPCs Another aspect of the invention relates to isolated populations of genetically modified glial progenitor cells and their competitive advantage over non-genetically modified glial progenitor cells of the same type.

[0148] In some embodiments, the glial progenitor cells of the isolated population are modified to increase the expression of one or more youth-associated genes selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3 and ZNF195. These genes are listed in Table 11. The expression of these genes is closely related to the superiority of transplanted young human glial progenitor cells over resident older human glial progenitor cells.

[0149] [Table 11]

[0150] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more youth-associated genes selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB, and TFDP1.

[0151] In some embodiments, the isolated population of glial precursor cells are modified to increase expression of CEBPZ, MYBL2, MYC, NFYB, or TFDP1.

[0152] In some embodiments, the isolated population of glial progenitor cells are modified to increase expression of a combination of CEBPZ and MYBL2, CEBPZ and MYC, CEBPZ, CEBPZ and NFYB, CEBPZ and TFDP1, MYBL2 and MYC, MYBL2 and NFYB, MYBL2 and TFDP1, MYC and NFYB, MYC and TFDP1, or NFYB and TFDP1.

[0153] In some embodiments, the isolated population of glial progenitor cells are modified to increase expression of a combination of CEBPZ, MYBL2 and MYC; CEBPZ, MYBL2 and NFYB; CEBPZ, MYBL2 and TFDP1; CEBPZ, MYC and NFYB; CEBPZ, MYC and TFDP1; CEBPZ, NFYB and TFDP1; MYBL2, MYC and NFYB; MYBL2, MYC and TFDP1; or MYC, NFYB and TFDP1.

[0154] In some embodiments, the isolated population of glial progenitor cells are modified to increase expression of a combination of CEBPZ, MYBL2, MYC and NFYB, CEBPZ, MYBL2, MYC and TFDP1; or MYBL2, MYC, NFYB and TFDP1.

[0155] In some embodiments, CEBPZ, MYBL2, MYC, NFYB and / or TFDP1 described above are human gene products having their respective protein sequences listed in SEQ ID NOs:4-10.

[0156] All gene products referred to in the present invention include wild-type gene products and functional variants thereof. A "functional variant of a gene product" refers to a modified gene product (e.g., by deletion, substitution, insertion, glycosylation, etc.) that retains at least 50% of the biological activity of the unmodified (wild-type) gene product in a competitive assay.

[0157] In some embodiments, the glial progenitor cells of the isolated population are modified to increase the expression of one or more youth-associated genes that selectively activate one or more signaling pathways selected from the group consisting of YAP1, MYC, and MYCN, so as not to result in unregulated growth of these cells, but to confer a competitive advantage to the glial cells. In some embodiments, the glial progenitor cells of the isolated population are modified to increase the expression of one or more genes that selectively activate TEAD2 and the YAP1 signaling pathway.

[0158] As used herein, the term "healthy human glial progenitor cells" refers to glial progenitor cells that function normally and can expand and / or differentiate into functional oligodendrocytes and astrocytes. In some embodiments, transplanted healthy human glial progenitor cells can outcompete the host glial pool and ultimately colonize and dominate the recipient brain.

[0159] As used hereinafter, the term "youth-associated genes" refers to genes that have significantly increased expression in young glial progenitor cells compared to older glial progenitor cells.

[0160] In some embodiments, the term "young glial progenitor cells" refers to stem cells induced to begin differentiation into glial progenitor cells in an in vitro context at differentiation stage 6 according to the protocol of Wang et al. Cell Stem Cell 12, 252-264, 2013, or at equivalent differentiation stages according to other protocols. Compared to older glial progenitor cells, young glial progenitor cells may have one or more of the following characteristics: (i) grow or differentiate or divide faster, (ii) have longer telomeres and / or higher telomerase activity, and (iii) have lower levels than older ones of senescence-associated transcripts encoding CDKN1A (p21Cip1) and CDKN2 / p16 (INK4) and p14 (ARF).

[0161] In some embodiments, the term "young glial progenitor cells" refers to glial progenitor cells that are within 1-20 weeks of transplantation into a host. The terms "older glial progenitor cells" or "old glial progenitor cells" are used in contrast to the term "young glial progenitor cells."

[0162] In some embodiments, the young glial progenitor cells are glial progenitor cells cultured at differentiation stage 6 according to the protocol of Wang et al. Cell Stem Cell 12, 252-264, 2013, or at an equivalent differentiation stage according to other protocols, for 1-5, 5-10, 5-20, 5-30, 10-20, 10-30, or 20-30 weeks.

[0163] In some embodiments, old glial progenitor cells are cultured at differentiation stage 6 according to the protocol of Wang et al. Cell Stem Cell 12, 252-264, 2013, or at equivalent differentiation stages according to other protocols, such as 5-100, 5-10, 5-20, 5-30, 5-40, 5-50, 5-60, 5-70, 5-80, 5-90, 10-20, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10-90, 10-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-100, 20-2 ... The glial precursor cells are cultured for 0, 20-100, 30-40, 30-50, 30-60, 30-70, 30-80, 30-90, 30-100, 40-50, 40-60, 40-70, 40-80, 40-90, 40-100, 50-60, 50-70, 50-80, 50-90, 50-100, 60-70, 60-80, 60-90, 60-100, 70-80, 70-90, 70-100, 80-90, 80-100, or 90-100 weeks.

[0164] In some embodiments, the old glial progenitor cells are 5-10, 5-20, 5-30, 5-40, 5-50, 5-60, 5-70, 5-80, 5-90, 5-100, 10-20, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10-90, 10-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-100, 30-40, 30-50, 30-60 , 30-70, 30-80, 30-90, 30-100, 40-50, 40-60, 40-70, 40-80, 40-90, 40-100, 50-60, 50-70, 50-80, 50-90, 50-100, 60-70, 60-80, 60-90, 60-100, 70-80, 70-90, 70-100, 80-90, 80-100, or 90-100 weeks.

[0165] In some embodiments, old glial progenitor cells refer to native glial progenitor cells in the host, while young glial progenitor cells refer to glial progenitor cells engrafted or transplanted into the host.

[0166] As used hereinafter, the term "significantly increased expression" refers to an increase of at least 20% at the mRNA or protein level. In some embodiments, the term "significantly increased expression" refers to an increase of at least 50%, 100%, 150%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% or 1000% at the mRNA level.

[0167] As used hereinafter, the term "significantly increased expression" refers to an increase of at least 20% at the mRNA or protein level. In some embodiments, the term "significantly increased expression" refers to an increase of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% at the protein level.

[0168] In some embodiments, the isolated population of glial progenitor cells is a glial progenitor cell that is a member of a group that is characterized by a gene encoding one or more youth-related genes selected from the group consisting of: (1) ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195, preferably selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB, and TFDP1; and (2) ACTB, AKR1C1, ANAPC11, AP2B1, APLP2, APOD, ARF5, ARL4A, ARPC3, ARPP19, ATOX1, ATP5F1E, ATP5MC1, ATP5MC3, ATP5MD, ATP5ME, ATP5MF, ATP5MG, ATP5MPL, ATP5PF, ATP6V0B, ATP6V0E1 , ATXN7L3B, B2M, B3GAT2, BEX1, BEX3, BEX5, BLOC1S1, BMERB1, C18orf32, C1orf122, C1QBP, C4orf48, CADM4, CALM1, CALM3, CALR, CANX, CAV2, CC2D1A, CC ND1, CCNI, CD63, CD82, CDC42, CDH2, CFL1, CHCHD2, CHGB, CIAO2B, CLCN3, CLTA, CLTC, CNN3, CNTN1, COTL1, COX4I1, COX6A1, COX6C, COX7A2, COX7C, COX8 A, CPNE8, CPS1, CRNDE, CSPG4, CTHRC1, CUL4B, CYP51A1, DBI, DCX, DDAH1, DDX1, DENND10, DMD, DMRT2, DNAJA2, DPYSL2, DRAP1, DSTN, DYNC1I2, EDF1, EDIL 3, EEF1A1, EEF1B2, EEF2, EID1, EIF3J, ELOB, EMC10, EMP2, ESD, ETV1, FABP7, FAM171B, FAM177A1, FAU, FIS1, FXYD6, GADD45A, GAP43, GCSH, GNAS, GOLM1, GPM6B, GSTP1, H3-3A, H3-3B, HINT1, HNRNPA1, HNRNPA3, HNRNPAB, HNRNPC, HNRNPK, HNRNPM, HNRNPR, HSPA5, IGFBP2, ITGB8, ITM2A, ITM2B, JPT1, KDELR1,<h2 style=";text-align:left;direction:ltr">KLRK1-AS1、KRTCAP2、KTN1、LDHB、LHFPL3、LRRC4B、LY6H、MAP2、MARCKS、MAR CKSL1、MIA、MICOS10、MIF、MIR9-1HG、MMGT1、MPZL1、MT3、MTLN、MTRNR2L12、 MTRNR2L8、MYL12A、MYL12B、NACA、NARS1、NCL、NDUFA1、NDUFA11、NDUFA13、N DUFA3、NDUFA4、NDUFB1、NDUFB11、NDUFB2、NDUFB6、NDUFB7、NDUFC2、NDUFS5 、NEU4、NUCKS1、OAZ1、OLFM2、OSBPL8、OST4、OSTC、PABPC1、PCBP2、PCDH10、P CDH11X、PCDH17、PCDHB2、PCDHGB6、PDGFRA、PDIA6、PEBP1、PEG10、PFN1、PGR MC1、PKIA、PLPP3、PLPPR1、PPIA、PRDX1、PRDX2、PRDX5、PSMB1、PSMB9、PTMS、 PTN、PTPRA、RAB10、RAB14、RAB2A、RAB31、RAC1、RACK1、RMDN2、RAMP1、RO60、R OBO1、RRAGB、RTN3、S100B、SARAF、SAT1、SBDS、SCARB2、SCP2、SCRG1、SEC62、 SELENOK、SELENOT、SELENOW、SERF2、SERPINE2、SET、SH3BGRL、SKP1、SLC25A 6、SLIT2、SLITRK2、SMC3、SMDT1、SMOC1、SMS、SNCA、SNHG29、SNHG6、SNX3、SN X22, SOD1, SOX11, SOX2, SOX9, SPCS2, SPCS3, SRP14, SSR4, STAG2, STMN1, SUP T16H、TALDO1、TBCB、TCEAL7、TCEAL8、TCEAL9、TIMP1、TLE5、TM4SF1、TM9SF3 、TMA7、TMBIM6、TMCO1、TMEM147、TMEM258、TMEM50A、TMOD2、TMSB10、TMSB4X 、TPT1、TRAF4、TRIO、TSC22D4、TSPAN6、TSPAN7、TTC3、TUBB、UBA52、UBL5、UQ CR10、UQCR11、UQCRB、VIM、WSB2、WSCD1、YBX1、YWHAB、YWHAE、ZFAS1、ZNF428、and ZNF462.

[0169] In some embodiments, the isolated population of glial progenitor cells comprises one selected from the group consisting of: (1) ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195, preferably selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB, and TFDP1. or multiple youth-associated genes, and (2) one or more additional genes selected from the group consisting of APOD, B2M, BEX3, BEX5, CCND1, CTHRC1, EDIL3, EMC10, FABP7, GADD45A, ITM2A, LRRC4B, LY6H, MIA, MT3, NEU4, OLFM2, PTMS, RAMP1, SNX3, TRAF4, TRIO, UBA52, and YWHAB.

[0170] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of (1) one or more youth-related genes selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195, preferably selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB, and TFDP1, and (2) one or more additional genes selected from the group consisting of ANAPC11, APOD, ATP5MC3, B2M, CALM1, MT3, NEU4, PEBP1, RAMP1, SOD1, and TBCB.

[0171] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of (1) one or more youth-related genes selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195, preferably selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB, and TFDP1, and (2) one or more additional genes selected from the group consisting of APOD, BEX3, BEX5, CCND1, CTHRC1, EDIL3, EMC10, GADD45A, ITM2A, MIA, TRAF4, and TRIO.

[0172] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of (1) one or more youth-associated genes selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195, preferably selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB, and TFDP1, and (2) one or more additional genes selected from the group consisting of B2M, FABP7, LRRC4B, LY6H, MT3, NEU4, OLFM2, PTMS, RAMP1, SNX3, UBA52, and YWHAB.

[0173] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of (1) one or more youth-associated genes selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3 and ZNF195, preferably selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB and TFDP1, and (2) one or more additional genes selected from the group consisting of LY6H, MIA, GADD45A, ITM2A and ITM2B.

[0174] In some embodiments, the isolated population of glial progenitor cells is selected from the group consisting of: (1) ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195, preferably CEBPZ, MYBL2, MYC, NFYB, and TFDP 1, and (2) increasing expression of one or more youth-associated genes selected from the group consisting of ABCG1, ADGRB1, ADGRG1, AKAP9, AL360181.3, ANKRD10, ARGLU1, ARL4C, ARL16, ARMCX6, ATP1A2, ATP1B3, ATP10B, B3GNT7, BHLHE41, BPTF, BRI3, BX664615.2, BX890604.1, C1QL2, CAMK2N1, CCDC85B, CCNL1, CHCHD10, CHORDC1, CIRBP, CLDN10, COL9A1, COL9A2, CXADR, DANCR, DCXR, DHX36, DLL3, DNAJA 1, DNM3, ECH1, EGR1, EIF1AX, ELAVL3, EMID1, ETFB, FABP5, FAM133A, FAM133B, FBXO2, FERMT1, FIBIN, FOS, FOSB, FSCN1, FSIP2, GAB PB1-AS1, GALR1, GNG8, GNPTAB, GOLGA8A, GOLGA8B, GPR155, GRID2, GRM7, HAPLN1, HMX1, HSPA1A, HSPA1B, HSPH1, HTRA1, IGFBP2, J AG1, JUN, JUNB, KCNIP4, KCNQ1OT1, KLF3-AS1, LAMP2, LINC01116, LINC01301, LINC01896, LRP4, LRRC7, MACF1, MALAT1, MAP3K13, M ASP1, MDH1, MT1E, MT2A, MYT1, NASP, NKTR, NUTM2A-AS1, OFD1, PCDHB5, PCDHGA3, PCDHGB6, PEPD, PHGDH, PLCG2, PMP2, PNISR, PPP1 R14A, PTGDS, RAB3IP, RAF1, RAP1GAP, RARRES2, RBM25, RBMX, REV3L, RHOBTB3, RIMS2, RIT2, RRBP1, RSRP1, S100A1, S100A16, SAT1, The expression of one or more adverse genes selected from the group consisting of SCG2, SEMA3E, SERTAD1, SEZ6L, SEZ6L2, SH3GLB2, SNHG15, SNRNP70, SPARCL1, SRSF5, STAT3, STXBP6, SYNRG, THBS4, TLE4, TMEM176B, TPI1, TSC22D3, USP11, VCAN, WFDC1, WSB1, ZFYVE16, ZNF528, and ZNF528-AS1 is reduced.

[0175] In some embodiments, the glial progenitor cells of the isolated population (1) increase expression of one or more youth-associated genes selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195, preferably selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB, and TFDP1, and (2) increase expression of one or more youth-associated genes selected from the group consisting of ADGRG1. The expression of one or more genes selected from the group consisting of ARL4C, ARMCX6, ATP1A2, ATP1B3, B3GNT7, CXADR, DLL3, FABP5, FIBIN, IGFBP2, LRRC7, MAP3K13, MT1E, MT2A, PCDHGA3, PCDHGB6, PLCG2, PTGDS, SAT1, SEZ6L, SPARCL1, THBS4, and TLE4 is reduced.

[0176] In some embodiments, the glial progenitor cells of the isolated population are modified to (1) increase expression of one or more youth-related genes selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3 and ZNF195, preferably selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB and TFDP1, and (2) decrease expression of one or more genes selected from the group consisting of EGR1, HSPH1, WSB1, RBMX, ARGLU1, TLE4, MACF1, STAT3, FSIP2 and NKTR.

[0177] In some embodiments, the glial progenitor cells of the isolated population have increased expression of one or more beneficial genes: (1) selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, MYC, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195, preferably selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB, and TFDP1; (2) increased expression of one or more beneficial genes selected from the group consisting of ACTB, AKR1C1, ANAPC11, AP2B1, AKR2C1, ANAPC11, AP2B1, AKR1C2, ANAPC12, AP2B1, AKR2C1, ANAPC13, AP2B1, AKR1C2, ANAPC14, AP2B1, AKR2C1, ANAPC15, AP2B1, AKR2C1, ANAPC16, AP2B1, AKR2C1, ANAPC17, AP2B1, AKR2C1, ANAPC18, AP2B1, AKR2C1, ANAPC19, AP2B1, AKR3C1, ANAPC19, AP2B1, AKR3C1, ANAPC19, AP2B1, AKR4C1, ANAPC19, AP2B1, AKR4C1, ANAPC19, AP2B1, AKR5C1, ANAPC20, AP2B2, ANAPC21, AP2B2, ANAPC22, AP2B2, ANAPC23, AP2B2, ANAPC24, AP2B2, ANAPC25, AP2B2, ANAPC26, AP , APLP2, APOD, ARF5, ARL4A, ARPC3, ARPP19, ATOX1, ATP5F1E, ATP5MC1, ATP5MC3, ATP5MD, ATP5ME, ATP5MF, ATP5MG, ATP5MPL, ATP5PF, ATP6V0B, ATP6V0E1 , ATXN7L3B, B2M, B3GAT2, BEX1, BEX3, BEX5, BLOC1S1, BMERB1, C18orf32, C1orf122, C1QBP, C4orf48, CADM4, CALM1, CALM3, CALR, CANX, CAV2, CC2D1A, CC ND1, CCNI, CD63, CD82, CDC42, CDH2, CFL1, CHCHD2, CHGB, CIAO2B, CLCN3, CLTA, CLTC, CNN3, CNTN1, COTL1, COX4I1, COX6A1, COX6C, COX7A2, COX7C, COX8 A, CPNE8, CPS1, CRNDE, CSPG4, CTHRC1, CUL4B, CYP51A1, DBI, DCX, DDAH1, DDX1, DENND10, DMD, DMRT2, DNAJA2, DPYSL2, DRAP1, DSTN, DYNC1I2, EDF1, EDIL 3, EEF1A1, EEF1B2, EEF2, EID1, EIF3J, ELOB, EMC10, EMP2, ESD, ETV1, FABP7, FAM171B, FAM177A1, FAU, FIS1, FXYD6, GADD45A, GAP43, GCSH, GNAS, GOLM1, GPM6B, GSTP1, H3-3A, H3-3B, HINT1, HNRNPA1, HNRNPA3, HNRNPAB, HNRNPC, HNRNPK, HNRNPM, HNRNPR, HSPA5, IGFBP2, ITGB8, ITM2A, ITM2B, JPT1, KDELR1,<h2 style=";text-align:left;direction:ltr">KLRK1-AS1、KRTCAP2、KTN1、LDHB、LHFPL3、LRRC4B、LY6H、MAP2、MARCKS、MAR CKSL1、MIA、MICOS10、MIF、MIR9-1HG、MMGT1、MPZL1、MT3、MTLN、MTRNR2L12、 MTRNR2L8、MYL12A、MYL12B、NACA、NARS1、NCL、NDUFA1、NDUFA11、NDUFA13、N DUFA3、NDUFA4、NDUFB1、NDUFB11、NDUFB2、NDUFB6、NDUFB7、NDUFC2、NDUFS5 、NEU4、NUCKS1、OAZ1、OLFM2、OSBPL8、OST4、OSTC、PABPC1、PCBP2、PCDH10、P CDH11X、PCDH17、PCDHB2、PCDHGB6、PDGFRA、PDIA6、PEBP1、PEG10、PFN1、PGR MC1、PKIA、PLPP3、PLPPR1、PPIA、PRDX1、PRDX2、PRDX5、PSMB1、PSMB9、PTMS、 PTN、PTPRA、RAB10、RAB14、RAB2A、RAB31、RAC1、RACK1、RMDN2、RAMP1、RO60、R OBO1、RRAGB、RTN3、S100B、SARAF、SAT1、SBDS、SCARB2、SCP2、SCRG1、SEC62、 SELENOK、SELENOT、SELENOW、SERF2、SERPINE2、SET、SH3BGRL、SKP1、SLC25A 6、SLIT2、SLITRK2、SMC3、SMDT1、SMOC1、SMS、SNCA、SNHG29、SNHG6、SNX3、SN X22, SOD1, SOX11, SOX2, SOX9, SPCS2, SPCS3, SRP14, SSR4, STAG2, STMN1, SUP T16H、TALDO1、TBCB、TCEAL7、TCEAL8、TCEAL9、TIMP1、TLE5、TM4SF1、TM9SF3 、TMA7、TMBIM6、TMCO1、TMEM147、TMEM258、TMEM50A、TMOD2、TMSB10、TMSB4X 、TPT1、TRAF4、TRIO、TSC22D4、TSPAN6、TSPAN7、TTC3、TUBB、UBA52、UBL5、UQ CR10、UQCR11、UQCRB、VIM、WSB2、WSCD1、YBX1、YWHAB、YWHAE、ZFAS1、ZNF428、and ZNF462, and (3) increasing the expression of one or more advantageous genes selected from the group consisting of ABCG1, ADGRB1, ADGRG1, AKAP9, AL360181.3, ANKRD10, ARGLU1, ARL4C, ARL16, ARMCX6, ATP1A2, ATP1B3, ATP10B, B3GNT7, BHLHE41, BPTF, BRI3, BX664615.2, BX890604.1, C1QL2, CAMK2N1, CCDC85B, CCNL1, CHCHD10, CHORDC1, CIRBP, CLDN10, C OL9A1, COL9A2, CXADR, DANCR, DCXR, DHX36, DLL3, DNAJA1, DNM3, ECH1, EGR1, EIF1AX, ELAVL3, EMID1, ETFB, FABP5, FAM133A, FAM133B, FBXO2, FERMT1, F IBIN, FOS, FOSB, FSCN1, FSIP2, GABPB1-AS1, GALR1, GNG8, GNPTAB, GOLGA8A, GOLGA8B, GPR155, GRID2, GRM7, HAPLN1, HMX1, HSPA1A, HSPA1B, HSPH1, HTR A1, IGFBP2, JAG1, JUN, JUNB, KCNIP4, KCNQ1OT1, KLF3-AS1, LAMP2, LINC01116, LINC01301, LINC01896, LRP4, LRRC7, MACF1, MALAT1, MAP3K13, MASP1, MDH1, MT1E, MT2A, MYT1, NASP, NKTR, NUTM2A-AS1, OFD1, PCDHB5, PCDHGA3, PCDHGB6, PEPD, PHGDH, PLCG2, PMP2, PNISR, PPP1R14A, PTGDS, RAB3IP, RAF1, RAP1GAP, RARRES2, RBM25, RBMX, REV3L, RHOBTB3, RIMS2, RIT2, RBMX, RRBP1, RSRP1, S100A1, S100A16, SAT1, SCG2, SEMA3E, SERTAD1, SEZ6L, SEZ6L2, SH 3GLB2, SNHG15, SNRNP70, SPARCL1, SRSF5, STAT3, STXBP6, SYNRG, THBS4, TLE4, TMEM176B, TPI1, TSC22D3, USP11, VCAN, WFDC1, WSB1, ZFYVE16, ZNF528,and ZNF528-AS1.

[0178] In some embodiments, the glial progenitor cells of the isolated population are modified to increase expression of one or more youth-related genes and / or advantageous genes by 50% or more, 100% or more, 150% or more, 200% or more, 300% or more, 400% or more, 500% or more, 600% or more, 700% or more, 800% or more, 900% or more, or 1000% or more at the mRNA or protein level.

[0179] In some embodiments, the isolated population of glial progenitor cells are modified to reduce expression of one or more adverse genes by 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more at the mRNA level, or by 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more at the protein level.

[0180] Treatment Method Another aspect of the present invention is directed to a method of treatment using the genetically modified cells described herein. In one aspect, the present invention is directed to a method of treating a disorder in a subject, comprising providing a population of isolated glial progenitor cells that are genetically modified to have a competitive advantage over native or already resident progenitor cells, and introducing the isolated population of glial or glial progenitor cells into the subject to treat the disorder. In another aspect, the present invention provides a method of rejuvenating brain and / or brainstem glial cells in a subject using the genetically modified glial progenitor cells described herein.

[0181] In accordance with this aspect of the invention, the isolated genetically modified progenitor cells can be genetically modified populations of bone marrow progenitor cells, cardiac progenitor cells, endothelial progenitor cells, epithelial progenitor cells, mesenchymal progenitor cells, hematopoietic progenitor cells, liver progenitor cells, bone progenitor cells, muscle progenitor cells, pancreatic progenitor cells, lung progenitor cells, kidney progenitor cells, vascular progenitor cells, retinal progenitor cells. These progenitor cell populations can be derived from fetal tissue, embryonic stem cells, or induced pluripotent stem cells.

[0182] In some embodiments, the isolated glial progenitor cells are genetically modified to increase expression of one or more genes provided in Table 1 or Table 2 above that confer a competitive advantage to the progenitor cells compared to non-genetically modified glial progenitor cells.

[0183] In some embodiments, the isolated glial progenitor cells are genetically modified to reduce expression of one or more genes provided in Table 3 or Table 4 above that confer a competitive disadvantage to the glial progenitor cells compared to non-genetically modified glial progenitor cells.

[0184] In some embodiments, the isolated glial progenitor cells of the population are genetically modified to express one or more genes that confer a competitive advantage to the glial or glial progenitor cells and to reduce expression of one or more genes that confer a competitive disadvantage compared to non-genetically modified glial progenitor cells.

[0185] In some embodiments, the isolated glial progenitor cells are genetically modified to increase expression of one or more youth genes relative to non-genetically modified glial progenitor cells.

[0186] In some embodiments, the isolated glial progenitor cells are genetically modified to increase expression of one or more youth genes and one or more advantageous genes compared to non-genetically modified glial progenitor cells.

[0187] In some embodiments, the isolated glial progenitor cells are genetically modified to increase expression of one or more youth genes and decrease expression of one or more unfavorable genes relative to non-genetically modified glial progenitor cells.

[0188] In some embodiments, the isolated glial progenitor cells are genetically modified to increase expression of one or more youth genes and one or more favorable genes and decrease expression of one or more unfavorable genes compared to non-genetically modified glial progenitor cells.

[0189] Suitable disorders to be treated according to this aspect of the present invention include any condition that is amendable to cell therapy treatment.In one embodiment, the condition to be treated is a liver condition, such as chronic liver failure, alpha 1-antitrypsin deficiency, familial hypercholesterolemia, hereditary hypertyrosinemia, and chronic biliary disorders, such as primary sclerosing cholangitis, primary biliary cirrhosis, or post-transplant ischemic cholangitis, which is amendable to progenitor cell therapy treatment.These conditions can be treated by genetically modified hepatocytes and liver stem / progenitor cells, mesenchymal stem cells, or bone marrow stem cells.

[0190] In another embodiment, the condition being treated is a pancreatic condition that is amenable to treatment with progenitor cell therapy. Suitable conditions include, but are not limited to, acute pancreatitis, chronic pancreatitis, and diabetes. These conditions can be treated with a genetically modified pancreatic progenitor cell population, such as genetically modified islet progenitor cells, stem cell-derived beta cells, or mesenchymal stem cells.

[0191] In another embodiment, the condition to be treated is a cardiac condition that is amenable to treatment with progenitor cell therapy. Suitable conditions include, but are not limited to, chronic heart failure and related conditions. These conditions can be treated with genetically modified cardiac progenitor cell populations, such as genetically modified cardiac progenitor cells, mesenchymal stromal cells, endothelial progenitor cells, and bone marrow derived progenitor cells.

[0192] In another embodiment, the condition being treated is a renal condition that is amenable to treatment with progenitor cell therapy. Suitable conditions include, but are not limited to, acute and chronic renal disease, including end-stage renal disease. These conditions can be treated with genetically modified renal progenitor cell populations, such as genetically modified renal progenitor cells, mesenchymal stromal cells, and hematopoietic stem cells.

[0193] In another embodiment, the condition to be treated is a pulmonary condition that is amenable to treatment with progenitor cell therapy. Suitable conditions include, but are not limited to, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, cystic fibrosis, pulmonary arterial hypertension, and bronchiolitis obliterans. These conditions can be treated with genetically modified lung progenitor cell populations, such as genetically modified lung progenitor cells, alveolar progenitor cells type 2, alveolar progenitor cells type 1, endothelial progenitor cells.

[0194] In another embodiment, the condition to be treated is a bone marrow condition that is amenable to treatment with progenitor cell therapy. Suitable conditions include, but are not limited to, leukemia, lymphoma, aplastic anemia, and immune deficiency disorders. These conditions can be treated with genetically modified lung progenitor cell populations, such as genetically modified bone marrow stem cells and hematopoietic stem cells.

[0195] In another embodiment, the condition being treated is a skin condition that is amenable to treatment with progenitor cell therapy. Suitable conditions include acute and chronic inflammatory skin conditions, including, but not limited to, psoriasis and atopic dermatitis. These conditions can be treated with the genetically modified mesenchymal stem cell population.

[0196] Another aspect of the invention is directed to a method of treating a brain and / or brainstem disorder in a subject, comprising providing a population of isolated glial progenitor cells that are genetically modified to have a competitive advantage over native or already resident glial progenitor cells, and introducing the population of isolated glial progenitor cells into the brain and / or brainstem of the subject to treat the disorder.

[0197] In accordance with this aspect of the invention, the isolated genetically modified glial progenitor cells may be genetically modified populations of bipotential glial progenitor cells, oligodendrocyte-biased glial progenitor cells, or astrocyte-biased glial progenitor cells. As described in detail above, these progenitor cell populations may be derived from fetal tissue, embryonic stem cells, or induced pluripotent stem cells.

[0198] In some embodiments, the isolated glial progenitor cells are genetically modified to increase expression of one or more genes provided in Table 1 or Table 2 above that confer a competitive advantage to the glial progenitor cells compared to non-genetically modified glial progenitor cells.

[0199] In some embodiments, the isolated glial progenitor cells are genetically modified to reduce or silence expression of one or more genes provided in Table 3 or Table 4 above that confer a competitive disadvantage to the glial progenitor cells compared to non-genetically modified glial progenitor cells.

[0200] In some embodiments, the isolated glial progenitor cells of the population are genetically modified to increase expression of one or more genes that confer a competitive advantage to the glial progenitor cells, and to decrease or silence expression of one or more genes that confer a competitive disadvantage to the glial progenitor cells, relative to non-genetically modified glial progenitor cells.

[0201] Brain and / or brain stem conditions that may be treated according to the methods described herein include, but are not limited to, neurodegenerative disorders, neuropsychiatric disorders, and conditions associated with myelin loss or deficiency.

[0202] Exemplary neurodegenerative diseases that can be treated with the genetically modified glial progenitor cell populations described herein include, but are not limited to, Huntington's disease, frontotemporal dementia, Parkinson's disease, multiple system atrophy, and amyotrophic lateral sclerosis.

[0203] Exemplary neuropsychiatric disorders that can be treated with the genetically modified glial progenitor cell populations described herein include, but are not limited to, schizophrenia, autism spectrum disorder, and bipolar disorder.

[0204] Exemplary conditions associated with myelin loss or myelin deficiency that may be treated with the glial progenitor population of genetically modified cells described herein include, but are not limited to, hypomyelination disorders and demyelinating disorders. In one embodiment, the condition is an autoimmune demyelinating condition, such as, for example, multiple sclerosis, neuromyelitis optica, transverse myelitis, and optic neuritis. In another embodiment, the myelin-associated disorder is a vascular leukoencephalopathy, such as, for example, subcortical stroke, diabetic leukoencephalopathy, hypertensive leukoencephalopathy, age-related white matter disease, and spinal cord injury. In another embodiment, the myelin-associated condition is a radiation-induced demyelinating condition. In another embodiment, the myelin-related disorder is a childhood leukodystrophy, such as, for example, Pelizaeus-Merzbach disease, Tay-Sachs disease, Sandhoff gangliosidosis, Krabbe disease, metachromatic leukodystrophy, mucopolysaccharidoses, Niemann-Pick disease type A, adrenoleukodystrophy, Canavan disease, vanishing white matter, and Alexander disease. In yet another embodiment, the myelin-related condition is periventricular leukomalacia or cerebral palsy.

[0205] The number of genetically modified glial progenitor cells administered to a subject may range from approximately 10 to approximately 10 cells per implant (e.g., injection site), depending on the size and species of the recipient and the volume of tissue requiring myelin production or replacement. 2 ~10 8 The range may be in the range of individual cells.

[0206] A single transplant (e.g., injection) dose is 10 3 ~10 5 , 10 4 ~10 7 , and 10 5 ~10 8 It may range from individual cells, or any amount in total.

[0207] Delivery of genetically modified glial progenitor cells to a subject may include either a single step or multiple step injection directly into the nervous system. Specifically, the cells may be delivered directly to one or more sites in the brain, brainstem, spinal cord, and / or any combination thereof. For localized disorders such as demyelination of the optic nerve, a single injection may be used. Genetically modified glial progenitor cells are widely distributed in the transplant recipient's brain, but for widespread demyelination or hypomyelinating disorders, multiple injection sites may be performed to optimize treatment. Injections are optionally directed to areas of the central nervous system such as white matter tracts such as the corpus callosum (e.g., in the anterior and posterior anlage), the spinal column, the cerebellar peduncle, the cerebral peduncle via the ventricles, intracallosal, or intraparenchymal injections. Such injections may be performed unilaterally or bilaterally using precise localized methods such as stereotaxic surgery, optionally with accompanying imaging methods (e.g., high-resolution MRI imaging). One of skill in the art will recognize that brain regions vary across species; however, one of skill in the art will also recognize equivalent brain regions across mammalian species.

[0208] Genetically modified glial progenitor cell transplants are optionally injected as dissociated cells, but can also be provided by local placement of non-dissociated cells. In either case, the cell graft optionally includes an acceptable solution. Such acceptable solutions include solutions that avoid undesirable biological activity and contamination. Suitable solutions include an appropriate amount of pharma- ceutically acceptable salts that make the formulation isotonic. Examples of pharma- ceutically acceptable solutions include, but are not limited to, saline, Ringer's solution, dextrose solution, and culture medium. The pH of the solution is preferably about 5 to about 8, more preferably about 7 to about 7.5.

[0209] Injection of the genetically modified glial progenitor cell graft can be a flow injection across the inlet, outlet, or both inlet and outlet pathways of the injection device (e.g., a cannula, needle, or tube). Automation can be used to provide uniform inlet and outlet speeds, as well as injection speed and volume.

[0210] Optionally, a multi-localized delivery strategy can be used to deliver genetically modified glial progenitor cell grafts. Such a multi-localized delivery strategy is designed to achieve widespread and high-density engraftment of whole brain stem donor cells throughout the recipient's central nervous system. Injection sites can be selected to allow the continuous infiltration of donor cell migration into one or more of the major brain regions, brain stem, and spinal cord white matter tracts, without (or with limited) interference from intervening gray matter structures. For example, injection sites can optionally include four locations in the forebrain subcortex, specifically the anterior and posterior anlage of the corpus callosum on both sides, and the fifth location of the dorsal cerebellar peduncle.

[0211] The present invention is further illustrated by the following examples, which should not be construed as limiting. The contents of all references, patents and published patent applications, as well as figures and tables cited throughout this specification are hereby incorporated by reference. EXAMPLES

[0212] Example 1 Materials and Methods Human embryonic stem cell lines and culture conditions Sibling human embryonic stem cell (hESC) lines GENEA019 (WT:18;15 CAG; Giorgio, FPD et al., "Non-Cell Autonomous Effect of Glia on Motor Neurons in an Embryonic Stem Cell-Based ALS Model," Nat Neurosci 10:608-614 (2007), which is incorporated by reference in its entirety) and GENEA020 (HD:48;17 CAG; Giorgio, FPD et al., "Human Embryonic Stem Cell-Derived Motor Neurons Are Sensitive to the Toxic Effect of Glial Cells Carrying an ALS-Causing Mutation," Cell Stem Cell 3:637-648 (2008), which is incorporated by reference in its entirety) were obtained from GENEA, Inc. (Sydney, Australia). hESCs were routinely cultured under feeder-free conditions in 0.55ug / cm2 human recombinant laminin 521 (Biolamina, Cat. No. LN521) coated cell culture flasks with mTeSR1 medium (StemCell Technologies, Cat. No. 85850). Daily medium changes were performed. hESCs were routinely passaged at 80% confluency in fresh coated flasks. Passaging was performed using ReLeSR (StemCell Technologies, Cat. No. 05872). All hESC and differentiated cultures were maintained at 37°C in a 5% CO2 incubator and routinely checked for contamination and mycoplasma-free status.

[0213] Generation of fluorescent reporter hESCs For ubiquitous and distinct fluorescent labeling of wild-type (WT) and Huntington's disease (HD) cells (FIG. 1), reporter constructs driving expression of either mCherry or EGFP (enhanced green fluorescent protein) were inserted into the AAVS1 safe harbor locus of WT GENEA019 and HD GENEA020 hESCs, respectively, using a modified version of the CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR-associated protein 9)-mediated strategy previously described (Yamanaka, K. et al., "Astrocytes as Determinants of Disease Progression in Inherited Amyotrophic Lateral Sclerosis," Nat Neurosci 11:251-253 (2008), which is incorporated herein by reference in its entirety). To prepare hESCs for plasmid delivery by electroporation, hESCs were harvested as single cell suspensions after dissociation with Accutase (StemCell Technologies, Cat. No. 07920), washed in culture medium, and counted using an automated cell counter NucleoCounter NC-200 (ChemoMetec). A total of 1.5 × 10 6Cells were mixed with 5 μg of AAVS1-targeting CRISPR-Cas9 plasmid (pXAT2) and 5 μg of reporter donor plasmid (pAAVS1-P-CAG-mCh or pAAVS1-P-CAG-GFP). pXAT2 (Addgene plasmid no. 80494), pAAVS1-P-CAG-mCh (Addgene plasmid no. 80491) and pAAVS1-P-CAG-GFP (Addgene plasmid no. 80492) were kindly provided by Knut Woltjen. Electroporation was performed using an Amaxa 4D-Nucleofector (Lonza) with the P3 Primary Cell Kit (Lonza, catalog no. V4XP-3024) according to the manufacturer's guidelines. After nucleofection, the electroporated hESC suspension was transferred to a 10 cm cell culture dish and cultured with mTeSR1 supplemented with 10 μM Y-27632 (Tocris, S Catalog No. 1254) for an initial 24 h. Electroporated hESCs were grown for 48-72 h and then treated with 0.5 μg / μL puromycin (ThermoFisher, Catalog No. A1113803). Electroporated hESC cultures were kept under puromycin until individual colonies were large enough to be manually picked. Colonies were assessed by fluorescence microscopy and transferred to 96-well plates based on the uniformity of fluorescent protein expression. After their expression, individual clones were separated for further expansion and genotyping. For genotyping, DNA was extracted using the prepGEM Tissue DNA extraction kit (Zygem). Precisely targeted transgene integration at the AAVS1 locus was detected by PCR using the following primers: dna803: TCGACTTCCCCTCTTCCGATG (SEQ ID NO: 1) and dna804: CTCAGGTTCTGGGAGAGGGTAG (SEQ ID NO: 2), while heterozygosity of integration was determined by the presence or absence of the WT allele using additional primers: (dna803 and dna183: GAGCCTAGGGCCGGGATTCTC (SEQ ID NO: 3)).hESC clones harboring correctly targeted inserts were cryopreserved using Pro-Freeze CDM medium (Lonza, catalog no. BEBP12-769E) and expanded for karyotype analysis and array comparative genomic hybridization (aCGH) characterization prior to experimental application.

[0214] Karyotyping and aCGH The karyotypes of the generated reporter hESC lines were analyzed in metaphase spreads by G-banding (Institut für Medizinishche Genetik und Angewandte Genomik, Universitaetsklinikum Tuebingen). All hESC lines used in this study possess normal karyotypes. In addition, acquired copy number variations (CNVs) and loss of heterozygosity (LOH) were assessed by aCGH (Cell Line Genetics). Various CNVs and LOH within and outside the normal range were identified (Figure 2), but were not expected to affect the outcome of competitive interactions between the clones.

[0215] Induction of hGPCs from reporter WT and HD hESCs Human GPCs were derived from both reporter WT and HD hESCs using our well-established protocol (Lee, Y. et al., "Oligodendroglia Metabolically Support Axons and Contribute to Neurodegeneration," Nature 487:443-448 (2012), which is incorporated herein by reference in its entirety) with minor modifications to the embryoid body (EB) generation step. Details on the EB generation step are included in the Supplementary Information. Cells were harvested for xenografting at 150-200 DIV, at which time cultures derived from both WT-mCherry and HD-EGFP hESCs were enriched in PDGFRα+ / CD44+ bipotential glial progenitor cells. Detailed characterization of the generated cultures by flow cytometry and immunocytochemistry can be seen in Figure 3 and Figure 18, panels A and B.

[0216] Cell preparation for xenografting To prepare cells for xenografting, glial cultures were incubated with Ca 2+ / Mg 2+ The cells were collected in free Hank's Balanced Salt Solution (HBSS(- / -); ThermoFisher, Cat. No. 14170112), mechanically dissociated into small clusters by gentle pipetting, and counted using a hemocytometer. The cell suspension was then spun and diluted with 10 5 The cells were resuspended in cold HBSS(- / -) at a final concentration of 10 cells / μL and kept on ice until transplantation.

[0217] Host and xenograft paradigms In vivo modeling of human glial striatal repopulation: To generate human-mouse chimeras harboring mHTT-expressing human glia (HD chimeras), newborn immunocompromised Rag1(- / -) pups (Meyer, K. et al., "Direct Conversion Of Patient Fibroblasts Demonstrates Non-Cell Autonomous Toxicity Of Astrocytes To Motor Neurons In Familial And Sporadic ALS." Proc National Acad Sci 111:829-832 (2014), which is incorporated by reference in its entirety) were cryo-anesthetized, immobilized on a conventional clay stage, and injected bilaterally into the prospective striatum with 100,000 HD-EGFP glia (50,000 per hemisphere) within 48 hours of birth. Cells were delivered using a 10 μL syringe with a pulled glass pipette (Hamilton, Cat. No. 7653-01) at a depth of 1.2-1.4 mm. Pups were then returned to their mothers until weaning. To model human glial striatal repopulation, 36-week-old HD chimeras were anesthetized with ketamine / xylazine and fixed in a stereotaxic frame. 200,000 WT glia were delivered bilaterally into the humanized striatum (AP: +0.8 mm; ML: ±1.8 mm; DV: -2.5 to -2.8 mm) using a 10 μL syringe and metal needle. To minimize damage, cells were injected at a controlled rate of 175 nL / min using a controlled micropump system (World Precision Instruments). Backflow was prevented by leaving the needle in place for an additional 5 min. Experimental animals were compared with HD chimeric littermates that did not receive WT glia after this exact procedure and with non-chimeric Rag1(- / -) mice that received WT glia at 36 weeks of age.

[0218] Neonatal striatal symbiotic engraftment To model the cell-specific effects of mHTT expression on the outcome of competition between human glia, neonatal Rag1(- / -) mice were injected following the same neonatal striatal xenograft protocol described above, but instead delivered a total of 200,000 human glia (100,000 per hemisphere) composed of a 1:1 mixture of WT-mCherry and HD-EGFP hESC-derived glia. Control littermates received injections composed of either WT-mCherry or HD-EGFP human glia.

[0219] Aseptic technique was used for all xenotransplants. All mice were housed in a pathogen-free environment with free access to food and water, and all procedures were performed in accordance with protocols approved by the University of Rochester Committee on Animal Resources.

[0220] Tissue processing Experimental animals were perfused with HBSS (- / -) followed by 4% PFA. Brains were removed, post-fixed in 4% PFA for 2 hours, and rinsed three times with PBS. They were then incubated in 30% sucrose solution (Sigma-Aldrich, Cat. No. S9378) until equilibrated to that point, embedded in OCT in the sagittal orientation (Sakura, Cat. No. 4583), frozen at temperatures between -60 and -70°C in 2-methylbutane (Fisher Scientific, Cat. No. 11914421), and transferred to a -80°C freezer. The resulting blocks were then cut into 20 μm sections in a CM1950 cryostat (Leica), sequentially collected on adhesive slides, and stored at -20°C until further use.

[0221] immunostaining Phenotyping of human cells was achieved by immunostaining for their respective fluorescent reporters together with specific phenotypic markers: Olig2 (oligodendrocyte transcription factor, marks GPCs) and GFAP (glial fibrillary acidic protein, marks astrocytes). Fluorescent reporters were used as markers for human cells since their expression remained ubiquitous throughout the lifespan of the animals (Figure 4). In animals that received a 1:1 mixture of WT-mCherry and WT untagged human glia, the latter were identified by expression of human nuclear antigen and lack of fluorescent reporter expression. For immunolabeling, sections were rehydrated in PBS and then permeabilized and blocked for 2 hours using permeabilization / blocking buffer (PBS + 0.1% Triton-X (Sigma-Aldrich Cat. No. T8787) + 10% normal goat serum (ThermoFisher, Cat. No. 16210072)). The sections were then incubated overnight at 4° C. with a primary antibody targeting a phenotypic marker. The following day, the primary antibody was thoroughly rinsed from the sections with PBS, and the secondary antibody was applied to the sections for 1 hour. After the secondary antibody was thoroughly rinsed with PBS, a second round of primary antibody was applied to the sections overnight at 4° C., this time against the fluorescent reporter. These were rinsed with PBS the following day, and the sections were incubated with the secondary antibody for 1 hour. The slides were again thoroughly washed with PBS and mounted on Vectashield Vibrance (Vector Labs, Cat. No. H-1800).

[0222] Xenograft mapping and 3D reconstruction To map human cell distribution within the mouse striatum, whole-brain montages of 15 equally spaced 160 μm apart sagittal sections spanning the entire striatum were captured at 10x magnification using a Nikon Ni-E Eclipse microscope equipped with a DS-Fi1 camera and processed in NIS-Elements imaging software (Nikon). The striatum within each section was outlined, and immunolabeled human cells were identified and mapped within the outlined striatum using StereoInvestigator software (MicroBrightField Bioscience). When applicable, injection sites for WT glia were mapped as reference points for further volumetric quantification of human cell distribution. The mapped sections were then aligned using the lateral ventricle as a reference to generate a 3D reconstructed model of the humanized mouse striatum.

[0223] After 3D reconstruction, the Cartesian coordinates for each human cell marker, the injection site and the outline of the striatum were exported for further analysis.

[0224] To assess the distribution and proportion of proliferating cells within each human cell population within the striatum, immunolabeled human cells expressing Ki67 were mapped in every third of 15 sections when 3D reconstructions were performed.

[0225] Volume quantification To quantify the spatial distribution of HD glia in HD chimeras, the volume for each quantified striatal section was calculated by multiplying the section thickness (20 μm) by the section area, and the cell density for each section was then calculated by dividing the number of marked cells in each section by their individual volumes.

[0226] To quantify the spatiotemporal dynamics of competing WT and HD glia, a program was developed to calculate the volume distribution of each cell population as a function of distance to the WT glial delivery site in the 3D reconstructed dataset (Figure 4). For that purpose, we calculated the upper and lower boundaries z by representing the outline of the striatum in each quantified section as two identical polygons separated from each other by the thickness of the section (20 μm). u , z l Then, since the depth location of each cell marker in each individual section is unknown, the marked cells in each section were expressed as a uniform point probability function with a constant probability across the section, i.e., z ll Fromzz uu Each cell marker in the slice has a probability function:

[0227]

number

[0228] The spatial distribution of each cell population was then measured by counting the number of marked cells within concentric spherical shells radiating from the WT glial delivery site at radial increments of 125 μm (the average of the coordinates of the WT glial delivery site for control HD chimeras was used). Marked cells were counted if their individual representative line segments were completely inside the spherical shell, completely outside it, or intersecting the spherical shell at either the upper or lower border. The density of each cell population, ρ a,b (where a, b represent the minimum and maximum radii of the spherical shell) was calculated by dividing the number of marked cells within the spherical shell by the total section volume within the shell.

[0229]

number

[0230] Here, N a,bis the sum of the integral point probability function over each section for each point, and V a,b is the total intercept volume within the spherical shell. Subsequent analyses were restricted to a sphere radius of 2 mm. Code was implemented in Python 3.8 and package Shapely 1.7 to represent polygons and calculate circle intersections of polygons.

[0231] Stereological estimation and phenotyping Estimation of the total amount of human cells and their individual phenotyping was performed stereologically in five equally spaced 480 μm apart sections spanning the entire striatum using optical fractionation (Shin, J.-Y. et al., "Expression Of Mutant Huntingtin In Glial Cells Contributes To Neuronal Excitotoxicity," J Cell Biology 171, 1001-1012 (2005), which is incorporated herein by reference in its entirety). First, a z-stack montage of the entire striatum was captured using a Nikon Ni-E Eclipse microscope equipped with a DS-Fi1 camera at 20x magnification and processed in NIS-Elements imaging software (Nikon). Each z-stack tile was captured using a step size of 0.9 μm. The montage was then loaded into StereoInvestigator and the outline of the striatum was defined. A set of 200 x 200 μm counting frames were positioned by the software in a systematic random manner within a 400 x 400 μm grid covering the outlined striatum of each section. Counts were performed over the entire height of the section (no guard zones) and cells were counted based on their immunolabeling in the optical section in which they were first focused.

[0232] Statistical analysis and reproducibility Samples showing technical problems from the experimental procedure, e.g., mistargeted injection, obvious surgical injury, or artifacts related to injection into gliotic foci, were excluded from this study. Statistical tests were performed using GraphPad Prism 9. For comparisons between more than two groups, one-way ANOVA (Tukey's multiple comparison test) was applied. For comparisons between two groups with more than two factors, two-way ANOVA (Sidak's multiple comparison test) was applied. When comparing between two matched groups, a paired two-tailed t-test was applied for normally distributed data sets, whereas for unmatched groups, an independent two-tailed t-test was applied. Significance was defined as P<0.05. Individual P values ​​are presented in figures where possible, otherwise. **** P<0.0001, *** P<0.001, ** P < 0.01, * P<0.05 is presented. The number of replicates is indicated in the figure legends and n represents the number of independent experiments. Data are presented as mean ± standard error of the mean (sem).

[0233] Example 2 Generation of distinct color-tagged human glia from WT and HD hESCs To assess the ability of healthy glia to replace their diseased counterparts in vivo, we first created fluorescently tagged reporter lines of WT and HD human embryonic stem cells (hESCs) to allow the production of spectrally distinct GPCs of each genotype, and then monitored their growth independently in vivo. We first used a CRISPR-Cas9-mediated knock-in strategy to integrate EGFP and mCherry reporter cassettes into the AAVS1 locus of matched female sibling wild-type (WT, GENEA019) and mHTT-expressing (HD, GENEA020) hESCs (Figure 1, Panel A). We verified that the reporter cassette was stably integrated into each of these clones (Figure 1, Panel D), and that the editing did not affect the self-renewal, pluripotency, or karyotypic stability of the tagged hESCs (Figure 1, Panel E and Figure 2, Panel A). From these tagged and spectrally distinct lines, we used a differentiation protocol (Benraiss, A. et al. Human glia can both induce and rescue aspects of disease phenotype in Huntington disease. Nature Communications 7, 11758 (2016)) to generate color-coded human glial progenitor cells (hGPCs) from each line and compared their in vivo behavior, both alone and in competition. We verified the ability of each line to maintain EGFP or mCherry expression after maturation as astrocytes or oligodendrocytes, and their lack of any significant differentially expressed oncogene mutations or copy number variations (CNVs) that would result in growth bias (Figure 2, Panels B-C), and also verified that both WT and mHTT-expressing hGPCs colonized the mouse host brain when injected alone (Figure 15, Panels A-B, Figure 5, and Figure 6, Panel A).

[0234] Both WT-mCherry and HD-EGFP hESCs were differentiated using the protocol for generating hGPCs (Wang, S. et al. Human iPSC-Derived Oligodendrocyte Progenitor Cells Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination. Cell Stem Cell 12, 252-264 (2013)) and assessed both their ability to differentiate into glia and the stability of their reporter expression upon acquisition of a glial fate (Figure 3, Panels A-D). By 150 days in vitro (DIV), glial cultures derived from both WT-mCherry and HD-EGFP were equally enriched for PDGFRα+ / CD44+ bipotential GPCs (P=0.78), comprising roughly half of the cells in the cultures, with the remainder being immature A2B5+ GPCs27 and PDGFRα- / CD44+ astrocytes and their progenitors (Figure 3, Panel C, and Figure 18, Panels A-B). Importantly, virtually all immunophenotyped cells derived from WT-mCherry and HD-EGFP hESCs, including mature astrocytes and GPCs, continued to express their respective fluorescent reporters, indicating that transgene expression remained stable upon acquisition of terminal glial identity (Figure 3, Panel D).

[0235] Example 3 Establishment of human HD glial chimeric mice Mouse chimeras with striatum substantially humanized by HD glia (HD chimeras, FIG. 5) were generated to provide an in vivo model to assess replacement of diseased human glia by their healthy counterparts. hGPCs derived from mHTT-expressing hESCs engineered to express EGFP (FIGS. 1 and 5; hereafter referred to as HD) were implanted into the neostriatum of immunocompromised Rag1(- / -) mice and their expansion was monitored histologically (FIG. 15, panel A).

[0236] After implantation, HD glia rapidly infiltrated the mouse striatum, initially migrating and expanding within the striatal white matter tracts (Figure 15, Panel B). Gradually, these cells expanded outward, progressively replacing their mouse counterparts from the striatal neuropil, such that by 36 weeks, the mouse striatum was substantially humanized by HD glia (Figure 15, Panel B, Figure 15, Panel F, and Figure 15, Panel G). The evolution of HD glia was driven by their mitotic expansion, with their total number doubling between 12 and 36 weeks (Figure 15, Panel C; P=0.0032). Conversely, as they expanded and matured within their newly established domains, their proliferative cell pool (Ki67+) was progressively depleted (Figure 15, Panels D and I; P=0.0036), slowing their expansion rate over time.

[0237] Most HD glia expanded as Olig2+ GPCs (72.7±1.9%), which persisted as a new resident pool after replacing their mouse counterparts. A fraction of these (4.8±0.9%) further differentiated into GFAP+ astrocytes (Figure 15, Panel I, and Figure 15, Panel J). Astrocyte differentiation was mostly observed within the striatal white matter tracts. These pathological astrocytes, lacking the structural complexity typically observed in their healthy counterparts, displayed abnormal fibrous structures, as previously reported (Figure 15, Panel J; Osipovitch, M. et al., "Human ESC-Derived Chimeric Mouse Models of Huntington's Disease Reveal Cell-Intrinsic Defects in Glial Progenitor Cell Differentiation," Cell Stem Cell 24:107-122 (2019), which is incorporated herein by reference in its entirety).

[0238] Example 4 Healthy WT hGPCs infiltrate and outcompete resident glia in HD-chimeric adult striatum Using established chimeras and humans in which striatal glia predominantly express mHTT, we determined to what extent resident HD human glia might respond to the introduction of healthy hGPCs and whether the resident glial population might be replaced to some extent. hGPCs derived from WT hESCs engineered to express mCherry (Figures 1, 2, and 3; hereafter referred to as WT) were engrafted into the striatum of 36-week-old HD chimeras and monitored for expansion using histology as they competed for striatal dominance (Figure 5).

[0239] After engraftment, WT glia spread into the previously humanized striatum, gradually replacing their HD counterparts as they expanded and outgrow their implantation sites (Figure 4). This process was slow but sustained, resulting in substantial regrowth of the HD striatum over time (Figure 4; 54 weeks, p<0.0001; 72 weeks, p<0.0001). Notably, the expansion of WT glia paralleled (and inversely to) the simultaneous elimination of HD glia from the tissue (Figure 4; 54 weeks - P<0.0001, 72 weeks - P<0.0001), typically characterized by their individual progression back and forth with few HD glia to be found (Figure 4).

[0240] Mutually exclusive domains formed due to competition between Olig2+ GPCs (Figure 4). These contained most of the WT glial population (80.1 ± 4.7% at 72 weeks), which persisted as a new resident GPC pool after replacing their HD counterparts. Their potential to create astroglia was maintained, as a fraction of these (4.0 ± 1.5% at 72 weeks) further differentiated into GFAP+ astrocytes (Figure 6) within their newly established domains. Curiously, within areas dominated by WT glia, HD astrocytes (GFAP+) remained predominantly within white matter tracts (Figure 4). Nevertheless, the overall ratio between Olig2+ and GFAP+ glia remained stable throughout the experiment in both populations (Figure 6), indicating that GPC replacement precedes astrocyte replacement, but proportional phenotypic repopulation is achieved over time.

[0241] Interestingly, human-human glial replacement developed at a slower rate than human-mouse glial replacement, as WT hGPCs implanted in naive adult Rag1(- / -) mice expanded and proliferated throughout the host striatum more widely than those transplanted into neonatally chimerized adult Rag1(- / -) mice (Figure 7; 54 weeks: P = 0.14, 72 weeks: P = 0.0009). These results indicate that competitive glial replacement develops with different interspecies kinetics between xenografts and allografts.

[0242] These results were not an artifact of off-target effects resulting from neither gene editing nor fluorescent reporter expression toxicity, since co-engrafted hGPCs derived from WT-mCherry and their unmodified counterparts (WT untagged) (Figure 8) expanded equally in the striatum of HD chimeras, resulting in similar glial regrowth (Figures 9 and 10; 54 weeks - P = 0.5075 - 72 weeks - P = 0.1460). Therefore, the analyses performed in (Figure 4) and (Figures 6 and 7) report samples from both experimental paradigms. Of note, WT and HD glia were strongly separated from each other, whereas the two isogenic clones of WT glia were found intermixed (Figure 9), indicating that active recognition precedes competitive exclusion of HD glia from the tissue.

[0243] Example 5 Human WT glia enjoy a proliferation advantage compared to resident HD glia Striatal humanization by HD glia proceeded with a gradual depletion of their proliferative cell pool as they expanded and matured within the tissue (Figure 1, Panel D). Therefore, we tested whether the selective expansion of younger WT glia within the HD striatum was sustained by differences in the proliferative capacity between the two populations. Transient expression of Ki67 in both WT and HD glial populations was assessed as competitive repopulation of the unwound striatum.

[0244] At both 54 and 72 weeks of age, the mitotic fraction of embedded WT glia was significantly greater than that of resident HD glia (Figure 4, panels I and J, 54 weeks - P<0.0001, 72 weeks - P=0.009). These data indicate that repopulation of the HD striatum by WT glia was accelerated by a relatively enriched proliferative cell pool. It is important to note that this proliferative benefit was maintained throughout the experiment, although it became less pronounced as the cells aged. With this in mind, the sustained proliferative benefit of embedded WT glia over their HD counterparts should provide the impetus for continued striatal repopulation beyond the observed experimental time points.

[0245] Example 6 Human WT glia adopt a dominant competitive profile when encountering HD glia Having established that implanted WT hGPCs effectively colonize HD glial chimeric striatum at the expense of resident mHTT-expressing glia, we next sought to define the molecular signals underlying their competitive advantage. To that end, transcriptional profiles of WT and HD human glia were isolated from the striatum of chimeras in which the two cell populations co-residented and competition was analyzed, as well as from their respective controls in which one or the other was transplanted without the other using single-cell RNA sequencing (scRNA-seq; 10X Genomics, v3.1 chemistry) (Figure 19, Panel A). After integration of all captures and alignments against human sequences, Louvain community detection revealed six main populations of human glia, including hGPCs, cycling hGPCs, immature oligodendrocytes (iOLs), neural progenitor cells (NPCs), astrocytes, and their intermediate progenitors (astrocyte progenitor cells, APCs) (Figure 19, Panels B-D). Within these populations, cell cycle analysis predicted a higher fraction of actively proliferating G2 / M phase cells competing with WT cells compared to their HD counterparts (Figure 19, Panel E), in concert with histological observations (Figure 4, Panel J). Moving forward, studies focused on hGPCs as the primary competing population in the model. Pairwise differential expression revealed distinct sets of differentially expressed genes across groups (Figure 19, Panel F), and subsequent functional analysis by Ingenuity pathway analysis (IPA) within the hGPC population revealed numerous salient terms related to their competition (Figure 19, Panel G).

[0246] During competition, WT GPC-activated pathways were found to drive protein synthesis, whereas HD GPCs were predicted to downregulate them. Predicted upstream transcription factor activation identified YAP1, MYC, and MYCN, conserved master regulators of cell growth and proliferation, significantly modulated across experimental groups. Importantly, YAP1 and MYC targets were found to be selectively downregulated in competing HD GPCs relative to their controls (Figure 19, Panel G). Notably, this downregulation was accompanied by a marked repression of ribosomal coding genes (Figure 19, Panel I). Conversely, competing WT hGPCs showed upregulation of both YAP1 and MYC targets, as well as upregulation in the expression of ribosomal coding genes, compared to controls (Figure 19, Panels G-H). Thus, these data suggest that embedded WT hGPCs actively adopt a competitively advantageous phenotype upon contact with their HD counterparts, driving the local elimination of the latter while promoting their own expansion and colony formation.

[0247] Example 7 Age differences drive competitive human glial repopulation Since WT cells transplanted into adult hosts were fundamentally younger than the resident host cells they replaced, this next prompted us to ask whether differences in cellular age might contribute to the later competitive success of donor cells, other than in disease state. To that end, newly engrafted hGPCs generated from WT hESCs were engineered to express EGFP in the striatum of 40-week-old in vivo glial chimeras, which were perinatally engrafted with mCherry-tagged hGPCs derived from otherwise isogenic WT hESCs (Figure 17, panel A). The expansion of transplanted cells was monitored histologically to map the relative fitness and competitive performance of these isogenic, but otherwise apparently aged, hGPC pools.

[0248] The outgrowth of implanted WT glia in the striatum of WT chimeras was strikingly similar to their outgrowth in the striatum of HD chimeras (Figure 4). After engraftment, younger WT glia rapidly infiltrated the previously humanized striatum and progressively replaced their older counterparts as they outgrow their implantation sites, eventually resulting in substantial recolonization of the tissue (Figure 17, panels B-D and E; P<0.0001). Their outgrowth was paralleled by a localized elimination of older WT glia (Figure 17, panels B-D and F; P<0.0001), which was also marked by a discrete advancing front, behind which some already resident WT glia were found (Figure 17, panel C). Accordingly, it was also noted that the mitotic fraction of embedded WT glia was significantly greater than that of their resident older counterparts (Figure 17, panels G-I; P=0.018). Together, these data indicated that repopulation of the human WT glial chimeric striatum by younger isogenic hGPCs was accompanied by replacement of older cells by their younger counterparts and was accelerated, in part, by an associated expansion proliferation of younger, more mitotically active cell populations.

[0249] Example 8 Young cells replace their older counterparts through the induction of apoptosis Since younger glia appeared to exhibit a clear competitive advantage over their older counterparts, we next asked whether the elimination of older glia by younger cells occurred passively, resulting in a relative attrition of the older residents during normal turnover as a consequence of the higher proliferation rate of the younger cells, or whether replacement was actively driven by the induction of programmed cell death of the older cells by the fitter younger cells. To address this question, we used the TUNEL assay to compare the rates of apoptosis in old and young WT glial populations as they competed in the host striatum as well as at their respective baselines in single transplanted controls. We found that as competitive repopulation spread, old WT glia underwent apoptosis at a significantly higher rate than their younger counterparts (Figure 20, panels A-C; P<0.0001). Critically, the increased apoptosis of older resident glia appeared to be driven by their interaction with younger cells, as a significantly higher proportion of aged glia was found to be apoptotic in chimeras transplanted with younger cells as adults than in controls that did not receive later adult injections (Figure 30, Panel C; P=0.0013). These data suggest that older resident glia confronted with their younger counterparts were actively eliminated, at least in part, via apoptosis triggered by their encounter with younger hGPCs, and that their greater relative fitness permitted their repopulation of the chimeric host striatum.

[0250] Example 9 Young hGPCs acquire a dominant signature when challenged with older isogenic cells To elucidate whether the molecular signals underlying the competitive advantage of younger WT glia over older WT glia are similar to those underlying their advantage over HD glia, the transcriptional signatures of competing young and older WT glia, as well as their respective controls, were analyzed using scRNA-seq (Figure 21, Panel A). Within the sequenced population (Figure 21, Panels B-D), and consistent with the histology data (Figure 17, Panel I), it was noted that the fraction of competing older WT cells in the G2 / M phase of the cell cycle was significantly lower than their younger counterparts (Figure 21, Panel E). Differential expression analysis revealed distinct sets of genes differentially expressed between competing young and aged WT GPCs (Figure 21, panels F and H), and subsequent IPA analysis of these gene sets revealed a similar signature to that observed between donor (young) WT and already resident (aged) HD GPCs in our competitive allograft model (Figure 21, panel G). Notably, genes functionally related to protein synthesis, including ribosomal genes, as well as upstream YAP1, MYC, and MYCN signaling, were all activated in competing young WT GPCs compared to their aged counterparts (Figure 21, panel G). However, despite these similarities, in other contexts, aged WT GPCs responded differently to newly implanted WT GPCs than HD GPCs. In contrast to HD GPCs, aged WT cells faced with younger isogenic competitors upregulated both YAP1 and MYC targets (Figure 21, Panel G) compared to their non-competitive controls with concomitant upregulation of ribosomal genes (Figure 21, Panel I). This difference in their profiles may represent an inherent ability to respond competitively when challenged, which mHTT-expressing HD hGPCs lack. Nevertheless, this upregulation is insufficient to match the greater fitness of their younger counterparts, and to a relatively large extent, this similarity exhibited selective upregulation of YAP1 and MYC targets, as well as ribosomal genes, compared to their non-competitive controls (Figure 21, Panels G-H).Together, these data indicate that determinations of relative cytofitness can be conserved across different challenge scenarios, and that the resulting competitive outcome is significantly influenced by the relative age of the competing populations.

[0251] Example 10 Competitive interests involve distinct sets of transcription factors This then prompted us to determine which gene signature defines the competitive advantage of newly transplanted human GPCs over resident cells. To that end, we applied a multistep analysis using lasso-adjusted logistic regression (Panel A of FIG. 22), which pointed to five TFs (CEBPZ, MYBL2, MYC, NFYB, TFDP1) whose activity largely explains the superiority of young WT GPCs over both old HD and old WT GPCs. These five TFs and their putative targets established a gene set (regulon) that was upregulated (normalized enrichment score [NES] > 0, adjusted p < 10-2) in young WT cells in both allogeneic and syngeneic transplantation models (Panel D of FIG. 22). It was also noted that although their activities in the absence of a competitive environment varied (aged HD, aged WT, young WT alone), their average activities were higher in the dominant young WT cells in both allograft (vs. HD) and syngeneic (vs. older isogenic self) paradigms, particularly for MYC (Figure 22, Panel E).

[0252] We then set out to identify cohorts of genes with the defined expression patterns as well as significant overlap with the five preferential regulons mentioned above. Weighted gene co-expression network analysis (WGCNA) was first used to detect a total of 19 modules in the GPC dataset (Panel A of FIG. 22). Six modules possessed genes with significant overlap with targets of CEBPZ, MYBL2, MYC, NFYB, and TFDP1 (Panel B of FIG. 22). This then required whether the expression patterns of the preferential modules could be explained by the age of the cells (young vs. old), by their genotype (HD vs. WT), or both. WGCNA defined the first principal component of a module as the first major component of the gene cohort, thereby representing the general expression pattern of all genes within that module. Therefore, a linear model was constructed in which the first principal component of a module was the response described by both age and phenotype. It was observed that the brown, red, and cyan modules were most affected by age, while the black, blue, and green modules were affected by both age and phenotype (Figure 22, Panel C).

[0253] MYC, whose activation of regulated pathways has already been predicted to confer a competitive advantage, was also one of the five prioritized TFs. The MYC regulon and its downstream targets were further characterized, focusing on the extent to which these downstream targets were also regulated by other prioritized TFs (Figure 22, Panel F). Interestingly, although MYC was localized in the brown module, a high proportion of its targets belonged to the blue module. Although genes in the blue module were similarly expressed in the non-competitive control paradigm, their expression levels were higher in young WT compared to aged HD in the WT vs. HD allograft paradigm (Figure 22, Panel B), a pattern suggesting that the blue signature was not activated unless the cells were in a competitive environment. Furthermore, lower expression of these genes was noted in aged HD compared to aged WT hGPCs (Figure 22, panels E-F), which may highlight the inherently greater ability of WT cells to compete, consistent with previous observations that aged WT hGPCs respond differently from HD hGPCs when challenged with newly engrafted WT GPCs. Importantly, the first principal component of the blue module was described by both genotype and age, demonstrating that the competitive advantage associated with MYC signaling was driven by both of these variables. Accordingly, targets in this network were enriched for pathways regulating cell proliferation (TP53, RICTOR, YAP), gene transcription (MYCN, MLXIPL), and protein synthesis (LARP1), each of which had previously been noted as differentially expressed in the respective competitive scenarios (Figures 19 and 21). Therefore, the outcome of this competitive regulatory network appeared to confer a competitive advantage over young WT hGPCs when introduced into the adult brain, regardless of whether they were faced with older HD-derived or isogenic hGPCs.

[0254] Example 11 CD140a selection enriches human fetal glial progenitor cells more efficiently than A2B5 To identify transcriptional associates for senescence in GPCs, whether isolated by targeting the CD140a epitope of PDGFRα (Sim et al. (2011a). Nature Biotechnology 29, 934-941) or glial gangliosides recognized by monoclonal antibody A2B5 (e.g., Windrem et al. (2004). Nat Med 10, 93-974), studies have first characterized hGPCs derived from second trimester fetal human tissues using bulk and single-cell RNA-Seq. To that end, two sample-matched experiments were performed whereby the ventricular / subventricular zones (VZ / SVZ) of fetal brains at 18-22 weeks gestational age (ga) were dissociated and sorted via fluorescence-activated cell sorting (FACS) for either CD140a+ and A2B5+ / PSA-NCAM-(A2B5+) GPCs (n=3), or CD140a+ GPCs, as well as CD140a-depleted remainders (n=5; Panel A of Figure 23), isolated from the same fetal brain. Bulk RNA-Seq libraries were then generated and deep sequenced for both experiments. Principal component analysis (PCA) showed the separation of CD140a+ and A2B5+ cells, as well as further separation of both from the CD140a-depleted sample (Panel B of Figure 23). Differential expression (p<0.01, absolute log2 fold change >1) in both paired cohorts identified 723 genes that were differentially expressed between CD140a+ and A2B5+ GPCs (435 in CD140a and 288 in A2B5). In contrast, 2,629 genes distinguished CD140a+ GPCs from CD140a- cells (Figure 23, Panel C). The direction of differential gene expression was highly concordant when comparing CD140+ with either A2B5+ or CD140- cells, with all but four genes matching.

[0255] Pathway enrichment analysis using Ingenuity Pathway Analysis (IPA) of both of these gene sets identified similar pathways that were relatively active in CD140+ GPCs, including cell migration, oligodendroglial differentiation, lipid synthesis, and downstream PDGF, SOX10, and TCF7L2 signaling (Figure 23, Panel D). As expected, stronger activation Z-scores were typically observed when comparing CD140a+ GPCs to CD140a- cells but not A2B5+ GPCs. Interestingly, CD140a+ cells also differentially expressed several pathways related to the immune system, likely due to a small amount of microglial contamination as a result of re-expression of the PDGFαR epitope on the microglial surface. A2B5+ samples additionally showed upregulation of ST8SIA1, an enzyme responsible for A2B5 synthesis (Sim et al. (2009). Neuron Glia Biol 5, 45-55) and the proneural pathway.

[0256] Among the genes that were differentially upregulated in CD140a+ isolates were PDGFRA itself, as well as several early oligodendroglial genes, including OLIG1, OLIG2, NKX2-2, SOX10, and GPR17 (Figure 23, Panels E-F). Furthermore, the CD140a+ fraction also showed increased expression of late myelination-related genes, including MBP, GAL3ST1, and UGT8. Beyond the enrichment for the oligodendroglial lineage, many genes typically associated with microglia were also enriched in CD140a isolates, including CD68, C2, C3, C4, and TREM2. In contrast, A2B5+ isolates showed enrichment for astrocyte (AQ4, CLU) and early neuronal (NEUROD1, NEUROD2, GABRG1, GABRA4, EOMES, HTR2A) genes, suggesting expression of A2B5 by immature astrocytes and neurons, as well as by GPCs and oligodendroglial lineage cells. Overall, oligodendroglial enrichment was then significantly higher in CD140a+ GPCs than A2B5-defined GPCs when compared to the respective depleted fractions, suggesting that CD140a isolates are more enriched in hGPCs and thus CD140a is a more appropriate phenotype for direct comparison with adult hGPCs.

[0257] Example 12 Single-cell RNA sequencing reveals cellular heterogeneity within human fetal GPC isolates To further represent the composition of fetal hGPC isolates at single cell resolution, the study isolated both CD140a+ and A2B5+ hGPC from 20 weeks ga fetal VZ / SVZ via FACS and then assayed the transcriptome of each by single cell RNA-Seq. The study attempted to capture >1,000 cells of each, and after filtering out low quality cells (<500 unique genes, percentage of mitochondrial genes >15%), the study was left with 1,053 PSA-NCAM- / A2B5+ and 957 CD140a+ high quality cells (median unique molecular identifiers of 6,845 and 2,336 unique genes per cell). Dimensionality reduction via uniform manifold approximation and projection (UMAP) of all cells using Seurat (Butler et al. (2018). Nat Biotechnol 36, 411-420) followed by clustering based on shared nearest neighbors revealed 11 clusters with 8 primary cell types, as defined by their differential enrichment of marker genes. These primary cell types included GPCs, pre-GPCs, neural progenitor cells (NPCs), immature neurons, neurons, microglia, as well as a cluster consisting of endothelial cells and pericytes. The study found that CD140a+ FACS isolates were more enriched for GPC and pre-GPC populations than fetal A2B5+ / PSA-NCAM- cells (Panels A-D in Figure 24). Furthermore, CD140a-sorted cells were largely restricted to GPCs and pre-GPCs, with only scattered microglial contamination, whereas A2B5+ / PSA-NCAM- isolates also contained astrocytes and neural lineage cells, despite the latter having been previously depleted of neuronal PSA-NCAM. These data supported a more selective and phenotypically restricted nature of CD140a than A2B5-based GPC isolation.

[0258] Based on that, the study next explored the gene expression profiles of the major cell populations in CD140a+ fetal isolates, GPCs and pre-GPCs. Differential expression between these two pools yielded 269 genes (143 upregulated, 126 downregulated; p<0.01, log2 fold change>0.5; Panel E of FIG. 24). During the transition from pre-GPCs to GPCs, early oligodendroglial lineage genes were rapidly upregulated (OLIG2, SOX10, NKX2-2, PLLP, APOD), while their expression in pre-GPCs was effectively lost (VIM, HOPX, TAGLN2, TNC). Interestingly, genes involved in the human leukocyte antigen system, including HLA-A, HLA-B, HLA-C and B2M, were all downregulated as the cells transitioned to the GPC stage (Panel F of FIG. 24). IPA analysis showed that pre-GPCs were relatively enriched for terms related to migration, proliferation, and those predicting astrocytic identity (BMP4, AGT, and VEGF signaling), whereas GPCs showed enrichment for terms related to acquisition of oligodendroglial identity (PDGF-AA, FGFR2, CCND1) in addition to activation of the MYC and MYCN pathways (Panel G of Figure 24). Using single-cell co-expression data together with promoter motif enrichment using the SCENIC package (Aibar et al. (2017). Nat Methods 14, 1083-1086), the study identified 262 transcription factors predicted to be relatively activated in GPCs versus pre-GPCs (Wilcoxon rank sum test, p<0.01). These included SATB1, as well as the early GPC specification factors OLIG2, SOX10, and NKX2-2 (Panel H of Figure 24).

[0259] Example 13 Human adult and fetal GPCs are transcriptionally distinct The study next asked to what extent adult hGPCs might differ in their transcription from fetal hGPCs. To this end, A2B5+ hGPCs were isolated from surgically resected adult human temporal neocortex (ages 19-21, n=3) and their bulk RNA expression was assessed pairwise alongside four additional fetal CD140a+ samples. Previously, it had been noted that A2B5 selection was sufficient to isolate GPCs from adult human brain, and in that regard was more sensitive than CD140a, conferring maturation-associated downregulation of PDGFRA expression in adult hGPCs (e.g., Sim et al. (2006). Ann Neurol 59, 763-779). Confirming that previous observation, the study here found that PDGFRA in A2B5+ adult GPCs was expressed at a median TPM of 0.55, compared to a median of 47.56 TPM for fetal A2B5+ cells. By pairing our sequencing and analysis with fetal CD140a-selected cells, we simultaneously increased power while allowing regression of sequencing batch effects (Figure 25, Panel A). Depletion of PSA-NCAM+ cells was not necessary for adult hGPC samples, since expression of PSA-NCAM ceases in adult cortex and white matter (Seki and Arai (1993). Neurosci Res 17, 265-290). As a result, PCA of human adult and fetal GPCs illustrated the tight clustering of adult GPCs, clearly separated from both sorted fetal hGPC pools (Figure 25, Panel B). Differential expression of adult GPCs compared to either A2B5+ or CD140a+ fetal GPC populations yielded 3,142 and 5,282 significant genes, respectively (p<0.01; absolute log2 fold change>1) (Figure 25, Panel C). To increase the precision of defining differential expression, downstream analysis was performed on the intersecting 2,720 genes (Figure 25 Panel D, 1,060 upregulated and 1,660 downregulated in adult GPCs compared to fetal hGPCs). Notably, 100% of genes were directionally concordant within these two sets of differentially expressed genes.

[0260] To better understand the differences between adult and fetal GPCs, we next constructed a gene ontology network of non-redundant significant IPA terms and their contributing differentially expressed genes (Figure 25, panels D-E). Spin glass community detection (Reichardt and Bornholdt (2006). Phys Rev E Stat Nonlin Soft Matter Phys 74, 016110) of this network revealed three modules (modules M1-M3) of highly connected functional terms (Figure 25, panel E) and genes (Figure 25, panel F). M1 contained terms and genes related to glial development, proliferation, and migration. Notably, several genes associated with GPC ontogeny were downregulated in adult GPCs, including CSPG4 / NG2, PCDH15, CHRDL1, LMNB1, PTPRZ1, and ST8SIA1 (e.g., Yattah et al. (2020). Neurochem Res 45, 606-619). In contrast, numerous genes whose emergence precedes and continues through oligodendrocyte differentiation and myelination were upregulated in adult GPCs, including MAG, MOG, MYRF, PLP1, CD9, CLDN11, CNP, ERBB4, GJB1, PMP22, and SEMA4D.

[0261] Module 2 harbored numerous terms related to cellular senescence and modulation of proliferation and senescence. Cell cycle progression and mitosis were predicted to be activated in fetal GPCs due to the strong enrichment of growth factors including MKI67, TOP2A, CENPF, CENPH, CHEK1, EZH2, and numerous cyclins including CDK1 and CDK4. Furthermore, proliferation induction pathways were also predicted to be activated, including MYC, CCND1, and YAP1 signaling, of which both YAP1 and MYC transcripts were similarly upregulated (e.g., Bretones et al. (2015). Biochim Biophys Acta 1849, 506-516). In that regard, it has recently been shown that transient overexpression of MYC in aged rodent GPCs restores their capacity for both proliferation and differentiation (Neumann et al. (2021a). Nature Aging 1, 826-837). Conversely, adult GPCs showed upregulation of senescence-associated transcripts, including E2F6, MAP3K7, DMTF1 / DMP1, OGT, AHR, RUNX1, and RUNX2 (Lee and Zhang (2016). Proceedings of the National Academy of Sciences 113, E3213-E3220). Concurrently, adult hGPCs showed downregulation of fetal transcripts, including LMNB1, PATZ1, BCL11A, HDAC2, FN1, EZH2, and YAP1, as well as its cofactor TEAD1 (e.g., Sundar et al. (2018). FASEB journal: official publication of the Federation of American Societies for Experimental Biology 32, 4955-4971). As a result, functional terms predicted to be active in adult hGPCs included senescence, the rapid onset of senescence observed in Hutchinson-Gilford progeria, and cyclin-dependent kinase inhibitory pathways downstream of CDKN1A / p21 and CDKN2A / p16.Furthermore, AHR and its signaling pathway, which have been implicated in driving senescence via inhibition of MYC (Yang et al. (2005). Oncogene 24, 7869-7881), were similarly upregulated in adult GPCs.

[0262] Module 3 consisted primarily of developmental and disease-related signaling pathways that were also associated with aging. This included predicted activation of ASCL1 and BDNF signaling in fetal hGPCs, and MAPT / Tau, APP, and REST signaling in adult GPCs (e.g., Harris et al. (2021). Cell Stem Cell). Overall, transcriptional and functional profiling of adult GPCs revealed a reduction in transcripts associated with proliferative capacity, as well as a shift toward senescence and a more mature phenotype.

[0263] Example 14 The effect of transcription factor activity involves the adult GPC transcriptional repressor Given the significant transcriptional differences between adult and fetal GPCs, the study next sought to infer which transcription factors direct their identity. To achieve this, the study first scanned two promoter windows (500bp up / 100bp down, 10kb up / 10kb down) of adult or fetal enriched GPC gene sets to infer significantly enriched TF motifs (Aibar et al. (2017). Nat Methods 14, 1083-1086). This identified 48 TFs that were also differentially expressed in the intersecting datasets scanned. Of these, the study focused on TFs whose primary means of DNA interaction was exclusively inhibitory or stimulatory, while also considering the enrichment of their known cofactors. This analysis resulted in 12 potential upstream regulators to be explored (panels A-C of FIG. 26): four adult repressors, E2F6, ZNF274, MAX, and IKZF3; one adult activator, STAT3; three fetal repressors, BCL11A HDAC2, and EZH2; and four fetal activators, MYC, HMGA2, NFIB, and TEAD2. Interestingly, among these predicted TFs, three groups shared high motif similarity matches within their targeted promoters: 1) E2F6, ZNF274, MAX, and MYC; 2) STAT3 and BCL11A; and 3) EZH2 and HDAC2, suggesting that they may cooperate or compete for DNA binding at the shared locus (panel A of FIG. 26).

[0264] The study then constructed four potential signaling pathways based on the curated transcriptional interactions to predict genes targeted by our set of TFs (panels D-G in Figure 26). Among the activators enriched in fetal GPCs (panel D in Figure 26), the growth factor MYC (Dang (1999). Molecular and Cellular Biology 19, 1), NFIB, a key determinant in gliogenesis (Deneen et al. (2006). Neuron 52, 953-968), the YAP / TAZ effector TEAD2, and another growth factor, HMGA2, were each predicted to activate a cohort of progenitor stage genes, including both mitosis-related transcripts and those demonstrated to inhibit the onset of senescence (e.g., Diepenbruck et al. (2014). Journal of cell science 127, 1523-1536). Direct positive regulation was also predicted between these four fetal activators, with NFIB driven by HMGA2 and TEAD2, MYC driven by TEAD2 and NFIB, HMGA2 driven by MYC and TEAD2, and TEAD2 reciprocally driven by MYC (Panel D, Figure 26). In contrast to these fetal activators, fetal repressors including the C2H2-type zinc finger BCL11A, the polycomb repressive complex subunit EZH2, and the histone deacetylase HDAC2 were each predicted to repress more mature oligodendrocyte gene expression at this stage (Panel E, Figure 26) (Nakamura et al. (2000). Mol Cell Biol 20, 3178-3186). Furthermore, all three of these TFs were predicted to inhibit targets involved in senescence. Thus, these factors appear to directly orchestrate downstream transcriptional events leading to the maintenance of a cycling progenitor state.

[0265] The study next assessed these predicted adult GPC signaling networks for possible mechanisms responsible for their aging-related gene expression changes. STAT3 was predicted to shift GPC identity toward glial maturation through upregulation of a large cohort of early differentiation and myelination-related oligodendrocyte genes (Panel F of FIG. 26). In addition, STAT3 was also predicted to activate a set of aging-related genes including BIN1, RUNX1, RUNX2, DMTF1, CD47, MAP3K7, CTNNA1, and OGT. Concurrently, repression in adult GPCs was predicted to occur through the Ikaros family zinc finger IKZF3 / Aiolos, the KRAB (Krüppel-associated box) zinc finger ZNF274, the MYC-related factor MAX, and the cell cycle regulator E2F6 (Panel G of FIG. 26) (e.g., Frietze et al. (2010). PLoS One 5, e15082). Targeting with this set of transcription factors predicted repression of those gene sets that contribute to the fetal GPC signature, which was indeed observed in the downregulation of the early ancestral genes PDGFRA and CSPG4, and the cell cycle genes CDK1, CDK4, and MKI67. Repression of YAP1, LMNB1, and TEAD1, whose expression delays or prevents the onset of senescence, was also predicted. Interestingly, this set of four adult repressors predicted downregulated expression of the fetal-enriched repressors BCL11A, EZH2, and HDAC2, as well as the fetal-enriched activators NFIB, MYC, TEAD2, and HMGA2, respectively.

[0266] Example 15 Expression of suppressor of adult condensation induces age-related transcriptional changes in GPCs Next, we asked whether the four identified adult-enriched transcriptional repressors E2F6, IKZF3, MAX, and ZNF274 were alone sufficient to induce aspects of age-related changes in gene expression by otherwise young GPCs. To accomplish this, the study designed doxycycline (Dox)-inducible overexpression lentiviruses for each transcription factor (Panel A of FIG. 27). Briefly, the study first identified which protein-coding isoforms were most abundant in adult GPCs for each repressor to best mimic endogenous age-related upregulation; these candidates were E2F6-202, IKZF3-217, MAX-201, and ZNF274-201. These cDNAs were cloned downstream of a tetracycline-responsive element promoter and upstream of a T2A self-cleaving EGFP reporter (Panel A of FIG. 27). Human induced pluripotent stem cell (iPSC)-derived hGPC cultures prepared from the C27 line as previously described (Wang et al. (2013). Cell Stem Cell 12, 252-264) were then infected for 24 hours and then treated with Dox to induce overexpression of the transgene. C27 iPSC-derived GPCs selected as their transcriptome resembles that of fetal GPCs, and they are similarly able to engraft and myelinate in hypomyelinating mice upon transplantation (e.g., Windrem et al. (2017). Cell Stem Cell 21, 195-208. e196). Overexpressing cells were selected via FACS for EGFP expression 3, 7, and 10 days after Dox addition (Panel B of Figure 27, n=3-5). Uninfected cultures fed Dox were used as controls.

[0267] RNA was extracted and aging-associated genes of interest were analyzed by qPCR. Significant induction of each adult-enriched repressor was observed at each time point after Dox supplementation (Panel C of FIG. 27). MKI67 and CDK1, genes whose upregulation is associated with active cell division, were significantly repressed at two or more time points in each overexpression paradigm (Panel D of FIG. 27). This was consistent with their reduced expression in adult GPCs, suggesting their direct repression by E2F6, MAX, and ZNF274 (MKI67) or by all four (CDK1). The GPC stage marker PDGFRA, the cognate receptor for PDGF-AA, was also significantly repressed at two time points in IKZF3-transduced GPCs and at day 3 in E2F6-transduced GPCs, consistent with its repression in normal adult GPCs. Interestingly, the senescence-associated cyclin-dependent kinase inhibitor CDKN1A / p21 was upregulated in response to each of the inhibitors tested at all time points, while CDKN2A / p16 was similarly upregulated at all time points in ZNF274-transduced hGPCs and at day 7 in E2F6-overexpressing GPCs (panel D of FIG. 27). In addition, both MBP and IL1A, which are both strongly upregulated in adult hGPCs compared to fetal, showed a sharp trend for upregulation of expression in response to inhibitor transduction, although time point-related variability prevented those increments from achieving statistical significance. Together, these data supported the prediction that forced premature expression of the adult-enriched GPC inhibitors E2F6, IKZF3, MAX, and ZNF274, individually, is sufficient alone to induce multiple features of the aged GPC transcriptome in young iPSC-derived GPCs.

[0268] Example 16 miRNA expression patterns of fetal hGPCs predict their suppression of senescence To identify possible post-transcriptional regulators of gene expression, we assessed the differences in miRNA expression between adult and fetal GPCs (n=4) utilizing Affymetrix GeneChip miRNA 3.0 arrays. PCA showed separation of both GPC populations defined by their miRNA expression profiles (Figure 28, Panel A). Differential expression (adjusted p-value <0.01) between both ages yielded 56 genes (23 enriched in adult GPCs, 33 enriched in fetal GPCs, Figure 28, Panels B-C). Notably, among these, differentially expressed miRNAs were the fetal precursor stage miRNAs miR-9-3p, miR-9-5p (Lau et al. (2008). J Neurosci 28, 11720-11730), and miR-17-5p (Budde et al. (2010). Development 137, 2127), as well as the adult oligodendrocyte regulators miR-219a-3p and miR-338-5p (e.g., Wang et al. (2017). Dev Cell 40, 566-582.e565).

[0269] The study then utilized this cohort of miRNAs to analyze both adult and fetal GPC pools separately to predict genes whose expression may be predicted to be suppressed via miRNA upregulation. To accomplish this, the study used miRNAtap to query five miRNA gene target databases: DIANA (Maragkakis et al. (2011). Nucleic Acids Res 39, W145-148), Miranda (Enright et al. (2003). MicroRNA targets in Drosophila. Genome biology 5, R1), PicTar (Lall et al. (2006). Current biology: CB 16, 460-471), TargetScan (Friedman et al. (2009). Genome Res 19, 92-105), and miRDB (Wong and Wang (2015). Nucleic Acids Res 43, D146-152). To maximize accuracy, genes were considered as targets only if they appeared in at least two databases. Among fetal enriched miRs, this approach predicted an average of 36.3 (SD=24.5) repressed genes per miRNA. In contrast, among adult hGPC enriched miRNAs, an average of 46.4 (SD=37.8) genes were predicted as targets per miRNA (Figure 28, Panel C). Altogether, this identified possible repression of 48.8% of adult GPC enriched genes via fetal miRNAs and repression of 39.9% of fetal GPC enriched genes by adult miRNAs.

[0270] To assess the functional significance of these miRNA-dependent post-transcriptional regulatory mechanisms, we curated fetal and adult networks according to miRNA targeting of functionally related differentially expressed genes (Figure 28, Panels D-E). Our proposed upstream adult transcriptional regulators STAT3, E2F6, and MAX were predicted to be inhibited through seven miRNAs in fetal GPCs (Figure 28, Panel D), including previously validated repression of STAT3 in other cell types by miR-126b-5p, miR-106a-5p, miR-17-5p, miR-130a-3p, and miR-130b-3p (e.g., Du et al. (2014a). Cellular Physiology and Biochemistry 34, 955-965). In parallel, several early and mature oligodendrocyte genes were simultaneously targeted for inhibition, all consistent with the maintenance of a progenitor state; these included MBP, UGT8, CD9, PLP1, MYRF, and PMP22 (Goldman and Kuypers, (2015). Development 142, 3983-3995). Importantly, a cohort of genes associated with either induction of senescence or inhibition of proliferation, or both, were also predicted to be actively repressed in fetal GPCs. These included RUNX1, RUNX2, BIN1, DMTF1 / DMP1, CTNNA1, SERPINE1, CDKN1C, PAK1, IFI16, EFEMP1, MAP3K7, AHR, OGT, CBX7, and CYLD (e.g., Eckers et al. (2016). Sci Rep 6, 19618). Inhibition of senescence or activation of proliferation has also been noted by several miRNAs identified herein, including miR-17-5p, miR-93-3p, miR-1260b, miR-106a-5p, miR-767-5p, miR-130a-3p, miR-9-3p, miR-9-5p, and miR-130b-3p (e.g., Borgdorff et al. (2010). Oncogene 29, 2262-2271). Together, these data provide a complementary mechanism by which fetal hGPCs may maintain their characteristic progenitor transcriptional state and signature.

[0271] Example 17 Adult miRNA signaling can suppress a proproliferative state and portend senescence The study next explored a possible miRNA regulatory network within adult hGPCs (Panel E of Figure 28). This implicated five miRNAs that control five identified active fetal transcriptional regulators, including HDAC2, NFIB, BCLL1A, TEAD2, and HMGA2, whose silencing via miR-4651 has previously been shown to inhibit proliferation (Han et al. (2020). Int J Oral Sci 12, 10). This cohort of miRNAs was predicted to operate in parallel with adult transcriptional repressors in inhibiting the expression of genes involved in maintaining the GPC progenitor state, including PDGFRA, PTPRZ1, ZBTB18, SOX6, EGFR, and NRXN1.Furthermore, the adult miRNA environment is involved in the regulation of LMNB1 (Freund et al. (2012). Mol Biol Cell 23, 2066-2075), PATZ1 (Cho et al. (2012). Cell Death Differ 19, 703-712), GADD45A (Hollander et al. (1999). Nat Genet 23, 176-184), YAP1 and TEAD1 (Xie et al. (2013)), CDK1 (Diril et al. (2012). Proc Natl Acad Sci USA 109, 3826-3831), TPX2 (Rohrberg et al. (2020). Cell Rep 30, 3368- 3382 e3367), S1PR1 (Liu et al. (2019). Journal of Experimental & Clinical Cancer Research 38, 369), RRM2 (Aird et al. (2013). Cell Rep 3, 1252-1265), CCND2 (Bunt et al. (2010). Mol Cancer Res 8, 1344-1357), SGO1 (Murakami-Tonami et al. (2016). Scientific Reports 6, 31615), MCM4 and MCM6 (Mason et al. (2004). Oncogene 23, 9238-9246), ZNF423 (Hernandez-Segura et al. (2017). Current biology:CB 27, 2652-2660 e2654), PHB (Piper et al. (2002). Aging cell 1, 149-157), WLS (Poudel et al. (2020). Stem The IL-11 receptor agonist, IL-11, and IL-11 receptor agonist, IL-11, were predicted to repress a number of genes known to induce a proliferative state or delay senescence, including IL-11, IL-11, IL-11, and ZMAT3 (Kim et al. (2012). EMBO J 31, 4289-4303).More directly, induction of senescence or inhibition of proliferation was associated with upregulation of miR-584-5p (Li et al. (2017). J Exp Clin Cancer Res 36, 59), miR-193a-5p (Chen et al. (2016). J Exp Clin Cancer Res 35, 173), miR-548ac (Song et al. (2020). Oncol Lett 20, 69), miR-23b-3p (Campos-Viguri et al. (2020). Sci Rep 10, 3256), miR-140-3p and miR-330-3p (Wang, Y et al. (2020b). Aging 12, 20366-20379). Taken together, these data implicate these miRs as active participants in the maintenance of the progenitor state in fetal hGPCs and their modulation as a likely mechanism by which adult hGPCs adopt their participating gene expression profile.

[0272] Example 18 Transcription factor regulation of miRNAs establishes and reinforces GPC identity The study next sought to predict the upstream regulation of differentially expressed miRNAs in fetal and adult GPCs by querying the TransmiR transcription factor miRNA regulation database (Tong et al. (2019). TransmiR v2.0: an updated transcription factor-microRNA regulation database. Nucleic Acids Res 47, D253-D258). This approach predicted the regulation of 54 of the 56 age-specific GPC miRNAs through 66 transcription factors that were also determined to be significantly differentially expressed between fetal and adult GPCs. Interestingly, the top four predicted miRNA-regulating TFs were all MYC-associated factors, including MAX, MYC itself, E2F6, and fetal-enriched MYC-associated zinc finger protein MAZ, which target 36, 33, 30, and 28 unique differentially expressed miRNAs, respectively.

[0273] Examination of the proposed associations in the context of the 12 TF candidates showed numerous fetal hGPC-enriched miRNAs predicted to be targeted by both fetal activators and adult repressors, whereas those miRNAs enriched in adult GPCs were more uniquely targeted. MYC was predicted to drive expression of numerous miRNAs in fetal GPCs, many of which were predicted to be repressed in adulthood via E2F6, MAX, or both. miR-130a-3p was predicted to be targeted by MYC, MAX, and E2F6, in addition to activation via TEAD2. Notably, among the validated TF-miRNA interactions in other cell types, the rejuvenating upregulation of miR-17-5p by MYC and its repression by MAX (Du et al. (2014b). miR-17 extends mouse lifespan by inhibiting senescence signaling mediated by MKP7. Cell Death Dis 5, e1355) was reported. Similarly, parallel activation of the proliferative miR-130-3p by MYC or TEAD2 and YAP1 (Shen et al. (2015). A miR-130a-YAP positive feedback loop promotes organ size and tumorigenesis. Cell Res 25, 997-1012) has been reported, as has activation of both arms of miR-9 by MYC (Ma, L. et al. (2010a). miR-9, a MYC / MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Nat Cell Biol 12, 247-256), which decreases with oligodendrocyte maturity (Lau, P. et al. (2008). Identification of dynamically regulated microRNA and mRNA networks in developing oligodendrocytes. J Neurosci 28, 11720-11730).

[0274] In adult GPCs, enriched miRNAs predicted to be regulated by our significantly enriched TF cohort were more likely to be targeted exclusively by adult activators of fetal suppressors, with only miR-151a-5p and miR-4687-3p, predicted inhibitors of HMGA2, oppositely targeted by STAT3 versus BCL11A and EZH2, respectively. Beyond this, miR-1268b was predicted to be inhibited by both EZH2 and HDAC2 in parallel. Notably, miR-219a-2-3p, a key oligodendrocyte microRNA, was predicted to remain inhibited in fetal GPCs via EZH2, while STAT3 may independently drive the expression of seven other miRs. Interestingly, STAT3, whose activity is increased in association with senescence (Kojima et al. (2013). IL-6-STAT3 signaling and premature senescence. JAKSTAT 2, e25763), was also predicted to drive the expression of a cohort of miRNAs independently associated with the induction of senescence, including miR-584-5p, miR-330-3p, miR-23b-3p, and miR-140-3p.

[0275] By integrating transcriptional and miRNA profiling, pathway enrichment analysis, and target prediction, we propose a model of human GPC senescence whereby fetal hGPCs maintain progenitor gene expression, activate proliferation programs, and prevent senescence, while transcriptionally and post-transcriptionally suppressing both oligodendrocyte and senescent gene programs. With adult maturation and time, as well as population doubling, hGPCs begin to upregulate repressors of these fetal progenitor-associated networks, while also activating programs toward a progressively more differentiated and ultimately senescent phenotype.

[0276] While various embodiments have been described above, it should be understood that such disclosure is presented by way of example only, and not limitation. Thus, the breadth and scope of the subject compositions and methods should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

[0277] The above description is for the purpose of teaching those skilled in the art how to carry out the invention, and is not intended to detail all obvious modifications and variations thereof that will become apparent to those skilled in the art upon reading the description. However, all such obvious modifications and variations are intended to be included within the scope of the invention as defined by the following claims. The claims are intended to cover the elements and steps in any order that is effective to fulfill the objectives intended therein, unless the context specifically indicates to the contrary.

Claims

1. A drug for rejuvenating brain and / or brainstem glial cells in a subject by introducing the drug into the brain and / or brainstem of the subject, the drug comprising a population of genetically modified glial progenitor cells, the genetically modified glial progenitor cells have increased expression of one or more genes compared to non-genetically modified glial progenitor cells of the same type; the one or more genes are selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3, and ZNF195; The agent, wherein said increased expression of one or more genes in the genetically modified glial progenitor cells confers a competitive advantage over native or already resident glial progenitor cells in the subject.

2. The method of claim 1, wherein the one or more genes are selected from the group consisting of CEBPZ, MYBL2, MYC, NFYB, and TFDP1.

3. The drug described in claim 2, wherein the CEBPZ gene encodes a protein product having the amino acid sequence of SEQ ID NO: 4, the MYBL2 gene encodes a protein product having the amino acid sequence of SEQ ID NO: 5 or 6, the NFYB gene encodes a protein product having the amino acid sequence of SEQ ID NO: 9, and the TFDP1 gene encodes a protein product having the amino acid sequence of SEQ ID NO:

10.

4. The genetically modified glial cells have increased expression of one or more additional genes that confer a competitive advantage compared to unmodified glial progenitor cells, the one or more additional genes being ACTB, AKR1C1, ANAPC11, AP2B1, APLP2, APOD, ARF5, ARL4A, ARPC3, ARPP19, ATOX1, ATP5F1E, ATP5MC1, ATP5MC3, ATP5MD, ATP5ME, ATP5MF, ATP5MG, ATP5MPL, ATP5PF, ATP6V0B, ATP6V0E1, ATXN7L3B, B2M, B3GAT2, BEX1, BEX3, BEX5, BLOC1S1, BMERB1, C18orf32, C1orf122, C1QBP, C4orf48, CADM4, CALM1, CALM3, CALR, CANX, CAV2, CC2D1A, CCND1, CCNI, CD63, CD82, CD C42, CDH2, CFL1, CHCHD2, CHGB, CIAO2B, CLCN3, CLTA, CLTC, CNN3, CNTN1, CO TL1, COX4I1, COX6A1, COX6C, COX7A2, COX7C, COX8A, CPNE8, CPS1, CRNDE, CSP G4, CTHRC1, CUL4B, CYP51A1, DBI, DCX, DDAH1, DDX1, DENND10, DMD, DMRT2, D NAJA2, DPYSL2, DRAP1, DSTN, DYNC1I2, EDF1, EDIL3, EEF1A1, EEF1B2, EEF2, E ID1, EIF3J, ELOB, EMC10, EMP2, ESD, ETV1, FABP7, FAM171B, FAM177A1, FAU, FIS1, FXYD6, GADD45A, GAP43, GCSH, GNAS, GOLM1, GPM6B, GSTP1, H3-3A, H3-3 B, HINT1, HNRNPA1, HNRNPA3, HNRNPAB, HNRNPC, HNRNPK, HNRNPM, HNRNPR, HS PA5, IGFBP2, ITGB8, ITM2A, ITM2B, JPT1, KDELR1, KLRK1-AS1, KRTCAP2, KTN1 , LDHB, LHFPL3, LRRC4B, LY6H, MAP2, MARCKS, MARCKSL1, MIA, MICOS10, MIF, MIR9-1HG, MMGT1, MPZL1, MT3, MTLN, MTRNR2L12, MTRNR2L8, MYL12A, MYL12B,NACA, NARS1, NCL, NDUFA1, NDUFA11, NDUFA13, NDUFA3, NDUFA4, NDUFB1, NDUFB11, NDUFB2, NDUFB6, NDUFB7, NDUFC2, NDUFS5, NEU4, NUCK S1, OAZ1, OLFM2, OSBPL8, OST4, OSTC, PABPC1, PCBP2, PCDH10, PCDH11X, PCDH17, PCDHB2, PCDHGB6, PDGFRA, PDIA6, PEBP1, PEG10, PFN1, PGRMC1, PKIA, PLPP3, PLPPR1, PPIA, PRDX1, PRDX2, PRDX5, PSMB1, PSMB9, PTMS, PTN, PTPRA, RAB10, RAB14, RAB2A, RAB31, RAC1, RACK1, R MDN2, RAMP1, RO60, ROBO1, RRAGB, RTN3, S100B, SARAF, SAT1, SBDS, SCARB2, SCP2, SCRG1, SEC62, SELENOK, SELENOT, SELENOW, SERF2, SE RPINE2, SET, SH3BGRL, SKP1, SLC25A6, SLIT2, SLITRK2, SMC3, SMDT1, SMOC1, SMS, SNCA, SNHG29, SNHG6, SNX3, SNX22, SOD1, SOX11, SOX2 , SOX9, SPCS2, SPCS3, SRP14, SSR4, STAG2, STMN1, SUPT16H, TALDO1, TBCB, TCEAL7, TCEAL8, TCEAL9, TIMP1, TLE5, TM4SF1, TM9SF3, TMA7 4. The agent according to any one of claims 1 to 3, wherein the agent is selected from the group consisting of TMBIM6, TMCO1, TMEM147, TMEM258, TMEM50A, TMOD2, TMSB10, TMSB4X, TPT1, TRAF4, TRIO, TSC22D4, TSPAN6, TSPAN7, TTC3, TUBB, UBA52, UBL5, UQCR10, UQCR11, UQCRB, VIM, WSB2, WSCD1, YBX1, YWHAB, YWHAE, ZFAS1, ZNF428, and ZNF462.

5. 4. The agent according to any one of claims 1 to 3, wherein the expression of the one or more genes and / or one or more additional genes is increased by at least 100% at the mRNA level in the genetically modified glial cells compared to the same type of glial cells that are not genetically modified.

6. the genetically modified glial cells have reduced expression of one or more genes compared to non-genetically modified glial cells of the same type; One or more genes may be ABCG1, ADGRB1, AKAP9, AL360181.3, ANKRD10, ARGLU1, ARL16, ATP10B, B3GNT7, BHLHE41, BPTF, BRI3, BX664615.2, BX890604.1, C1QL2, CAMK2N1, CCDC85B, CCNL1, CHCHD10, CHORDC1, CIRBP, CLDN10, COL9A1, COL9A2, DANCR, DCXR, DHX36, DLL3, DNAJA1, D NM3, ECH1, EGR1, EIF1AX, ELAVL3, EMID1, ETFB, FAM133A, FAM133B, FBXO2, FERMT1, FOS, FOSB, FSCN1, FSIP2, GABPB1-AS1, GALR1, GNG 8, GNPTAB, GOLGA8A, GOLGA8B, GPR155, GRID2, GRM7, HAPLN1, HMX1, HSPA1A, HSPA1B, HTRA1, JAG1, JUN, JUNB, KCNIP4, KCNQ1OT1, KLF3- AS1, LAMP2, LINC01116, LINC01301, LINC01896, LRP4, LRRC7, MACF1, MALAT1, MASP1, MDH1, MT1E, MYT1, NASP, NKTR, NUTM2A-AS1, OFD 1, PCDHB5, PCDHGA3, PEPD, PHGDH, PMP2, PNISR, PPP1R14A, PTGDS, RAB3IP, RAF1, RAP1GAP, RARRES2, RBM25, RBMX, REV3L, RHOBTB3, RIM The agent of any one of claims 1 to 3, wherein the agent is selected from the group consisting of S2, RIT2, RRBP1, RSRP1, S100A1, S100A16, SCG2, SEMA3E, SERTAD1, SEZ6L, SEZ6L2, SH3GLB2, SNHG15, SNRNP70, SRSF5, STXBP6, SYNRG, TLE4, TMEM176B, TPI1, TSC22D3, USP11, VCAN, WFDC1, WSB1, ZFYVE16, ZNF528, and ZNF528-AS1.

7. The method of claim 6, wherein the expression of the one or more genes that are decreased is reduced by at least 50% at the mRNA level in the genetically modified glial cells compared to the same type of glial cells that are not genetically modified.

8. The agent according to any one of claims 1 to 3, wherein the subject is a human and the genetically modified glial cells are derived from human glial progenitor cells.

9. The method of claim 8, wherein the human progenitor cells are derived from fetal tissue, embryonic stem cells, or induced pluripotent stem cells.

10. 4. The method of claim 1, wherein the introducing step results in replacement of native or already resident glial cells in the forebrain, striatum, and / or cerebellum of the subject with genetically modified glial cells.

11. an isolated population of genetically modified glial progenitor cells, wherein the genetically modified glial progenitor cells have increased expression of one or more genes compared to non-genetically modified glial progenitor cells of the same type; 1. An isolated population of genetically modified glial progenitor cells, wherein one or more genes are selected from the group consisting of ARX, CEBPZ, DLX1, DLX2, ELK1, ETS1, ETV4, KLF16, MYBL2, NFYB, POU3F1, SMAD1, SOX3, SP5, TCF12, TFDP1, TP53, ZIC3 and ZNF195.

12. 12. The genetically modified glial progenitor cell of claim 11, wherein the one or more genes are selected from the group consisting of CEBPZ, MYBL2, NFYB, and TFDP1.

13. The genetically modified glial cell of claim 12, wherein the CEBPZ gene encodes a protein product having the amino acid sequence of SEQ ID NO: 4, the MYBL2 gene encodes a protein product having the amino acid sequence of SEQ ID NO: 5 or 6, the NFYB gene encodes a protein product having the amino acid sequence of SEQ ID NO: 9, and the TFDP1 gene encodes a protein product having the amino acid sequence of SEQ ID NO:

10.

14. The genetically modified progenitor glial cells have increased expression of one or more additional genes compared to unmodified glial progenitor cells, and the one or more additional genes are ACTB, AKR1C1, ANAPC11, AP2B1, APLP2, APOD, ARF5, ARL4A, ARPC3, ARPP19, ATOX1, ATP5F1E, ATP5MC1, ATP5MC3, ATP5MD, ATP5ME, ATP5MF, ATP5MG, ATP5MPL, ATP5PF, ATP6V0B, ATP6V0E1, ATXN7L3B, B2M, B3GAT2, BEX1, and BEX2. 3, BEX5, BLOC1S1, BMERB1, C18orf32, C1orf122, C1QBP, C4orf48, CADM4, CA LM1, CALM3, CALR, CANX, CAV2, CC2D1A, CCND1, CCNI, CD63, CD82, CDC42, CDH 2, CFL1, CHCHD2, CHGB, CIAO2B, CLCN3, CLTA, CLTC, CNN3, CNTN1, COTL1, COX 4I1, COX6A1, COX6C, COX7A2, COX7C, COX8A, CPNE8, CPS1, CRNDE, CSPG4, CTHR C1, CUL4B, CYP51A1, DBI, DCX, DDAH1, DDX1, DENND10, DMD, DMRT2, DNAJA2, D PYSL2, DRAP1, DSTN, DYNC1I2, EDF1, EDIL3, EEF1A1, EEF1B2, EEF2, EID1, EI F3J, ELOB, EMC10, EMP2, ESD, ETV1, FABP7, FAM171B, FAM177A1, FAU, FIS1, F XYD6, GADD45A, GAP43, GCSH, GNAS, GOLM1, GPM6B, GSTP1, H3-3A, H3-3B, HINT 1, HNRNPA1, HNRNPA3, HNRNPAB, HNRNPC, HNRNPK, HNRNPM, HNRNPR, HSPA5, IG FBP2, ITGB8, ITM2A, ITM2B, JPT1, KDELR1, KLRK1-AS1, KRTCAP2, KTN1, LDHB , LHFPL3, LRRC4B, LY6H, MAP2, MARCKS, MARCKSL1, MIA, MICOS10, MIF, MIR9- 1HG, MMGT1, MPZL1, MT3, MTLN, MTRNR2L12, MTRNR2L8, MYL12A, MYL12B, NACA,NARS1, NCL, NDUFA1, NDUFA11, NDUFA13, NDUFA3, NDUFA4, NDUFB1, NDUFB11, NDUFB2, NDUFB6, NDUFB7, NDUFC2, NDUFS5, NEU4, NUCKS1, OA Z1, OLFM2, OSBPL8, OST4, OSTC, PABPC1, PCBP2, PCDH10, PCDH11X, PCDH17, PCDHB2, PCDHGB6, PDGFRA, PDIA6, PEBP1, PEG10, PFN1, PGRMC1 , PKIA, PLPP3, PLPPR1, PPIA, PRDX1, PRDX2, PRDX5, PSMB1, PSMB9, PTMS, PTN, PTPRA, RAB10, RAB14, RAB2A, RAB31, RAC1, RACK1, RMDN2, RA MP1, RO60, ROBO1, RRAGB, RTN3, S100B, SARAF, SAT1, SBDS, SCARB2, SCP2, SCRG1, SEC62, SELENOK, SELENOT, SELENOW, SERF2, SERPINE2, S ET, SH3BGRL, SKP1, SLC25A6, SLIT2, SLITRK2, SMC3, SMDT1, SMOC1, SMS, SNCA, SNHG29, SNHG6, SNX3, SNX22, SOD1, SOX11, SOX2, SOX9, SP CS2, SPCS3, SRP14, SSR4, STAG2, STMN1, SUPT16H, TALDO1, TBCB, TCEAL7, TCEAL8, TCEAL9, TIMP1, TLE5, TM4SF1, TM9SF3, TMA7, TMBIM6, T The genetically modified glial cell of any one of claims 11 to 13, wherein the gene is selected from the group consisting of MCO1, TMEM147, TMEM258, TMEM50A, TMOD2, TMSB10, TMSB4X, TPT1, TRAF4, TRIO, TSC22D4, TSPAN6, TSPAN7, TTC3, TUBB, UBA52, UBL5, UQCR10, UQCR11, UQCRB, VIM, WSB2, WSCD1, YBX1, YWHAB, YWHAE, ZFAS1, ZNF428, and ZNF462.

15. 14. The genetically modified glial cell of any one of claims 11 to 13, wherein the expression of the one or more genes and / or one or more additional genes is increased at the mRNA level by at least 100% in the genetically modified glial cell compared to a glial cell of the same type that is not genetically modified.

16. the genetically modified glial cells have reduced expression of one or more genes compared to non-genetically modified glial cells of the same type; One or more genes include ABCG1, ADGRB1, AKAP9, AL360181.3, ANKRD10, ARGLU1, ARL16, ATP10B, B3GNT7, BHLHE41, BPTF, BRI3, BX664615.2, BX890604.1, C1QL2, CAMK2N1, CCDC85B, CCNL1, CHCHD10, CHORDC1, CIRBP, CLDN10, COL9A1, COL9A2, DANCR, DCXR, DHX36, DLL3, DNAJA1, DNM3 , ECH1, EGR1, EIF1AX, ELAVL3, EMID1, ETFB, FAM133A, FAM133B, FBXO2, FERMT1, FOS, FOSB, FSCN1, FSIP2, GABPB1-AS1, GALR1, GNG8, GN PTAB, GOLGA8A, GOLGA8B, GPR155, GRID2, GRM7, HAPLN1, HMX1, HSPA1A, HSPA1B, HTRA1, JAG1, JUN, JUNB, KCNIP4, KCNQ1OT1, KLF3-AS1, L AMP2, LINC01116, LINC01301, LINC01896, LRP4, LRRC7, MACF1, MALAT1, MASP1, MDH1, MT1E, MYT1, NASP, NKTR, NUTM2A-AS1, OFD1, PCDH B5, PCDHGA3, PEPD, PHGDH, PMP2, PNISR, PPP1R14A, PTGDS, RAB3IP, RAF1, RAP1GAP, RARRES2, RBM25, RBMX, REV3L, RHOBTB3, RIMS2, RIT2 , RRBP1, RSRP1, S100A1, S100A16, SCG2, SEMA3E, SERTAD1, SEZ6L, SEZ6L2, SH3GLB2, SNHG15, SNRNP70, SRSF5, STXBP6, SYNRG, TLE4, TMEM176B, TPI1, TSC22D3, USP11, VCAN, WFDC1, WSB1, ZFYVE16, ZNF528, and ZNF528-AS1.

17. 17. The genetically modified glial cell of claim 16, wherein the expression of one or more genes with decreased expression is reduced by at least 50% at the mRNA level in the genetically modified glial cell compared to the same type of glial cell that is not genetically modified.

18. The genetically modified glial progenitor cells according to any one of claims 11 to 13, wherein the genetically modified glial progenitor cells are derived from human glial progenitor cells.