Heat-resistant FGF10 polypeptide or fragment thereof, and uses thereof

Abstract

The present invention relates to a thermostable FGF10 polypeptide having FGF10 activity and having at least 85% sequence identity with or consisting of SEQ ID NO:3 having or consisting of the amino acid sequence from Ser69 to Ser208 of SEQ ID NO:1, or SEQ ID NO:5 having or consisting of the amino acid sequence from Leu40 to Ser208 of SEQ ID NO:1, or a fragment thereof comprising at least the amino acid substitution L152F. Preferably, any of the amino acid substitutions V123I, Q175E, and N181D may further be included. The present invention further discloses the use of the subject thermostable FGF10 polypeptide in regenerative medicine or other related medical applications or in cosmetics. Furthermore, the present invention discloses a medium comprising the subject thermostable FGF10 polypeptide suitable for the proliferation and differentiation of human embryonic stem cells or the formation and differentiation of spheroids and organoids.

Description

[Technical field]

[0001] The present invention relates to a thermostable modified fibroblast growth factor 10 (FGF10) or a fragment thereof, which has improved thermal stability or thermostable compared to wild-type FGF10, and its use in spheroid and organoid culture, regenerative medicine, or other related medical applications or cosmetics. The present invention further relates to a medium comprising FGF10 suitable for the proliferation and differentiation of human embryonic stem cells, and for the formation and differentiation of spheroids and organoids. [Background technology]

[0002] Fibroblast growth factor 10 (also called FGF10, keratinocyte growth factor 2, KGF-2, KGF2, or rhKGF2) belongs to one of five paracrine-acting subfamilies of heparin-interacting fibroblast growth factors. Together with the closely related FGF3, FGF7, and FGF22, FGF10 forms the so-called FGF7 subfamily. This subfamily is unique from other FGFs in that its members are secreted exclusively by the mesenchyme and specifically activate the "b" isoforms of the receptors FGFR1 (FGFR1b) and FGFR2 (FGFR2b) present in the overlying epithelium (Itoh, N. & Ornitz, DM, 2004, Trends Genet. 20:563-569). FGF10 plays a key role in embryonic organogenesis and tissue patterning, and mediates wound healing and tissue homeostasis in adult mammals through the control of cell proliferation and differentiation (Beenken, A. & Mohammadi, M., 2009, Nat. Rev. Drug Discov. 8:235-253). FGF10 has been shown to mediate epithelial-mesenchymal interactions, which are essential for lung development and regeneration after various stresses (Tong, L. et al., 2016, Sci. Rep. 6:21642). FGF10 is also required for the development of limbs, thyroid, pituitary, kidney, teeth, hair follicles, salivary glands, inner ear, thymus, glandular stomach, and pancreas (Itoh, N., 2016, Cytokine Growth Factor Rev. 28:63-69).

[0003] The human FGF10 cDNA encodes a 208 amino acid residue protein with a 37 amino acid hydrophobic N-terminal signal peptide. FGF10 is highly conserved in both gene structure and amino acid sequence across vertebrate species (Ornitz, DM & Itoh, N., 2001, Genome Biol. 2: 3005). Across vertebrate species, orthologous FGF10 proteins share approximately 85% amino acid sequence identity and similar biological functions (Ornitz, DM & Itoh, N., 2015, Rev. Dev. Biol. 4:215-266). FGF10 contains a conserved core region of approximately 120 amino acids (amino acids 75-166 and 176-205) that is homologous (approximately 30-60%) to other paracrine FGF members (Emoto, H. et al., 1997, J. Biol. Chem. 272: 23191-23194) and has a β-trefoil knot fold consisting of 12 β-strands (Yeh, BK et al., 2003, Proc. Natl. Acad. Sci. USA 100:2266-2271). In the core region of FGF10, most of the amino acids are important for the interaction with the FGFR2 receptor.

[0004] Selective interaction of FGF10 with the FGFR2b receptor autophosphorylates the receptor and subsequently activates intracellular signaling pathways (RAS-MAPK, PI3K-AKT, and PLCγ1) that promote cell survival, induce mitogenic cell responses, and mediate cell motility. Given its ability to control epithelial proliferation and lineage commitment during embryonic development and postnatal life, as well as to stimulate epithelial regeneration after injury as demonstrated in rodent models, the main therapeutic potential of FGF10 lies in preventing alveolar cell injury and restoring normal epithelial function in injured lungs (Yuan, T. et al., 2018, Front. Genet. 9:418). Other potential therapeutic applications of FGF10 include wound healing (US Pat. No. 6,653,284), treating heart disease (Rochairs, F. et al., 2014, Cardiovasc. Res. 104:432-442), or treating obesity and metabolic diseases (Fisher, C. et al., 2017, Nat. Commun. 8:2079). Besides therapeutic applications, FGF10 is often used as a component of culture media for various embryonic stem cells, spheroids, and organoids (US Pat. No. 6,692,961 B1; Rabata, A. et al., 2020, Front. Cell Dev. Biol. 21:574).

[0005] However, the practical potential of FGF10 is limited by its inherent instability, demonstrated by its short half-life (<24 h in cell-free medium), low thermal stability, and vulnerability to proteolysis with rapid loss of biological activity (Buchtova, M. et al., 2015, Cell. Mol. Life Sci., 72: 2445-2459; Chen, G. et al., 2012, Stem Cells 30:623-630). The poor stability of FGF10 is a major obstacle for the storage, transport, and practical application of this protein. Due to its low stability, FGF10 must be frequently replaced in cell culture, and concentration fluctuations may adversely affect cell fitness. The same is true for therapeutic applications, as the unfolded or aggregated protein forms resulting from degradation can be toxic and immunogenic (Chen, BL & Arakawa, T., 1996, J. Pharm. Sci. 85:419-426).

[0006] A typical process for FGF10 stabilization is represented by the addition of heparin. Heparin binding protects FGF10 from heat and acid denaturation and extends its half-life (Buchtova, M. et al., 2015, Cell. Mol. Life Sci., 72: 2445-2459). However, the use of heparin is not for physiological applications, since heparin is mainly produced by mast cells and its anticoagulant properties may further affect the fragile balance of the cellular environment. In order to use FGF10 in medical and cosmetic applications, various methods must be developed to obtain higher stability.

[0007] Other strategies have been employed to stabilize FGF10 without the use of heparin. The strategy described in WO2013 / 082196 (or US Patent 10,039,807) uses heparin-mimicking sulfonic acid polymers and copolymers in combination with FGF10 for stabilization. Other strategies stabilize FGF polypeptides using reducing agents (US Patent 7,754,686), sucrose octasulfate addition (US Patent 5,202,311), hydroxypropylcellulose addition (US Patent 5,189,148), glucan sulfate addition (EP Patent 0345660), polyanion-PEG conjugates (Khondee, S., et al., 2011, Biomacromolecules 12:3880-3894), or chelating agents (US Patent 5,217,954). The patent literature, US Patent No. 8,304,387, describes novel stable formulations of Keratinocyte Growth Factor (KGF) useful for lyophilization, in which KGF is combined with sugars, surfactants, or bulking agents. European Patent Specification No. 750628 describes FGF10 produced by recombinant techniques. Such polypeptides, or polynucleotides encoding such polypeptides, can be used for therapeutic purposes, e.g., to promote healing of wounds, burns, and ulcers, to prevent neuronal damage due to neuronal disorders, to prevent skin aging and hair loss. However, this form of the polypeptide is not stabilized by any means.

[0008] An alternative approach to the addition of stabilizing additives is protein engineering. Protein engineering introduces substitutions in the amino acid sequence that increase the stability of the protein. The patent document EP 0950100 refers to artificial forms of FGF10 polypeptides with truncated N- or C-terminal portions and C-terminal substitutions R194E, R194Q, K191E, K191Q, R188E, R188Q, which are constructed to increase protein expression levels and solubility in Escherichia coli (E. coli) and can be used for therapeutic applications. However, these documents do not state or support that the mutations or truncations affect the thermal stability or half-life of the provided FGF10 variants. The patent document US Pat. No. 6,653,284 refers to liquid and lyophilized formulations of FGF10 polypeptides with truncations in either the N- or C-terminal portions for therapeutic applications requiring soft tissue growth and regeneration. No enhanced thermal stability or half-life has been demonstrated for any truncated form of FGF10. The patent document WO2001 / 002433 refers to multiple mutant forms of FGF10 polypeptides truncated at the N-terminal portion and having the substitutions R68G, R68S, R68A, R78A, R80A, K81A, K87A, K91A, K136A, K137A, K139A, K144A, K148E, K149E, K151A, K153A, K155A, R174A, K183A, K183Q, K183E, R187A, R188A, R188E, or K191E, which show enhanced activity, increased stability, improved yield, or improved solubility and can be used in therapeutic applications to promote wound healing. Other potentially stabilizing substitutions in the FGF10 polypeptide, N105D, C106F, K144R, K153M, and I156R, have recently been identified by in silico design, but these have not been experimentally demonstrated (Alizadeh, AK, et al., 2021, Growth Factors 38:197-209). Summary of the Invention

[0009] The present invention provides an isolated thermostable artificial polypeptide derived from human FGF10 polypeptide (SEQ ID NO: 1) and which can be used in spheroid and organoid culture, regenerative medicine or other related medical applications, or in cosmetics. MWKWILTHCA SAFPHLPGCC CCCFLLLFLV SSVPVTCQAL GQDMVSPEAT NSSSSSFSSP SSAGRHVRSY NHLQGDVRWR KLFSFTKYFL KIEKNGKVSG TKKENCPYSI LEITSVEIGV VAVKAINSNY YLAMNKKGKL YGSKEFNNDC KLKERIEENG YNTYASFNWQ HNGRQMYVAL NGKGAPRRGQ KTRRKNTSAH FLPMVVHS (SEQ ID NO: 1)

[0010] The disadvantages arising from the natural instability of FGF10 polypeptide are overcome by the present invention, which provides an isolated heat-stable modified polypeptide having FGF10 activity and 85% sequence identity to SEQ ID NO:1 or a functional fragment thereof.

[0011] The subject of the present invention is a heat-stable FGF10 polypeptide or a fragment thereof having FGF10 activity and having at least 85% sequence identity with or consisting of SEQ ID NO: 3 having the amino acid sequence from Ser69 to Ser208 of SEQ ID NO: 1, wherein said heat-stable FGF10 polypeptide or a fragment thereof contains at least the amino acid substitution L152F.

[0012] According to a preferred embodiment of the present invention, the heat-stable FGF10 polypeptide comprises or consists of SEQ ID NO:3 or a fragment thereof, wherein the heat-stable FGF10 polypeptide or a fragment thereof comprises at least the amino acid substitution L152F.

[0013] A preferred embodiment of the present invention discloses a thermostable FGF10 polypeptide or a fragment thereof further comprising at least one, or at least two, or at least three amino acid substitutions selected from the group consisting of V123I, Q175E and N181D, i.e., a polypeptide according to the present invention always exhibits at least an L152F substitution; or a combination of two, three or four substitutions, combining L152F with V123I and / or Q175E and / or N181D.

[0014] The amino acid sequence of human FGF10 polypeptide (SEQ ID NO:1) consists of 208 amino acids, and the N-terminal amino acid region MWKWILTHCA SAFPHLPGCC CCCFLLLFLV SSVPVTC (SEQ ID NO:2) of the amino acid sequence SEQ ID NO:1 corresponds to an N-terminal signal peptide, which directs the translocation of the protein and is usually removed in the mature polypeptide. Thus, a signal peptide may or may not be present in the amino acid sequence of the FGF10 polypeptide according to the invention. In some embodiments, such as those for recombinant production of FGF10 polypeptide in E. coli, the signal peptide may be replaced by only the single amino acid methionine (M).

[0015] The mature human FGF10 polypeptide may be further truncated by up to 31 amino acids at its N-terminus without losing its biological activity, and thus consists of the amino acid sequence from Ser69 to Ser208, with or without the N-terminal Met (amino acid numbering corresponds to SEQ ID NO:1).

[0016] It is further known in the art that FGF10 polypeptides from various vertebrate species share approximately 85% sequence identity, exhibit similar functions, and have similar biological activity.

[0017] The subject of the present invention relates to an isolated modified thermostable FGF10 polypeptide, said FGF10 polypeptide exhibiting FGF10 activity and comprising: (a) a heat-stable FGF10 polypeptide having at least 85% sequence identity with or consisting of the amino acid sequence of Ser69 to Ser208 of SEQ ID NO: 1 (see SEQ ID NO: 3); (b) a heat-stable FGF10 polypeptide having or consisting of SEQ ID NO: 3 or a fragment thereof; and (c) a heat-stable polypeptide (a or b) having at least the stabilizing amino acid substitution L152F (sequence number: 3) or a combination of the stabilizing substitution L152F and at least one additional stabilizing amino acid substitution selected from the group consisting of V123I, Q175E or N181D. TIFF2024540542000001.tif25139

[0018] Preferably, the maximum length of the heat-stable FGF10 polypeptide sequence is 228 amino acids, more preferably 190 amino acids.

[0019] The amino acid marked in bold and underlined in SEQ ID NO:3 is mutated at position 84 of this amino acid sequence; this corresponds to the amino acid substitution L152F in the amino acid numbering according to SEQ ID NO:1.

[0020] In some embodiments, the thermostable polypeptide further comprises at least one, at least two, or at least three of the following amino acid substitutions: - the amino acid substitution I at position 55 in SEQ ID NO:3 of said amino acid sequence (corresponding to the amino acid substitution V123I in the numbering according to SEQ ID NO:1); - the amino acid substitution E at position 107 in SEQ ID NO:3 of said amino acid sequence (corresponding to the amino acid substitution Q175E in the numbering according to SEQ ID NO:1); an amino acid substitution D in position 113 in SEQ ID NO:3 of said amino acid sequence (corresponding to the amino acid substitution N181D in the numbering according to SEQ ID NO:1).

[0021] In some embodiments, the heat-stable FGF10 polypeptide may have at least a part or all of the amino acid sequence MWKWILTHCA SAFPHLPGCC CCCFLLLFLV SSVPVTCQAL GQDMVSPEAT NSSSSSFSSP SSAGRHVR (SEQ ID NO: 4) at the N-terminal portion of SEQ ID NO: 3. In other embodiments, the heat-stable FGF10 polypeptide may have a methionine (M) at the N-terminal portion of SEQ ID NO: 3. In some embodiments, the heat-stable FGF10 polypeptide may have a short fused amino acid sequence (known as a tag) at its N-terminal or C-terminal portion, the maximum length of which is 20 amino acids. The above embodiments regarding the extension at the N-terminus and C-terminus of the heat-stable FGF10 polypeptide sequence can be combined with each other.

[0022] According to another preferred embodiment of the present invention, the heat-stable FGF10 polypeptide further comprises: - at least some or all of the amino acids of SEQ ID NO:4 or the N-terminal methionine of SEQ ID NO:3; and / or - at least one short fused amino acid sequence (tag) with a maximum length of 20 amino acids in the N-terminal or C-terminal part.

[0023] In a preferred embodiment, the present invention discloses a thermostable FGF10 polypeptide having or consisting of a sequence having at least 85% sequence identity to SEQ ID NO:5: In the TIFF2024540542000002.tif28140 sequence, the amino acids in bold and underlined must be retained.

[0024] Preferably, the maximum length of the heat-stable FGF10 polypeptide sequence is 228 amino acids, more preferably 190 amino acids.

[0025] The amino acid sequence SEQ ID NO:5 corresponds to the fragment from Leu40 to Ser208 of SEQ ID NO:1. The amino acid shown in bold and underlined in SEQ ID NO:5 is mutated at position 113 of this amino acid sequence; this portion corresponds to the amino acid substitution L152F in the numbering according to SEQ ID NO:1.

[0026] According to another preferred embodiment of the present invention, the heat-stable FGF10 polypeptide has at least 85% sequence identity with or consists of SEQ ID NO:5 or a fragment thereof having the amino acid sequence from Leu40 to Ser208 of SEQ ID NO:1, and the heat-stable FGF10 polypeptide or a fragment thereof contains at least the amino acid substitution L152F.

[0027] According to another preferred embodiment of the present invention, the heat-stable FGF10 polypeptide comprises or consists of SEQ ID NO:5 or a fragment thereof, said heat-stable FGF10 polypeptide or a fragment thereof comprising at least the amino acid substitution L152F.

[0028] In some embodiments, the heat-stable FGF10 polypeptide further comprises at least one, at least two, or at least three of the following amino acid substitutions: - the amino acid substitution I at position 84 in SEQ ID NO:5 of said amino acid sequence (corresponding to the amino acid substitution V123I in the numbering according to SEQ ID NO:1); - the amino acid substitution E at position 136 in SEQ ID NO:5 of said amino acid sequence (corresponding to the amino acid substitution Q175E in the numbering according to SEQ ID NO:1); an amino acid substitution D in position 142 in SEQ ID NO:5 of said amino acid sequence (corresponding to the amino acid substitution N181D in the numbering according to SEQ ID NO:1).

[0029] According to another preferred embodiment of the present invention, the heat-stable FGF10 polypeptide or a fragment thereof further comprises at least one, at least two, or at least three amino acid substitutions selected from the group consisting of V123I, Q175E, and N181D.

[0030] In some embodiments, the thermostable polypeptide may have at least part or all of the amino acid sequence MWKWILTHCA SAFPHLPGCC CCCFLLLFLV SSVPVTCQA (SEQ ID NO:6) at the N-terminal portion of SEQ ID NO:5. In other embodiments, the thermostable polypeptide may have a methionine (M) at the N-terminal portion of SEQ ID NO:5. In some embodiments, the thermostable polypeptide may have a short fused amino acid sequence (known as a tag) at its N-terminal or C-terminal portion, the maximum length being 20 amino acids. The above embodiments of the extension at the N-terminus and C-terminus of the thermostable polypeptide sequence can be combined.

[0031] In the detailed description of the invention and in the examples of the invention, the numbering of amino acid substitutions is used according to SEQ ID NO: 1. That is, even when a truncated amino acid sequence is used, the numbering is used relative to the entire amino acid sequence of the human FGF10 polypeptide.

[0032] The thermostable FGF10 polypeptide or fragment thereof according to the present invention has intact FGF10 activity in a 4MBr-5 cell proliferation assay, in which pulmonary epithelial 4MBr-5 cells express FGF receptor 2b (FGFR2b), the natural ligand of FGF10 polypeptide (see Figures 2, 6, 14, and 17). Advantageously, the thermostable FGF10 polypeptide or fragment thereof according to the present invention exhibits stable and intact biological activity at 37°C for a long period of time (see Figures 7, 9, and 10).

[0033] The heat-stable FGF10 polypeptide of the present invention is particularly advantageous because it is significantly more stable than FGF10 wild-type or fragments thereof. This stability is due to the inherent stability of the polypeptide molecule. There is no need to add other compounds that promote protein stability, such as additives (i.e., heparin) or carrier molecules (i.e., bovine serum albumin (BSA)). At the same time, the biological activity of the heat-stable FGF10 polypeptide is maintained. The disclosed heat-stable FGF10 polypeptide can be used for research and clinical applications.

[0034] The thermostable FGF10 polypeptide or fragment thereof according to the present invention has unmodified FGF10 activity and its melting temperature is 7-19° C. higher, preferably 10-19° C. higher, compared to the wild-type FGF10 polypeptide. All thermostable FGF10 polypeptides according to the present invention were constructed by site-directed mutagenesis or by artificial gene synthesis, subcloned into the expression vector pET28b, purified to homogeneity (protein purity ≧95% as determined by SDS-PAGE electrophoresis), and subsequently characterized for stability (melting temperature measurement) and biological activity.

[0035] More preferred is a heat-stable FGF10 polypeptide having a total length of up to 228 amino acids (more preferably a total length of up to 190 amino acids) that has at least 85% sequence identity with or consists of an amino acid sequence selected from SEQ ID NO:5 and SEQ ID NO:7 to SEQ ID NO:13, or a fragment thereof. TIFF2024540542000003.tif208134

[0036] According to another preferred embodiment of the present invention, the heat-stable FGF10 polypeptide is selected from the group of heat-stable FGF10 polypeptides consisting of SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13.

[0037] In some embodiments, the heat-stable polypeptides of SEQ ID NO:5 and any of SEQ ID NO:7 to SEQ ID NO:13 may have at least a part or all of the amino acid sequence MWKWILTHCA SAFPHLPGCC CCCFLLLFLV SSVPVTCQA (SEQ ID NO:6) at their N-terminal portions. In other embodiments, the heat-stable polypeptides of SEQ ID NO:5 and any of SEQ ID NO:7 to SEQ ID NO:13 may have a methionine (M) at their N-terminal portions. In some embodiments, the heat-stable polypeptides of SEQ ID NO:5 and any of SEQ ID NO:7 to SEQ ID NO:13 may have a short fusion amino acid sequence (known as a tag) with a maximum length of 20 amino acids at their N-terminal or C-terminal portions. The above embodiments regarding the extension at the N-terminus and C-terminus of the heat-stable polypeptide sequence can be combined with each other.

[0038] According to another preferred embodiment of the present invention, the heat-stable FGF10 polypeptide further comprises: - at least some or all of the amino acids of SEQ ID NO:6 or the N-terminal methionine of SEQ ID NO:5; and / or - at least one short fused amino acid sequence (tag) with a maximum length of 20 amino acids in the N-terminal or C-terminal part.

[0039] Another embodiment of the present invention discloses a heat-stable FGF10 polypeptide having FGF10 activity. The heat-stable FGF10 polypeptide according to the present invention further comprises SEQ ID NO:6 at the N-terminus of any of SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, or SEQ ID NO:13.

[0040] The biological activity of the FGF10 polypeptide or its fragment or mutein according to the invention is measured by the ED4, which is the median effective dose for the proliferation of 4MBr-5 cells. 50 It can be quantitatively expressed by the ED (concentration of a polypeptide required to achieve half of the maximum biological effect) and the ED for this effect. 50The concentration is <15 ng / mL, preferably <12 ng / mL. The biological activity of FGF10 can be assessed by a cultured lung epithelial proliferation assay as previously reported (Rubin, JS et al., 1989, Proc Natl Acad Sci USA, 86:802-806).

[0041] A more preferred embodiment of the present invention discloses a heat-stable FGF10 polypeptide according to the present invention for use in regenerative medicine, preferably for pulmonary epithelial regeneration after various stresses or for wound and ulcer healing or other related medical applications, e.g. cardiac therapy.

[0042] A more preferred embodiment of the present invention discloses the use of thermostable FGF10 polypeptides in cosmetics, preferably in supporting collagen synthesis, skin strength, anti-aging treatment and non-therapeutic stimulation of hair growth.

[0043] A more preferred embodiment of the present invention discloses a culture medium for the proliferation and differentiation of human embryonic stem cells or the formation and differentiation of spheroids and organoids, preferably lung organoids, gastric organoids, hepatic organoids, pancreatic organoids and prostate organoids, comprising an effective amount of a heat-stable FGF10 polypeptide at 10 ng / mL to 500 ng / mL in the culture medium.

[0044] These and other features, objects and advantages of the present invention will be better understood from the following description, in which reference is made to the accompanying drawings, which form a part hereof, and in which embodiments of the present invention are illustrated by way of example, and not by way of limitation, and in which:

[0045] Detailed Description of the Invention definition Below are definitions of some terms used herein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0046] To describe the amino acid sequence of the FGF10 polypeptide, the present invention uses standard one-letter abbreviations for amino acids: Alanine: A, Cysteine: C, Aspartic acid: D, Glutamic acid: E, Phenylalanine: F, Glycine: G, Histidine: H, Isoleucine: I, Lysine: K, Leucine: L, Methionine: M, Asparagine: N, Proline: P, Glutamine: Q, Arginine: R, Serine: S, Threonine: T, Valine: V, Tryptophan: W, and Tyrosine: Y.

[0047] As used herein, the term "thermostability" is synonymous with the term "thermal stability" of a protein and includes thermodynamic stability and kinetic stability. Thermodynamic stability relates to the equilibrium between the folded state (native functional protein) and the unfolded or partially unfolded state of a protein, and is defined as the difference in Gibbs free energy between these two protein states. Kinetic stability reflects the rate (i.e., kinetics) of folding and unfolding of a protein, and relates to the free energy barrier that "separates" the native state of a protein from the non-functional forms (unfolded or partially unfolded states, irreversibly denatured protein, aggregated protein).

[0048] As used herein, the “melting temperature” (T m The term melting temperature (TMT) refers to the temperature at which a protein is 50% folded and 50% unfolded. The melting temperature is a direct indicator of thermodynamic stability. mcan be measured by any suitable method known in the art, such as circular dichroism (CD) spectroscopy, differential scanning calorimetry (DSC), or differential scanning fluorometry (DSF), which are further described in the Examples below. CD spectroscopy is a method suitable for monitoring secondary and tertiary structural changes of proteins as a function of temperature or other variable physicochemical parameters (e.g., salt, denaturant, or organic cosolvent concentrations). DSC is a thermodynamic method that allows the direct assessment of the uptake of thermal energy that occurs in a protein sample within a controlled temperature range, either rising or falling, as structural changes occur. DSF is a method that monitors the global tertiary structural changes of proteins as a function of temperature by following the changes in intrinsic fluorescence.

[0049] As used herein, the term "conformational half-life" or "secondary structure half-life" of an FGF10 polypeptide refers to the amount of time it takes for the ellipticity, an indicator of protein secondary structure, to decrease by half under defined process conditions. Half-life is a direct indicator of kinetic stability.

[0050] As used herein, the term "wild type" refers to native FGF10 having the most common amino acid sequence in a species. As used herein, wild type FGF10 refers to the recombinant mature form of human FGF10 corresponding to the Leu40 to Ser208 fragment of SEQ ID NO:1, a 19.1 kDa protein consisting of 169 amino acids (SEQ ID NO:14): L GQDMVSPEAT NSSSSSFSSP SSAGRHVRSY NHLQGDVRWR KLFSFTKYFL KIEKNGKVSG TKKENCPYSI LEITSVEIGV VAVKAINSNY YLAMNKKGKL YGSKEFNNDC KLKERIEENG YNTYASFNWQ HNGRQMYVAL NGKGAPRRGQ KTRRKNTSAH FLPMVVHS (SEQ ID NO: 14)

[0051] Preferably, "wild type" FGF10 refers to a recombinant mature form of human FGF10 containing a molecular weight of 21.4 kDa, a 190 amino acid long His tag and a thrombin cleavage site at the N-terminal portion (SEQ ID NO: 15): MGSSHHHHHH SSGLVPRGSH MLGQDMVSPE ATNSSSSSFS SPSSAGRHVR SYNHLQGDVR WRKLFSFTKY FLKIEKNGKV SGTKKENCPY SILEITSVEI GVVAVKAINS NYYLAMNKKG KLYGSKEFNN DCKLKERIEE NGYNTYASFN WQHNGRQMYV ALNGKGAPRR GQKTRRKNTS AHFLPMVVHS (SEQ ID NO: 15)

[0052] Short fusion amino acid sequences of up to 20 amino acids, so-called tags or peptide tags, facilitate the expression, solubility, purification and detection of recombinant polypeptides. Those skilled in the art know that, in general, the addition of tags to the N- or C-terminal part of a polypeptide does not significantly affect its biological function (e.g. biological activity or stability). Tags, their amino acid sequences and their uses are known to those skilled in the art. Commonly used tags include, for example, ALFA tag, Avi tag, C tag, polyglutamic acid tag, polyarginine tag, E tag, FLAG tag, HA tag, His tag, Myc tag, NE tag, Rho1D4 tag, S tag, Sof tag1, Sof tag3, Spot tag, Strep tag, T7 tag, TC tag, Ty tag, V5 tag, VSV tag, Xpress tag, Isopep tag, Spy tag, Snoop tag, Dog tag or Sdy tag.

[0053] As used herein, the term "polypeptide derived from human FGF10" or "heat-stable FGF10 polypeptide" refers to a polypeptide having FGF10 activity and having or consisting of at least 85% sequence identity to SEQ ID NO:3 or SEQ ID NO:5.

[0054] As used herein, the term "two-point mutant of FGF10" refers to a heat-stable FGF10 polypeptide having SEQ ID NO:5 or a fragment thereof, and consisting of a combination of the amino acid substitution L152F and one additional amino acid substitution selected from the group consisting of V123I, Q175E and N181D. The heat-stable FGF10 polypeptide is preferably a heat-stable FGF10 polypeptide having SEQ ID NO:7 (containing substitutions L152F and V123I), a heat-stable FGF10 polypeptide having SEQ ID NO:8 (containing substitutions L152F and Q175E), or a heat-stable FGF10 polypeptide having SEQ ID NO:9 (containing substitutions L152F and N181D).

[0055] As used herein, the term "multiple-point mutant of FGF10" refers to a heat-stable FGF10 polypeptide having SEQ ID NO:5 or a fragment thereof, and consisting of a combination of the amino acid substitution L152F and at least two or three additional amino acid substitutions selected from the group consisting of V123I, Q175E and N181D. The heat-stable FGF10 polypeptide is preferably a heat-stable FGF10 polypeptide having SEQ ID NO:10 (containing substitutions L152F, V123I and Q175E), a heat-stable FGF10 polypeptide having SEQ ID NO:11 (containing substitutions L152F, V123I and N181D), a heat-stable FGF10 polypeptide having SEQ ID NO:12 (containing substitutions L152F, Q175E and N181D), or a heat-stable FGF10 polypeptide having SEQ ID NO:13 (containing substitutions L152F, V123I, Q175E and N181D).

[0056] As used herein, the term "FGF10 4-point mutant" is synonymous with "FGF10-STAB" and refers to a heat-stable FGF10 polypeptide having SEQ ID NO:5 or a fragment thereof, consisting of the amino acid substitutions L152F, V123I, Q175E and N181D. Preferably, the heat-stable FGF10 polypeptide is a heat-stable FGF10 polypeptide having SEQ ID NO:13.

[0057] As used herein, the term "FGF10 from Peregrine Falco (Falco peregrinus)" is synonymous with "FGF10-Fp" and refers to an FGF10 polypeptide having 88% sequence identity to SEQ ID NO:3 or SEQ ID NO:5, which correspond to functional fragments of an FGF10 polypeptide having the amino acid sequence Ser69 to Ser208 or Leu40 to Ser208, respectively, of SEQ ID NO:1. The FGF10-Fp polypeptide, which has modifications at 16 of the 136 amino acids, has unmodified FGF10 activity when compared to both SEQ ID NO:3 or SEQ ID NO:5 (as described in Example 14) and has the amino acid sequence SEQ ID NO:16. LQGDVRKRK LYSYNKYFLK IEKNGKVSGT KKENCPFSIL EITSVEIGVV AVKSIKSNYY LAMNKKGKVY GSKEFNSDCK LKERIEENGY NTYASLNWKH NGRQMFVALN GRGATKRGQK TRRKNTSAHF LPMVVMS (SEQ ID NO: 16)

[0058] As used herein, the term "single point mutant of FGF10-Fp" is synonymous with "FGF10-Fp+L152F" and refers to a heat-stable GF10 polypeptide containing a stabilizing amino acid substitution F at position 80 of amino acid SEQ ID NO:16, which corresponds to substitution L152F in the numbering according to SEQ ID NO:1, and having 88% sequence identity to SEQ ID NO:3 or SEQ ID NO:5. FGF10-Fp+L152F has improved stability compared to SEQ ID NO:16 and unmodified FGF10 activity (described in Example 14) and has amino acid SEQ ID NO:17. TIFF2024540542000004.tif21141

[0059] As used herein, the term "human FGF10-derived polypeptide" is synonymous with "FGF10 mutant" and "FGF10 mutein" and refers to a modified FGF10 polypeptide sequence having at least one different amino acid sequence exhibiting any of the substitutions according to the present invention compared to the human FGF10 polypeptide (SEQ ID NO:1) or a fragment thereof.

[0060] As used herein, the term "polypeptide" is synonymous with "protein." The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, preferably a recombinant polypeptide.

[0061] As used herein, the term "activity of FGF10" is synonymous with "biological activity of FGF10." The activity of FGF10 is intended to mean the biological activity of an FGF10 polypeptide according to the present invention or a polypeptide derived from a human FGF10 polypeptide, or a fragment or mutein thereof. An active (functional) polypeptide is the complete amino acid sequence and structure of a test FGF10 polypeptide according to the present invention, the FGF10 polypeptide comprising all functionally important amino acids responsible for binding interactions (iterations) with a cell surface receptor, heparan sulfate, or its structural analog heparin. Amino acids of FGF10 essential for the function of the polypeptide (e.g., amino acids important for polypeptide-receptor interaction) can be identified by methods well known in the art, such as structural analysis, including X-ray crystallography and nuclear magnetic resonance, site-directed mutagenesis, or alanine-scanning mutagenesis. Functionally important amino acids of the FGF10 polypeptide can be found in Yeh, KB et al., 2003, Proc Natl Acad Sci USA, 100:2266-2271; and Zinkle, A. & Mohammadi, M., 2019, Front. Genet. 10:102.

[0062] The biological functions of FGF10 polypeptide in tissue development and repair are mediated through binding to fibroblast growth factor receptor 2 (FGFR2). Among the FGFR isoforms "b" (IIIb) and "c" (IIIc) that arise by alternative splicing of the extracellular immunoglobulin domain III, FGF10 acts primarily through selective interaction with the FGFR2b receptor. The binding interaction of FGF10 with FGFR2b dimerizes and autophosphorylates the receptor, subsequently activating intracellular signaling pathways (RAS-MAPK, PI3K-AKT, and PLCγ1) that promote cell survival, induce mitogenic cell responses, and mediate cell motility. FGF10 polypeptide is primarily expressed in the lung mesenchyme. In the lung mesenchyme, FGF10 polypeptide plays an important role in regulating epithelial proliferation and lineage commitment during embryonic lung development and postnatal life. Other target cells generally include cells of epithelial origin, such as cells involved in the development of both the limbs, small and large intestine, as well as various other organs such as the kidney, thymus, liver, and heart, which are known in the art to express the FGFR2b receptor or to respond to FGF10.

[0063] Biological activity can be measured by methods known in the art, such as cell proliferation and / or substrate phosphorylation. Thus, "polypeptides having FGF10 activity" include polypeptides that exhibit FGF10 activity in cell proliferation assays (e.g., the pulmonary epithelial 4MBr-5 cell proliferation assay described in Examples 4, 8, 13, and 14) and substrate phosphorylation (e.g., ERK1 / 2 phosphorylation described in Examples 9 and 10) and bind to the FGFR2b receptor.

[0064] The thermostable FGF10 polypeptide, or a fragment or mutein thereof according to the present invention exhibits an ED as measured by the 4MBr-5 cell proliferation assay. 50A candidate polypeptide having FGF10 activity is considered to have FGF10 activity if its concentration (median effective dose) is ≦15 ng / mL, preferably <12 ng / mL. The degree of activity need not be identical to that of FGF10 protein, but a "polypeptide having FGF10 activity" preferably exhibits approximately similar activity compared to FGF10-wt (i.e., the candidate polypeptide exhibits no more than about 2-fold less activity than the reference FGF10 protein).

[0065] As used herein, the term "median effective dose" means "ED 50 The term "heat-stable FGF10 polypeptide" is synonymous with "value" and refers to the concentration of the heat-stable FGF10 polypeptide, or a fragment or mutein thereof, according to the present invention, required to achieve half of the maximum proliferation (i.e., required to achieve 50% of the maximum biological activity).

[0066] The biological activity of FGF10 polypeptide requires the presence of a functional fragment of the heat-stable FGF10 polypeptide that retains the biological activity of FGF10. As used herein, the term "fragment" is synonymous with "functional fragment" and refers to an intact portion of the sequence and structure of the heat-stable FGF10 polypeptide that contains all functionally important amino acids, i.e., amino acids responsible for the interaction of the polypeptide with the FGF receptor and with heparan sulfate. It is known to those skilled in the art that FGF10 activity remains intact even when 37 (corresponding to the mature FGF10 polypeptide lacking the signal sequence) to 68 amino acids are truncated at the N-terminal portion of the FGF10 sequence (SEQ ID NO: 1). Also, short FGF10 peptides, which are mimetic peptides of FGF10 that mimic FGF10 activity by binding to, activating or inhibiting the FGFR2b receptor, have been previously reported (see patent literature, U.S. Pat. No. 6,653,284, and European Patent Application Publication No. 0950100).

[0067] FGF10 polypeptides exhibit approximately 85% sequence identity among various vertebrate species. Thus, one skilled in the art would understand that 85% sequence identity does not adversely affect the biological activity of FGF10 polypeptides. Sequence identities of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and preferably 100% are used. Thermostable FGF10 polypeptides also exhibit at least one or more stabilizing amino acid substitutions according to the present invention. Thus, the T of a test thermostable FGF10 polypeptide according to the present invention can be determined by the following methods: m is capable of increasing the temperature of cultured cells by at least 7°C, preferably at least 10°C, and more preferably at least 14°C, while retaining the desired biological activity, i.e., being capable of binding to a target FGF receptor on the cell surface and inducing growth, proliferation or survival of cultured cells compared to untreated control cells.

[0068] As used herein, the term "mutein" is synonymous with "mutant" and "variant" and refers to a functional mutein of a thermostable FGF10 polypeptide having a stabilizing amino acid substitution according to the present invention and a desired biological activity. Furthermore, mutein refers to a functional mutein of a thermostable FGF10 polypeptide having additional substitutions (point substitutions, point insertions and point deletions) when it has at least 85% sequence identity with SEQ ID NO:3 or SEQ ID NO:5. Thus, a functional FGF10 polypeptide has the stabilizing amino acid substitution of the present invention and has at least 85% or more of the amino acids of SEQ ID NO:3 or SEQ ID NO:5. Those skilled in the art are fully aware that amino acid substitutions are unlikely or unlikely to significantly affect the function of a polypeptide (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid). In general, it is possible to replace residues that form a tertiary structure when using residues that exhibit similar functions. For example, it is preferred that 15% of sequence variations are conservative substitutions of L-amino acids. Here, the newly inserted amino acid has similar physicochemical properties as the original substituted amino acid and is expected according to common general knowledge to have no or minimal effect on the structure, activity and stability of the protein. Examples of conservative substitutions known to those skilled in the art include the substitution of one hydrophobic residue for another, or the substitution of a charged or polar residue for another. Such conservative substitutions include amino acid substitutions within the following groups: (i) glycine, alanine, valine, leucine and isoleucine; (ii) phenylalanine, tyrosine and tryptophan; (iii) serine and threonine; (iv) aspartic acid and glutamic acid; (v) glutamine and asparagine; and (vi) lysine, arginine and histidine.Further guidance as to which amino acid changes are likely to be phenotypically silent (i.e., unlikely to have a significant adverse effect on protein function) can be found in Bowie, JU et al., 1990, 'Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions', Science 247:1306-1310. In other instances, where the modification occurs in a non-critical region of the protein (i.e., a region of the protein that is not important for the function of the protein), the type of residue may not be important at all.

[0069] As used herein, the term "sequence identity" refers to the relationship between two polypeptide sequences and is defined as the percentage of positional sequence identity over the entire length of the reference amino acid sequence. The percentage of positional sequence identity is determined by multiplying the number of identical residues in the same positions over a defined length in a given alignment by 100. Two polypeptides have "100% sequence identity" if their amino acid residues are identical when aligned for maximum correspondence. Bioinformatics methods of sequence alignment are well known in the art. The percentage of positional sequence identity can be calculated using standard software programs. Preferred computer programs include, but are not limited to, BLASTP, MatGAT, Water (EMBOSS), Matcher (EMBOSS), and LALIGN. The well-known Smith-Waterman algorithm can also be used to determine sequence identity.

[0070] The amino acid sequence of the thermostable FGF10 polypeptide according to the present invention may be identical to the reference sequence of the FGF10 polypeptide (SEQ ID NO: 3 or SEQ ID NO: 5), i.e. the sequence identity may be 100%. Alternatively, it may contain up to a certain integer number of amino acid substitutions (corresponding to a maximum of 15% sequence variation) that differ from the reference sequence, in which case the sequence identity of the FGF10 polypeptide is less than 100%. These amino acid changes that contribute to sequence variation may be formed by point substitutions, point insertions, point deletions or a combination thereof. The changes may occur either at the N-terminal end, the C-terminal end or between these terminal ends of the reference polypeptide, and may extend between individual amino acids of the reference polypeptide individually or in one or more contiguous regions of the reference sequence.

[0071] In vertebrate species such as primates, mice, rats, rabbits, pigs, dogs, cows, horses, hawks, lizards, and humans, FGF10 is highly conserved, showing at least 85% sequence identity across a wide range of species. Those skilled in the art understand that, for example, when using FGF10 sequences of non-human origin, the heat-stable FGF10 polypeptide will have 15% sequence variation (corresponding to the 85% sequence identity described herein). FGF10 proteins according to embodiments of the present invention that have at least 85% identity with the heat-stable FGF10 polypeptide are unlikely to contain proteins other than those similar to FGF10, since other members of the FGF family generally have much lower sequence identity.

[0072] The FGF10 polypeptide derived from human FGF10 according to the present invention can be prepared by gene synthesis or mutagenesis. In general, a gene encoding an FGF10 polypeptide is cloned into an expression vector and then expressed in a transformed host organism, preferably a microorganism. The host organism expresses the foreign gene and produces the FGF10 polypeptide under given expression conditions. The gene encoding the FGF10 polypeptide can also be prepared in eukaryotic organisms such as yeast or mammalian cells.

[0073] An example of the nucleotide sequence of recombinant FGF10-wt (5'-3') and the upstream sequence in the pET28b vector is shown below (SEQ ID NO: 18). The start codon atg and the stop codon TAA are in grey, the N-terminal His tag (6xHis) is in bold and underlined, the thrombin cleavage recognition site is in black, and the restriction sites NcoI, NdeI, XhoI that allow cloning into the expression vector pET28b are underlined (ccatgg-5'NcoI, CATATG-5'NdeI, and CTCGAG-3'XhoI). The coding sequence of the FGF10 polypeptide begins with the start codon atg and ends with the stop codon TAA. JPEG2024540542000005.jpg77164

[0074] The FGF10 polypeptide used to insert amino acid substitutions according to the present invention can be isolated from any vertebrate species, such as primates, mice, rats, rabbits, pigs, dogs, cows, horses, hawks, snakes, lizards, and humans. The FGF10 polypeptide is preferably of human origin. However, biologically active forms of mammalian, avian, or reptilian FGF10 polypeptides having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the amino acid sequence of human FGF10 (SEQ ID NO:1) or the heat-stable FGF10 polypeptide (SEQ ID NO:3, SEQ ID NO:5) may also be used. [Brief description of the drawings]

[0075] [Figure 1] SDS-PAGE gel of purified FGF10-wt and its single point mutants (with one of the following substitutions N71E, T86F, I118V, V123I, I126Y, N127Y, L152F, H171Y, R174Y, Q175E, Y177F, N181D, V205P) is shown. Protein markers: 116, 66.2, 45, 35, 25, 18.4, 14.4 kDa. The Mw of recombinant FGF10-wt and its mutants with N-terminal His tag and thrombin cleavage site is approximately 21.4 kDa. [Diagram 2] Proliferation of lung epithelial 4MBr-5 cells induced by FGF10-wt and its single point mutants with improved stability is shown. The ED50 values ​​determined for the effects of FGF10-wt and its single point mutants with amino acid substitutions V123I, L152F, Q175E, and N181D were 0.8, 0.4, 1.4, 0.2, and 1.6 ng / mL, respectively. Each data point represents the average of triplicate samples. Error bars were smaller than the symbol size and generally less than 4%. [Diagram 3] SDS-PAGE gel of purified FGF10-wt and its four-point mutant with enhanced stability, FGF10-STAB, is shown. Protein markers: 116, 66.2, 45, 35, 25, 18.4, and 14.4 kDa. The Mw of recombinant FGF10-wt and FGF10-STAB with a His tag and thrombin cleavage site at the N-terminus is approximately 21.4 kDa. [Figure 4] The thermal stability of FGF10-wt and its four-point mutant FGF10-STAB were compared. The melting temperatures (Tm) were measured by DSF. [Diagram 5] A comparison of the degree of FGF10 polypeptide stabilization mediated by protein engineering with the introduction of four stabilizing amino acid substitutions (V123I+L152F+Q175E+N181D) and by the addition of heparin is shown. Protein stabilization is expressed as the difference in melting temperature (ΔTm) between stabilized and non-stabilized (wild-type polypeptide) FGF10 polypeptides. Tm was measured by DSF. [Figure 6] Figure 1 shows the proliferation of pulmonary epithelial 4MBr-5 cells induced by FGF10-STAB. The ED50 value measured for this effect was 0.2 ng / mL, which is consistent with the predicted ED50 value of <15 ng / mL for recombinant FGF10-wt. Each data point represents the mean value of triplicate samples. Error bars were smaller than the symbol size and generally less than 4%. [Figure 7]Ability of FGF10-STAB to retain biological activity at 37°C during extended incubation. (A) FGF10-wt and FGF10-STAB were preincubated in complete medium for 10 min, 30 min, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, 14 h, and 24 h before cell treatment. Mammary adenocarcinoma MCF7 cells endogenously expressing FGFR2 receptor were cultured in complete medium for 24 h. Cells were then stimulated with FGF10-wt or FGF10-STAB for 30 min and immunoblotted for phosphorylated ERKl / 2. FGF10 levels in medium aliquots were used as a loading control. The biological activity of wild-type FGF10 decreased over time during heat preincubation, whereas the heat-resistant FGF10-STAB retained full biological activity even after 24 h at 37°C. (B) Densitometric analysis of Western blots performed using ImageJ software. (C) Densitometric analysis of loading controls. Error bars represent standard error of the mean from three independent experiments. Student's t-test: ***p<0.001, **p<0.01, *p<0.05. [Figure 8]The ability of FGF10-STAB to retain its secondary structure during prolonged incubation at 37°C is shown. Changes in the secondary structure of both proteins were monitored by CD spectroscopy. (A) The structural integrity of FGF10-wt and FGF10-STAB at a concentration of 0.2 mg / mL in 25 mM phosphate buffer (pH 7.5) containing 750 mM NaCl was followed by monitoring the ellipticity over the wavelength range of 200-260 nm for 24 h at 37°C (the maximum time of measurement was limited by the capacity of the compressed nitrogen bomb used in the CD spectroscopy protocol). FGF10-STAB retained its secondary structure for 24 h at 37°C, whereas the measured half-life of the secondary structure of FGF10-wt assessed at 227 nm was 11.6 h. (B) CD spectra of FGF10-wt and FGF10-STAB recorded before and after 24 h of protein incubation at 37°C. Properly folded FGF10 protein samples showed CD spectra with a broad positive peak centered around 227 nm and a minimum around 204 nm, which is characteristic of β-rich proteins of the β-II type. FGF10-STAB after 24 h incubation at 37°C showed the same CD spectrum shape and intensity as before heat incubation, whereas FGF10-wt during incubation at 37°C underwent a conformational change, as evidenced by the CD spectrum shape and intensity being different from that of FGF10-wt recorded before incubation. [Figure 9] Ability of FGF10-STAB to induce sustained activation of FGFR signaling in MCF7 cells transfected with TR01G vector carrying pKrox24(MapERK)-DsRed reporter. (A) Transactivation of pKrox24 reporter in MCF7 cells induced by stimulation with fresh FGF10-wt and FGF10-STAB. (B) Transactivation of pKrox24 reporter in MCF7 cells induced by stimulation with FGF10-wt and FGF10-STAB after preincubating samples for 2 h at 37°C. FGF-mediated pKrox24 induction was monitored for 24 h by live cell imaging of DsRed fluorescence. [Figure 10] Figure 1 shows the ability of FGF10-STAB to induce proliferation of pulmonary epithelial 4MBr-5 cells after 7 days of incubation at 37°C. FGF10-wt and FGF10-STAB were exposed to a temperature of 37°C for 1, 3, and 7 days and then used to treat 4MBr-5 cells. The plot shows the resorufin fluorescence measured after 3 days of incubation with FGF10 samples. Each data point represents the average of triplicate samples. Error bars are smaller than the size of the symbols and are generally less than 4%. FGF10-STAB retains the ability to induce cell proliferation after the entire preincubation period, whereas the ability of FGF10-wt to induce cell proliferation is already diminished after 1 day of incubation at 37°C. [Figure 11] Comparison of the resistance of FGF10-wt and FGF10-STAB to protein trypsin digestion. (A) FGF10-wt and (B) FGF10-STAB were digested with trypsin (final concentration 2 μg protease / 100 μg FGF10) at 37°C for 180 min. The reaction products were visualized by SDS-PAGE. The difference between time 0 min and 5 min is most likely due to the cleavage of the N-terminal part of the recombinant FGF10 polypeptide (formed by the N-terminal His tag, the thrombin cleavage site, and the following 29 amino acids), which does not adversely affect the biological function of FGF10. [Figure 12] SDS-PAGE gel of purified FGF10 polypeptide (FGF1069-208) consisting of the amino acid sequence Ser69-Ser208 of SEQ ID NO: 1 and its stable mutant (FGF1069-208+L152F) with substitution L152F. Protein markers: 116, 66.2, 45, 35, 25, 18.4, 14.4 kDa. The Mw of recombinant FGF1069-208 and FGF1069-208+L152F with N-terminal His tag and thrombin cleavage site is approximately 18.5 kDa. [Figure 13]CD spectra of FGF10 polypeptides are shown, demonstrating that the FGF10 polypeptide consisting of the amino acid sequence Ser69-Ser208 (FGF1069-208) and its stable mutant with the substitution L152F (FGF1069-208+L152F) are properly folded. [Figure 14] (A) Proliferation of lung epithelial 4MBr-5 cells induced by FGF10 polypeptide consisting of the amino acid sequence Ser69-Ser208 (FGF1069-208) and (B) its stable variant with the substitution L152F (FGF1069-208+L152F). The ED50 values ​​determined for this effect of FGF1069-208 and FGF1069-208+L152F were 0.5 and 1.9 ng / mL, respectively. Each data point represents the mean value of triplicate samples. Error bars were smaller than the size of the symbols and generally less than 4%. [Figure 15] SDS-PAGE gel of purified FGF10 polypeptides with 88% sequence identity to SEQ ID NO:3 or SEQ ID NO:5, corresponding to FGF10 from Peregrine Falcon (FGF10-Fp) and its stable mutant with substitution L152F (FGF10-Fp+L152F). Protein markers: 116, 66.2, 45, 35, 25, 18.4, 14.4 kDa. The Mw of recombinant FGF10-Fp and FGF10-Fp+L152F with N-terminal His tag and thrombin cleavage site is approximately 17.9 kDa. [Figure 16] CD spectra of FGF10 polypeptides are shown, demonstrating that the introduction of 12% mutations into the FGF10 amino acid sequence (i.e., FGF10-Fp, which has 88% sequence identity with SEQ ID NO:3 or SEQ ID NO:5) does not alter the secondary structure of the protein. At the same time, the introduction of a single-point stabilizing substitution, L152F, into an FGF10 polypeptide (FGF10-Fp+L152F) that has 88% sequence identity with SEQ ID NO:3 or SEQ ID NO:5 does not alter the secondary structure of the protein. [Figure 17](A) Proliferation of pulmonary epithelial 4MBr-5 cells induced by FGF10 polypeptide with 88% sequence identity to SEQ ID NO:3 or SEQ ID NO:5 corresponding to FGF10 from Peregrine Falcon (FGF10-Fp) and (B) its stable variant with substitution L152F (FGF10-Fp+L152F). The ED50 values ​​determined for this effect of FGF10-Fp and FGF10-Fp+L152F were 12.7 and 6.1 ng / mL, respectively. Each data point represents the mean value of triplicate samples. Error bars were smaller than the size of the symbols and generally less than 4%. [Figure 18] The results show that FGF10-STAB had a higher lungospheres and lung organoids formation efficiency than FGF10-wt. The plots show the mean ± SD. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0076] The following examples are presented to illustrate embodiments of the present invention. The presented examples are illustrative in nature and are not intended to be limiting. Although methods and materials similar or equivalent to those described herein can be used in testing of the present invention, suitable methods and materials are described below.

[0077] Example 1. In silico design of potential stabilizing single point mutations in FGF10 using energy-based and evolution-based approaches The available crystal structure of FGF10-FGFR2b complex at 2.9 Å resolution (PDB ID 1NUN) was downloaded from the RCSB PDB database and used to predict possible stabilizing substitutions in FGF10 by an energy-based approach. The complex structure was prepared for analysis by removing all ligands and water molecules and creating a pdb file containing amino acid residues Ser69-His207 with isolated strand A corresponding to the FGF10 molecule. Protein side chains were minimized and scored to determine whether the minimization was performed properly. The stabilizing effect of all possible single point mutations was estimated by force-field calculations. ΔΔG free energies were collected for all 20 mutations at specific positions. Evolutionary conservation was estimated by phylogenetic analysis of homologous sequences. Mutations with ΔΔG<-1.0 kcal / mol and conservation ≦7 were selected for further analysis. Functionally relevant positions, such as residues located in the receptor-binding and heparin-binding sites, were excluded from selection to minimize the occurrence of mutations that impair protein function.

[0078] To predict possible stabilizing substitutions in FGF10 by an evolution-based approach, a multiple sequence alignment of FGF10 and related proteins was constructed. The FGF10 protein sequence (SEQ ID NO: 1) was used as a query for a PSI-BLAST (Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402) search against the NCBI nr database. The e-values ​​collected after three rounds of PSI-BLAST were 10 -15Sequences that matched were clustered with CD-HIT (Li, W. & Godzik, A., 2006, Bioinformatics 22:1658-1659) at an identity threshold of 90%. The resulting dataset of over 200 sequences was clustered with CLANS (Frickey & Lupas, (2004). Bioinformatics. 20, 3702-3704) using default parameters and varying P-value thresholds. -29 Sequences that clustered with FGF10 with a P value of 0.5 were extracted and aligned with the program MUSCLE (Edgar, RC, 2004, BMC Bioinformatics 5:113). The final alignment, consisting of 129 sequences, was used as input for a back-to-consensus analysis using a simple consensus approach. This analysis was performed using a consensus cutoff of 0.5, meaning that a given residue had to be present at a given position in at least 50% of all analyzed sequences to be assigned as a consensus residue. Mutations identified by consensus had to pass a cutoff of ΔΔG<0.5 kcal / mol as assessed by force field calculations.

[0079] A list of the best 14 mutations identified by both the energy-based and evolution-based approaches is listed in Table 1. All 14 identified mutations were selected for experimental validation. Amino acid numbers correspond to the sequence of human FGF10 polypeptide (SEQ ID NO: 1).

[0080] [Table 1]

[0081] Example 2. Construction and expression of 14 single point mutants of FGF10 and purification to homogeneity by affinity chromatography Mutant recombinant genes were constructed by the OneClick method and Phusion polymerase (New England Biolabs) according to the instructions of the web program OneClick and the polymerase manufacturer's recommendations. Mutagenesis of FGF10 was performed by whole-plasmid PCR using the vector pET28b-His-Thrombin::fgf10 as a template and two reverse-complementary oligonucleotides carrying the desired mutations. The resulting construct was transformed into E. coli NEB5-alpha competent cells. The cells were plated on agar plates containing kanamycin (50 μg / mL) and grown overnight at 37°C. Plasmids were isolated and the nucleotide sequences were confirmed by commercial sequencing. E. coli BL21(DE3) cells were transformed with the expression vectors, plated on agar plates containing kanamycin, and grown overnight at 37°C. A single colony was inoculated into 10 mL of LB medium containing kanamycin (50 μg.mL) and the cells were grown overnight at 37°C. The overnight culture was inoculated into 1 L of LB medium containing kanamycin. The cells were grown at 37°C. The expression was induced with isopropyl b-D-1-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM. The cells were then grown overnight at 20°C. At the end of the cultivation, the biomass was harvested by centrifugation and washed with buffer (20 mM dipotassium hydrogen phosphate and potassium dihydrogen phosphate, pH 7.5, 0.5 M NaCl, 10 mM imidazole). The cells in suspension were disrupted by sonication, and the cell lysate was centrifuged. The protein was purified from the crude extract using single-step nickel affinity chromatography. The presence of the protein in the peak fraction was verified by SDS-PAGE in a 15% polyacrylamide gel. The purified protein was dialyzed against phosphate buffer containing 750 mM NaCl. Purification of the FGF10 mutants by affinity chromatography yielded homogeneous proteins with purity exceeding 95%, as verified by SDS-PAGE electrophoresis (Fig. 1).The yields of most FGF10 single point mutants ranged from 10 to 21 mg per liter of cell culture. The only exception was the FGF10 mutation S143P, which reduced protein yields by approximately 90%. Therefore, this mutation was excluded from further analysis.

[0082] Example 3. Determining the thermal stability of single-point FGF10 mutants The thermal stability of single-point FGF10 mutants predicted by the energy-based and evolution-based approaches was measured by differential scanning fluorometry (DSF) and differential scanning calorimetry (DSC). Protein solutions of 0.2 mg / mL and 1.0 mg / mL in 20 mM phosphate buffer (pH 7.5) containing 750 mM sodium chloride were thermally unfolded and then the changes in intrinsic fluorescence and heat capacity were monitored using a NanoTemper Prometheus DSF system and a VP-capillary DSC system, respectively. The measurements were performed at temperatures from 25 to 90 °C with a heating rate of 1 °C / min. The melting temperatures (T m ) was evaluated as the midpoint of the normalized fluorescence thermal transition in the case of DSF experiments or as the maximum of the apparent heat capacity peak in the case of DSC experiments, respectively. The results are listed in Table 2. ΔT m Single point mutants with stability-increasing mutations of ≥2°C were selected for biological activity testing (see Example 4), and once unmodified activity was confirmed, stabilizing mutations were combined into multi-point mutants using free energy calculations (see Example 5).

[0083] [Table 2]

[0084] Example 4. Biological activity testing of single-point FGF10 mutants with improved stability using the lung epithelial 4MBr-5 cell proliferation assay FGF10 is expressed in mesenchymal cells and promotes epithelial-mesenchymal signaling by binding to epithelially expressed FGF receptor 2b (FGFR2b). 4MBr-5 rhesus bronchial epithelial cells require epidermal growth factor (EGF) to proliferate, but because these cells naturally express FGFR2b, FGF10 may be used instead to induce cell proliferation. Activation of FGFR2b signaling leads to a mitogenic response that can be quantified using various cell proliferation / viability assays, such as resazurin-based assays. Resazurin is a cell-permeable redox indicator that reflects cell viability by being converted from the non-fluorescent blue dye resazurin to the highly fluorescent red dye resorufin in response to chemical reduction of the growth medium caused by cell proliferation. The fluorescent signal is proportional to the number of viable cells in the sample.

[0085] To test the biological activity of FGF10 mutants with increased thermodynamic stability, 4MBr-5 cells were cultured at 7.5 × 10 cells / well in 96-well plates containing 150 μL of 4MBr-5 starvation medium (Ham's F-12K-Gibco, 10% newborn calf serum, 1% penicillin G / streptomycin sulfate, 2 μg / mL heparin). 3 The plates were seeded at 1000 cells / well. Three hours after seeding, the cells were protein-treated to ensure proper cell adhesion. FGF10 mutants were serially diluted in starvation medium, and 50 μL of protein solution was added to the wells. The final concentrations of FGF10 mutants ranged from 0.001 ng / mL to 2000 ng / mL, and each concentration was tested in triplicate. Mouse EGF was used as a positive control. After 3 days of culture, 20 μL of resazurin solution was added to each well, and the plates were incubated overnight. Metabolic activity was measured by fluorescence measurement (excitation 560 nm, emission 590 nm) on a Synergy 4H reader (BioTek, USA). FGF10-induced cell proliferation was monitored by the online software ED 50 The effective dose ED was calculated using the AAT Bioquest Calculator (USA). 50 The concentrations are expressed as median values ​​(protein concentrations required to achieve half-maximal proliferation).

[0086] FGF10-wt and its thermostable single point mutants effectively induced proliferation of 4MBr-5 cells (Fig. 2). The median effective dose (ED 50 ) comparison, all the thermostable single point mutants were significantly higher than FGF10-wt (ED 50 = 0.8 ng / mL) as well as 4MBr-5 cells (ED 50 The predicted ED of the commercially available recombinant human FGF10 molecule, measured in a cell proliferation assay using 4MBr-5 cells, was found to be effective in inducing proliferation at concentrations ranging from 0.2 to 1.6 ng / mL. 50 Values ​​are <15 ng / mL. This example demonstrates the unaltered biological activity of thermostable single point mutants of FGF10.

[0087] Example 5. In silico validation of multiple point mutants of FGF10 polypeptide All the single-point substitutions selected above, which were experimentally confirmed to be stabilizing while retaining the unmodified biological activity, were combined in silico with all possible double-point and multi-point mutants, and their energies were estimated by force field calculations. Both double-point and multi-point mutants were designed in silico using a protocol incorporating backbone flexibility in the ddg monomer module of Rosetta software, according to Kellogg et al. (Kellogg, E. et al., 2011, Proteins, 79:830-838). A soft-repulsive design energy function was used for side chain repacking. Optimization was performed on the whole protein without distance restrictions. Three rounds of optimization were performed with increasing weighting on the repulsive terms. The minimum energy obtained after 50 iterations was taken as the final parameter representing the stability effect. A comparison of the calculated free energies of the multi-point mutants with the predicted ΔΔG values ​​estimated as the sum of the energy contributions from the individual stabilizing mutations is summarized in Table 3. The observed differences between the calculated ΔΔG values ​​of the multi-point mutants and the sum ΔΔG of the individual stabilizing mutations suggested that the individual mutations do not significantly antagonize each other and that their combination leads to a stable FGF10 polypeptide.

[0088] [Table 3]

[0089] Example 6. Construction, purification, and thermostability testing of four-point FGF10 mutants Genes encoding four point mutants of FGF10 and FGF10-STAB were commercially synthesized and subcloned into the Ndel and Xhol sites of the expression vector pET28b-His-Thrombin under the control of the T7lac promoter. The resulting constructs were transformed into E. coli NEB5-alpha competent cells. The cells were plated on agar plates containing kanamycin (50 μg / mL) and grown overnight at 37°C. Plasmids were isolated and the nucleotide sequences were confirmed by commercial sequencing. E. coli BL21(DE3) cells were transformed with the expression vectors, plated on agar plates containing kanamycin and grown overnight at 37°C. A single colony was inoculated into 10 mL of LB medium containing kanamycin (50 μg / mL) and the cells were grown overnight at 37°C. The overnight culture was inoculated into 1 L of LB medium containing kanamycin. The cells were grown at 37°C. The expression was induced with IPTG to a final concentration of 0.5 mM. The cells were then cultured overnight at 20°C. At the end of the culture, the biomass was harvested by centrifugation, washed with purification buffer (20 mM dipotassium hydrogen phosphate and potassium dihydrogen phosphate, pH 7.5, 0.5 M NaCl, 10 mM imidazole), and the wet biomass was frozen at -80°C. The thawed culture was disrupted by sonication, and the lysate was centrifuged. FGFq10-STAB was purified from the crude extract using single-step nickel affinity chromatography. The purified protein was dialyzed against a buffer containing 750 mM NaCl. Protein purity was revealed by SDS-PAGE in 15% polyacrylamide gels (Figure 3). The average yield of FGF10-STAB was 12 mg per liter of cell culture. The thermal stability of FGF10-STAB was measured by DSF and DSC by diluting the protein solution to 1.0 mg / mL. The measurements were performed at temperatures between 25 and 90°C with a heating rate of 1°C / min. m ) was evaluated as the midpoint of the normalized fluorescence thermal transition or as the maximum of the apparent heat capacity peak in the case of DSF and DSC experiments, respectively. m was 64°C, which represents a 19°C increase in melting temperature compared with FGF10-wt (Figure 4).

[0090] Example 7. Stabilization of FGF10 polypeptide by protein engineering exceeds the stabilizing effect of heparin The stabilizing effect of heparin addition has been previously reported for various members of the FGF protein family, including the FGF10 polypeptide. Therefore, we tested the effect of heparin on the thermal stability of FGF10-STAB, a stabilized form of the FGF10 polypeptide, and compared it with the stabilizing effect of heparin on FGF10-wt. The melting temperatures of FGF10-STAB and FGF10-wt at a range of heparin concentrations were measured by DSF after diluting the protein solutions to 1.0 mg / mL. Measurements were performed at temperatures from 25 to 90°C with a heating rate of 1°C / min. T m was evaluated as the midpoint of the normalized fluorescence thermal transition. m 46°C; measured in the absence of heparin) was significantly increased in the presence of 5-15 μM heparin, but (T m The thermal stability of FGF10-STAB stabilized by protein engineering (57°C) was not affected even in the presence of the highest heparin concentration tested (15 μM). Stabilization of the FGF10 polypeptide via heparin increased the melting temperature by 10°C, whereas stabilization of FGF10 via protein engineering (i.e., introduction of four stabilizing amino acid substitutions) increased the melting temperature by 19°C (Figure 5). This example demonstrates that stabilization of FGF10 by protein engineering complements and even surpasses the stabilizing effect of heparin.

[0091] Example 8. Biological activity testing of four-point FGF10 mutants with enhanced stability in the lung epithelial 4MBr-5 cell proliferation assay The biological activity of the four-point FGF10 mutant, FGF10-STAB, was measured by cell proliferation assay using the 4MBr-5 cell line (Rubin, JS et al., 1989, Proc Natl Acad Sci USA, 86:802-806). Prior to analysis, lyophilized form of FGF10 was reconstituted in water, diluted with 0.1% BSA to a final concentration of 100 μg / mL, and used immediately or stored at -20°C. 4MBr-5 cells were seeded at 7.5 × 10 cells / well in a 96-well plate containing 150 μL of 4MBr-5 starvation medium (Ham's-12K-Gibco® + 10% newborn calf serum + 1% penicillin G / streptomycin sulfate + 2 μg / mL heparin). 3 Cells were seeded at 1000μL / well. Three hours after seeding, cells were protein-treated to ensure proper cell attachment. FGF10-STAB was serially diluted in starvation medium, and 50μL of protein solution was added to the wells. The final concentrations of FGF10 ranged from 0.001ng / mL to 2000ng / mL, and each concentration was tested in triplicate. Mouse EGF was used as a positive control. After 3 days of culture, 20μL of resazurin solution was added to each well, and the plates were incubated overnight. Metabolic activity was measured by fluorescence measurement (excitation 560nm, emission 590nm) on a Synergy 4H reader. FGF10-induced cell proliferation was monitored using the online software ED 50 Effective dose calculated by the calculator 50 The measured ED of FGF10-STAB was expressed as the median (protein concentration required to achieve half-maximal proliferation). 50 The ED value, i.e., the concentration of FGF10-STAB inducing half the maximal response in proliferation of 4MBr-5 cells, was 0.21 ng / mL, which is less than the predicted ED of recombinant FGF10-wt for this effect. 50 This is in perfect agreement with the values ​​(<15 ng / mL) (Figure 6). Therefore, this example demonstrates that the biological activity of FGF10-STAB is unchanged.

[0092] Example 9. FGF10-STAB, a thermostable four-point FGF10 mutant that maintains biological activity even after prolonged incubation at 37°C due to enhanced structural half-life It is clear that the inherent instability of FGF proteins limits their biological functions and fails to activate FGF receptor signaling over long periods of time (Buchtova, M. et al., 2015, Cell. Mol. Life Sci., 72: 2445-2459). To assess how the increased thermodynamic stability of FGF10-STAB correlates with its ability to maintain cell signaling after prolonged incubation at 37°C, we monitored the biological activity of FGF10-STAB through activation of the ERK pathway in breast adenocarcinoma MCF7 cell signaling assays. MCF7 cells endogenously express the FGFR2 receptor, which is activated upon interaction with FGF10 along with its downstream effectors including ERK1 / 2. When the biological activity of FGF10 is reduced at 37°C, ERK1 / 2 phosphorylation (pERK1 / 2) is reduced. MCF7 cells were grown in complete medium (Dulbecco's modified Eagle's medium (DMEM) with 10% FBS and 1% penicillin / streptomycin; Thermo Fisher Scientific). For Western blot experiments, 200,000 MCF7 cells / well were plated in 24-well plates containing 0.5 mL of complete medium and stimulated the next day with FGF10 at a final concentration of 10 ng / mL for 30 min and lysed in 2x Laemmli sample buffer. For this treatment, FGF10 was diluted in complete medium to a concentration of 0.5 μg / mL and preincubated at 37°C for up to 24 h. Cell lysates were boiled (95°C, 7 min), resolved by SDS-PAGE, transferred to PDVF membranes, and pERK1 / 2 and ERK1 / 2 levels were visualized by antibodies and chemiluminescence. Aliquots of FGF10-containing medium were collected at each time point of preincubation, mixed with an equal volume of 2x Laemmli sample buffer, boiled, and Western blotted for FGF10 using the following antibodies: rabbit monoclonal anti-pERK (4376; Cell Signaling), rabbit polyclonal anti-ERK (9102; Cell Signaling), rabbit polyclonal anti-FGF10 (sc-7917; SCBT), and goat anti-rabbit IgG-HRP (A6667; Sigma-Aldrich).The biological activity of FGF10-wt decreased with time of heat preincubation, whereas the heat-stabilized FGF10-STAB mutant retained full biological activity even after 24 h at 37°C (Fig. 7).

[0093] Concurrently, the structural integrity of FGF10-wt and its thermostable four-point mutant FGF10-STAB during incubation at 37°C was monitored by circular dichroism (CD) spectroscopy. The changes in the secondary structure of FGF10-wt and FGF10-STAB at a concentration of 0.2 mg / mL in 25 mM phosphate buffer (pH 7.5) containing 750 mM NaCl were followed by monitoring the ellipticity over a wavelength range of 200-260 nm at 37°C. Data were recorded at 5 min intervals with a bandwidth of 1 nm using a 0.1 cm quartz cuvette containing the protein. The recorded denaturation curves (single exponential) of the tested FGF10 mutants were globally fitted to exponential decay curves using Origin2019b software (OriginLab, Northampton, MA). The half-life t 1 / 2 is defined as the time required for the initial value of ellipticity, an index of the secondary structure of a protein, to decrease to half its original value, and was evaluated from the collected data as the decay constant (τ) according to the following formula: t 1 / 2 = ln(2) / λ = τ ln(2), where λ is the exponential decay constant. 1 / 2 was assessed from data collected at 227 nm (Fig. 8A), at which the CD spectra of both FGF10 protein variants showed maximum ellipticity (Fig. 8B). FGF10-STAB clearly outperformed FGF10-wt, and the t 1 / 2 The t of the secondary structure of FGF10-STAB was 11.6 h, whereas 1 / 2 for >24 h at 37°C (Figure 8A). This example demonstrates that whereas the loss of biological activity of wild-type FGF10 is manifested by the loss of secondary structure after heat preincubation at 37°C, FGF10-STAB retains its secondary structure and therefore full biological activity after 1 day of incubation at 37°C.

[0094] Example 10. Long-term biological activity testing of the four-point FGF10 mutant FGF10-STAB using MCF7 cell reporter assay The ability of FGF10-STAB to activate extended FGFR signaling was tested by fluorescent reporter assay using MCF7 cells transfected with TR01G vector carrying pKrox24(MapERK)-DsRed reporter. pKrox24(MapERK)-DsRed allowed sensitive monitoring of the ability of FGF10 to stimulate the FGFR / ERK MAP signaling pathway in response to FGFR signaling activation upon addition of FGF10 to cell culture medium. For the reporter assay, 50,000 MCF7 cells expressing DsRed (Discosoma red fluorescent protein) under the control of pKrox24(MapERK) promoter were plated in 24-well plates containing 0.5 mL of complete medium. The next day, cells were stimulated with FGF10 at a final concentration of 100 ng / mL for 24 h. The expression of DsRed was monitored over a 24-h period using an automated incubation microscope BioStation CT (Nikon) and plotted against the signal recorded for the control, FGF10-free cells transfected with pKrox24(MapERK)-DsRed. For cell treatment, FGF10 was diluted to a concentration of 100 ng / mL in complete medium and preincubated at 37°C for 2 h.

[0095] Treatment of cells with recombinant FGF10-wt induced transcription of the pKrox24 reporter in response to activation of the FGFR / ERK MAP kinase pathway. FGF-mediated pKrox24 induction was monitored for 24 h and was approximately 2.5-fold stronger in cells treated with FGF10-STAB compared to FGF10-wt (Figure 9A). When cells were preincubated in complete medium for 2 h before adding FGF10, almost no pKrox24 induction was observed with FGF10-wt compared to normal activation with FGF10-STAB (Figure 9B). This example demonstrates that FGF10-STAB can sustain activation of FGFR signaling that is resistant to unfolding and proteolysis in the presence of serum.

[0096] Example 11. Thermostability measurements of four-point FGF10 mutants using 4MBr-5 cells The ability of FGF10-STAB to promote proliferation of 4MBr-5 cells after exposure to 37°C for 7 days was further tested to further explore protein stability. 4MBr-5 cells were plated at 7.5 × 10 cells / well in a 96-well plate containing 150 μL of 4MBr-5 starvation medium (Ham's F-12K-Gibco, 10% newborn calf serum, 1% penicillin G / streptomycin sulfate, 2 μg / mL heparin). 3Cells were seeded at 1000μL / well. Three hours after seeding, cells were protein-treated to ensure proper cell attachment. Prior to testing, both FGF10-STAB and FGF10-wt were incubated at 37°C for 1, 3, and 7 days at a concentration of 8μg / mL. After preincubation, protein solutions were serially diluted in starvation medium and 50μL of protein solution was added to the wells at final concentrations ranging from 0.001ng / mL to 2000ng / mL. Each protein concentration was tested in triplicate. Mouse EGF was used as a positive control. After 3 days of culture, 20μL of resazurin solution was added to each well and the plates were incubated overnight. Metabolic activity was measured by fluorescence measurement (excitation 560nm, emission 590nm) on a Synergy 4H reader. Preincubation of FGF10-STAB at 37°C for 24 hours, 3 days, and 7 days did not affect the ability of the protein to effectively induce proliferation of 4MBr-5 cells (Figure 10). ED of FGF10-STAB measured after preincubation at 37°C for three test periods. 50 The ED value was <15 ng / mL, which is the ED value for the non-preincubated protein. 50 Equivalent to the value (ED 50 On the other hand, when FGF10-wt was treated at 37°C for 24 hours, 3 days, and 7 days, the protein activity gradually decreased, which was related to the ED 50 This example shows that the biological activity of FGF10-STAB remains unchanged even after pre-incubation at 37°C for 7 days.

[0097] [Table 4]

[0098] Example 12. Thermostable four-point FGF10 mutants with improved resistance to proteolysis To characterize the resistance of FGF10-STAB to proteolysis, 1 mg / mL of FGF10-STAB and FGF10-wt were incubated in 20 mM phosphate buffer containing 750 mM sodium chloride at 37°C for 15 min. Trypsin (final concentration 2 μg protease / 100 μg FGF10) was then added to the protein solution and the digestion mixture was incubated at 37°C. At selected times, aliquots were removed, added to an equal volume of electrophoresis diluent, heated at 95°C for 5 min, and analyzed by SDS-polyacrylamide gel electrophoresis. Protein bands were analyzed by densitometric analysis. Progression of FGF10-wt degradation was observed, with no protein remaining after 10 min of incubation with trypsin. In contrast, no significant proteolysis was observed at 10 min, and even after 180 min of incubation with trypsin, a band of FGF10-STAB was detectable that decreased in intensity over time (Figure 11). This example demonstrates the enhanced resistance of FGF10-STAB to proteolysis compared to FGF10-wt.

[0099] Example 13. N-terminal truncation of 31 amino acids from the mature human FGF10 polypeptide, forming the amino acid sequence Ser69 to Ser208 of SEQ ID NO:1, without adversely affecting FGF10 stability and activity To demonstrate that the N-terminal truncation of 31 amino acids from the mature human FGF10 polypeptide does not affect protein stability and activity, we constructed and characterized an FGF10 polypeptide consisting of the amino acid sequence Ser69-Ser208 of SEQ ID NO:1 and its stable mutant with the substitution L152F. 69‐208An FGF10 polypeptide consisting of the nucleotide sequence 1444 of the 1444 gene was constructed by side-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer's instructions. Mutagenesis was performed by whole-plasmid PCR using the plasmid pET28b-His-Thrombin::fgf10 as template and two oligonucleotides (Fw: AGCTATAATCATCTGCAGGGTGATGTTCG, Rv: CATATGGCTGCCGCGCGG) designed using the NEBaseChanger™ tool. Then, the vector pET28b-His-Thrombin::fgf10 was cloned into the 1444 of ... 69‐208 And, the single point substitution L152F (mutation number corresponds to SEQ ID NO: 1) was introduced into FGF10 by whole-plasmid PCR using two non-overlapping oligonucleotides carrying the desired mutation. 69‐208The polypeptide was introduced into the ribozyme. The resulting construct was transformed into E. coli NEB5-alpha competent cells. The cells were plated on agar plates containing kanamycin (50 μg / mL) and grown overnight at 37°C. The plasmid was isolated and the nucleotide sequence was confirmed by commercial sequencing. E. coli BL21(DE3) cells were transformed with the expression vector, plated on agar plates supplemented with kanamycin and grown overnight at 37°C. A single colony was inoculated into 10 mL of LB medium containing kanamycin (50 μg.mL) and the cells were grown overnight at 37°C. The overnight culture was inoculated into 1 L of LB medium containing kanamycin. The cells were grown at 37°C. The expression was induced with IPTG to a final concentration of 0.5 mM. The cells were then grown overnight at 20°C. At the end of the cultivation, the biomass was harvested by centrifugation, washed with purification buffer (20 mM dipotassium hydrogen phosphate and potassium dihydrogen phosphate, pH 7.5, 0.5 M NaCl, 10 mM imidazole), and the wet biomass was frozen at -80°C. The thawed culture was disrupted by sonication, and the lysate was centrifuged. Protein was purified from the crude extract using single-step nickel affinity chromatography. The purified protein was dialyzed against a buffer containing 750 mM NaCl. Protein purity was revealed by SDS-PAGE in a 15% polyacrylamide gel (Figure 12). Proper folding and thermostable FGF polypeptides were determined by CD spectroscopy. CD spectra were collected from 200 to 260 nm at 100 nm per minute, with a response time of 1 s and a bandwidth of 2 nm using a Chirascan CD spectrometer. FGF10 69‐208 Polypeptide and its mutant FGF10 69‐208The CD spectrum of +L152F was comparable to that of recombinant human FGF10 (FGF10-wt) and its mutants with the same stabilizing amino acid substitution L152F, suggesting that the N-terminal truncation does not adversely affect the folding of the FGF10 polypeptide (Figure 13). Thermal unfolding of a 0.2 mg / mL protein solution in 20 mM phosphate buffer pH 7.5 containing 750 mM sodium chloride was followed by monitoring the ellipticity at 227 nm over the temperature range of 25°C to 90°C at a heating rate of 1°C / min using a Chirascan CD spectrometer. The melting temperatures (T m ) was evaluated as the midpoint of the normalized ellipticity thermal transition. 69‐208 is FGF10‐wt(T m 53.0℃) m The N-terminal truncation did not have a negative or positive effect on the thermal stability of the FGF10 polypeptide, as shown by the thermal stability (52.7°C) of both FGF10 polypeptides, FGF10-wt and FGF10. 69‐208 Introduction of the stabilizing amino acid substitution L152F into FGF10 consistently increases stability by 7°C. 69‐208 Polypeptide and its mutant FGF10 69‐208 The biological activity of +L152F was measured by a cell proliferation assay using the 4MBr-5 cell line (Rubin, JS et al., 1989, Proc Natl Acad Sci USA, 86:802-806). 4MBr-5 cells were cultured at 7.5 × 10 cells / well in 150 μL of 4MBr-5 starvation medium (Ham's F-12K-Gibco, 10% newborn calf serum, 1% penicillin G / streptomycin sulfate, 2 μg / mL heparin) in a 96-well plate. 3 Cells were seeded at 1000 cells / well. Three hours after seeding, the cells were treated with protein. The final protein concentrations ranged from 0.001 ng / mL to 2000 ng / mL. After treatment, the cells were cultured for another 3 days. Cell proliferation was measured by resazurin fluorescence assay. Experiments were performed in triplicate. FGF10 69‐208 and FGF10 69‐208 Both FGF10 and L152F showed similar proliferation-promoting ability to 4MBr-5 cells as FGF10-wt (Fig. 14).50 The predicted ED values ​​for this effect were 0.5 and 1.9 ng / mL, respectively. 50 This corresponds to a value of <15 ng / mL.

[0100] Example 14. A 12% change in the thermostable FGF10 amino acid sequence can be achieved without losing protein thermal stability and activity A gene encoding an FGF10 polypeptide with 88% sequence identity to SEQ ID NO:3 or SEQ ID NO:5, corresponding to FGF10 from Peregrine Falcon (FGF10-Fp), was artificially synthesized and subcloned into the Ndel and Xhol sites of the expression vector pET28b-His-Thrombin under the control of the T7lac promoter. Then, using the vector pET28b-His-Thrombin::fgf10-fp as a template and two non-overlapping oligonucleotides carrying the desired mutations, a single point substitution L152F (the number of the mutation corresponds to SEQ ID NO:1) was introduced into the FGF10-FP polypeptide with 88% sequence identity to SEQ ID NO:3 or SEQ ID NO:5 by whole-plasmid PCR. The resulting construct was transformed into E. coli NEB5-alpha competent cells. The cells were plated on agar plates containing kanamycin (50 μg / mL) and grown overnight at 37°C. The plasmid was isolated and the nucleotide sequence was confirmed by commercial sequencing. E. coli BL21(DE3) cells were transformed with the expression vector, plated on agar plates supplemented with kanamycin, and grown overnight at 37°C. A single colony was inoculated into 10 mL of LB medium containing kanamycin (50 μg / mL), and the cells were grown overnight at 37°C. The overnight culture was inoculated into 1 L of LB medium containing kanamycin. The cells were grown at 37°C. The expression was induced with IPTG to a final concentration of 0.5 mM. The cells were then grown overnight at 20°C. At the end of the cultivation, the biomass was harvested by centrifugation, washed with purification buffer (20 mM dipotassium hydrogen phosphate and potassium dihydrogen phosphate, pH 7.5, 0.5 M NaCl, 10 mM imidazole), and the wet biomass was frozen at -80°C. The thawed culture was disrupted by sonication, and the lysate was centrifuged. Proteins were purified from the crude extract using single-step nickel affinity chromatography. The purified protein was dialyzed against a buffer containing 750 mM NaCl. The purity of the protein was revealed by SDS-PAGE on a 15% polyacrylamide gel (Figure 15). The FGF polypeptide was properly folded and thermostable as determined by CD spectroscopy.CD spectra were collected from 200 to 260 nm using a Chirascan CD spectrometer at 100 nm per minute, 1 s response time, and 2 nm bandwidth. The CD spectra of FGF10 polypeptide and its single point mutants with 88% sequence identity to SEQ ID NO:3 or SEQ ID NO:5, including the amino acid substitution L152F, were comparable to those of recombinant human FGF10-wt and its mutants with the same amino acid substitution L152F (Figure 16), suggesting that the folding of the newly constructed FGF10 polypeptide with 12% amino acid sequence change was proper. Thermal unfolding of a 0.2 mg / mL protein solution in 20 mM phosphate buffer pH 7.5 containing 750 mM sodium chloride was followed by monitoring the ellipticity at 227 nm using a Chirascan CD spectrometer over the temperature range of 25°C to 90°C at a heating rate of 1°C / min. Melting temperatures (T m ) was evaluated as the midpoint of the normalized ellipticity thermal transition. The melting temperature of recombinant hawk FGF10 polypeptide (FGF10-Fp) with 88% sequence identity to SEQ ID NO:3 or SEQ ID NO:5 was 5°C higher than that of recombinant human FGF10 (FGF10-wt). The observed difference in melting temperatures of FGF10 polypeptides may be due to the fact that avian core body temperatures are generally 3-6°C higher than human body temperatures (McCafferty, DJ, et al., 2015, Anim. Biotelemetry 3:33). However, introduction of the same stabilizing mutation L152F into both FGF10-wt and FGF10-Fp polypeptides increased the melting temperatures by 7°C and 5°C, respectively.

[0101] The biological activity of FGF10-Fp and its mutant with the single substitution L152F (FGF10-Fp+L152F) was measured by cell proliferation assay using the 4MBr-5 cell line (Rubin, JS et al., 1989, Proc Natl Acad Sci USA, 86:802-806). 4MBr-5 cells were cultured at 7.5 × 10 cells / well in 150 μL of 4MBr-5 starvation medium (Ham's F-12K-Gibco, 10% newborn calf serum, 1% penicillin G / streptomycin sulfate, 2 μg / mL heparin) in a 96-well plate. 3 Cells were seeded at 1000 cells / well. Three hours after seeding, the cells were treated with proteins. The final protein concentrations ranged from 0.001 ng / mL to 2000 ng / mL. After treatment, the cells were cultured for an additional 3 days. Cell proliferation was measured by resazurin fluorescence assay. Experiments were performed in triplicate. The EDs of FGF10-Fp and FGF10-Fp+L152F measured in the 4MBr-5 proliferation assay were 50 The values ​​were 12.7 and 6.1 ng / mL, respectively (FIG. 17). This example demonstrates that 12% amino acid sequence changes can be introduced into the thermostable FGF10 polypeptide without significantly impairing its stability while retaining its biological activity.

[0102] Example 15. The presence of FGF10-STAB in the culture medium promotes the formation of lung cell clusters and lung organoids. FGF10 plays an important role in lung development, differentiation, and regeneration. Therefore, we investigated the effect of FGF10-STAB on the formation, branching, and differentiation of lung cell clusters and lung organoids. Lung epithelial cells were isolated as previously described (Rabata, A. et al., 2017, Methods Mol Biol, 1612:149-165) and cultured under non-adherent conditions. 2.5 × 10 cells were cultured in 6-well polyHEMA-treated plates containing 2 mL / well of lung cell cluster medium (DMEM / F12 without phenol red, 1 x B-27 without vitamin A, 100 U / mL penicillin, 100 μg / mL streptomycin, 4 μg / mL heparin, 20 ng / mL mouse EGF, 10 ng / mL FGF10-wt or FGF10-STAB, 10 μM Y-27632). 4 ~5×10 4 Unsorted lung epithelial cells were seeded on the cells. The plates were incubated at 37℃ in a humidified atmosphere of 5% CO2. Fresh lung cell cluster medium (without Y-27632) was added every 3 days. After culturing for 10-15 days, the lung cell clusters were counted. The lung cell cluster formation efficiency was calculated as the ratio of the number of lung cell clusters formed to the number of cells seeded.

[0103] For lung organoid culture in 3D Matrigel, lung epithelial cells were resuspended in Matrigel and plated in Matrigel-coated domed 24-well plates (1.0–1.5 × 10 cells in 50 μL Matrigel / well). 4 Cells). After the plates were incubated at 37°C for 45 min, 1 mL of medium (1 x B-27 without vitamin A, 100 U / mL penicillin, 100 μg / mL streptomycin, 20 ng / mL mouse EGF, 2 nM FGF10-wt or FGF10-STAB, and 10 μM Y-27632 in phenol red-free DMEM / F12) was added to each well. The cells were incubated at 37°C in a humidified atmosphere of 5% CO2. The medium was changed every 3 days. After 21 days of culture, the lung organoids were counted. The organoid formation efficiency was calculated as the ratio of the number of lung organoids formed to the number of cells seeded.

[0104] The results showed that FGF10-STAB had higher lung cell cluster formation efficiency and organoid formation efficiency than FGF10-wt (Figure 18). Furthermore, organoids formed with FGF10-STAB showed more branching and higher staining rates for airway and alveolar cell markers than for basal cell markers. This example demonstrates that the presence of FGF10-STAB in lung cell cluster / lung organoid culture medium promotes the formation and differentiation of lung cell clusters / organoids.

Claims

1. A heat-stable FGF10 polypeptide or a fragment thereof having FGF10 activity and having at least 85% sequence identity with or consisting of SEQ ID NO: 3 having the amino acid sequence of Ser69 to Ser208 of SEQ ID NO: 1, wherein said heat-stable FGF10 polypeptide or a fragment thereof contains at least the amino acid substitution L152F.

2. 2. The heat-resistant FGF10 polypeptide of claim 1, wherein said heat-resistant FGF10 polypeptide has or consists of SEQ ID NO: 3 or a fragment thereof, and said heat-resistant FGF10 polypeptide or a fragment thereof comprises at least the amino acid substitution L152F.

3. The heat-stable FGF10 polypeptide according to claim 1 or 2, wherein the heat-stable FGF10 polypeptide or a fragment thereof further comprises at least one amino acid substitution selected from the group consisting of V123I, Q175E, and N181D.

4. The heat-resistant FGF10 polypeptide according to claim 1 or 2, wherein the heat-resistant FGF10 polypeptide or a fragment thereof further comprises at least two amino acid substitutions selected from the group consisting of V123I, Q175E, and N181D.

5. The heat-stable FGF10 polypeptide according to claim 1 or 2, wherein the heat-stable FGF10 polypeptide or a fragment thereof further comprises three amino acid substitutions V123I, Q175E and N181D.

6. In addition: at least some or all of the amino acids of SEQ ID NO:4 or the N-terminal methionine of SEQ ID NO:3; and / or - at least one short fused amino acid sequence (tag) of a maximum length of 20 amino acids in the N- or C-terminal part The heat-stable FGF10 polypeptide according to claim 1 or 2,

7. The heat-resistant FGF10 polypeptide according to claim 1, wherein the heat-resistant FGF10 polypeptide has at least 85% sequence identity with or consists of SEQ ID NO: 5 or a fragment thereof having the amino acid sequence of Leu40 to Ser208 of SEQ ID NO: 1, and the heat-resistant FGF10 polypeptide or a fragment thereof contains at least the amino acid substitution L152F.

8. The heat-stable FGF10 polypeptide of claim 7, wherein the heat-stable FGF10 polypeptide has or consists of SEQ ID NO: 5 or a fragment thereof, and the heat-stable FGF10 polypeptide or a fragment thereof comprises at least the amino acid substitution L152F.

9. The heat-resistant FGF10 polypeptide according to claim 7 or 8, wherein the heat-resistant FGF10 polypeptide or a fragment thereof further comprises at least one amino acid substitution selected from the group consisting of V123I, Q175E, and N181D.

10. The heat-resistant FGF10 polypeptide according to claim 7 or 8, wherein the heat-resistant FGF10 polypeptide or a fragment thereof further comprises at least two amino acid substitutions selected from the group consisting of V123I, Q175E, and N181D.

11. The heat-stable FGF10 polypeptide according to claim 7 or 8, wherein the heat-stable FGF10 polypeptide or a fragment thereof further comprises three amino acid substitutions, V123I, Q175E and N181D.

12. The heat-resistant FGF10 polypeptide according to claim 7 or 8, selected from the group of FGF10 polypeptides consisting of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO:

13.

13. Further below at least part or all of the amino acids of SEQ ID NO:6 or the N-terminal methionine of SEQ ID NO:5; and / or - at least one short fused amino acid sequence (tag) of a maximum length of 20 amino acids in the N- or C-terminal part The heat-stable FGF10 polypeptide according to claim 7 or 8,

14. The heat-resistant FGF10 polypeptide according to claim 7 or 8, further comprising SEQ ID NO: 6 at the N-terminus of any of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO:

13.

15. A heat-stable FGF10 polypeptide according to any one of claims 1, 2, 7 or 8 for use in regenerative medicine, preferably for pulmonary epithelial regeneration after various stresses or for wound and ulcer healing or other related medical applications, e.g. cardiac therapy.

16. Use of a heat-stable FGF10 polypeptide according to any one of claims 1, 2, 7 or 8 in cosmetics, preferably in supporting collagen synthesis, skin strength, anti-aging treatment and non-therapeutic stimulation of hair growth.

17. A culture medium for the proliferation and differentiation of human embryonic stem cells or the formation and differentiation of spheroids and organoids, preferably lung organoids, gastric organoids, liver organoids, pancreatic organoids, and prostate organoids, comprising an effective amount of a heat-stable FGF10 polypeptide according to any one of claims 1, 2, 7, or 8 at 10 ng / mL to 500 ng / mL in said culture medium.

Images