Methods for intratumoral delivery of the CRISPR / CAS system
Patent Information
- Application Number
- JP2024529494
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-11-19
- Filing Date
- 2022-11-18
- Publication Date
- 2025-11-27
AI Technical Summary
【0027】 その他の目的及び利点は、以下に続く詳細な説明を参照すれば、当業者には明らかになるであろう。
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 USC §119(e) to U.S. Provisional Patent Application No. 63 / 281,361, filed November 19, 2021, which is incorporated by reference herein in its entirety.
[0002] Sequence Listing The sequence listing associated with this application has been submitted in electronic format and is incorporated herein by reference in its entirety. The name of the text file containing the sequence listing is 13094901120sequencelisting. The size of the text file is 39kb and the text file was created on November 17, 2022.
[0003] This field relates to the treatment of cancer through intratumoral delivery of the CRISPR / Cas system. [Background technology]
[0004] Conventional systemic cancer chemotherapy and immunotherapy have been significantly limited in their safety and efficacy due to toxicity issues. Moreover, such treatments can significantly impair the quality of life of patients. Intratumoral therapy has been considered as an alternative to systemic chemotherapy or immunotherapy, but for the past 30 years, intratumoral therapy has not been recommended. There are at least three main reasons behind this discouragement: tumors can be resected, so direct treatment is unnecessary; direct injection would stimulate metastasis; and local targeting is ineffective in addressing metastasis (Goldberg et al., J. Pharm. Pharmacol. 54:159-80 (2002)).
[0005] The CRISPR / Cas system can be delivered to cells in several formats, including as synthetic molecules that can contain chemically modified bases to enhance activity and stability and reduce toxicity, as plasmid DNA encoding CRISPR-associated proteins and guide RNAs, and as mRNA encoding CRISPR-associated proteins and guide RNAs. CRISPR-associated proteins and guide RNAs can be delivered as preassembled ribonucleoprotein (RNP) complexes. The advantage of delivering preassembled RNPs compared to plasmids or mRNAs is that there is no need to transcribe RNA or translate proteins to induce editing, maximizing efficiency, and the disruption of RNPs results in a shorter duration of nuclease activity, which is safer and therefore less off-target effects. Summary of the Invention [Problem to be solved by the invention]
[0006] One of the major challenges for effective cancer therapy is the ability to deliver CRISPR / Cas systems to solid tumors, and therefore there remains a need to improve the delivery of CRISPR / Cas systems to solid tumors. [Means for solving the problem]
[0007] One embodiment is a method of treating a solid tumor comprising administering, intratumorally or peritumor to a subject in need thereof, a therapeutically effective amount of a CRISPR / Cas system comprising: (a) one or more nucleic acid sequences encoding one or more guide RNAs (gRNAs) complementary to one or more target sequences in a target cell, and (b) a nucleic acid sequence encoding a CRISPR-associated endonuclease.
[0008] In some embodiments, the one or more gRNAs comprise a trans-activating small RNA (tracrRNA) and a CRISPR RNA (crRNA).
[0009] In some embodiments, the one or more gRNAs are one or more single guide RNAs.
[0010] In some embodiments, the target cell is a cancer cell of a solid tumor, and in some embodiments, the one or more target sequences are cancer genes, and in some embodiments, the cancer genes are NRF2, EGFR, EIF1AX, GNA11, SF3B1, BAP1, PBRM1, ATM, SETD2, KDM6A, CUL3, MET, SMARCA4, U2AF1, RBM10, STK11, NF1, NF2, IDH1, IDH2, PTPN11, MAX, TCF12, HIST1H1E, LZTR1, KIT, RAC1, ARID2, BRD4, BRD7, BARF1, NRAS, RN F43, SMAD4, ARID1A, ARID1B, KRAS, APC, SMAD2, SMAD3, ACVR2A, GNAS, HRAS, STAG2, FGFR3, FGFR4, RHOA, CDKN1A, ERBB3, KANSL1, RB1, TP53, CDKN2A, CDK N2B, CDKN2C, KEAP1, CASP8, TGFBR2, HLA-B, MAPK1, NOTCH1, NOTCH2, NOTCH3, HLA-A, RASA1, EPHA2, EPHA3, EPHA5, EPHA7, NSD1, ZNF217, ZNF750, KLF5, EP 300, FAT1, PTEN, FBXW7, PIK3CA, PIK3CB, PIK3C2B, PIK3CG, RUNX1, RUNX1T1, DNMT3A, SMC1A, ERBB2, AKT1, AKT2, AKT3, MAP3K1, FOXA1, BRCA1, BRCA2, CD H1, PIK3R1, PPP2R1A, BCOR, BCORL1, ARHGAP35, FGFR2, CHD4, CTCF, CTNNA1, CTNNB1, SPOP, TMSB4X, PIM1, CD70, CD79A, CD79B, B2M, CARD11, MYD88, BTG1, BTG2, TNFAIP3, MEN1, PRKAR1A, PDGFRA, PDGFRB, SPTA1, GABRA6, KEL, SMARCB1, ZBTB7B, BCL2, BCL2L1, BCL2L2, BCL2L11, RFC1, MAP3K4, CSDE1, EPAS1, R ET, LATS2, EEF2, CYLD, HUWE1, MYH9, AJUBA, FLNA, ERBB4, CNBD1, DMD, MUC6, FAM46C, FAM46D, PLCG1, PLCG2, NIPBL, FUBP1, CIC, ZBTB2, ZBTB20, ZCCHC12,<h2 style=";text-align:left;direction:ltr">TGIF1、SOX2、SOX9、SOX10、PCBP1、ZFP36L2、TCF7L2、AMER1、KDM5A、KDM5C、M TOR、VHL、KIF1A、TCEB1、TXNIP、CUL1、TSC1、ELF3、RHOB、PSIP1、SF1、FOXQ1、G NA13、DIAPH2、ZFP36L1、ERCC2、SPTAN1、RXRA、ASXL2、CREBBP、CREB3L3、ALB 、DHX9、XPO1、RPS6KA3、IL6ST、TSC2、EEF1A1、WHSC1、APOB、NUP133、AXIN1、PH F6、TET2、WT1、FLT3、FLT4、SMC3、CEBPA、RAD21、RAD50、RAD51、PTPDC1、ASXL 1、EZH2、NPM1、SRSF2、GNAQ、PLCB4、CYSLTR2、CDKN1B、CBFB、NCOR1、PTPRD、TB X3,GPS2,GATA1,GATA2,GATA3,GATA4,GATA6,MAP2K4,PTCH1,PTMA,LATS1, POLRMT、CDK4、COL5A1、PPP6C、MECOM、DACH1、MAP2K1、MAP2K2、RQCD1、DDX3X、 NUP93、PPM1D、CHD2、CHD3、CCND1、CCND2、CCND3、ACVR1、KMT2A、KMT2B、KMT2 C、KMT2D、SIN3A、SCAF4、DICER1、FOXA2、CTNND1、MYC、MYCL、MYCN、SOX17、ARI D5B、ATR、INPPL1、INPP4B、ATF7IP、ZMYM2、ZFHX3、PDS5B、SOS1、TAF1、PIK3R 2、RPL22、RRAS2、MSH2、MSH6、CKD12、ZNF133、ZNF703、MED12、ZMYM3、GTF2I、R IT1、MGA、ABL1、BRAF、CHEK1、FANCC、JAK2、MITF、PDCD1LG2、STAT4、ABL2、CH EK2、FANCD2、JAK3、MLH1、FANCE、JUN、MPL、RICTOR、SUFU、FANCF、GID4、KAT6A 、MRE11A、PDK1、SYK、BRIP1、CRKL、FANCG、GLI1、CRLF2、FANCL、RPTOR、ALK、B TK、CSF1R、FAS、TERC、C11orf30、KDR、MUTYH、SDHA、AR、FGF10、GPR124、SDHB、ARAF, CBL, FGF14, GRIN2A, SDHC, ARFRP1, FGF19, GRM3, KLHL6, PMS2, SDHD, TNFRSF14, DAXX, FGF23, GSK3B, POLD1, TOP1, DDR2, FGF3, H3F3A, POLE, TOP2A, CCNE1, FGF4, HGF, SLIT2, CD274, FGF6, HNF1A, NFKBIA, PRDM1, DOT1L, FGFR1, LMO1, NKX2-1, PREX2, HSD3B1, LRP1B, TSHR, ATRX, CDC73, HSP90AA1, PRKCI, AURKA, PRKDC, VEGFA, AURKB, CDK12, FH, MAGI2, PRSS8, SMO, FLCN, IGF1R, SNCAIP, WISP3, AXL , CDK6, EPHB1, FLT1, IGF2, SOCS1, CDK8, IKBKE, NTRK1, BARD1, IKZF1, NTRK2, QKI, FOXL2, IL7R, MCL1, NTRK3, ERG, FOXP1, INHBA, MDM2, SPEN, ERRFI1, FRS2, MDM4, PAK3, BCL6, ESR1, IRF2, PALB2, RAF1, IRF4, MEF2B, PARK2, RANBP2, SRC, IRS2, PAX5, RARA, BLM, FANCA, JAK1, FCRL4, LIG4, MAR, PWWP3A, MUC16, MUC17, FCGBP, FAT17, MMSET, IRTA2, TTN, DST, or STAT3, and in some embodiments the oncogene is NRF2 or EGFR.
[0011] In some embodiments, the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease, and in some embodiments, the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.
[0012] In some embodiments, the CRISPR / Cas system is comprised in a ribonucleoprotein (RNP) or lipid nanoparticle (LNP) complex.
[0013] In some embodiments, one or more vectors driving expression of one or more elements of the CRISPR system are administered to the subject, in some embodiments, the one or more vectors are viral vectors, liposomes, or lipid-containing complexes, in some embodiments, the viral vector is an adenovirus, adeno-associated virus (AAV), helper-dependent adenovirus, retrovirus, or Sendai virus liposome (HVJ) complex.
[0014] In some embodiments, the solid tumor is an adenoid cystic carcinoma tumor, a biliary tract cancer tumor, a bladder cancer tumor, a bone cancer tumor, a breast cancer tumor, a cervical cancer tumor, a bile duct cancer tumor, a colon cancer tumor, an endometrial cancer tumor, an esophageal cancer tumor, a gallbladder cancer tumor, a gastric cancer tumor, a head and neck cancer tumor, a hepatocellular carcinoma tumor, a kidney cancer tumor, a lip cancer tumor, a liver cancer tumor, a melanoma tumor, a mesothelioma tumor, a non-small cell lung cancer tumor, a non-melanoma skin cancer tumor, an oral cancer tumor, an ovarian cancer tumor, a pancreatic cancer tumor, a prostate cancer tumor, a rectal cancer tumor, a renal cancer tumor, a sarcoma tumor, a small cell lung cancer tumor, a splenic cancer tumor, a thyroid cancer tumor, a urothelial carcinoma tumor, or a uterine cancer tumor.
[0015] Another aspect is a method of reducing expression of a cancer gene in cancer cells of a solid tumor, comprising introducing into the cancer cells intratumorally or peritumorally (a) one or more nucleic acid sequences encoding one or more guide RNAs (gRNAs) complementary to one or more target sequences of the cancer gene, and (b) a nucleic acid sequence encoding a CRISPR-associated endonuclease, whereby the one or more gRNAs hybridize to the cancer gene and the CRISPR-associated endonuclease cleaves the cancer gene.
[0016] In some embodiments, the one or more gRNAs comprise a trans-activating small RNA (tracrRNA) and a CRISPR RNA (crRNA).
[0017] In some embodiments, the one or more gRNAs are one or more single guide RNAs.
[0018] In some embodiments, the CRISPR-associated endonuclease is a Class 2 CRISPR-associated endonuclease, and in some embodiments, the Class 2 CRISPR-associated endonuclease is Cas9 or Cas12a.
[0019] In some embodiments, the activity of the oncogene is reduced in the cancer cells, in some embodiments, the expression or activity of the oncogene is not completely eliminated in the cancer cells, and in some embodiments, the expression or activity of the oncogene is completely eliminated in the cancer cells.
[0020] In some embodiments, the one or more nucleic acid sequences of (a) and the nucleic acid sequence of (b) are comprised in an RNP or LNP complex.
[0021] In some embodiments, one or more vectors driving expression of one or more elements of the CRISPR system are administered to the subject, in some embodiments, the one or more vectors are viral vectors, liposomes, or lipid-containing complexes, in some embodiments, the viral vector is adenovirus, AAV, helper-dependent adenovirus, retrovirus, or Sendai virus liposome (HVJ) complex.
[0022] In some embodiments, the solid tumor is an adenoid cystic carcinoma tumor, a biliary tract cancer tumor, a bladder cancer tumor, a bone cancer tumor, a breast cancer tumor, a cervical cancer tumor, a bile duct cancer tumor, a colon cancer tumor, an endometrial cancer tumor, an esophageal cancer tumor, a gallbladder cancer tumor, a gastric cancer tumor, a head and neck cancer tumor, a hepatocellular carcinoma tumor, a kidney cancer tumor, a lip cancer tumor, a liver cancer tumor, a melanoma tumor, a mesothelioma tumor, a non-small cell lung cancer tumor, a non-melanoma skin cancer tumor, an oral cancer tumor, an ovarian cancer tumor, a pancreatic cancer tumor, a prostate cancer tumor, a rectal cancer tumor, a renal cancer tumor, a sarcoma tumor, a small cell lung cancer tumor, a splenic cancer tumor, a thyroid cancer tumor, a urothelial carcinoma tumor, or a uterine cancer tumor.
[0023] Other key genes include NRF2, EGFR, EIF1AX, GNA11, SF3B1, BAP1, PBRM1, ATM, and SET D2, KDM6A, CUL3, MET, SMARCA4, U2AF1, RBM10, STK11, NF1, NF2, IDH1, IDH2. PTPN11, MAX, TCF12, HIST1H1E, LZTR1, KIT, RAC1, ARID2, BRD4, BRD7, BARF1 NRAS, RNF43, SMAD4, ARID1A, ARID1B, KRAS, APC, SMAD2, SMAD3, ACVR2A, GNA S, HRAS, STAG2, FGFR3, FGFR4, RHOA, CDKN1A, ERBB3, KANSL1, RB1, TP53, CDK N2A, CDKN2B, CDKN2C, KEAP1, CASP8, TGFBR2, HLA-B, MAPK1, NOTCH1, NOTCH2 NOTCH3, HLA-A, RASA1, EPHA2, EPHA3, EPHA5, EPHA7, NSD1, ZNF217, ZNF750 KLF5, EP300, FAT1, PTEN, FBXW7, PIK3CA, PIK3CB, PIK3C2B, PIK3CG, RUNX1 RUNX1T1, DNMT3A, SMC1A, ERBB2, AKT1, AKT2, AKT3, MAP3K1, FOXA1, BRCA1, B RCA2, CDH1, PIK3R1, PPP2R1A, BCOR, BCORL1, ARHGAP35, FGFR2, CHD4, CTCF. CTNNA1, CTNNB1, SPOP, TMSB4X, PIM1, CD70, CD79A, CD79B, B2M, CARD11, MYD 88 BTG1, BTG2, TNFAIP3, MEN1, PRKAR1A, PDGFRA, PDGFRB, SPTA1, GABRA6, KE L, SMARCB1, ZBTB7B, BCL2, BCL2L1, BCL2L2, BCL2L11, RFC1, MAP3K4, CSDE1 EPAS1, RET, LATS2, EEF2, CYLD, HUWE1, MYH9, AJUBA, FLNA, ERBB4, CNBD1, DM D, MUC6, FAM46C, FAM46D, PLCG1, PLCG2, NIPBL, FUBP1, CIC, ZBTB2, ZBTB20. ZCCHC12, TGIF1, SOX2, SOX9, SOX10, PCBP1, ZFP36L2, TCF7L2, AMER1, KDM5A.<h2 style=";text-align:left;direction:ltr">KDM5C、MTOR、VHL、KIF1A、TCEB1、TXNIP、CUL1、TSC1、ELF3、RHOB、PSIP1、SF1 、FOXQ1、GNA13、DIAPH2、ZFP36L1、ERCC2、SPTAN1、RXRA、ASXL2、CREBBP、CREB 3L3、ALB、DHX9、XPO1、RPS6KA3、IL6ST、TSC2、EEF1A1、WHSC1、APOB、NUP133、 AXIN1、PHF6、TET2、WT1、FLT3、FLT4、SMC3、CEBPA、RAD21、RAD50、RAD51、PTPD C1、ASXL1、EZH2、NPM1、SRSF2、GNAQ、PLCB4、CYSLTR2、CDKN1B、CBFB、NCOR1、 PTPRD、TBX3、GPS2、GATA1、GATA2、GATA3、GATA4、GATA6、MAP2K4、PTCH1、PTMA 、LATS1、POLRMT、CDK4、COL5A1、PPP6C、MECOM、DACH1、MAP2K1、MAP2K2、RQCD 1、DDX3X、NUP93、PPM1D、CHD2、CHD3、CCND1、CCND2、CCND3、ACVR1、KMT2A、KMT 2B、KMT2C、KMT2D、SIN3A、SCAF4、DICER1、FOXA2、CTNND1、MYC、MYCL、MYCN、S OX17、ARID5B、ATR、INPPL1、INPP4B、ATF7IP、ZMYM2、ZFHX3、PDS5B、SOS1、TAF 1, PIK3R2, RPL22, RRAS2, MSH2, MSH6, CKD12, ZNF133, ZNF703, MED12, ZMYM3, GTF2I, RIT1, MGA, ABL1, BRAF, CHEK1, FANCC, JAK2, MITF, PDCD1LG2, STAT4, ABL2、CHEK2、FANCD2、JAK3、MLH1、FANCE、JUN、MPL、RICTOR、SUFU、FANCF、GI D4、KAT6A、MRE11A、PDK1、SYK、BRIP1、CRKL、FANCG、GLI1、CRLF2、FANCL、RPTO R, ALK, BTK, CSF1R, FAS, TERC, C11orf30, KDR, MUTYH, SDHA, AR, FGF10, GPR124, SDHB, ARAF, CBL, FGF14, GRIN2A, SDHC, ARFRP1, FGF19, GRM3, KLHL6, PMS2SDHD, TNFRSF14, DAXX, FGF23, GSK3B, POLD1, TOP1, DDR2, FGF3, H3F3A, POLE, TOP2A, CCNE1, FGF4, HGF, SLIT2, CD274, FGF6, HNF1A, NFKBIA, PRDM1, DOT1L, FGFR1, LMO1, NKX2-1, PREX2 , HSD3B1, LRP1B, TSHR, ATRX, CDC73, HSP90AA1, PRKCI, AURKA, PRKDC, VEGFA, AURKB, CDK12, FH, MAGI2, PRSS8, SMO, FLCN, IGF1R, SNCAIP, WISP3, AXL, CDK6, EPHB1, FLT1, IGF2, SOCS1, CDK8, IKBKE, NTRK1, BARD1, IKZF1, NTRK2, QKI, FOXL2, IL7R, MCL1, NTRK3, ERG, FOXP1, INHBA, MDM2, SPEN, ERRFI1, FRS2, MDM4, PAK3, BCL6, ESR1, IRF2, PALB2, RAF1, IRF4, MEF2B, PARK2, RANBP2, SRC, IRS2, PAX5, RARA, BLM, FANCA, JAK1, FCRL4, LIG4, MAR, PWWP3A, MUC16, MUC17, FCGBP, FAT17, MMSET, IRTA2, TTN, DST, or STAT3, and in some embodiments, the oncogene is NRF2 or EGFR.
[0024] In some embodiments, intratumoral or peritumoral delivery of the CRISPR / Cas system results in at least about a 20% reduction in tumor size compared to an untreated tumor.
[0025] In some embodiments, intratumoral or peritumoral delivery of the CRISPR / Cas system results in at least about 20% inhibition of tumor growth compared to untreated tumors.
[0026] In some embodiments, the method further includes administering one or more chemotherapeutic agents to the subject, and in some embodiments, intratumoral or peritumoral delivery of the CRISPR / Cas system reduces the amount of the one or more chemotherapeutic agents administered to the subject compared to a subject not administered the CRISPR / Cas system.
[0027] Other objects and advantages will become apparent to those skilled in the art from the detailed description which follows. [Brief description of the drawings]
[0028] [Figure 1] FIG. 1 shows an exemplary NRF2 R34G sgRNA adenoviral vector construct for evaluating different sgRNA copy numbers and dual vector systems. [Diagram 2] FIG. 13 shows indel formation rates after adenoviral vector-mediated gene editing in lung cancer cell lines C26-8 and C44-25 treated with NRF2 R34G sgRNA. [Diagram 3] Figure 1 shows the transduction efficiency of AAV and adenovirus in lung cancer cells compared by GFP expression. The numbers in the upper right corner of the scale bar indicate the percentage of GFP-positive cells, and the numbers in the left corner of each image indicate the mean fluorescence intensity (MFI) of GFP. [Figure 4] FIG. 13 shows a comparison of AAV6 and adenovirus for Cas9 expression in lung cancer cells as demonstrated by the editing effect of NRF2 R34G gRNA. [Diagram 5] Intratumoral injection of LNPs resulted in high luciferase expression in tumor samples with minimal biodistribution. qPCR analysis of luciferase expression normalized to Gapdh in tissues from LNP-injected NCG mice (n=5 per LNP). Error bars indicate ± standard deviation. [Figure 6A] Bioluminescence imaging of athymic nude mice shows expression of luciferase in the area of intratumoral injection 4 and 24 hours after A. In vivo imaging of athymic nude mice injected with LNPs at 4 and 24 hours. [Figure 6B] B. Quantification of in vivo imaging at 4 and 24 hours. [Figure 7]Diagram of intratumoral delivery of adenoviral vector (fLuc) in H1703 44-25 subcutaneous xenograft model. Mice were injected intratumorally with Ad-CMV-fLuc and imaged 1-16 days after injection. Bioluminescence signals from each tumor were quantified by setting ROIs, and each value listed is total photon flux. Scale bars are representative values for each image to the left of the bar. [Figure 8] Schematic diagram of the NRF2-targeting CRISPR / Cas9 adenoviral vector. The diagram depicts the U6 promoter driving the R34G-targeting sgRNA expression followed by the chicken beta-actin (CAG) promoter driving enhanced SpCas9 expression. [Figure 9] Representative images of Cas9 immunostaining of H1703 44-25 derived tumors. The two left panels show the same tumor section of an adenovirus-treated tumor at two magnifications, 5x and 20x. The scale bars represent 200 μm and 50 μm, respectively. The two right panels show the same tumor section of an untreated tumor at two magnifications, 2.5x and 20x. The scale bars represent 500 μm and 50 μm, respectively. [Figure 10] Representative images of Cas9 immunostaining of PDX-derived tumors. The two left panels show the same tumor section of an adenovirus-treated tumor at two magnifications, 5x and 20x. Scale bars represent 200 μm and 50 μm, respectively. The two right panels show the same tumor section of an untreated tumor at two magnifications, 2.5x and 20x. Scale bars represent 500 μm and 50 μm, respectively. [Figure 11]Schematic diagram of CRISPR / Cas9 adenoviral vector targeting NRF2. A) Diagram depicts U6, H1, and 7SK promoters driving R34G targeting sgRNA (SEQ ID NO: 25) expression followed by chicken beta actin (CAG) promoter driving enhanced SpCas9 expression. B) Diagram depicts U6, H1, and 7SK promoters driving scramble targeting sgRNA (SEQ ID NO: 26) expression followed by chicken beta actin (CAG) promoter driving enhanced SpCas9 expression. [Figure 12] CRISPR / Cas9 adenoviral delivery in combination with chemotherapy inhibits tumor growth in a xenograft model. Graph shows tumor growth over 22 days in NRF2-targeted or scramble-targeted mice. Mice were injected intratumorally with 3.6e9 pfu of Ad-U6H17SK-R34G-CAG-eSpCas9 or U6H17SK-scrambled-CAG-eSpCas9 on days 0, 2, and 7, as indicated by a ^ on the x-axis. All mice received 12.5 mg / kg carboplatin and 5 mg / kg paclitaxel intravenously on days 3 and 10, as indicated by an * on the x-axis. [Figure 13] Genomic analysis of NRF2-targeted tumor tissues in xenograft mouse models. A) A single injection of 3.6e9 pfu of Ad-U6-R34G-CAG-eSpCas9 was delivered intratumorally in a patient-derived xenograft model. B) Two injections of 3.6e9 pfu of Ad-U6H17SK-R34G-CAG-eSpCas9 were delivered intratumorally in a H1703 44-25 xenograft model. C) Three injections of 3.6e9 pfu of Ad-U6H17SK-R34G-CAG-eSpCas9 were delivered intratumorally in a H1703 44-25 xenograft model. Tumor tissues from each mouse model were excised and analyzed by PCR and Sanger sequencing. [Figure 14]Figure 1. Intratumoral delivery of luciferase-containing lipid nanoparticles in H1703 44-25 subcutaneous xenograft model. Mice were injected intratumorally with lipid nanoparticles and imaged 4 and 24 hours after injection. Bioluminescence signal from each tumor was quantified by setting ROIs, and each value listed is total photon flux. Scale is representative of all images. [Figure 15] Figure 1. Intratumoral delivery of luciferase-containing lipid nanoparticles in a patient-derived xenograft model. Mice were injected intratumorally with lipid nanoparticles and imaged 4 and 24 hours after injection. Bioluminescence signal from each tumor was quantified by setting ROIs, and values reported are total photon flux. Scale is representative of all images. [Figure 16] Figure 1. Intratumoral delivery of luciferase-containing lipid nanoparticles in a patient-derived xenograft model. Mice were injected intratumorally with lipid nanoparticles and imaged 4 and 24 hours after injection. Bioluminescence signal from each tumor was quantified by setting ROIs, and values reported are total photon flux. Scale is representative of all images. [Figure 17] Figure 1 shows in vivo AAV tropism assessment of luciferase gene-containing AAV5 and AAV6 in mice implanted with H1703 squamous non-small cell lung cancer cells. The representative median animal was selected as the animal with the light flux value closest to the median of all surviving animals at the last time point when at least 50% of the animals remained in the group. [Figure 18] FIG. 1 shows tumor volume (mm3) and in vivo bioluminescence (luminous flux, photons / sec) over time in representative mice implanted with H1703 squamous non-small cell lung cancer cells and treated intratumorally with AAV6 containing the luciferase gene. [Figure 19]Figure 1 shows the biodistribution of luciferase gene-containing AAV6 (AAV6-fLuc) injected into the tumors of mice implanted with H1703 squamous non-small cell lung cancer cells. Ex vivo bioluminescence was measured on day 21. Animals were implanted with 5x106 H1703 cells subcutaneously. After the tumor volume reached 60mm3 or more, AAV6-fLuc was directly injected into the tumors, and luciferase expression was observed by ex vivo imaging of isolated tissues. Data are shown without scale. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0029] Applicant specifically incorporates the entire contents of all references cited in this disclosure. Furthermore, when an amount, concentration, or other value or parameter is given as either a range or a list of upper and lower values, this is to be understood as specifically disclosing all ranges formed from any pairing of any upper range limit or value with any lower range limit or value, regardless of whether the ranges are separately disclosed. When a range of numerical values is recited herein, unless otherwise specified, the range is intended to include its endpoints, as well as all integers and fractions within the range. When a range is defined, it is not intended that the scope of the present disclosure be limited to the specific values recited.
[0030] definition In this disclosure, a number of terms and abbreviations are used. The following definitions are provided:
[0031] As used herein, the terms "about" or "approximately" mean within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or less of a given value or range.
[0032] The term "comprising" is intended to include embodiments encompassed by the terms "consisting essentially of" and "consisting of." Similarly, the term "consisting essentially of" is intended to include embodiments encompassed by the term "consisting of."
[0033] The indefinite articles "a" and "an," as used herein, should be understood to mean "at least one," unless the specification and claims clearly indicate otherwise.
[0034] The phrase "and / or," as used herein, should be understood in the specification and claims to mean "either or both" of the elements connected thereby, i.e., elements that are conjunctive in some cases and elements that are disjunctive in other cases. Other elements, whether related or unrelated to those elements specifically associated, may optionally be present other than the elements specifically associated with the "and / or" clause, unless expressly indicated otherwise. Thus, as a non-limiting example, a reference to "A and / or B," when used with open-ended language such as "comprising," can refer to, in one embodiment, including A but not including B (optionally including elements other than B); in another embodiment, including B but not including A (optionally including elements other than A); in yet another embodiment, both A and B (optionally including other elements), etc.
[0035] As used herein, in the specification and claims, "or" shall be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be construed as inclusive, i.e., including not only at least one of a number or list of elements, but more than one of them, and optionally additional unlisted items. Only terms clearly indicated otherwise, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," shall refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or," as used herein, shall be construed as indicating exclusive alternatives (i.e., "one or the other, but not both") only when followed by terms with exclusivity, such as "any of," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0036] An "endonuclease" is an enzyme that cleaves phosphodiester bonds in a polynucleotide chain. In some embodiments, the endonuclease generates a double-stranded break at a desired location in the genome, and in some embodiments, the endonuclease generates a single-stranded break or "nick" or break on one strand of the DNA phosphate sugar backbone at a desired location in the genome, in some embodiments, without generating undesired off-target DNA strand breaks. The endonuclease may be a naturally occurring endonuclease or may be artificially generated.
[0037] A "clustered regularly interspaced short palindromic repeats (CRISPR) associated endonuclease protein binding domain" or "Cas binding domain" refers to a nucleic acid element or domain within a nucleic acid sequence or polynucleotide sequence that binds to or has affinity for one or more CRISPR associated endonucleases (or functional fragments thereof) in an effective amount. In some embodiments, in the presence of one or more proteins (or functional fragments thereof) and a target sequence, the one or more proteins and nucleic acid elements may form a biologically active CRISPR complex and / or be enzymatically active at the target sequence. In some embodiments, the CRISPR associated endonuclease is a class 1 or class 2 CRISPR associated endonuclease, and in some embodiments, is a Cas9 or Cas12a endonuclease. The Cas9 endonuclease may have a nucleotide sequence identical to that of wild-type Streptococcus pyogenes. In some embodiments, the CRISPR-associated endonuclease may be a sequence from other species, such as other Streptococcus species, such as Streptococcus thermophilus; Pseudomonas aeruginosa, Escherichia coli, or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms. Such species include Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomycetes spp., Alicycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, and Actinobacillus spp.smithii, Bacillus thuringiensis, Bacteroides spp., Blastopyrellula marina, Bradyrhizobium spp., Brevibacillus laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheriae diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, Gammaproteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae kingae, Lactobacillus crispatus, Listeria ivanoviiivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria spp., Neisseria wadsworthii, Nitrosomonas spp., Parvibaculum labamentivorans lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodoblum spp., Simonsiella muelleri, Sphingomonas spp., Sporolactobacillus vineae, Staphylococcus aureus, Staphylococcus lugdunensis, Streptococcus spp., Subdoligranulum spp., Tistrella mobilis, Treponema spp., and Verminephrobacter eisenii. eiseniae) (or a functional fragment or variant of any of the foregoing sequences having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing Cas9 endonucleases). In some embodiments, the CRISPR-associated endonuclease may be a Cas12a nuclease. Cas12a nuclease is a nuclease that is isolated from wild-type Prevotella, Francisella, Acidaminococcus, Proteocatella, Sulfurimonas, Elizabethkingia, Methylococcales, Moraxella, Helcococcus, Lachnospira, Limihaloglobus, Butyrivibrio, Methanomethylophilus, Coprococcus, Synergistes,Eubacterium, Roseburia, Bacteroidales, Ruminococcus, Eubacteriaceae, Leptospira, Parabacteriodes, Gracilibacteria, Lachnospiraceae, Clostridium ), Brumimicrobium, Fibrobacter, Catenovulum, Acinetobacter, Flavobacterium, Succiniclasticum, Pseudobutyrivibrio, Barnesiella, Sneathia, Succinibrionaceae cinivibrionaceae, Treponema, Sedimentisphaera, Thiomicrospira, Eucomonympha, Arcobacter, Oribacterium, Methanoplasma, Porphyromonas, Succinovibrio, or or a nucleotide sequence identical to that of Anaerovibrio (or a functional fragment or variant of any of the foregoing sequences having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing Cas12a endonucleases).
[0038] In some embodiments, the term "(CRISPR) associated endonuclease protein binding domain" or "Cas binding domain" refers to a nucleic acid element or domain (e.g., and RNA element or domain) within a nucleic acid sequence that binds to or has affinity for one or more CRISPR-associated endonucleases (or a functional fragment or variant thereof that is at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to a CRISPR-associated endonuclease) in an effective amount. In some embodiments, the Cas binding domain is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 , 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 nucleotides or less, and comprises at least one sequence capable of forming a hairpin or duplex that partially associates with or binds to a biologically active CRISPR-associated endonuclease at a concentration and in a microenvironment suitable for formation of a CRISPR system.
[0039] A "clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system guide RNA" or "CRISPR-Cas system guide RNA" may contain a transcription terminator domain. The term "transcription terminator domain" refers to a nucleic acid element or domain within a nucleic acid sequence (or polynucleotide sequence) that, in an effective amount, prevents transcription in bacteria when the CRISPR complex is in the bacterial species and / or creates a secondary structure that stabilizes the association of the nucleic acid sequence to one or more Cas proteins (or functional fragments thereof) such that in the presence of one or more proteins (or functional fragments thereof), one or more Cas proteins and the nucleic acid element form a biologically active CRISPR complex and / or in the presence of such target sequence and DNA binding domain, can be enzymatically active at the target sequence. In some embodiments, the transcription terminator domain is at least about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109 ...0, 100, 100, 100, 100, 100, 101, 102, 103, 104, 105, 106, 107, 108, 1 8, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 11 0, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 nucleotides or less, and comprises at least one sequence capable of forming a hairpin or duplex that, in part, promotes association of a nucleic acid sequence (sgRNA, crRNA with tracrRNA, or other nucleic acid sequence) into a biologically active CRISPR complex at a concentration and microenvironment suitable for CRISPR complex formation.
[0040] The term "DNA binding domain" refers to a nucleic acid element or domain in a nucleic acid sequence (e.g., guide RNA) that is complementary to a target sequence. In some embodiments, the DNA binding domain binds to or has affinity for a target sequence such that in the presence of a biologically active CRISPR complex, one or more Cas proteins can be enzymatically active at the target sequence. In some embodiments, the DNA binding domain comprises at least one sequence that can form Watson-Crick base pairs with the target sequence as part of a biologically active CRISPR system at a concentration and microenvironment suitable for CRISPR system formation.
[0041] "CRISPR system" or "CRISPR / Ca" collectively refers to transcripts or synthetically produced transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding Cas genes, tracr (transactivating CRISPR) sequences (e.g., tracrRNA or active partial tracrRNA), tracr-mate sequences (including "direct repeats" and tracrRNA-processed partial direct repeats in the context of endogenous CRISPR systems), guide sequences (also referred to as "spacers" in the context of endogenous CRISPR systems), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of the CRISPR system are derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a particular organism that contains an endogenous CRISPR system. Generally, CRISPR systems feature elements (also referred to as protospacers in the context of endogenous CRISPR systems) that promote the formation of a CRISPR complex at the site of a target sequence. In the context of CRISPR complex formation, a "target sequence" refers to a nucleic acid sequence to which a guide sequence is designed to have complementarity, where hybridization of the target sequence with the guide sequence promotes the formation of a CRISPR complex.
[0042] The target sequence may comprise any polynucleotide, such as a DNA or RNA polynucleotide. In some embodiments, the target sequence is a DNA polynucleotide and is referred to as a DNA target sequence. In some embodiments, the target sequence comprises at least three nucleic acid sequences that are recognized by the Cas-protein when the Cas protein associates with a CRISPR complex or a system comprising at least one sgRNA or one tracrRNA / crRNA duplex, in a concentration and microenvironment suitable for the association of such systems. In some embodiments, the target DNA comprises at least one, or more, protospacer adjacent motifs, the sequence of which is known in the art and depends on the Cas protein system used with the sgRNA or crRNA / tracrRNA employed in this study. In some embodiments, the target DNA comprises NNG, where G is guanine and N is any naturally occurring nucleic acid. In some embodiments, the target DNA comprises any one or combination of NNG, NNA, GAA, NGGNG, NGRRT, NGRRN, NNNNGATT, NNNNRYAC, NNAGAAW, TTTV, YG, TTTN, YTN, NGCG, NGAG, NGAN, NGNG, NG, NNGRRT, TYCV, TATV, or NAAAAC. In some embodiments, the target sequence is located in the nucleus or cytoplasm of a cell.
[0043] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to the target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands at or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more base pairs from the target sequence). Without wishing to be limited by theory, the tracr sequence may be a sequence that is a portion of or is similar to the wild-type tracr sequence (e.g., about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 109, 109, 109, 102, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119 The tracr sequence may comprise or consist of at least 6, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more nucleotides, or more, and may form part of a CRISPR complex, for example, by hybridization to all or a portion of a tracr mate sequence operably linked to a guide sequence, along at least a portion of the tracr sequence. In some embodiments, the tracr sequence has sufficient complementarity to the tracr mate sequence to hybridize and participate in the formation of a CRISPR complex. Similarly, perfect complementarity may not be required for the target sequence, as long as it is sufficient to be functional (to bind to a Cas protein or a functional fragment thereof).In some embodiments, the tracr sequence has at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence complementarity along the length of the tracr mate sequence when optimally aligned. In some embodiments, one or more vectors facilitating the expression of one or more elements of the CRISPR system are introduced into a host cell such that the presence and / or expression of the elements of the CRISPR system directs the formation of a CRISPR complex at one or more target sites. For example, the Cas enzyme, the guide sequence linked to the tracr-mate sequence, and the tracr sequence may each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements may be combined into a single vector, with one or more additional vectors providing any elements of the CRISPR system not included in the first vector. In some embodiments, with at least some of the modifications contemplated by this disclosure, the guide sequence or the RNA or DNA sequences forming the CRISPR complex are at least partially synthetic. The CRISPR system elements combined into a single vector may be aligned in any suitable orientation, for example, one element is positioned 5' to the second element ("upstream" of the second element) or 3' to the second element ("downstream" of the second element). In some embodiments, the present disclosure relates to compositions comprising a chemically synthesized guide sequence, hi some embodiments, the chemically synthesized guide sequence is used in conjunction with a vector that includes a coding sequence encoding a CRISPR enzyme, such as a class 2 Cas9 or Cas12a protein.In some embodiments, the chemically synthesized guide sequence is used with one or more vectors, each vector containing a coding sequence encoding a CRISPR enzyme, such as a class 2 Cas9 or Cas12a protein. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of the second element, and may be oriented in the same or opposite direction. In some embodiments, a single promoter drives expression of a transcript encoding the CRISPR enzyme, as well as one or more additional (second, third, fourth, etc.) guide sequences, a tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, one or more additional guide sequences, the tracr mate sequence, and the tracr sequence are each elements of a different nucleic acid sequence. For example, in the case of tracr and tracr mate sequences, in some embodiments, the present disclosure relates to compositions comprising at least a first and a second nucleic acid sequence, where the first nucleic acid sequence comprises a tracr sequence and the second nucleic acid sequence comprises a tracr mate sequence, and the first and second nucleic acids of the duplex further comprise a DNA targeting domain, a Cas protein binding domain, and a transcription terminator domain, respectively, individually or collectively, where the first nucleic acid sequence is at least partially complementary to the second nucleic acid sequence. In some embodiments, the CRISPR enzyme, one or more additional guide sequences, the tracr mate sequence, and the tracr sequence are operably linked to and expressed from the same promoter. In some embodiments, the present disclosure relates to compositions comprising any one or combination of the disclosed domains, with or without the disclosed modifications, on one guide sequence or two separate tracrRNA / crRNA sequences.Any method disclosed herein also relates to the use of tracrRNA / crRNA sequences that are interchangeable with the use of guide sequences, such that a composition may comprise a single synthetic guide sequence and / or synthetic tracrRNA / crRNA with any one or combination of modified domains disclosed herein.
[0044] In some embodiments, the guide RNA may be a short synthetic chimeric tracrRNA / crRNA ("single guide RNA" or "sgRNA"). The guide RNA may also comprise two short synthetic tracrRNA / crRNA ("dual guide RNA" or "dgRNA").
[0045] As used herein, the term "homologous" or "homologous gene" or "ortholog" refers to related sequences that share a common ancestor or family member, determined based on the degree of sequence identity. The terms "homology", "homologous", "substantially similar", and "substantially corresponding" are used interchangeably herein. These terms refer to nucleic acid fragments in which changes in one or more nucleotide bases do not affect the ability of the nucleic acid fragment to mediate gene expression or produce a particular phenotype. These terms also refer to modifications of the nucleic acid fragments of the present disclosure, such as deletion or insertion of one or more nucleotides, that do not substantially change the functional properties of the resulting nucleic acid fragment compared to the original unmodified fragment. In some embodiments, these terms describe the relationship between a gene found in one species, subspecies, variety, cultivar, or lineage (strain) and a corresponding or equivalent gene in another species, subspecies, variety, cultivar, or lineage (strain). Homology can be determined using software programs readily available in the art, such as those discussed in Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987) Supplement 30, Section 7.718, Table 7.71. Some alignment programs are MacVector (Oxford Molecular Ltd, Oxford, UK), ALIGN Plus (Scientific and Educational Software, Pennsylvania), AlignX (Vector NTI, Invitrogen, Carlsbad, Calif.), and Sequencher (Gene Codes, Ann Arbor, Mich.).
[0046] "Hybridizable," "complementary," or "substantially complementary" means that a nucleic acid (e.g., RNA, DNA) contains a nucleotide sequence that allows it to non-covalently bind, i.e., form Watson-Crick base pairs and / or G / U base pairs (i.e., a nucleic acid specifically binds to a complementary nucleic acid), and "anneal" or "hybridize" to another nucleic acid in a sequence-specific, antiparallel manner under appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base pairing includes adenine (A) and thymidine (T), adenine (A) and uracil (U), and guanine (G) and cytosine (C). Additionally, in the case of hybridization between two RNA molecules (e.g., dsRNA) and hybridization between DNA and RNA molecules (e.g., when an ssRNA target nucleic acid base pairs with a DNA PAMmer, when a DNA target nucleic acid base pairs with an RNA guide nucleic acid, etc.), guanine (G) can also base pair with uracil (U). For example, G / U base pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of codons in mRNA and tRNA anticodon base pairing. Thus, a guanine (G) (e.g., a guanine in the protein binding segment (dsRNA duplex) of a subject guide nucleic acid molecule, a target nucleic acid that base pairs with a guide nucleic acid, and / or a PAMmer, etc.) is considered to be complementary to both uracil (U) and adenine (A). For example, when a G / U base pair can be formed at a given nucleotide position in the protein binding segment (e.g., dsRNA duplex) of a subject guide nucleic acid molecule, the position is not considered to be non-complementary, but instead is considered to be complementary.
[0047] Hybridization and washing conditions are well known and are exemplified in Sambrook J., Fritsch. EF and Maniatis, T. Molecular Cloning: A Laboratory Manual, Second Edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor (1989), especially Chapter 11 and Table 11.1 therein; and Sambrook. J. and Russell, W., Molecular Cloning: A Laboratory Manual, Third Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001). The conditions of temperature and ionic strength determine the "stringency" of hybridization.
[0048] Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, which are variables well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the melting temperature (Tm) value of hybrids of nucleic acids having those sequences. In hybridization between nucleic acids having short stretches of complementarity (e.g., complementarity over 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18 or fewer nucleotides), the position of mismatches can be important (see Sambrook et al., supra, 11.7-11.8). Typically, the length of a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides or more). The temperature and salt concentration of the washing solution can be appropriately adjusted depending on the length of the complementary region, the degree of complementarity, and the like.
[0049] Examples of stringent hybridization conditions include: an incubation temperature of about 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, or 37°C; a hybridization buffer concentration of about 6xSSC, 7xSSC, 8xSSC, 9xSSC, or 10xSSC; a formamide concentration of about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25%; and a wash solution of about 4xSSC, 5xSSC, 6xSSC, 7xSSC, 8xSSC. Examples of moderate hybridization conditions include: an incubation temperature of about 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, or 50°C; a buffer concentration of about 9xSSC, 8xSSC, 7xSSC, 6xSSC, 5xSSC, 4xSSC, 3xSSC, or 2xSSC; a formamide concentration of about 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50%; and a wash solution of about 5xSSC, 4xSSC, 3xSSC, or 2xSSC.Examples of high stringency conditions include: an incubation temperature of about 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, or 68%; about 1×SSC, 0. buffer concentrations of 95xSSC, 0.9xSSC, 0.85xSSC, 0.8xSSC, 0.75xSSC, 0.7xSSC, 0.65xSSC, 0.6xSSC, 0.55xSSC, 0.5xSSC, 0.45xSSC, 0.4xSSC, 0.35xSSC, 0.3xSSC, 0.25xSSC, 0.2xSSC, 0.15xSSC, or 0.1xSSC; formamide concentrations of about 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%; and about 1xSSC, 0.95xSSC, 0. Washing solutions of 9xSSC, 0.85xSSC, 0.8xSSC, 0.75xSSC, 0.7xSSC, 0.65xSSC, 0.6xSSC, 0.55xSSC, 0.5xSSC, 0.45xSSC, 0.4xSSC, 0.35xSSC, 0.3xSSC, 0.25xSSC, 0.2xSSC, 0.15xSSC, or 0.1xSSC, or deionized water. Typically, hybridization incubation times range from 5 minutes to 24 hours with one, two, or more wash steps, and wash incubation times are about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 minutes or more. It is understood that equivalents of SSC with other buffer systems can be employed.
[0050] It is understood that the sequence of a polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable or hybridizable. Furthermore, a polynucleotide can hybridize in one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop or hairpin structure). The polynucleotides hybridize to a target region within the target nucleic acid sequence at about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%. It may comprise 1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% (i.e., full complementarity) sequence complementarity. For example, an antisense nucleic acid in which 18 of the 20 nucleotides of an antisense compound are complementary to a target region and thus specifically hybridize would exhibit 90% complementarity. In this example, the remaining non-complementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous with each other or with complementary nucleotides. The percent complementarity between specific stretches of nucleic acid sequences within a nucleic acid can be determined using any convenient method.Exemplary methods include using the BLAST program (Basic Local Alignment Search Tool) and PowerBLAST program (Altschul et al., J. Mol. Biol. 215:403-10 (1990); Zhang et al., Genome Res., 7:649-56 (1997)), or the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using default settings using the algorithm of Smith et al. (Adv. Appl. Math. 2:482-89 (1981)).
[0051] The term "intratumoral" as used herein refers to delivery or transport of the CRISPR / Cas system into a tumor. One example of intratumoral delivery or transport of the CRISPR / Cas system as described herein is by intratumoral administration, which is a route of administration commonly known in the art. As an alternative route of intratumoral administration, the CRISPR / Cas system can be delivered to the tumor via a tumor-specific carrier, such as an oncolytic virus or a gene therapy vector, which have been widely developed to deliver gene sequences to tumors. In some embodiments, delivery or transport to a tumor may include delivery or transport of the CRISPR / Cas system at the periphery of a solid tumor ("peritumor"), such as when the amount of the CRISPR / Cas system is too large to be delivered or transported entirely directly to the solid tumor, or when tumor treatment may be more effectively achieved by delivery or transport of the CRISPR / Cas system to the periphery of the tumor, or generally anywhere within a zone of about 2.5 cm thickness surrounding the edge of the tumor (e.g., within an organ, e.g., brain, lung, liver, bladder, kidney, stomach, intestine, breast, pancreas, prostate, ovary, esophagus, spleen, thyroid). Multiple injections into separate areas of the tumor or cancer are also included. Additionally, intratumoral administration includes delivery of the composition to one or more metastatic foci.
[0052] As used herein, a "solid tumor" is an abnormal mass of tissue that usually does not contain cysts or fluid. Solid tumors may be benign or malignant. Various types of solid tumors are named for the type of cells that form them. In some embodiments, the solid tumor is an adenoid cystic carcinoma tumor, a biliary tract cancer tumor, a bladder cancer tumor, a bone cancer tumor, a breast cancer tumor, a cervical cancer tumor, a cholangiocarcinoma tumor, a colon cancer tumor, an endometrial cancer tumor, an esophageal cancer tumor, a gallbladder cancer tumor, a gastric cancer tumor, a head and neck cancer tumor, a hepatocellular carcinoma tumor, a kidney cancer tumor, a lip cancer tumor, a liver cancer tumor, a melanoma tumor, a mesothelioma tumor, a non-small cell lung cancer tumor, a non-melanoma skin cancer tumor, an oral cancer tumor, an ovarian cancer tumor, a pancreatic cancer tumor, a prostate cancer tumor, a rectal cancer tumor, a renal cancer tumor, a sarcoma tumor, a small cell lung cancer tumor, a splenic cancer tumor, a thyroid cancer tumor, a urothelial carcinoma tumor, or a uterine carcinoma tumor. In some embodiments, the solid tumor is a benign tumor and the subject has cancer elsewhere in the body. In some embodiments, the solid tumor is a malignant solid tumor. In some embodiments, the malignant solid tumor is the only cancer in the subject's body. In other embodiments, the subject has a malignant solid tumor and cancer in another area of the body.
[0053] A "variant," "mutant," or "mutated" polynucleotide, as used herein, contains at least one polynucleotide sequence alteration when compared to the polynucleotide sequence of a corresponding wild-type or parent polynucleotide.
[0054] "Chemotherapeutic agent" refers to a drug used for the treatment of cancer. Chemotherapeutic agents include, but are not limited to, small molecules, hormones and hormone analogs, and biologics (e.g., antibodies, peptide drugs, nucleic acid drugs). In certain embodiments, chemotherapy does not include hormones and hormone analogs.
[0055] CRISPR / endonuclease CRISPR / endonuclease (e.g., CRISPR / Cas9) systems are known in the art and described, for example, in U.S. Patent No. 9,925,248, the entirety of which is incorporated herein by reference. CRISPR-directed gene editing can identify and perform DNA cleavage at specific sites in chromosomes with surprisingly high efficiency and precision. The natural activity of CRISPR / Cas9 is to disable viral genomes that infect bacterial cells. Subsequent genetic reconstitution of CRISPR / Cas function in human cells offers the possibility of disabling human genes with remarkable frequency.
[0056] In bacteria, CRISPR / Cas loci encode an RNA-guided adaptive immune system against mobile genetic elements (viruses, transposable elements and conjugative plasmids). Three types (I-III) of CRISPR systems have been identified. CRISPR clusters contain a spacer, a sequence complementary to the preceding mobile element. CRISPR clusters are transcribed and processed into mature CRISPR (clustered regularly interspaced short palindromic repeats) RNA (crRNA) that contains a DNA-binding region (spacer) complementary to the target gene.
[0057] The compositions described herein may comprise a nucleic acid encoding a CRISPR-associated endonuclease. The CRISPR-associated endonuclease may be, for example, a class 1 CRISPR-associated endonuclease or a class 2 CRISPR-associated endonuclease. Class 1 CRISPR-associated endonuclease includes type I, type III, and type IV CRISPR-Cas systems, which have effector molecules that include multiple subunits. For Class 1 CRISPR-associated endonucleases, the effector molecules may, in some embodiments, include Cas7 and Cas5, as well as, in some embodiments, SS(Cas11) and Cas8a1; Cas8b1; Cas8c; Cas8u2 and Cas6; Cas3" and Cas10d; CasSS(Cas11), Cas8e, and Cas6; Cas8f and Cas6f; Cas6f; Cas8-like (Csf1); SS(Cas11) and Cas8-like (Csf1); or SS(Cas11) and Cas10. Class 1 The CRISPR-associated endonuclease may also, in some embodiments, be associated with a target cleavage molecule, which may be Cas3 (Type I) or Cas10 (Type III), and may also be associated with a spacer gain molecule, such as Cas1, Cas2, and / or Cas4. See, e.g., Koonin et al., Curr. Opin. Microbiol. 37:67-78 (2017); Strich et al., J. Clin. Microbiol. 57:1307-18 (2019).
[0058] Class 2 CRISPR-associated endonucleases include Type I, Type V, and Type VI CRISPR-Cas systems, which have a single effector molecule. For Class 2 CRISPR-associated endonucleases, the effector molecule may, in some embodiments, be Cas9, Cas12a (cpf1), Cas12b1 (c2c1), Cas12b2, Cas12c (c2c3), Cas12d (CasY), Cas12e (CasX), Cas12f1 (Cas14a), Cas12f2 (Cas14b), Cas12f3 (Cas14c), Cas12g, Cas12h, Cas12i, Cas12k (c2c5), Cas12j, or any combination thereof. (Casφ), Cas13a(c2c2), Cas13b1(c2c6), Cas13b2(c2c6), Cas13c(c2c7), Cas13d, c2c4, c2c8, c2c9, and / or c2c10. See, e.g., Koonin et al., Curr. Opin. Microbiol. 37:67-78 (2017); Strich et al., J. Clin. Microbiol. 57:1307-18 (2019); Makarova et al., Nat. Rev. Microbiol. 18:67-83 (2020); Pausch et al., Science 369:333-37 (2020).
[0059] In some embodiments, the CRISPR-associated endonuclease may be a Cas9 nuclease. The Cas9 nuclease may have a nucleotide sequence identical to a wild-type Streptococcus pyogenes sequence. In some embodiments, the CRISPR-associated endonuclease may be a sequence from other species of Streptococcus species, such as Streptococcus thermophilus; Pseudomonas aeruginosa, Escherichia coli, or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms.Such species include Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces spp., Alicycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides spp., Blastopyrella marina, Brazilirhizobium spp., Brevibacillus laterosporus, Campylobacter coli, Campylobacter truncatula, jejuni, Campylobacter lari, Candidatus puniseispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium acorense, Corynebacterium diphtheriae, Corynebacterium maturschotti, Dinosariocephalus shibae, Eubacterium doricum, Gammaproteobacteria, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputrum, Helicobacter canadensis, Helicobacter cinerea, Helicobacter sphaeroides ... Bacter mustelae, Iriobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae, Methylocystis spp., Methylosinus trichosporium, Mobiluncus murielis, Neisseria basiliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria spp., Neisseria wadsworthyi, Nitrosomonas spp., Parvivacrum lavamentivorans, Pasteurella multocida, Phascolactomyces succinatutens, Ralstonia szygii, Rhodopseudomonas palustris, Rhodoburum spp., Simonsiella muerelli, Sphingomonas spp., Sporolactobacillus vinea, Staphylococcus aureus, Staphylococcus lugdunensis, Streptococcus spp., Subdoligranulum spp., Tistrella mobilis, Treponema spp., and Verminefrobacter eiseniae.
[0060] Alternatively, the wild-type Streptococcus pyogenes Cas9 sequence may be modified. The nucleic acid sequence may be codon-optimized for efficient expression in mammalian cells, such as human cells. The Cas9 nuclease sequence codon-optimized for expression in human cells sequence may be, for example, the Cas9 nuclease sequence encoded by any of the expression vectors listed in Genbank accession numbers KM099231.1GI:669193757; KM099232.1GI:669193761; or KM099233.1GI:669193765. Alternatively, the Cas9 nuclease sequence may be, for example, a sequence contained within a commercially available vector, such as pX458, pX330, or pX260 from Addgene (Cambridge, Mass.). In some embodiments, the Cas9 endonuclease may have an amino acid sequence that is a variant or fragment of any of the Cas9 endonuclease sequences of Genbank Accession Nos. KM099231.1GI:669193757; KM099232.1GI:669193761; or KM099233.1GI:669193765, or the Cas9 amino acid sequence of pX458, pX330, or pX260 (Addgene, Cambridge, Mass.). The Cas9 nucleotide sequence may be modified to encode a biologically active variant of Cas9, which may have or may include an amino acid sequence that differs from wild-type Cas9 by containing one or more, e.g., insertions, deletions, or mutations, or a combination thereof. One or more of the mutations may be a substitution (e.g., a conservative amino acid substitution).For example, a biologically active variant of a Cas9 polypeptide may have at least or about 50% sequence identity (e.g., at least or about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68% or more) to a wild-type Cas9 polypeptide. , 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).
[0061] In some embodiments, the CRISPR-associated endonuclease may be a Cas12a nuclease. The Cas12a nuclease may have a nucleotide sequence identical to that of a wild-type Prevotella or Francisella sequence. Alternatively, the Cas12a sequence of a wild-type Prevotella or Francisella may be modified. In some embodiments, the genera Acidaminococcus, Proteocatella, Sulfurimonas, Elizabethkingia, Methylococcus, Moraxella, Hercococcus, Lachnospira, Limihaloglobus, Butyribrio, Methanomethylophilus, Coprococcus, Synergistes, Eubacterium, Roseburia, Bacteroides, Ruminococcus, Eubacteriaceae, Leptospira, Parabacteriodes, Gracilibacterium, Lachnospiraceae, Clostridium, The sequence of Cas12a of the genus Umium, Blumimicrobium, Fibrobacter, Catenobulum, Acinetobacter, Flavobacterium, Succiniclasticum, Pseudobutyribrio, Barnesiella, Snaeacina, Succinibrioidaceae, Treponema, Sedimentspaella, Thiomicrospira, Eucomonympha, Arcobacter, Olibacterium, Methanoplasma, Porphyromonas, Succinovibrio, or Anaerovibrio may be modified. The nucleic acid sequence may be codon-optimized for efficient expression in mammalian cells, such as human cells. The Cas12a nuclease sequence that is codon-optimized for expression in a human cell sequence may be, for example, a Cas9 nuclease sequence encoded by any of the expression vectors listed in Genbank Accession Nos. MF193599.1GI:1214941796, KY985374.1GI:1242863785, KY985375.1GI:1242863787, or KY985376.1GI:1242863789. Alternatively, the Cas12a nuclease sequence may be, for example, a sequence contained within a commercially available vector, such as pAs-Cpf1 or pLb-Cpf1 from Addgene (Cambridge, Mass.).In some embodiments, the Cas12a endonuclease may have an amino acid sequence that is a variant or fragment of any of the Cas12a endonuclease sequences of Genbank Accession Nos. MF193599.1GI:1214941796, KY985374.1GI:1242863785, KY985375.1GI:1242863787, or KY985376.1GI:1242863789, or the Cas12a amino acid sequence of pAs-Cpf1 or pLb-Cpf1 (Addgene, Cambridge, Mass.). The Cas12a nucleotide sequence may be modified to encode a biologically active variant of Cas12a, which may have or include an amino acid sequence that differs from wild-type Cas12a by containing one or more, e.g., insertions, deletions, or mutations, or a combination thereof. One or more of the mutations may be a substitution (e.g., a conservative amino acid substitution). For example, a biologically active variant of a Cas12a polypeptide may have at least or about 50% sequence identity (e.g., at least or about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109, 109, 102, 103, 104, 105, 106, 107, 108, 109 ... 8%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).
[0062] The compositions described herein may also include a guide RNA (gRNA) that includes a DNA binding domain that is complementary to the target domain in the target sequence, and a sequence that encodes a CRISPR-associated endonuclease protein binding domain. The guide RNA sequence may be a sense or antisense sequence. The guide RNA sequence may include a PAM. The sequence of the PAM may vary depending on the specificity requirements of the CRISPR endonuclease used. In the CRISPR-Cas system from S. pyogenes, the target DNA is typically immediately preceded by a 5'-NGG protospacer adjacent motif (PAM). Thus, for S. pyogenes Cas9, the PAM sequence may be NGG. Other Cas endonucleases may have different PAM specificities (e.g., NNG, NNA, GAA, NGGNG, NGRRT, NGRRN, NNNNGATT, NNNNRYAC, NNAGAAW, TTTV, YG, TTTN, YTN, NGCG, NGAG, NGAN, NGNG, NG, NNGRRT, TYCV, TATV, or NAAAAC). The specific sequence of the guide RNA may vary, but regardless of the sequence, useful guide RNA sequences are those that achieve high efficiency while minimizing off-target effects.
[0063] In some embodiments, the DNA binding domain is a variable length of about 20 to about 55 nucleotides, e.g., about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, or about 55 nucleotides in length. In some embodiments, the Cas protein binding domain is a variable length of about 30 to about 55 nucleotides, e.g., about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, or about 55 nucleotides in length.
[0064] In some embodiments, the composition comprises one or more nucleic acid (i.e., DNA) sequences encoding a guide RNA and a CRISPR endonuclease. When the composition is administered as a nucleic acid or contained within an expression vector, the CRISPR endonuclease may be encoded by the same nucleic acid or vector as the guide RNA sequence. In some embodiments, the CRISPR endonuclease may be encoded in a physically separate nucleic acid or separate vector from the guide RNA sequence. The nucleic acid sequence encoding the guide RNA may include a DNA binding domain, a Cas protein binding domain, and a transcription terminator domain.
[0065] The nucleic acid encoding the guide RNA and / or the CRISPR endonuclease may be an isolated nucleic acid. An "isolated" nucleic acid may be, for example, a naturally occurring DNA molecule or a fragment thereof, provided that at least one of the nucleic acid sequences that normally immediately flank the DNA molecule in the naturally occurring genome is removed or absent. An isolated nucleic acid molecule may be produced by standard techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain isolated nucleic acids containing the nucleotide sequences described herein, such as nucleotide sequences encoding the polypeptides described herein. PCR can be used to amplify specific sequences from DNA as well as from RNA, such as sequences from total genomic DNA or total cellular RNA. Various PCR methods are described, for example, in PCR Primer: A Laboratory Manual, edited by Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995. Generally, sequence information from the ends or beyond of the region of interest is employed to design oligonucleotide primers that are identical or similar in sequence on opposite strands of the template to be amplified. A variety of PCR strategies are also available that allow for the introduction of site-specific nucleotide sequence modifications into a template nucleic acid.
[0066] Isolated nucleic acids can also be chemically synthesized, either as a single nucleic acid molecule (e.g., using automated DNA synthesis in the 3' to 5' direction using phosphoramidite technology) or as a series of oligonucleotides. For example, one or more pairs of long oligonucleotides (e.g., >50-100 nucleotides) containing the desired sequence can be synthesized, with each pair containing a short segment (e.g., about 15 nucleotides) of complementarity such that a duplex is formed when the oligonucleotide pairs anneal. DNA polymerase is used to extend the oligonucleotides, resulting in a single-stranded, double-stranded nucleic acid molecule for each oligonucleotide pair, which may then be ligated into a vector. Isolated nucleic acids can also be obtained, for example, by mutagenesis (e.g., according to the formula above) of a naturally occurring portion of DNA encoding Cas9.
[0067] Also provided herein are recombinant constructs that can be used to transform cells to express a CRISPR endonuclease and / or a guide RNA complementary to a target sequence. The recombinant nucleic acid construct may include a nucleic acid encoding a CRISPR endonuclease and / or a guide RNA complementary to a target sequence operably linked to a promoter suitable for expressing the CRISPR endonuclease and / or the guide RNA complementary to the target sequence in the cell. In some embodiments, the nucleic acid encoding the CRISPR endonuclease is operably linked to the same promoter as the nucleic acid encoding the guide RNA. In other embodiments, the nucleic acid encoding the CRISPR endonuclease and the nucleic acid encoding the guide RNA are operably linked to different promoters. In some embodiments, the promoter can be one or more pol III promoters, one or more pol II promoters, one or more pol I promoters, or a combination thereof. Examples of pol III promoters include, but are not limited to, U6 and H1 promoters. Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV), LTR promoter (optionally with the RSV enhancer), cytomegalovirus (CMV) promoter (optionally with the CMV enhancer; see, e.g., Boshart et al., Cell 41:521-30 (1985)), SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, phosphoglycerol kinase (PGK) promoter, and EF1 promoter. Examples of pol I promoters include, but are not limited to, the 47S pre-rRNA promoter.
[0068] Intratumoral delivery Any of the pharmaceutical compositions disclosed herein can be formulated for use in pharmaceutical preparations, with particular use being indicated in the context of the following treatments, for example, treatment of subjects with cancer. When employed as pharmaceuticals, any of the nucleic acids and vectors can be administered in the form of a pharmaceutical composition. A subject will be successfully "treated" according to the present method if the subject exhibits one or more of the following: reduced tumorigenicity, reduced number or frequency of cancer stem cells, increased immune response, increased anti-tumor response, increased cytolytic activity of immune cells, increased killing of tumor cells, increased killing of tumor cells by immune cells, reduced number of cancer cells or complete disappearance of cancer cells, reduced tumor size; reduced or eliminated invasion of cancer cells into peripheral organs, including spread of cancer cells to soft tissue and bone; reduced or eliminated metastasis of tumors or cancer cells; reduced or eliminated cancer growth; alleviation of one or more symptoms associated with a particular cancer; reduced morbidity and mortality; improved quality of life; or a combination of these effects.
[0069] In some embodiments, pharmaceutical compositions may contain the nucleic acids and vectors described herein as active ingredients in combination with one or more pharma- ceutically acceptable carriers. The term "pharma-ceutically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to animals or humans as required. The term "pharma-ceutically acceptable carriers" as used herein includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants, and the like that can be used as a medium for a pharma-ceutically acceptable substance. In making the pharmaceutical compositions disclosed herein, the active ingredient is typically mixed with an excipient, diluted by the excipient, or enclosed within such a carrier, for example, in the form of a capsule, tablet, tub, paper, or other container. When an excipient serves as a diluent, it may be a solid, semi-solid, or liquid material (e.g., saline) that acts as a vehicle, carrier, or medium for the active ingredient. Thus, the compositions may be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as solids or in liquid media), lotions, creams, ointments, gels, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders. As is known in the art, the type of diluent may vary depending on the intended route of administration. The resulting composition may contain additional agents, such as preservatives. In some embodiments, the carrier may be or may include a lipid-based or polymer-based colloid. In some embodiments, the carrier material may be a colloid formulated as a liposome, hydrogel, microparticle, nanoparticle, or block copolymer micelle. As stated, the carrier material may form a capsule, which material may be a polymer-based colloid.
[0070] Methods for delivering agents into tumors are known in the art (Brincker, Crit. Rev. Oncol. Hematol. 15:91-98 (1993); Celikoglu et al., Cancer Ther. 6:545-52 (2008)). For example, the CRISPR / Cas system can be administered by conventional needle injection, needle-free jet injection, or electroporation into tumor or cancer tissue, or a combination thereof. The CRISPR / Cas system can be administered directly into the tumor or cancer (tissue) with high precision using computed tomography, ultrasound, gamma camera imaging, positron emission tomography, or magnetic resonance tumor imaging. In some embodiments, intratumoral administration of the CRISPR / Cas system is by direct intratumoral administration by endoscopy, bronchoscopy, cystoscopy, colonoscopy, laparoscopy, or catheterization. In some embodiments where the tumor is in contact with bodily fluids in a closed system, the CRISPR / Cas system can be administered into the bodily fluids for intratumoral administration.
[0071] Intratumoral administration may be used to achieve one or more of the following: a reduction in tumor size; a reduction in tumor growth; a reduction or limiting the occurrence and / or spread of metastases; elimination of the tumor; inhibition, prevention, or reduction of tumor recurrence for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more months; and / or promotion of an immune response against the tumor, which effects may be seen in the tumor to which the CRISPR / Cas system was administered and / or in one or more metastases or other tumors.
[0072] In some embodiments, one or more CRISPR endonucleases and one or more guide RNAs may be combined and provided in the form of a ribonucleoprotein particle (RNP). The RNP complex can be introduced into a subject, for example, by injection, electroporation, nanoparticles (including, for example, lipid nanoparticles), vesicles, and / or with the aid of cell-penetrating peptides. See, for example, Lin et al., ELife 3:e04766 (2014); Sansbury et al., CRISPR J. 2(2):121-32 (2019); US2019 / 0359973.
[0073] In some embodiments, one or more CRISPR endonucleases and one or more guide RNAs may be delivered by lipid nanoparticles (LNPs). LNPs refer to particles with diameters of less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, the size of the nanoparticles may range from 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm. LNPs may be made from cationic, anionic, or neutral lipids. Neutral lipids such as the fusogenic phospholipid DOPE and the membrane component cholesterol may be included in LNPs as "helper lipids" that enhance transfection activity and stability of the nanoparticles. LNPs may also be composed of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.
[0074] In certain embodiments, cationic lipid N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used. DOTMA can be formulated into liposome transfer vehicles or lipid nanoparticles, either alone or in combination with neutral lipids, dioleoylphosphatidyl-ethanolamine (DOPE) or other cationic or non-cationic lipids, and such liposomes can be used to enhance the delivery of nucleic acids to target cells. Other suitable cationic lipids include, but are not limited to, 5-carboxyspermylglycine dioctadecylamide, 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium, 1,2-dioleoyl-3-dimethylammonium-propane, 1,2-dioleoyl-3-trimethylammonium-propane, and the like.Contemplated cationic lipids also include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane, 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane, 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane, 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane, N-dioleyl-N,N-dimethyl ammonium chloride, N,N-distearyl- N,N-Dimethylammonium bromide, N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide, 3-Dimethylamino-2-(cholest-5-en-3-β-oxybutane-4-oxy)-1-(cis,cis-9,12-octadecadienoxy)propane, 2-[5'-(cholest-5-en-3-β-oxy)-3'-oxapentoxy)-3- Dimethyl-1-(cis,cis-9',12'-octadecadienoxy)propane, N,N-dimethyl-3,4-dioleyloxybenzylamine, 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane, 2,3-dilinoleyloxy-N,N-dimethylpropylamine, 1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane, 1,2-dilinoleylcarbamyl-3-dimethylaminopropane DLin-KC2-DMA), or mixtures thereof.
[0075] In some embodiments, non-cationic lipids can be used. As used herein, the phrase "non-cationic lipid" refers to any neutral, zwitterionic, or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), DOPE, palmitoyloleylphosphatidylcholine (POPC), palmitoyloleyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleic acid, glyceryl phosphate ... Non-cationic lipids include, but are not limited to, dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), cholesterol, or mixtures thereof. Such non-cationic lipids may be used alone or in combination with other excipients, such as cationic lipids.
[0076] Also provided are DNA vectors containing nucleic acids, such as those described herein. A "DNA vector" is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment can be inserted to effect replication of the inserted segment. Generally, DNA vectors are capable of replication when associated with suitable control elements. Suitable vector backbones include, for example, those routinely used in the art, such as plasmids, viruses, artificial chromosomes, BACs, YACs, or PACs. The term "DNA vector" includes cloning and expression vectors, as well as viral vectors and integrating vectors. An "expression vector" is a vector that includes a regulatory region. A variety of host / expression vector combinations can be used to express the nucleic acid sequences described herein. Suitable expression vectors include, but are not limited to, plasmids and viral vectors derived from bacteriophages, baculoviruses, and retroviruses. Many vectors and expression systems are commercially available from companies such as Novagen (Madison, Wis.), Clontech (Palo Alto, Calif.), Stratagene (La Jolla, Calif.), and Invitrogen / Life Technologies (Carlsbad, Calif.).
[0077] The DNA vectors provided herein may also include, for example, an origin of replication, a scaffold attachment region (SAR), and / or a marker. A marker gene can confer a selectable phenotype to a host cell. For example, a marker can confer biocide resistance, such as resistance to an antibiotic (e.g., kanamycin, G418, bleomycin, or hygromycin). As described above, an expression vector may include a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of an expressed polypeptide. Tag sequences, such as green fluorescent protein (GFP), glutathione S-transferase (GST), polyhistidine, c-myc, hemagglutinin, or Flag™ tag (Kodak, New Haven, Conn.) sequences, are typically expressed as a fusion with the encoded polypeptide. Such tags may be inserted anywhere within the polypeptide, for example, at either the carboxyl or amino terminus.
[0078] The DNA vector may contain a regulatory region. The term "regulatory region" refers to a nucleotide sequence that influences the initiation and rate of transcription or translation, as well as the stability and / or mobility of the transcription or translation product. Regulatory regions include, but are not limited to, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5' and 3' untranslated regions (UTRs), transcription initiation sites, termination sequences, polyadenylation sequences, nuclear localization signals, and introns.
[0079] The term "operably linked" as used herein refers to a regulatory region (e.g., a promoter) in a nucleic acid and a sequence to be transcribed being positioned so as to affect the transcription or translation of such sequence. For example, by placing a coding sequence under the control of a promoter, the translation start site of the translation reading frame of the polypeptide is typically positioned 1 to about 50 nucleotides downstream from the promoter. However, the promoter may be positioned as much as about 5,000 nucleotides upstream from the translation start site, or about 2,000 nucleotides upstream from the transcription start site. A promoter typically includes at least a core (basal) promoter. A promoter may also include at least one control element, such as an enhancer sequence, an upstream element, or an upstream activation region (UAR). The choice of promoter to include depends on a number of factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level, and cell or tissue preferential expression. It is routine for one of skill in the art to appropriately select promoters and other regulatory regions and position them relative to the coding sequence to modulate the expression of the coding sequence.
[0080] Vectors include, for example, viral vectors (e.g., adenovirus ("Ad"), adeno-associated virus (AAV), and vesicular stomatitis virus (VSV) and retroviruses), liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of polynucleotides to host cells. Direct injection of adenoviral vectors into lung tumors remains a routine procedure in clinical trials evaluating gene therapy for lung cancer. Dong et al., J. Int. Med. Res. 36, 1273-87 (2008); Li et al., Cancer Gene Ther. 20, 251-59 (2013); Zhou et al., Cancer Gene Ther. 23, 1-6 (2016). Vectors may also include other elements or functionalities that further modulate gene delivery and / or gene expression or otherwise provide beneficial properties to the targeted cells. As described and exemplified in more detail below, such other elements include, for example, elements that affect binding or targeting to cells (such as elements that mediate cell type or tissue specific binding); elements that affect uptake of vector nucleic acid by cells; elements that affect localization of the polynucleotide within the cell after uptake (e.g., agents that mediate nuclear localization); and elements that affect expression of the polynucleotide. Such elements can also include markers, such as detectable and / or selectable markers that can be used to detect or select cells that have taken up and are expressing the nucleic acid delivered by the vector. Such elements can be provided as natural features of the vector (e.g., the use of certain viral vectors that have elements or functionality that mediate binding or uptake) or the vector can be modified to provide such functionality. Other vectors include those described by Chen et al.; BioTechniques, 34: 167-71 (2003). A wide variety of such vectors are known in the art and are generally available.
[0081] Suitable nucleic acid delivery systems include sequences from recombinant viral vectors, typically at least one of adenovirus, adeno-associated virus (AAV), helper-dependent adenovirus, retrovirus, or hemagglutinating virus of Japan-liposome (HVJ) complex. In such cases, the viral vector comprises a strong eukaryotic promoter, such as a cytomegalovirus (CMV) promoter, operably linked to the polynucleotide. The recombinant viral vector may comprise one or more of the polynucleotides therein, and in some embodiments, may comprise about one polynucleotide. In embodiments in which the polynucleotide is administered with a non-viral vector, use of from about 0.1 ng to about 4000 μg is often useful, e.g., from about 0.1 ng to about 3900 μg, from about 0.1 ng to about 3800 μg, from about 0.1 ng to about 3700 μg, from about 0.1 ng to about 3600 μg, from about 0.1 ng to about 3500 μg, from about 0.1 ng to about 3400 μg, from about 0.1 ng to about 3300 μg, μg, approximately 0.1ng to approximately 3200μg, approximately 0.1ng to approximately 3100μg, approximately 0.1ng to approximately 3000μg, approximately 0.1ng to approximately 2900μg, approximately 0.1ng to approximately 2800μg, approximately 0.1ng to approximately Approximately 2700μg, approximately 0.1ng to approximately 2600μg, approximately 0.1ng to approximately 2500μg, approximately 0.1ng to approximately 2400μg, approximately 0.1ng to approximately 2300μg, approximately 0.1ng to approximately 2200μg, approximately 0. 1ng to about 2100μg, about 0.1ng to about 2000μg, about 0.1ng to about 1900μg, about 0.1ng to about 1800μg, about 0.1ng to about 1700μg, about 0.1ng to about 1600μg g, about 0.1ng to about 1500μg, about 0.1ng to about 1400μg, about 0.1ng to about 1300μg, about 0.1ng to about 1200μg, about 0.1ng to about 1100μg, about 0.1ng to about 1 000μg, about 0.1ng to about 900μg, about 0.1ng to about 800μg, about 0.1ng to about 700μg, about 0.1ng to about 600μg, about 0.1ng to about 500μg, about 0.1ng to about 4 00μg, about 0.1ng to about 300μg, about 0.1ng to about 200μg, about 0.1ng to about 100μg, about 0.1ng to about 90μg, about 0.1ng to about 80μg, about 0.1ng to about 70μg,from about 0.1 ng to about 60 μg, from about 0.1 ng to about 50 μg, from about 0.1 ng to about 40 μg, from about 0.1 ng to about 30 μg, from about 0.1 ng to about 20 μg, from about 0.1 ng to about 10 μg, from about 0.1 ng to about 1 μg, from about 0.1 ng to about 900 ng, from about 0.1 ng to about 800 ng, from about 0.1 ng to about 700 ng, from about 0.1 ng to about 600 ng, from about 0.1 ng to about 500 ng, from about 0.1 ng to about 400 ng, from about 0.1 ng to about 300 ng, from about 0.1 ng to about 200 ng, from about 0.1 ng to about 100 ng, from about 0.1 ng to about 90 ng, from about 0.1 ng to about 80 ng, from about 0.1 ng to about 70 ng, from about 0.1 ng to about 60 ng, from about 0.1 ng to about 50 ng, from about 0.1 ng to about 40 ng, from about 0.1 ng to about 30 ng, from about 0.1 ng to about 20 ng, from about 0.1 ng to about 10 ng, from about 0.1 ng to about 1 ng, from about 1 ng to about 4000 μg, from about 1 ng to about 3900 μg, from about 1 ng to about 3800 μg, from about 1 ng to about 3700 μg, from about 1 ng to about 3600 μg, from about 1 ng to about 3500 μg, from about 1 ng to about 3400 μg, from about 1 ng to about 3300 μg, from about 1 ng to about 3200 μg, from about 1 ng to about 3100 μg, from about 1 ng to about 3000 μg, from about 1 ng to about 2900 μg, from about 1 ng to about 2800 μg, from about 1 ng to about 2700 μg, from about 1 ng to about 2600 μg, from about 1 ng to about 2500 μg, from about 1 ng to about 2400 μg, from about 1 ng to about 2300 μg, from about 1 ng to about 2200 μg, from about 1 ng to about 2100 μg, from about 1 ng to about 2000 μg, from about 1 ng to about 1900 μg, from about 1 ng to about 1800 μg, from about 1 ng to about 1700 μg, from about 1 ng to about 1600 μg, from about 1 ng to about 1500 μg, from about 1 ng to about 1400 μg, from about 1 ng to about 1300 μg, from about 1 ng to about 1200 μg, from about 1 ng to about 1100 μg, from about 1 ng to about 1000 μg, from about 1 ng to about 900 μg, from about 1 ng to about 800 μg, from about 1 ng to about 700 μg, from about 1 ng to about 600 μg, from about 1 ng to about 500 μg, from about 1 ng to about 400 μg, from about 1 ng to about 300 μg, from about 1 ng to about 200 μg, from about 1 ng to about 100 μg, from about 1 ng to about 90 μg, from about 1 ng to about 80 μg, from about 1 ng to about 70 μg, from about 1 ng to about 60 μg, from about 1 ng to about 50 μg, from about 1 ng to about 40 μg, from about 1 ng to about 30 μg, from about 1 ng to about 20 μg, from about 1 ng to about 10 μg, from about 1 ng to about 1 μg, from about 1 ng to about 900 ng, from about 1 ng to about 800 ng, from about 1 ng to about 700 ngFrom about 1 ng to about 600 ng, from about 1 ng to about 500 ng, from about 1 ng to about 400 ng, from about 1 ng to about 300 ng, from about 1 ng to about 200 ng, from about 1 ng to about 100 ng, from about 1 ng to about 90 ng, from about 1 ng to about 80 ng, from about 1 ng to about 70 ng, from about 1 ng to about 60 ng, from about 1 ng to about 50 ng, from about 1 ng to about 40 ng, from about 1 ng to about 30 ng, from about 1 ng to about 20 ng, from about 1 ng to about 10 ng, from about 10 ng to about 4000 μg, from about 20 ng to about 4000 μg, from about 30 ng to about 4000 μg, from about 40 ng to about 4000 μg, from about 50 ng to about 4000 μg, from about 60 ng to about 4000 μg, from about 70 ng to about 4000 μg, from about 80 ng to about 4000 μg, from about 90 ng to about 4000 μg, from about 100 ng to about 4000 μg, from about 200 ng to about 4000 μg, from about 300 ng to about 4000 μg, from about 400 ng to about 4000 μg, from about 500 ng to about 4000 μg, from about 600 ng to about 4000 μg, from about 700 ng to about 4000 μg, from about 800 ng to about 4000 μg, from about 900 ng to about 4000 μg, from about 1 μg to about 4000 μg, from about 10 μg to about 4000 μg, from about 20 μg to about 4000 μg, from about 30 μg to about 4000 μg, from about 40 μg to about 4000 μg, from about 50 μg to about 4000 μg, from about 60 μg to about 4000 μg, from about 70 μg to about 4000 μg, from about 80 μg to about 4000 μg, from about 90 μg to about 4000 μg, from about 100 μg to about 4000 μg, from about 200 μg to about 4000 μg, from about 300 μg to about 4000 μg, from about 400 μg to about 4000 μg, from about 500 μg to about 4000 μg, from about 600 μg to about 4000 μg, from about 700 μg to about 4000 μg, from about 800 μg to about 4000 μg, from about 900 μg to about 4000 μg, from about 1000 μg to about 4000 μg, from about 1100 μg to about 4000 μg, from about 1200 μg to about 4000 μg, from about 1300 μg to about 4000 μg, from about 1400 μg to about 4000 μg, from about 1500 μg to about 4000 μg, from about 1600 μg to about 4000 μg, from about 1700 μg to about 4000 μg, from about 1800 μg to about 4000 μg, from about 1900 μg to about 4000 μg, from about 2000 μg to about 4000 μg, from about 2100 μg to about 4000 μg, from about 2200 μg to about 4000 μg, from about 2300 μg to about 4000 μg, from about 2400 μg to about 4000 μg, from about 2500 μg to about 4000 μg, from about 2600 μg to about 4000 μg, from about 2700 μg to about 4000 μg, from about 2800 μg to about 4000 μg, from about 2900 μg to about 4000 μg,3000μg to about 4000μg, 3100μg to about 4000μg, 3200μg to about 4000μg, 3300μg to about 4000μg, 3400μg to about 4000μg, 3500μg to about 4000μg, 3600μg to about 4000μg, 3700μg to about 4000μg, 3800μg to about 4000μg, or 3900μg to about 4000μg are useful.
[0082] Additional vectors include viral vectors, fusion proteins and chemical conjugates. Retroviral vectors include Moloney Murine Leukemia Virus and HIV-based viruses. An HIV-based viral vector contains at least two vectors, where the gag and pol genes are derived from the HIV genome and the env gene is derived from another virus. DNA viral vectors include pox vectors, such as orthopox or avipox vectors, herpes viral vectors, such as herpes simplex I virus (HSV) vectors (see, e.g., Geller et al., J. Neurochem, 64: 487-96 (1995); Lim et al., DNA Cloning: Mammalian Systems, edited by D. Glover (Oxford Univ. Press, Oxford England) (1995); Geller et al., Proc Natl. Acad. Sci. USA.: 90: 7603-07 (1993); Geller et al., Proc Natl. Acad. Sci. USA 87: 1149-53 (1990)), adenoviral vectors (see, e.g., Le Gal LaSalle et al., Science, 259: 988-90 (1993); Davidson et al., Nat. Genet. 3: 219-23 (1993); Yang et al., J. Virol. 69: 2004-15 (1995)] and adeno-associated virus vectors [see, e.g., Kaplitt et al., Nat. Genet. 8:148-54 (1994)].
[0083] If necessary, the polynucleotides described herein can also be used with microdelivery vehicles, such as cationic liposomes, adenoviral vectors, and exosomes.For a general overview of liposome preparation, targeting, and content delivery procedures, see Mannino et al., BioTechniques, 6:682-90 (1988).See also Feigner et al., Bethesda Res. Lab. Focus, 11(2):21 (1989) and Maurer, Bethesda Res. Lab. Focus, 11(2):25 (1989).In some embodiments, exosomes can be used to deliver nucleic acids encoding CRISPR endonucleases and / or guide RNAs to target cells, such as cancer cells.Exosomes are nano-sized vesicles secreted by various cells and are composed of cell membranes. Exosomes can attach to target cells by various surface adhesion proteins and vector ligands (tetraspanin, integrin, CD11b and CD18 receptors) and deliver their payload to target cells. Numerous studies have shown that exosomes have specific cell affinities according to their characteristics and origins and can be used to target them to diseased tissues and / or organs. See Batrakova et al., J Control Release 219: 396-405 (2015). For example, cancer-derived exosomes function as natural carriers that can efficiently deliver CRISPR / Cas9 plasmids to cancer cells. See Kim et al., J Control Release 266: 8-16 (2017).
[0084] Replication-defective recombinant adenovirus vectors can be produced according to known techniques (see Quantin, et al., Proc. Natl. Acad. Sci. USA, 89:2581-84 (1992); Stratford-Perricadet et al., J. Clin. Invest., 90:626-30 (1992); Rosenfeld et al., Cell, 68:143-55 (1992).
[0085] Another delivery method is to use a single-stranded DNA production vector that can produce an expressed product inside the cell, see, e.g., Chen et al., BioTechniques, 34: 167-71 (2003).
[0086] In some embodiments, the methods, compositions, and combinations disclosed herein can be used to treat tumors, hi other embodiments, treating tumors includes inhibiting tumor growth, promoting tumor shrinkage, or both inhibiting tumor growth and promoting tumor shrinkage.
[0087] In some embodiments, intratumoral or peritumoral delivery of the CRISPR / Cas systems described herein can result in a decrease or elimination of tumor size, e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, The amount of iodine may be reduced by 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.
[0088] In some embodiments, intratumoral or peritumoral delivery of the CRISPR / Cas systems described herein can result in a decrease in tumor growth, e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 108%, 109%, 110%, 111%, 112%, The expression level may be inhibited by 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.
[0089] In certain embodiments, the tumor is treated with an additional agent, for example, a chemotherapeutic agent. In certain embodiments, the treatment with the chemotherapeutic agent is started simultaneously with the treatment with a therapeutically effective amount of the CRISPR / Cas system. In certain embodiments, the treatment with the chemotherapeutic agent is started after the treatment with a therapeutically effective amount of the CRISPR / Cas system is started. In certain embodiments, the treatment with the chemotherapeutic agent is started before the treatment with a therapeutically effective amount of the CRISPR / Cas system.
[0090] In certain embodiments, a therapeutically effective amount of the CRISPR / Cas system of the present disclosure can be utilized for the treatment of a tumor, where the subject has failed at least one prior chemotherapy regimen. For example, in some embodiments, the tumor is resistant to one or more chemotherapeutic agents. Thus, the present disclosure provides a method of treating a tumor in a subject, where the subject has failed at least one prior chemotherapy regimen for cancer, the method comprising administering to the subject a therapeutically effective amount of the CRISPR / Cas system described herein in an amount sufficient to treat the tumor. A therapeutically effective amount of the CRISPR / Cas system described herein can also be utilized to inhibit tumor cell growth in a subject, where the subject has failed at least one prior chemotherapy regimen. Thus, the present disclosure further provides a method of inhibiting tumor cell growth in a subject, where, for example, the subject has failed at least one prior chemotherapy regimen, the method comprising administering to the subject a pharmaceutical composition described herein such that tumor cell growth is inhibited.
[0091] Small molecule chemotherapeutic agents generally include, for example: 1. topoisomerase II inhibitors (cytotoxic antibiotics), such as anthracyclines / anthracenediones, e.g., doxorubicin, epirubicin, idarubicin, and nemorubicin, anthraquinones, e.g., mitoxantrone and losoxantrone, and podophillotoxines, e.g., etoposide and teniposide; 2. agents that affect microtubule formation (mitotic inhibitors), such as plant alkaloids (e.g., compounds belonging to a family of alkaline nitrogen-containing molecules derived from plants that are biologically active and cytotoxic), such as taxanes, e.g., paclitaxel and docetaxel, and vinca alkaloids, e.g., vinblastine, vincristine, and vinorelbine, and podophyllotoxins. 3. Alkylating agents such as nitrogen mustards, ethylenimine compounds, alkyl sulfonates and other compounds with alkylating action such as nitrosoureas, dacarbazine, cyclophosphamide, ifosfamide and melphalan; 4. Antimetabolites (nucleoside inhibitors) such as folates, e.g. folic acid, fiuropyrimidines, purine or pyrimidine analogues such as 5-fluorouracil, capecitabine, gemcitabine, methotrexate and edatrexate; 5. Topoisomerase I inhibitors such as topotecan, irinotecan and 9-nitrocamptothecin, camptothecin derivatives and retinoic acid; and 6. Platinum compounds / complexes such as cisplatin, oxaliplatin and carboplatin. Exemplary chemotherapeutic agents for use in the methods disclosed herein include, but are not limited to, amifostine (ethyol), cisplatin, dacarbazine (DTIC), dactinomycin, mechlorethamine (nitrogen mustard), streptozocin, cyclophosphamide, carmustine (BCNU), lomustine (CCNU), doxorubicin (adriamycin), doxorubicin lipoprotein (DMP), doxorubicin serotonin (DSM ...lipo) (doxil), gemcitabine (Gemzar), daunorubicin, daunorubicin lipo (daunoxome), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, 5-fluorouracil (5-FU), vinblastine, vincristine, bleomycin, paclitaxel (Taxol), docetaxel (Taxotere), aldesleukin, asparaginase, busulfan, carboplatin, cladribine, camptothecin, CPT-Il, 10-hydroxy-7-ethyl-camptothecin (SN38), capecitabine, ftorafur, 5'deoxyfluorouridine, UFT, eniluracil, deoxycytidine, 5-azacytosine, 5-azadeoxycytosine, allopurinol, 2-chloroaza Denosine, trimetrexate, aminopterin, methylene-10-deazaaminopterin (MDAM), oxaliplatin, picoplatin, tetraplatin, satraplatin, platinum-DACH, ormaplatin, CI-973 (and its analogs), JM-216 (and its analogs), epirubicin, 9-aminocamptothecin, 10,11-methylenedioxycamptothecin, karenitecin, 9-nitrocamptothecin, TAS103, vindesine, L-phenylalanine mustard, ifosphamide, mefosphamide, perfosfamide, trofosfamide, carmustinecarmustine), semustine, epothilone A to E, tomudex, 6-mercaptopurine, 6-thioguanine, amsacrine, etoposide phosphate, acyclovir, valacyclovir, ganciclovir, amantadine, rimantadine, lamivudine, zidovudine, bevacizumab, trastuzumab, rituximab, pentostatin, floxiridine, fludarabine, hydroxyurea, ifosfamide, idarubicin, mesna, irinotecan, mitoxantrone , topotecan, leuprolide, megestrol, melphalan, plicamycin, mitotane, pegaspargase, pipobroman, tamoxifen, teniposide, testolactone, thiotepa, uracil mustard, vinorelbine, chlorambucil, mTor, epidermal growth factor receptor (EGFR), and fibroblast growth factor (FGF), and combinations thereof, which will be readily apparent to one of skill in the art based on the appropriate standard of care for a particular tumor or cancer. In certain embodiments, the chemotherapeutic agent is selected from the group consisting of cisplatin, vinorelbine, carboplatin, and combinations thereof (e.g., cisplatin and vinorelbine; cisplatin and carboplatin; vinorelbine and carboplatin; cisplatin, vinorelbine, and carboplatin).
[0092] In some embodiments, intratumoral or peritumoral delivery of the CRISPR / Cas systems described herein can reduce the amount of chemotherapeutic agent used in treating a subject by, for example, about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 108%, 109%, 109%, 1 The concentration may be reduced by 4%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.
[0093] Oncogenes In some embodiments, the cancer gene is a cancer driver gene, a disease-causing gene, an oncogene, or a mutated tumor suppressor gene, such as NRF2, EGFR, EIF1AX, GNA11, SF3B1, BAP1, PBRM1, ATM, SETD2, KDM6A, CUL3, MET, SMARCA4, U2AF1, RBM10, STK11, NF1, NF2, IDH1, IDH2, PTPN11, MAX, TCF12, HIST1H1E, LZTR1, KIT, RAC1, ARID2, BRD4, BRD7, BARF1, NRAS, RNF43, SMAD4, ARID1A, ARID1B, KRAS, APC, SMAD2, SMAD3, ACVR2A, GNAS, HRAS, STAG2, FGFR3, FGFR4, RHOA, CDKN1A, ERBB3, KANSL1, RB1, TP53, CDKN2A, CD KN2B, CDKN2C, KEAP1, CASP8, TGFBR2, HLA-B, MAPK1, NOTCH1, NOTCH2, NOTCH3, HLA-A, RASA1, EPHA2, EPHA3, EPHA5, EPHA7, NSD1, ZNF217, ZNF750, KLF5, E P300, FAT1, PTEN, FBXW7, PIK3CA, PIK3CB, PIK3C2B, PIK3CG, RUNX1, RUNX1T1, DNMT3A, SMC1A, ERBB2, AKT1, AKT2, AKT3, MAP3K1, FOXA1, BRCA1, BRCA2, C DH1, PIK3R1, PPP2R1A, BCOR, BCORL1, ARHGAP35, FGFR2, CHD4, CTCF, CTNNA1, CTNNB1, SPOP, TMSB4X, PIM1, CD70, CD79A, CD79B, B2M, CARD11, MYD88, BTG1 , BTG2, TNFAIP3, MEN1, PRKAR1A, PDGFRA, PDGFRB, SPTA1, GABRA6, KEL, SMARCB1, ZBTB7B, BCL2, BCL2L1, BCL2L2, BCL2L11, RFC1, MAP3K4, CSDE1, EPAS1, R ET, LATS2, EEF2, CYLD, HUWE1, MYH9, AJUBA, FLNA, ERBB4, CNBD1, DMD, MUC6, FAM46C, FAM46D, PLCG1, PLCG2, NIPBL, FUBP1, CIC, ZBTB2, ZBTB20, ZCCHC12,<h2 style=";text-align:left;direction:ltr">TGIF1、SOX2、SOX9、SOX10、PCBP1、ZFP36L2、TCF7L2、AMER1、KDM5A、KDM5C、M TOR、VHL、KIF1A、TCEB1、TXNIP、CUL1、TSC1、ELF3、RHOB、PSIP1、SF1、FOXQ1、G NA13、DIAPH2、ZFP36L1、ERCC2、SPTAN1、RXRA、ASXL2、CREBBP、CREB3L3、ALB 、DHX9、XPO1、RPS6KA3、IL6ST、TSC2、EEF1A1、WHSC1、APOB、NUP133、AXIN1、PH F6、TET2、WT1、FLT3、FLT4、SMC3、CEBPA、RAD21、RAD50、RAD51、PTPDC1、ASXL 1、EZH2、NPM1、SRSF2、GNAQ、PLCB4、CYSLTR2、CDKN1B、CBFB、NCOR1、PTPRD、TB X3,GPS2,GATA1,GATA2,GATA3,GATA4,GATA6,MAP2K4,PTCH1,PTMA,LATS1, POLRMT、CDK4、COL5A1、PPP6C、MECOM、DACH1、MAP2K1、MAP2K2、RQCD1、DDX3X、 NUP93、PPM1D、CHD2、CHD3、CCND1、CCND2、CCND3、ACVR1、KMT2A、KMT2B、KMT2 C、KMT2D、SIN3A、SCAF4、DICER1、FOXA2、CTNND1、MYC、MYCL、MYCN、SOX17、ARI D5B、ATR、INPPL1、INPP4B、ATF7IP、ZMYM2、ZFHX3、PDS5B、SOS1、TAF1、PIK3R 2、RPL22、RRAS2、MSH2、MSH6、CKD12、ZNF133、ZNF703、MED12、ZMYM3、GTF2I、R IT1、MGA、ABL1、BRAF、CHEK1、FANCC、JAK2、MITF、PDCD1LG2、STAT4、ABL2、CH EK2、FANCD2、JAK3、MLH1、FANCE、JUN、MPL、RICTOR、SUFU、FANCF、GID4、KAT6A 、MRE11A、PDK1、SYK、BRIP1、CRKL、FANCG、GLI1、CRLF2、FANCL、RPTOR、ALK、B TK、CSF1R、FAS、TERC、C11orf30、KDR、MUTYH、SDHA、AR、FGF10、GPR124、SDHB、ARAF, CBL, FGF14, GRIN2A, SDHC, ARFRP1, FGF19, GRM3, KLHL6, PMS2, SDHD, TNFRSF14, DAXX, and FGF 23. GSK3B, POLD1, TOP1, DDR2, FGF3, H3F3A, POLE, TOP2A, CCNE1, FGF4, HGF, SLIT2, CD274, FGF6 HNF1A, NFKBIA, PRDM1, DOT1L, FGFR1, LMO1, NKX2-1, PREX2, HSD3B1, LRP1B, TSHR, ATRX, CDC73 HSP90AA1, PRKCI, AURKA, PRKDC, VEGFA, AURKB, CDK12, FH, MAGI2, PRSS8, SMO, FLCN, IGF1R, SNC AIP, WISP3, AXL, CDK6, EPHB1, FLT1, IGF2, SOCS1, CDK8, IKBKE, NTRK1, BARD1, IKZF1, NTRK2, QK I, FOXL2, IL7R, MCL1, NTRK3, ERG, FOXP1, INHBA, MDM2, SPEN, ERRFI1, FRS2, MDM4, PAK3, BCL6, ES R1, IRF2, PALB2, RAF1, IRF4, MEF2B, PARK2, RANBP2, SRC, IRS2, PAX5, RARA, BLM, FANCA, JAK1, F CRL4, LIG4, MAR, PWWP3A, MUC16, MUC17, FGBP, FAT17, MMSET, IRTA2, TTN, DST, and STAT3.
[0094] In some embodiments, the oncogene is nuclear factor erythroid 2-related factor (NRF2, NFE2L2). NRF2 is considered a master regulator of 100-200 target genes involved in the cellular response to oxidative / electrophilic stress. Targets include genes controlling glutathione (GSH) mediators, antioxidants, and efflux pumps (Hayden et al., Urol. Oncol. Semin. Orig. Investig. 32:806814 (2014)). NRF2 is also known to regulate the expression of genes involved in protein degradation and detoxification, and is negatively regulated by Kelch-like ECH-associated protein 1 (KEAP1), a substrate adaptor for the Cul3-dependent E3 ubiquitin ligase complex. Under standard conditions, Keap1 constantly targets NRF2 for ubiquitin-dependent degradation, maintaining low expression of NRF2 at downstream target genes. However, chemotherapy has been shown to activate the transcriptional activity of NRF2 target genes, often promoting cytoprotective responses, with enhanced expression of NRF2 occurring in response to environmental stress or adverse growth conditions. Other mechanisms leading to NRF2 upregulation include mutations in KEAP1 or epigenetic changes in the promoter region. Upregulation of NRF2 expression leads to enhanced resistance of cancer cells to chemotherapeutic drugs, which by their very action induces an unfavorable environment for cell proliferation. Indeed, Hayden et al. (ibid.) clearly demonstrated that increased expression of NRF2 leads to resistance of cancer cells to chemotherapeutic drugs such as cisplatin. Singh et al. (2010, Antioxidants & Redox Signaling 13) also showed that constitutive expression of NRF2 leads to radioresistance, and inhibition of NRF2 causes reduced survival in addition to increased levels of endogenous reactive oxygen species (ROS). Recently, Torrente et al. (Oncogene (2017). doi:10.1038 / onc.2017.221) identified crosstalk between NRF2 and two HIPK2 homeodomain-interacting protein kinases and demonstrated that HIPK2 exerts cytoprotective effects via NRF2.
[0095] By using CRISPR / Cas9, it is possible to target and knock out mutant NRF2 proteins that cause chemotherapy resistance without compromising the function of wild-type NRF2 protein (PCT / US2020 / 034369, incorporated herein by reference in its entirety). Thus, some embodiments are directed to reducing, or in some embodiments, eliminating, the expression of variant NRF2 that is found only in cancer cells and not in non-cancerous cells. These variants are generally found within the Neh2 domain of NRF2, known as the KEAP1 binding domain. In some embodiments, the NRF2 mutation may be one found in Table 1 below.
[0096] [Table 1]
[0097] NRF2 SEQ ID NO:15: 1 gattaccgag tgccggggag ccgggaggag ccgccgacgc agccgccacc gccgccgccg 61 ccgccaccag agccgccctg tccgcgccgc gcctcggcag ccggaacagg gccgccgtcg 121 gggagcccca aacacacggtc cacagctcat catgatggac ttggagctgc cgccgccggg 181 actcccgtcc cagcaggaca tggatttgat tgacatactt tggaggcaag atatagatct 241 tggagtaagt cgagaagtat ttgacttcag tcagcgacgg aaagagtatg agctggaaaa 301 acagaaaaaa cttgaaaagg aaagacaaga acaactccaa aaggagcaag agaaagcctt 361 ttcgctcag ttacaactag atgaagagac aggtgaattt ctcccaattc agccagccca 421 gcacatccag tcagaaacca gtggatctgc caactactcc caggttgcc acattcccaa 481 atcagatgct ttgtactttg atgactgcat gcagcttttg gcgcagacat tcccgtttgt 541 agatgacaat gaggttctt cggctacgtt tcagtcactt gttcctgata ttcccggtca 601 catcgagagc ccagtcttca ttgctactaa tcaggctcag tcacctgaaa cttctgttgc 661 tcaggtagcc cctgttgatt tagacggtat gcaacaggac attgagcaag tttgggagga 721 gctattatcc attcctgagt tacagtgtct tatattgaa aatgacaagc tggttgagac 781 taccatggtt ccaagtccag aagccaaact gacagaagtt gacaattatc atttttactc 841 atctataccc tcaatggaaa aagaagtagg taactgtagt ccacattttc ttaatgcttt 901 tgaggattcc ttcagcagca tcctctccac agaagacccc aaccagttga cagtgaactc 961 attaaattca gatgccacag tcaacacaga ttttggtgat gaattttatt ctgctttcat 1021 agctgagcc agtatcagca acagcatgcc ctcacctgct actttaagcc attcactctc 1081 tgaacttcta aatgggccca ttgatgtttc tgatctatca ctttgcaaag ctttcaacca 1141 aaaccaccct gaaagcacag cagaattcaa tgattctgac tccggcattt cactaaacac 1201 aagtcccagt gtggcatcac cagaacactc agtggaatct tccagctatg gagacacact 1261 acttggcctc agtgattctg aagtggaaga gctagatagt gcccctggaa gtgtcaaaca 1321 gaatggtcct aaaacaccag tacattcttc tggggatatg gtacaaccct tgtcaccatc 1381 tcaggggcag agcactcacg tgcatgatgc ccaatgtgag aacacaccag agaaagaatt 1441 gcctgtaagt cctggtcatc ggaaaacccc attcacaaaa gacaaacatt caagccgctt 1501 ggaggctcat ctcacaagag atgaacttag ggcaaaagct ctccatatcc cattccctgt 1561 agaaaaaatc attaacctcc ctgttgttga cttcaacgaa atgatgtcca aagagcagtt 1621 caatgaagct caacttgcat taattcggga tatacgtagg aggggtaaga ataaagtggc 1681 tgctcagaat tgcagaaaaa gaaaactgga aaatatagta gaactagagc aagatttaga 1741 tcatttgaaa gatgaaaaag aaaaattgct caaagaaaaa ggagaaaatg acaaaagcct 1801 tcacctactg aaaaaacac tcagcacctt atatctcgaa gttttcagca tgctacgtga 1861 tgaagatgga aaaccttatt ctcctagtga atactccctg cagcaaacaa gagatggcaa 1921 tgttttcctt gttcccaaaa gtaagaagcc agatgttaag aaaaactaga tttaggagga 1981 tttgacctt tctgagctag ttttttgta ctattatact aaaagctcct actgtgatgt 2041 gaaatgctca tactttataa gtaattctat gcaaaatcat agccaaaact agtatagaaa 2101 ataatacgaa actttaaaaa gcattggagt gtcagtatgt tgaatcagta gtttcacttt 2161 aactgtaaac aatttcttag gacaccattt gggctagttt ctgtgtaagt gtaaatacta 2221 caaaaactta tttatactgt tcttatgca tttgttatat tcatagattt atatgatgat 2281 atgacatctg gctaaaaaga aattattgca aaactaacca ctatgtactt ttttataaat 2341 actgtatgga caaaaaatgg catttttat attaaattgt ttagctctgg caaaaaaaaa 2401 aaatttaag agctggtact aataaaggat tattatgact gttaaa
[0098] In some embodiments, the oncogene is epidermal growth factor receptor (EGFR). EGFR is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor, thereby inducing receptor dimerization and tyrosine autophosphorylation, leading to cell proliferation. Mutations in this gene are associated with lung cancer. EGFR is a component of the cytokine storm that contributes to severe forms of COVID-19 resulting from infection with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2). In some embodiments, the L858R mutation (highlighted in SEQ ID NOs: 16 and 17 below) creates a de novo PAM (CTG→CGG) in EGFR.
[0099] SEQ ID NO:16 TIFF2024540513000003.tif38160TIFF2024540513000004.tif224161TIFF2024540513000005.tif223161TIFF2024540513000006.tif191160
[0100] SEQ ID NO:17 TIFF2024540513000007.tif13161TIFF2024540513000008.tif126161
[0101] R34G NRF2 sgRNA (SEQ ID NO:18): 60 agccuuauuu uaacuugcua uuucuagcuc uaaaac 96
[0102] [Example] The present disclosure is further defined in the following examples. It should be understood that these examples, while indicating exemplary embodiments of the present disclosure, are given by way of illustration only.
[0103] [Example 1] Biodistribution of adenovirus after subcutaneous or intratumoral injection in H1703 non-small cell lung cancer (NSCLC) human xenograft mouse model The biodistribution of adenovirus after intratumoral injection was measured in mice implanted with wild-type H1703 squamous non-small cell lung cancer cells. H1703 cells were implanted subcutaneously or orthotopically (i.e., in the lung tissue) in mice as described below.
[0104] Subcutaneous injection of H1703 cells Five 6-week-old female athymic nude mice and five female NCG mice are injected subcutaneously with H1703 cells. The subcutaneous injection implants the tumor cells in the left flank in the abdominal fat area. Once injected, these cells grow into solid tumor masses in the mouse model. The H1703 human tumor-derived cell line is cultured at 4 × 10 cells / mL in a total volume of 200 μL of sterile PBS. 6 The mice are injected at a concentration of 0.01 mg / kg / day. This injection is performed while the mouse is restrained with the researcher's non-dominant hand. After injection, the mouse is returned to its home cage and has free access to food and water as usual. As the cells grow, the tumors are measured using calipers at 3-day intervals until the tumor volume reaches at least 1.5 cm in any dimension. If the tumor grows beyond 1.5 cm in any dimension, the mouse is humanely euthanized using CO2 inhalation. The purpose of this experiment is to determine the compatibility of tumor growth between each strain of mouse (athymic nude or NCG). Athymic nude or NCG mice are selected for the remaining experiments depending on the success or failure of tumor growth for each strain.
[0105] Mice will be weighed every 3 days to monitor the health of the animals. If mice lose more than 20% of their body weight during this or subsequent experiments, they will be euthanized appropriately according to the guidelines of this protocol.
[0106] [Table 2]
[0107] Orthotopic injection of H1703 cells H1703 cells are orthotopically administered to five 6-week-old female mice of one of the previously determined strains using surgery to access the dorsal lung. H1703 tumor-derived cells are administered at 1 x 10 in a total volume of 40 μL of sterile PBS. 6 This is done under isoflurane anesthesia. Animals are weighed on the day of surgery and every 3 days thereafter. After injection, mice are returned to their home cages with free access to food and water as usual. Tumors are measured using IVIS bioluminescence or MRI imaging at 3-day intervals until tumor volumes reach ≥1.5 cm in any dimension. Mice are humanely euthanized using CO2 inhalation when tumors grow beyond 1.5 cm in any dimension. The aim of this experiment is to determine the suitability of tumor growth in an orthotopic model using either of the optimized strains of mice (athymic nude or NCG) established in previous experiments.
[0108] [Table 3]
[0109] The tumors were grown to approximately 100 mm before adenovirus injection. 3 The tumors are allowed to grow to a size of 100x the size of 1 ...
[0110] [Table 4]
[0111] Mice are live imaged (ventral and lateral) with luciferase activity using an IVIS luminescence camera. 100 μl of sodium luciferin (1.58 mg / ml, 10 μg / g body weight) is injected intraperitoneally 5 min prior to imaging. In vivo imaging of luciferase expression using IVIS is performed 1, 2, 3, 6, 10, 15, and 18 days after virus injection, and body weights are recorded.
[0112] Cohorts of 5 Ad-CMV-Luc mice (or 4 PBS mice) are euthanized and tumor and peripheral tissues (lung, liver, blood, spleen, thymus, pancreas, stomach, intestine, kidney, heart, ovary, brain) are harvested at 1, 3, 6, and 18 days after virus injection. Tumor cell identity is confirmed by sequencing.
[0113] In vivo bioluminescence imaging (IVIS) is calculated as the photon flux or RLU (ln) of each viral PFU tested.
[0114] For viral genome quantification, DNA is isolated from tumor and peripheral tissues using the Dneasy blood and tissue kit (Qiagen 69504). Viral genome quantification in tissue and tumor samples is performed by real-time PCR using the Adeno-X qPCR Titration kit (product no. 632252).
[0115] Expression of the luciferase transgene in tissues is determined by lysing cells of tumor and peripheral tissues with Promega lysis buffer. Luciferase gene expression is measured using the Bright-Glo Luciferase Assay system (Promega, E2620).
[0116] Hepatotoxicity takes into account virus-induced damage to liver cells and is determined by measuring serum ALT (alanine aminotransferase) and AST (aspartate aminotransferase) using ELISA.
[0117] [Example 2] Dosing and in vivo efficacy for treatment of subcutaneous or lung tumors The treatment window is based on the tumor growth curve established for subcutaneous injection in Example 1 above. It is estimated to be between 4 and 6 weeks after subcutaneous injection of tumor cells. As performed in Example 2, the same subcutaneous injection will result in tumors of 80-100 mm in size. 3 When the concentration reached 2 × 10 in 100 μL, 8 MOI of adenovirus or 1 x 10 in 100 µL 11 An MOI of AAV is delivered directly to the tumor mass. If this dose is not sufficient to induce a change in chemotherapy response, the dose is adjusted. The orthotopic injection window and therapeutic window are determined based on tumor growth curves established in previous experiments. A second minor surgery is used to inject either adenovirus or AAV directly into the lung tumor. The animal groups used for each type of injection are shown in Table 5 below.
[0118] [Table 5]
[0119] The efficacy of CRISPR-guided intervention will also be tested in combination with chemotherapy treatment. Cisplatin will be delivered via tail vein injection at a dose of 3 mg / kg every 3 days for 10 days, for a total of 4 cycles. Tumor size will be assessed using calipers. Different formulations and additional dose ranges of the targeted gene editing tool will be tested to optimize the treatment effect.
[0120] [Example 3] Evaluation of adenovirus serotype 5 vectors encoding one or three sgRNAs targeting R34G NRF2 in lung cancer cells and comparison of a single adenovirus 5 vector encoding Cas9 and the R34G NRF2 sgRNA with a dual vector system containing separate adenovirus vectors encoding either Cas9 or the three R34G NRF2 sgRNAs in lung cancer cells A schematic diagram of the adenovirus serotype 5 vectors evaluated in this study is shown in Figure 1. Treatment group 1 was a single vector encoding one copy of the R34G NRF2 sgRNA (SEQ ID NO: 18) driven by the U6 promoter, and treatment group 2 was a single vector encoding three copies of the R34G NRF2 sgRNA driven by the U6, H1, or 7SK promoters. Both vectors also encoded wild-type Streptococcus pyogenes Cas9 (spCas9) driven by the CMV promoter with one copy of an NLS fused within the C-terminus of spCas9. The spCas9 cassette was obtained from SignaGen Laboratories. Treatment groups 3 and 4 were essentially the same as 1 and 2, except that the 20 base pairs encoding the DNA binding domain of the R34G NRF2 gRNA were replaced with a scrambled DNA sequence as a negative control. Treatment group 5 contained a dual vector system, with one vector encoding three copies of the R34G NRF2 gRNA but lacking an spCas9 cassette, and the other vector containing a CMV promoter-containing spCas9 cassette but lacking a gRNA cassette.
[0121] Figure 2 shows the percentage of indels after infection of lung cancer cells with different adenoviral vectors at different MOI PFU / ml, e.g., MOI 100, 500, 2500, 5000. 72 hours after infection, gDNA was collected and subjected to Sanger sequencing. The percentage of indels was analyzed using DECODR. Figure 43 shows the percentage of indels for lung cancer C26-8 cells (left) and lung cancer C44-25 cells (right). Both of these squamous non-small cell lung cancer cell lines were derived from the parental H1703 cell line by engineering them to contain a homozygous R34G mutation in the NRF2 gene. From the bottom to the top of each figure, the first group is labeled UT, indicating that the cells were not treated (negative control). The second group from the bottom was transduced with pAD-U6H17SK-R34G only (negative control), so no indel formation was observed. The third group, labeled pAD-CMV-Cas9, was transfected with Cas9 alone (negative control) and showed no or background levels of indel formation. The fourth group from the bottom is pAD-U6H17SK-R34G-CMV-Cas9 (3 copies of sgRNA + Cas9), and showed increased indel formation compared to the negative control. The fifth group from the bottom is pAD-U6-R34G-CMV-Cas9 (1 copy of sgRNA + Cas9) infected cells. In this fifth group, containing one copy of sgRNA, the same level of indel formation was observed as in the fourth group, containing three copies of sgRNA. The sixth group of cells was infected with a dual vector, providing three copies of R34G NRF2 sgRNA in one vector and spCas9 in a separate pAD-CMV-Cas9 vector. This sixth group also showed similar levels of indel formation as the fourth and fifth groups.
[0122] In summary, vectors carrying one or three copies of R34G gRNA showed similar gene editing efficacy in two transduced lung cancer cell lines, and the integrated vector performed as well as or better than the dual vector in terms of gene editing.
[0123] [Example 4] Comparison of transduction efficiency of AAV6 and adenovirus in lung cancer cells To compare the transduction efficiency in lung cancer cells between AAV6 and adenovirus, both vectors expressing GFP were transduced into lung cancer cells, and the degree of GFP expression 48 hours after transduction was evaluated by flow cytometry. As shown in Figure 3, adenovirus efficiently transduced cells at a low multiplicity of infection (MOI) of 10 (lower row), which exceeded the highest MOI of AAV6 tested, 4 million (upper row). The numbers in the upper right corner of the scale bar represent the percentage of GFP-positive cells, and the numbers in the left corner of each image indicated the mean fluorescence intensity (MFI) of GFP. This data indicated that adenovirus vectors have a higher transduction efficiency in lung cancer cells than AAV6 vectors.
[0124] Since the size of GFP is only a fraction of the size of the Cas9 protein, we also compared the possibility of directly expressing Cas9 in lung cancer cells using AAV6 and adenovirus. The experiment was divided into stages. In the first stage, cells were treated with nucleic acid encoding Cas9 for 4 days. The nucleic acid encoding Cas9 was delivered by AAV6 or adenovirus vectors. In the second stage, sufficient LNP containing R34G sgRNA was delivered 4 days after infection with AAV6 or adenovirus. Cells were transfected with R34G gRNA using the reagent RNAiMax purchased from Thermo Fisher Scientific. gDNA was harvested from these cells on day 5, and PCR amplicons flanking the R34G mutation were subjected to Sanger sequencing. The treatment groups in the order shown in Figure 4 (top to bottom) are described below.
[0125] R34G gRNA control: cells treated with R34G gRNA but not with the Cas9 construct (negative control).
[0126] Ad-CMV-Cas9 50: cells treated with adenovirus encoding Cas9 under the transcriptional control of the CMV promoter at an MOI of 50, but not with the gRNA construct (negative control).
[0127] Ad-CMV-Cas9 100: cells treated with 1) adenovirus encoding Cas9 under the transcriptional control of the CMV promoter at an MOI of 100, and 2) with LNP-mediated R34G sgRNA on day 4.
[0128] Ad-CMV-Cas9 50: 1) cells treated with adenovirus encoding Cas9 under the transcriptional control of the CMV promoter at an MOI of 50, and 2) treated with LNP-mediated R34G sgRNA on day 4.
[0129] Ad-CMV-Cas9 10: 1) cells treated with adenovirus encoding Cas9 under the transcriptional control of the CMV promoter at an MOI of 10, and 2) cells treated with LNP-mediated R34G sgRNA on day 4.
[0130] AAV6-EF1as-Cas9-4e6: 1) 4 × 10 AAV6 encoding Cas9 under the transcriptional control of the core EF1α short (as) promoter 6 and 2) cells treated with LNP-mediated R34G sgRNA on day 4.
[0131] AAV6-EF1as-Cas9-1e6: 1) 1 × 10 AAV6 encoding Cas9 under the transcriptional control of the core EF1α short (as) promoter 6 and 2) cells treated with LNP-mediated R34G sgRNA on day 4.
[0132] Cas9 / R34G CrisprMax™: cells treated with 1) LNPs containing Cas9 protein (CrisprMax™) and 2) R34G sgRNA via the LNPs on day 4 (positive control).
[0133] Mock: cells not treated with Cas9 or sgRNA constructs (negative control).
[0134] As shown in Figure 4, adenoviral vectors were superior in reconstituting Cas9 expression compared to AAV6 vectors in which Cas9 expression is driven by the core EF1α short promoter, as further evidenced by the efficacy of overall gene editing. The reason why the EF1α short promoter was selected for the AAV vector expressing Cas9 is because AAV vectors do not have the size capacity to contain a complete CMV promoter. The data showed that when a high multiplicity of infection (MOI) of 4 million AAV6 was used, 70-80% of cells remained unedited, whereas when a low MOI of 10 adenoviral vector was used, only 10% of cells remained unedited, i.e., more than 90% of cells were gene edited with the adenoviral vector. In this experiment, we designed an R34G sgRNA based on the R34G mutation in the human NEF2L2 gene, which encodes the NRF2 protein. These results indicate that adenoviral vectors are much more effective than AAV vectors for expressing Cas9 in lung cancer cells.
[0135] [Example 5] Athymic Nude Mouse Background: Athymic nude mice are often used in cancer research because they are immunodeficient mice. These mice carry a homozygous mutation in the Foxn1 gene that causes thymus hypofunction or absence. T lymphocytes mature in the thymus and are involved in the host's transplantation response. Thus, the absence of a thymus in this mouse model allows tumor growth and development when human cancer cells are injected subcutaneously. Another advantage of this model is that the tumors can be easily observed because the mice do not have hair. Relative luciferase expression was graphed as fold change over control / uninjected mice (Figure 5). No biodistribution was observed in the lungs, spleen, brain, ovaries, or liver, but 25,000- to 45,000-fold increased expression was observed in tumor samples injected with LNP3, 4, and 5.
[0136] Biodistribution (qRTPCR) of intratumoral delivery of LNP / fLuc to H1703(44-25) grown subcutaneously in the NCG mouse background Materials and Methods: Quantitative PCR was performed to analyze the biodistribution of luciferase-expressing LNPs. Briefly, RNA was extracted from tissue samples using the TRIzol RNA extraction protocol described by the manufacturer (Invitrogen). Then, 250 ng of complementary DNA (cDNA) per reaction was synthesized using the Applied Biosystems High-Capacity RNA-to-cDNA kit, and qPCR was performed in triplicate using Fast SYBR Green Master Mix. Table 6 shows the primer sequences used. Samples were run on a Bio-Rad CFX384 real-time PCR detection system according to the manufacturer's conditions. After 20 seconds at 95°C, 40 cycles of 95°C for 30 seconds and 60°C for 30 seconds were performed. Relative quantification of each transcript was performed using 20% qPCR. (-Ct) / 2 (CtGapdh) The expression was calculated by normalizing the amount of Gapdh transcript according to the formula:
[0137] [Table 6]
[0138] [Example 6] Intratumoral delivery of LNP / fLuc to H1703(44-25) grown subcutaneously in nude mice (4-hour and 24-hour IVIS data) The goal of this experiment is to visualize the expression of luciferase mRNA after intratumoral injection. Luciferase mRNA-containing lipid nanoparticles were injected into subcutaneous tumors of athymic nude mice. Images were taken 4 and 24 hours after injection. Figure 6 shows that all of the LNP / fLuc delivered directly to the tumor led to the expression of the fLuc gene in the tumor area.
[0139] Materials and Methods Animal testing All experiments with mice were performed in accordance with animal welfare guidelines and protocols approved by the Institutional Animal Care and Use Committee of the University of Delaware. Tumors were implanted in 6- to 8-week-old athymic nude female mice (Charles River) at 5 × 10 6 Tumors were generated by subcutaneous implantation of human lung squamous cell-derived H1703 clone 44-25. Tumor growth was measured and estimated using calipers, and the volume (mm 3 ) = (length [mm] × (width [mm]) 2 The calculation was made based on the ratio of 0.5 to 60. 3 Once the mice reached 10 μg / mL, they were divided into experimental groups. Intratumoral injections were performed with 2 μg of LNPs in a total volume of 25 μL purchased from Precision Nanosystems.
[0140] Bioluminescence imaging Bioluminescence imaging was performed using an IVIS Spectrum imaging system (Caliper Life Sciences). Mice were administered d-luciferin (Promega) intraperitoneally at a dose of 150 mg / kg. Five minutes after d-luciferin administration, mice were anesthetized in a chamber containing 3% isoflurane and placed on the imaging platform with 3% isoflurane maintained via a nose cone. Mice were imaged 15 minutes after d-luciferin administration using an exposure time of 1 second or greater. Bioluminescence values were quantified by measuring the photon flux (photons / second) in the area of interest where the bioluminescent signal was emitted using Living IMAGE Software provided by Caliper (Hopkinton, MA).
[0141] [Example 7] Delivery of adenoviral vector (fLuc) in H1703(44-25) subcutaneous xenograft model Adenovirus containing a firefly luciferase transgene was used to evaluate intratumoral delivery and expression in a xenograft mouse model. CRISPR-engineered human lung squamous cell carcinoma cell line H1703 44-25 was implanted subcutaneously. Tumors were 60-150 mm 3 When the mouse reaches a size of 1.5e 9 pfu Ad5-CMV-fLuc (SignaGen Laboratories) was injected intratumorally at three sites within the tumor. Mice were subjected to bioluminescence imaging at 1, 2, 4, 10, and 16 days after injection. Figure 7 shows the time course of bioluminescence signal after intratumoral injection. Signal from each tumor was quantified by setting regions of interest (ROI) in the tumor. ROI values are reported as total flux photons for each tumor. In both mice with different sized tumors, strong signals were generated at comparable ROIs 1 day after intratumoral injection. Signal increased over the 16-day time course and plateaued.
[0142] Materials and Methods Animal testing All experiments with mice were performed in accordance with animal welfare guidelines and protocols approved by the Institutional Animal Care and Use Committee of the University of Delaware. Tumors were implanted in 6- to 8-week-old NCG female mice (Charles River) at 5 × 10 6 Tumors were generated by subcutaneous implantation of human lung squamous cell-derived H1703 clone 44-25. Tumor growth was measured and estimated using calipers, and the volume (mm 3 ) = (length [mm] × (width [mm]) 2 The calculation was made based on the ratio of 0.5 to 60. 3 When the mice reached 100 mg / kg, they were divided into experimental groups. Adenovirus injections were performed using Ad5-CMV-fLuc purchased from SignaGen Laboratories at 1.5 e in a total volume of 30 μL. 9 It was done at pfu.
[0143] Bioluminescence imaging Bioluminescence imaging was performed using an IVIS Spectrum imaging system (Caliper Life Sciences). Mice were administered d-luciferin (Promega) intraperitoneally at a dose of 150 mg / kg. Five minutes after d-luciferin administration, mice were anesthetized in a chamber containing 3% isoflurane and placed on the imaging platform with 3% isoflurane maintained via a nose cone. Mice were imaged 15 minutes after d-luciferin administration using an exposure time of 1 second or greater. Bioluminescence values were quantified by measuring the photon flux (photons / second) in the area of interest where the bioluminescent signal was emitted using Living IMAGE Software provided by Caliper (Hopkinton, MA).
[0144] [Example 8] Delivery of adenoviral vectors targeting Nrf2 in the H1703(44-25) subcutaneous xenograft model We used a CRISPR / Cas9-containing adenovirus targeting NRF2 to evaluate intratumoral delivery and expression in a xenograft mouse model. The CRISPR-engineered human lung squamous cell carcinoma cell line H1703 44-25 was implanted subcutaneously. Tumors were 60–150 mm 3 When the mouse reaches a size of 3.6e 9Tumors were injected with pfu of Ad-U6-R34G-CAG-eSpCas9 or were left untreated. Figure 8 shows a schematic diagram of Ad-U6-R34G-CAG-eSpCas9 used with a U6 promoter driving R34G-targeting sgRNA (SEQ ID NO: 25) expression. 48 hours after intratumoral injection, tumors were harvested for immunohistochemical staining and analysis. Immunostained tumor tissues were imaged and analyzed for Cas9 localization and expression. As shown in Figure 9, the top panel of images shows treated and untreated tumors at 5x and 2.5x magnification, and the bottom panel of images shows 20x magnification. DAB staining was used to visualize the localization of the signal within the tumor sections. As seen in Ad-U6-R34G-CAG-eSpCas9-treated tumor tissues, there is signal (dark brown reaction) throughout the tumor sections, in contrast to the clear and uniform images obtained from untreated tumor sections.
[0145] Materials and Methods Animal testing All experiments with mice were performed in accordance with animal welfare guidelines and protocols approved by the Institutional Animal Care and Use Committee of the University of Delaware. Tumors were implanted in 6- to 8-week-old NCG female mice (Charles River) at 5 × 10 6 Tumors were generated by subcutaneous implantation of human lung squamous cell-derived H1703 clone 44-25. Tumor growth was measured and estimated using calipers, and the volume (mm 3 ) = (length [mm] × (width [mm]) 2 The calculation was made based on the ratio of 0.5 to 60. 3 When the mice reached 100 mg / kg, they were divided into experimental groups. Adenovirus injections were performed using Ad-U6-R34G-CAG-eSpCas9 purchased from Vector Biolabs at 3.6 e in a total volume of 30 μL. 9 It was done at pfu.
[0146] immunohistochemistry Tumor tissues were fixed overnight at 4°C with 4% paraformaldehyde in 1x PBS. Cas9 labeling was performed using immunohistochemistry on fixed tumor tissues. Tumors were frozen, sectioned at 10 μm, and directly mounted on slides. After blocking with 5% normal goat serum (Vector), rabbit anti-Cas9 primary antibody (Abcam) was applied directly to each section at a dilution of 1:100 in incubation buffer (1% BSA in PBS). To prevent drying, the primary antibody was incubated overnight at 4°C in a humidity chamber. Goat anti-rabbit biotinylated secondary antibody (Vector) was applied directly to each section at a dilution of 1:200 in incubation buffer. The secondary antibody was incubated for 1 h at room temperature. Detection was performed using the ABC Elite HRP kit (Vector) according to the kit protocol. Staining was performed with DAB, and slides were counterstained with hemotoxylin. Slides were then dehydrated in ethanol / xylene and permanently mounted with Acrytol. Slides were imaged with a LEICA DMIL LED microscope.
[0147] [Example 9] Delivery of Nrf2-targeted adenoviral vectors in NCI PDMR PDXs We used CRISPR / Cas9-containing adenovirus targeting NRF2 to evaluate intratumoral delivery and expression in a patient-derived xenograft mouse model. Human lung squamous cell carcinoma tumor fragments (NCI PMDR) were implanted subcutaneously. Tumors were 60–150 mm 3 When the mouse reaches a size of 3.6e 9Tumors were injected intratumorally with pfu of Ad-U6-R34G-CAG-eSpCas9 (schematically shown in Figure 8) or without any treatment. 48 hours after intratumoral injection, tumors were harvested for immunohistochemical staining and analysis. Immunostained tumor tissues were imaged and analyzed for Cas9 localization and expression. As shown in Figure 10, the top panel of images shows treated and untreated tumors at 2.5x magnification, and the bottom panel of images shows 20x magnification. DAB staining was used to visualize the localization of the signal within the tumor sections. As seen in Ad-U6-R34G-CAG-eSpCas9-treated tumor tissues, there is signal (dark brown reaction) throughout the tumor sections, in contrast to the clear and uniform images obtained from untreated tumor sections.
[0148] Materials and Methods Animal testing All mouse experiments were performed in accordance with animal welfare guidelines and protocols approved by the Institutional Animal Care and Use Committee of the University of Delaware. Tumors were generated by subcutaneous implantation of human lung squamous cell carcinoma tumor-derived PDX fragments (obtained from NCI PDMR, specimen ID 073-R) in 6- to 8-week-old NCG female mice (Charles River). Tumor growth was measured and estimated using calipers and volume (mm 3 ) = (length [mm] × (width [mm]) 2 The calculation was made based on the ratio of 0.5 to 60. 3 When the mice reached 100 mg / kg, they were divided into experimental groups. Adenovirus injections were performed using Ad-U6-R34G-CAG-eSpCas9 purchased from Vector Biolabs at 3.6 e in a total volume of 30 μL. 9 It was done at pfu.
[0149] immunohistochemistry Tumor tissues were fixed overnight at 4°C with 4% paraformaldehyde in 1x PBS. Cas9 labeling was performed using immunohistochemistry on fixed tumor tissues. Tumors were frozen, sectioned at 10 μm, and directly mounted on slides. After blocking with 5% normal goat serum (Vector), rabbit anti-Cas9 primary antibody (Abcam) was applied directly to each section at a dilution of 1:100 in incubation buffer (1% BSA in PBS). To prevent drying, the primary antibody was incubated overnight at 4°C in a humidity chamber. Goat anti-rabbit biotinylated secondary antibody (Vector) was applied directly to each section at a dilution of 1:200 in incubation buffer. The secondary antibody was incubated for 1 h at room temperature. Detection was performed using the ABC Elite HRP kit (Vector) according to the kit protocol. Staining was performed with DAB, and slides were counterstained with hemotoxylin. Slides were then dehydrated in ethanol / xylene and permanently mounted with Acrytol. Slides were imaged with a LEICA DMIL LED microscope.
[0150] [Example 10] Delivery of adenoviral vectors targeting Nrf2 in H1703(44-25) We used CRISPR / Cas9-containing adenovirus targeting NRF2 to evaluate intratumoral delivery and efficacy in a xenograft mouse model. CRISPR-engineered human lung squamous cell carcinoma cell line H1703 44-25 was implanted subcutaneously. Tumors were 60–150 mm 3 When the mouse reaches the size of 3.6.5e 9 pfu of A) Ad-U6H17SK-R34G-CAG-eSpCas9 (Vector Biolabs) or B) Ad-U6H17SK-scramble-CAG-eSpCas9 (Vector Biolabs) (schematically shown in FIG. 11) were administered to 1.08 e 10pfu. Figure 11A shows a schematic diagram of Ad-U6H17SK-R34G-CAG-eSpCas9 with U6, H1 and 7SK promoters driving R34G targeting sgRNA (GATATAGATCTTGGAGTAAG, SEQ ID NO: 25) expression followed by chicken beta actin (CAG) promoter driving enhanced SpCas9 expression. Figure 11B shows a schematic diagram of Ad-U6H17SK-scrambled-CAG-eSpCas9 with U6, H1 and 7SK promoters driving scrambled targeting sgRNA (GCACTACCAGAGCTAACTCA, SEQ ID NO: 26) expression followed by chicken beta actin (CAG) promoter driving enhanced SpCas9 expression. Mice were treated with 12.5 mg / kg carboplatin and 5 mg / kg paclitaxel (intravenous injection) on days 3 and 10 as indicated by * on the x-axis. Animals were monitored for 22 days after injection. Results showed that mice treated with combination therapy with NRF2-targeted adenovirus had smaller tumor size at the time of sacrifice. Mice treated with combination therapy with scrambled adenovirus reached endpoint tumor size by day 14. All tumors were collected at sacrifice for further analysis.
[0151] Materials and Methods Animal testing All experiments with mice were performed in accordance with animal welfare guidelines and protocols approved by the Institutional Animal Care and Use Committee of the University of Delaware. Tumors were implanted in 6- to 8-week-old NCG female mice (Charles River) at 5 × 10 6 Tumors were generated by subcutaneous implantation of human lung squamous cell-derived H1703 clone 44-25. Tumor growth was measured and estimated using calipers, and the volume (mm 3 ) = (length [mm] × (width [mm]) 2 The calculation was made based on the ratio of 0.5 to 60. 3When the mice reached 100 mg / kg, they were divided into experimental groups. Adenovirus injections were performed using 3.6 eL of Ad-U6H17SK-R34G-CAG-eSpCas9 or Ad-U6H17SK-scrambled-CAG-eSpCas9 purchased from Vector Biolabs in 30 μL. 9 pfu were administered every other day. Carboplatin at 12.5 mg / kg and paclitaxel at 5 mg / kg were administered intravenously in two doses to xenografted mice. In some experiments, tumors were 1500 mm 3 Upon reaching a tumor size of 10 μg / mL, mice were euthanized and tumors were surgically removed and processed for histopathology or genomic DNA.
[0152] [Example 11] Targeting efficiency of intratumoral delivery of Cas9 using adenovirus vectors To evaluate the activity and efficiency of the NRF2-targeted adenovirus, tumors were excised from the experimental mice and genomic DNA was isolated. Once genomic DNA was isolated, the region of interest NRF2 was PCR amplified and the PCR amplicons were used for Sanger sequencing. Sanger sequencing of each sample was used to evaluate the indel efficiency of the CRISPR target site using DECODR software, which unconvolutes sequence chromatograms. Figure 13 shows the DECODR analysis output for each sample per experiment. Figure 13A shows the results of the 3.6e 9 Figure 13B shows the sequencing results from Example 9, which consists of a single injection of pfu of Ad-U6-R34G-CAG-eSpCas9. The results show two samples with CRISPR efficiencies of 2.6% and 5.4%. Figure 13B shows data from an experiment not described but performed similarly to Example 10. The results show five samples with CRISPR efficiencies of 0%, 5.5% and 50.8%. Figure 13C shows the sequencing results from Example 10. The results show four samples with CRISPR efficiencies of 0% and 3.3%.
[0153] Materials and Methods Gene editing analysis Cellular genomic DNA was isolated from each clonal cell line using DNeasy Blood and Tissue kit (Qiagen). Regions surrounding the CRISPR target sites were PCR amplified using Q5 High-Fidelity 2x Master Mix (New England BioLabs) (FWD primer - CACCATCAACAGTGGCATAATGTGAA (SEQ ID NO: 27); REV primer - AACTCAGGTTAGGTACTGAACTCATCA (SEQ ID NO: 28)). PCR reactions were purified using QIAquick PCR Purification kit (Qiagen) and Big Dye Terminator PCR was performed using Big Dye Terminator v3.1 (Thermofisher). PCR products were purified once more using Big Dye Xterminator kit (Thermofisher) and then sequenced using a SeqStudio Genetic Analyzer (Applied Biosystems). Sequence analysis was performed using the software program DECODR, available on the Decodr website.
[0154] [Example 12] Intratumoral delivery of LNP / fLuc into H1703(44-25) grown subcutaneously in NCG mice Lipid nanoparticles (LNPs) packaged with firefly luciferase mRNA were used to evaluate intratumoral delivery and expression in a xenograft mouse model. CRISPR-engineered human lung squamous cell carcinoma cell line H1703 44-25 was implanted subcutaneously. Tumors were 60–150 mm 3Mice were injected intratumorally with 2 μg of LNP-mixed tumors when tumor size reached 10 μg. Bioluminescence imaging was performed in mice at 4 and 24 hours after injection. Figure 14 shows the time course of bioluminescence signal after intratumoral injection. Signal from each tumor was quantified by setting a region of interest (ROI) in the tumor. The ROI value is reported as the total flux photons of each tumor. All six LNPs tested produced strong signals at comparable ROIs 4 hours after intratumoral injection in mice. The signal increased at 24 hours after injection.
[0155] Materials and Methods Animal testing All experiments with mice were performed in accordance with animal welfare guidelines and protocols approved by the Institutional Animal Care and Use Committee of the University of Delaware. Tumors were implanted in 6- to 8-week-old NCG female mice (Charles River) at 5 × 10 6 Tumors were generated by subcutaneous implantation of human lung squamous cell-derived H1703 clone 44-25. Tumor growth was measured and estimated using calipers, and the volume (mm 3 ) = (length [mm] × (width [mm]) 2 The calculation was made based on the ratio of 0.5 to 60. 3 Once the mice reached 10 μg / mL, they were divided into experimental groups. Intratumoral injections were performed with 2 μg of LNPs in a total volume of 25 μL purchased from Precision Nanosystems.
[0156] Bioluminescence imaging Bioluminescence imaging was performed using an IVIS Spectrum imaging system (Caliper Life Sciences). Mice were administered d-luciferin (Promega) intraperitoneally at a dose of 150 mg / kg. Five minutes after d-luciferin administration, mice were anesthetized in a chamber containing 3% isoflurane and placed on the imaging platform with 3% isoflurane maintained via a nose cone. Mice were imaged 15 minutes after d-luciferin administration using an exposure time of 1 second or greater. Bioluminescence values were quantified by measuring the photon flux (photons / second) in the area of interest where the bioluminescent signal was emitted using Living IMAGE Software provided by Caliper (Hopkinton, MA).
[0157] [Example 13] Lipid nanoparticles (LNPs) packaged with firefly luciferase mRNA were used to evaluate intratumoral delivery and expression in a patient-derived xenograft mouse model. Human lung squamous cell carcinoma tumor fragments were implanted subcutaneously. Tumors were 60–150 mm 3 When tumors reached a size of 100 μg, mice were injected intratumorally with 2 μg of LNP-mixed tumors. Bioluminescence imaging was performed in mice at 4 and 24 hours after injection. Figure 15 shows the time course of bioluminescence signal after intratumoral injection. Signal from each tumor was quantified by setting a region of interest (ROI) in the tumor. The ROI value is reported as the total flux photons of each tumor. All four LNPs tested produced strong signals at comparable ROIs 4 hours after intratumoral injection in mice. The signal increased at 24 hours after injection.
[0158] Materials and Methods Animal testing All experiments with mice were performed in accordance with animal welfare guidelines and protocols approved by the Institutional Animal Care and Use Committee of the University of Delaware. Tumors were generated by subcutaneous implantation of PDX fragments derived from human lung squamous cell carcinoma tumors (obtained from Jackson Laboratories, model TM00244) in 6- to 8-week-old NCG female mice (Charles River). Tumor growth was measured and estimated using calipers and volume (mm 3 ) = (length [mm] × (width [mm]) 2 The calculation was made based on the ratio of 0.5 to 60. 3 Once the mice reached 10 μg / mL, they were divided into experimental groups. Intratumoral injections were performed with 2 μg of LNPs in a total volume of 25 μL purchased from Precision Nanosystems.
[0159] Bioluminescence imaging Bioluminescence imaging was performed using an IVIS Spectrum imaging system (Caliper Life Sciences). Mice were administered d-luciferin (Promega) intraperitoneally at a dose of 150 mg / kg. Five minutes after d-luciferin administration, mice were anesthetized in a chamber containing 3% isoflurane and placed on the imaging platform with 3% isoflurane maintained via a nose cone. Mice were imaged 15 minutes after d-luciferin administration using an exposure time of 1 second or greater. Bioluminescence values were quantified by measuring the photon flux (photons / second) in the area of interest where the bioluminescent signal was emitted using Living IMAGE Software provided by Caliper (Hopkinton, MA).
[0160] [Example 14] Intratumoral delivery of LNP / fLuc to NCI PDXs grown subcutaneously in the NCG mouse background Lipid nanoparticles (LNPs) packaged with firefly luciferase mRNA were used to evaluate intratumoral delivery and expression in a patient-derived xenograft mouse model. Human lung squamous cell carcinoma tumor fragments were implanted subcutaneously. Tumors were 60–150 mm 3 When the tumor reached a size of 10 μg, mice were intratumorally injected with 2 μg of LNP-mixed tumors. Bioluminescence imaging was performed on the mice at 4 and 24 hours after injection. Figure 16 shows the time course of bioluminescence signal after intratumoral injection. Signal from each tumor was quantified by setting a region of interest (ROI) on the tumor. The value of the ROI is listed as the total flux photons of each tumor. 24 hours after intratumoral injection in mice, the LNP mixture tested produced a signal as strong as the previous ROIs in Examples 12 and 13.
[0161] Materials and Methods Animal testing All mouse experiments were performed in accordance with animal welfare guidelines and protocols approved by the Institutional Animal Care and Use Committee of the University of Delaware. Tumors were generated by subcutaneous implantation of human lung squamous cell carcinoma tumor-derived PDX fragments (obtained from NCI PDMR, specimen ID 073-R) in 6- to 8-week-old NCG female mice (Charles River). Tumor growth was measured and estimated using calipers and volume (mm 3 ) = (length [mm] × (width [mm]) 2 The calculation was made based on the ratio of 0.5 to 60. 3 Once the mice reached 10 μg / mL, they were divided into experimental groups. Intratumoral injections were performed with 2 μg of LNPs in a total volume of 25 μL purchased from Precision Nanosystems.
[0162] Bioluminescence imaging Bioluminescence imaging was performed using an IVIS Spectrum imaging system (Caliper Life Sciences). Mice were administered d-luciferin (Promega) intraperitoneally at a dose of 150 mg / kg. Five minutes after d-luciferin administration, mice were anesthetized in a chamber containing 3% isoflurane and placed on the imaging platform with 3% isoflurane maintained via a nose cone. Mice were imaged 15 minutes after d-luciferin administration using an exposure time of 1 second or greater. Bioluminescence values were quantified by measuring the photon flux (photons / second) in the area of interest where the bioluminescent signal was emitted using Living IMAGE Software provided by Caliper (Hopkinton, MA).
[0163] [Example 15] AAV tropism evaluation of AAV5 and AAV6 in a human xenograft mouse model of H1703 non-small cell lung cancer (NSCLC) Objective: To determine the in vivo transduction efficiency of two AAV serotypes, AAV5 and AAV6, expressing firefly luciferase using the H1703 NSCLC human xenograft model in female NCG mice and assessed by bioimaging.
[0164] [Table 7]
[0165] procedure CR female NCG mice were treated with 5 × 10 6 H1703 tumor cells were injected subcutaneously in the flank. The cell injection volume was 0.1 mL / mouse. The age of the mice at the start of the study was 8-12 weeks. The average tumor size was 60-100 mm. 3 When the animals reached a maturity of about 80 mm, they were paired and treatment was started. 3The mean tumor size of 100 mm was targeted. Day 1 was defined as the day of AAV administration. Mice were weighed daily, and tumor size was measured with a caliper every other week until the end of the experiment. Mice that showed a weight loss of 30% or more in one session or 25% or more in three consecutive sessions were euthanized. The endpoint of the experiment was a mean tumor weight of 2000 mm in the control group. 3 All animals were euthanized upon reaching the endpoint.
[0166] AAV5-fLUC and AAV6-fLUC containing the firefly luciferase gene under the transcriptional control of the chicken actin promoter (CAG) were administered intratumorally in PBS at a volume of 0.05 mL / mouse on day 1.
[0167] Whole-body in vivo bioluminescence imaging was performed at a total of seven time points, as described below.
[0168] All groups: All animals - Day 2 (1 day after AAV injection)
[0169] All groups: All animals - Day 3 (2 days after AAV injection)
[0170] All groups: Animals days 2, 3, 5, 6, 7 - 4 (3 days after AAV injection)
[0171] All groups: Animals days 2, 3, 5, 6, 7 - 6 (4 days after AAV injection)
[0172] All groups: Animals days 2, 3, 5, 6, 7 - 8 (7 days after AAV injection)
[0173] All groups: animals days 2, 3, 5, 6, 7 - 9 (8 days after AAV injection)
[0174] All groups: animals days 2, 3, 5, 6, 7 - 10 (9 days after AAV injection)
[0175] All groups: animals days 2, 3, 5, 6, 7 - 13 (12 days after AAV injection)
[0176] All groups: Animals days 2, 3, 5, 6, 7 - 15 (14 days after AAV injection)
[0177] All groups: animals days 2, 3, 5, 6, 7 - 17 (16 days after AAV injection)
[0178] All groups: Animals days 2, 3, 5, 6, 7 - 20 (19 days after AAV injection)
[0179] Luciferase substrate (D-luciferin) was administered intraperitoneally at 150 mg / kg, 10 mL / kg (2 separate injections) based on the most recent body weight. Dorsolateral images were taken 10 min after substrate injection. Imaging was performed under anesthesia.
[0180] For ex vivo bioluminescence imaging, luciferase substrate (D-luciferin) was administered intraperitoneally at 150 mg / kg, 10 mL / kg (2 separate injections) based on recent body weight, prior to sampling. Ex vivo bioluminescence imaging of sampled tissues was performed at a total of two time points, as described below.
[0181] All groups: animals 1, 4, 8 - 4 days (3 days after AAV injection)
[0182] All groups: Animals days 2, 5, 7 - 21 (20 days after AAV injection)
[0183] In order to photograph all organs per animal, two images were taken per animal, for a total of 24 images (n = 3 animals from each of the two groups, two time points, two images per animal).
[0184] result As shown in Figure 17, mice administered AAV6-fLUC virus showed greater bioluminescence from day 3 compared to mice administered AAV5-fLUC. These results indicate that AAV6 showed higher transduction efficiency against the lung cancer cell line H1703 in vivo compared to AAV5.
[0185] As shown in Figure 18, in a representative mouse implanted with H1703 squamous non-small cell lung cancer cells and treated intratumorally with AAV6-fLUC, both tumor volume and bioluminescence increased over time. These results indicate that the bioluminescence signal and tumor volume increased steadily throughout the experimental period, i.e., 21 days after injection, and did not reach a plateau, suggesting that luciferase gene expression continues beyond 21 days after injection.
[0186] As shown in Figure 19, mice treated intratumorally with AAV6-fLUC had much greater bioluminescence in tumor tissues compared to other tissues at day 21. These results indicate that most of the reporter gene expression remains within the tumor where the AAV was delivered. Qualitatively, these results suggest that AAV is less likely to distribute to other tissues.
Claims
1. 1. A composition for treating a solid tumor, comprising an intratumoral or peritumoral CRISPR / Cas system, wherein the intratumoral or peritumoral CRISPR / Cas system comprises (a) one or more nucleic acid sequences encoding one or more guide RNAs (gRNAs) complementary to an NRF2 or EGFR gene in a target cancer cell, and (b) a nucleic acid sequence encoding a CRISPR-associated endonuclease, wherein the intratumoral or peritumoral CRISPR / Cas system results in at least about a 20% reduction in tumor size compared to an untreated tumor and / or results in at least about a 20% inhibition of tumor growth compared to an untreated tumor.
2. The composition described in claim 1, wherein the CRISPR-associated endonuclease is Cas9 or Cas12a.
3. 2. The composition of claim 1, wherein the CRISPR / Cas system is contained in a ribonucleoprotein (RNP) or lipid nanoparticle (LNP) complex.
4. The composition described in claim 1, wherein the CRISPR / Cas system is contained in one or more vectors that drive expression of one or more elements of the CRISPR system.
5. The composition of claim 4, wherein the one or more vectors are viral vectors, liposomes, or lipid-containing complexes.
6. 6. The composition according to claim 5, wherein the viral vector is an adenovirus, an adeno-associated virus (AAV), a helper-dependent adenovirus, a retrovirus, or a Sendai virus liposome (HVJ) complex.
7. 7. The composition of any one of claims 1 to 6, wherein the solid tumor is an adenoid cystic carcinoma tumor, a biliary tract cancer tumor, a bladder cancer tumor, a bone cancer tumor, a breast cancer tumor, a cervical cancer tumor, a bile duct cancer tumor, a colon cancer tumor, an endometrial cancer tumor, an esophageal cancer tumor, a gallbladder cancer tumor, a gastric cancer tumor, a head and neck cancer tumor, a hepatocellular carcinoma tumor, a kidney cancer tumor, a lip cancer tumor, a liver cancer tumor, a melanoma tumor, a mesothelioma tumor, a non-small cell lung cancer tumor, a non-melanoma skin cancer tumor, an oral cancer tumor, an ovarian cancer tumor, a pancreatic cancer tumor, a prostate cancer tumor, a rectal cancer tumor, a renal cancer tumor, a sarcoma tumor, a small cell lung cancer tumor, a spleen cancer tumor, a thyroid cancer tumor, a urothelial cancer tumor, or a uterine cancer tumor.
8. 1. A composition comprising an intratumoral or peritumoral CRISPR / Cas system for reducing expression of NRF2 or EGFR in cancer cells of a solid tumor, wherein the intratumoral or peritumoral CRISPR / Cas system comprises: (a) one or more nucleic acid sequences encoding one or more guide RNAs (gRNAs) complementary to the NRF2 or EGFR gene; and (b) a nucleic acid sequence encoding a CRISPR-associated endonuclease, whereby the one or more gRNAs hybridize to the NRF2 or EGFR gene and the CRISPR-associated endonuclease cleaves the NRF2 or EGFR gene; and wherein the intratumoral or peritumoral CRISPR / Cas system results in at least about a 20% reduction in tumor size compared to an untreated tumor and / or at least about a 20% inhibition of tumor growth compared to an untreated tumor.
9. The composition described in claim 8, wherein the CRISPR-associated endonuclease is Cas9 or Cas12a.
10. The composition of claim 8, wherein the one or more nucleic acid sequences of (a) and the nucleic acid sequence of (b) are contained in an RNP or LNP complex.
11. The composition described in claim 8, wherein the CRISPR / Cas system is contained in one or more vectors that drive expression of one or more elements of the CRISPR system.
12. 12. The composition of claim 11, wherein the one or more vectors are viral vectors, liposomes, or lipid-containing complexes.
13. The composition according to claim 12, wherein the viral vector is an adenovirus, an AAV, a helper-dependent adenovirus, a retrovirus, or a Sendai virus (HVJ) complex.
14. 14. The composition of any one of claims 8 to 13, wherein the solid tumor is an adenoid cystic carcinoma tumor, a biliary tract cancer tumor, a bladder cancer tumor, a bone cancer tumor, a breast cancer tumor, a cervical cancer tumor, a bile duct cancer tumor, a colon cancer tumor, an endometrial cancer tumor, an esophageal cancer tumor, a gallbladder cancer tumor, a gastric cancer tumor, a head and neck cancer tumor, a hepatocellular carcinoma tumor, a kidney cancer tumor, a lip cancer tumor, a liver cancer tumor, a melanoma tumor, a mesothelioma tumor, a non-small cell lung cancer tumor, a non-melanoma skin cancer tumor, an oral cancer tumor, an ovarian cancer tumor, a pancreatic cancer tumor, a prostate cancer tumor, a rectal cancer tumor, a renal cancer tumor, a sarcoma tumor, a small cell lung cancer tumor, a spleen cancer tumor, a thyroid cancer tumor, a urothelial cancer tumor, or a uterine cancer tumor.
15. A composition described in any one of claims 1 to 6 or 8 to 13, wherein the intratumoral or peritumoral CRISPR / Cas system further comprises one or more chemotherapeutic agents.