Compounds and methods for reducing tau expression

JP2024539596A5Pending Publication Date: 2025-10-14IONIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024520945
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-03-08
Filing Date
2022-10-07
Publication Date
2025-10-14

AI Technical Summary

Technical Problem

Current treatments for neurodegenerative diseases associated with tau protein, such as Alzheimer's disease and frontotemporal dementia, lack effective options to reduce tau expression and alleviate symptoms.

Method used

The use of RNAi agents and pharmaceutical compositions to target and reduce tau RNA and protein levels in cells, including oligomeric duplexes, to alleviate symptoms of neurodegenerative diseases.

Benefits of technology

Reduces tau protein levels and alleviates symptoms such as memory loss and neurofibrillary inclusions in neurodegenerative diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2023064707000001
    Figure 2023064707000001
Patent Text Reader

Abstract

RNAi agents, methods, and pharmaceutical compositions are provided for reducing the amount or activity of tau RNA in a cell or animal, and in certain cases, for reducing the amount of tau protein in a cell or animal. Such RNAi agents, methods, and pharmaceutical compositions are useful for alleviating at least one symptom or characteristic of a neurodegenerative disease, including tauopathy, Alzheimer's disease, frontolateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Sequence Listing This application has been filed in electronic format with a Sequence Listing, which is provided as a file entitled BIOL0438WOSEQ.xml, created on October 3, 2022, which is 1.68 MB in size. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety.

[0002] RNAi agents, methods, and pharmaceutical compositions are provided for reducing the amount or activity of tau RNA in a cell or animal, and in certain cases, for reducing the amount of tau protein in a cell or animal. Such agents, methods, and pharmaceutical compositions are useful for alleviating at least one symptom or characteristic of a neurodegenerative disease. Such neurodegenerative diseases include tauopathy, Alzheimer's disease (AD), frontolateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome. Such symptoms or characteristics include memory loss, loss of motor function, and an increase in the number and / or volume of neurofibrillary inclusions. [Background technology]

[0003] The main function of tau is to bind and stabilize microtubules, which are important structural components of the cytoskeleton involved in mitosis, cytokinesis, and vesicle transport. Tau is found in multiple tissues, but is particularly abundant in the axons of neurons. In humans, there are six isoforms of tau generated by alternative splicing of exons 2, 3, and 10. Splicing of exons 2 and 3 results in the inclusion of 0, 1, or 2 29 amino acid acidic domains, referred to as 0N, 1N, or 2N tau, respectively. The effect of these domains on tau function is not entirely clear, but may play a role in interactions with the plasma membrane. Inclusion of exon 10 leads to the inclusion of a microtubule-binding domain encoded by exon 10. Due to the presence of three microtubule-binding domains elsewhere in tau, this tau isoform (including exon 10) is referred to as 4R tau, where "R" refers to the number of repeats of the microtubule-binding domain. Tau without exon 10 is referred to as 3R tau. 4R tau likely significantly increases microtubule binding and assembly, since more microtubule-binding domains (4R compared to 3R) increase binding to microtubules. The ratio of 3R / 4R tau is developmentally regulated, with fetal tissues expressing only 3R tau and adult human tissues expressing similar levels of 3R / 4R tau. Deviations from the normal ratio of 3R / 4R tau are characteristic of neurodegenerative FTD tauopathy. It is not known how altering the 3R / 4R tau ratio at later stages in adult animals affects tau pathogenesis.

[0004] Serine-threonine directed phosphorylation regulates the microtubule binding ability of tau. Hyperphosphorylation promotes detachment of tau from microtubules. Other post-translational modifications of tau have been described, but the significance of these is unclear. Tau phosphorylation is also developmentally regulated with higher phosphorylation in fetal tissues and much lower phosphorylation in adults. One hallmark of neurodegenerative disorders is abnormally increased tau phosphorylation. The microtubule network is involved in many important processes within the cell, including the structural integrity required to maintain cell morphology and to operate transport mechanisms. Because binding of tau to microtubules stabilizes microtubules, tau may be a key mediator of some of these processes, and disruption of normal tau in neurodegenerative diseases may disrupt some of these important cellular processes.

[0005] One of the early indications that tau may be important in neurodegenerative syndromes was the recognition that tau is a key component of neurofibrillary inclusions in Alzheimer's disease. Indeed, neurofibrillary inclusions are aggregates of hyperphosphorylated tau protein. Together with amyloid beta-containing plaques, neurofibrillary inclusions are a hallmark of Alzheimer's disease and significantly correlate with cognitive impairment. 95% of tau accumulation in AD is found in neuronal processes, referred to as neuritic dystrophy. The process(es) by which this microtubule-associated protein breaks free from microtubules to form protein deposits, and how this relates to neurotoxicity, is not fully understood.

[0006] Neuronal tau inclusions are a pathological hallmark of Alzheimer's disease as well as PSP and CBD, subsets of frontolateral dementia (FTD). The discovery that mutations in the tau gene cause a subset of FTD solidified the link between tau and neurodegeneration. These genetic data also highlighted the importance of the 3R:4R ratio of tau. Many of the tau mutations that cause FTD cause changes in tau splicing, which results in preferential inclusion of exon 10 and thus an increase in 4R tau. Overall tau levels are normal. It remains unclear whether changes in tau isoforms, or amino acid changes, or both, cause neurodegeneration. Recent data suggest that PSP may also be associated with an increased 3R:4R ratio.

[0007] To help understand the impact of tau ratio on neurodegeneration, a mouse model based on one of the spliced ​​tau mutations (N279K) was generated using a minigene containing the tau promoter and flanking intronic sequences of exon 10. Similar to humans, these mice exhibit increased levels of 4R tau compared to transgenics expressing WT tau and develop behavioral and motor abnormalities, as well as accumulation of aggregated tau in the brain and spinal cord.

[0008] Tau protein is associated with multiple diseases of the brain, including Alzheimer's disease, FTD, PSP, CBD, dementia pugilistica, chromosome-associated parkinsonism, Ritiko-Bodig disease, neurofibrillary tangle senile dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, argyrophilic grain dementia, corticobasal degeneration or frontotemporal lobar degeneration, etc. Tau-related disorders such as AD are the most common cause of dementia in the elderly. AD affects an estimated 15 million people worldwide and 40% of the population over 85 years of age. AD is characterized by two pathological hallmarks, namely tau neurofibrillary inclusions (NFTs) and amyloid beta (Aβ) plaques.

[0009] Currently, there is a lack of acceptable options for treating such neurodegenerative diseases, and therefore, it is a goal herein to provide methods for the treatment of such diseases. Summary of the Invention

[0010] Provided herein are RNAi agents, methods, and pharmaceutical compositions for reducing the amount or activity of tau RNA, and in certain embodiments, for reducing the amount of tau protein in a cell or animal. In certain embodiments, the animal has a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is tauopathy, Alzheimer's disease, frontolateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome. In certain embodiments, the RNAi agents useful for reducing the expression of tau RNA are oligomeric duplexes.

[0011] Also provided is a method useful for alleviating at least one symptom or characteristic of neurodegenerative disease.In certain embodiments, the neurodegenerative disease is tauopathy, Alzheimer's disease, frontolateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome.In certain embodiments, the neurodegenerative disease is AD or FTD.In certain embodiments, the symptom or characteristic includes memory loss, motor function loss, and an increase in the number and / or volume of neurofibrillary inclusions. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "comprising" and other forms such as "comprises" and "includes" is not limiting. Also, terms such as "element" or "component" include both elements and components comprising one unit and elements and components comprising two or more subunits, unless expressly stated otherwise.

[0013] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and papers, and GenBank and NCBI reference sequence records, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.

[0014] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, organic synthetic chemistry, and medicinal and medicinal chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0015] Unless otherwise indicated, the following terms have the following meanings. As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and includes a 2'-β-D-deoxyribosyl sugar moiety having the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).

[0016] As used herein, "2'-MOE" or "2'-O-methoxyethyl" means a 2'-O(CH2)2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" means a sugar moiety having a 2'-O(CH2)2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" means O-methoxyethyl.

[0017] As used herein, "2'-MOE nucleoside" or "2'-O(CH2)2OCH3 nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0018] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" or "2'-O-methylribosyl sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a furanosyl (e.g., ribosyl) sugar moiety. Unless otherwise indicated, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0019] As used herein, "2'-OMe nucleoside" or "2'-OMe modified nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0020] As used herein, "2'-F" refers to a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-fluoro sugar moiety" or "2'-F sugar moiety" or "2'-fluororibosyl sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, the 2'-F sugar moiety is in the β-D-ribosyl configuration.

[0021] As used herein, "2'-F nucleoside" or "2'-F modified nucleoside" means a nucleoside that includes a 2'-F modified sugar moiety.

[0022] As used herein, "xylo 2'-F" refers to a sugar moiety in which the 2'-F has the β-D-xylosyl configuration.

[0023] As used herein, "2'-substituted nucleoside" means a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein with respect to the sugar moiety, "2'-substituted" means a sugar moiety that includes at least one 2'-substituent group other than H or OH.

[0024] As used herein, "3' target site" refers to the 3'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0025] As used herein, "5' target site" refers to the 5'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0026] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0027] As used herein, "abasic sugar moiety" means the sugar portion of a nucleoside that is not linked to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0028] As used herein, "administering" or "administration" means providing a pharmaceutical agent or composition to a subject.

[0029] As used herein, "antisense activity" refers to any detectable and / or measurable change that can be caused by the hybridization of an antisense compound to its target nucleic acid.In certain embodiments, antisense activity is the reduction of the amount or expression of target nucleic acid or protein encoded by such target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of antisense compound.In certain embodiments, antisense activity is the regulation of splicing of target pre-mRNA.

[0030] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0031] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0032] As used herein, "antisense oligonucleotide" refers to the oligonucleotide that comprises the oligonucleotide portion of antisense compound that can hybridize with target nucleic acid and can have at least one antisense activity.Antisense oligonucleotide includes, but is not limited to, antisense RNAi oligonucleotide.

[0033] As used herein, "antisense RNAi oligonucleotide" means an oligonucleotide that is complementary to a target sequence and contains a region that contains at least one chemical modification suitable for RNAi-mediated nucleic acid reduction.

[0034] As used herein, "alleviating" in the context of treatment means that there is an improvement in at least one symptom or characteristic, compared to the same symptom or characteristic in the absence of treatment. In certain embodiments, alleviation is a decrease in the severity or frequency of a symptom or characteristic, or a delay in the onset of a symptom or characteristic, or a delay in the progression of the severity or frequency of a symptom or characteristic. In certain embodiments, the symptom or characteristic is memory loss, loss of motor function, and an increase in the number and / or volume of neurofibrillary inclusions. The progression or severity of an indicator can be determined by subjective or objective measures, which are known to those skilled in the art.

[0035] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0036] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

[0037] As used herein, "blunt" or "blunt ended" with respect to an oligomeric duplex means that there are no unpaired nucleotides at the ends (i.e., there are no overhanging nucleotides). One or both ends of an oligomeric duplex can be blunt.

[0038] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties of cerebrospinal fluid (e.g., osmolality, pH, and / or electrolytes) and is biocompatible with CSF.

[0039] As used herein, "cell targeting moiety" means a conjugate group or a portion of a conjugate group that is capable of binding to a particular cell type or types of cells.

[0040] As used herein, a "cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0041] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of an oligonucleotide or one or more portions thereof and another nucleic acid or one or more portions thereof are capable of hydrogen bonding with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite orientations. As used herein, "complementary nucleobases" means nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (C). mCertain modified nucleobases that pair with natural or other modified nucleobases are known in the art and are not considered to be complementary nucleobases as defined herein unless otherwise indicated. For example, inosine can pair with adenosine, cytosine, or uracil, but are not considered to be complementary. Complementary oligonucleotides and / or target nucleic acids need not have nucleobase complementarity at every nucleoside. Rather, some mismatches are permitted. As used herein, "fully complementary" or "100% complementary" with respect to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to another oligonucleotide or target nucleic acid at every nucleobase of the shorter of the two oligonucleotides, or at every nucleoside if the oligonucleotides are the same length.

[0042] As used herein, a "complementary region" in reference to an oligonucleotide is a stretch of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or target nucleic acid. A "complementary region" of an oligonucleotide means that at least 70% of the nucleobases of the region and another nucleic acid or one or more regions thereof can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions.

[0043] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0044] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0045] As used herein, "conjugate moiety" means a grouping of atoms that modifies one or more properties of a molecule compared to the same molecule lacking the conjugate moiety, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0046] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in a sequence.

[0047] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar moiety" means a β-D ribosyl bicyclic sugar moiety, where the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0048] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar.

[0049] As used herein, "chirally enriched" refers to a plurality of molecules of the same molecular formula, where the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom, as defined herein. A chirally enriched population of molecules with multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds that contain modified oligonucleotides.

[0050] As used herein, "diluent" refers to an ingredient in a composition that lacks pharmacological activity, but is pharma- ceutically necessary or desirable. For example, a diluent in a composition to be injected can be a liquid, such as aCSF, PBS, or saline solution.

[0051] As used herein, "double stranded" with respect to a region or oligonucleotide means a duplex formed by complementary strands of nucleic acid (including, but not limited to, oligonucleotides) hybridized to each other. In certain embodiments, the two strands of a double stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that are folded back on themselves (e.g., a hairpin structure).

[0052] As used herein, "duplex" or "double-stranded region" refers to the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.

[0053] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to antisense agent-mediated, particularly RNAi agent-mediated, reduction in the amount or activity of the target nucleic acid.

[0054] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligomeric duplexes and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense oligonucleotides and nucleic acid targets.

[0055] As used herein, "internucleoside bond" refers to the covalent bond between adjacent nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond."Phosphorothioate internucleoside bond" refers to a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0056] As used herein, "inverted nucleoside" means a nucleotide having 3' to 3' and / or 5' to 5' internucleoside linkages as depicted herein.

[0057] As used herein, "inverted sugar moiety" means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having 3' to 3' and / or 5' to 5' internucleoside linkages.

[0058] As used herein, a "lipid nanoparticle" or "LNP" is a vesicle that includes a lipid layer that encapsulates a pharma- ceutically active molecule, such as a nucleic acid molecule, e.g., an RNAi agent or a plasmid into which an RNAi agent is transcribed. LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of each of which are incorporated herein by reference.

[0059] As used herein, "linked nucleosides" are nucleosides that are linked in a contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0060] As used herein, "linker nucleoside" refers to a nucleoside that either directly or indirectly connects an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

[0061] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first nucleic acid sequence that is not complementary to a corresponding nucleobase of a second nucleic acid sequence, or target nucleic acid, when the first and second nucleic acid sequences are aligned.

[0062] As used herein, "modified nucleoside" means a nucleoside that includes a modified nucleobase and / or a modified sugar moiety.

[0063] As used herein, a "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or at least one internucleoside linkage is modified. As used herein, an "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.

[0064] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0065] As used herein, "neurodegenerative disease" refers to a condition characterized by progressive loss of function or structure, including loss of neuronal function and death of neurons. In certain embodiments, the neurodegenerative disease is a tauopathy, Alzheimer's disease, frontolateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome.

[0066] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications, such as substituents, that do not form a bridge between two atoms of the sugar to form a second ring.

[0067] As used herein, "nucleobase" refers to unmodified or modified nucleobase. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0068] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0069] As used herein, "nucleoside" means a compound or fragment of a compound that includes a nucleobase and a sugar moiety, each of which, independently, is unmodified or modified.

[0070] As used herein, "nucleoside overhang" refers to unpaired nucleotides at either or both termini of an oligomeric duplex formed by hybridization of two oligonucleotides.

[0071] As used herein, "oligomeric agent" refers to an oligomeric compound and, optionally, one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or can be an oligomeric duplex formed by two complementary oligomeric compounds.

[0072] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0073] As used herein, the term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.

[0074] As used herein, "oligonucleotide" means a chain of linked nucleosides linked via internucleoside linkages, each of which may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides.

[0075] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administering to an animal. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as a pill, tablet, dragee, capsule, liquid, gel, syrup, slurry, suspension, and lozenge for oral ingestion by a subject. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0076] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects to the parent compound.

[0077] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0078] As used herein, "prodrug" refers to an inactive or less active form of a compound that is metabolized to form an active or more active compound when administered to a subject. In certain embodiments, a prodrug comprises a cell targeting moiety and at least one active compound.

[0079] As used herein, "reducing or inhibiting the amount or activity" means reducing or blocking transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a complete abolition of transcriptional expression or activity.

[0080] As used herein, "RNA" means RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0081] As used herein, "RNAi agent" refers to an antisense compound that acts, at least in part, via RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or end groups. In certain embodiments, RNAi agents regulate the amount, activity, and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act via RNaseH.

[0082] As used herein, a "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0083] As used herein, "sense oligonucleotide" refers to an oligonucleotide that comprises an oligonucleotide portion of a sense compound that can hybridize with an antisense oligonucleotide. Sense oligonucleotides include, but are not limited to, sense RNAi oligonucleotides.

[0084] As used herein, "standard in vitro assay" means the assay described in Example 2 and reasonable variations thereof.

[0085] As used herein, "stereorandom" or "stereorandom chiral center" in the context of a population of molecules of the same molecular formula means a chiral center that is not controlled during synthesis or enriched after synthesis for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules that contain a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center can be, but is not necessarily, the same as the number of molecules having the (R) configuration of the stereorandom chiral center. In certain embodiments, the stereorandom chiral center is not racemic because one absolute configuration predominates after synthesis, for example, due to the action of a non-chiral reagent near the enriched stereochemistry of the adjacent sugar moieties. In certain embodiments, the stereorandom chiral center is at the phosphorus atom of a stereorandom phosphorothioate or mesyl phosphoramidate internucleoside linkage. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0086] As used herein, a "stabilized phosphate group" refers to a 5' phosphate analog that is more metabolically stable than the 5' phosphate naturally occurring on DNA or RNA.

[0087] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0088] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can attach a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides, including sugar surrogates, can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to a complementary oligomeric compound or target nucleic acid.

[0089] As used herein, "symptom" or "characteristic" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is evident to the subject or a medical professional examining or testing the subject. In certain embodiments, the characteristic is evident by invasive diagnostic testing, including but not limited to post-mortem examination. In certain embodiments, the characteristic is evident by a brain MRI scan. In certain embodiments, the symptom or characteristic includes memory loss, loss of motor function, and / or an increase in the number and / or volume of neurofibrillary inclusions.

[0090] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an oligomeric compound is designed to affect. Target RNA refers to an mRNA transcript, and includes pre-mRNA and mRNA, unless otherwise specified.

[0091] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0092] "Tau-related disease" refers to any disease or disorder associated with any tau nucleic acid or its expression product. Such diseases may include neurodegenerative diseases. Such neurodegenerative diseases may include tauopathy, Alzheimer's disease, frontolateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome.

[0093] By "tau RNA" is meant any messenger RNA (mRNA) expression product of a DNA sequence encoding tau.

[0094] "Tau nucleic acid" refers to any nucleic acid encoding tau. For example, in certain embodiments, tau nucleic acid includes DNA sequences encoding tau, RNA sequences transcribed from DNA encoding tau (including genomic DNA including introns and exons), and mRNA sequences encoding tau. "Tau mRNA" refers to mRNA encoding tau protein. Tau nucleic acid may also be referred to herein as mammalian microtubule-associated protein tau (MAPT), including human microtubule-associated protein tau (MAPT).

[0095] By "tau protein" is meant the polypeptide expression product of a tau nucleic acid.

[0096] As used herein, "terminal group" means a chemical group or group of atoms that is covalently attached to the end of an oligonucleotide.

[0097] As used herein, "treating" means improving a disease or condition in a subject by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves symptoms for the same symptoms in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of a symptom, or delays the onset of a symptom, delays the progression of a symptom, or delays the severity or frequency of a symptom.

[0098] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent or composition that provides a therapeutic effect to an animal. For example, a therapeutically effective amount ameliorates a symptom of a disease.

[0099] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments: Embodiment 1. An oligomeric compound, comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11 to 39, 69 to 112, 157 to 204, 253 to 290, 329 to 375, 423 to 452, 483 to 516, 551 to 580, 611 to 650, 691 to 721, 753 to 898, 1045 to 1443, and the modified oligonucleotide is an antisense oligonucleotide.

[0100] Embodiment 2. The oligomeric compound according to embodiment 1, wherein the nucleic acid base sequence of the modified oligonucleotide comprises any one of the nucleic acid base sequences of SEQ ID NOs: 11-39, 69-112, 157-204, 253-290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, and 1045-1443.

[0101] Embodiment 3. The oligomeric compound according to embodiment 1, wherein the nucleic acid base sequence of the modified oligonucleotide is any of the nucleic acid base sequences of SEQ ID NOs: 11-39, 69-112, 157-204, 253-290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, and 1045-1443.

[0102] Embodiment 4. The oligomeric compound according to any one of embodiments 1 to 3, wherein the nucleobase sequence of the modified oligonucleotide comprises or consists of a nucleobase sequence selected from SEQ ID NOs: 329, 330, 391, 694, 696, 721, 759, 774, 787, 848, 850, 855, 857-858, 860-861, 863, 884, 886, 890, 891, 1045, 1050, 1115, 1116, 1142, 1157, 1159, 1161, 1166-1167, 1229-1330, 1343, 1360, 1364-1365, 1402, 1430-1431.

[0103] Embodiment 5. The oligomeric compound of any one of embodiments 1 to 4, wherein the nucleobase sequence of the modified oligonucleotide is at least 90%, at least 95%, or 100% complementary to an equal length portion of the Tau nucleic acid, and the Tau nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0104] Embodiment 6. The modified oligonucleotide is selected from the group consisting of 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17-30, 17-50, 16. The oligomeric compound according to any one of embodiments 1 to 15, consisting of 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 29, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

[0105] Embodiment 7. The oligomeric compound according to any one of embodiments 1 to 6, wherein the modified oligonucleotide consists of 23 linked nucleosides.

[0106] Embodiment 8. The nucleobase sequence of the modified oligonucleotide is: An isometric portion of nucleobases 110 to 142 of SEQ ID NO: 1; An isometric portion of nucleobases 1754 to 1783 of SEQ ID NO: 1; An isometric portion of the nucleobases 2332 to 2362 of SEQ ID NO: 1; or The oligomeric compound according to any one of embodiments 1 to 7, which is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of an isometric portion of nucleobases 6523 to 6552 of SEQ ID NO: 1.

[0107] Embodiment 9. The nucleobase sequence of the modified oligonucleotide is: SEQ ID NO: 721, 850, 1115, or 1116; SEQ ID NO: 885, 1142, or 1360; SEQ ID NO: 329, 1045, or 1343; and 9. The oligomeric compound according to any one of embodiments 1 to 8, which is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of SEQ ID NO: 890, 1330, or 1431.

[0108] Embodiment 10. The nucleobase sequence of the modified oligonucleotide is SEQ ID NO: 721, 850, 1115, or 1116; SEQ ID NO: 885, 1142, or 1360; SEQ ID NO: 329, 1045, or 1343; and 9. The oligomeric compound according to any one of the preceding embodiments, comprising or consisting of a nucleobase sequence selected from SEQ ID NOs: 890, 1330 or 1431.

[0109] Embodiment 11. The oligomeric compound according to any one of embodiments 1 to 10, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

[0110] Embodiment 12 The oligomeric compound of embodiment 11, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0111] Embodiment 13. The oligomeric compound according to embodiment 12, wherein the bicyclic sugar moiety comprises a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0112] Embodiment 14 The oligomeric compound of embodiment 11, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

[0113] Embodiment 15. The oligomeric compound of embodiment 14, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.

[0114] Embodiment 16 The oligomeric compound according to any one of embodiments 1 to 15, wherein at least one nucleoside of the modified oligonucleotide comprises a sugar surrogate.

[0115] Embodiment 17. The oligomeric compound of embodiment 16, wherein the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), hexitol nucleic acid (HNA), fluoro-hexitol nucleic acid (F-HNA), and peptide nucleic acid (PNA).

[0116] Embodiment 18. The oligomeric compound according to any one of embodiments 1 to 17, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0117] Embodiment 19. The oligomeric compound according to embodiment 18, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0118] Embodiment 20 The oligomeric compound according to embodiment 19, wherein at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.

[0119] Embodiment 21 The oligomeric compound according to embodiment 20, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0120] Embodiment 22. The oligomeric compound according to any one of embodiments 1 to 18, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0121] Embodiment 23. The oligomeric compound according to any one of embodiments 1 to 18, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage.

[0122] Embodiment 24. The oligomeric compound according to any one of embodiments 1 to 18, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage.

[0123] Embodiment 25. The oligomeric compound according to any one of embodiments 1 to 24, wherein the modified oligonucleotide has an internucleoside linkage motif of ssooooooooooooooooooooss, where "s" is a phosphorothioate internucleoside linkage and "o" is a phosphodiester internucleoside linkage.

[0124] Embodiment 26. The oligomeric compound according to any one of embodiments 1 to 25, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0125] Embodiment 27. The oligomeric compound according to embodiment 26, wherein the modified nucleobase is 5-methylcytosine.

[0126] Embodiment 28 The oligomeric compound of embodiment 27, wherein each cytosine is a 5-methylcytosine.

[0127] Embodiment 29. The oligomeric compound of any one of embodiments 1 to 28, wherein the modified oligonucleotide has a sugar motif (5' to 3') of yfyfyfyfyfyfyfyfyfyfyy or yfyyyfyyyyyyyyyfyyyyy, wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0128] Embodiment 30. The oligomeric compound of any one of embodiments 1 to 29, wherein the oligomeric compound comprises a conjugate group.

[0129] Embodiment 31 The oligomeric compound according to embodiment 30, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0130] Embodiment 32 The oligomeric compound according to embodiment 31, wherein the conjugate moiety is a lipophilic group.

[0131] Embodiment 33. The oligomeric compound according to embodiment 31, wherein the conjugate moiety is selected from C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0132] Embodiment 34. The oligomeric compound according to any one of embodiments 31 to 33, wherein the conjugate linker consists of a single bond.

[0133] Embodiment 35 The oligomeric compound according to any one of embodiments 31 to 33, wherein the conjugate linker is cleavable.

[0134] Embodiment 36 The oligomeric compound of any one of embodiments 1 to 335, comprising a terminal group.

[0135] Embodiment 37. An oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound described in any one of embodiments 1 to 36.

[0136] Embodiment 38. The oligomeric duplex of embodiment 37, wherein the second modified oligonucleotide consists of 8 to 80 linked nucleosides and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0137] Embodiment 39. An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleic acid bases of any of the nucleic acid base sequences of SEQ ID NOs: 11 to 39, 69 to 112, 157 to 204, 253 to 290, 329 to 375, 423 to 452, 483 to 516, 551 to 580, 611 to 650, 691 to 721, 753 to 898, and 1045 to 1443; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0138] Embodiment 40. An oligomeric duplex comprising: A first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleic acid bases of any of the nucleic acid base sequences of SEQ ID NOs: 11 to 39, 69 to 112, 157 to 204, 253 to 290, 329 to 375, 423 to 452, 483 to 516, 551 to 580, 611 to 650, 691 to 721, 753 to 898, and 1045 to 1443; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleic acid base sequence of the second modified oligonucleotide comprises at least 8, at least 10, or at least 15 of any of the nucleic acid base sequences of SEQ ID NOs: 40 to 68, 113 to 156, 205 to 252, 291 to 328, 376 to 422, 453 to 482, 517 to 550, 581 to 610, 651 to 690, 722 to 752, 899 to 1044, and 1444 to 1842. and a second oligomeric compound comprising at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0139] Embodiment 41. An oligomeric duplex comprising: A first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide is any one of SEQ ID NOs: 11 to 39, 69 to 112, 157 to 204, 253 to 290, 329 to 375, 423 to 452, 483 to 516, 551 to 580, 611 to 650, 691 to 721, 753 to 898, and 1045 to 1443; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide is any of the nucleobase sequences of SEQ ID NOs: 40-68, 113-156, 205-252, 291-328, 376-422, 453-482, 517-550, 581-610, 651-690, 722-752, 899-1044, and 1444-1842, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal-length portion of the first modified oligonucleotide.

[0140] Embodiment 42 The oligomeric duplex of any one of embodiments 39 to 41, wherein the first modified oligonucleotide comprises a 5'-stabilizing phosphate group.

[0141] Embodiment 43. The oligomeric duplex of embodiment 42, wherein the 5'-stabilizing phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate.

[0142] Embodiment 44 The oligomeric duplex of any one of embodiments 39 to 43, wherein the first modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate.

[0143] Embodiment 45 The oligomeric duplex of any one of embodiments 39 to 44, wherein the first modified oligonucleotide comprises a 2'-NMA sugar moiety.

[0144] Embodiment 46 The oligomeric duplex of any one of embodiments 39 to 45, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0145] Embodiment 47 The oligomeric duplex of any one of embodiments 39 to 46, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0146] Embodiment 48. The oligomeric duplex of any one of embodiments 39 to 47, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0147] Embodiment 49 The oligomeric duplex of any one of embodiments 39 to 48, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0148] Embodiment 50 The oligomeric duplex of embodiment 49, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

[0149] Embodiment 51 The oligomeric duplex of any one of embodiments 39 to 50, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.

[0150] Embodiment 52 The oligomeric duplex of any one of embodiments 39 to 51, wherein the second modified oligonucleotide comprises at least one modified internucleoside linkage.

[0151] Embodiment 53 The oligomeric duplex of embodiment 52, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0152] Embodiment 54 The oligomeric duplex of any one of embodiments 39 to 52, wherein the second modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0153] Embodiment 55. The oligomeric duplex of any one of embodiments 39 to 52, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0154] Embodiment 56. The oligomeric duplex of any one of embodiments 39 to 52, wherein the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooooooss, wherein each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0155] Embodiment 57 The oligomeric duplex of any one of embodiments 39 to 56, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

[0156] Embodiment 58 The oligomeric duplex of embodiment 57, wherein the modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.

[0157] Embodiment 59 The oligomeric duplex of any one of embodiments 39 to 58, wherein the second modified oligonucleotide comprises a conjugate group.

[0158] Embodiment 60 The oligomeric duplex of embodiment 59, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0159] Embodiment 61 The oligomeric duplex of embodiment 59 or 60, wherein the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide.

[0160] Embodiment 62 The oligomeric duplex of embodiment 59 or 60, wherein the conjugate group is attached to the second modified oligonucleotide at the 3' end of the second modified oligonucleotide.

[0161] Embodiment 63. The oligomeric duplex of any one of embodiments 59-62, wherein the conjugate group comprises C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0162] Embodiment 64 The oligomeric duplex of any one of embodiments 39 to 63, wherein the second modified oligonucleotide comprises a terminal group.

[0163] Embodiment 65 The oligomeric duplex of embodiment 64, wherein the terminal group is an abasic sugar moiety.

[0164] Embodiment 66. The second modified oligonucleotide is selected from the group consisting of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25 66. The oligomeric duplex of any one of embodiments 39-65, comprising 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0165] Embodiment 67. The oligomeric duplex of any one of embodiments 39 to 66, wherein the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides.

[0166] Embodiment 68. The oligomeric duplex of embodiment 67, wherein the modified oligonucleotide of the first oligomeric compound has a sugar motif (5' to 3') of yfyfyfyfyfyfyfyfyfyfyy and the second modified oligonucleotide has a sugar motif (5' to 3') of fyfyfyfyfyfyfyfyfyfyf, wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0167] Embodiment 69. The oligomeric duplex of claim 67, wherein the modified oligonucleotide of a first oligomeric compound has a sugar motif (5' to 3') of yfyyyyyyyyyyfyyyyyyy and the second modified oligonucleotide has a sugar motif (5' to 3') of yyyyyyfyfffyyyyyyyyyy, wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0168] Embodiment 70. An antisense agent, wherein the antisense agent is an oligomeric duplex according to any one of embodiments 37 to 69.

[0169] Embodiment 71. The antisense agent of embodiment 70, wherein the antisense agent is an RNAi agent capable of reducing the amount of tau nucleic acid by activating RISC / Ago2.

[0170] Embodiment 72. A chirally enriched population of oligomeric duplexes according to any one of embodiments 37 to 69, wherein the population is enriched for modified oligonucleotides containing at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0171] Embodiment 73. The chirally enriched population of embodiment 72, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0172] Embodiment 74. The chirally enriched population of embodiment 73, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0173] Embodiment 75. A population of oligomeric duplexes comprising the modified oligonucleotides of any one of embodiments 37 to 69, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0174] Embodiment 76. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 36, an oligomeric duplex according to any one of embodiments 37 to 69, an antisense agent according to embodiment 70 or 71, or a population according to any one of embodiments 72 to 75, and a pharma- ceutically acceptable diluent or carrier.

[0175] Embodiment 77. The pharmaceutical composition of embodiment 76, wherein the pharma- ceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0176] Embodiment 78. The pharmaceutical composition of embodiment 777, wherein the pharmaceutical composition consists essentially of the oligomeric compound, oligomeric duplex, antisense agent, or population and phosphate buffered saline or artificial cerebrospinal fluid.

[0177] Embodiment 79. A method comprising administering to an animal an oligomeric compound according to any one of embodiments 1 to 36, an oligomeric duplex according to any one of embodiments 37 to 69, an antisense agent according to embodiment 70 or 71, a population according to any one of embodiments 72 to 75, or a pharmaceutical composition according to any one of embodiments 76 to 78.

[0178] Embodiment 80 The method of embodiment 79, wherein the animal has a tau-associated disease.

[0179] Embodiment 81. The method of embodiment 79 or 80, wherein the tau-related disease is a tauopathy, Alzheimer's disease, frontolateral dementia (FTD), frontolateral dementia with parkinsonism-17 (FTDP-17), progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome.

[0180] Embodiment 82. A method of treating a tau-associated disease, comprising administering to an individual having or at risk of developing a tau-associated disease a therapeutically effective amount of an oligomeric compound according to any one of embodiments 1-36, an oligomeric duplex according to any one of embodiments 37-69, an antisense agent according to embodiment 70 or 71, a population according to any one of embodiments 72-75, or a pharmaceutical composition according to any one of embodiments 76-78, thereby treating the tau-associated disease.

[0181] Embodiment 83. The method of embodiment 82, wherein the tau-related disease is a tauopathy, Alzheimer's disease, frontolateral dementia (FTD), frontolateral dementia with parkinsonism-17 (FTDP-17), progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome.

[0182] Embodiment 84 The method of embodiment 82 or 83, wherein the tau-related disease is a tauopathy.

[0183] Embodiment 85 The method of embodiment 82 or 83, wherein the tau-related disease is Alzheimer's disease.

[0184] Embodiment 86. The method of embodiment 82 or 83, wherein the tau-related disease is frontotemporal dementia (FTD).

[0185] Embodiment 87 The method of embodiment 82 or 83, wherein the tau-related disease is FTDP-17.

[0186] Embodiment 88. The method of embodiment 82 or 83, wherein the tau-related disease is progressive supranuclear palsy (PSP).

[0187] Embodiment 89. The method of embodiment 82 or 83, wherein the tau-related disease is chronic traumatic encephalopathy (CTE).

[0188] Embodiment 90. The method of embodiment 82 or 83, wherein the tau-related disease is corticobasal degeneration (CBD).

[0189] Embodiment 91 The method of embodiment 82 or 83, wherein the tau-related disease is epilepsy.

[0190] Embodiment 92 The method of embodiment 82 or 83, wherein the tau-related disease is Dravet syndrome.

[0191] Embodiment 93 The method of any one of embodiments 83 to 92, wherein at least one symptom or characteristic of a tau-related disease is alleviated.

[0192] Embodiment 94. The method of embodiment 93, wherein the symptom or characteristic is memory loss, loss of motor function, and / or an increase in the number and / or volume of neurofibrillary inclusions.

[0193] Embodiment 95. A method of reducing tau in a cell, comprising contacting the cell with an oligomeric compound according to any one of embodiments 1-36, an oligomeric duplex according to any one of embodiments 37-69, an antisense agent according to embodiment 70 or 71, a population according to any one of embodiments 72-75, or a pharmaceutical composition according to any one of embodiments 76-78.

[0194] Embodiment 96 The method of embodiment 95, wherein the cell is a central nervous system cell.

[0195] Embodiment 97. The method of any one of embodiments 95-96, wherein the cell is a human cell.

[0196] Embodiment 98. Use of an oligomeric compound according to any one of embodiments 1 to 36, an oligomeric duplex according to any one of embodiments 37 to 69, an antisense agent according to embodiment 70 or 71, a population according to any one of embodiments 72 to 75, or a pharmaceutical composition according to any one of embodiments 76 to 78 for treating a tau-related disease.

[0197] Embodiment 99. Use of an oligomeric compound according to any one of embodiments 1 to 36, an oligomeric duplex according to any one of embodiments 37 to 69, an antisense agent according to embodiment 70 or 71, a population according to any one of embodiments 72 to 75, or a pharmaceutical composition according to any one of embodiments 76 to 78 for the manufacture of a medicament for treating a tau-related disease.

[0198] Embodiment 100. The use of embodiment 98 or 99, wherein the tau-related disease is a tauopathy, Alzheimer's disease, frontolateral dementia (FTD), frontolateral dementia with parkinsonism-17 (FTDP-17), progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome.

[0199] Embodiment 101. The use described in any one of embodiments 98 to 100, wherein at least one symptom or characteristic is alleviated.

[0200] Embodiment 102. The use according to embodiment 101, wherein at least one symptom or characteristic is memory loss, loss of motor function, or an increase in the number and / or volume of neurofibrillary inclusions.

[0201] Embodiment 103. The use of any one of embodiments 98 to 102, wherein the use of the oligomeric compound, oligomeric duplex, antisense agent, population, or pharmaceutical composition improves motor function, reduces the amount or volume of alpha-synuclein aggregates, reduces or slows neurodegeneration, improves cognitive function, or delays the onset or progression of dementia.

[0202] I. Certain Oligonucleotides Provided herein is an oligomeric agent comprising an antisense oligonucleotide complementary to a Tau nucleic acid, and optionally a sense oligonucleotide complementary to the antisense oligonucleotide. The antisense oligonucleotide and the sense oligonucleotide typically comprise at least one modified nucleoside and / or at least one modified internucleoside bond. Certain modified nucleosides and modified internucleoside bonds suitable for use in the antisense oligonucleotide and / or the sense oligonucleotide are described below.

[0203] A. Certain modified nucleosides Modified nucleosides contain a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase. Modified nucleosides containing the following modified sugar moieties and / or the following modified nucleobases can be incorporated into antisense and / or sense oligonucleotides.

[0204] 1. Certain modified sugar moieties In certain embodiments, the sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can contain one or more substitutions that correspond to other types of modified sugar moieties.

[0205] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety that includes one or more acyclic substituents, including but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched.

[0206] In certain embodiments, non-bicyclic modified sugar moieties include a 2'-substituent. Examples of suitable substituents at the 2'-position of a modified sugar moiety include, but are not limited to, -F, -OCH3 ("OMe" or "O-methyl"), and -O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) are selected from each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 alkyl, -O(CH2)2ON(CH3)2 ("DMAOE"), 2'-O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), where the 2'-substituents are described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0207] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, O(CH2)2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, O(CH2)2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0208] In certain embodiments, the 2'-substituted sugar moiety of a modified nucleoside comprises a 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2 ("DMAOE"), O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").

[0209] In certain embodiments, the 2'-substituted sugar moiety of a modified nucleoside comprises a 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0210] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2'-position compared to 2'-deoxyfuranosyl sugar moieties, and thus such sugar moieties have a total of 16 possible isomeric configurations. The modified furanosyl sugar moieties described herein are in the β-D-ribosyl isomeric configuration, unless otherwise specified.

[0211] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 4' position. Examples of suitable substituents at the 4' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO2015 / 106128.

[0212] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3'. Examples of suitable substituent groups for the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

[0213] In certain embodiments, the non-bicyclic modified sugar moiety comprises a 5'-substituent. Examples of suitable substituent groups for the 5'-position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkyl (e.g., methyl (R or S), ethyl).

[0214] In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as the modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0215] In naturally occurring nucleic acids, the sugars are linked to each other 3' to 5'. In certain embodiments, an oligonucleotide comprises one or more nucleosides or sugar moieties linked at alternating positions, e.g., 2' or conversely, 5' to 3'. For example, if the linkage is at the 2' position, the 2'-substituent may instead be at the 3' position.

[0216] Certain modified sugar moieties include a bridged sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. Nucleosides that include such bicyclic sugar moieties are referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383 and PCT Publication No. WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,569,686). al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., US 7,741,457, and Swayze et al., US 8,022,193), al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US8,278,426), 4'-C(R a Rb )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2' (wherein each R, R a , and R b are independently H, a protecting group, or C-C 12 alkyl) (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0217] In certain embodiments, such a 4' to 2' bridge is: -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), where each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl, or a protecting group.

[0218] The molecular weight of the particles was obtained by analyzing the solvent, Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443;Albaek et al.,J.Org.Chem.,2006,71,7731-7740;Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490; al.US6,770,748; Imanishi et al.,USRE44,779; Wengel et al.,US6,794,499; al., US8,034,909, Wengel et al., US8,153,365, Wengel et al., US7,572,582, and Ramasamy et al., US6,525,191, Torsten et al., WO2004 / 106356 al.,WO1999 / 014226;Seth et al.,WO2007 / 134181, Seth et al.,US7,547,684, Seth et al.,US7,666,854, Seth et al.,US8,088,746, Seth et al.,US7,750,131, Seth et al.,US8,030,467, Seth et al. al., US8,268,980, Seth et al., US8,546,556, Seth et al., US8,530,640, Migawa et al., US9,012,421, Seth et al., US8,501,805, Allerson et al., US2008 / 0039618, and Migawa et al. al., US2015 / 0191727. .

[0219] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration.

[0220] [ka]

[0221] Alpha-L-methyleneoxy (4'-CH2-O-2') or alpha-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase the stability of siRNAs in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified in the exemplary embodiments herein, they are in the β-D configuration, unless otherwise specified.

[0222] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0223] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and a substitution at the 2' position (see, for example, Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or a substitution at the 5' position.

[0224] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluorohexitol nucleic acid (F-HNA):

[0225] [ka]

[0226] ("F-HNA", see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides including additional modified THP compounds having the formula:

[0227] [ka]

[0228] wherein, independently for each such modified THP nucleoside: Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group that links a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that links a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, an attached conjugate group, or a 5' or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1 ≈C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, each of R1 and R2 is independently selected from among hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2, and CN, X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0229] In certain embodiments, modified THP nucleosides are provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided, wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0230] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure:

[0231] [ka]

[0232] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents from the morpholino structures shown above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0233] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Additional PNA compounds suitable for use in RNAi oligonucleotides are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0234] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is a nucleoside in which any of the bonds of the sugar moiety are removed to form an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.

[0235] In certain embodiments, the sugar surrogate is glycerol, such as found in GNA (glycol nucleic acid) nucleosides, as shown below:

[0236] [ka]

[0237] In the formula, Bx represents any nucleic acid base.

[0238] Many other modified sugar moieties and sugar surrogates are known in the art and can be used in modified nucleosides.

[0239] 2. Certain modified nucleobases In certain embodiments, an oligonucleotide comprises one or more nucleosides that comprise a modified nucleobase. In certain embodiments, an oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides that comprise a hypoxanthine nucleobase).

[0240] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobases are 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, general bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-ones, 1,3-diazaphenothiazin-2-ones, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-ones (G-clamps).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0241] Publications teaching the preparation of certain of the above modified nucleobases, as well as other modified nucleobases, include, but are not limited to, Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al. al., including US6,005,096.

[0242] 3. Certain modified internucleoside linkages The naturally occurring internucleoside bond of RNA and DNA is a 3' to 5' phosphodiester bond. In certain embodiments, the nucleosides of an oligonucleotide may be linked together using one or more modified internucleoside linkages. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphates, including phosphodiester linkages ("P=O") (also referred to as unmodified or natural linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can alter, typically increase, the nuclease resistance of oligonucleotides compared to naturally occurring phosphate linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0243] In certain embodiments, the modified internucleoside linkage is any of those described in WO2021 / 030778, which is incorporated herein by reference. In certain embodiments, the modified internucleoside linkage has the formula:

[0244] [ka]

[0245] and for each internucleoside linkage group of the modified oligonucleotide, independently: X is selected from O or S; R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; T is selected from SO2R2, C(=O)R3, and P(=O)R4R5; R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl, substituted C1-C6 alkynyl, and a conjugate group; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and a conjugate group; R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0246] In certain embodiments, the modified internucleoside linkage comprises a mesyl phosphoramidate linking group having the following formula:

[0247] [ka]

[0248] In certain embodiments, the mesyl phosphoramidate internucleoside linkage may contain a chiral center. In certain embodiments, the modified oligonucleotides containing (Rp) and / or (Sp) mesyl phosphoramidate each include one or more of the following formulas, where "B" represents a nucleobase:

[0249] [ka]

[0250] Representative internucleoside linkages with chiral centers include, but are not limited to, alkyl phosphonates, mesyl phosphoramidates, and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages, or as a population of modified oligonucleotides containing phosphorothioate or other linkages containing chiral centers in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the population of modified oligonucleotides contains mesyl phosphoramidate internucleoside linkages, and all mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using a synthetic method that results in random selection of the stereochemical configuration of each phosphorothioate or mesyl phosphoramidate linkage. Nevertheless, each individual phosphorothioate or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain one or more specific phosphorothioate or mesyl phosphoramidate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population.In certain embodiments, a particular arrangement of a particular phosphorothioate or mesyl phosphoramidate bond is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Rp) configuration. In certain embodiments, the (Rp) and / or (Sp) phosphorothioate-containing modified oligonucleotides each comprise one or more of the following formulae, where "B" represents a nucleobase:

[0251] [ka]

[0252] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.

[0253] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages including mixed N, O, S, and CH2 constituent moieties.

[0254] In certain embodiments, oligonucleotides (such as antisense and / or sense oligonucleotides) contain one or more inverted nucleosides, as shown below:

[0255] [ka]

[0256] In the formula, each Bx independently represents any nucleobase.

[0257] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), and therefore only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of the oligonucleotide.

[0258] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is terminal (i.e., the last nucleoside at one end of an oligonucleotide), and thus only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.

[0259] In certain embodiments, the nucleic acids can be linked 2' to 5' rather than the standard 3' to 5' linkage. Such linkages are shown below.

[0260] [ka]

[0261] In the formula, each Bx represents any nucleobase.

[0262] B. Antisense Oligonucleotides In certain embodiments, the antisense oligonucleotide comprises multiple linked nucleosides, and certain nucleosides and / or linkages are modified.

[0263] 1. A certain length In certain embodiments, antisense oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, antisense oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X≦Y. For example, in certain embodiments, the antisense oligonucleotides may be 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20 , 17-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-29, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0264] In certain embodiments, the antisense oligonucleotide consists of 12-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 15-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 17-25 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 17-23 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 17-21 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 18-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 19-29 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 20-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 21-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 23-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 18-25 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 20-22 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 21-23 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 23-24 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 21 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 22 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 23 linked nucleosides.

[0265] 2. Certain glyco-motifs In certain embodiments, the sugar moiety of at least one nucleoside of the antisense oligonucleotide is a modified sugar moiety.

[0266] In certain such embodiments, at least one nucleoside comprises a 2'-OMe modified sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least twelve nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least fourteen nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least fifteen nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least seventeen nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 18 nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 20 nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 21 nucleosides comprise a 2'-OMe modified sugar moiety.

[0267] In certain embodiments, at least one nucleoside comprises a 2'-F modified sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, one but not more than one nucleoside comprises a 2'-F modified sugar moiety. In certain embodiments, one or two nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, one to three nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least one to four nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, the antisense oligonucleotide has a block of two to four contiguous 2'-F modified nucleosides. In certain embodiments, four nucleosides of an antisense oligonucleotide are 2'-F modified nucleosides, and three of the 2'-F modified nucleosides are contiguous. In certain such embodiments, the remainder of the nucleosides are 2'-OMe modified. In certain embodiments, an antisense oligonucleotide has a sugar motif (5' to 3') of yfyfyfyfyfyfyfyfyfyfyy or yfyyyfyyyyyyyyyyyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-fluororibosyl sugar.

[0268] In certain embodiments, one nucleoside of the antisense oligonucleotide is a UNA.

[0269] In certain embodiments, one nucleoside of the antisense oligonucleotide is GNA.

[0270] In certain embodiments, 1 to 4 nucleosides of the antisense oligonucleotide are DNA. In certain such embodiments, the 1 to 4 DNA nucleosides are at one or both termini of the antisense oligonucleotide.

[0271] 3. Certain internucleoside linkage motifs In certain embodiments, at least one linkage of the antisense oligonucleotide is a modified linkage. In certain embodiments, the 5'-most linkage is modified (i.e., linking the first nucleoside from the 5'-end to the second nucleoside from the 5'-end). In certain embodiments, the two 5'-most linkages are modified. In certain embodiments, the first one or two linkages from the 3'-end are modified. In certain embodiments, the modified internucleoside linkage is a phosphorothioate linkage. In certain embodiments, all remaining linkages are unmodified phosphodiester linkages. In certain embodiments, the internucleoside linkage motif is ssooooooooooooooooooooss, where each "s" represents a phosphorothioate linkage and each "o" represents a phosphodiester linkage.

[0272] In certain embodiments, at least one bond of the antisense oligonucleotide is an inverted bond.

[0273] C. Sense oligonucleotides In certain embodiments, a sense oligonucleotide comprises multiple linked nucleosides, and certain nucleosides and / or linkages are modified.

[0274] 1. A certain length In certain embodiments, sense oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, sense oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X≦Y. For example, in certain embodiments, the sense oligonucleotides may be 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, It consists of 16-50, 17-20, 17-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0275] In certain embodiments, the sense oligonucleotide consists of 12-30 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 15-29 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 17-25 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 17-23 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 17-21 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 18-30 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 20-30 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 21-30 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 23-30 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 18-25 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 20-22 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 21-23 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 23-24 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 21 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 22 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 23 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 25 linked nucleosides.

[0276] 2. Certain glyco-motifs In certain embodiments, the sugar moiety of at least one nucleoside of the sense oligonucleotide is a modified sugar moiety.

[0277] In certain such embodiments, at least one nucleoside comprises a 2'-OMe modified sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least twelve nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least fourteen nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least fifteen nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least seventeen nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 18 nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 20 nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 21 nucleosides comprise a 2'-OMe modified sugar moiety.

[0278] In certain embodiments, at least one nucleoside comprises a 2'-F modified sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, one but not more nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, one or two nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, one to three nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least one to four nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, the sense oligonucleotide has a block of two to four contiguous 2'-F modified nucleosides. In certain embodiments, four nucleosides of a sense oligonucleotide are 2'-F modified nucleosides, and three of the 2'-F modified nucleosides are contiguous. In certain such embodiments, the remainder of the nucleosides are 2'OMe modified. In certain embodiments, a sense oligonucleotide has a sugar motif (5' to 3') of fyfyfyfyfyfyfyfyfyfyf or yyyyyyfyfffyyyyyyyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-fluororibosyl sugar.

[0279] In certain embodiments, one nucleoside of the sense oligonucleotide is a UNA.

[0280] In certain embodiments, one nucleoside of the sense oligonucleotide is GNA.

[0281] In certain embodiments, 1 to 4 nucleosides of the sense oligonucleotide are DNA. In certain such embodiments, the 1 to 4 DNA nucleosides are at one or both termini of the sense oligonucleotide.

[0282] 3. Certain internucleoside bonds In certain embodiments, at least one bond of the sense oligonucleotide is a modified bond. In certain embodiments, the 5'-most bond is modified (i.e., linking the first nucleoside from the 5'-end to the second nucleoside from the 5'-end). In certain embodiments, the two 5'-most bonds are modified. In certain embodiments, the first one or two bonds from the 3'-end are modified. In certain embodiments, the modified internucleoside bond is a phosphorothioate bond. In certain embodiments, all remaining bonds are unmodified phosphodiester bonds. In certain embodiments, the internucleoside linkage motif is ssooooooooooooooooooss, where each "s" represents a phosphorothioate bond and each "o" represents a phosphodiester bond.

[0283] In certain embodiments, at least one bond of the sense oligonucleotide is an inverted bond.

[0284] II. Oligomeric duplexes In certain embodiments, an oligomeric compound described herein comprising an oligonucleotide having a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid is paired with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a first modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside. In certain embodiments, the two oligonucleotides have at least one mismatch with respect to each other. In certain embodiments, the oligomeric duplex is an antisense agent.

[0285] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleic acid bases of any of the nucleic acid base sequences of SEQ ID NOs: 11 to 39, 69 to 112, 157 to 204, 253 to 290, 329 to 375, 423 to 452, 483 to 516, 551 to 580, 611 to 650, 691 to 721, 753 to 898, and 1045 to 1443; and and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0286] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that are at least 90% complementary to the nucleobase sequence of an equal portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 95% complementary to the nucleobase sequence of the equal portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is 100% complementary to the nucleobase sequence of the equal portion of the first modified oligonucleotide.

[0287] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleic acid bases of any of the nucleic acid base sequences of SEQ ID NOs: 11 to 39, 69 to 112, 157 to 204, 253 to 290, 329 to 375, 423 to 452, 483 to 516, 551 to 580, 611 to 650, 691 to 721, 753 to 898, and 1045 to 1443; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleic acid base sequence of the second modified oligonucleotide comprises at least 8, at least 9, or at least 10 nucleotides selected from any of the nucleic acid base sequences of SEQ ID NOs: 40 to 68, 113 to 156, 205 to 252, 291 to 328, 376 to 422, 453 to 482, 517 to 550, 581 to 610, 651 to 690, 722 to 752, 899 to 1044, and 1444 to 1842. and a second oligomeric compound comprising at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0288] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of the equal length portion of the first modified oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0289] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide is any one of SEQ ID NOs: 11 to 39, 69 to 112, 157 to 204, 253 to 290, 329 to 375, 423 to 452, 483 to 516, 551 to 580, 611 to 650, 691 to 721, 753 to 898, and 1045 to 1443; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide consists of any of the nucleobase sequences of SEQ ID NOs: 40-68, 113-156, 205-252, 291-328, 376-422, 453-482, 517-550, 581-610, 651-690, 722-752, 899-1044, and 1444-1842, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal-length portion of the first modified oligonucleotide.

[0290] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of the equal length portion of the first modified oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0291] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 15-30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 11 / 40, 12 / 41, 13 / 42, 14 / 43, 15 / 44, 16 / 45, 17 / 46, 18 / 47, 19 / 48, 20 / 49, 21 / 50, 22 / 51, 23 / 52, 24 / 53, 25 / 54, 26 / 55, 27 / 56, 28 / 57, 29 / 59, 30 / 60, 31 / 61, 32 / 62, 33 / 63, 34 / 64, 35 / 65, 36 / 66, 37 / 67, 38 / 69, 39 / 70, 39 / 71, 39 / 72, 39 / 73, 39 / 74, 39 / 75, 39 / 76, 40 / 77, 40 / 78, 41 / 79, 42 / 80, 43 / 81, 44 / 82, 45 / 83, 46 / 84, 47 / 85, 48 / 86, 49 / 90, 50 / 91, 51 / 92, 52 / 93, 53 / 94, 54 / 95, 55 / 96, 56 / 97, 57 / 98, 58 / 99, 60 / 100, 61 / 101, 62 / 102 25 / 54, 26 / 55, 27 / 56, 28 / 57, 29 / 58, 30 / 59, 31 / 60, 32 / 61, 33 / 62, 34 / 63, 35 / 64, 36 / 65, 37 / 66, 38 / 67, 39 / 68, 69 / 113, 70 / 114, 71 / 115, 72 / 116, 73 / 117, 74 / 118, 75 / 119, 76 / 120, 77 / 121, 78 / 122, 79 / 123, 80 / 124, 81 / 125, 82 / 126, 83 / 127, 84 / 128, 85 / 129, 86 / 130, 87 / 131, 88 / 132, 89 / 133, 90 / 134, 91 / 135, 92 / 136, 93 / 137, 94 / 138, 95 / 139, 96 / 140、97 / 141、98 / 142、99 / 143、100 / 144、101 / 145、102 / 146、103 / 147、104 / 148、105 / 149、106 / 150、107 / 151、108 / 152、109 / 153、110 / 154、111 / 155、112 / 156、157 / 205、158 / 206、159 / 207、160 / 208、161 / 209、162 / 210、163 / 211、164 / 212、165 / 213、166 / 214、167 / 215、168 / 216、169 / 217、170 / 218、171 / 219、172 / 220、173 / 221、174 / 222、175 / 223、176 / 224、177 / 225、178 / 226、179 / 227、180 / 228、181 / 229、182 / 230、183 / 231、184 / 232、185 / 233、186 / 234、187 / 235、188 / 236、189 / 237、190 / 238、191 / 239、192 / 240、193 / 241、194 / 242、195 / 243、196 / 244、197 / 245、198 / 246、199 / 247、200 / 248、201 / 249、202 / 250、203 / 251、204 / 252、253 / 291、254 / 292、255 / 293、256 / 294、257 / 295、258 / 296、259 / 297、260 / 298、261 / 299、262 / 300、263 / 301、264 / 302、265 / 303、266 / 304、267 / 305、268 / 306、269 / 307、270 / 308、271 / 309、272 / 310、273 / 311、274 / 312、275 / 313、276 / 314、277 / 315、278 / 316、279 / 317、280 / 318、281 / 319、282 / 320、283 / 321、284 / 322、285 / 323、286 / 324、287 / 325、288 / 326、289 / 327、290 / 328、329 / 376、330 / 377、331 / 378、332 / 379、333 / 380、334 / 381、335 / 382、336 / 383、337 / 384、338 / 385、339 / 386、340 / 387、341 / 388、342 / 389、343 / 390、344 / 391、345 / 392、346 / 393、347 / 394、348 / 395、349 / 396、350 / 397、351 / 398、352 / 399、353 / 400、354 / 401、355 / 402、356 / 403、357 / 404、358 / 405、359 / 406、360 / 407、361 / 408、362 / 409、363 / 410、364 / 411、365 / 412、366 / 413、367 / 414、368 / 415、369 / 416、370 / 417、371 / 418、372 / 419、373 / 420、374 / 421、375 / 422、423 / 453、424 / 454、425 / 455、426 / 456、427 / 457、428 / 458、429 / 459、430 / 460、431 / 461、432 / 462、433 / 463、434 / 464、435 / 465、436 / 466、437 / 467、438 / 468、439 / 469、440 / 470、441 / 471、442 / 472、443 / 473、444 / 474、445 / 475、446 / 476、447 / 477、448 / 478、449 / 479、450 / 480、451 / 481、452 / 482、483 / 517、484 / 518、485 / 519、486 / 520、487 / 521、488 / 522、489 / 523、490 / 524、491 / 525、492 / 526、493 / 527、494 / 528、495 / 529、496 / 530、497 / 531、498 / 532、499 / 533、500 / 534、501 / 535、502 / 536、503 / 537、504 / 538、505 / 539、506 / 540、507 / 541、508 / 542、509 / 543、510 / 544、511 / 545、512 / 546、513 / 547、514 / 548、515 / 549、516 / 550、551 / 581、552 / 582、553 / 583、554 / 584、555 / 585、556 / 586、557 / 587、558 / 588、559 / 589、560 / 590、561 / 591、562 / 592、563 / 593、564 / 594、565 / 595、566 / 596、567 / 597、568 / 598、569 / 599、570 / 600、571 / 601、572 / 602、573 / 603、574 / 604、575 / 605、576 / 606、577 / 607、578 / 608、579 / 609、580 / 610、611 / 651、612 / 652、613 / 653、614 / 654、615 / 655、616 / 656、617 / 657、618 / 658、619 / 659、620 / 660、621 / 661、622 / 662、623 / 663、624 / 664、625 / 665、626 / 666、627 / 667、628 / 668、629 / 669、630 / 670、631 / 671、632 / 672、633 / 673、634 / 674、635 / 675、636 / 676、637 / 677、638 / 678、639 / 679、640 / 680、641 / 681、642 / 682、643 / 683、644 / 684、645 / 685、646 / 686、647 / 687、648 / 688、649 / 689、650 / 690、691 / 722、692 / 723、693 / 724、694 / 725、695 / 726、696 / 727、697 / 728、698 / 729、699 / 730、700 / 731、701 / 732、702 / 733、703 / 734、704 / 735、705 / 736、706 / 737、707 / 738、708 / 739、709 / 740、710 / 741、711 / 742、712 / 743、713 / 744、714 / 745、715 / 746、716 / 747、717 / 748、718 / 749、719 / 750、720 / 751、721 / 752、753 / 899、754 / 900、755 / 901、756 / 902、757 / 903、758 / 904、759 / 905、760 / 906、761 / 907、762 / 908、763 / 909、764 / 910、765 / 911、766 / 912、767 / 913、768 / 914、769 / 915、770 / 916、771 / 917、772 / 918、773 / 919、774 / 920、775 / 921、776 / 922、777 / 923、778 / 924、779 / 925、780 / 926、781 / 927、782 / 928、783 / 929、784 / 930、785 / 931、786 / 932、787 / 933、788 / 934、789 / 935、790 / 936、791 / 937、792 / 938、793 / 939、794 / 940、795 / 941、796 / 942、797 / 943、798 / 944、799 / 945、800 / 946、901 / 947、802 / 948、803 / 949、804 / 950、805 / 951、806 / 952、807 / 953、808 / 854、809 / 955、810 / 956、811 / 957、812 / 958、813 / 959、814 / 960、815 / 961、816 / 962、817 / 963、818 / 964、819 / 965、820 / 966、821 / 967、822 / 968、823 / 969、824 / 970、825 / 971、826 / 972、827 / 973、828 / 974、829 / 975、830 / 976、831 / 977、832 / 978、833 / 979、834 / 980、835 / 981、836 / 982、837 / 983、838 / 984、839 / 985、840 / 986、841 / 987、842 / 988、843 / 989、844 / 990、845 / 991、846 / 992、847 / 993、848 / 994、849 / 995、850 / 996、851 / 997、852 / 998、853 / 999、854 / 1000、855 / 1001、856 / 1002、857 / 1003、858 / 1004、859 / 1005、860 / 1006、861 / 1007、862 / 1008、863 / 1009、864 / 1010、865 / 1011、866 / 1012、867 / 1013、868 / 1014、869 / 1015、870 / 1016、871 / 1017、872 / 1018、873 / 1019、874 / 1020、875 / 1021、876 / 1022、877 / 1023、878 / 1024、879 / 1025、880 / 1026、881 / 1027、882 / 1028、883 / 1029、884 / 1030、885 / 1031、886 / 1032、887 / 1033、888 / 1034、889 / 1035、890 / 1036、891 / 1037、892 / 1038、893 / 1039、894 / 1040、895 / 1041、896 / 1042、897 / 1043、898 / 1044、1045 / 1444、1046 / 1445、1047 / 1446、1048 / 1447、1049 / 1448、1050 / 1449、1051 / 1450、1052 / 1451、1053 / 1452、1054 / 1453、1055 / 1454、1056 / 1455、1057 / 1456、1058 / 1457、1059 / 1458、1060 / 1459、1061 / 1460、1062 / 1461、1063 / 1462、1064 / 1463、1065 / 1464、1066 / 1465、1067 / 1466、1068 / 1467、1069 / 1468、1070 / 1469、1071 / 1470、1072 / 1471、1073 / 1472、1074 / 1473、1075 / 1474、1076 / 1475、1077 / 1476、1078 / 1477、1079 / 1478、1080 / 1479、1081 / 1480、1082 / 1481、1083 / 1482、1084 / 1483、1085 / 1484、1086 / 1485、1087 / 1486、1088 / 1487、1089 / 1488、1090 / 1489、1091 / 1490、1092 / 1491、1093 / 1492、1094 / 1493、1095 / 1494、1096 / 1495、1097 / 1496、1098 / 1497、1099 / 1498、1100 / 1499、1101 / 1500、1102 / 1501、1103 / 1502、1104 / 1503、1105 / 1504、1106 / 1505、1107 / 1506、1108 / 1507、1109 / 1508、1110 / 1509、1111 / 1510、1112 / 1511、1113 / 1512、1114 / 1513、1115 / 1514、1116 / 1515、1117 / 1516、1118 / 1517、1119 / 1518、1120 / 1519、1121 / 1520、1122 / 1521、1123 / 1522、1124 / 1523、1125 / 1524、1126 / 1525、1127 / 1526、1128 / 1527、1129 / 1528、1130 / 1529、1131 / 1530、1132 / 1531、1133 / 1532、1134,1533、1135 / 1534、1136 / 1535、1137 / 1536、1138 / 1537、1139 / 1538、1140 / 1539、1141 / 1540、1142 / 1541、1143 / 1542、1144 / 1543、1145 / 1544、1146 / 1545、1147 / 1546、1148 / 1547、1149 / 1548、1150 / 1549、1151 / 1550、1152 / 1551、1153 / 1552、1154 / 1553、1155 / 1554、1156 / 1555、1157 / 1556、1158 / 1557、1159 / 1558、1160 / 1559、1161 / 1560、1162 / 1561、1163 / 1562、1164 / 1563、1165 / 1564、1166 / 1565、1167 / 1566、1168 / 1567、1169 / 1568、1170 / 1569、1171 / 1570、1172 / 1571、1173 / 1572、1174 / 1573、1175 / 1574、1176 / 1575、1177 / 1576、1178 / 1577、1179 / 1578、1180 / 1579、1181 / 1580、1182 / 1581、1183 / 1582、 1184 / 1583、1185 / 1584、1186 / 1585、1187 / 1586、1188 / 1587、1189 / 1588、1190 / 1589、1191 / 1590、1192 / 1591、1193 / 1592、1194 / 1593、1195 / 1594、1196 / 1595、1197 / 1596、1198 / 1597、1199 / 1598、1200 / 1599、1201 / 1600、1202 / 1601、1203 / 1602、1204 / 1603、1205 / 1604、1206 / 1605、1207 / 1608、1208 / 1607、1209 / 1608、1210 / 1609、1211 / 1610、1212 / 1611、1213 / 1612、1214 / 1613、1215 / 1614、1216 / 1615、1217 / 1616、1218 / 1617、1219 / 1618、1220 / 1619、1221 / 1620、1222 / 1621、1223 / 1622、1224 / 1623、1225 / 1624、1226 / 1625、1227 / 1626、1228 / 1627、1229 / 1628、1230 / 1629、1231 / 1630、1232 / 1631、1233 / 1632、1234 / 1633、1235 / 1634、1236 / 1635、1237 / 1636、1238 / 1637、1239 / 1638、1240 / 1639、1241 / 1340、1242 / 1641、1243 / 1642、1244 / 1643、1245 / 1644、1246 / 1645、1247 / 1646、1248 / 1647、1249 / 1648、1250 / 1649、1251 / 1650、1252 / 1651、1253 / 1652、1254 / 1653、1255 / 1654、1256 / 1655、1257 / 1656、1258 / 1657、1259 / 1658、1260 / 1659、1261 / 1660、1262 / 1661、1263 / 1662、1264 / 1663、1265 / 1664、1266 / 1665、1267 / 1666、1268 / 1667、1269 / 1668、1270 / 1669、1271 / 1670、1272 / 1671、1273 / 1672、1274 / 1673、1275 / 1674、1276 / 1675、1277 / 1676、1278 / 1677、1279 / 1678、1280 / 1679、1281 / 1680、1282 / 1681、1283 / 1682、1284 / 1683、1285 / 1684、1286 / 1685、1287 / 1686、1288 / 1687、1289 / 1688、1290 / 1689、1291 / 1690、1292 / 1691、1293 / 1692、1294 / 1693、1295 / 1694、1296 / 1695、1297 / 1696、1298 / 1697、1299 / 1698、1300 / 1699、1301 / 1700、1302 / 1701、1303 / 1702、1304 / 1703、1305 / 1704、1306 / 1705、1307 / 1706、1308 / 1707、1309 / 1708、1310 / 1709、1311 / 1710、1312 / 1711、1313 / 1712、1314 / 1713、1315 / 1714、1316 / 1715、1317 / 1716、1318 / 1717、1319 / 1718、1320 / 1719、1321 / 1720、1322 / 1721、1323 / 1722、1324 / 1723、1325 / 1724、1326 / 1725、1327 / 1726、1328 / 1727、1329 / 1728、1330 / 1729、1331 / 1730、1332 / 1731、1333 / 1732、1334 / 1733、1335 / 1734、1336 / 1735、1337 / 1736、1338 / 1737、1339 / 1738、1340 / 1739、1341 / 1740、1342 / 1741、1343 / 1742、1344 / 1743、1345 / 1744、1346 / 1745、1347 / 1746、1348 / 1747、1349 / 1748、1350 / 1749、1351 / 1750、1352 / 1751、1353 / 1752、1354 / 1753、1355 / 1754、1356 / 1755、1357 / 1756、1358 / 1757、1359 / 1758、1360 / 1759、1361 / 1760、1362 / 1761、1363 / 1762、1364 / 1763、1365 / 1764、1366 / 1765、1367 / 1766、1368 / 1767、1369 / 1768、1370 / 1769、1371 / 1770、1372 / 1771、1373 / 1772、1374 / 1773、1375 / 1774、1376 / 1775、1377 / 1776、1378 / 1777、1379 / 1778、1380 / 1779、1381 / 1780、1382 / 1781、1383 / 1782、1384 / 1783, 1385 / 1784, 1386 / 1785, 1387 / 1786, 1388 / 1787, 1389 / 1788, 1390 / 1789, 1391 / 1790, 1392 / 1791, 1393 / 1792, 1394 / 1793, 1395 / 1794, 1396 / 1795, 1397 / 1796, 1398 / 1797, 1399 / 1798, 1400 / 1799, 1401 / 1800, 1402 / 1801, 1403 / 1802, 1404 / 1803, 1405 / 1804, 1406 / 1805, 1407 / 1806, 1408 / 1807, 1409 / 1808, 1410 / 1809, 1411 / 1810, 1412 / 1811, 1413 / 1812, 1414 / 1813, 1415 / 1814, 1416 / 1815, 1417 / 1816, 1418 / 1817, 1419 / 1818, 1420 / 1819, 1421 / 1820, 1422 / 1821, 1423 / 1822, 1424 / 1823, 1425 / 1824, 1426 / 1825, 1427 / 1826, At least 8, at least 9, at least 10, at least 11, or at least 12 of any of the nucleic acid base sequence pairs recited in 1428 / 1827, 1429 / 1828, 1430 / 1829, 1431 / 1830, 1432 / 1831, 1433 / 1832, 1434 / 1833, 1435 / 1834, 1436 / 1835, 1437 / 1836, 1438 / 1837, 1439 / 1838, 1440 / 1839, 1441 / 1840, 1442 / 1841, 1443 / 1842 at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.

[0292] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.

[0293] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 15-30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 11 / 40, 12 / 41, 13 / 42, 14 / 43, 15 / 44, 16 / 45, 17 / 46, 18 / 47, 19 / 48, 20 / 49, 21 / 50, 22 / 51, 23 / 52, 24 / 53, 25 / 54, 26 / 55, 27 / 56, 28 / 57, 29 / 58, 30 / 59, 31 / 60, 32 / 61, 33 / 62, 34 / 63, 35 / 64, 36 / 65, 37 / 66, 38 / 67, 39 / 68, 69 / 113, 70 / 114, 71 / 115, 72 / 116, 73 / 117, 74 / 118, 75 / 119, 76 / 120, 77 / 121, 78 / 122, 79 / 123, 80 / 124, 81 / 125, 82 / 126, 83 / 127, 84 / 128, 85 / 129, 86 / 130、87 / 131、88 / 132、89 / 133、90 / 134、91 / 135、92 / 136、93 / 137、94 / 138、95 / 139、96 / 140、97 / 141、98 / 142、99 / 143、100 / 144、101 / 145、102 / 146、103 / 147、104 / 148、105 / 149、106 / 150、107 / 151、108 / 152、109 / 153、110 / 154、111 / 155、112 / 156、157 / 205、158 / 206、159 / 207、160 / 208、161 / 209、162 / 210、163 / 211、164 / 212、165 / 213、166 / 214、167 / 215、168 / 216、169 / 217、170 / 218、171 / 219、172 / 220、173 / 221、174 / 222、175 / 223、176 / 224、177 / 225、178 / 226、179 / 227、180 / 228、181 / 229、182 / 230、183 / 231、184 / 232、185 / 233、186 / 234、187 / 235、188 / 236、189 / 237、190 / 238、191 / 239、192 / 240、193 / 241、194 / 242、195 / 243、196 / 244、197 / 245、198 / 246、199 / 247、200 / 248、201 / 249、202 / 250、203 / 251、204 / 252、253 / 291、254 / 292、255 / 293、256 / 294、257 / 295、258 / 296、259 / 297、260 / 298、261 / 299、262 / 300、263 / 301、264 / 302、265 / 303、266 / 304、267 / 305、268 / 306、269 / 307、270 / 308、271 / 309、272 / 310、273 / 311、274 / 312、275 / 313、276 / 314、277 / 315、278 / 316、279 / 317、280 / 318、281 / 319、282 / 320、283 / 321、284 / 322、285 / 323、286 / 324、287 / 325、288 / 326、289 / 327、290 / 328、329 / 376、330 / 377、331 / 378、332 / 379、333 / 380、334 / 381、335 / 382、336 / 383、337 / 384、338 / 385、339 / 386、340 / 387、341 / 388、342 / 389、343 / 390、344 / 391、345 / 392、346 / 393、347 / 394、348 / 395、349 / 396、350 / 397、351 / 398、352 / 399、353 / 400、354 / 401、355 / 402、356 / 403、357 / 404、358 / 405、359 / 406、360 / 407、361 / 408、362 / 409、363 / 410、364 / 411、365 / 412、366 / 413、367 / 414、368 / 415、369 / 416、370 / 417、371 / 418、372 / 419、373 / 420、374 / 421、375 / 422、423 / 453、424 / 454、425 / 455、426 / 456、427 / 457、428 / 458、429 / 459、430 / 460、431 / 461、432 / 462、433 / 463、434 / 464、435 / 465、436 / 466、437 / 467、438 / 468、439 / 469、440 / 470、441 / 471、442 / 472、443 / 473、444 / 474、445 / 475、446 / 476、447 / 477、448 / 478、449 / 479、450 / 480、451 / 481、452 / 482、483 / 517、484 / 518、485 / 519、486 / 520、487 / 521、488 / 522、489 / 523、490 / 524、491 / 525、492 / 526、493 / 527、494 / 528、495 / 529、496 / 530、497 / 531、498 / 532、499 / 533、500 / 534、501 / 535、502 / 536、503 / 537、504 / 538、505 / 539、506 / 540、507 / 541、508 / 542、509 / 543、510 / 544、511 / 545、512 / 546、513 / 547、514 / 548、515 / 549、516 / 550、551 / 581、552 / 582、553 / 583、554 / 584、555 / 585、556 / 586、557 / 587、558 / 588、559 / 589、560 / 590、561 / 591、562 / 592、563 / 593、564 / 594、565 / 595、566 / 596、567 / 597、568 / 598、569 / 599、570 / 600、571 / 601、572 / 602、573 / 603、574 / 604、575 / 605、576 / 606、577 / 607、578 / 608、579 / 609、580 / 610、611 / 651、612 / 652、613 / 653、614 / 654、615 / 655、616 / 656、617 / 657、618 / 658、619 / 659、620 / 660、621 / 661、622 / 662、623 / 663、624 / 664、625 / 665、626 / 666、627 / 667、628 / 668、629 / 669、630 / 670、631 / 671、632 / 672、633 / 673、634 / 674、635 / 675、636 / 676、637 / 677、638 / 678、639 / 679、640 / 680、641 / 681、642 / 682、643 / 683、644 / 684、645 / 685、646 / 686、647 / 687、648 / 688、649 / 689、650 / 690、691 / 722、692 / 723、693 / 724、694 / 725、695 / 726、696 / 727、697 / 728、698 / 729、699 / 730、700 / 731、701 / 732、702 / 733、703 / 734、704 / 735、705 / 736、706 / 737、707 / 738、708 / 739、709 / 740、710 / 741、711 / 742、712 / 743、713 / 744、714 / 745、715 / 746、716 / 747、717 / 748、718 / 749、719 / 750、720 / 751、721 / 752、753 / 899、754 / 900、755 / 901、756 / 902、757 / 903、758 / 904、759 / 905、760 / 906、761 / 907、762 / 908、763 / 909、764 / 910、765 / 911、766 / 912、767 / 913、768 / 914、769 / 915、770 / 916、771 / 917、772 / 918、773 / 919、774 / 920、775 / 921、776 / 922、777 / 923、778 / 924、779 / 925、780 / 926、781 / 927、782 / 928、783 / 929、784 / 930、785 / 931、786 / 932、787 / 933、788 / 934、789 / 935、790 / 936、791 / 937、792 / 938、793 / 939、794 / 940、795 / 941、796 / 942、797 / 943、798 / 944、799 / 945、800 / 946、901 / 947、802 / 948、803 / 949、804 / 950、805 / 951、806 / 952、807 / 953、808 / 854、809 / 955、810 / 956、811 / 957、812 / 958、813 / 959、814 / 960、815 / 961、816 / 962、817 / 963、818 / 964、819 / 965、820 / 966、821 / 967、822 / 968、823 / 969、824 / 970、825 / 971、826 / 972、827 / 973、828 / 974、829 / 975、830 / 976、831 / 977、832 / 978、833 / 979、834 / 980、835 / 981、836 / 982、837 / 983、838 / 984、839 / 985、840 / 986、841 / 987、842 / 988、843 / 989、844 / 990、845 / 991、846 / 992、847 / 993、848 / 994、849 / 995、850 / 996、851 / 997、852 / 998、853 / 999、854 / 1000、855 / 1001、856 / 1002、857 / 1003、858 / 1004、859 / 1005、860 / 1006、861 / 1007、862 / 1008、863 / 1009、864 / 1010、865 / 1011、866 / 1012、867 / 1013、868 / 1014、869 / 1015、870 / 1016、871 / 1017、872 / 1018、873 / 1019、874 / 1020、875 / 1021、876 / 1022、877 / 1023、878 / 1024、879 / 1025、880 / 1026、881 / 1027、882 / 1028、883 / 1029、884 / 1030、885 / 1031、886 / 1032、887 / 1033、888 / 1034、889 / 1035、890 / 1036、891 / 1037、892 / 1038、893 / 1039、894 / 1040、895 / 1041、896 / 1042、897 / 1043、898 / 1044、1045 / 1444、1046 / 1445、1047 / 1446、1048 / 1447、1049 / 1448、1050 / 1449、1051 / 1450、1052 / 1451、1053 / 1452、1054 / 1453、1055 / 1454、1056 / 1455、1057 / 1456、1058 / 1457、1059 / 1458、1060 / 1459、1061 / 1460、1062 / 1461、1063 / 1462、1064 / 1463、1065 / 1464、1066 / 1465、1067 / 1466、1068 / 1467、1069 / 1468、1070 / 1469、1071 / 1470、1072 / 1471、1073 / 1472、1074 / 1473、1075 / 1474、1076 / 1475、1077 / 1476、1078 / 1477、1079 / 1478、1080 / 1479、1081 / 1480、1082 / 1481、1083 / 1482、1084 / 1483、1085 / 1484、1086 / 1485、1087 / 1486、1088 / 1487、1089 / 1488、1090 / 1489、1091 / 1490、1092 / 1491、1093 / 1492、1094 / 1493、1095 / 1494、1096 / 1495、1097 / 1496、1098 / 1497、1099 / 1498、1100 / 1499、1101 / 1500、1102 / 1501、1103 / 1502、1104 / 1503、1105 / 1504、1106 / 1505、1107 / 1506、1108 / 1507、1109 / 1508、1110 / 1509、1111 / 1510、1112 / 1511、1113 / 1512、1114 / 1513、1115 / 1514、1116 / 1515、1117 / 1516、1118 / 1517、1119 / 1518、1120 / 1519、1121 / 1520、1122 / 1521、1123 / 1522、1124 / 1523、1125 / 1524、1126 / 1525、1127 / 1526、1128 / 1527、1129 / 1528、1130 / 1529、1131 / 1530、1132 / 1531、1133 / 1532、1134,1533、1135 / 1534、1136 / 1535、1137 / 1536、1138 / 1537、1139 / 1538、1140 / 1539、1141 / 1540、1142 / 1541、1143 / 1542、1144 / 1543、1145 / 1544、1146 / 1545、1147 / 1546、1148 / 1547、1149 / 1548、1150 / 1549、1151 / 1550、1152 / 1551、1153 / 1552、1154 / 1553、1155 / 1554、1156 / 1555、1157 / 1556、1158 / 1557、1159 / 1558、1160 / 1559、1161 / 1560、1162 / 1561、1163 / 1562、1164 / 1563、1165 / 1564、1166 / 1565、1167 / 1566、1168 / 1567、1169 / 1568、1170 / 1569、1171 / 1570、1172 / 1571、1173 / 1572、1174 / 1573、1175 / 1574、1176 / 1575、 1177 / 1576、1178 / 1577、1179 / 1578、1180 / 1579、1181 / 1580、1182 / 1581、1183 / 1582、1184 / 1583、1185 / 1584、1186 / 1585、1187 / 1586、1188 / 1587、1189 / 1588、1190 / 1589、1191 / 1590、1192 / 1591、1193 / 1592、1194 / 1593、1195 / 1594、1196 / 1595、1197 / 1596、1198 / 1597、1199 / 1598、1200 / 1599、1201 / 1600、1202 / 1601、1203 / 1602、1204 / 1603、1205 / 1604、1206 / 1605、1207 / 1608、1208 / 1607、1209 / 1608、1210 / 1609、1211 / 1610、1212 / 1611、1213 / 1612、1214 / 1613、1215 / 1614、1216 / 1615、1217 / 1616、1218 / 1617、1219 / 1618、1220 / 1619、1221 / 1620、1222 / 1621、1223 / 1622、1224 / 1623、1225 / 1624、1226 / 1625、1227 / 1626、1228 / 1627、1229 / 1628、1230 / 1629、1231 / 1630、1232 / 1631、1233 / 1632、1234 / 1633、1235 / 1634、1236 / 1635、1237 / 1636、1238 / 1637、1239 / 1638、1240 / 1639、1241 / 1340、1242 / 1641、1243 / 1642、1244 / 1643、1245 / 1644、1246 / 1645、1247 / 1646、1248 / 1647、1249 / 1648、1250 / 1649、1251 / 1650、1252 / 1651、1253 / 1652、1254 / 1653、1255 / 1654、1256 / 1655、1257 / 1656、1258 / 1657、1259 / 1658、1260 / 1659、1261 / 1660、1262 / 1661、1263 / 1662、1264 / 1663、1265 / 1664、1266 / 1665、1267 / 1666、1268 / 1667、1269 / 1668、1270 / 1669、1271 / 1670、1272 / 1671、1273 / 1672、1274 / 1673、1275 / 1674、1276 / 1675、1277 / 1676、1278 / 1677、1279 / 1678、1280 / 1679、1281 / 1680、1282 / 1681、1283 / 1682、1284 / 1683、1285 / 1684、1286 / 1685、1287 / 1686、1288 / 1687、1289 / 1688、1290 / 1689、1291 / 1690、1292 / 1691、1293 / 1692、1294 / 1693、1295 / 1694、1296 / 1695、1297 / 1696、1298 / 1697、1299 / 1698、1300 / 1699、1301 / 1700、1302 / 1701、1303 / 1702、1304 / 1703、1305 / 1704、1306 / 1705、1307 / 1706、1308 / 1707、1309 / 1708、1310 / 1709、1311 / 1710、1312 / 1711、1313 / 1712、1314 / 1713、1315 / 1714、1316 / 1715、1317 / 1716、1318 / 1717、1319 / 1718、1320 / 1719、1321 / 1720、1322 / 1721、1323 / 1722、1324 / 1723、1325 / 1724、1326 / 1725、1327 / 1726、1328 / 1727、1329 / 1728、1330 / 1729、1331 / 1730、1332 / 1731、1333 / 1732、1334 / 1733、1335 / 1734、1336 / 1735、1337 / 1736、1338 / 1737、1339 / 1738、1340 / 1739、1341 / 1740、1342 / 1741、1343 / 1742、1344 / 1743、1345 / 1744、1346 / 1745、1347 / 1746、1348 / 1747、1349 / 1748、1350 / 1749、1351 / 1750、1352 / 1751、1353 / 1752、1354 / 1753、1355 / 1754、1356 / 1755、1357 / 1756、1358 / 1757、1359 / 1758、1360 / 1759、1361 / 1760、1362 / 1761、1363 / 1762、1364 / 1763、1365 / 1764、1366 / 1765、1367 / 1766、1368 / 1767、1369 / 1768、1370 / 1769、1371 / 1770、1372 / 1771、1373 / 1772、1374 / 1773、1375 / 1774、1376 / 1775、1377 / 1776, 1378 / 1777, 1379 / 1778, 1380 / 1779, 1381 / 1780, 1382 / 1781, 1383 / 1782, 1384 / 1783, 1385 / 1784, 1386 / 1785, 1387 / 1786, 1388 / 1787, 1389 / 1788, 1390 / 1789, 1391 / 1790, 1392 / 1791, 1393 / 1792, 1394 / 1793, 1395 / 1794, 1396 / 1795 , 1397 / 1796, 1398 / 1797, 1399 / 1798, 1400 / 1799, 1401 / 1800, 1402 / 1801, 1403 / 1802, 1404 / 1803, 1405 / 1804, 1406 / 1805, 1407 / 1806, 1408 / 1807, 1409 / 1808, 1410 / 1809, 1411 / 1810, 1412 / 1811, 1413 / 1812, 1414 / 1813, 1415 / 1814, 1416 / 181 5, 1417 / 1816, 1418 / 1817, 1419 / 1818, 1420 / 1819, 1421 / 1820, 1422 / 1821, 1423 / 1822, 1424 / 1823, 1425 / 1824, 1426 / 1825, 1427 / 1826, 1428 / 1827, 1429 / 1828, 1430 / 1829, 1431 / 1830, 1432 / 1831, 1433 / 1832, 1434 / 1833, 1435 / 1834, 1436 / 18 35, 1437 / 1836, 1438 / 1837, 1439 / 1838, 1440 / 1839, 1441 / 1840, 1442 / 1841, 1443 / 1842, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.

[0294] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19-30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the first modified oligonucleotide and the second modified oligonucleotide are The nucleic acid sequences of the nucleotides of the nucleotides of SEQ ID NOs: 329 / 376, 330 / 377, 691 / 722, 694 / 725, 696 / 727, 721 / 752, 759 / 905, 774 / 920, 787 / 933, 848 / 994, 850 / 996, 855 / 1001, 857 / 1003, 858 / 1004, 860 / 1006, 861 / 1007, 863 / 1009, 864 / 1010, 866 / 1011, 867 / 1012, 868 / 1013, 869 / 1014, 870 / 1015, 871 / 1016, 872 / 1017, 873 / 1018, 874 / 1019, 875 / 1020, 876 / 1021, 877 / 1022, 878 / 1023, 879 / 1024, 878 / 1025, 879 / 1026, 879 / 1027, 879 / 1028, 880 / 1029, 881 / 1030, 882 / 1031, 883 / 1032, 884 / 1033, 885 / 1034, 886 / 1035, 887 / 1036, 888 / 1037, 889 / 1038, 890 / 1039, 900 / 1039, 901 / 1040, 901 / 1041, 1012, 890 / 1036, 891 / 1037, 1045 / 1444, 1050 / 1449, 1115 / 1514, 1116 / 1515, 1142 / 1541, 1157 / 1556, 1159 / 1558, 1161 / 1560, 1166 / 1565, 1167 / 1566, 1229 / 1628, 1230 / 1629, 1343 / 1742, 1360 / 1759, 1364 / 17 63, 1365 / 1764, 1402 / 1801, 1430 / 1829, 1431 / 1830, wherein the nucleobase sequence of a first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair, and the nucleobase sequence of a second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.

[0295] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.

[0296] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 11 / 40, 12 / 41, 13 / 42, 14 / 43, 15 / 44, 16 / 45, 17 / 46, 18 / 47, 19 / 48, 20 / 49, 21 / 50, 22 / 51, 23 / 52, 24 / 53, 25 / 54, 26 / 55, 27 / 56, 28 / 57, 29 / 58, 30 / 59, 31 / 60, 32 / 61, 33 / 62, 34 / 63, 35 / 64, 36 / 65, 37 / 66, 38 / 67, 39 / 68, 40 / 69, 41 / 69, 42 / 69, 43 / 70, 44 / 71, 45 / 72, 46 / 73, 47 / 74, 48 / 75, 49 / 76, 50 / 77, 51 / 78, 52 / 79, 53 / 80, 54 / 81, 55 / 82, 56 / 83, 57 / 84, 58 / 85, 59 / 86, 60 / 87, 61 / 88, 62 / 89, 63 / 90, 64 / 91, 65 / 92, 66 / 93, 67 / 94, 68 / 95, 69 / 96, 70 / 97, 7 21 / 50, 22 / 51, 23 / 52, 24 / 53, 25 / 54, 26 / 55, 27 / 56, 28 / 57, 29 / 58, 30 / 59, 31 / 60, 32 / 61, 33 / 62, 34 / 63, 35 / 64, 36 / 65, 37 / 66, 38 / 67, 39 / 68, 69 / 113, 70 / 114, 71 / 115, 72 / 116, 73 / 117, 74 / 118, 75 / 119, 76 / 120, 77 / 121, 78 / 122, 79 / 123, 80 / 124, 81 / 125, 82 / 126, 83 / 127, 84 / 128, 85 / 129, 86 / 130, 87 / 131、88 / 132、89 / 133、90 / 134、91 / 135、92 / 136、93 / 137、94 / 138、95 / 139、96 / 140、97 / 141、98 / 142、99 / 143、100 / 144、101 / 145、102 / 146、103 / 147、104 / 148、105 / 149、106 / 150、107 / 151、108 / 152、109 / 153、110 / 154、111 / 155、112 / 156、157 / 205、158 / 206、159 / 207、160 / 208、161 / 209、162 / 210、163 / 211、164 / 212、165 / 213、166 / 214、167 / 215、168 / 216、169 / 217、170 / 218、171 / 219、172 / 220、173 / 221、174 / 222、175 / 223、176 / 224、177 / 225、178 / 226、179 / 227、180 / 228、181 / 229、182 / 230、183 / 231、184 / 232、185 / 233、186 / 234、187 / 235、188 / 236、189 / 237、190 / 238、191 / 239、192 / 240、193 / 241、194 / 242、195 / 243、196 / 244、197 / 245、198 / 246、199 / 247、200 / 248、201 / 249、202 / 250、203 / 251、204 / 252、253 / 291、254 / 292、255 / 293、256 / 294、257 / 295、258 / 296、259 / 297、260 / 298、261 / 299、262 / 300、263 / 301、264 / 302、265 / 303、266 / 304、267 / 305、268 / 306、269 / 307、270 / 308、271 / 309、272 / 310、273 / 311、274 / 312、275 / 313、276 / 314、277 / 315、278 / 316、279 / 317、280 / 318、281 / 319、282 / 320、283 / 321、284 / 322、285 / 323、286 / 324、287 / 325、288 / 326、289 / 327、290 / 328、329 / 376、330 / 377、331 / 378、332 / 379、333 / 380、334 / 381、335 / 382、336 / 383、337 / 384、338 / 385、339 / 386、340 / 387、341 / 388、342 / 389、343 / 390、344 / 391、345 / 392、346 / 393、347 / 394、348 / 395、349 / 396、350 / 397、351 / 398、352 / 399、353 / 400、354 / 401、355 / 402、356 / 403、357 / 404、358 / 405、359 / 406、360 / 407、361 / 408、362 / 409、363 / 410、364 / 411、365 / 412、366 / 413、367 / 414、368 / 415、369 / 416、370 / 417、371 / 418、372 / 419、373 / 420、374 / 421、375 / 422、423 / 453、424 / 454、425 / 455、426 / 456、427 / 457、428 / 458、429 / 459、430 / 460、431 / 461、432 / 462、433 / 463、434 / 464、435 / 465、436 / 466、437 / 467、438 / 468、439 / 469、440 / 470、441 / 471、442 / 472、443 / 473、444 / 474、445 / 475、446 / 476、447 / 477、448 / 478、449 / 479、450 / 480、451 / 481、452 / 482、483 / 517、484 / 518、485 / 519、486 / 520、487 / 521、488 / 522、489 / 523、490 / 524、491 / 525、492 / 526、493 / 527、494 / 528、495 / 529、496 / 530、497 / 531、498 / 532、499 / 533、500 / 534、501 / 535、502 / 536、503 / 537、504 / 538、505 / 539、506 / 540、507 / 541、508 / 542、509 / 543、510 / 544、511 / 545、512 / 546、513 / 547、514 / 548、515 / 549、516 / 550、551 / 581、552 / 582、553 / 583、554 / 584、555 / 585、556 / 586、557 / 587、558 / 588、559 / 589、560 / 590、561 / 591、562 / 592、563 / 593、564 / 594、565 / 595、566 / 596、567 / 597、568 / 598、569 / 599、570 / 600、571 / 601、572 / 602、573 / 603、574 / 604、575 / 605、576 / 606、577 / 607、578 / 608、579 / 609、580 / 610、611 / 651、612 / 652、613 / 653、614 / 654、615 / 655、616 / 656、617 / 657、618 / 658、619 / 659、620 / 660、621 / 661、622 / 662、623 / 663、624 / 664、625 / 665、626 / 666、627 / 667、628 / 668、629 / 669、630 / 670、631 / 671、632 / 672、633 / 673、634 / 674、635 / 675、636 / 676、637 / 677、638 / 678、639 / 679、640 / 680、641 / 681、642 / 682、643 / 683、644 / 684、645 / 685、646 / 686、647 / 687、648 / 688、649 / 689、650 / 690、691 / 722、692 / 723、693 / 724、694 / 725、695 / 726、696 / 727、697 / 728、698 / 729、699 / 730、700 / 731、701 / 732、702 / 733、703 / 734、704 / 735、705 / 736、706 / 737、707 / 738、708 / 739、709 / 740、710 / 741、711 / 742、712 / 743、713 / 744、714 / 745、715 / 746、716 / 747、717 / 748、718 / 749、719 / 750、720 / 751、721 / 752、753 / 899、754 / 900、755 / 901、756 / 902、757 / 903、758 / 904、759 / 905、760 / 906、761 / 907、762 / 908、763 / 909、764 / 910、765 / 911、766 / 912、767 / 913、768 / 914、769 / 915、770 / 916、771 / 917、772 / 918、773 / 919、774 / 920、775 / 921、776 / 922、777 / 923、778 / 924、779 / 925、780 / 926、781 / 927、782 / 928、783 / 929、784 / 930、785 / 931、786 / 932、787 / 933、788 / 934、789 / 935、790 / 936、791 / 937、792 / 938、793 / 939、794 / 940、795 / 941、796 / 942、797 / 943、798 / 944、799 / 945、800 / 946、901 / 947、802 / 948、803 / 949、804 / 950、805 / 951、806 / 952、807 / 953、808 / 854、809 / 955、810 / 956、811 / 957、812 / 958、813 / 959、814 / 960、815 / 961、816 / 962、817 / 963、818 / 964、819 / 965、820 / 966、821 / 967、822 / 968、823 / 969、824 / 970、825 / 971、826 / 972、827 / 973、828 / 974、829 / 975、830 / 976、831 / 977、832 / 978、833 / 979、834 / 980、835 / 981、836 / 982、837 / 983、838 / 984、839 / 985、840 / 986、841 / 987、842 / 988、843 / 989、844 / 990、845 / 991、846 / 992、847 / 993、848 / 994、849 / 995、850 / 996、851 / 997、852 / 998、853 / 999、854 / 1000、855 / 1001、856 / 1002、857 / 1003、858 / 1004、859 / 1005、860 / 1006、861 / 1007、862 / 1008、863 / 1009、864 / 1010、865 / 1011、866 / 1012、867 / 1013、868 / 1014、869 / 1015、870 / 1016、871 / 1017、872 / 1018、873 / 1019、874 / 1020、875 / 1021、876 / 1022、877 / 1023、878 / 1024、879 / 1025、880 / 1026、881 / 1027、882 / 1028、883 / 1029、884 / 1030、885 / 1031、886 / 1032、887 / 1033、888 / 1034、889 / 1035、890 / 1036、891 / 1037、892 / 1038、893 / 1039、894 / 1040、895 / 1041、896 / 1042、897 / 1043、898 / 1044、1045 / 1444、1046 / 1445、1047 / 1446、1048 / 1447、1049 / 1448、1050 / 1449、1051 / 1450、1052 / 1451、1053 / 1452、1054 / 1453、1055 / 1454、1056 / 1455、1057 / 1456、1058 / 1457、1059 / 1458、1060 / 1459、1061 / 1460、1062 / 1461、1063 / 1462、1064 / 1463、1065 / 1464、1066 / 1465、1067 / 1466、1068 / 1467、1069 / 1468、1070 / 1469、1071 / 1470、1072 / 1471、1073 / 1472、1074 / 1473、1075 / 1474、1076 / 1475、1077 / 1476、1078 / 1477、1079 / 1478、1080 / 1479、1081 / 1480、1082 / 1481、1083 / 1482、1084 / 1483、1085 / 1484、1086 / 1485、1087 / 1486、1088 / 1487、1089 / 1488、1090 / 1489、1091 / 1490、1092 / 1491、1093 / 1492、1094 / 1493、1095 / 1494、1096 / 1495、1097 / 1496、1098 / 1497、1099 / 1498、1100 / 1499、1101 / 1500、1102 / 1501、1103 / 1502、1104 / 1503、1105 / 1504、1106 / 1505、1107 / 1506、1108 / 1507、1109 / 1508、1110 / 1509、1111 / 1510、1112 / 1511、1113 / 1512、1114 / 1513、1115 / 1514、1116 / 1515、1117 / 1516、1118 / 1517、1119 / 1518、1120 / 1519、1121 / 1520、1122 / 1521、1123 / 1522、1124 / 1523、1125 / 1524、1126 / 1525、1127 / 1526、1128 / 1527、1129 / 1528、1130 / 1529、1131 / 1530、1132 / 1531、1133 / 1532、1134,1533、1135 / 1534、1136 / 1535、1137 / 1536、1138 / 1537、1139 / 1538、1140 / 1539、1141 / 1540、1142 / 1541、1143 / 1542、1144 / 1543、1145 / 1544、1146 / 1545、1147 / 1546、1148 / 1547、1149 / 1548、1150 / 1549、1151 / 1550、1152 / 1551、1153 / 1552、1154 / 1553、1155 / 1554、1156 / 1555、1157 / 1556、1158 / 1557、1159 / 1558、1160 / 1559、1161 / 1560、1162 / 1561、1163 / 1562、1164 / 1563、1165 / 1564、1166 / 1565、1167 / 1566、1168 / 1567、1169 / 1568、1170 / 1569、1171 / 1570、1172 / 1571、1173 / 1572、1174 / 1573、1175 / 1574、1176 / 1575、1177 / 、 1576、1178 / 1577、1179 / 1578、1180 / 1579、1181 / 1580、1182 / 1581、1183 / 1582、1184 / 1583、1185 / 1584、1186 / 1585、1187 / 1586、1188 / 1587、1189 / 1588、1190 / 1589、1191 / 1590、1192 / 1591、1193 / 1592、1194 / 1593、1195 / 1594、1196 / 1595、1197 / 1596、1198 / 1597、1199 / 1598、1200 / 1599、1201 / 1600、1202 / 1601、1203 / 1602、1204 / 1603、1205 / 1604、1206 / 1605、1207 / 1608、1208 / 1607、1209 / 1608、1210 / 1609、1211 / 1610、1212 / 1611、1213 / 1612、1214 / 1613、1215 / 1614、1216 / 1615、1217 / 1616、1218 / 1617、1219 / 1618、1220 / 1619、1221 / 1620、1222 / 1621、1223 / 1622、1224 / 1623、1225 / 1624、1226 / 1625、1227 / 1626、1228 / 1627、1229 / 1628、1230 / 1629、1231 / 1630、1232 / 1631、1233 / 1632、1234 / 1633、1235 / 1634、1236 / 1635、1237 / 1636、1238 / 1637、1239 / 1638、1240 / 1639、1241 / 1340、1242 / 1641、1243 / 1642、1244 / 1643、1245 / 1644、1246 / 1645、1247 / 1646、1248 / 1647、1249 / 1648、1250 / 1649、1251 / 1650、1252 / 1651、1253 / 1652、1254 / 1653、1255 / 1654、1256 / 1655、1257 / 1656、1258 / 1657、1259 / 1658、1260 / 1659、1261 / 1660、1262 / 1661、1263 / 1662、1264 / 1663、1265 / 1664、1266 / 1665、1267 / 1666、1268 / 1667、1269 / 1668、1270 / 1669、1271 / 1670、1272 / 1671、1273 / 1672、1274 / 1673、1275 / 1674、1276 / 1675、1277 / 1676、1278 / 1677、1279 / 1678、1280 / 1679、1281 / 1680、1282 / 1681、1283 / 1682、1284 / 1683、1285 / 1684、1286 / 1685、1287 / 1686、1288 / 1687、1289 / 1688、1290 / 1689、1291 / 1690、1292 / 1691、1293 / 1692、1294 / 1693、1295 / 1694、1296 / 1695、1297 / 1696、1298 / 1697、1299 / 1698、1300 / 1699、1301 / 1700、1302 / 1701、1303 / 1702、1304 / 1703、1305 / 1704、1306 / 1705、1307 / 1706、1308 / 1707、1309 / 1708、1310 / 1709、1311 / 1710、1312 / 1711、1313 / 1712、1314 / 1713、1315 / 1714、1316 / 1715、1317 / 1716、1318 / 1717、1319 / 1718、1320 / 1719、1321 / 1720、1322 / 1721、1323 / 1722、1324 / 1723、1325 / 1724、1326 / 1725、1327 / 1726、1328 / 1727、1329 / 1728、1330 / 1729、1331 / 1730、1332 / 1731、1333 / 1732、1334 / 1733、1335 / 1734、1336 / 1735、1337 / 1736、1338 / 1737、1339 / 1738、1340 / 1739、1341 / 1740、1342 / 1741、1343 / 1742、1344 / 1743、1345 / 1744、1346 / 1745、1347 / 1746、1348 / 1747、1349 / 1748、1350 / 1749、1351 / 1750、1352 / 1751、1353 / 1752、1354 / 1753、1355 / 1754、1356 / 1755、1357 / 1756、1358 / 1757、1359 / 1758、1360 / 1759、1361 / 1760、1362 / 1761、1363 / 1762、1364 / 1763、1365 / 1764、1366 / 1765、1367 / 1766、1368 / 1767、1369 / 1768、1370 / 1769、1371 / 1770、1372 / 1771、1373 / 1772、1374 / 1773、1375 / 1774、1376 / 1775、1377 / 1776, 1378 / 1777, 1379 / 1778, 1380 / 1779, 1381 / 1780, 1382 / 1781, 1383 / 1782, 1384 / 1783, 1385 / 1784, 1386 / 1785, 1387 / 1786, 1388 / 1787, 1389 / 1788, 1390 / 1789, 1391 / 1790, 1392 / 1791, 1393 / 1792, 1394 / 1793, 1395 / 1794, 1396 / 1795 , 1397 / 1796, 1398 / 1797, 1399 / 1798, 1400 / 1799, 1401 / 1800, 1402 / 1801, 1403 / 1802, 1404 / 1803, 1405 / 1804, 1406 / 1805, 1407 / 1806, 1408 / 1807, 1409 / 1808, 1410 / 1809, 1411 / 1810, 1412 / 1811, 1413 / 1812, 1414 / 1813, 1415 / 1814, 1416 / 1815 , 1417 / 1816, 1418 / 1817, 1419 / 1818, 1420 / 1819, 1421 / 1820, 1422 / 1821, 1423 / 1822, 1424 / 1823, 1425 / 1824, 1426 / 1825, 1427 / 1826, 1428 / 1827, 1429 / 1828, 1430 / 1829, 1431 / 1830, 1432 / 1831, 1433 / 1832, 1434 / 1833, 1435 / 1834, 1436 / 183 5, 1437 / 1836, 1438 / 1837, 1439 / 1838, 1440 / 1839, 1441 / 1840, 1442 / 1841, 1443 / 1842, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.

[0297] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 15-30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the first modified oligonucleotide and the second modified oligonucleotide are The nucleic acid sequences of the nucleotides of the nucleotides of SEQ ID NOs: 329 / 376, 330 / 377, 691 / 722, 694 / 725, 696 / 727, 721 / 752, 759 / 905, 774 / 920, 787 / 933, 848 / 994, 850 / 996, 855 / 1001, 857 / 1003, 858 / 1004, 860 / 1006, 861 / 1007, 863 / 1009, 864 / 1010, 866 / 1011, 867 / 1012, 868 / 1013, 869 / 1014, 870 / 1015, 871 / 1016, 872 / 1017, 873 / 1018, 874 / 1019, 875 / 1020, 876 / 1021, 877 / 1022, 878 / 1023, 879 / 1024, 878 / 1025, 879 / 1026, 879 / 1027, 879 / 1028, 880 / 1029, 881 / 1030, 882 / 1031, 883 / 1032, 884 / 1033, 885 / 1034, 886 / 1035, 887 / 1036, 888 / 1037, 889 / 1038, 890 / 1039, 900 / 1039, 901 / 1040, 901 / 1041, 1012, 890 / 1036, 891 / 1037, 1045 / 1444, 1050 / 1449, 1115 / 1514, 1116 / 1515, 1142 / 1541, 1157 / 1556, 1159 / 1558, 1161 / 1560, 1166 / 1565, 1167 / 1566, 1229 / 1628, 1230 / 1629, 1343 / 1742, 1360 / 1759, 1364 / 17 63, 1365 / 1764, 1402 / 1801, 1430 / 1829, 1431 / 1830, wherein the nucleobase sequence of a first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair, and the nucleobase sequence of a second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.

[0298] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.

[0299] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, bicyclic sugar moieties, e.g., 2'-4' bridges selected from -O-CH2- and -O-CH(CH3)-, and non-bicyclic sugar moieties, such as 2'-MOE sugar moieties, 2'-F sugar moieties, 2'-OMe sugar moieties, or 2'-NMA sugar moieties. In certain embodiments, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise an unmodified 2'-deoxyribosyl sugar moiety. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe. In certain embodiments, one or more 2'-F sugar moieties have a configuration other than 2'-β-D-ribosyl. In certain embodiments, one or more 2'-F sugar moieties are in the 2'-β-D-ribosyl configuration.

[0300] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, modified morpholino, hexitol nucleic acid (HNA), fluoro-hexitol nucleic acid (FHNA), peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, and the sugar surrogate may be a GNA.

[0301] In any of the oligomeric duplexes described herein, the first modified oligonucleotide has a sugar motif (5' to 3') of yfyfyfyfyfyfyfyfyfyfyy or yfyyyfyyyyyyyyfyyyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety. In any of the oligomeric duplexes described herein, the second modified oligonucleotide has a sugar motif (5' to 3') of fyfyfyfyfyfyfyfyfyfyfyf or yyyyyyfyfffyyyyyyyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0302] In any of the oligomeric duplexes described herein, the modified oligonucleotide of a first oligomeric compound has a sugar motif (5' to 3') of yfyfyfyfyfyfyfyfyfyfyy and the second modified oligonucleotide has a sugar motif (5' to 3') of fyfyfyfyfyfyfyfyfyfyfyf, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety. In any of the oligomeric duplexes described herein, the modified oligonucleotide of a first oligomeric compound has a sugar motif (5' to 3') of yfyyyyyyyyyyfyyyyyyy and the second modified oligonucleotide has a sugar motif (5' to 3') of yyyyyyfyfffyyyyyyyyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0303] In any of the oligomeric duplexes described herein, at least one internucleoside bond of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified internucleoside bond. In certain embodiments, the modified internucleoside bond is a phosphorothioate internucleoside bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the first modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the second modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, the modified internucleoside bond is a mesyl phosphoramidate internucleoside bond. In certain embodiments, at least one of the first or second internucleoside linkages from the 5'-end and / or 3'-end of a first modified oligonucleotide comprises a mesyl phosphoramidate internucleoside linkage. In certain embodiments, at least one of the first or second internucleoside linkages from the 5'-end and / or 3'-end of a second modified oligonucleotide comprises a mesyl phosphoramidate internucleoside linkage.

[0304] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage.

[0305] In any of the oligomeric duplexes described herein, the internucleoside linkage of each of the first modified oligonucleotide and / or the second modified oligonucleotide can be independently selected from phosphodiester, phosphorothioate, or mesyl phosphoramidate internucleoside linkages.

[0306] In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the first modified oligonucleotide may be ssooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage. In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the second modified oligonucleotide may be ssooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0307] In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and / or the second modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

[0308] In any of the oligomeric duplexes described herein, the first modified oligonucleotide can include a stabilized phosphate group attached to the 5' position of the 5'-most nucleoside. In certain embodiments, the stabilized phosphate group includes cyclopropylphosphonate or (E)-vinylphosphonate.

[0309] In any of the oligomeric duplexes described herein, the first modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5' end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0310] In any of the oligomeric duplexes described herein, the second modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0311] In certain embodiments, the antisense agent comprises an antisense compound comprising an oligomeric compound or oligomeric duplex as described herein. In certain embodiments, the antisense agent may comprise an oligomeric compound or oligomeric duplex as described herein and is an RNAi agent capable of reducing the amount of tau nucleic acid by activating RISC / Ago2.

[0312] Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes. In certain embodiments, the oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, the oligomeric agent comprises two or more of the same oligomeric duplexes, which may be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together at their 3' ends. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker.

[0313] Certain end groups In certain embodiments, the oligomeric compound comprises a terminal group. In certain such embodiments, the oligomeric compound comprises a phosphorus-containing group at the 5'-end of the antisense oligonucleotide and / or the sense oligonucleotide. In certain embodiments, the terminal group is a phosphate-stabilized phosphate group. The 5'-terminal phosphorus-containing group can be 5'-terminal phosphate (5'-P), 5'-terminal phosphorothioate (5'-PS), 5'-terminal phosphorodithioate (5'-PS2), 5'-terminal vinyl phosphonate (5'-VP), 5'-terminal methyl phosphonate (MePhos), or 5'-deoxy-5'-C-malonyl. When the 5'-terminal phosphorus-containing group is 5'-terminal vinyl phosphonate, the 5'VP can be either a 5'-E-VP isomer (i.e., trans-vinyl phosphate), a 5'-Z-VP isomer (i.e., cis-vinyl phosphate), or a mixture thereof. Such phosphate groups can be attached to either antisense or sense oligonucleotides, but are typically attached to antisense oligonucleotides, as they have been shown to improve the activity of certain RNAi agents. See, e.g., Prakash et al., Nucleic Acids Res., 43(6):2993-3011, 2015; Elkayam, et al., Nucleic Acids Res., 45(6):3528-3536, 2017; Parmar, et al. ChemBioChem, 17(11)985-989; 2016; Harastzi, et al., Nucleic Acids Res., 45(13):7581-7592, 2017. In certain embodiments, the phosphate stabilizing group is 5'-cyclopropylphosphonate. See, e.g., WO2018 / 027106.

[0314] Certain conjugated oligomeric compounds In certain embodiments, the oligomeric compound comprises one or more conjugate groups. The conjugate group is composed of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide of the oligomeric compound. The conjugate group can be attached to either or both ends of the oligonucleotide and / or any internal position. In certain embodiments, the conjugate group modifies one or more properties of the oligomeric compound, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0315] Conjugation of one or more carbohydrate moieties to modified oligomeric compounds can optimize one or more properties of the oligomeric compounds. In certain embodiments, carbohydrate moieties are attached to modified subunits of oligomeric compounds. For example, the ribose sugar of one or more ribonucleotide subunits of an oligomeric compound can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit is so replaced is referred to herein as a ribose-replacement modified subunit (RRMS), which is a modified sugar moiety. The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can include two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can include one or more double bonds.

[0316] A. Certain Specific Conjugate Groups Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantaneacetic acid, palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038 / mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0317] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0318] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0319] 2. Conjugate Linker The conjugate moiety is linked to the oligomeric compound via a conjugate linker. In certain embodiments, the conjugate group is a single chemical bond (i.e., the conjugate moiety is linked to the oligonucleotide via the conjugate linker by a single bond). In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0320] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0321] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0322] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, for example, one known in the art to be useful for attaching a conjugate group to a parent compound, such as an oligonucleotide, provided herein. In general, the bifunctional linking moiety includes at least two functional groups. One of the functional groups is selected to bind to a specific site of the compound, and the other is selected to bind to a composite group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0323] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 A non-limiting list of preferred substituents includes, but is not limited to, alkynyl, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0324] In certain embodiments, the conjugate linker comprises 1-5 linker nucleosides. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker nucleoside to be cleaved from the compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0325] In this specification, linker nucleosides are not considered to be part of oligonucleotide.Thus, in the embodiment where an oligomeric compound comprises two oligonucleotides, each consisting of a specific number or range of linked nucleosides and an antisense oligonucleotide with a specific percentage of complementarity with reference nucleic acid, and the oligomeric compound also comprises a conjugate group that comprises a conjugate linker that comprises linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide of the oligomeric compound and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid.Unless otherwise indicated, the conjugate linker comprises 10 or less linker nucleosides.In certain embodiments, the conjugate linker comprises 5 or less linker nucleosides.In certain embodiments, the conjugate linker comprises 3 or less linker nucleosides.In certain embodiments, the conjugate linker comprises 2 or less linker nucleosides. In certain embodiments, the conjugate linker comprises no more than one linker nucleoside.

[0326] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligomeric compound. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are more likely to be taken up by certain cell types, but it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligomeric compound after the oligomeric compound is taken up. Thus, certain conjugates may contain one or more cleavable moieties, typically within the conjugate linker. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0327] In certain embodiments, the cleavable bond is selected from among amides, esters, ethers, one or both esters of a phosphodiester, phosphate esters, carbamates, and disulfides. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0328] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the compound by a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'-terminal nucleoside or the 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0329] 3. Certain cell-targeting conjugate moieties In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor type on target cell.In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells.In certain embodiments, each ligand has affinity for hepatic asialoglycoprotein receptor (ASGP-R).In certain embodiments, each ligand is a carbohydrate.

[0330] In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. For example, see WO2011 / 131693, WO2014 / 064257.

[0331] A certain motif Oligomeric duplexes may be described by motifs or particular features. In certain embodiments, oligomeric duplexes having motifs or particular features described herein are antisense agents.

[0332] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' or 5' terminus, and (iii) a sense oligonucleotide having 2'-F modifications at positions 1, 3, 5, 7, 9-11, 13, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 12, 14-16, 18, and 20 (counting from the 5' end); (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3, 5, 9, 11-13, 15, 17, 19, 21, and 23, and 2'-F modifications at positions 2, 4, 6-8, 10, 14, 16, 18, 20, and 22 (counting from the 5' end); and (iii) an antisense oligonucleotide having phosphorothioate internucleoside linkages (counting from the 5' end) between nucleoside positions 21 and 22 and between nucleoside positions 22 and 23, The two nucleosides at the 3' end of the antisense oligonucleotide are overhanging nucleosides, and the ends of the oligomeric duplex comprising the 5' end of the antisense oligonucleotide and the 3' end of the sense oligonucleotide are blunt (i.e., neither oligonucleotide has an overhanging nucleoside at its end; instead, the hybridizing region of the sense oligonucleotide comprises the 3'-most nucleoside of the sense oligonucleotide, which hybridizes to the 5'-most nucleoside of the antisense oligonucleotide).

[0333] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' or 5' end, (iii) 2'-F modifications at positions 1, 3, 5, 7, 9-11, 13, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 12, 14-16, 18, and 20 (counting from the 5' end); and (iv) a sense oligonucleotide having phosphorothioate internucleoside linkages between nucleoside positions 1 and 2 and between nucleoside positions 2 and 3 (counting from the 5' end); (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3, 5, 7, 9, 11-13, 15, 17, 19, and 21-23, and 2'-F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5' end); and (iii) an antisense oligonucleotide having phosphorothioate internucleoside linkages (counting from the 5' end) between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23; The oligomeric duplex contains a two nucleoside overhang at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide.

[0334] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' or 5' end, (iii) 2'-OMe modifications at positions 1-6, 8, 10, and 12-21, and 2'-F modifications at positions 7 and 9, and a deoxynucleoside at position 11 (counting from the 5' end); and (iv) a sense oligonucleotide having phosphorothioate internucleoside linkages between nucleoside positions 1 and 2 and between nucleoside positions 2 and 3 (counting from the 5' end); (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3, 7, 9, 11, 13, 15, 17, and 19-23, and 2'-F modifications at positions 2, 4-6, 8, 10, 12, 14, 16, and 18 (counting from the 5' end); and (iii) an antisense oligonucleotide having phosphorothioate internucleoside linkages (counting from the 5' end) between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23; The oligomeric duplex contains two nucleoside overhangs at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide.

[0335] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' or 5' end, (iii) 2'-F modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iv) a sense oligonucleotide having phosphorothioate internucleoside linkages (counting from the 5' end) between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 19 and 20, and between nucleoside positions 20 and 21; (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21-23, and 2'-F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iii) an antisense oligonucleotide having phosphorothioate internucleoside linkages (counting from the 5' end) between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23; The oligomeric duplex contains two nucleoside overhangs at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide.

[0336] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' or 5' end, (iii) 2'-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2'-F modifications at positions 7, and 9 to 11, and (iv) a sense oligonucleotide having phosphorothioate internucleoside linkages between nucleoside positions 1 and 2 and between nucleoside positions 2 and 3 (counting from the 5' end); (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 8, 10-13, 15, and 17-23, and 2'-F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5' end); and (iii) an antisense oligonucleotide having phosphorothioate internucleoside linkages (counting from the 5' end) between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23; The oligomeric duplex has a two nucleotide overhang at the 3' end of the antisense oligonucleotide and contains a blunt end at the 5' end of the antisense oligonucleotide.

[0337] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' or 5' end, (iii) 2'-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2'-F modifications at positions 7, and 9 to 11, and (iv) a sense oligonucleotide having phosphorothioate internucleoside linkages between nucleoside positions 1 and 2 and between nucleoside positions 2 and 3 (counting from the 5' end); (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 10-13, 15, and 17-23, and 2'-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5' end); and (iii) an antisense oligonucleotide having phosphorothioate internucleoside linkages (counting from the 5' end) between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23; The oligomeric duplex contains two nucleoside overhangs at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide.

[0338] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' or 5' end, (iii) 2'-OMe modifications at positions 1-6, 8, and 12-21, and 2'-F modifications at positions 7, and 9-11 (counting from the 5' end); and (iv) a sense oligonucleotide having phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 19 and 20, and between nucleoside positions 20 and 21; (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3-5, 7-13, 15, and 17-23, and 2'-F modifications at positions 2, 6, 14, and 16 (counting from the 5' end); and (iii) an antisense oligonucleotide having phosphorothioate internucleoside linkages (counting from the 5' end) between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23; The oligomeric duplex comprises two nucleoside overhangs at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide. In certain embodiments, the oligomeric duplexes described herein comprise: (a) (i) a length of 19 nucleosides; (ii) a conjugate attached to the 3' or 5' end, (iii) 2'-OMe modifications at positions 1-4, 6, and 10-19, and 2'-F modifications at positions 5, and 7-9, and (iv) a sense oligonucleotide having phosphorothioate internucleoside linkages between nucleoside positions 1 and 2 and between nucleoside positions 2 and 3 (counting from the 5' end); (b) (i) a length of 21 nucleosides; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 10-13, 15, and 17-21, and 2'-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5' end); and (iii) an antisense oligonucleotide having phosphorothioate internucleoside linkages (counting from the 5' end) between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 19 and 20, and between nucleoside positions 20 and 21; The oligomeric duplex contains two nucleoside overhangs at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide.

[0339] In certain embodiments, the antisense oligonucleotide of the oligomeric duplex has a stabilized phosphate group at its 5' end.

[0340] In certain embodiments, the oligomeric duplex comprises a sense oligonucleotide consisting of 21 nucleosides and an antisense oligonucleotide consisting of 23 nucleosides, the sense oligonucleotide contains at least one motif of three consecutive 2'F-modified nucleosides at positions 9, 10, 11 from the 5' end, and the antisense oligonucleotide contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleosides at positions 11, 12, 13 from the 5' end, and one end of the oligomeric duplex is blunt, while the other end contains two nucleotide overhangs. In certain embodiments, the two nucleotide overhangs are at the 3' end of the antisense oligonucleotide.

[0341] In certain embodiments, when two nucleotide overhangs are present at the 3' end of the antisense oligonucleotide, there may be two phosphorothioate internucleoside bonds between the terminal three nucleotides, two of which are overhanging nucleotides, and the third nucleotide is the paired nucleotide next to the overhanging nucleotide. In certain embodiments, the oligomeric duplex further comprises two phosphorothioate internucleoside bonds between the terminal three nucleotides at both the 5' end of the sense oligonucleotide and the 5' end of the antisense oligonucleotide. In certain embodiments, all nucleosides of the sense oligonucleotide and the antisense oligonucleotide of the oligomeric duplex are modified nucleosides. In certain embodiments, each nucleoside is independently modified with 2'-O-methyl or 2'-fluoro, for example, in an alternating motif. Optionally, the oligomeric duplex comprises a conjugate.

[0342] In certain embodiments, all nucleotides of the sense and antisense oligonucleotides of the oligomeric duplex, including the nucleotides that are part of the motif, can be modified. Each nucleotide can be modified with the same or different modifications, and modifications can include one or more changes to one or both of the non-linked phosphate oxygens, changes to the components of the ribose sugar, such as the 2' hydroxyl on the ribose sugar, wholesale replacement of the phosphate moiety with a "dephospho" linker, modification or replacement of naturally occurring bases, and replacement or modification of the ribose-phosphate backbone.

[0343] In certain embodiments, each nucleoside of the sense oligonucleotide and the antisense oligonucleotide is independently modified with LNA, cEt, UNA, HNA, CeNA, 2'-MOE, 2'-OMe, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. The oligomer duplex may contain more than one modification. In one embodiment, each nucleoside of the sense oligonucleotide and the antisense oligonucleotide is independently modified with 2'-O-methyl or 2'-F. In certain embodiments, the modification is a 2'-NMA modification.

[0344] The term "alternating motif" as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleosides of an oligonucleotide. The alternating nucleosides can refer to one every other nucleoside, or one every three nucleosides, or a similar pattern. For example, if A, B, and C each represent one type of modification to a nucleoside, the alternating motif can be "ABABABABABAB...", "AABBAABBAABB...", "AABAABAABAAB...", "AAABAAABAAAB...", "AAABBBAAABBB...", or "ABCABCABCABC...", etc.

[0345] The types of modifications included in the alternating motif can be the same or different. For example, if A, B, C, D each represent one type of modification on a nucleoside, the alternation pattern, i.e., the modifications on all other nucleosides, can be the same, but each sense or antisense oligonucleotide can choose from several possibilities of modifications within the alternating motif, such as "ABABAB...", "ACACAC...", "BDBDBD...", or "CDCDCD...".

[0346] In certain embodiments, the modification pattern of the alternating motif on the sense oligonucleotide is shifted relative to the modification pattern of the alternating motif on the antisense oligonucleotide. The shift may be such that a group of modified nucleotides of the sense oligonucleotide corresponds to a group of different modified nucleotides of the antisense oligonucleotide, or vice versa. For example, when a sense oligonucleotide is paired with an antisense oligonucleotide in an oligomeric duplex, within the double-stranded region, the alternating motif in the sense oligonucleotide may start with "ABABAB" from 5' to 3' of the oligonucleotide, and the alternating motif in the antisense oligonucleotide may start with "BABABA" from 5' to 3' of the oligonucleotide. As another example, within the double-stranded region, the alternating motif in the sense oligonucleotide may start with "AABBAABB" from 5' to 3' of the oligonucleotide, and the alternating motif in the antisense oligonucleotide may start with "BBAABBAA" from 5' to 3' of the oligonucleotide, resulting in a complete or partial shift of 10 patterns of modification between the sense oligonucleotide and the antisense oligonucleotide.

[0347] In certain embodiments, the oligomer duplex comprising a pattern of alternating motifs of 2'-O-methyl and 2'-F modifications on the sense oligonucleotide has a shift to the pattern of alternating motifs of 2'-O-methyl and 2'-F modifications on the antisense oligonucleotide, i.e., the 2'-O-methyl modified nucleotide on the sense oligonucleotide base is paired with the 2'-F modified nucleotide on the antisense oligonucleotide, and vice versa. Position 1 of the sense oligonucleotide may start with a 2'-F modification, and position 1 of the antisense oligonucleotide may start with a 2'-O-methyl modification.

[0348] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides into sense and / or antisense oligonucleotides interrupts the initial modification pattern present in the sense and / or antisense oligonucleotides. This interruption of the modification pattern of the sense and / or antisense oligonucleotides by introducing one or more motifs of three identical modifications on three consecutive nucleotides into the sense and / or antisense oligonucleotides surprisingly enhances the gene silencing activity against the target gene. In one embodiment, when the motif of three identical modifications on three consecutive 25 nucleotides is introduced into any of the oligonucleotides, the modification of the nucleotide next to the motif is a different modification from the modification of the motif. For example, the portion of the sequence containing the motif is "...NaYYYNb...", where "Y" represents the modification of the motif of three identical modifications on three consecutive nucleotides, "Na" and "Nb" represent the modification of the nucleotide next to the motif "YYY" that is different from the modification of Y, and Na and Nb may be the same modification or different modifications. Alternatively, when wing modifications are present, Na and / or Nb may or may not be present.

[0349] In certain embodiments, the sense oligonucleotide may be represented by formula (I): 5'n p -N a -(XXX)iN b -YYY-N b -(ZZZ) r N a -n q 3'(I) During the ceremony, i and j are each independently 0 or 1; p and q each independently represent 0 to 6; each N a independently represent 0 to 25 linked nucleosides, including at least two different modified nucleosides; each N b independently represent 0 to 10 linked nucleosides; each n p and n q independently represent an overhanging nucleoside; N b and Y do not have the same modification, XXX, YYY, and ZZZ each independently represent a modified nucleoside, where each X nucleoside has the same modification, each Y nucleoside has the same modification, and each Z nucleoside has the same modification. In certain embodiments, each Y includes a 2'-F modification.

[0350] In certain embodiments, N a and N b includes alternating pattern modifications.

[0351] In certain embodiments, the YYY motif occurs at or near the cleavage site of the target nucleic acid.For example, when the oligomer duplex has a double-stranded region of 17-23 nucleotides in length, the YYY motif may occur near or near the cleavage site of the sense oligonucleotide (e.g., may occur at 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13 positions), counting starts from the first nucleotide from the 5' end, or optionally, counting starts from the first paired nucleotide in the double-stranded region from the 5' end.

[0352] In certain embodiments, the oligomeric duplex antisense oligonucleotide may be represented by the formula: 5'n q -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p 3'(II) During the ceremony, k and l are each independently 0 or 1; p' and q' are each independently 0 to 6; each Na ' independently represent 0 to 25 linked nucleotides that include at least two different modified nucleotides; each N b ' independently represents 0 to 10 linked nucleotides; each n p ' and n q ' independently represents an overhanging nucleoside; N b ' and Y' do not have the same modification, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent a modified nucleoside, where each X' nucleoside has the same modification, each Y' nucleoside has the same modification, and each Z' nucleoside has the same modification. In certain embodiments, each Y' includes a 2'-F modification. In certain embodiments, each Y' includes a 2'-OMe modification.

[0353] In certain embodiments, N a ' and / or N b ' includes alternating pattern modifications.

[0354] In certain embodiments, the Y'Y'Y' motif occurs at or near the cleavage site of the target nucleic acid. For example, when the oligomer duplex has a double-stranded region of 17-23 nucleotides in length, the Y'Y'Y' motif may occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense oligonucleotide, counting starting from the first nucleotide from the 5' end, or optionally, counting starting from the first paired nucleotide in the double-stranded region from the 5' end. Preferably, the Y'Y'Y' motif occurs at positions 11, 12, 13.

[0355] In certain embodiments, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0356] Thus, the antisense oligonucleotide may be represented by the formula: 5'n q '-N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p '3'(IIb), 5'n q '-N a '-Y'Y'Y'-N b '-X'X'X'-n p '3' (IIc), or 5'n q '-N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p '3'(IId).

[0357] When the antisense oligonucleotide is represented by formula IIb, N b Each N' represents 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a ' independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0358] When the antisense oligonucleotide is represented by formula IIc, N b Each N' represents 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a ' independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0359] When the antisense oligonucleotide is represented by formula IId, N b Each N' represents 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a ' independently represents 2 to 20, 2 to 15, or 2 to 10 linked nucleosides. b ' is 0, 1, 2, 3, 4, 5, or 6.

[0360] In certain embodiments, k is 0, l is 0, and the antisense oligonucleotide may be represented by the following formula: 5'n p '-Na'-Y'Y'Y'-N a '-n q '3'(Ia)

[0361] When the antisense oligonucleotide is represented by Formula IIa, each N a ' independently represents 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0362] Each X', Y', and Z' may be the same or different from each other.

[0363] Each nucleoside of the sense oligonucleotide and the antisense oligonucleotide can be independently modified with LNA, UNA, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleoside of the sense oligonucleotide and the antisense oligonucleotide can be independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y, Z, X', Y', and Z' can specifically represent 2'-O-methyl modification or 2'-fluoro modification. In certain embodiments, the modification is 2'-NMA modification.

[0364] In certain embodiments, the sense oligonucleotide of the oligomeric duplex may contain a YYY motif occurring at positions 9, 10, and 11 of the oligonucleotide when the double-stranded region is 21 nucleotides, counting starting from the first nucleotide from the 5' end, or optionally counting starting from the first paired nucleotide in the double-stranded region from the 5' end, where Y represents a 2'-F modification. The sense oligonucleotide may further contain a XXX motif or a ZZZ motif as a wing modification at the opposite end of the double-stranded region, where XXX and ZZZ each independently represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0365] In certain embodiments, the antisense oligonucleotide may contain a Y'Y'Y' motif occurring at positions 11, 12, 13 of the oligonucleotide, counting starting from the first nucleotide from the 5' end, or optionally counting starting from the first paired nucleotide in the double-stranded region from the 5' end, where Y' represents a 2'-O-methyl modification. The antisense oligonucleotide may further contain a X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the double-stranded region, where X'X'X' and Z'Z'Z' each independently represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0366] A sense oligonucleotide represented by any one of the above formulas Ia, Ib, Ic, and Id forms a duplex with an antisense oligonucleotide represented by any one of the above formulas IIa, IIb, IIc, and IId, respectively.

[0367] Thus, the oligomeric duplexes described herein may comprise a sense oligonucleotide and an antisense oligonucleotide, each oligonucleotide having between 14 and 30 nucleotides, and the oligomeric duplex is represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense:3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5' During the ceremony, i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represents 0 to 25 linked nucleotides, each of which contains at least two different modified nucleotides; each N b and N b ' independently represents 0 to 10 linked nucleosides; each n p ',n p , n q ' and n q each may be present or absent and independently represent an overhanging nucleotide; XXX, YYY, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0368] In certain embodiments, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In other embodiments, k is 0 and l is 0; or k is 1 and l is 0; or k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

[0369] Exemplary combinations of sense and antisense oligonucleotides that form oligomeric duplexes include the following formulas: 5'n p -N a -YYY-N a -n q 3' 3'np'-N a '-Y'Y'Y'-N a 'n q '5' (IIIa) 5'n p -N a -YYY-N b -ZZZ-N a-n q 3' 3'n p '-N a '-Y'Y'Y'-Nb'-Z'Z'Z'-N a 'n q '5' (IIIb) 5'np-N a -XXX-N b -YYY-N a -n q 3' 3'np'-N a '-X'X'X'-N b '-Y'Y'Y'-N a '-n q '5' (IIIc) 5'np-N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'np'-N a '-X'X'X'-N b '-Y'Y'Y'-N b '-Z'Z'Z'-N a -n q '5' (Illd)

[0370] When the oligomer duplex has the formula IIIa, each N a independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0371] When the oligomeric duplex is represented by formula IIIb, each N b Each N independently represents 1 to 10, 1 to 7, 1 to 5, or 1 to 4 linked nucleosides. a independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0372] When the oligomeric duplex is represented by formula IIIc, each N b , N bEach N′ independently represents 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0373] When the oligomeric duplex is represented by formula IIId, each N b , N b Each N′ independently represents 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a , N a Each N' independently represents 2 to 20, 2 to 15, or 2 to 10 linked nucleosides. a , N a ', N b , N b ' independently includes alternating pattern modifications.

[0374] Each of X, Y, and Z in formulas III, IIIa, IIIb, IIIc, and IIId can be the same or different from each other.

[0375] When the oligomeric duplex is represented by Formula III, IIIa, IIIb, IIIc, and / or IIId, at least one of the Y nucleotides may be base-paired to one of the Y' nucleotides, alternatively, at least two of the Y nucleotides may be base-paired to a corresponding Y' nucleotide, or all three of the Y nucleotides may be base-paired to a corresponding Y' nucleotide.

[0376] When the oligomeric duplex is represented by formula IIIb or IIId, at least one of the Z nucleotides can be base-paired with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides can be base-paired with a corresponding Z' nucleotide, or all three of the Z nucleotides can be base-paired with a corresponding Z' nucleotide.

[0377] When the oligomeric duplex is represented by formula IIIc or IIId, at least one of the X nucleotides may be base-paired to one of the X' nucleotides, alternatively, at least two of the X nucleotides may be base-paired to a corresponding X' nucleotide, or all three of the X nucleotides may be base-paired to a corresponding X' nucleotide.

[0378] In certain embodiments, the modification of a Y nucleotide is different from the modification on a Y' nucleotide, the modification on a Z nucleotide is different from the modification on a Z' nucleotide, and / or the modification on an X nucleotide is different from the modification on an X' nucleotide.

[0379] In certain embodiments, when the oligomeric duplex is represented by formula IIId, N a The modification is a 2'-O-methyl or a 2'-fluoro modification. In another embodiment, when the oligomeric duplex is represented by formula IIId, N a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In another embodiment, when the oligomeric duplex is represented by Formula IIId, N' is linked to the adjacent nucleotide via a phosphorothioate bond. a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In certain embodiments, when the oligomeric duplex is represented by formula IIId, N is linked to the adjacent nucleotide via a phosphorothioate bond, and the sense oligonucleotide is conjugated to one or more cell targeting groups linked via a bivalent or trivalent branched linker. a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p' is linked to an adjacent nucleotide via a phosphorothioate bond, the sense oligonucleotide comprises at least one phosphorothioate bond, and the sense oligonucleotide is conjugated to one or more cell targeting groups attached via a divalent or trivalent branched linker.

[0380] In certain embodiments, when the oligomeric duplex is represented by Formula IIIa, N a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p ' is linked to an adjacent nucleotide via a phosphorothioate bond, the sense oligonucleotide comprises at least one phosphorothioate bond, and the sense oligonucleotide is conjugated to one or more cell targeting groups attached via a divalent or trivalent branched linker.

[0381] In certain embodiments, the modification is a 2'-NMA modification.

[0382] Antisense activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acid to provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense agents. In certain antisense activities, antisense agents or parts of antisense agents are incorporated into RNA-induced silencing complexes (RISCs), ultimately resulting in cleavage of target nucleic acid. For example, certain antisense compounds result in cleavage of target nucleic acid by Argonaute. Antisense agents with antisense oligonucleotides incorporated into RISCs are RNAi agents. RNAi agents can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0383] In certain embodiments, the RNAi agent is capable of RISC-mediated regulation of target nucleic acid in a cell. In certain embodiments, such compounds reduce or inhibit the amount or activity of target nucleic acid by 25% or more in a standard in vitro assay in which they are described in Example 2. In certain embodiments, the RNAi agent selectively affects more than one target nucleic acid. Such an RNAi agent comprises a nucleobase sequence that hybridizes to more than one target nucleic acid and produces more than one desired antisense activity. In certain embodiments, the RNAi agent does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in such a way that it produces significant undesired antisense activity.

[0384] Antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting RNAi activity involves observing or detecting a change in the amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a phenotypic change in a cell or animal.

[0385] A specific target nucleic acid The RNAi agent comprises or consists of an antisense oligonucleotide that comprises a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein.

[0386] A. Target / Duplex Complementarity In certain embodiments, the oligomeric agent or oligomeric compound comprises or consists of an antisense oligonucleotide that comprises a region complementary to a target nucleic acid. In certain embodiments, the antisense oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the antisense oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the antisense oligonucleotide and comprises a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0387] In certain embodiments, antisense oligonucleotide comprises one or more mismatched nucleobases with target nucleic acid.In certain embodiments, the antisense activity against target is reduced by such mismatch, but the activity against non-target is reduced to a greater extent.Therefore, in certain embodiments, the selectivity of antisense oligonucleotide is improved.

[0388] In certain embodiments, the antisense oligonucleotide comprises a region complementary to the target nucleic acid. In certain embodiments, the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleosides. In certain embodiments, the complementary region comprises 70%, 80%, 85%, 90%, or 95% of the nucleosides of the antisense oligonucleotide. In certain embodiments, the complementary region comprises all of the nucleosides of the antisense oligonucleotide. In certain embodiments, the complementary region of the antisense oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the complementary region of the antisense oligonucleotide is 100% complementary to the target nucleic acid.

[0389] In certain embodiments, the oligomeric duplex comprises a sense oligonucleotide. In such embodiments, the sense oligonucleotide comprises a region complementary to the antisense oligonucleotide. In certain embodiments, the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides. In certain embodiments, the complementary region comprises 70%, 80%, 85%, 90%, or 95% of the nucleosides of the sense oligonucleotide. In certain embodiments, the complementary region comprises all of the nucleosides of the sense oligonucleotide. In certain embodiments, the complementary region of the sense oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the antisense oligonucleotide. In certain embodiments, the complementary region of the sense oligonucleotide is 100% complementary to the antisense oligonucleotide.

[0390] The complementary region of the sense oligonucleotide hybridizes with the antisense oligonucleotide to form a double-stranded region. In certain embodiments, such a double-stranded region is composed of 7 pairs of hybridized nucleosides (one of each pair is on the antisense oligonucleotide, and the other of each pair is on the sense oligonucleotide). In certain embodiments, the double-stranded region comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 hybridized pairs. In certain embodiments, each nucleoside of the antisense oligonucleotide is paired in the double-stranded region (i.e., the antisense oligonucleotide does not have an overhanging nucleoside). In certain embodiments, the antisense oligonucleotide comprises unpaired nucleosides (overhang nucleosides) at the 3'-end and / or 5'-end. In certain embodiments, each nucleoside of the sense oligonucleotide is paired in the double-stranded region (i.e., the sense oligonucleotide does not have an overhang nucleoside). In certain embodiments, the sense oligonucleotide comprises unpaired nucleosides (overhang nucleosides) at the 3'-end and / or 5'-end. In certain embodiments, the duplex formed by the antisense oligonucleotide and the sense oligonucleotide does not include any overhang at one or both ends. Such ends that do not have an overhang are called blunt. In certain embodiments, where the antisense oligonucleotide comprises an overhang nucleoside, one or more of the overhang nucleosides are complementary to the target nucleic acid. In certain embodiments, where the antisense oligonucleotide comprises an overhang nucleoside, one or more of the overhang nucleosides are not complementary to the target nucleic acid.

[0391] B. Tau In certain embodiments, the RNAi agent comprises or consists of an antisense oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being tau RNA. In each of the above embodiments, the RNAi agent may target tau RNA. In certain embodiments, the RNAi agent is an oligomeric duplex. In certain embodiments, the tau nucleic acid has a sequence as set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_001377265.1) or SEQ ID NO: 2 (GENBANK Accession No. NT_010783.14 truncated from 2624000-2761000). In certain embodiments, contacting a cell with an oligomeric duplex comprising an oligomeric compound complementary to SEQ ID NO: 1 reduces the amount of tau RNA, and in certain embodiments, reduces the amount of tau protein. In certain embodiments, contacting a cell with an oligomeric duplex comprising an oligomeric compound complementary to SEQ ID NO: 1 results in reduced aggregation of tau protein.

[0392] In certain embodiments, contacting a cell in an animal with an RNAi agent comprising an oligonucleotide complementary to SEQ ID NO: 1 alleviates one or more symptoms of a neurodegenerative disease. In certain embodiments, the symptom is memory loss, loss of motor function, or an increase in the number and / or volume of neurofibrillary inclusions. In certain embodiments, contacting a cell in an animal with an RNAi agent comprising an oligonucleotide complementary to SEQ ID NO: 1 results in the maintenance or improvement of memory, the maintenance or improvement of motor function, and / or the maintenance or reduction of the number and / or volume of neurofibrillary inclusions.

[0393] In certain embodiments, the RNAi agent is composed of antisense oligonucleotide.In certain embodiments, the RNAi agent comprises a conjugate group.In certain embodiments, the RNAi agent is an oligomer duplex that comprises an antisense RNA oligomer compound and a sense RNAi oligomer compound.In certain embodiments, the oligomer duplex comprises more than one conjugate group.

[0394] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an antisense oligonucleotide that comprises a region that is complementary to a target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue.In certain embodiments, the oligomeric duplex comprises an antisense oligonucleotide that comprises a region that is complementary to a target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue.In certain embodiments, the pharmacologically relevant tissue is a cell or tissue that comprises the central nervous system (CNS).Such tissues include the cortex, spinal cord, and hippocampus.

[0395] D. Certain Methods and Uses Certain embodiments provided herein relate to methods of inhibiting tau RNA expression or activity, which may be useful for treating or alleviating a tau-related disease. In certain embodiments, the tau-related disease is a tauopathy, Alzheimer's disease, frontolateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome.

[0396] In certain embodiments, the method includes administering to a subject an oligomeric compound or oligomeric duplex, either of which has a nucleobase sequence complementary to tau RNA. In certain embodiments, the subject has or is at risk of developing a tau-related disease. In certain embodiments, the subject has or is at risk of developing a tauopathy, Alzheimer's disease, frontolateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome. In certain embodiments, the oligomeric compound or oligomeric duplex is an antisense agent. In certain embodiments, the subject has or is at risk of developing Alzheimer's disease.

[0397] In certain embodiments, a method of treating a tau-related disease comprises administering to a subject an oligomeric compound, oligomeric duplex, or antisense agent, any of which has a nucleobase sequence complementary to tau RNA. In certain embodiments, the subject has or is at risk of developing tauopathy, Alzheimer's disease, frontal lateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome. In certain embodiments, the oligomeric compound or oligomeric duplex is an antisense agent. In certain embodiments, the subject has or is at risk of developing Alzheimer's disease. In certain embodiments, the oligomeric compound or oligomeric duplex is an antisense agent. In certain embodiments, the at least one symptom or characteristic is memory loss, loss of motor function, and an increase in the number and / or volume of neurofibrillary inclusions. In certain embodiments, administration of the oligomeric compound, oligomeric duplex, or antisense agent to a subject reduces or delays the onset or progression of memory loss, loss of motor function, and an increase in the number and / or volume of neurofibrillary inclusions.

[0398] In certain embodiments, the method of reducing the expression of tau in a cell comprises contacting the cell with an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to tau RNA. In certain embodiments, the cell is a central nervous system cell. In certain embodiments, the cell is a human cell.

[0399] Certain embodiments are provided for oligomeric compounds, oligomeric duplexes, or antisense agents, any of which have a nucleobase sequence complementary to tau RNA, for use in treating related tau-related diseases or for use in the manufacture of medicaments for treating tau-related diseases. In certain embodiments, the tau-related disease is tauopathy, Alzheimer's disease, frontolateral dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome. In certain embodiments, the tau-related disease is Alzheimer's disease.

[0400] In any of the methods or uses described herein, the oligomeric compound, oligomeric duplex, or antisense agent may be any of those described herein.

[0401] E. Certain Pharmaceutical Compositions The oligomeric compound, oligomeric duplex or antisense agent described herein may be mixed with pharmaceutically acceptable active or inactive substances for preparation of pharmaceutical compositions or formulations.The composition and method for the formulation of pharmaceutical compositions depend on several criteria, including but not limited to the route of administration, the extent of disease, or the dose administered.In certain embodiments, the oligomeric compound or oligomeric duplex is an RNAi agent.

[0402] Certain embodiments provide pharmaceutical compositions comprising one or more oligomeric compounds, oligomeric duplexes, or antisense agents, or salts thereof. In certain such embodiments, the pharmaceutical composition comprises a suitable pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises sterile saline and one or more oligomeric compounds, oligomeric duplexes, or antisense agents. In certain embodiments, such pharmaceutical compositions consist of sterile saline and one or more oligomeric compounds, oligomeric duplexes, or antisense agents. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents, and sterile water. In certain embodiments, the pharmaceutical composition consists of an oligomeric compound, oligomeric duplex, antisense agent, and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents and phosphate buffered saline (PBS). In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents and sterile PBS. In certain embodiments, the sterile PBS comprises pharmaceutical grade PBS. In certain embodiments, such pharmaceutical compositions comprise cerebrospinal fluid (CSF) and one or more oligomeric compounds, oligomeric duplexes, or antisense agents. In certain embodiments, the oligomeric duplexes or antisense agents comprise sense and antisense oligonucleotides. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0403] In certain embodiments, the CSF is an artificial CSF (aCSF). In certain embodiments, the pharmaceutical composition consists of one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0404] In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dianhydrous dihydrate, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to about 7.1 to 7.3, or to about 7.2, using a suitable pH adjusting agent, e.g., an acid such as hydrochloric acid and an alkali such as sodium hydroxide.

[0405] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds, oligomeric duplexes, or antisense agents and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0406] In certain embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0407] Pharmaceutical compositions comprising one or more oligomeric compounds, oligomeric duplexes, or antisense agents provided herein include any pharmaceutically acceptable salts, esters, or salts of such esters, which can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to animals, including humans. Thus, for example, the present disclosure also focuses on pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts.

[0408] Prodrugs may include oligomeric compounds, oligomeric duplexes, or incorporation of additional nucleosides at one or both termini of an antisense agent that are cleaved by endogenous nucleases in the body to form the active compound.

[0409] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including pharmaceutical compositions that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0410] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including oligomeric compounds, oligomeric duplexes, or antisense agents provided herein, to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0411] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems can be varied considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0412] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or in a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are in unit dosage form, e.g., in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents such as sesame oil and fatty oils, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0413] In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in an aqueous solution that includes sodium. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in an aqueous solution that includes potassium. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in PBS. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in water. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in aCSF. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0414] Specific hotspot areas 1. Nucleic acid bases 1754 to 1783 of SEQ ID NO:1 In certain embodiments, nucleobases 1754-1783 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, the oligomeric duplex comprises an antisense oligonucleotide complementary to a portion of nucleobases 1754-1783 of SEQ ID NO: 1. The antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0415] The nucleobase sequences of SEQ ID NOs: 1115, 1116, 850, and 721 are complementary to a portion of nucleobases 1754 to 1783 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 1702622, 1702625, 1703582, and 1613217 are complementary to a portion of nucleobases 1754 to 1783 of SEQ ID NO: 1.

[0416] In certain embodiments, oligomeric duplexes comprising an antisense oligonucleotide complementary to a portion of nucleobases 1754-1783 of SEQ ID NO:1 achieve at least a 43% reduction in MAPT RNA in a standard in vitro assay. In certain embodiments, oligomeric duplexes comprising an antisense oligonucleotide complementary to a portion of nucleobases 1754-1783 of SEQ ID NO:1 achieve an average of a 69% reduction in MAPT RNA in a standard in vitro assay.

[0417] In certain embodiments, antisense oligonucleotides have an internucleoside linkage motif of 5'-ssooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage. In certain embodiments, antisense oligonucleotides have a sugar motif of 5'-yfyfyfyfyfyfyfyfyfyfyy-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety. In certain embodiments, antisense oligonucleotides have a sugar motif of 5'-yfyyyyyyyyyfyyyyyy-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0418] 2. Nucleic acid bases 2332 to 2362 of SEQ ID NO:1 In certain embodiments, nucleobases 2332-2362 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, the oligomeric duplex comprises an antisense oligonucleotide complementary to a portion of nucleobases 2332-2362 of SEQ ID NO: 1. The antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0419] The nucleobase sequences of SEQ ID NOs: 855, 1142, and 1360 are complementary to a portion of nucleobases 2332 to 2362 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 1703618, 1702718, and 1703621 are complementary to a portion of nucleobases 2332 to 2362 of SEQ ID NO: 1.

[0420] In certain embodiments, oligomeric duplexes comprising an antisense oligonucleotide complementary to a portion of nucleobases 2332-2362 of SEQ ID NO:1 achieve at least a 47% reduction in MAPT RNA in a standard in vitro assay. In certain embodiments, oligomeric duplexes comprising an antisense oligonucleotide complementary to a portion of nucleobases 2332-2362 of SEQ ID NO:1 achieve an average of a 64% reduction in MAPT RNA in a standard in vitro assay.

[0421] In certain embodiments, antisense oligonucleotides have an internucleoside linkage motif of 5'-ssooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage. In certain embodiments, antisense oligonucleotides have a sugar motif of 5'-yfyyyyyyyyyfyfyyyyyyy-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0422] 3. Nucleic acid bases 110 to 142 of SEQ ID NO:1 In certain embodiments, nucleobases 110-142 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, the oligomeric duplex comprises an antisense oligonucleotide complementary to a portion of nucleobases 110-142 of SEQ ID NO: 1. The antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0423] The nucleic acid base sequences of SEQ ID NOs: 1360, 329, and 1045 are complementary to a portion of nucleic acid bases 110 to 142 of SEQ ID NO: 1. The nucleic acid base sequences of compound numbers 1612977, 1702343, and 1703531 are complementary to a portion of nucleic acid bases 110 to 142 of SEQ ID NO: 1.

[0424] In certain embodiments, oligomeric duplexes comprising an antisense oligonucleotide complementary to a portion of nucleobases 110-142 of SEQ ID NO:1 achieve at least 48% reduction in MAPT RNA in a standard in vitro assay. In certain embodiments, oligomeric duplexes comprising an antisense oligonucleotide complementary to a portion of nucleobases 110-142 of SEQ ID NO:1 achieve an average of 63% reduction in MAPT RNA in a standard in vitro assay.

[0425] In certain embodiments, antisense oligonucleotides have an internucleoside linkage motif of 5'-ssooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage. In certain embodiments, antisense oligonucleotides have a sugar motif of 5'-yfyfyfyfyfyfyfyfyfyfyy-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety. In certain embodiments, antisense oligonucleotides have a sugar motif of 5'-yfyyyyyyyyyfyyyyyy-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0426] 4. Nucleic acid bases 6523 to 6552 of SEQ ID NO:1 In certain embodiments, nucleobases 6523-6552 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, the oligomeric duplex comprises an antisense oligonucleotide complementary to a portion of nucleobases 6523-6552 of SEQ ID NO: 1. The antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0427] The nucleic acid base sequences of SEQ ID NOs: 890, 1330, and 1431 are complementary to a portion of nucleic acid bases 6523 to 6552 of SEQ ID NO: 1. The nucleic acid base sequences of compound numbers 1703939, 1703471, and 1703942 are complementary to a portion of nucleic acid bases 6523 to 6552 of SEQ ID NO: 1.

[0428] In certain embodiments, oligomeric duplexes comprising an antisense oligonucleotide complementary to a portion of nucleobases 6523-6552 of SEQ ID NO:1 achieve at least a 44% reduction in MAPT RNA in a standard in vitro assay. In certain embodiments, oligomeric duplexes comprising an antisense oligonucleotide complementary to a portion of nucleobases 6523-6552 of SEQ ID NO:1 achieve an average of a 60% reduction in MAPT RNA in a standard in vitro assay.

[0429] In certain embodiments, antisense oligonucleotides have an internucleoside linkage motif of 5'-ssooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage. In certain embodiments, antisense oligonucleotides have a sugar motif of 5'-yfyyyyyyyyyfyfyyyyyyy-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0430] Non-Limiting Disclosure and Incorporation by Reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.

[0431] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to be limiting thereof. Each of the references, GenBank accession numbers, etc. listed in this application are incorporated herein by reference in their entirety.

[0432] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in practice these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that the designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases, unless otherwise stated. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG", whether modified or unmodified, can be used in combination with other compounds, including, but not limited to, those having the sequence "AUCGAUCG", as well as those compounds having some DNA bases and some RNA bases, such as "AUCGATCG", and those having some RNA bases, such as "AT m and compounds having other modified nucleobases such as "AACGAUCG", m C denotes a cytosine base containing a methyl group at the 5-position. Finally, for clarity, unless otherwise indicated, the phrase "nucleobase sequence of SEQ ID NO:X" refers only to the nucleobase sequence of SEQ ID NO:X, independent of any sugar or internucleoside linkage modifications also set forth in such SEQ ID NO:X.

[0433] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, such as sugar anomers, or as (D) or (L), such as amino acids. Compounds provided herein that are noted or described as having a particular stereoisomeric configuration include only the compounds shown. Compounds provided herein that are depicted or described with undefined stereochemistry include all such possible isomers (including their stereorandom and optically pure forms), unless otherwise specified. Similarly, tautomeric forms of the compounds herein are also included, unless otherwise indicated. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

[0434] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include 1 Isotopic substitutions encompassed by the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O. 17 O or 18 O, and 32 Instead of S. 33 S, 34 S, 35 S, or 36 These include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitution may provide the oligomeric compound with new properties beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotope substitution may make the compound suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0435] The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting. Moreover, when specific embodiments are provided, the inventors have contemplated the general application of those specific embodiments. For example, the disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motifs. Moreover, for example, when a particular high affinity modification appears at a particular position, other high affinity modifications at the same position are considered to be suitable unless otherwise indicated.

[0436] Example 1: Design of RNAi compounds having antisense RNAi oligonucleotides complementary to human MAPT nucleic acids RNAi compounds comprising an antisense RNAi oligonucleotide complementary to a human MAPT nucleic acid and a sense RNAi oligonucleotide complementary to the antisense RNAi oligonucleotide were designed as follows.

[0437] The RNAi compounds in the table below consist of antisense RNAi oligonucleotides and sense RNAi oligonucleotides. In each case, the antisense RNAi oligonucleotides are 23 nucleosides in length and have a sugar motif (5' to 3') of yfyfyfyfyfyfyfyfyfyfyy, where each "y" represents a 2'-O-methyl ribosyl sugar, each "f" represents a 2'-fluoro ribosyl sugar, and have an internucleoside linkage motif (5' to 3') of ssooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage, and each "s" represents a phosphorothioate internucleoside linkage. The sense RNAi oligonucleotides, in each case, are 21 nucleosides long, have a sugar motif (5' to 3') of fyfyfyfyfyfyfyfyfyfyf, where each "y" represents a 2'-O-methylribosyl sugar, each "f" represents a 2'-fluororibosyl sugar, and have an internucleoside linkage motif (5' to 3') of ssooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage, and each "s" represents a phosphorothioate internucleoside linkage. Each antisense RNAi oligonucleotide is complementary to a target nucleic acid (MAPT) and each sense RNAi oligonucleotide is complementary to the first 21 nucleosides (5' to 3') of the antisense RNAi oligonucleotide, with the last two 3' nucleosides of the antisense RNAi oligonucleotide being unpaired to the sense RNAi oligonucleotide (are overhanging nucleosides).

[0438] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the antisense RNAi oligonucleotide is complementary. Each antisense RNAi oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_001377265.1).

[0439] [Table 1-1]

[0440]

Table 1-2

[0441]

Table 1-3

[0442]

Table 2-1

[0443]

Table 2-2

[0444]

Table 2-3

[0445]

Table 2-4

[0446]

Table 3-1

[0447]

Table 3-2

[0448]

Table 3-3

[0449]

Table 3-4

[0450]

Table 3-5

[0451]

Table 4-1

[0452]

Table 4-2

[0453]

Table 4-3

[0454]

Table 4-4

[0455]

Table 5-1

[0456]

Table 5-2

[0457]

Table 5-3

[0458]

Table 5-4

[0459] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the antisense RNAi oligonucleotide is complementary. Each antisense RNAi oligonucleotide listed in the following table has a single mismatch with SEQ ID NO: 1 (described hereinabove), and this mismatch is located at the 1st position of the 5'-end of the antisense sequence.

[0460] [Table 6-1]

[0461] [Table 6-2]

[0462] [Table 6-3]

[0463] [Table 7-1]

[0464] [Table 7-2]

[0465] [Table 7-3]

[0466] [Table 8-1]

[0467] [Table 8-2]

[0468] [Table 8-3]

[0469] [Table 8-4]

[0470] [Table 9-1]

[0471] [Table 9-2]

[0472] [Table 9-3]

[0473] [Table 9-4]

[0474] [Table 10-1]

[0475] [Table 10-2]

[0476] [Table 10-3]

[0477] Example 2: Effects of RNAi compounds on human MAPT RNA in vitro, single dose The RNAi compounds described herein above were tested for their single dose effect on MAPT RNA in vitro in cultured cells expressing MAPT.The RNAi compounds were tested in a series of experiments with similar culture conditions.

[0478] A-172 cells cultured at a density of 30,000 cells per well were treated with RNAi compounds at a concentration of 15 nM by LipofectAMINE 2000. After a 24-hour treatment period, total RNA was isolated from the cells and MAPT RNA levels were measured by quantitative real-time RTPCR. MAPT RNA was measured by human primer probe set RTS3104 (forward sequence AAGATTGGGGTCCCTGGACAAT, designated herein as SEQ ID NO: 3; reverse sequence AGCTTGGGGTTTCAATCTTTTTATT, designated herein as SEQ ID NO: 4; probe sequence CACCCACGTCCCTGGCGGA, designated herein as SEQ ID NO: 5). MAPT RNA levels were normalized to total RNA content, measured by RIBOGREEN®. The reduction of MAPT RNA is presented in the table below as a percentage (UTC%) of MAPT RNA relative to the amount in untreated control cells.

[0479] Each individual experiment described in this example is presented in a separate table. Values ​​marked with "†" indicate that the RNAi compound is complementary to the amplicon region of the primer probe set.

[0480] [Table 11-1]

[0481] [Table 11-2]

[0482] [Table 12-1]

[0483]

Table 12-2

[0484]

Table 12-3

[0485]

Table 13-1

[0486]

Table 13-2

[0487]

Table 13-3

[0488]

Table 14-1

[0489]

Table 14-2

[0490]

Table 14-3

[0491]

Table 15-1

[0492]

Table 15-2

[0493] Example 3: Dose-dependent inhibition of human MAPT in A-172 cells by RNAi compounds Modified RNAi compounds selected from the above examples were tested at various doses in A-172 cells. A-172 cells plated at a density of 30,000 cells per well were treated with various concentrations of RNAi compounds specified in the table below using LipofectAMINE 2000. After a treatment period of about 24 hours, total RNA was isolated from the cells and MAPT RNA levels were measured by quantitative real-time RTPCR. Human MAPT primer probe set RTS3104 (described hereinabove) was used to measure RNA levels as described above. MAPT RNA levels were normalized to total RNA content, measured by RIBOGREEN®. MAPT RNA reduction is expressed in the table below as a percentage (UTC%) of MAPT RNA relative to untreated control cells.

[0494] Linear regression of log / linear plots of the data in Excel or GraphPad Prism (version 9.2.0) was used to calculate the half inhibitory concentration (IC) of each RNAi compound. 50 ) was calculated and is also shown in the table below. Compound 623782 (a 5-10-5 MOE gapmer modified oligonucleotide previously described in WO 2015 / 010135) was included as a positive control.

[0495] [Table 16]

[0496] [Table 17-1]

[0497] [Table 17-2]

[0498] [Table 18]

[0499] [Table 19-1]

[0500] [Table 19-2]

[0501] [Table 20]

[0502] Example 4: Design of RNAi compounds having antisense RNAi oligonucleotides complementary to human MAPT nucleic acids RNAi compounds comprising an antisense RNAi oligonucleotide complementary to a human MAPT nucleic acid and a sense RNAi oligonucleotide complementary to the antisense RNAi oligonucleotide were designed as follows.

[0503] The RNAi compounds in the following table consist of antisense RNAi oligonucleotides and sense RNAi oligonucleotides. In each case, the antisense RNAi oligonucleotides are 23 nucleosides in length and have a sugar motif (5' to 3') of yfyyyyyyyyyyyfyyyyyyy, where each "y" represents a 2'-O-methyl ribosyl sugar, each "f" represents a 2'-fluoro ribosyl sugar, and an internucleoside linkage motif (5' to 3') of ssooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage, and each "s" represents a phosphorothioate internucleoside linkage. Each antisense RNAi oligonucleotide has a terminal phosphate at the 5' end. The sense RNAi oligonucleotides, in each case, are 21 nucleosides long, have a sugar motif (5' to 3') of yyyyyyfyfffyyyyyyyyy, where each "y" represents a 2'-O-methylribosyl sugar, each "f" represents a 2'-fluororibosyl sugar, and have an internucleoside linkage motif (5' to 3') of ssooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage, and each "s" represents a phosphorothioate internucleoside linkage. Each antisense RNAi oligonucleotide in the table below is complementary to a target nucleic acid (MAPT), and each sense RNAi oligonucleotide is complementary to the first (5' to 3') of 21 nucleosides of the antisense RNAi oligonucleotide, where the last two 3' nucleosides of the antisense RNAi oligonucleotide are not paired to the sense RNAi oligonucleotide (they are overhanging nucleosides).

[0504] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the antisense RNAi oligonucleotide is complementary. Each antisense RNAi oligonucleotide listed in the following table is 100% complementary to SEQ ID NO: 1 (herein above).

[0505]

Table 21-1

[0506]

Table 21-2

[0507]

Table 21-3

[0508]

Table 21-4

[0509]

Table 21-5

[0510]

Table 21-6

[0511]

Table 21-7

[0512]

Table 21-8

[0513]

Table 21-9

[0514]

Table 21-10

[0515] [Table 21-11]

[0516] [Table 21-12]

[0517] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the antisense RNAi oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the antisense RNAi oligonucleotide is complementary. Each antisense RNAi oligonucleotide listed in the table below is complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_001377265.1) with a single mismatch at the 5' end.

[0518] [Table 22-1]

[0519] [Table 22-2]

[0520] [Table 22-3]

[0521] [Table 22-4]

[0522] [Table 22-5]

[0523] [Table 22-6]

[0524]

Table 22-7

[0525]

Table 22-8

[0526]

Table 22-9

[0527]

Table 22-10

[0528]

Table 22-11

[0529]

Table 22-12

[0530]

Table 22-13

[0531]

Table 22-14

[0532]

Table 22-15

[0533]

Table 22-16

[0534]

Table 22-17

[0535]

Table 22-18

[0536]

Table 22-19

[0537]

Table 22-20

[0538]

Table 22-21

[0539]

Table 22-22

[0540]

Table 22-23

[0541]

Table 22-24

[0542]

Table 22-25

[0543]

Table 22-26

[0544] [Table 22-27]

[0545] [Table 22-28]

[0546] [Table 22-29]

[0547] Example 5: Effects of RNAi compounds on human MAPT RNA in vitro, single dose The RNAi compounds described herein above were tested for their single dose effect on MAPT RNA in vitro. The RNAi compounds were tested in a series of experiments with similar culture conditions.

[0548] A-172 cells cultured at a density of 10,000 cells per well were treated with RNAi compounds at a concentration of 1 nM by LipofectAMINE RNAiMAX. After a 72-hour treatment period, total RNA was isolated from the cells and MAPT RNA levels were measured by quantitative real-time RTPCR. MAPT RNA was measured by human primer probe set RTS3104 (described hereinabove). MAPT RNA levels were normalized to total RNA content, measured by RIBOGREEN®. The reduction of MAPT RNA is expressed in the table below as a percentage (UTC%) of MAPT RNA relative to the amount of MAPT RNA in untreated control cells.

[0549] Each individual experiment described in this example is presented in a separate table. Values ​​marked with "†" indicate that the RNAi compound is complementary to the amplicon region of the primer probe set.

[0550] [Table 23-1]

[0551]

Table 23-2

[0552]

Table 23-3

[0553]

Table 24-1

[0554]

Table 24-2

[0555]

Table 24-3

[0556]

Table 25-1

[0557]

Table 25-2

[0558]

Table 26-1

[0559]

Table 26-2

[0560]

Table 26-3

[0561]

Table 27-1

[0562]

Table 27-2

[0563]

Table 27-3

[0564]

Table 28-1

[0565]

Table 28-2

[0566]

Table 28-3

[0567]

Table 29-1

[0568]

Table 29-2

[0569]

Table 29-3

Claims

1. an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences of any of SEQ ID NOs: 11-39, 69-112, 157-204, 253-290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, 1045-1443; and wherein the modified oligonucleotide is an antisense oligonucleotide; and optionally a) the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 11-39, 69-112, 157-204, 253-290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, 1045-1443; or b) the nucleobase sequence of the modified oligonucleotide consists of any one of the nucleobase sequences of SEQ ID NOs: 11-39, 69-112, 157-204, 253-290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, and 1045-1443; The oligomeric compound.

2. a) the nucleobase sequence of the modified oligonucleotide comprises or consists of a nucleobase sequence selected from SEQ ID NOs: 329, 330, 391, 694, 696, 721, 759, 774, 787, 848, 850, 855, 857-858, 860-861, 863, 884, 886, 890, 891, 1045, 1050, 1115, 1116, 1142, 1157, 1159, 1161, 1166-1167, 1229-1330, 1343, 1360, 1364-1365, 1402, 1430-1431; b) the nucleobase sequence of the modified oligonucleotide is at least 90%, at least 95%, or 100% complementary to an equal length portion of a Tau nucleic acid, wherein the Tau nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2; c) the modified oligonucleotide is selected from the group consisting of: 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, consisting of 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-29, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides; d) the modified oligonucleotide consists of 23 linked nucleosides; and / or e) the nucleobase sequence of the modified oligonucleotide is an isometric portion of nucleobases 110 to 142 of SEQ ID NO: 1; an isometric portion of nucleobases 1754 to 1783 of SEQ ID NO: 1; an isometric portion of nucleobases 2332 to 2362 of SEQ ID NO: 1; or is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of an equal length portion of nucleobases 6523 to 6552 of SEQ ID NO: 1; The oligomeric compound of claim 1.

3. a) the nucleobase sequence of the modified oligonucleotide is SEQ ID NO: 721, 850, 1115, or 1116; SEQ ID NO: 885, 1142, or 1360; SEQ ID NO: 329, 1045, or 1343; and is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of SEQ ID NO: 890, 1330, or 1431; or b) the nucleobase sequence of the modified oligonucleotide is SEQ ID NO: 721, 850, 1115, or 1116; SEQ ID NO: 885, 1142, or 1360; SEQ ID NO: 329, 1045, or 1343; and comprising or consisting of a nucleobase sequence selected from SEQ ID NOs: 890, 1330, or 1431; The oligomeric compound of claim 1.

4. a) at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety, and optionally i) the modified sugar moiety comprises a bicyclic sugar moiety, and further optionally, the bicyclic sugar moiety comprises a 2'-4' bridge, wherein the 2'-4' bridge is -O-CH 2 - and -O-CH(CH 3 )—selected from; or ii) the modified sugar moiety comprises a non-bicyclic modified sugar moiety, and further optionally, the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety; b) at least one nucleoside of the modified oligonucleotide comprises a sugar surrogate, optionally selected from morpholino, modified morpholino, glycol nucleic acid (GNA), hexitol nucleic acid (HNA), fluoro-hexitol nucleic acid (F-HNA), peptide nucleic acid (PNA), and unlocked nucleic acid (UNA); c) the modified oligonucleotide contains at least one modified internucleoside linkage, and / or A) i) each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage; ii) each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage; or iii) each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage; or B) at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage, and further optionally, at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage, e.g., each internucleoside linkage is a phosphorothioate internucleoside linkage; The oligomeric compound of claim 1.

5. a) the modified oligonucleotide has an internucleoside linkage motif of ssooooooooooooooooooooooss, where "s" is a phosphorothioate internucleoside linkage and "o" is a phosphodiester internucleoside linkage; b) the modified oligonucleotide comprises at least one modified nucleobase, optionally wherein said modified nucleobase is a 5-methylcytosine, and further optionally wherein each cytosine is a 5-methylcytosine; c) the modified oligonucleotide has a sugar motif (5' to 3') of yfyfyfyfyfyfyfyfyfyfyy or yfyyyfyyyyyyyfyyyyyy, where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; and / or d) the oligomeric compound comprises a conjugate group, optionally comprising a conjugate moiety and a conjugate linker, and further optionally i) the conjugate moiety is a lipophilic group; or the conjugate moiety is selected from C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl; ii) the conjugate linker consists of a single bond; and / or iii) the conjugate linker is cleavable; and / or e) containing an end group; The oligomeric compound of claim 1.

6. 1. An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide; and a second oligomeric compound comprising a second modified oligonucleotide, wherein said first oligomeric compound is the oligomeric compound of claim 1; and optionally, said second modified oligonucleotide consists of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide.

7. an oligomeric duplex, a) a first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences set forth in SEQ ID NOs: 11-39, 69-112, 157-204, 253-290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, and 1045-1443; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide; or b) a first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences set forth in SEQ ID NOs: 11-39, 69-112, 157-204, 253-290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, and 1045-1443; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises at least 8, at least 9, or at least 10 nucleosides selected from the group consisting of any of the nucleobase sequences set forth in SEQ ID NOs: 40-68, 113-156, 205-252, 291-328, 376-422, 453-482, 517-550, 581-610, 651-690, 722-752, 899-1044, and 1444-1842; a second oligomeric compound comprising at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases, and wherein said nucleobase sequence of said second modified oligonucleotide is at least 90% complementary to an equal length portion of said first modified oligonucleotide; or c) a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 11-39, 69-112, 157-204, 253-290, 329-375, 423-452, 483-516, 551-580, 611-650, 691-721, 753-898, and 1045-1443; a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 40-68, 113-156, 205-252, 291-328, 376-422, 453-482, 517-550, 581-610, 651-690, 722-752, 899-1044, and 1444-1842, and wherein said nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal-length portion of the first modified oligonucleotide; The oligomeric duplex.

8. a) the first modified oligonucleotide comprises a 5'-stabilized phosphate group, optionally wherein the 5'-stabilized phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate; b) the first modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate; c) the first modified oligonucleotide comprises a 2'-NMA sugar moiety; d) at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety, and optionally, i) the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety, and further optionally, the bicyclic sugar moiety of the second modified oligonucleotide is -O-CH 2 - and -O-CH(CH 3 )-; or ii) the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety, and optionally the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety; and / or e) at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate; The oligomeric duplex of claim 7.

9. a) the second modified oligonucleotide comprises at least one modified internucleoside linkage, and optionally, at least one modified internucleoside linkage of said second modified oligonucleotide is a phosphorothioate internucleoside linkage; and / or b) i) the second modified oligonucleotide comprises at least one phosphodiester internucleoside linkage; ii) each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage; or iii) the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooooooss and the internucleoside linkage motif of said second modified oligonucleotide is ssooooooooooooooooooooss, wherein each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage; and / or c) the second modified oligonucleotide comprises at least one modified nucleobase, and optionally, the modified nucleobase of said second modified oligonucleotide is 5-methylcytosine; The oligomeric duplex of claim 7.

10. The second modified oligonucleotide comprises a conjugate group, and optionally a) the conjugate group comprises a conjugate linker and a conjugate moiety; b) the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide, or the conjugate group is attached to the second modified oligonucleotide at the 3' end of the second modified oligonucleotide, and / or c) the conjugate group comprises a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C17 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, a C5 alkyl, a C22 alkenyl, a C20 alkenyl, a C17 alkenyl, a C16 alkenyl, a C10 alkenyl, a C21 alkenyl, a C19 alkenyl, a C18 alkenyl, a C15 alkenyl, a C14 alkenyl, a C13 alkenyl, a C12 alkenyl, a C11 alkenyl, a C9 alkenyl, a C8 alkenyl, a C7 alkenyl, a C6 alkenyl, or a C5 alkenyl; The oligomeric duplex of claim 7.

11. a) the second modified oligonucleotide comprises a terminal group, optionally the terminal group being an abasic sugar moiety; b) the second modified oligonucleotide is selected from the group consisting of 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17 and / or consisting of up to 20, 17-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides; and / or c) the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides, and optionally i) the modified oligonucleotide of a first oligomeric compound has a sugar motif (5' to 3') of yfyfyfyfyfyfyfyfyfyfyyy and said second modified oligonucleotide has a sugar motif (5' to 3') of fyfyfyfyfyfyfyfyfyfyfyf, wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; or ii) the modified oligonucleotide of a first oligomeric compound has a sugar motif (5' to 3') of yfyyyfyyyyyyyfyyyyyyy and said second modified oligonucleotide has a sugar motif (5' to 3') of yyyyyyfyfffyyyyyyyyy, wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; The oligomeric duplex of claim 7.

12. 10. An antisense agent, wherein the antisense agent is the oligomeric duplex of claim 7, and optionally the antisense agent is an RNAi agent capable of reducing the amount of tau RNA by activating RISC / Ago2.

13. a) a chirally enriched population of oligomeric duplexes according to claim 7, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration, optionally wherein the population is enriched for modified oligonucleotides having a particular independently selected stereochemical configuration at each phosphorothioate internucleoside linkage, and further optionally wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages; or b) A population of oligomeric duplexes comprising the modified oligonucleotides of claim 7, wherein all of the phosphorothioate internucleoside linkages of said modified oligonucleotides are stereorandom.

14. 14. A pharmaceutical composition comprising the oligomeric compound of any one of claims 1-5, the oligomeric duplex of any one of claims 7-11, the antisense agent of claim 12, or the population of claim 13, and a pharmaceutically acceptable diluent or carrier, optionally wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid, and further optionally wherein the pharmaceutical composition consists essentially of the oligomeric compound, oligomeric duplex, antisense agent, or population and phosphate buffered saline or artificial cerebrospinal fluid.

15. 14. A pharmaceutical composition for treating an animal in need thereof comprising the oligomeric compound of any one of claims 1-5, the oligomeric duplex of any one of claims 7-11, the antisense agent of claim 12, or the population of claim 13, wherein optionally the animal has a tau-related disease, and further optionally the tau-related disease is tauopathy, Alzheimer's disease, frontolateral dementia (FTD), frontolateral dementia with parkinsonism-17 (FTDP-17), progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome.

16. 14. A pharmaceutical composition for treating a tau-associated disease comprising an oligomeric compound according to any one of claims 1-5, an oligomeric duplex according to any one of claims 7-11, an antisense agent according to claim 12, or a population according to claim 13, wherein the treatment comprises administering a therapeutically effective amount of the pharmaceutical composition to an individual having or at risk of developing a tau-associated disease, thereby treating the tau-associated disease, and optionally a) the tau-related disease is tauopathy, Alzheimer's disease, frontolateral dementia (FTD), frontolateral dementia with parkinsonism-17 (FTDP-17), progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome; optionally, i) the tau-related disease is a tauopathy; ii) the tau-related disease is Alzheimer's disease; iii) the tau-related disease is frontotemporal dementia (FTD); iv) the tau-related disease is FTDP-17; v) the tau-related disease is progressive supranuclear palsy (PSP); vi) the tau-related disease is chronic traumatic encephalopathy (CTE); vii) the tau-related disease is corticobasal degeneration (CBD); viii) the tau-related disease is epilepsy; or ix) the tau-related disease is Dravet syndrome; b) at least one symptom or feature of the tau-related disease is alleviated, optionally the symptom or feature being memory loss, loss of motor function, and / or an increase in the number and / or volume of neurofibrillary inclusions; and / or c) the treatment improves motor function, reduces the amount or volume of alpha-synuclein aggregates, reduces or slows neurodegeneration, improves cognitive function, or delays the onset or progression of dementia; The above pharmaceutical composition.

17. 14. Use of an oligomeric compound according to any one of claims 1 to 5, an oligomeric duplex according to any one of claims 7 to 11, an antisense agent according to claim 12, or a population according to claim 13 for the manufacture of a medicament for treating a tau-related disease, optionally comprising: a) the tau-related disease is tauopathy, Alzheimer's disease, frontolateral dementia (FTD), frontolateral dementia with parkinsonism-17 (FTDP-17), progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), epilepsy, or Dravet syndrome; b) at least one symptom or characteristic is alleviated, optionally wherein the at least one symptom or characteristic is memory loss, loss of motor function, or an increase in the number and / or volume of neurofibrillary inclusions; and / or c) use of said oligomeric compound, said oligomeric duplex, said antisense agent, or said population improves motor function, reduces the amount or volume of alpha-synuclein aggregates, reduces or slows neurodegeneration, improves cognitive function, or delays the onset or progression of dementia; Use the above.