CD38 Compositions and Methods for Immunotherapy
Patent Information
- Application Number
- JP2024525807
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-11-03
- Filing Date
- 2022-11-02
- Publication Date
- 2025-11-11
AI Technical Summary
Current treatments for cancers expressing CD38, such as multiple myeloma and lung cancer, are limited by immunosuppression and immunomodulation induced by CD38, which acts as an immune checkpoint molecule, and CD38 overexpression contributes to tumor proliferation and antitumor T cell depletion.
Genetically modified T cells and NK cells with reduced or eliminated CD38 expression, equipped with chimeric antigen receptors (CARs) and recombinant T cell receptors (TCR), are used in adoptive cell transfer therapy, combined with CD38-targeted therapeutic agents like daratumumab, to target and eliminate CD38-expressing cancer cells.
Enhances cancer treatment efficacy by overcoming immunosuppression and targeting CD38-expressing cancers, improving T cell function and reducing tumor proliferation.
Smart Images

Figure 2023081200000001
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 275,431, filed November 3, 2021, the contents of which are incorporated herein by reference in their entirety. [Background technology]
[0002] Cyclic ADP-ribose hydrolase (CD38) is an ectoenzyme expressed on the surface of certain immune cells that has been used as a biomarker to identify activation of T cells and lymphocytes. It synthesizes the second messengers cyclic adenosine 5'-diphosphate-ribose (cADP-ribose) and nicotinamide dinucleotide (NAD+). NAD+ is the second messenger for glucose-induced insulin secretion. Adenosine can be synthesized from NAD+, and adenosine has been implicated in immunosuppression and immune regulation in multiple myeloma and lung cancer. These findings have led to speculation that CD38 may function as an immune checkpoint molecule. Furthermore, CD38 is thought to be involved in aging and aging-related dysfunction, responses to microbial infections, and hyperinflammatory disorders. Furthermore, CD38 controls antitumor T cell exhaustion.
[0003] CD38 is expressed on immune cells including T cells, B cells, circulating monocytes, dendritic cells, granulocytes, plasma cells, both resting and circulating NK cells, neutrophils, and granulocytes. CD38 can also function as a receptor on these cells, a function that can activate immune cells and is necessary for these cells to proliferate. On the T cell surface, CD38 interacts with its ligand, CD31, eliciting downstream effects that overlap with T cell receptor (TCR) / CD3 activation.
[0004] CD38, which is associated with several hematological malignancies, plays a role in immunosuppression in the tumor microenvironment. For example, it has been shown that chronic lymphocytic leukemia CD38+ clones have a survival advantage over CD38- clones. CD38 is frequently overexpressed on multiple myeloma plasma cells that accumulate in the bone marrow and is involved in metabolic reprogramming and cell proliferation by upregulating the PI3K / AKT / mTOR pathway. Summary of the Invention
[0005] In certain aspects, provided herein are the preparation of engineered cells having genetic modifications (e.g., insertions, deletions, substitutions) in the CD38 gene sequence using the CRISPR / Cas system, as well as compositions and methods relating to cells having genetic modifications in the CD38 gene sequence (e.g., modifications that reduce or eliminate CD38 expression by the cells) and their use in a variety of methods, including, but not limited to, adoptive cell transfer therapy for cancer (e.g., CD38-expressing cancers).
[0006] In some embodiments, the engineered cells provided herein are genetically modified T cells or natural killer (NK) cells. In certain embodiments, the engineered cells are cells modified to express a CAR, such as a chimeric antigen receptor (CAR) specific for a CD38 polypeptide (i.e., a full-length CAR protein or a fragment thereof, including, for example, a CD38 peptide that is MHC-presented). In certain embodiments, the engineered cells express a recombinant TCR, such as a recombinant T cell receptor (TCR) specific for a CD38 polypeptide. In some embodiments, the engineered cells may include other genetic modifications in additional genomic sequences, such as at a T cell receptor (TCR) locus, e.g., the TRAC locus or the TRBC locus, to reduce and / or eliminate TCR expression; at a genomic locus, e.g., the B2M locus and the HLA-A locus, to reduce and / or eliminate expression of one or more MHC class I molecules, e.g., the CIITA locus; and / or at one or more checkpoint inhibitor loci, e.g., the CD244 (2B4) locus, the TIM3 locus, the LAG3 locus, and the PD-1 locus. In some embodiments, such cells are used to treat cancer in a subject (e.g., a cancer expressing CD38 in a subject). In some embodiments, such genetically modified cells are used in a combination therapy that also includes administering a CD38-targeted therapeutic agent, e.g., a CD38-specific monoclonal antibody (e.g., daratumumab, isatuximab) to the subject.
[0007] In some embodiments, the present disclosure relates to cell populations comprising cells with genetic modifications of CD38 sequences, and optionally other genomic loci as provided herein. In certain embodiments, such cell populations may be used in adoptive cell (e.g., T cells, NK cells) transfer therapy. In some embodiments, the present disclosure relates to compositions and uses of cells with genetic modifications of CD38 sequences for use in therapy, e.g., cancer therapy and immunotherapy.
[0008] In certain aspects, provided herein are engineered cells comprising a genetic modification in the human CD38 sequence, within the genomic coordinates of chr4:15766497-15871496.
[0009] Also disclosed is the use of the composition and / or formulation described in any of the above embodiments for the preparation of a medicament for treating a subject.The subject may be a human or an animal (e.g., a human or a non-human animal, e.g., a cynomolgus monkey).In certain embodiments, the subject is a human.
[0010] In some aspects, any of the above compositions or formulations are also disclosed for use in effecting genetic modifications (e.g., insertions, substitutions, or deletions) in the CD38 gene sequence, for example, using a CRISPR / Cas system. In some embodiments, gRNA molecules, CRISPR systems, cells, and methods useful for genome editing of cells are provided herein. In certain embodiments, the genetic modification in the CD38 gene sequence results in a change in the nucleic acid sequence that prevents translation of the full-length CD38 protein, for example, by forming a frameshift or nonsense mutation, resulting in premature translation termination. In some embodiments, the genetic modification can include an insertion, substitution, or deletion at a splice site, i.e., a splice acceptor site or a splice donor site, such that aberrant splicing results in a frameshift mutation, a nonsense mutation, or a truncated mRNA, resulting in premature translation termination. In some embodiments, the genetic modification can also disrupt translation or folding of the encoded protein, resulting in premature translation termination. In certain embodiments, the compositions and methods provided herein for use in generating genetic modifications in a CD38 sequence result in a reduction in expression of the CD38 protein (e.g., cell surface expression of the CD38 protein from the CD38 sequence).
[0011] In certain aspects, provided herein are methods of providing immunotherapy to a subject, comprising administering to the subject an effective amount of cells (e.g., genetically modified T cells or NK cells described herein) as described herein. In some embodiments, the immunotherapy is for the treatment of cancer in a subject. In certain embodiments, the cancer is a cancer that expresses CD38. In some embodiments, the therapy also comprises administering to the subject a CD38-targeted therapeutic agent, e.g., a CD38-specific monoclonal antibody (e.g., daratumumab, isatuximab). In certain embodiments, the modification of the CD38 gene sequence in the cell is such that the cell is resistant to targeting by a CD38-targeted therapeutic agent (e.g., another CD38-targeted adoptive transfer cell and / or a CD38-specific therapeutic agent such as an anti-CD38 monoclonal antibody). In certain embodiments, the resistance to targeting is the result of a reduction in the expression of CD38 on the cell. In some embodiments, the resistance to targeting is the result of a modification of the expressed CD38 protein that eliminates the epitope recognized by the CD38-targeted therapeutic agent.
[0012] In embodiments, the immunotherapy method includes lymphodepletion prior to administration of the cells or cell populations described herein. In some embodiments, the method includes administering a lymphodepletion or immunosuppressant prior to administering to the subject an effective amount of the cells described herein, such as any of the aforementioned cell aspects and embodiments. In certain embodiments, the treatment method includes preparing cells (e.g., a population of cells) using the methods provided herein such that the cells have reduced and / or eliminated CD38 expression prior to administration to the subject.
[0013] In another aspect, the present invention provides a method of preparing cells (e.g., a cell population such as T cells or NK cells) for immunotherapy, comprising: (a) modifying the cells by reducing or eliminating expression of CD38 protein and, optionally, one or more or all components of the T cell receptor (TCR), e.g., by introducing into the cells a gRNA molecule (described herein), or two or more gRNA molecules disclosed herein; and (b) expanding the cells. The cells of the present invention are suitable for further engineering, e.g., by introduction of a heterologous sequence or sequences encoding a targeting receptor, e.g., a protein that mediates TCR / CD3 zeta chain signaling. In some embodiments, the protein is a targeting receptor selected from a non-endogenous TCR or CAR sequence (e.g., a sequence encoding a TCR or CAR specific for a CD38 polypeptide). In some embodiments, the protein is a wild-type or variant TCR. The cells provided herein may also be suitable for further engineering by the introduction of heterologous sequences encoding alternative antigen-binding moieties, for example, by the introduction of heterologous sequences encoding alternative (non-endogenous) T cell receptors, such as chimeric antigen receptors (CARs) engineered to target a particular protein (e.g., CD38). CARs are also known as chimeric immune receptors, chimeric T cell receptors, or artificial T cell receptors.
[0014] In another aspect, provided herein is a method of treating a subject comprising administering a cell (e.g., a cell population, such as a T cell population or an NK cell population) prepared by a method described herein (e.g., a method that results in the reduction and / or elimination of CD38 protein expression). In some embodiments, the method further comprises administering an additional therapeutic agent to the subject. The additional therapeutic agent can be a CD38-targeted therapy, such as an anti-CD38 antibody (e.g., daratumumab, isatuximab), a small molecule inhibitor of CD38, an NAD+ analog, a flavonoid, or a cell comprising a chimeric antigen receptor that specifically binds to CD38. In some embodiments, the subject is treated for cancer, an infectious disease, and / or an aging disorder. The cancer can be a solid tumor or a hematological cancer. In some embodiments, the antibody is a cancer that expresses CD38. In some embodiments, the cancer is multiple myeloma, chronic lymphocytic leukemia, lung cancer, prostate cancer, or melanoma.
[0015] Further embodiments are provided and described throughout the claims and drawings. [Brief description of the drawings]
[0016] [Figure 1] Graph showing the percentage of NK cells without CD38 surface expression following treatment with LNPs delivering Cas9 mRNA and gRNA shown in Table 5 that target CD38. [Diagram 2] Graph showing the percentage of NK cells with or without CD38 surface expression and with or without GFP expression. [Diagram 3] Editing frequency of T cells harvested 4 days after LNP treatment with fixed doses of BC22 mRNA and uracil glycosylase inhibitor (UGI) mRNA and decreasing doses of CD38 sgRNA in 100mer or 91mer format is shown. [Figure 4]Shown is the percentage of CD8+ T cells negative for the CD38 surface receptor following treatment with a fixed dose of BC22 mRNA and UGI mRNA and decreasing doses of B2M and CD38 sgRNA in 100mer or 91mer format. [Figure 5A] The mean percentage of CD38 negative NK cells assessed by flow cytometry after editing with various guide concentrations is shown. [Figure 5B] The mean percentage of CD38 negative NK cells assessed by flow cytometry after editing with various mRNA concentrations is shown. [Figure 6] The average percentage of CD38KO as assessed by flow cytometry after gene editing is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0017] Reference will now be made in detail to the specific embodiments disclosed herein. The present teachings also encompass various alternatives, modifications and equivalents, as will be appreciated by those of skill in the art.
[0018] Before describing the teachings of the present invention in detail, it is to be understood that the present disclosure is not limited to specific compositions or process steps, as such may vary. As used herein and in the appended claims, it is noted that the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "a complex" includes a plurality of complexes, a reference to "a cell" includes a plurality of cells (e.g., a population of cells), and the like.
[0019] Numerical ranges include the numbers defining the range. Measurements and measurable values are understood to be approximations taking into account significant digits and errors associated with the measurements. In some embodiments, the cell population is at least 10 3 , 10 4 , 10 5 , or 10 6 cells, preferably 10 7 , 2×107 , 5×10 7 , or 10 8 It refers to a population of individual cells.
[0020] The use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting. It should be understood that the foregoing general description and detailed description are merely exemplary and explanatory and are not intended to limit the present teachings. Unless otherwise stated herein, embodiments described herein as "comprising" various components are also contemplated as "consisting of" or "consisting essentially of" the described components, and embodiments described herein as "consisting of" various components are also contemplated as "comprising" or "consisting essentially of" the described components. Also, embodiments described herein as "consisting essentially of" various components are also contemplated as "consisting of" or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims).
[0021] The term "or" is used herein in its inclusive sense, ie, equivalent to "and / or," unless the context clearly dictates otherwise.
[0022] The term "about" when used before a list modifies each member of the list. The term "about" is understood to encompass variations or errors accepted within the art, such as two standard deviations from the mean, or the sensitivity of the method used to make the measurement. When "about" is present before the first value in a series, it is understood to modify each value in the series.
[0023] Ranges are understood to include the numerical endpoints of the range and all logical values therebetween, for example, 5-10 nucleotides is understood to mean 5, 6, 7, 8, 9, or 10 nucleotides, and 5-10% is understood to include all possible values from 5% to 10%.
[0024] At least 17 nucleotides of a 20 nucleotide sequence is understood to include 17, 18, 19, or 20 nucleotides of the provided sequence, thereby providing an upper limit even if not specifically stated, as is clearly understood. Similarly, up to 3 nucleotides is understood to include 0, 1, 2, or 3 nucleotides, thereby providing a lower limit even if not specifically stated. When "at least," "up to," or other similar language modifies a number, it will be understood to modify each number in the numerical sequence.
[0025] As used herein, "less than" or "less than" is understood to mean the expression and the logical lower zero or adjacent integer value that is logical from the context. For example, a duplex region of "2 nucleotide base pairs or less" has 2, 1, or 0 nucleotide base pairs. When "less than" or "less than" is present before a series of numbers or ranges, it is understood that each of the series of numbers or ranges is modified.
[0026] As used herein, ranges include both upper and lower limits.
[0027] In the event of a conflict between a sequence in the application and a designated accession number or position within an accession number, the sequence in the application will control.
[0028] In the event of a conflict between the chemical name and the structure, the structure takes precedence.
[0029] As used herein, "detecting an analyte" and the like is understood as performing an assay that can detect the analyte, if present, where the analyte is present in an amount above the detection level of the assay.
[0030] As used herein, when a value is expressed as a maximum amount of 100% (e.g., 100% inhibition or 100% encapsulation), it is understood that the value is limited by the detection method.For example, 100% inhibition is understood to be inhibition to a level below the detection level of the assay, and 100% encapsulation is understood to be that the substance intended to be encapsulated cannot be detected outside the vesicle.
[0031] As used herein, "eliminate" is understood to mean reducing levels below the detection threshold of the assay.
[0032] The section headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any manner. In the event that any material incorporated by reference conflicts with any term defined herein or any other express content of this specification, this specification shall control.
[0033] definition Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings:
[0034] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds that contain nucleosides or nucleoside analogs with nitrogen-containing heterocyclic bases or base analogs linked together along the backbone, including polymers that are conventional RNA, DNA, mixed RNA-DNA, and analogs thereof. The nucleic acid "backbone" can be composed of a variety of linkages, including one or more of sugar phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT No. WO95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions (e.g., 2' methoxy or 2' halide substitutions). RNA can contain, for example, one or more deoxyribose nucleotides as a modification, and similarly, DNA can contain one or more ribonucleotides. Nitrogenous bases include the conventional bases (A, G, C, T, U), their analogs (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine), derivatives of inosine, purine, or pyrimidine (e.g., N 4 -methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituents at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with substituents at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 No. 5,378,825 and PCT WO 93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 thed., 1992). Nucleic acids may contain one or more "abasic" residues where the backbone does not contain a nitrogenous base at a position or positions in the polymer (U.S. Pat. No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases and linkages, or may contain both conventional building blocks and substitutions (e.g., conventional nucleosides with 2' methoxy substituents, or polymers containing both conventional nucleosides and one or more nucleoside analogs). Nucleic acids include "locked nucleic acids" (LNAs) and analogs containing one or more LNA nucleotide monomers with bicyclic furanose units locked to an RNA-mimetic sugar structure, enhancing hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA can differ by having different sugar moieties, the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.
[0035] "Guide RNA", "gRNA", and simply "guide" are used interchangeably herein and refer to, for example, either a single guide RNA or a combination of crRNA and trRNA (also known as tracrRNA). The crRNA and trRNA may be associated as a single RNA molecule (as a single guide RNA, sgRNA) or, for example, as two separate RNA strands (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refer to each type. The trRNA may be a naturally occurring sequence or may be a trRNA sequence with modifications or mutations.
[0036] As used herein, a "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to guide the guide RNA to a target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA-binding agent. A "guide sequence" may also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence may be, for example, 20 base pairs in length for Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologues. Shorter or longer sequences, for example 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, may also be used as a guide. For example, in some embodiments, the guide sequence comprises at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-88. In some embodiments, the target sequence is, for example, within a gene or on a chromosome, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence is at least 75%, 80%, 85%, 90%, 95%, or 100%. For example, in some embodiments, the guide sequence comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, or 100% identity to at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1-88. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch, i.e., one nucleotide that is not identical or complementary, depending on the reference sequence. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, and the total length of the target sequence is 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and the target sequence may contain 1 to 4 mismatches, and the guide sequence comprises at least 17, 18, 19, 20, or more nucleotides.In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches when the guide sequence contains 20 nucleotides. That is, the guide sequence and the target region may form a duplex region with 17, 18, 19, 20, or more base pairs. In certain embodiments, the duplex region may contain 1, 2, 3, or 4 mismatches such that the guide strand and the target sequence are not fully complementary. For example, the guide strand and the target sequence may be complementary over a 20 nucleotide region containing 2 mismatches, such that the guide sequence and the target sequence are 90% complementary, providing a duplex region of 18 base pairs out of the 20 base pairs.
[0037] Since the nucleic acid substrate of the RNA-guided DNA binder is a double-stranded nucleic acid, the target sequence of the RNA-guided DNA binder includes both the plus and minus strands of genomic DNA (i.e., the given sequence and the reverse complement of the sequence). Thus, when a guide sequence is said to be "complementary to a target sequence", it should be understood that the guide sequence can direct the guide RNA to bind to the sense or antisense strand (e.g., the reverse complement) of the target sequence. That is, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a particular nucleotide of the target sequence (e.g., the target sequence without PAM) except for the T to U substitution in the guide sequence. Unless otherwise specified, the nucleotides in the guide RNA sequences provided herein that are identified using capital letters are RNA nucleotides with 2'-OH.
[0038] As used herein, "RNA-guided DNA binder" refers to a polypeptide or complex of polypeptides with RNA and DNA binding activity, or a DNA-binding subunit of such a complex, where the DNA binding activity is sequence-specific and dependent on the sequence of the RNA. Exemplary RNA-guided DNA binders include Cas cleavase / Cas nickase and their inactivated forms ("dCas DNA binders"). As used herein, "Cas nuclease" includes Cas cleavase, Cas nickase, and dCas DNA binder. dCas DNA binders can be inactive nucleases that contain a non-functional nuclease domain (RuvC or HNH domain). In some embodiments, Cas cleavase or Cas nickase includes dCas DNA binders that have been modified to enable DNA cleavage, for example, via fusion with a FokI domain. Cas cleavase / Cas nickase and dCas DNA binders include the Csm complex or Cmr complex of type III CRISPR system, their Cas10 subunit, Csm1 subunit or Cmr2 subunit, the Cascade complex of type I CRISPR system, its Cas3 subunit, and class 2 Cas nucleases. As used herein, a "class 2 Cas nuclease" is a single-chain polypeptide with RNA-guided DNA binding activity. Class 2 Cas nucleases include class 2 Cas cleavase / Cas nickase (e.g., H840A variant, D10A variant or N863A variant) that further has RNA-guided DNA cleavase activity or DNA nickase activity, and class 2 dCas DNA binders in which the cleavase activity / nickase activity is inactivated.Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A variant, R661A variant, Q695A variant, Q926A variant), HypaCas9 (e.g., N692A variant, M694A variant, Q695A variant, H698A variant), eSPCas9(1.0) (e.g., K810A variant, K1003A variant, R1060A variant), and eSPCas9(1.1) (e.g., K848A variant, K1003A variant, R1060A variant) proteins, and modifications thereof. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain. The Zetsche Cpf1 sequence is incorporated by reference in its entirety. See, e.g., Tables S1 and S3 of the Zetsche reference. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).
[0039] As used herein, the term "editor" refers to an agent that comprises a polypeptide that can make modifications in a DNA sequence. In some embodiments, the editor is a cleavase, such as Cas9 cleavase. In some embodiments, the editor can deaminate bases in a DNA molecule. In some embodiments, the editor can deaminate cytosines (C) in DNA. In some embodiments, the editor is a fusion protein that comprises an RNA-guided nickase fused to a cytidine deaminase. In some embodiments, the editor is a fusion protein that comprises an RNA-guided nickase fused to a deaminase APOBEC3A (A3A). In some embodiments, the editor comprises a Cas9 nickase fused to a deaminase APOBEC3A (A3A). In some embodiments, the editor is a fusion protein that comprises a cytidine deaminase and an RNA-guided nickase fused to a uracil glycosylase inhibitor (UGI). In some embodiments, the editor is UGI-deficient.
[0040] As used herein, "cytidine deaminase" means a polypeptide or complex of polypeptides capable of cytidine deaminase activity, which catalyzes the hydrolytic deamination of cytidine or deoxycytidine, typically resulting in uridine or deoxyuridine. Cytidine deaminases include enzymes of the cytidine deaminase superfamily, in particular the APOBEC family of enzymes (APOBEC1, APOBEC2, APOBEC4 and APOBEC3 subgroups of enzymes), activation-induced cytidine deaminases (AID or AICDA), and CMP deaminases (see, e.g., Conticello et al., Mol. Biol. Evol. 22:367-77, 2005; Conticello, Genome Biol. 9:229, 2008; Muramatsu et al., J. Biol. Chem. 274:18470-6, 1999; Carrington et al., Cells 9:1690 (2020)).
[0041] As used herein, the term "APOBEC3" refers to an APOBEC3 protein, such as the APOBEC3 protein expressed by any of the seven genes (A3A-A3H) of the human APOBEC3 locus. APOBEC3 may have DNA or RNA editing catalytic activity. The amino acid sequence of APOBEC3A has been described (UniPROT Accession ID: p31941). In some embodiments, the APOBEC3 protein is a mammalian, e.g., human, wild-type APOBEC3 protein or a variant protein. Variants include proteins with sequences that differ from the wild-type APOBEC3 protein by one or more mutations (i.e., substitutions, deletions, insertions), e.g., one or more single-point substitutions. For example, a truncated APOBEC3 sequence can be used, e.g., by deleting several N- or C-terminal amino acids, preferably 1-4 amino acids at the C-terminus of the sequence. As used herein, the term "variant" refers to allelic variants, splicing variants, and natural or artificial variants, which are homologous to the APOBEC3 reference sequence. The variants are "functional" in that they exhibit catalytic activity for DNA editing or RNA editing. In some embodiments, the APOBEC3 (such as human APOBEC3A) has a wild-type amino acid at position 57 (as numbered in the wild-type sequence). In some embodiments, the APOBEC3 (such as human APOBEC3A) has an asparagine at amino acid position 57 (as numbered in the wild-type sequence).
[0042] As used herein, a "nickase" is an enzyme that creates a single-strand break (also known as a "nick") in double-stranded DNA, i.e., it cuts one strand of the DNA double helix but not the other. As used herein, an "RNA-guided DNA nickase" refers to a polypeptide or polypeptide complex having DNA nickase activity, the DNA nickase activity of which is sequence-specific and dependent on the sequence of its RNA. Exemplary RNA-guided DNA nickases include Cas nickases. Cas nickases include the Csm or Cmr complexes of type III CRISPR systems, their Cas10 subunits, Csm1 subunits or Cmr2 subunits, the Cascade complexes of type I CRISPR systems, their Cas3 subunits, and the nickase forms of class 2 Cas nucleases. Class 2 Cas nickases include variants in which only one of the two catalytic domains is inactivated, and the variants have RNA-guided DNA nickase activity. Class 2 Cas nickases include, for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and modifications thereof. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like protein domain. The Zetsche Cpf1 sequence is incorporated by reference in its entirety. See, e.g., Tables S1 and S3 of Zetsche. "Cas9" includes S. pyogenes (Spy) Cas9, Cas9 variants listed herein, and equivalents thereof.See, e.g., Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).
[0043] As used herein, the term "fusion protein" refers to a hybrid polypeptide that contains protein domains from at least two different proteins. One protein may be located at the amino-terminal (N-terminal) portion or the carboxy-terminal (C-terminal) portion of the fusion protein, thus forming an "amino-terminal fusion protein" or a "carboxy-terminal fusion protein", respectively. Any of the proteins provided herein may be produced by any method known in the art. For example, the proteins provided herein may be produced via recombinant protein expression and purification, which is particularly suitable for fusion proteins that contain peptide linkers. Methods of recombinant protein expression and purification are well known and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012)), the entire contents of which are incorporated herein by reference.
[0044] The term "linker" as used herein refers to a chemical group or molecule that connects two adjacent molecules or moieties. Typically, a linker is located or sandwiched between two groups, molecules or other moieties and is covalently linked to each other. In some embodiments, the linker is an amino acid or multiple amino acids (e.g., a peptide or protein), such as the 16 amino acid residue "XTEN" linker, or variants thereof (see, e.g., the Examples, and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 900), SGSETPGTSESA (SEQ ID NO: 901), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 902).
[0045] As used herein, the term "uracil glycosylase inhibitor" or "UGI" refers to a protein that can inhibit the base excision repair enzyme uracil DNA glycosylase (UDG).
[0046] Exemplary nucleotide and polypeptide sequences of Cas9 molecules are provided below. Methods for identifying alternative nucleotide sequences encoding Cas9 polypeptide sequences, including alternative naturally occurring variants, are known in the art. Sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to any of the Cas9 nucleic acid sequences, amino acid sequences, or nucleic acid sequences encoding the amino acid sequences provided herein are also contemplated.
[0047] Exemplary open reading frames of Cas9
[0048] Exemplary amino acid sequences of Cas9
[0049] Exemplary open reading frames of Cas9
[0050] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA together with an RNA-guided DNA binding agent, such as a Cas nuclease, e.g., a Cas cleavase, a Cas nickase, or a dCas DNA binding agent (e.g., Cas9). In some embodiments, the guide RNA guides an RNA-guided DNA binding agent, such as Cas9, to a target sequence, where the guide RNA hybridizes to the target sequence, where the binding agent binds to the target sequence, and where the binding agent is a cleavase or nickase, can cleave or nick after binding.
[0051] As used herein, "target sequence" refers to a nucleic acid sequence in a target gene that has complementarity to the guide sequence of a gRNA, i.e., is sufficiently complementary to the guide sequence to allow specific binding of the guide sequence. The interaction of the target sequence with the guide sequence induces an RNA-guided DNA binding agent to bind to the target sequence and potentially nick or cleave (depending on the activity of the binding agent) in the target sequence.
[0052] As used herein, a first sequence is considered to be "identical" or "100% identical" to a second sequence when the alignment of the first and second sequences shows that all positions of the second sequence are generally identical to the first sequence. For example, the sequence AAG has 100% identity to the sequence AAGA, because the alignment results in 100% identity in that all three positions of the first sequence match without gaps. Identities less than 100% can be calculated using routine methods. For example, ACG has 67% identity with AAGA (2 / 3=67%), because two of the three positions of the first sequence match the second sequence. Differences between RNA and DNA (generally uridine to thymidine exchange or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to identity or complementarity between polynucleotides, as long as the relevant nucleotides (e.g., thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine, another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as complements). Thus, for example, in the sequence 5'-AXG, if X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine, it is considered to be 100% identical to AUG, since they are all perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand what algorithm and parameter setting is appropriate for a given pair of sequences to be aligned. Generally, for sequences of similar length and predicted identity of more than 50% for amino acids or more than 75% for nucleotides, the Needleman-Wunsch algorithm, using default settings in the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server, is generally appropriate.
[0053] Similarly, as used herein, a first sequence is considered to be "fully complementary" or 100% complementary" to a second sequence when all of the nucleotides of the first sequence are complementary to the second sequence without gaps. For example, the sequence UCU is considered to be fully complementary to the sequence AAGA, since each of the nucleobases from the first sequence is base-paired with the nucleotides of the second sequence, without gaps. The sequence UGU is considered to be 67% complementary to the sequence AAGA, since two of the three nucleobases of the first sequence are base-paired with the nucleobases of the second sequence. Those skilled in the art will understand that algorithms are available with various parameter settings to determine the percent complementarity for any pair of sequences, for example, using the NCBI BLAST interface (blast.ncbi.nlm.nih.gov / Blast.cgi) or the Needleman-Wunsch algorithm.
[0054] "mRNA" is used herein to refer to a polynucleotide that contains an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by ribosomes and aminoacylated tRNAs). An mRNA can contain a phosphate-sugar backbone that includes ribose residues or analogs thereof, such as 2'-methoxyribose residues. In some embodiments, the sugars of the mRNA phosphate-sugar backbone consist essentially of ribose residues, 2'-methoxyribose residues, or a combination thereof.
[0055] Exemplary guide sequences useful in the guide RNA compositions and methods described herein are provided in Table 1 and throughout the application. For example, Table 1 provides guide sequences that can be used in guide RNA to direct an RNA-guided DNA binding agent, e.g., a nuclease, such as a Cas nuclease, such as Cas9, to a target sequence. The target sequences are provided in Table 1 as genomic coordinates and include both the plus and minus strands of genomic DNA (i.e., the sequence given and the reverse complement of that sequence). In some embodiments, when a guide sequence binds to the reverse complement of a target sequence, the guide sequence is identical to a particular nucleotide of the target sequence (e.g., the target sequence without the PAM), except for the T to U substitution in the guide sequence.
[0056] As used herein, "indel" refers to an insertion / deletion mutation consisting of a number of nucleotides inserted or deleted at the site of a double-stranded break (DSB) in a target nucleic acid.
[0057] As used herein, "inhibit expression" and the like refers to a decrease in the expression of a particular gene product (e.g., protein, mRNA, or both). Expression of a protein (i.e., gene product) can be measured by detecting the total cellular amount of the protein from a tissue or cell population of interest, by detecting the expression of the protein in individual members of a cell population, e.g., by detecting the percentage of cells expressing the protein by cell sorting, or by detecting the expression of the protein in aggregated cells, e.g., by ELISA or Western blotting. Inhibition of expression can result from genetic modification of a gene sequence, e.g., a genomic sequence, such that the full-length gene product or any gene product is no longer expressed, e.g., knockdown of a gene. Certain genetic modifications can introduce frameshift or nonsense mutations that prevent translation of the full-length gene product. Genetic modifications at a splice site, e.g., close enough to a splice acceptor site or splice donor site to disrupt splicing, can prevent translation of the full-length protein. Inhibition of expression can occur by genetic modification in regulatory sequences in genomic sequences required for expression of the gene product, such as promoter sequences, 3'UTR sequences (e.g., cap sequences), 5'UTR sequences (e.g., polyA sequences). Inhibition of expression can also occur by disruption of expression or activity of regulatory factors required for translation of the gene product, such as inhibiting production of the gene product. For example, genetic modification of a transcription factor sequence that inhibits expression of a full-length transcription factor can have downstream effects and inhibit expression of one or more gene products controlled by the transcription factor. Inhibition of expression can therefore be predicted by changes in the genome or mRNA sequence. Mutations expected to result in inhibition of expression can therefore be detected by known methods, including sequencing of mRNA isolated from a tissue or cell population of interest. Inhibition of expression can be determined as a reduction in the percentage of cells in a population that have a given expression level of a protein, i.e., the percentage or number of cells in a population that express a protein of interest at least at a particular level.Inhibition of expression can also be assessed, for example, by measuring a reduction in overall protein levels in a cell or tissue sample, such as a biopsy sample. In certain embodiments, inhibition of expression of a secreted protein can be assessed in a liquid sample, such as cell culture medium or a bodily fluid. Proteins may be present in bodily fluids, such as blood or urine, to allow for analysis of protein levels. In certain embodiments, protein levels can be determined by protein activity or metabolite levels, such as urine or blood. In some embodiments, "inhibition of expression" can refer to some loss of expression of a particular gene product, such as a reduction in the amount of mRNA transcribed or a reduction in the amount of protein expressed by a cell population. In some embodiments, "inhibition" can refer to some degree of loss of expression of a particular gene product, such as the CD38 gene product at the cell surface. It is understood that the level of knockdown is relative to the starting level of a sample of the same type of subject. For example, routine monitoring of protein levels is easier to perform in a bodily fluid sample, such as blood or urine, from a subject than in a tissue sample, such as a biopsy sample. It is understood that the level of knockdown is relative to the sample being assayed. Similarly, in animal studies where serial tissue samples, such as liver tissue, are obtained, the knockdown target may be expressed in other tissues, and therefore the level of knockdown is not necessarily the level of systemic knockdown, but rather the level of knockdown in the tissue, cell type, or body fluid sampled.
[0058] As used herein, a "genetic modification" is a change at the DNA level, for example, induced by the CRISPR / Cas9 gRNA and Cas9 system. A genetic modification can typically include an insertion, deletion, or substitution (i.e., base sequence substitution, i.e., mutation) within a defined sequence or genomic locus. A genetic modification changes the nucleic acid sequence of DNA. A genetic modification may be made at a single nucleotide position. A genetic modification may be multiple nucleotides, e.g., 2, 3, 4, 5 or more nucleotides, typically close to each other, e.g., contiguous nucleotides. A genetic modification may be within a coding sequence, e.g., an exon sequence. A genetic modification may be made at a splice site, i.e., close enough to a splice acceptor site or splice donor site to disrupt splicing. A genetic modification may include the insertion of a nucleotide sequence that is not endogenous to the genomic locus, for example, the insertion of a heterologous open reading frame or coding sequence of a gene. As used herein, preferably, genetic modification prevents the translation of a full-length protein having the amino acid sequence of the full-length protein prior to genetic modification of the genomic locus.Prevention of translation of a full-length protein or gene product includes prevention of translation of any length of protein or gene product.The translation of a full-length protein can be prevented, for example, by a frameshift mutation that results in the generation of a premature stop codon or by the generation of a nonsense mutation.The translation of a full-length protein can be prevented by disruption of splicing.
[0059] As used herein, a "heterologous coding sequence" refers to a coding sequence that has been introduced into a cell as an exogenous source (e.g., inserted into a genomic locus, such as a safe harbor locus, including a TCR locus). That is, the introduced coding sequence is heterologous at least with respect to its insertion site. A polypeptide expressed from such a heterologous coding sequence gene is referred to as a "heterologous polypeptide." A heterologous coding sequence may be naturally occurring or engineered, and may be wild-type or variant. A heterologous coding sequence may include nucleotide sequences other than the sequence encoding the heterologous polypeptide (e.g., an internal ribosome entry site). A heterologous coding sequence may be a coding sequence that is naturally occurring in a genome as a wild-type or variant (e.g., mutant). For example, a cell contains a coding sequence of interest (as a wild-type or variant), but the same coding sequence or a variant thereof may be introduced as an exogenous source for expression, for example, at a locus of high expression. A heterologous coding sequence may also be a coding sequence that is not naturally occurring in a genome, or a coding sequence that expresses a heterologous polypeptide that is not naturally occurring in a genome. "Heterologous coding sequence," "exogenous coding sequence," and "transgene" are used interchangeably. In some embodiments, a heterologous coding sequence or transgene comprises an exogenous nucleic acid sequence, e.g., a nucleic acid sequence that is not endogenous to a recipient cell. In some embodiments, a heterologous coding sequence or transgene comprises an exogenous nucleic acid sequence, e.g., a nucleic acid sequence that does not naturally occur in a recipient cell. For example, a heterologous coding sequence can be heterologous with respect to its insertion site and with respect to its recipient cell.
[0060] A "safe harbor" locus is a locus in a genome that can insert a gene without causing significant adverse effects to cells.Non-limiting examples of safe harbor loci targeted by nuclease(s) for use herein include AAVS1 (PPP1 R12C), TCR, B2M, or albumin.In some embodiments, insertion into a locus targeted for knockdown, such as a TRC gene, for example, a TRAC gene, is advantageous to the cell.Other suitable safe harbor loci are known in the art.
[0061] As used herein, a "targeting receptor" refers to a receptor present on the surface of a cell (e.g., a T cell) that allows the cell to bind to a target site (e.g., a specific cell or tissue within an organism). Targeting receptors include, but are not limited to, chimeric antigen receptors (CARs), T cell receptors (TCRs), and receptors that contain a binding agent for a target (e.g., a cell surface molecule or ligand) operably linked through at least a transmembrane domain within an internal signaling domain that can activate a T cell upon binding of the extracellular receptor portion of the protein. As used herein, a "receptor" and "ligand" pair includes any binding pair that includes an antigen and an antibody that specifically binds to the antigen.
[0062] As used herein, "chimeric antigen receptor" refers to an extracellular antigen recognition domain, e.g., scFv, VHH, nanobody, operably linked to an intracellular signaling domain that activates T cells when the target is bound. CARs are composed of four regions: a target recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T cell signaling domain. Such receptors are well known in the art (see, e.g., WO2020092057, WO2019191114, WO2019147805, WO2018208837, the contents of each of which are incorporated herein by reference in their entirety). Also contemplated are reverse universal CARs that facilitate the binding of immune cells to target cells via adaptor molecules (see, e.g., WO2019238722, the contents of which are incorporated herein in their entirety). CARs can be targeted to any target (e.g., antigen) for which a binding agent (e.g., antibody) can be developed, and are typically directed to a molecule displayed on the surface of the targeted cell or tissue.
[0063] As used herein, "treatment" refers to any administration or application of a therapeutic agent to a disease or disorder in a subject, including inhibiting the disease, arresting its occurrence, alleviating one or more symptoms of the disease, curing the disease, preventing one or more symptoms of the disease, or preventing the recurrence of one or more symptoms of the disease. Treating an autoimmune or inflammatory response or disorder may include alleviating inflammation associated with a particular disorder, thereby alleviating symptoms specific to the disease. Treatment with the engineered T cells described herein may be used before, after, or in combination with additional therapeutic agents, such as standard treatment for the indication being treated.
[0064] The human wild-type CD38 sequence is available at NCBI Gene ID: 952 (www.ncbi.nlm.nih.gov / gene / 952, version available on the filing date of this application); Ensembl: ENSG00000004468, chr4: 15,778,275-15,853,232. Cluster of differentiation 38 (CD38) protein is a type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose. The CD38 gene contains eight exons. ADP-ribosyl cyclase / cyclic ADP-ribose hydrolase and ecto-nicotinamide adenine dinucleotide glycohydrolase are gene synonyms of CD38. CD38 increases airway contractile hyperresponsiveness and is increased in the lungs of asthmatic patients, thereby amplifying the inflammatory response of their airway smooth muscle.
[0065] As used herein, "T cell receptor" or "TCR" refers to a receptor in a T cell. In general, a TCR is a heterodimeric receptor molecule that includes two TCR polypeptide chains, an α chain and a β chain. After antigen binding, the α chain and the β chain TCR polypeptide can complex with various CD3 molecules and induce immune response(s), including inflammation and autoimmunity. As used herein, knockdown of a TCR refers to partial or total knockdown of any TCR gene (e.g., deletion of a portion of the TRBC1 gene, alone or in combination with partial or total knockdown of other TCR gene(s)).
[0066] "TRAC" is used to refer to the T cell receptor alpha chain. Human wild type TRAC sequence is available at NCBI Gene ID: 28755, Ensembl: ENSG00000277734. T cell receptor alpha constant, TCRA, IMD7, TRCA, and TRA are gene synonyms of TRAC.
[0067] "TRBC" refers to the T cell receptor β chain (e.g., TRBC1 and TRBC2). "TRBC1" and "TRBC2" refer to two homologous genes that encode the T cell receptor β chain, which is the gene product of the TRBC1 or TRBC2 gene.
[0068] The human wild type TRBC1 sequence is available at NCBI Gene ID: 28639, Ensembl: ENSG00000211751. T cell receptor beta constant, V_segment translation product, BV05S1J2.2, TCRBC1, and TCRB are gene synonyms of TRBC1.
[0069] The human wild type TRBC2 sequence is available at NCBI Gene ID: 28638, Ensembl: ENSG00000211772. T cell receptor beta constant, V_segment translation product, and TCRBC2 are gene synonyms of TRBC2.
[0070] "T cells" play a central role in immune responses following exposure to an antigen. T cells can be naturally occurring or non-naturally occurring, e.g., where T cells are generated by engineering (e.g., from stem cells) or by transdifferentiation (e.g., reprogramming of somatic cells). T cells can be distinguished from other lymphocytes by the presence of T cell receptors on the cell surface. Included in this definition are conventional and adaptive T cells (including helper CD4+ T cells, cytotoxic CD8+ T cells, memory T cells, and regulatory CD4+ T cells), as well as innate-like T cells (including natural killer T cells, mucosal-associated invariant T cells, and gamma delta T cells). In some embodiments, the T cells are CD4+. In some embodiments, the T cells are CD3+ / CD4+.
[0071] As used herein, "MHC" or "MHC protein" refers to a major histocompatibility complex molecule(s), including, for example, MHC class I molecules (e.g., HLA-A, HLA-B, and HLA-C in humans) and MHC class II molecules (e.g., HLA-DP, HLA-DQ, and HLA-DR in humans).
[0072] "CIITA", "CIITA", or "C2TA" as used herein refers to the nucleic acid or protein sequence of the "class II major histocompatibility complex transactivator". The human CIITA gene has the accession number NC_000016.10 (range 10866208..10941562), reference GRCh38.p13. The CIITA protein in the nucleus functions as a positive regulator of the transcription of MHC class II genes and is required for the expression of MHC class II proteins.
[0073] "β2M" or "B2M" as used herein refers to the nucleic acid or protein sequence of "β-2 microglobulin". The human B2M gene has the accession number NC_000015 (range 44711492..44718877), reference GRCh38.p13. The B2M protein associates as a heterodimer with MHC class I molecules on the surface of nucleated cells and is required for the expression of MHC class I proteins.
[0074] The term "HLA-A" as used herein in the context of HLA-A protein refers to an MHC class I protein molecule that is a heterodimer consisting of a heavy chain (encoded by the HLA-A gene) and a light chain (i.e., beta-2 microglobulin). The term "HLA-A" or "HLA-A gene" as used herein in the context of a nucleic acid refers to a gene that encodes the heavy chain of the HLA-A protein molecule. The HLA-A gene is also referred to as "HLA class I histocompatibility, A alpha chain" and the human HLA-A gene has the accession number NC_000006.12 (29942532..29945870). The HLA-A gene is known to come in thousands of different forms (also referred to as "alleles") across the population (an individual can receive two different alleles of the HLA-A gene). A public database of HLA-A alleles containing sequence information can be accessed at IPD-IMGT / HLA: www.ebi.ac.uk / ipd / imgt / hla / . All alleles of HLA-A are encompassed by the terms "HLA-A" and "HLA-A gene."
[0075] As used herein, the term "within genomic coordinates" includes the boundaries of the given genomic coordinate range. For example, given chr6:29942854-chr6:29942913, the coordinates chr6:29942854-chr6:29942913 are encompassed. Throughout this application, the genomic coordinates referenced are based on the genome annotations in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium, available at www.ncbi.nlm.nih.gov (National Center for Biotechnology Information website). Tools and methods for converting genomic coordinates between one assembly and another are known in the art and can be used to convert the genomic coordinates shown herein to corresponding coordinates in another assembly of the human genome, including conversion to a previous assembly made by the same institution or using the same algorithm (e.g., GRCh38 to GRCh37), and conversion of an assembly made by a different institution or algorithm (e.g., GRCh38 to NCBI33 made by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, NCBI Genome Remapping Service (available at the National Center for Biotechnology Information website), UCSC LiftOver (available at the UCSC Genome Brower website), and Assembly Converter (available at the Ensembl.org website).
[0076] As used herein, "splice site" refers to the three nucleotides that make up an acceptor splice site or donor splice site (defined below), or any other nucleotides known in the art that are part of a splice site. See, e.g., Burset et al., Nucleic Acids Research 28(21):4364-4375(2000) (describing canonical and non-canonical splice sites in the mammalian genome). The three nucleotides that make up the "acceptor splice site" are the two conserved residues 3' of the intron (e.g., AG in humans) and the boundary nucleotide (i.e., the first nucleotide of the exon 3' of AG). The "splice site boundary nucleotide" of the acceptor splice site is represented as "Y" in the diagram below, and is sometimes referred to herein as the "acceptor splice site boundary nucleotide" or the "splice acceptor site boundary nucleotide." The terms "acceptor splice site," "splice acceptor site," "acceptor splice sequence," or "splice acceptor sequence" may be used interchangeably herein.
[0077] The three nucleotides that make up the "donor splice site" are two conserved residues at the 5' end of the intron and the boundary nucleotide (i.e., the first nucleotide of the exon 5' to GT) (e.g., GT (gene) in humans or GU (in RNA such as pre-mRNA). The "splice site boundary nucleotide" of the donor splice site is represented as "X" in the diagram below and is sometimes referred to herein as the "donor splice site boundary nucleotide" or "splice donor site boundary nucleotide." The terms "donor splice site," "splice donor site," "donor splice sequence," or "splice donor sequence" may be used interchangeably herein. [ka]
[0078] Compositions containing guide RNA (gRNA) Provided herein are compositions useful for modifying DNA sequences, e.g., using guide RNAs in conjunction with RNA-guided DNA binding agents (e.g., CRISPR / Cas systems) to induce single-stranded breaks (SSBs) or double-stranded breaks (DSBs) in the CD38 gene. Guide sequences targeting the CD38 gene are shown in Table 1 as SEQ ID NOs: 1-88, as are the genomic coordinates targeted by such guide RNAs.
[0079] Each guide sequence set forth in SEQ ID NOs: 1-88 in Table 1 may further comprise additional nucleotides to form a crRNA, for example, having at its 3' end the following exemplary nucleotide sequence following the guide sequence: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 200), in the 5' to 3' orientation.
[0080] In the case of sgRNA, the guide sequence described above may further include additional nucleotides to form the sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 201) in the 5' to 3' orientation.
[0081] In the case of sgRNAs, the guide sequences described above may further include additional nucleotides to form the sgRNA, such as the following exemplary nucleotide sequence following the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 202) in the 5' to 3' orientation.
[0082] In the case of sgRNAs, the guide sequence may incorporate the following modified motif mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 300), where "N" can be any natural or non-natural nucleotide, preferably an RNA nucleotide, the sugar portion of the nucleotide can be ribose, deoxyribose, or similar compounds having substitutions, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage between the nucleotide residues, and N is collectively the nucleotide sequence of the guide sequence.
[0083] In some embodiments, the guide sequence can include any one of SEQ ID NOs: 1220-1225 (Table 12), where "N" can be any natural or non-natural nucleotide, preferably an RNA nucleotide, the sugar portion of the nucleotide can be ribose, deoxyribose, or similar compounds having substitutions, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage between the nucleotide residues, and N is collectively the nucleotide sequence of the guide sequence.
[0084] In the case of sgRNA, the guide sequence may further comprise a SpyCas9 sgRNA sequence. An example of a SpyCas9 sgRNA sequence is shown in the table below (SEQ ID NO: 201 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC-"Exemplary SpyCas9 sgRNA-1"), which is included at the 3' end of the guide sequence and has domains as shown in the table below. LS is the lower stem. B is the bulge. US is the upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. H1 and H2 together are referred to as the hairpin region. A model of the structure is provided in Figure 10A of WO2019237069, which is incorporated herein by reference.
[0085] The nucleotide sequence of the exemplary SpyCas9 sgRNA-1 can serve as a template sequence for specific chemical modifications, sequence replacements, and cleavage.
[0086] In certain embodiments, the gRNA is, for example, an sgRNA or a dgRNA, and optionally includes chemical modifications. In some embodiments, the modified sgRNA includes a guide sequence and a SpyCas9 sgRNA sequence, for example, the exemplary SpyCas9 sgRNA-1. The gRNA, such as the sgRNA, may include modifications at the 5' end of the guide sequence and / or the 3' end of the SpyCas9 sgRNA sequence, for example, at one or more terminal nucleotides, for example, at 1, 2, 3, or 4 of the 3' or 5' terminal nucleotides, as in the exemplary SpyCas9 sgRNA-1. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphorothioate (PS) internucleotide linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides include 2'-OMe modified nucleotides. In certain embodiments, the modified nucleotide comprises a PS linkage.In certain embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide and a PS linkage.
[0087] In certain embodiments, using SEQ ID NO:201 ("exemplary SpyCas9 sgRNA-1") as an example (see WO2019237069, the contents of which are incorporated herein by reference), an exemplary SpyCas9 sgRNA-1 further comprises one or more of the following: A. A shortened or substituted and optionally shortened hairpin 1 region, 1. At least one of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, is replaced with a Watson-Crick paired nucleotide in said substituted and optionally shortened Hairpin 1, said Hairpin 1 region optionally comprising: a.One or two of H1-5 to H1-8, b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or C. lacking 1 to 8 nucleotides of the hairpin 1 region, or 2. The shortened hairpin 1 region lacks 4 to 8 nucleotides, preferably 4 to 6 nucleotides; a. one or more of positions H1-1, H1-2, or H1-3 are deleted or substituted compared to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 201); or b. one or more of positions H1-6 through H1-10 are substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 201); or 3. A shortened hairpin 1 region, wherein the shortened hairpin 1 region is missing 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted compared to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 201); or B. A shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides, and wherein 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region contain no more than 4 substitutions compared to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 201); or C. A substitution compared to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 201) in any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substitutent nucleotide is not a pyrimidine followed by an adenine or an adenine preceded by a pyrimidine; or D. An exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 201) having an upper stem region, wherein the upper stem modification comprises any one or more modifications of US1-US12 in the upper stem region; 1. The modified nucleotides are optionally selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof; or 2. An exemplary SpyCas9 sgRNA-1, wherein the modified nucleotides optionally include 2'-OMe modified nucleotides.
[0088] In certain embodiments, the sgRNA, such as the exemplary SpyCas9 sgRNA-1, or an sgRNA comprising the exemplary SpyCas9 sgRNA-1, further comprises a 3' tail, e.g., a 3' tail consisting of one, two, three or more nucleotides. In certain embodiments, the tail comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphorothioate (PS) internucleotide linkages, and inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides. In certain embodiments, the modified nucleotides comprise PS internucleotide linkages. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides and PS internucleotide linkages.
[0089] In certain embodiments, the hairpin region comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides.
[0090] In certain embodiments, the upper stem region comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides.
[0091] In certain embodiments, an exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is a pyrimidine, and the YA dinucleotide comprises a modified nucleotide. In certain embodiments, the modified nucleotide is selected from a 2'-O-methyl (2'-OMe) modified nucleotide, a 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotide, a 2'-fluoro (2'-F) modified nucleotide, an internucleotide phosphorothioate (PS) linkage, an inverted abasic modified nucleotide, or a combination thereof. In certain embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide.
[0092] In certain embodiments, an exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is a pyrimidine, and the YA dinucleotide comprises a replacement nucleotide, i.e., a sequence replacement nucleotide, where the pyrimidine is replaced with a purine. In certain embodiments, if the pyrimidine forms a Watson-Crick base pair within a single guide, the Watson-Crick based nucleotide of the replacement pyrimidine nucleotide is replaced to maintain the Watson-Crick base pair. [Table 1] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10]
[0093] In some embodiments, provided herein are compositions comprising one or more guide RNAs (gRNAs) comprising guide sequences that direct an RNA-guided DNA binding agent, which may be a nuclease (e.g., a Cas nuclease such as Cas9), to a target DNA sequence in CD38. The gRNA may be a guide sequence as shown in Table 1, optionally SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, 9, 10, 11, 16, 25, 28, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 31, 35, 38, 48, 53, 58, 71, 79, and 81; or SEQ ID NOs: 3, 8, 11, 28, 35, and SEQ ID NO: 37; or SEQ ID NOs: 9, 10, 11, 27, and 35; or SEQ ID NOs: 10, 11, and 35; or SEQ ID NO: 8 and SEQ ID NO: 35. The gRNA may comprise a crRNA comprising 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Table 1. In some embodiments, the gRNA comprises a guide sequence as set forth in Table 1, optionally SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, 9, 10, 11, 16, 25, 27, 28, 31, 34, 35, and 36; or SEQ ID NOs: 8, 9, 10, , 11, 16, 23, 25, 27, 31, 35, 38, 48, 53, 58, 71, 79, and 81; or SEQ ID NO:3, 8, 11, 28, 35, and SEQ ID NO:37; or SEQ ID NO:9, 10, 11, 27, and 35; or SEQ ID NO:10, 11, and 35; or SEQ ID NO:8 and SEQ ID NO:35.In some embodiments, the gRNA is a guide sequence as set forth in Table 1, optionally comprising SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, 9, 10, 11, 16, 25, 27, 28, 31, 34, 35, and 3 or SEQ ID NO: 3, 8, 11, 28, 35, and SEQ ID NO: 37; or SEQ ID NO: 9, 10, 11, 27, and 35; or SEQ ID NO: 10, 11, and 35; or SEQ ID NO: 8 and SEQ ID NO: 35. The gRNA may further comprise a trRNA. In each of the embodiments described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or may be on separate RNAs (dgRNA). In the context of the sgRNA, the crRNA and trRNA components may be covalently linked, for example, via a phosphodiester bond or other covalent bond.
[0094] In certain embodiments described herein, the guide RNA may comprise two RNA molecules as a "dual guide RNA" or "dgRNA." The dgRNA comprises a first RNA molecule comprising a crRNA, e.g., comprising a guide sequence as shown in Table 1, and a second RNA molecule comprising a trRNA. The first and second RNA molecules may not be covalently linked, but can form an RNA duplex via base pairing between a portion of the crRNA and a portion of the trRNA.
[0095] In some embodiments, the guide RNA may comprise a single RNA molecule as a "single guide RNA" or "sgRNA." The sgRNA may comprise a guide sequence as shown in Table 1, optionally covalently linked to a trRNA, such as SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, 9, 10, 11, 16, 25, 36, and 37; , 27, 28, 31, 34, 35, and 36; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 31, 35, 38, 48, 53, 58, 71, 79, and 81; or SEQ ID NOs: 3, 8, 11, 28, 35, and SEQ ID NO: 37; or SEQ ID NOs: 9, 10, 11, 27, and 35; or SEQ ID NOs: 10, 11, and 35; or SEQ ID NO: 8 and SEQ ID NO: 35 (or a portion thereof). The sgRNA may be selected from the guide sequences shown in Table 1, optionally SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, 9, 10, 11, 16, 25, 27, 28, 31, or SEQ ID NO:3, 8, 11, 28, 35, and SEQ ID NO:37; or SEQ ID NO:9, 10, 11, 27, and 35; or SEQ ID NO:10, 11, and 35; or SEQ ID NO:8 and SEQ ID NO:35. In some embodiments, the crRNA and the trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure via base pairing between portions of the crRNA and the trRNA. In some embodiments, the crRNA and the trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.
[0096] In some embodiments, the trRNA may comprise all or part of the trRNA sequence from a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 nucleotides, or more than 100 nucleotides. In some embodiments, the trRNA may comprise a certain secondary structure, such as one or more hairpin or stem-loop structures, or one or more bulge structures.
[0097] In some embodiments, SEQ ID NOs: 1-88, preferably SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, 9, 10, 11, 16, 25, 27, 28, 31, 34, 35, and 3 or SEQ ID NO:3, 8, 11, 28, 35, and SEQ ID NO:37; or SEQ ID NO:9, 10, 11, 27, and 35; or SEQ ID NO:10, 11, and 35; or SEQ ID NO:8 and SEQ ID NO:35.
[0098] In some embodiments, SEQ ID NOs: 125, 122, 124, 114, 123, 115, 119, 113, 116, 126, 104, 97, 98, 96, 91, 99, 111, 136, 141, 146, 147, 159, 162, 167, and 169; or 96, 97, 98, 99, 104, 111, 113, 115, 116, 119, 122, 123, 124, and 125; or 96, 97, 98, Provided herein are compositions comprising one or more sgRNAs comprising any one of: 99, 104, 113, 115, 116, 119, 122, 123, and 124; or 96, 97, 98, 99, 104, 111, 113, 115, 119, 123, 126, 136, 141, 146, 159, 167, and 169; or 91, 96, 99, 116, 123, and 125; or 96 and 123.
[0099] In one embodiment, SEQ ID NOs: 1 to 88, preferably SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, 9, 10, 11, 16, 25, 27, 28, 31, 34, 35, and 36; or SEQ ID NOs: 8, 9, 1 Provided herein are compositions comprising a gRNA comprising a guide sequence that is 100%, or at least 95% or 90% identical to any of the nucleic acids of SEQ ID NOs: 0, 11, 16, 23, 25, 27, 31, 35, 38, 48, 53, 58, 71, 79, and 81; or SEQ ID NOs: 3, 8, 11, 28, 35, and SEQ ID NO: 37; or SEQ ID NOs: 9, 10, 11, 27, and 35; or SEQ ID NOs: 10, 11, and 35; or SEQ ID NO: 8 and SEQ ID NO: 35.
[0100] In other embodiments, the composition comprises SEQ ID NOs: 1-88, preferably SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, 9, 10, 11, 16, 25, 27, 28, 31, 34, 35, and 36; or or SEQ ID NO:3, 8, 11, 28, 35, and SEQ ID NO:37; or SEQ ID NO:9, 10, 11, 27, and 35; or SEQ ID NO:10, 11, and 35; or SEQ ID NO:8 and SEQ ID NO:35. In some embodiments, the composition comprises SEQ ID NOs: 1-88, preferably SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, 9, 10, 11, 16, 25, 27, 28, 31, 34, 35, and 36; or or SEQ ID NO:3, 8, 11, 28, 35, and SEQ ID NO:37; or SEQ ID NO:9, 10, 11, 27, and 35; or SEQ ID NO:10, 11, and 35; or SEQ ID NO:8 and SEQ ID NO:35.
[0101] In some embodiments, the guide RNA compositions provided herein are designed to recognize (e.g., hybridize to) a target sequence in the CD38 gene. For example, the CD38 target sequence can be recognized and cleaved by the provided Cas cleavage containing guide RNA. In some embodiments, an RNA-guided DNA binding agent, e.g., Cas cleavase, can direct the guide RNA to a target sequence in the CD38 gene, where the guide sequence of the guide RNA hybridizes to the target sequence, and the RNA-guided DNA binding agent, e.g., Cas cleavase, cleaves the target sequence.
[0102] In some embodiments, the selection of one or more guide RNAs is determined based on a target sequence within the CD38 gene.
[0103] Without being bound to any particular theory, the location of the DSB is an important factor in the amount or type of protein knockdown that can occur, since mutations in certain regions of a gene (e.g., indels, i.e., frameshift mutations resulting from insertions or deletions, occurring as a result of nuclease-mediated DSBs) may be less tolerated than mutations in other regions of the gene. In some embodiments, a gRNA that is complementary or has complementarity to a target sequence in CD38 is used to direct an RNA-guided DNA-binding agent to a specific location in the CD38 gene. In some embodiments, the gRNA is designed to have a guide sequence that is complementary or has complementarity to a target sequence in exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, or exon 8 of CD38.
[0104] In some embodiments, the guide sequence is 100% or at least 95% or 90% identical to the target sequence present in the human CD38 gene. In some embodiments, the target sequence may be complementary to the guide sequence of its guide RNA. In some embodiments, the degree of complementarity or identity between the guide sequence of the guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, or 95%, or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, and the total length of the guide sequence is 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1 to 4 mismatches, and the guide sequence is 20 nucleotides.
[0105] In some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA-binding agent, such as a Cas nuclease, as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA-binding agent, such as a Cas nuclease, is provided, used or administered.
[0106] Modified gRNA and mRNA In some embodiments, the gRNA is chemically modified. A gRNA that includes one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or a "chemically modified" gRNA to account for the presence of one or more non-natural or naturally occurring components or structures that are used in place of, or in addition to, the canonical A, G, C, and U residues. In some embodiments, a modified gRNA is synthesized with non-canonical nucleosides or nucleotides, referred to herein as "modified." Modified nucleosides and nucleotides can include one or more of: (i) an alteration in the phosphodiester backbone linkage, e.g., replacement of one or both of the non-bridging phosphate oxygens or one or more of the bridging phosphate oxygens (exemplary backbone modifications); (ii) an alteration, e.g., replacement, of a component of the ribose sugar, e.g., the 2' hydroxyl of the ribose sugar (exemplary sugar modifications); (iii) wholesale replacement of a phosphate moiety with a "dephosphorylated" linker (exemplary backbone modifications); (iv) modification or replacement of a naturally occurring nucleobase, including with a non-standard nucleobase (exemplary base modifications); (v) replacement or modification of the ribose phosphate backbone (exemplary backbone modifications); (vi) a modification of the 3' or 5' end of the oligonucleotide, e.g., removal, modification or replacement of a terminal phosphate group, or conjugation of a moiety, cap, or linker (such 3' or 5' cap modifications can include sugar and / or backbone modifications); and (vii) a modification or replacement of the sugar (exemplary sugar modifications).
[0107] Chemical modifications such as those listed above can be combined to obtain modified gRNAs or mRNAs that contain nucleosides and nucleotides (collectively "residues") that can have two, three, four, or more modifications. For example, modified residues can have modified sugars and modified nucleobases. In some embodiments, every base of the gRNA is modified, e.g., every base has a modified phosphate group, such as a phosphorothioate group. In certain embodiments, all, or substantially all, of the phosphate groups of the gRNA molecule are replaced with phosphorothioate groups. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5' end of the RNA. In some embodiments, the modified gRNA contains at least one modified residue at or near the 3' end of the RNA.
[0108] In some embodiments, the gRNA comprises one, two, three or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) of the positions of the modified gRNA are modified nucleosides or nucleotides.
[0109] Unmodified nucleic acids may be susceptible to degradation, for example, by intracellular nucleases or nucleases found in serum. For example, nucleases can hydrolyze phosphodiester bonds of nucleic acids. Thus, in one aspect, the gRNAs described herein may contain one or more modified nucleosides or nucleotides to introduce stability against nucleases, for example, found in cells or serum. In some embodiments, the modified gRNA molecules described herein may exhibit reduced innate immune responses when introduced into a cell population both in vivo and ex vivo. The term "innate immune response" includes cellular responses to exogenous nucleic acids, such as single-stranded nucleic acids, involving the expression and release of cytokines, particularly interferons, and the induction of cell death.
[0110] In some embodiments of backbone modification, the phosphate group of the modified residue can be modified by replacing one or more of the oxygens with different substituents.Furthermore, modified residues, such as modified residues present in modified nucleic acids, can include largely replacing unmodified phosphate moieties with modified phosphate groups as described herein.In some embodiments, backbone modification of phosphate backbone can include changes that result in either uncharged linkers or charged linkers with asymmetric charge distribution.
[0111] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. The phosphate atom in an unmodified phosphate group is achiral. However, replacement of one of the non-bridging oxygens with one of the atoms or groups of atoms described above can make the phosphorus atom chiral. The stereogenic phosphorus atom can have either the "R" configuration (herein Rp) or the "S" configuration (herein Sp). The backbone can also be modified by replacing the bridging oxygens (i.e., the oxygens that link the phosphate group to the nucleoside) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates). Replacement can occur at either or both of the linking oxygens.
[0112] In certain backbone modifications, the phosphate group can be replaced with a phosphorus-free connector. In some embodiments, the charged phosphate group can be replaced with a neutral moiety. Examples of moieties that can replace the phosphate group can include, but are not limited to, for example, methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, methyleneoxymethylimino.
[0113] Scaffolds can also be constructed that can mimic nucleic acids, in which the phosphate linker and ribose sugar are replaced by nuclease-resistant nucleoside or nucleotide surrogates. Such modifications can include backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by a surrogate backbone. Examples can include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.
[0114] Modified nucleosides and modified nucleotides may include one or more modifications to the sugar group, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) may be modified, e.g., replaced by a number of different "oxy" or "deoxy" substituents. In some embodiments, modifying the 2' hydroxyl group improves the stability of the nucleic acid by preventing the hydroxyl from being deprotonated to form a 2'-alkoxide ion.
[0115] Examples of 2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), polyethylene glycol (PEG), O(CH2CHO) n In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, where the 2' hydroxyl group is replaced with fluoride. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, where the 2' hydroxyl is replaced with fluoride, for example, C1-6 alkylene or C1-6 alkylene. 1-6They may also include "locked" nucleic acids (LNAs) that may be linked to the 4' carbon of the same ribose sugar via a heteroalkylene bridge, exemplary bridges being methylene, propylene, ether, or amino bridges, O-amino (wherein amino can be, for example, NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino), and aminoalkoxy, O(CH). n -amino (wherein amino can be, for example, NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl group modification can include an "unlocked" nucleic acid (UNA), which lacks a C2'-C3' bond in the ribose ring. In some embodiments, the 2' hydroxyl group modification can include a methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).
[0116] A "deoxy" 2' modification can be any of the following: hydrogen (i.e., a deoxyribose sugar, e.g., a partial dsRNA overhang); halo (e.g., bromo, chloro, fluoro, or iodo); amino (where amino can be, e.g., NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CHCHNH) n and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, optionally substituted by amino, e.g., as described herein; -NHC(O)R, where R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar; cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, optionally substituted by amino, e.g., as described herein.
[0117] Sugar modification may include a sugar group that may also contain one or more carbons that have the opposite stereochemical configuration to the stereochemical configuration of the corresponding carbon of ribose.Thus, modified nucleic acids may include nucleotides that contain, for example, arabinose as sugar.Modified nucleic acids may also include abasic sugars.These abasic sugars may be further modified at one or more of the constituent sugar atoms.Modified nucleic acids may also include one or more sugars that are L-form, for example, L-nucleosides.
[0118] The modified nucleosides and modified nucleotides described herein that can be incorporated into modified nucleic acids can include modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobases of the nucleotides can be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, natural and synthetic derivatives of bases.
[0119] In embodiments, the use of dual guide RNAs allows for the inclusion of modifications in each of the crRNA and the tracr RNA. Such modifications may be at one or both ends of the crRNA or the tracr RNA. In embodiments, including sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or internal nucleosides may be modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. Further embodiments include 5'-end modifications and 3'-end modifications.
[0120] In some embodiments, the guide RNA disclosed herein comprises one of the modification patterns disclosed in WO2018 / 107028A1 entitled "Chemically Modified Guide RNAs" or WO2021119275 entitled "Modified Guide RNAs for Gene Editing", the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the structure / modification patterns disclosed in US20170114334, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the structure / modification patterns disclosed in WO2017 / 136794, the contents of which are incorporated herein by reference in their entirety.
[0121] In some embodiments, the sgRNA comprises any of the modification patterns shown herein, where N is any natural or non-natural nucleotide and the entirety of N comprises a CD38 guide sequence as described herein in Table 1. In some embodiments, the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU (SEQ ID NO: 300), where "N" may be any natural or non-natural nucleotide and the entirety of N comprises a CD38 guide sequence as described herein in Table 1. For example, N is replaced with any of the guide sequences disclosed herein in Table 1, and optionally N is selected from SEQ ID NOs: 37, 34, 36, 26, 35, 27, 31, 25, 28, 38, 16, 9, 10, 8, 3, 11, 23, 48, 53, 58, 59, 71, 74, 79, and 81; or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; or SEQ ID NOs: 8, or SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 31, 35, 38, 48, 53, 58, 71, 79, and 81; or SEQ ID NOs: 3, 8, 11, 28, 35, and SEQ ID NO: 37; or SEQ ID NOs: 9, 10, 11, 27, and 35; or SEQ ID NOs: 10, 11, and 35; or SEQ ID NO: 8 and SEQ ID NO: 35. In some embodiments, the sgRNAs listed in Table 1 are modified according to the modification pattern of SEQ ID NO: 300. In some embodiments, the guide sequence can include any one of SEQ ID NOs: 1220-1225 (Table 12), where "N" can be any natural or non-natural nucleotide, preferably an RNA nucleotide, the sugar portion of the nucleotide can be ribose, deoxyribose, or similar compounds having substitutions, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage between the nucleotide residues, and N is collectively the nucleotide sequence of the guide sequence.
[0122] Any of the modifications described below may be present in the gRNAs and mRNAs described herein.
[0123] The terms "mA," "mC," "mU," or "mG" may be used to refer to a 2'-O-Me modified nucleotide.
[0124] The 2'-O-methyl modification can be depicted as follows: [ka]
[0125] Another chemical modification shown to affect the sugar ring of nucleotides is halogen substitution: for example, 2'-fluoro (2'-F) substitution on the nucleotide sugar ring improves oligonucleotide binding affinity and nuclease stability.
[0126] In this application, the terms "fA," "fC," "fU," or "fG" may be used to refer to a 2'-F substituted nucleotide.
[0127] The 2'-F substitution can be represented as follows: [ka]
[0128] Phosphorothioate (PS) linkage or bond refers to a phosphodiester linkage, e.g., a linkage in which one non-bridging phosphate oxygen is replaced with sulfur in the bond between nucleotide bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides are also referred to as S-oligos.
[0129] A "*" may be used to indicate a PS modification. In this application, the terms A*, C*, U*, or G* may be used to indicate a nucleotide that is linked to the following (e.g., 3') nucleotide by a PS bond.
[0130] The terms "mA*", "mC*", "mU*" or "mG*" may be used to refer to a nucleotide that is substituted with 2'-O-Me and is linked to the following (e.g., 3') nucleotide by a PS bond.
[0131] The diagram below shows the substitution of S- for the non-bridging phosphate oxygens resulting in a PS bond instead of a phosphodiester bond. [ka]
[0132] An abasic nucleotide is a nucleotide that is missing a nitrogenous base. The diagram below shows an oligonucleotide with an abasic (also called apurinic) site that is missing a base. [ka]
[0133] An inverted base refers to a base that has a linkage that is inverted from the normal 5' to 3' linkage (i.e., either a 5' to 5' linkage or a 3' to 3' linkage). For example, [ka]
[0134] The abasic nucleotide can be linked with an inverted linkage. For example, the abasic nucleotide can be linked to the terminal 5' nucleotide via a 5' to 5' linkage, or the abasic nucleotide can be linked to the terminal 3' nucleotide via a 3' to 3' linkage. The inverted abasic nucleotide at either the terminal 5' or 3' nucleotide is also called an inverted abasic end cap.
[0135] In some embodiments, one or more of the first 3, 4, or 5 nucleotides at the 5' end and one or more of the last 3, 4, or 5 nucleotides at the 3' end are modified, in some embodiments, the modifications are 2'-O-Me, 2'-F, inverted abasic nucleotides, PS linkages, or other nucleotide modifications known in the art to enhance stability or performance.
[0136] In some embodiments, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked with phosphorothioate (PS) linkages.
[0137] In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise inverted abasic nucleotides.
[0138] In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern set forth in mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 300), where N is any natural or unnatural nucleotide, and the entirety of N comprises a guide sequence that directs a nuclease to a target sequence within CD38, e.g., the genomic coordinates set forth in Table 1. In some embodiments, the guide sequence can include any one of SEQ ID NOs: 1220-1225 (Table 12), where "N" can be any natural or non-natural nucleotide, preferably an RNA nucleotide, the sugar portion of the nucleotide can be ribose, deoxyribose, or similar compounds having substitutions, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage between the nucleotide residues, and N is collectively the nucleotide sequence of the guide sequence.
[0139] In some embodiments, the guide RNA comprises a sgRNA comprising any one of the guide sequences of SEQ ID NOs: 1-88 and a conserved portion of the sgRNA, such as the conserved portion of the sgRNA shown as exemplary SpyCas9 sgRNA-1, or the conserved portion of the gRNA shown in Table 1 and throughout the specification. In some embodiments, the guide RNA comprises a guide sequence of SEQ ID NOs: 1-88 and an sgRNA comprising any one of the nucleotides of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 202), where the nucleotide is at the 3' end of the guide sequence, and the sgRNA can be modified as described herein or in the sequence mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 300). In some embodiments, the sgRNA includes the exemplary SpyCas9 sgRNA-1 and modified versions thereof provided herein, or the versions provided in Table 9 below, where the entire N comprises a guide sequence that directs a nuclease to a target sequence. "N" can be any natural or non-natural nucleotide, preferably an RNA nucleotide, the sugar portion of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage between the nucleotide residues, and N collectively is the nucleotide sequence of the guide sequence. Each N is independently modified or unmodified. In certain embodiments, where there is no indication of modification, the nucleotide is an unmodified RNA nucleotide residue, i.e., a ribose sugar and a phosphodiester backbone.In some embodiments, the guide sequence can include any one of SEQ ID NOs: 1220-1225 (Table 12), where "N" can be any natural or non-natural nucleotide, preferably an RNA nucleotide, the sugar portion of the nucleotide can be ribose, deoxyribose, or similar compounds having substitutions, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage between the nucleotide residues, and N is collectively the nucleotide sequence of the guide sequence.
[0140] As mentioned above, in some embodiments, the compositions or formulations disclosed herein comprise an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, such as a Cas nuclease, such as a Cas9 nuclease, as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease, such as a Cas9 nuclease, is provided, used, or administered. In some embodiments, the ORF encoding the RNA-guided DNA nuclease is a "modified RNA-guided DNA binding agent ORF" or simply a "modified ORF", which is used as an abbreviation to indicate that the ORF is modified.
[0141] In some embodiments, the mRNA and / or modified ORF may include modified uridines at at least one, multiple, or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5-position, e.g., with a halogen or a methyl or ethyl group. In some embodiments, the modified uridine is a pseudouridine modified at the 1-position, e.g., with a halogen or a methyl or ethyl group. The modified ORF includes one or more modified uridines, which may be, e.g., pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or combinations thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.
[0142] In some embodiments, the mRNAs disclosed herein include a 5' cap (e.g., Cap0, Cap1, or Cap2). The 5' cap is generally a 7-methylguanine ribonucleotide (which may be further modified, e.g., with respect to ARCA, as discussed below) linked via a 5'-triphosphate to the 5' position of the first nucleotide (i.e., the first cap-proximal nucleotide) of the 5' to 3' strand of the mRNA. In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both include a 2'-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA both include a 2'-methoxy and a 2'-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both include a 2'-methoxy. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous mRNAs in higher eukaryotes, including mammalian mRNAs such as human mRNAs, contain Cap1 or Cap2. Cap0, as well as other cap structures distinct from Cap1 and Cap2, can be immunogenic in mammals, such as humans, because they are recognized as "non-self" by components of the innate immune system, such as IFIT-1 and IFIT-5, which can lead to increased levels of cytokines, such as type I interferons. Components of the innate immune system, such as IFIT-1 and IFIT-5, can also compete with eIF4E for binding to mRNAs with caps other than Cap1 or Cap2, which can inhibit translation of the mRNA.
[0143] A cap can be included co-transcriptionally. For example, ARCA (anti-reverse cap analog, Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of guanine ribonucleotides and can be incorporated into transcripts in vitro at initiation. ARCA generates a Cap0 cap in which the 2' position of the first cap-proximal nucleotide is a hydroxyl. See, e.g., Stepinski et al., (2001) "Synthesis and properties of mRNAs containing the novel'anti-reverse'cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG," RNA 7:1486-1495. The structure of ARCA is shown below. [ka]
[0144] CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG, TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG, TriLink Biotechnologies catalog number N-7133) can be used to provide the Cap1 structure co-transcriptionally. 3'-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies as catalog numbers N-7413 and N-7433, respectively. The structure of CleanCap™ AG is shown below. [ka]
[0145] Alternatively, a cap can be added to RNA post-transcriptionally. For example, Vaccinia capping enzyme is commercially available (New England Biolabs Catalog No. M2080S) and has RNA triphosphatase and guanylyltransferase activities provided by its D1 subunit, and guanine methyltransferase provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, 7-methylguanine can be added to RNA to give Cap0. See, e.g., Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479.
[0146] Poly A tail In some embodiments, the mRNA further comprises a polyadenylation (polyA) tail. In some embodiments, the polyA tail sequence comprises 100-400 nucleotides. In some embodiments, the polyA tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines. In some embodiments, the polyA sequence comprises non-adenine nucleotides. In some cases, the polyA tail is "interrupted" with one or more non-adenine nucleotide "anchors" at one or more positions within the polyA tail. The polyA tail may comprise at least eight consecutive adenine nucleotides, but may also comprise one or more non-adenine nucleotides. As used herein, "non-adenine nucleotides" refers to any natural or non-natural nucleotide that does not contain an adenine. Guanine nucleotides, thymine nucleotides, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the poly A tail on an mRNA described herein can include consecutive adenine nucleotides located 3' to the nucleotides encoding a polypeptide disclosed herein. In some cases, the poly A tail of an mRNA includes non-consecutive adenine nucleotides located 3' to the nucleotides encoding an RNA-guided DNA binding agent or sequence of interest, where the non-adenine nucleotides interrupt the adenine nucleotides at regular or irregular intervals.
[0147] In some embodiments, the polyA tail is encoded by the plasmid used for in vitro transcription of the mRNA and becomes part of the transcription product. The polyA sequence encoded by the plasmid, i.e., the number of consecutive adenine nucleotides in the polyA sequence, may not be exact, e.g., 100 polyA sequences in the plasmid may not result in exactly 100 polyA sequences in the transcribed mRNA. In some embodiments, the polyA tail is not encoded by the plasmid and is added by PCR tailing or enzymatic tailing, e.g., using E. coli poly(A) polymerase.
[0148] In some embodiments, one or more non-adenine nucleotides are positioned to interrupt consecutive adenine nucleotides such that poly(A) binding protein can bind to a stretch of consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotide(s) are positioned after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after at least 8-50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after at least 8-100 consecutive adenine nucleotides. In some embodiments, the non-adenine nucleotide is positioned after 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides followed by at least 8 consecutive adenine nucleotides.
[0149] A polyA tail of the present disclosure may comprise a sequence of consecutive adenine nucleotides followed by one or more non-adenine nucleotides, optionally, an additional adenine nucleotide.
[0150] In some embodiments, the poly-A tail consists of or contains one non-adenine nucleotide or one contiguous stretch of 2-10 non-adenine nucleotides. In some embodiments, the non-adenine nucleotide(s) is / are preceded by at least 8, 9, 10, 11, or 12 contiguous adenine nucleotides. In some cases, the one or more non-adenine nucleotides are preceded by at least 8-50 contiguous adenine nucleotides. In some embodiments, the one or more non-adenine nucleotides are positioned after at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 consecutive adenine nucleotides.
[0151] In some embodiments, the non-adenine nucleotide is a guanine, cytosine, or thymine. In some embodiments, the non-adenine nucleotide is a guanine nucleotide. In some embodiments, the non-adenine nucleotide is a cytosine nucleotide. In some embodiments, the non-adenine nucleotide is a thymine nucleotide. In some embodiments, when there is more than one non-adenine nucleotide, the non-adenine nucleotide may be selected from a) guanine and thymine nucleotides, b) guanine and cytosine nucleotides, c) thymine and cytosine nucleotides, or d) guanine, thymine, and cytosine nucleotides.
[0152] Ribonucleoprotein complex In some embodiments, the compositions provided herein include one or more gRNAs comprising one or more guide sequences from Table 1, or one or more sgRNAs from Table 1, and an RNA-guided DNA-binding agent, e.g., a nuclease, e.g., a Cas nuclease, e.g., Cas9. In some embodiments, the RNA-guided DNA-binding agent has a cleavase activity, which activity can also be referred to as a double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nuclease. Examples of Cas9 nucleases include those of the Type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, e.g., the list in the next paragraph), as well as modified (e.g., engineered or mutant) versions thereof. See, e.g., US20160312198, US20160312199. Other examples of Cas nucleases include the Csm complex or Cmr complex of a type III CRISPR system, or the Cas10, Csm1 or Cmr2 subunits thereof, and the Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof. In some embodiments, the Cas nuclease can be from a type IIA, type IIB, or type IIC system. For a discussion of various CRISPR systems and Cas nucleases, see, e.g., Makarova et al., NAT.REV.MICROBIOL.9:467-477(2011); Makarova et al., NAT.REV.MICROBIOL,13:722-36(2015); Shmakov et al., MOLECULAR CELL,60:385-397(2015).
[0153] Non-limiting examples of species from which Cas nucleases may be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp.、Crocosphaera watsonii、Cyanothece sp.、Microcystis aeruginosa、Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp.、Lachnospiraceae bacterium ND2006、、、Acaryochloris marina is included。.
[0154] In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is a Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is a Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus or Lachnospiraceae.
[0155] In some embodiments, the gRNA and the RNA-guided DNA-binding agent are referred to as a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA-binding agent is a Cas nuclease. In some embodiments, the gRNA combined with the Cas nuclease is referred to as a Cas RNP. In some embodiments, the RNP comprises type I, type II, or type III components. In some embodiments, the Cas nuclease is a Cas9 protein from a type II CRISPR / Cas system. In some embodiments, the gRNA combined with Cas9 is referred to as a Cas9 RNP.
[0156] Wild-type Cas9 has two nuclease domains, RuvC and HNH. The RuvC domain cleaves the non-target DNA strand and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 protein comprises multiple RuvC domains or multiple HNH domains. In some embodiments, the Cas9 protein is wild-type Cas9. In each of the embodiments of the compositions, uses, and methods of the present invention, Cas induces a double-stranded break in the target DNA.
[0157] In some embodiments, chimeric Cas nucleases are used in which one domain or region is replaced with a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.
[0158] In other embodiments, the Cas protein may be from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of a cascade complex of a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas protein may be from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.
[0159] In some embodiments, the RNA-guided DNA binding agent may have single-stranded nickase activity, i.e., it can cleave one DNA strand to create a single-stranded break (also known as a "nick"). In some embodiments, the RNA-guided DNA binding agent comprises a Cas nickase. A nickase is an enzyme that nicks dsDNA, i.e., it cleaves one strand of the DNA double helix but not the other. In some embodiments, the Cas nickase is a variant of a Cas nuclease (e.g., the Cas nucleases discussed above) in which the endonucleolytic activity site has been inactivated, for example, by one or more alterations (e.g., point mutations) in the catalytic domain. See, e.g., U.S. Pat. No. 8,889,356 for a discussion of Cas nickases and exemplary catalytic domain modifications. In some embodiments, the Cas nickase (e.g., Cas9 nickase) has an inactivated RuvC or HNH domain.
[0160] In some embodiments, the RNA-guided DNA binding agent is modified to contain only one functional nuclease domain. For example, the drug protein can be modified to reduce its nucleic acid cleavage activity by mutating or completely or partially deleting one of the nuclease domains. In some embodiments, a nickase with a RuvC domain that has reduced activity is used. In some embodiments, a nickase with an inactive RuvC domain is used. In some embodiments, a nickase with an HNH domain that has reduced activity is used. In some embodiments, a nickase with an inactive HNH domain is used.
[0161] In some embodiments, conserved amino acids in the Cas protein nuclease domain are substituted to reduce or modify nuclease activity. In some embodiments, the Cas nuclease may include an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may include an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB-A0Q7Q2(CPF1_FRATN)).
[0162] In some embodiments, an mRNA encoding a nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs guide the nickase to the target sequence, where it introduces a DSB by nicking opposing strands of the target sequence (i.e., double nicking). In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, a nickase is used with two separate guide RNAs that target opposite strands of DNA to generate a double nick in the target DNA. In some embodiments, a nickase is used with two separate guide RNAs that are selected to be in close proximity to generate a double nick in the target DNA.
[0163] In some embodiments, the RNA-guided DNA-binding agent lacks cleavase and nickase activity. In some embodiments, the RNA-guided DNA-binding agent comprises a dCas DNA-binding polypeptide. The dCas polypeptide has DNA-binding activity but essentially lacks catalytic (cleavase / nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-guided DNA-binding agent or DNA-binding polypeptide lacking cleavase and nickase activity, dCas, is a form of Cas nuclease (e.g., a Cas nuclease discussed above) whose endonuclease active site has been inactivated, e.g., by one or more alterations (e.g., point mutations) in its catalytic domain. See, e.g., US20140186958, US20150166980.
[0164] In some embodiments, the RNA-guided DNA binding agent comprises (eg, is or comprises a fusion polypeptide) one or more heterologous functional domains.
[0165] In some embodiments, the heterologous functional domain can facilitate transport of the RNA-guided DNA binding agent into the cell nucleus. For example, the heterologous functional domain can be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binding agent can be fused with 1-10 NLS(s). In some embodiments, the RNA-guided DNA binding agent can be fused with 1-5 NLS(s). In some embodiments, the RNA-guided DNA binding agent can be fused with one NLS. If one NLS is used, the NLS can be attached at the N-terminus or C-terminus of the RNA-guided DNA binding agent sequence. The NLS can be inserted within the sequence of the RNA-guided DNA binding agent. In other embodiments, the RNA-guided DNA binding agent can be fused with multiple NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with two, three, four or five NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA-binding agent is fused with two SV40 NLS sequences linked at the carboxy terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs, one linked at the N terminus and the other at the C terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with three NLSs. In some embodiments, the RNA-guided DNA-binding agent may not be fused to an NLS. In some embodiments, the NLS may be a monokaryotic sequence, such as the SV40 NLS, PKKKRKV or PKKKRRV. In some embodiments, the NLS may be a bikaryotic sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK. In certain embodiments, a single PKKKRKV NLS may be linked at the C-terminal end of the RNA-guided DNA-binding agent. One or more linkers are optionally included at the fusion site.
[0166] In some embodiments, the heterologous functional domain can modify the intracellular half-life of the RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder can increase its half-life. In some embodiments, the RNA-guided DNA binder can decrease its half-life. In some embodiments, the heterologous functional domain can increase the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain can decrease the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain can act as a signal peptide for protein degradation. In some embodiments, the protein degradation can be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain can include a PEST sequence. In some embodiments, the RNA-guided DNA binder can be modified by adding ubiquitin or polyubiquitin chains. In some embodiments, the ubiquitin can be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neural progenitor expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-related (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).
[0167] In some embodiments, the heterologous functional domain can be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain can be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed), and the like. Monomeric, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, JRed) and orange fluorescent protein (mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato), or any other suitable fluorescent protein. In another embodiment, the marker domain can be a purification tag or an epitope tag.Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag1, Softag3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent proteins.
[0168] In additional embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent to a given organelle, cell type, tissue or organ, hi some embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent to mitochondria.
[0169] In further embodiments, the heterologous functional domain can be an effector domain. When an RNA-guided DNA-binding agent is guided to its target sequence, for example, when a Cas nuclease is guided to the target sequence by gRNA, the effector domain can modify or affect the target sequence. In some embodiments, the effector domain can be selected from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcription activation domain, or a transcription repressor domain. In some embodiments, the heterologous functional domain is a nuclease, such as FokI nuclease. See, for example, U.S. Patent No. 9,023,649. In some embodiments, the heterologous functional domain is a transcription activator or a transcription repressor. See, for example, Qi et al., "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression", Cell 152:1173-83 (2013); Perez-Pinera et al., "RNA-guided gene activation by CRISPR-Cas9-based transcription factors", Nat. Methods 10:973-6 (2013); Mali et al., "CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering", Nat. Biotechnol. 31:833-8 (2013); Gilbert et al., "CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes", Cell 154:442-51 (2013). Thus, RNA-guided DNA-binding agents essentially become transcription factors that can be induced to bind to desired target sequences using guide RNAs.In some embodiments, the heterologous functional domain is a deaminase, such as cytidine deaminase or adenine deaminase. In certain embodiments, the heterologous functional domain is a C to T base conversion (cytidine deaminase), such as apolipoprotein B mRNA editing enzyme (APOBEC) deaminase.
[0170] In some embodiments, the RNA-guided DNA binding agent is selected from one of S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g., Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpf1, Acidaminococcus sp. Cpf1, Lachnospiraceae bacterium Cpf1, a CT base editor, an AG base editor, Cas12a, Mad7 nuclease, ARCUS nuclease, and CasX. In some embodiments, the RNA-guided DNA binding agent comprises a polypeptide selected from one of S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g., Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpf1, Acidaminococcus sp. Cpf1, Lachnospiraceae bacterium Cpf1, a CT base editor, an AG base editor, Cas12a, and CasX.
[0171] In some embodiments, the RNA-guided DNA binding agent comprises an editor. An exemplary editor is BC22n, which comprises H. sapiens APOBEC3A fused to S. pyogenes-D10A Cas9 nickase by an XTEN linker, and an mRNA encoding BC22n. An mRNA encoding BC22n is provided (SEQ ID NO: 804 or 805).
[0172] Determining gRNA efficacy In some embodiments, the effectiveness of gRNA is determined when it is delivered or expressed together with other components that form RNP. In some embodiments, gRNA is expressed together with RNA-guided DNA binding agent, such as Cas protein, such as Cas9. In some embodiments, gRNA is delivered to or expressed in a cell line that already stably expresses RNA-guided DNA nuclease, such as Cas nuclease or nickase, such as Cas9 nuclease or nickase. In some embodiments, gRNA is delivered to cell as part of RNP. In some embodiments, gRNA is delivered to cell together with mRNA that codes RNA-guided DNA nuclease, such as Cas nuclease or nickase, such as Cas9 nuclease or nickase.
[0173] As described herein, the use of the RNA-guided DNA nucleases and guide RNAs disclosed herein can cause double-stranded breaks in DNA that can generate errors in the form of insertion / deletion (indel) mutations upon repair by the cellular machinery. Many mutations resulting from indels alter the reading frame or introduce premature stop codons, thus producing non-functional proteins. In some embodiments, the efficacy of a particular gRNA is determined based on an in vitro model. In some embodiments, the in vitro model is HEK293 cells stably expressing Cas9 (HEK293_Cas9). In some embodiments, the in vitro model is peripheral blood mononuclear cells ("PBMCs"). In some embodiments, the in vitro model is T cells, such as primary human T cells. In some embodiments, the in vitro model is NK cells, such as primary human NK cells. With regard to the use of primary cells, commercially available primary cells can be used to increase consistency between experiments. In some embodiments, the number of off-target sites at which deletions or insertions occur in an in vitro model (e.g., in T cells or NK cells) is determined, for example, by analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA and guide RNA. In some embodiments, such determination involves analyzing genomic DNA of the cells into which Cas9 mRNA, guide RNA and donor oligonucleotides have been introduced in vitro. Exemplary procedures for such determination include analyzing genomic DNA of cells transfected in vitro with Cas9 mRNA, guide RNA and donor oligonucleotides. + Working examples using human T cells and human NK cells are provided.
[0174] In some embodiments, the efficacy of a particular gRNA is determined across multiple in vitro cell models for the gRNA selection process. In some embodiments, cell line comparisons of selected gRNAs and data are performed. In some embodiments, cross-screening across multiple cell models is performed.
[0175] In some embodiments, the efficacy of the guide RNA is measured by the percentage of indels or gene modifications of CD38. In some embodiments, the efficacy of the guide RNA is measured by the percentage of indels or gene modifications at the CD38 locus. In some embodiments, the efficacy of the guide RNA is measured by the percentage of indels or gene modifications of CD38 at the genomic coordinates of Table 1. In some embodiments, the percentage of editing of CD38 is compared to the percentage of indels or gene modifications required to achieve knockdown of the CD38 protein product. In some embodiments, the efficacy of the guide RNA is measured by reducing or eliminating the expression of CD38 protein. In embodiments, the reduction or elimination of the expression of the CD38 protein is as measured, for example, by flow cytometry as described herein.
[0176] In some embodiments, CD38 protein expression is reduced or eliminated in a cell population using the methods and compositions disclosed herein, in some embodiments, the cell population is at least 55%, 60%, 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% CD38 negative as measured by flow cytometry relative to an unmodified cell population.
[0177] An "unmodified cell" (or "unmodified cells") refers to a control cell (or cells) of the same type of cell in an experiment or test, where the "unmodified" control cell has not been contacted with a CD38 guide. Thus, an unmodified cell (or cells) can be a cell that has not been contacted with a guide RNA or a cell that has been contacted with a guide RNA that does not target CD38.
[0178] In some embodiments, the efficacy of a guide RNA is measured by the number or frequency of indels or genetic modifications at off-target sequences in the genome of a target cell type, such as T cells or NK cells. In some embodiments, an effective guide RNA is provided that generates indels at off-target sites at a very low frequency (e.g., <5%) compared to the frequency of indel generation in a cell population or at the target site. Thus, the present disclosure provides guide RNAs that do not exhibit off-target indel formation in a target cell type (e.g., T cells or NK cells) or that have a frequency of off-target indel formation of less than 5% compared to the frequency of indel generation in a cell population or at the target site. In some embodiments, the present disclosure provides guide RNAs that do not exhibit any off-target indel formation in a target cell type (e.g., T cells or NK cells). In some embodiments, a guide RNA is provided that generates indels at less than 5 off-target sites, for example, as assessed by one or more methods described herein. In some embodiments, guide RNAs are provided that create indels at no more than 4, no more than 3, no more than 2, or no more than 1 off-target site(s), e.g., as assessed by one or more methods described herein. In some embodiments, the off-target site(s) are not found in protein-coding regions of the target cell (such as a hepatocyte) genome.
[0179] In some embodiments, detection of gene editing events, such as the formation of insertion / deletion ("indel") mutations or insertion or homologous directed repair (HDR) events in the target DNA, utilizes linear amplification with tagged primers and isolation of tagged amplification products (hereinafter referred to as "LAM-PCR" or "Linear Amplification (LA)" method). In some embodiments, the efficacy of the guide RNA is measured by the level of a functional protein complex that contains the expressed protein product of the gene. In some embodiments, the efficacy of the guide RNA is measured by flow cytometric analysis of CD38 expression, where a viable population of edited cells is analyzed for loss of CD38.
[0180] T cell receptor (TCR) In some embodiments, for example, an engineered cell or cell population comprising a genetic modification of an endogenous nucleic acid sequence encoding CD38 further comprises a modification, e.g., knockdown, of an endogenous nucleic acid sequence encoding a TCR gene sequence(s) (e.g., TRAC or TRBC).
[0181] In some embodiments, an engineered cell or cell population comprising a genetic modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding CD38, and the insertion into the cell of a heterologous sequence(s) encoding a targeted receptor, further comprises a modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding a TCR gene sequence(s) (e.g., TRAC or TRBC).
[0182] Generally, TCR is a heterodimeric receptor molecule comprising two TCR polypeptide chains, α and β. Suitable α and β genomic sequences or loci for targeting knockdown are known in the art. In some embodiments, the engineered T cells comprise a modification, e.g., knockdown, of a TCR α chain gene sequence, e.g., TRAC. See, e.g., NCBI Gene ID:28755, Ensembl:ENSG00000277734 (T cell receptor alpha constants), US2018 / 0362975, and WO2020081613.
[0183] In some embodiments, the engineered cell or cell population comprises a genetic modification of an endogenous nucleic acid sequence encoding CD38, a genetic modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding a TCR gene sequence(s) (e.g., TRAC or TRBC), and a modification (e.g., knockdown) of an MHC class I gene (e.g., B2M or HLA-A). In some embodiments, the MHC class I gene is an HLA-B gene or an HLA-C gene.
[0184] In some embodiments, the engineered cell or cell population comprises a genetic modification of an endogenous nucleic acid sequence encoding CD38, and a genetic modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding a TCR (e.g., TRAC or TRBC), and a genetic modification (e.g., knockdown) of an MHC class II gene (e.g., CIITA).
[0185] In some embodiments, the engineered cell or cell population comprises a modification of an endogenous nucleic acid sequence encoding CD38, a genetic modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding a TCR (e.g., TRAC or TRBC), and a genetic modification (e.g., knockdown) of a checkpoint inhibitor gene (e.g., TIM3, 2B4, LAG3, or PD-1).
[0186] In some embodiments, the engineered cells or cell populations comprise a genetic modification of the CD38 gene as assessed by sequencing, e.g., NGS, where at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the cells comprise an insertion, deletion, or substitution in the endogenous CD38 sequence. In some embodiments, at least 50% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, at least 55% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, at least 60% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, at least 65% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, at least 70% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, at least 75% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, at least 85% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, at least 70% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, at least 90% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, at least 95% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous CD38 sequence. In some embodiments, CD38 is reduced by at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or below the detection limit of the assay, e.g., compared to a suitable control in which the CD38 gene is not modified.In some embodiments, the expression of CD38 is reduced by at least 50% or below the detection limit of the assay, for example, compared to a suitable control in which the CD38 gene is not modified. In some embodiments, the expression of CD38 is reduced by at least 55% or below the detection limit of the assay, for example, compared to a suitable control in which the CD38 gene is not modified. In some embodiments, the expression of CD38 is reduced by at least 60% or below the detection limit of the assay, for example, compared to a suitable control in which the CD38 gene is not modified. In some embodiments, the expression of CD38 is reduced by at least 65% or below the detection limit of the assay, for example, compared to a suitable control in which the CD38 gene is not modified. In some embodiments, the expression of CD38 is reduced by at least 70% or below the detection limit of the assay, for example, compared to a suitable control in which the CD38 gene is not modified. In some embodiments, the expression of CD38 is reduced by at least 80% or below the detection limit of the assay, for example, compared to a suitable control in which the CD38 gene is not modified. In some embodiments, the expression of CD38 is reduced by at least 90% or below the detection limit of the assay, for example, compared to a suitable control in which the CD38 gene is not modified. In some embodiments, the expression of CD38 is reduced by at least 95% or below the detection limit of the assay, for example, compared to a suitable control in which the CD38 gene is not modified. Assays for CD38 protein and mRNA expression are known in the art. "Expression of CD38" refers to the expression of the encoding transcript (e.g., CD38 mRNA), or the expression of the CD38 protein or a portion thereof. Inhibiting the expression of CD38 can result in a reduction in the level of the transcript encoding CD38 (e.g., CD38 mRNA) or a reduction in the level of the CD38 protein or a portion thereof. Inhibition of CD38 expression can be assessed by detecting or quantifying the transcript encoding CD38 (e.g., mRNA), CD38 protein, a portion of the CD38 protein, or CD38 activity.
[0187] In some embodiments, the engineered cells or cell populations include modification (e.g., knockdown) of the TCR gene sequence by gene editing, e.g., assessed by sequencing, e.g., NGS, and at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the cells include an insertion, deletion, or substitution in the endogenous TCR gene sequence. In some embodiments, the TCR is reduced by at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or below the detection limit of the assay, e.g., compared to a suitable control group in which the TCR gene is not modified. In certain embodiments, the TCR is TRAC or TRBC. Assays for TCR protein and mRNA expression are known in the art.
[0188] In some embodiments, the engineered cell or cell population includes the insertion, by gene editing, of a sequence(s) encoding a target receptor, as assessed, for example, by sequencing, such as NGS.
[0189] In some embodiments, a guide RNA that specifically targets a site within a TCR gene (e.g., the TRAC gene) is used to provide modification (e.g., knockdown) of the TCR gene.
[0190] In some embodiments, the TCR gene is modified (e.g., knocked down) in a T cell using a guide RNA with an RNA-guided DNA binding agent. In some embodiments, disclosed herein are engineered T cells by inducing a break (e.g., a double-strand break (DSB) or a single-strand break (nick)) in the TCR gene of a T cell, e.g., using a guide RNA with an RNA-guided DNA binding agent (e.g., a CRISPR / Cas system). The methods can be used in vitro or ex vivo, e.g., in the manufacture of cell products for suppressing an immune response.
[0191] In some embodiments, the guide RNA mediates target-specific cleavage by an RNA-guided DNA-binding agent (e.g., a Cas nuclease) at a site described herein in the TCR gene. It will be appreciated that in some embodiments, the guide RNA comprises a guide sequence that binds or is capable of binding to the above region.
[0192] Methods and uses, including methods of treatment and preparation of engineered cells or immunotherapy reagents In certain embodiments, the gRNAs and related methods and compositions disclosed herein are useful for generating cell therapy (e.g., immunotherapy) reagents, such as engineered cells (e.g., engineered T cells and / or engineered NK cells).
[0193] Immunotherapy is the treatment of disease by activating or suppressing the immune system. Immunotherapies designed to induce or amplify an immune response are classified as activated immunotherapies. Cell-based immunotherapy has been shown to be effective in the treatment of several cancers. Immune effector cells, such as lymphocytes, macrophages, dendritic cells, natural killer cells (NK cells), and cytotoxic T lymphocytes (CTLs), can be programmed to act in response to abnormal antigens expressed on the surface of tumor cells. Cancer immunotherapy thus enables components of the immune system to destroy tumors or other cancer cells.
[0194] Immunotherapy may also be useful in treating chronic infections, such as Hepatitis B and C virus infections, human immunodeficiency virus (HIV) infections, tuberculosis infections, and malaria infections. Immune effector cells containing targeted receptors, such as transgenic TCRs or CARs, are useful in immunotherapy, such as those described herein.
[0195] In some embodiments, a gRNA comprising a guide sequence from Table 1 induces a double strand break (DSB) with an RNA-guided DNA nuclease, e.g., a Cas nuclease, and non-homologous end joining (NHEJ) during repair results in a modification, such as a mutation, in the CD38 gene. In some embodiments, NHEJ causes a deletion or insertion of a nucleotide(s) to induce a frameshift or nonsense mutation in the CD38 gene. In certain embodiments, a gRNA comprising a guide sequence targeting a TCR sequence (e.g., TRAC and TRBC) is also delivered to a cell with or separately from an RNA-guided DNA nuclease, such as a Cas nuclease, to genetically modify the TCR sequence to inhibit expression of the full-length TCR sequence. In certain embodiments, the gRNA is an sgRNA.
[0196] In some embodiments, the subject is a mammalian animal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate.
[0197] In some embodiments, the guide RNA, compositions, and formulations are used to produce cells, e.g., immune cells, e.g., T cells with genetic modifications in the CD38 gene, ex vivo. The modified T cells can be natural killer (NK) T cells. The modified T cells can express a T cell receptor, such as a universal TCR or a modified TCR. The T cells can express a CAR or a CAR construct with a zeta chain signaling motif.
[0198] Delivery of gRNA compositions Lipid nanoparticles (LNPs) are well-known vehicles for the delivery of nucleotide and protein cargoes and may be used to deliver the guide RNAs and compositions disclosed herein ex vivo and in vitro. In some embodiments, the LNPs deliver nucleic acids, proteins, or nucleic acids and proteins.
[0199] In some embodiments, provided herein is a method for delivering any one of the cells or cell populations disclosed herein to a subject, wherein the gRNA is delivered via a LNP. In some embodiments, the gRNA / LNP is also associated with Cas9 or an mRNA encoding Cas9.
[0200] In some embodiments, provided herein is a composition comprising any one of the disclosed gRNAs and LNPs, in some embodiments, the composition further comprises Cas9 or an mRNA encoding Cas9.
[0201] In some embodiments, the gRNA-associated LNPs disclosed herein are for use in preparing a cell as a medicament for treating a disease or disorder.
[0202] Electroporation is a well-known means for cargo delivery, and any electroporation method can be used to deliver any one of the gRNAs disclosed herein. In some embodiments, electroporation can be used to deliver any one of the gRNAs disclosed herein and Cas9 or an mRNA encoding Cas9.
[0203] In some embodiments, provided herein is a method for delivering any one of the gRNAs disclosed herein to an ex vivo cell, wherein the gRNA is associated with a LNP or is not associated with a LNP. In some embodiments, the gRNA / LNP or gRNA is also associated with Cas9 or an mRNA encoding Cas9.
[0204] In some embodiments, the guide RNA compositions described herein, alone or encoded in one or more vectors, are formulated in or administered via lipid nanoparticles (see, e.g., WO2017 / 173054 and PCT / US2021 / 29446, the contents of each of which are incorporated by reference in their entireties).
[0205] In certain embodiments, provided herein is a DNA or RNA vector encoding any of the guide RNAs comprising any one or more of the guide sequences described herein. In some embodiments, in addition to the guide RNA sequence, the vector further comprises a nucleic acid that does not encode a guide RNA. The nucleic acid that does not encode a guide RNA includes, but is not limited to, a promoter, an enhancer, a regulatory sequence, and a nucleic acid that encodes an RNA-guided DNA nuclease (which can be a nuclease such as Cas9). In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, or a crRNA and a trRNA. In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding an sgRNA and an mRNA that encodes an RNA-guided DNA nuclease (which can be a Cas nuclease such as Cas9 or Cpf1). In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a crRNA and a trRNA and an mRNA that encodes an RNA-guided DNA nuclease (which can be a Cas protein such as Cas9). In one embodiment, the Cas9 is from Streptococcus pyogenes (i.e., SpyCas9). In some embodiments, the nucleotide sequence encoding the crRNA, trRNA, or the crRNA and trRNA (which may be an sgRNA) comprises or consists of a guide sequence flanked by all or a portion of a repeat sequence from a naturally occurring CRISPR / Cas system. The nucleic acid comprising or consisting of the crRNA, trRNA, or the crRNA and trRNA may further comprise a vector sequence comprising or consisting of a nucleic acid not found in nature with the crRNA, trRNA, or the crRNA and trRNA.
[0206] In some embodiments, the components can be introduced as naked nucleic acid or as nucleic acid complexed with an agent such as liposome or poloxamer, or can be delivered by viral vectors (e.g., adenovirus, AAV, herpes virus, retrovirus, lentivirus). Methods and compositions for non-viral delivery of nucleic acid include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, LNP, polycation or lipid:nucleic acid conjugates, naked nucleic acid (e.g., naked DNA / RNA), artificial virions, and drug-enhanced DNA uptake. Sonoporation, for example using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acid.
[0207] This description and exemplary embodiments should not be construed as limiting. For the purposes of this specification and the appended claims, unless otherwise specified, all numerical values expressing quantities, percentages, or ratios, as well as other numerical values used in this specification and the appended claims, unless already so modified, should be understood to be modified in all cases by the term "about". Thus, unless otherwise specified, the numerical parameters set forth in the following specification and the appended claims are approximations that may vary depending on the desired properties sought to be obtained. Each numerical parameter should, at the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, be construed at least in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0208] Combination therapy As described herein, delivery of gRNA together with RNA-guided DNA nuclease that induces double-strand breaks (DSBs) and non-homologous end joining (NHEJ) during repair and results in modifications, e.g., mutations, in the CD38 gene can be combined with one or more additional therapies. In some embodiments, the additional therapy is a cancer therapy. In some embodiments, the additional therapy is a chemotherapy, a hormone therapy, an immunotherapy, a radiation therapy, or a targeted therapy.
[0209] As described herein, delivery of gRNA together with RNA-guided DNA nuclease that induces double-strand breaks (DSBs) and non-homologous end joining (NHEJ) during repair and results in mutations in the CD38 gene can be combined with one or more additional therapies. In some embodiments, the additional therapy is a cancer therapy. In some embodiments, the additional therapy is a chemotherapy, a hormone therapy, an immunotherapy, a radiation therapy, or a targeted therapy.
[0210] In some embodiments, the additional therapy can be an anti-CD38 antibody. The gRNA / Cas therapeutic approach that results in at least one mutation in the CD38 gene can be combined with another anti-CD38 therapy (e.g., anti-CD38 targeted therapy) to reduce CD38 activity in cells that escape the gRNA / Cas therapeutic approach. The additional therapy can also be another gRNA / Cas therapy that includes a gRNA that targets another gene (e.g., a TCR gene).
[0211] Anti-CD38 antibodies are known in the art and have been shown to be effective (or are undergoing clinical trials to confirm efficacy) in reducing CD38 activity and treating or preventing certain diseases (e.g., multiple myeloma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, T-cell leukemia). Thus, contemplated herein are antibodies that specifically bind to CD38 and at least partially inhibit its activity. In some embodiments, the anti-CD38 antibody is daratumumab, an IgG1k human monoclonal antibody that has been shown to be effective (or is undergoing clinical trials to confirm efficacy) in treating multiple myeloma, diffuse large B-cell lymphoma, follicular lymphoma, and mantle cell lymphoma. In addition, administration of CD38-depleted NK cells has been shown to reduce or eliminate fratricide caused by daratumumab and enhance NK cell efficacy (Kararoudi et al., Blood (2020) 136(21):2416-2427). In some embodiments, the anti-CD38 antibody is isatuximab (an IgG1 human monoclonal antibody). In some embodiments, the anti-CD38 antibody is a bispecific antibody. In some embodiments, the anti-CD38 antibody is TAK-079 or MOR-202, both of which are currently in clinical trials.
[0212] In some embodiments, the CD38 inhibitor is a small molecule. In some embodiments, the small molecule is a 4-aminoquinoline. Examples of 4-aminoquinolines include, but are not limited to, CD38 inhibitor 78c, CD38 inhibitor 1ah, and CD38 inhibitor 1ai. These types of CD38 inhibitors generally competitively inhibit the NADase activity of CD38. CD38 inhibitor 78c (structure shown below) has been shown to be effective in reducing tumor burden in Lewis lung carcinoma mouse model. [ka]
[0213] NAD+ analogs are also contemplated herein as additional therapeutic agents that inhibit CD38 and can be combined with gRNA / Cas systems that target CD38. NAD+ analogs that are CD38 inhibitors include, but are not necessarily limited to, Ara-F-NAD+, Ara-F-NMN, Ara-F-NMN phosphoester / C48, Carba-NAD, and Pseudo-Carba-NAD.
[0214] NAD+ analogs are also contemplated herein as additional therapeutic agents that inhibit CD38 and can be combined with gRNA / Cas systems that target CD38. NAD+ analogs that are CD38 inhibitors include, but are not necessarily limited to, Ara-F-NAD+, Ara-F-NMN, Ara-F-NMN phosphoester / C48, Carba-NAD, and Pseudo-Carba-NAD.
[0215] In some embodiments, the anti-CD38 inhibitor is a flavonoid. Flavonoid CD38 inhibitors are generally non-toxic to humans, and beneficial effects have been observed in animal models of obesity, cardiac ischemia, kidney injury, viral infection, and cancer. Flavonoid inhibitors of CD38 include, but are not limited to, quercetin, apigenin, luteolinidin, Kuromanin, and rhein / K-rhein. Flavonoids, such as NAD+ analogs, generally tend to inhibit the NADase activity of CD38 by competitive inhibition.
[0216] In some embodiments, the additional cancer therapy is a CAR-T cell therapy. Chimeric antigen receptors (CARs) are molecules that combine antibody-based specificity for tumor-associated surface antigens with a T cell receptor activation intracellular domain that has specific anti-tumor cell immune activity (Eshhar, 1997, Cancer Immunol Immunother 45(3-4)131-136; Eshhar et al., 1993, Proc Natl Acad Sci USA 90(2):720-724; Brocker and Karjalainen, 1998, Adv Immunol 68:257-269). These CARs allow T cells to achieve MHC-independent primary activation through a single-chain Fv (scFv) antigen-specific extracellular domain fused to an intracellular domain that provides T cell activation and costimulatory signals. Second and third generation CARs also provide appropriate co-stimulatory signals via CD28 and / or CD137 (4-1BB) intracellular activation motifs, which enhance cytokine secretion and antitumor activity in various solid tumor and leukemia models (Pinthus, et al, 2004, J Clin Invest 114(12):1774-1781; Milone, et al., 2009, Mol Ther 17(8):1453-1464; Sadelain, et al., 2009, Curr Opin Immunol 21(2):215-223). Chimeric antigen receptor (CAR) T-cell therapy involves genetic modification of a patient's autologous T cells to express a CAR specific for a tumor antigen, followed by ex vivo cell expansion and reinfusion into the patient. CARs are fusion proteins of selected single-chain fragments variable from a particular monoclonal antibody and one or more T-cell receptor intracellular signaling domains. This T cell genetic modification can occur via either viral-based gene transfer methods or non-viral methods such as DNA-based transposon, CRISPR / Cas9 technology, or direct transfer of in vitro transcribed mRNA by electroporation.
[0217] efficacy In some embodiments, the methods described herein can be used to treat any cancer, including any cancerous or precancerous tumor. Cancers that can be treated by the methods and compositions provided herein include, but are not limited to, cancers of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gums, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testes, tongue, or uterus. In addition, cancer may include, but is not limited to, the following histological types: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant cell and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; stromal carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; mixed hepatocellular carcinoma-cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenomatous intrapolypoid adenocarcinoma; adenocarcinoma, familial polyposis coli; solid tumor; carcinoid tumor, malignant; cytoplasmic tumor; Bronchoalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; eosinophilic carcinoma; eosinophilic adenocarcinoma; basophilic carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary / follicular adenocarcinoma; Cancer; ceruminous gland carcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; invasive ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease of the breast; acinar cell carcinoma; adenosquamous carcinoma; squamous cell carcinoma Adenocarcinoma with metaplasia;malignant thymoma;malignant ovarian stromal tumor;malignant theca cell tumor;malignant granulosa cell tumor;malignant roblastoma;Sertoli cell carcinoma;malignant Leydig cell tumor;malignant lipid cell tumor;malignant paraganglioma;malignant extramammary paraganglioma;pheochromocytoma;glomus angiosarcoma;malignant melanoma;amelanotic melanoma;superficial spreading melanoma;malignant melanoma in giant pigmented nevus;epithelioid cell melanoma;malignant blue nevus;sarcoma;fibrosarcoma;malignant fibrous histiocytoma;myxoid meat tumor;liposarcoma;leiomyosarcoma;rhabdomyosarcoma;embryonic rhabdomyosarcoma;alveolar rhabdomyosarcoma;stromal sarcoma;malignant mixed tumor;mixed Müllerian tumor;nephroblastoma;hepatoblastoma;carcinosarcoma;malignant mesenchymoma;malignant Brenner tumor;malignant phyllodes tumor;synovial sarcoma;malignant mesothelioma;dysgerminoma;embryonic carcinoma;malignant teratoma;malignant ovarian thyroid tumor;choriocarcinoma;malignant mesothelioma;angiosarcoma;malignant hemangioendothelioma;Kaposi's sarcoma;malignant hemangiopericytoma;lymphangiosarcoma;osteosarcoma;parosteal osteosarcoma;chondrosarcoma;malignant chondroblastoma;Mesenchymal chondrosarcoma;Giant cell tumor of bone;Ewing's sarcoma;Malignant odontogenic tumor;Ameloblastoma;Malignant ameloblastoma;Ameloblastic fibrosarcoma;Malignant pinealoma;Chordoma;Malignant glioma;Ependymoma;Astrocytoma;Protoplasmic astrocytoma;Fibrous astrocytoma;Astroblastoma;Glioblastoma;Oligodendroglioma;Oligodendroglioma;Primitive neuroectodermal tumor;Cerebellar sarcoma;Ganglioblastoma;Neuroblastoma;Retinoblastoma;Olfactory neurogenic tumor;Malignant meningioma;Neurofibrosarcoma;Malignant neurilemmoma;Malignant granular cell tumor;Malignant lymphoma;Ho Hodgkin's disease; Hodgkin's lymphoma; lateral granuloma; small lymphocytic lymphoma; diffuse large cell lymphoma; follicular lymphoma; mycosis fungoides; other specific non-Hodgkin's lymphoma; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphocytic leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.
[0218] In some embodiments, the cancer to be treated is a CD38-expressing cancer.
[0219] In some embodiments, the cancer comprises a solid tumor. In some embodiments, the tumor is an adenocarcinoma, an adrenal tumor, anal tumor, bile duct tumor, bladder tumor, bone tumor, blood-borne tumor, brain / CNS tumor, breast tumor, cervical tumor, colorectal tumor, endometrial tumor, esophageal tumor, Ewing's tumor, eye tumor, gallbladder tumor, gastrointestinal tumor, kidney tumor, laryngeal or hypopharyngeal tumor, liver tumor, lung tumor, mesothelial tumor, multiple myeloma tumor, muscle tumor, nasopharyngeal tumor, neuroblastoma, oral cavity tumor, osteosarcoma, ovarian tumor, pancreatic tumor, penile tumor, pituitary tumor, primary tumor, prostate tumor, retinoblastoma, rhabdomyosarcoma, salivary gland tumor, soft tissue sarcoma, melanoma, metastatic tumor, basal cell carcinoma, Merkel cell tumor, testicular tumor, thymus tumor, thyroid tumor, uterine tumor, vaginal tumor, vulvar tumor, or Wilms tumor.
[0220] In certain embodiments, the cancer is multiple myeloma, chronic lymphocytic leukemia (CLL), the most common leukemia in adults, lung cancer, prostate cancer, or melanoma. EXAMPLES
[0221] The following examples are provided to illustrate certain disclosed embodiments and should not be construed as limiting the scope of the disclosure in any way.
[0222] Example 1. General Method 1.1. Preparation of lipid nanoparticles In general, lipid components were dissolved in 100% ethanol at various molar ratios. RNA cargo (e.g., Cas9 mRNA and sgRNA) was dissolved in 25 mM citrate buffer, 100 mM NaCl (pH 5.0) to obtain a concentration of RNA cargo of approximately 0.45 mg / mL.
[0223] The lipid-nucleic acid assembly comprises ionizable lipid A, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate. The mixture contained 2-dienoate, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000 (PEG2k-DMG) in molar ratios of 50:38:9:3, respectively. The lipid nucleic acid assemblies were formulated to have a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA weight ratio of 1:2, unless otherwise specified.
[0224] LNPs were prepared by impingement jet mixing of lipids in ethanol with two volumes of RNA solution and one volume of water using cross-flow technology. Lipid-containing ethanol was mixed with two volumes of RNA solution through a mixing cross. A fourth water stream was mixed with the outlet flow of the cross through a tee in line (see FIG. 2 of WO2016010840). LNPs were held at room temperature for 1 hour and further diluted with water (approximately 1:1 v / v). LNPs were concentrated using tangential flow filtration with a flat sheet cartridge (Sartorius, 100 kD MWCO) and buffer exchanged into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) using a PD-10 desalting column (GE). Alternatively, LNPs were optionally concentrated using a 100 kDa Amicon spin filter and buffer exchanged into TSS using a PD-10 desalting column (GE). The resulting mixture was then filtered using a 0.2 μM sterile filter, and the final LNPs were stored at 4° C. or −80° C. until further use.
[0225] 1.2. In Vitro Transcription of mRNA ("IVT") Capped, polyadenylated mRNA containing N1-methylpseudo-U was generated by in vitro transcription using a linear plasmid DNA template and T7 RNA polymerase. Plasmid DNA containing the T7 promoter, sequence for transcription, and polyadenylation region was linearized by incubation with XbaI for 2 hours at 37°C using the following conditions: 200 ng / μL plasmid, 2 U / μL XbaI (NEB), and 1× reaction buffer. XbaI was inactivated by heating the reaction at 65°C for 20 minutes. Linearized plasmid was purified from enzymes and buffer salts. IVT reactions to generate modified mRNA were performed with the following conditions: 50 ng / μL linearized plasmid, 2–5 mM each of GTP, ATP, CTP, and N1-methylpseudo-UTP (Trilink), 10–25 mM ARCA (Trilink), 5 U / μL T7 RNA polymerase (NEB), 1 U / μL mouse RNase inhibitor (NEB), 0.004 U / μL inorganic E. coli pyrophosphatase (NEB), and 1× reaction buffer, incubated for 1.5–4 h at 37°C. TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U / μL, and the reaction was incubated for an additional 30 min to remove the DNA template. mRNA was purified using the MegaClear Transcription Clean-up kit (ThermoFisher) or RNeasy Maxi kit (Qiagen) according to the manufacturer's operating instructions. Alternatively, mRNA was purified using a precipitation protocol (in some cases followed by HPLC-based purification). Briefly, after DNase digestion, LiCl precipitation, ammonium acetate precipitation, and sodium acetate precipitation were used to purify mRNA. For HPLC-purified mRNA, after LiCl precipitation and reconstitution, mRNA was purified by RP-IP HPLC (see, e.g., Kariko, et al. Nucleic Acids Research, 2011, Vol. 39, No. 21 e142). The fractions selected for pooling were combined and desalted by sodium acetate / ethanol precipitation as described above.In a further alternative method, mRNA was purified by LiCl precipitation and then further purified by tangential flow filtration. RNA concentrations were determined by measuring absorbance at 260 nm (Nanodrop) and transcripts were analyzed by capillary electrophoresis with a Bioanlayzer (Agilent).
[0226] Streptococcus pyogenes ("Spy") Cas9 mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID NO: 801-803 (see sequences in Table 9). BC22n mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID NO: 804 or 805. UGI mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID NO: 807 or 808. When the sequences cited in this paragraph are referred to below in relation to RNA, it is understood that T should be replaced by U (which was N1-methylpseudouridine as above). The messenger RNA used in the examples includes a 5' cap and a 3' polyadenylation region, e.g., up to 100 nt.
[0227] 1.3. Next Generation Sequencing ("NGS") and Analysis of On-Target Editing Efficiency Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen, Cat. QE09050) according to the manufacturer's protocol. To quantitatively determine the efficiency of editing at the target location in the genome, deep sequencing was used to identify the presence of insertions and deletions introduced by gene editing. PCR primers were designed around the target site in the gene of interest (e.g., CD38) to amplify the genomic region of interest. Primer sequence design was performed as standard in the art.
[0228] An additional PCR was performed according to the manufacturer's protocol (Illumina) to add the necessary chemistry for sequencing. Amplicons were sequenced on an Illumina MiSeq instrument. After removing reads with low quality scores, reads were aligned to the human reference genome (e.g., hg38). Reads overlapping the target region of interest were realigned to the local genomic sequence to improve alignment. The number of wild-type reads relative to the number of reads containing CT mutations, CA / G mutations, or indels was then calculated. Insertions and deletions were scored in a 20 bp region centered around the predicted Cas9 cleavage site. The indel percentage is defined as the total number of sequence reads with one or more bases inserted or deleted within the 20 bp score region divided by the total number of sequencing reads containing wild type. CT or CA / G mutations were scored in a 40 bp region that included 10 bp upstream and 10 bp downstream of the 20 bp sgRNA target sequence. The CT editing percentage is defined as the total number of sequencing reads with one or more CT mutations within a 40 bp region divided by the total number of sequencing reads containing the wild type. The percentage of CA / G mutations is calculated similarly.
[0229] Example 2 - CD38 guide RNA screening in T cells using Cas9 and BC22n 2.1 Preparation of T cells T cells were edited at the CD38 locus with either Cas9 or BC22n and UGI mRNA to assess the editing outcome and corresponding loss of CD38 expression. The guide sequences and target regions used are listed in Table 1. As shown in Table 1, each sgRNA containing a guide sequence contains a guide scaffold of SEQ ID NO:202 and is modified according to the modification pattern of SEQ ID NO:300.
[0230] Healthy human donor apheresis was obtained commercially (Hemacare) and cells were washed and resuspended in CliniMACS PBS / EDTA buffer (Miltenyi Biotec, Cat. No. 130-070-525) on a LOVO device. T cells were isolated via positive selection using CD4 and CD8 magnetic beads (Miltenyi Biotec, Cat. No. 130-030-401 / 130-030-801) and CliniMACS Plus and CliniMACS LS disposable kits. T cells were aliquoted into vials and cryopreserved for future use in a Cryostor CS10 (StemCell Technologies, Cat. No. 07930). Upon thawing, T cells were collected at 1.0×10 6 At a density of cells / mL, the cells were incubated in 5% (v / v) fetal bovine serum (ThermoFisher, Catalog No. A3160902), 50 μM (1X) 2-mercaptoethanol (ThermoFisher, Catalog No. 31350010), 1% penicillin-streptomycin (ThermoFisher, Catalog No. 15140122), 1 M N-acetyl-L-cystine (Fisher, Catalog No. ICN19460325) and 1% ethanol. T cells were plated in T cell X-VIVO 15 growth medium composed of X-VIVO 15 (Lonza, Cat. No. BE02-06Q) containing 100 U / mL recombinant human interleukin-2 (Peprotech, Cat. No. 200-02), 5 ng / mL recombinant human interleukin-7 (Peprotech, Cat. No. 200-07), and 5 ng / mL recombinant human interleukin-15 (Peprotech, Cat. No. 200-15). T cells were activated with TransAct™ (1:100 dilution, Miltenyi Biotec, Cat. No. 130-111-160). Cells were grown at 37° C. for 72 hours prior to mRNA electroporation.
[0231] 2.2 T cell editing by RNA electroporation Solutions containing mRNA encoding Cas9 protein (SEQ ID NOs: 801-803), BC22n (SEQ ID NOs: 804 or 805), or UGI (SEQ ID NOs: 807 or 808) were prepared in sterile water. 50 μM of sgRNA targeting CD38 were removed from their storage plates, denatured at 95 °C for 2 min, and incubated at room temperature for 5 min. 72 h after activation, T cells were harvested, centrifuged, and 12.5 × 10 6 T cells / mL. For each well to be electroporated, 1 × 10 5 T cells were mixed with 200ng of Cas9 or BC22n mRNA, 200ng of UGI mRNA, and 20pmol of sgRNA listed in Table 2 in a final volume of 20μL P3 electroporation buffer. The mixture was transferred in duplicate to a 96-well Nucleofector™ plate and electroporated using the manufacturer's pulse code. The electroporated T cells were immediately placed in 80μL of X-VIVO 15 medium without cytokines for 15 minutes and then transferred to a new flat-bottom 96-well plate containing an additional 90μL of X-VIVO 15 medium supplemented with 2x cytokines. The resulting plate was incubated at 37°C for 10 days. To promote proliferation, T cells were split at a ratio of 1:4 and 1:3, respectively, on days 3 and 6 after electroporation using fresh X-VIVO15 medium with 1x cytokines. On day 9 after electroporation, cells were split 1:2 into two U-bottom plates, one plate was collected for NGS sequencing and the other plate was used for flow cytometry on day 10.
[0232] 2.3 Flow cytometry and NGS sequencing Ten days after editing, T cells were phenotyped by flow cytometry to determine CD38 receptor expression. Briefly, T cells were incubated for 30 minutes at 4°C with a mixture of antibodies against CD3 (BioLegend, Cat. No. 317340), CD4 (BioLegend, Cat. No. 300537), CD8 (BioLegend, Cat. No. 344706) diluted 1:200 in cell staining buffer (BioLegend, Cat. No. 420201) and CD38 (BioLegend, Cat. No. 303546) diluted 1:100. Cells were then washed and stained with DAPI (BioLegend, Cat. No. 422801) diluted 1:10,000 in cell staining buffer. Cells were then processed on a Cytoflex flow cytometer (Beckman Coulter) and analyzed using the FlowJo software package. T cells were gated based on size, shape, viability, and CD38 expression.
[0233] On day 9, DNA samples were subjected to PCR and subsequent NGS analysis as described in Example 1. Table 2 shows the CD38 gene editing and CD38 positivity results for cells edited with BC22n or Cas9. [Table 3-1] [Table 3-2] [Table 3-3]
[0234] Example 3. Off-target analysis 3.1 Biochemical off-target analysis Biochemical methods (see, e.g., Cameron et al., Nature Methods. 6, 600-606; 2017) were used to determine potential off-target genomic sites cleaved by Cas9 using specific guides targeting CD38. Twenty-one sgRNAs targeting human CD38 (shown in both Tables 3 and 4) were screened using NA24385 genomic DNA (Coriell Institute) along with three control guides with known off-target profiles. The number of on-target and potential off-target cleavage sites was detected using a guide concentration of 192 nM gRNA and 64 nM Cas9 protein in the biochemical assay, and the results are shown in Tables 3 and 4. [Table 4] [Table 5]
[0235] 3.2 Targeted sequencing to verify potential off-target sites Potential off-target sites predicted by detection assays such as the biochemical methods used above can be evaluated using targeted sequencing of the identified potential off-target sites to determine whether off-target cleavage at those sites is detected.
[0236] In one approach, the Cas9 and sgRNA of interest (e.g., an sgRNA with potential off-target sites for evaluation) are introduced into primary T cells. The T cells are then lysed and primers flanking the potential off-target site(s) are used to generate amplicons for NGS analysis. Identification of indels at a particular level can validate potential off-target sites, but the lack of indels found at potential off-target sites may indicate a false positive in the off-target prediction assay utilized.
[0237] After editing in cells, G019771 was further evaluated for possible off-target indel formation using amplicon sequencing at potential off-target sites identified by the biochemical assays described above or by in silico prediction.
[0238] Samples were prepared in triplicate. T cells were prepared as described in Example 6. Cells were treated simultaneously with three LNPs, each formulated with a single RNA cargo of SpyCas9 mRNA, UGI mRNA, or G019771. LNPs were generally prepared as described in Example 1 with a lipid molar ratio of 50 lipid A: 38.5 cholesterol: 10 DPSC: 1.5 PEG. LNPs were pre-incubated in 20ug / ml human ApoE3. Approximately 50,000 cells were treated with LNPs measured by RNA weight as follows: 334ug Cas9 mRNA, 334ug G019771, 100ug UGI mRNA. Cells were incubated at 37°C for 24 hours and then resuspended in fresh medium for further growth. Approximately 72 hours after LNP treatment, cells were harvested and NGS analysis was performed using primers designed to identify the indel percentage at predicted off-target sites, generally as described in Example 1, or via rhAmpSeq CRISPR analysis system (IDT) according to manufacturer's protocol. To confirm indel repair structures, repair structures were manually inspected at loci with statistically relevant indel rates at off-target cleavage sites. Of the 37 potential off-target sites examined, one site located in an intergenic region showed less than 1% indels with statistical significance compared to untreated controls. Other sites examined did not show statistically significant editing compared to untreated controls.
[0239] Example 4. Dose-dependent editing in NK cells Natural killer (NK) cells were edited using two guides at increasing concentrations. NK cells were isolated from commercial Leukopak using the EasySep Human NK Cell Isolation Kit (STEMCELL, Cat. No. 17955) according to the manufacturer's protocol. After isolation, human primary NK cells were cryopreserved. Upon thawing, cells were cultured overnight in RPMI1640 medium with 10% fetal bovine serum (FBS), 100U / mL interleukin-2 (IL-2), and 1% Pen-Strep. NK cells were activated by culturing the cells 1:1 with irradiated K562 4-1BBL cells for 3 days in RPMI1640 medium with 10% FBS and 1% Pen-Strep.
[0240] NK cells were treated with LNPs delivering Cas9 mRNA (SEQ ID NO:802) and gRNA (G019768 or G019795) targeting CD38 as shown in Table 5. LNPs were prepared as described in Example 1 with a lipid composition generally having a molar ratio of 50 ionizable lipid A / 38.5 cholesterol / 10 DSPC / 1.5 PEG. LNPs were formulated to have a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA weight ratio of 1:2. LNPs were preincubated with 1 μg / ml recombinant human ApoE3 (Peprotech, 350-02) in RPMI medium at 37° C. for 15 minutes. Preincubated LNPs were added in duplicate to NK cells at the total RNA cargo concentrations shown in Table 5. Twelve days after LNP treatment, cells were assayed by flow cytometry to measure CD38 surface expression. Briefly, NK cells were incubated with antibodies targeting CD3 (Biolegend, Cat. No. 317344), CD56 (Biolegend, Cat. No. 362518), and CD38 (Biolegend, Cat. No. 303510). Cells were then washed, processed on a Cytoflex instrument (Beckman Coulter), and analyzed using the FlowJo software package. NK cells were gated based on size and CD3 / CD56 status. Table 5 and Figure 1 show the percentage of NK cells without CD38 surface expression. [Table 6]
[0241] Example 5. Multi-editing by CD38 disruption and AAVS1 insertion Natural killer (NK) cells were sequentially edited to first disrupt CD38 and then insert GFP into the AAVS1 locus. NK cells from buffy coats were isolated using the EasySep Human NK Cell Isolation Kit (STEMCELL, Cat. No. 17955) according to the manufacturer's protocol. After isolation, human primary NK cells were cryopreserved. Upon thawing, human primary NK cells were cultured overnight at 1x106 cells / ml in CTS OpTmizer medium (Gibco, A10221-01) containing 5% FBS and 1% Pen-Strep with 500U / ml IL-2 (CTS OpTmizer complete medium). NK cells were activated by culturing the cells 1:1 with irradiated K5624-1BBL cells for 1 day in CTS OpTmizer complete medium. Cells were washed and plated at 0.5×10 6 cells / ml in CTS OpTmizer medium containing 500 U / ml IL-2 and 5 ng / ml IL-15.
[0242] NK cells were treated with LNPs delivering Cas9 mRNA (SEQ ID NO: 802) targeting CD38 and gRNA G019768. LNPs were generally prepared as described in Example 1 with lipids having a molar ratio of 50 ionized lipid A / 38.5 cholesterol / 10 DSPC / 1.5 PEG. LNPs were preincubated with 5 μg / ml recombinant human ApoE3 (Peprotech, 350-02) for 15 min at 37° C. in CTS OpTmizer complete medium containing 2.5% human AB serum (GemCell, 100-512). Preincubated LNPs were added to NK cells in duplicate with 5 μg / ml total RNA cargo.
[0243] One day after CD38 LNP exposure, cells were treated with LNP and AAV6 for insertion of GFP at the AAVS1 locus. LNPs were prepared as in Example 1 with a lipid composition generally having a molar ratio of 50 ionizable lipid A / 38.5 cholesterol / 10 DSPC / 1.5 PEG. LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA weight ratio of 1:2. LNPs were preincubated with 10 μg / ml APOE3 in OpTmizer medium with 2.5% human AB serum, 500 U / mL IL-2, and 5 ng / ml IL-15 for approximately 15 minutes at 37°C. Preincubated LNPs were added to NK cells in duplicate with 10 μg / ml total RNA cargo. After editing, an AAV6 vector encoding a GFP gene driven by its own promoter and homology arms flanking the AAVS1 sequence (SEQ ID NO: 1001) was added to the cells at a multiplicity of infection (MOI) of 600,000 genome copies, after editing, and the cells were incubated for 6 days.
[0244] Eight days after activation, cells were assayed by flow cytometry to measure the percentage of CD38 surface expression and GFP expression. Briefly, NK cells were incubated with antibodies targeting CD3 (Biolegend, Cat. No. 317344), CD56 (Biolegend, Cat. No. 362518), CD38 (Biolegend, Cat. No. 303510) and DAPI. Cells were then washed, processed with a Cytoflex instrument (Beckman Coulter) and analyzed using the FlowJo software package. NK cells were gated based on size and CD3 / CD56 status. Table 6 and Figure 2 show the percentage of NK cells without CD38 surface expression and with GFP expression. Using LNPs, sequential gene disruption and sequence insertion editing were achieved in NK cells. [Table 7]
[0245] For each crRNA, the 20 nt guide sequence shown is contained within the N20GUUUUAGAGCUAUGCUGUUUUG nucleic acid sequence, where "N20" represents the guide sequence.
[0246] To identify PAMs in regions of interest, an initial guide selection was performed in silico using a human reference genome (e.g., hg38) and a user-defined genomic region of interest (e.g., CD38). Analysis was performed and statistics were reported for each identified PAM. gRNA molecules were further selected and ranked based on a number of criteria known in the art (e.g., GC content, predicted on-target activity, and potential off-target activity).
[0247] Example 6. Knockout of CD38 to prevent autoactivation and fratricide of engineered cells Healthy human donor T cells were engineered with a targeting receptor that targets engineered cells to CD38 with or without disruption of CD38. After T cell expansion, engineered cells were characterized for autoactivation and fratricide.
[0248] Example 6.1. Preparation of T Cells Healthy human donor apheresis was obtained commercially (Hemacare), cells were washed and resuspended in CliniMACS® PBS / EDTA buffer (Miltenyi Biotec catalog 130-070-525) and processed in a MultiMACS™ Cell24 Separator Plus device (Miltenyi Biotec). T cells were isolated via positive selection using the Leukopak® CD4 / CD8 MicroBead Kit, human (Miltenyi Biotec catalog 130-122-352). T cells were aliquoted into vials and cryopreserved in a Cryostor® CS10 (StemCell Technologies, catalog no. 07930) for future use.
[0249] Upon thawing, T cells were plated at a density of 1.0x10^6 cells / mL in T cell growth medium (TCGM) composed of CTS OpTmizer T cell proliferation SFM and T cell proliferation supplement (ThermoFisher, Cat. A1048501), 5% human AB serum (GeminiBio, Cat. 100-512), 1X penicillin-streptomycin, 1X Glutamax, 10mM HEPES, 200U / mL recombinant human interleukin-2 (Peprotech, Cat. 200-02), 5ng / ml recombinant human interleukin-7 (Peprotech, Cat. 200-07), and 5ng / ml recombinant human interleukin-15 (Peprotech, Cat. 200-15). T cells were left in this medium for 24 hours, at which point they were plated for editing with lipid nanoparticles.
[0250] Example 6.2 - Multi-editing of T cells targeting CD38 by sequential LNP delivery T cells were engineered by a series of gene disruptions and insertions. Healthy donor T cells were treated sequentially with up to three LNPs, each co-formulated with mRNA encoding Cas9 and sgRNA targeting either TRBC (G016239) or TRAC (G013006), with or without CD38 (G019771). A transgenic receptor targeting engineered cells to CD38-expressing cells was integrated at the TRAC break site by delivering a homology-directed repair template using adeno-associated virus (AAV).
[0251] Example 6.3. LNP Treatment and T Cell Expansion Prior to each LNP treatment, T cells were centrifuged at 500 g for 5 min and resuspended in T cell plating medium (TCPM): a serum-free version of TCPM containing 400 U / mL recombinant human interleukin-2 (Peprotech, Catalog 200-02), 10 ng / ml recombinant human interleukin-7 (Peprotech, Catalog 200-07), and 10 ng / ml recombinant human interleukin-15 (Peprotech, Catalog 200-15).
[0252] LNPs were prepared generally as described in Example 1. For LNPs with TRAC or TRBC gRNA, lipid A, cholesterol, DSPC, and PEG2k-DMG in a ratio of 50 / 38.5 / 10 / 1.5 were used. For LNPs with CD38 gRNA, lipid A, cholesterol, DSPC, and PEG2k-DMG in a ratio of 50 / 38 / 9 / 3 were used. LNPs were prepared at a 1:2 weight ratio of gRNA to mRNA. LNPs were prepared daily in T cell treatment medium (TCTM): a version of TCGM containing 20ug / mL rhApoE3 in the absence of interleukin 2, 5, or 7. LNPs were incubated at 37°C for 15 minutes and delivered to T cells at a 1:1 volume ratio.
[0253] On day 1, LNPs containing Cas9 mRNA and TRBC sgRNA were incubated at a concentration of 5ug / mL in TCPM containing 20ug / mL rhApoE3 (Peprotech, Catalog 350-02). Meanwhile, T cells were harvested, washed, and cultured at 2x10 in TCPM with a 1:50 dilution of T Cell TransAct Human Reagent (Miltenyi, Catalog 130-111-160). 6 The T cells were resuspended at a density of 10000000 cells / mL. The T cells and LNP medium were mixed in a 1:1 ratio and the T cells were plated in culture flasks until day 3.
[0254] On day 3, LNPs carrying Cas9 mRNA and TRAC sgRNA were incubated at a concentration of 5ug / mL in TCPM containing 20ug / mL rhApoE3 (Peprotech, Cat. 350-02) and 1μM DNA protein kinase inhibitor. Meanwhile, T cells were washed and plated at 1x10 in TCPM. 6 The T cells and LNP medium were mixed in a 1:1 volume ratio in a culture flask. Adeno-associated virus (AAV) carrying a homology-directed repair template encoding the targeted receptor was injected into the culture flask at a density of 3 × 10 5 The antibodies were added to T cells at an MOI of 100 genome copies / cell. T cells were cultured for up to 4 days.
[0255] On day 4, two separate treatments were performed. In the first group, LNPs containing Cas9 mRNA and CD38 sgRNA were incubated at a concentration of 5 μg / mL in TCPM containing 20 μg / mL rhApoE3 (Peprotech, Cat. 350-02). Meanwhile, T cells were washed and incubated at 1 × 10 6 In group 2, T cells were washed and resuspended at a density of 1 × 10 cells / mL. T cells and LNP medium were mixed in a culture flask at a 1:1 volume ratio. In group 3, T cells were washed and resuspended at a density of 1 × 10 cells / mL. In group 4, T cells were resuspended at a density of 1 × 10 cells / mL. In group 5, T cells were resuspended at a density of 1 × 10 cells / mL. In group 6 T cells were mixed 1:1 with TCTM containing 20ug / mL rhApoE3 but no LNPs.
[0256] On day 5, T cells were washed and transferred to 6M well GREX plates (Wilson Wolf, Catalog 80660M) in T cell growth medium (TCGM) consisting of CTS OpTmizer T cell proliferation SFM and T cell proliferation supplement (ThermoFisher, Catalog A1048501), 5% human AB serum (GeminiBio, Catalog 100-512), 1X penicillin-streptomycin, 1X Glutamax, 10 mM HEPES, 200U / mL recombinant human interleukin-2 (Peprotech, Catalog 200-02), 5ng / ml recombinant human interleukin-7 (Peprotech, Catalog 200-07), and 5ng / ml recombinant human interleukin-15 (Peprotech, Catalog 200-15). T cells were expanded for 9 days without medium changes according to the manufacturer's protocol. T cells were harvested, assessed by flow cytometry, and cryopreserved in a Cryostor® CS10 (StemCell Technologies, Cat. No. 07930).
[0257] Example 6.4. Assessment of T cell editing by flow cytometry After expansion, edited T cells were assayed by flow cytometry to assess loss of CD38 expression. T cells were incubated with an antibody cocktail targeting the following molecules: CD4 (Biolegend, Cat. 317434), CD8 (Biolegend, Cat. 301046), CD3 (Biolegend, Cat. 317336), and CD38 (Biolegend, Cat. 303516). Cells were then washed and analyzed on a Cytoflex LX instrument (Beckman Coulter) using the FlowJo software package. T cells were gated based on size and CD4 / CD8 status before expression of any markers was determined. Loss of CD38 expression was confirmed in T cells edited with CD38 LNPs.
[0258] Example 6.5. Assessment of T cell activation by flow cytometry Engineered T cells (CD38+ / -) expressing the targeted receptors described herein were co-cultured with target multiple myeloma (MM1.S) cells expressing high levels of CD38 at an effector-to-target ratio of 1:2. To assess the occurrence of self-activation or fratricide, CD38+ / - targeted receptor expressing T cells were cultured in the absence of target MM1.S cells. Co-cultures were performed in cytokine-free medium composed of CTS OpTmizer T cell proliferation SFM and T cell proliferation supplement (ThermoFisher, catalog A1048501), 5% human AB serum (GeminiBio, catalog 100-512), 1x penicillin-streptomycin, 1x Glutamax, and 10 mM HEPES.
[0259] After 24 hours, the co-cultures were assayed by flow cytometry to assess activation of CD8+ effector T cells. For this purpose, cells were incubated with a cocktail of antibodies targeting the following molecules: CD4 (Biolegend, Cat. 317434), CD8 (Biolegend, Cat. 301046), CD38 (Biolegend, Cat. 303516), CD25 (Biolegend, Cat. 302632), and CD69CD25 (Biolegend, Cat. 310906). Cells were then washed and analyzed on a Cytoflex LX instrument (Beckman Coulter) using the FlowJo software package. T cells were gated based on size and CD4 / CD8 status before expression of any markers was determined.
[0260] In the presence of MM1.S target cells, both CD38+ and CD38- effector T cells showed strong expression of the activation markers CD25 and CD69. More importantly, in the absence of MM1.S target cells, CD38+ effector T cells showed detectable expression of activation markers, whereas CD38- effector T cells did not express activation markers above background levels.
[0261] Example 6.6. Luciferase-based cytotoxicity assay of CD38KO effector T cells Engineered targeted receptor expressing T cells with and without CD38 disruption were co-cultured with luciferized multiple myeloma (MM1.S) cells expressing high levels of CD38 at an effector to target ratio of 1:2. Co-cultures were performed in cytokine-free medium composed of CTS OpTmizer T cell proliferation SFM and T cell proliferation supplement (ThermoFisher, Cat. A1048501), 5% human AB serum (GeminiBio, Cat. 100-512), 1x penicillin-streptomycin, 1x Glutamax, and 10 mM HEPES.
[0262] After 48 hours, the amount of luciferase enzyme produced by viable MM1.S cells, which is inversely proportional to engineered T cell cytotoxicity, was measured by Bright-Glo assay (Promega catalog E2620) according to the manufacturer's instructions. Luminescence was measured using a Synergy Neo2 Hybrid Multi-Mode Reader (BioTek Instruments).
[0263] Both CD38+ and CD38- T cells expressing the target receptor displayed a cytotoxic response against the target MM1.S cells, but CD38- T cells displayed greater cytotoxicity than CD38+ T cells.
[0264] Example 6.7. Secretion of proinflammatory biomarkers by CD38+ / - T cells To assess the occurrence of autoactivation or fratricide, targeted receptor-expressing T cells with and without CD38 disruption were cultured in the absence of target MM1.S cells in cytokine-free medium composed of CTS OpTmizer T cell proliferation SFM and T cell proliferation supplement (ThermoFisher, Cat. A1048501), 5% human AB serum (GeminiBio, Cat. 100-512), 1x penicillin-streptomycin, 1x Glutamax, and 10 mM HEPES.
[0265] After 24 hours, cultures were centrifuged at 500g for 5 minutes and 100 μL of supernatant was harvested to assess the levels of proinflammatory analytes secreted by CD38+ and CD38- T cells in the absence of target MM1.S cells. Interleukin-2 (IL2), interferon gamma (IFNG), tumor necrosis factor-alpha (TNF), granulocyte-macrophage colony-stimulating factor (GM-CSF) and granzyme A (GZMA) concentrations were measured using a Meso Scale Discovery (cat. K15338K-2) multiplex immunoassay according to the manufacturer's protocol using a MESO QuickPlex SQ 120 instrument.
[0266] In the absence of MM1.S target cells, CD38+ T cells secreted detectable levels of proinflammatory biomarkers, indicative of autoactivation or fratricide. In contrast, CD38- T cells did not secrete proinflammatory biomarkers above background levels, indicating a lack of fratricide.
[0267] Example 7 Editing of human T cells with BC22n, UGI and 91mer sgRNA The base editing efficiency of the 91mer sgRNA, assessed by NGS and receptor knockout, was compared to that of a 100mer sgRNA control with the same guide sequence.
[0268] Example 7.1. Preparation of T Cells Healthy human donor apheresis was obtained commercially (Hemacare), cells were washed and resuspended in CliniMACS® PBS / EDTA buffer (Miltenyi Biotec catalog 130-070-525) and processed in a MultiMACS™ Cell 24 Separator Plus device (Miltenyi Biotec). T cells were isolated via positive selection using the Leukopak® CD4 / CD8 MicroBead kit, human (Miltenyi Biotec catalog 130-122-352). T cells were sorted and cryopreserved for future use in a Cryostor® CS10 (StemCell Technologies, catalog 07930).
[0269] Upon thawing, T cells were plated at a density of 1.0 x 10^6 cells / mL in T cell proliferation medium (TCGM) composed of CTS OpTmizer T cell proliferation SFM and T cell proliferation supplement (ThermoFisher, Cat. A1048501), 5% human AB serum (GeminiBio, Cat. 100-512), 1X penicillin-streptomycin, 1X Glutamax, 10 mM HEPES, 200U / mL recombinant human interleukin-2 (Peprotech, Cat. 200-02), 5ng / ml recombinant human interleukin-7 (Peprotech, Cat. 200-07), and 5ng / ml recombinant human interleukin-15 (Peprotech, Cat. 200-15). T cells were left in this medium for 24 hours, at which point they were activated with the human reagent T cell TransAct™ (Miltenyi, catalog 130-111-160), added at a volume ratio of 1:100. T cells were allowed to activate for 48 hours prior to LNP treatment.
[0270] Example 7.2. T Cell LNP Treatment and Expansion 48 hours after activation, T cells were harvested, centrifuged at 500g for 5 minutes, and resuspended at a concentration of 1x10^6 T cells / mL in T cell plating medium (TCPM): a serum-free version of TCPM containing 400U / mL recombinant human interleukin-2 (Peprotech, Cat. 200-02), 10ng / mL recombinant human interleukin-7 (Peprotech, Cat. 200-07), and 10ng / mL recombinant human interleukin-15 (Peprotech, Cat. 200-15). 50μL of T cells (5x10^4 T cells) in TCPM were added per well to process in flat-bottom 96-well plates.
[0271] LNPs were prepared with a ratio of 35 / 15 / 47.5 / 2.5 (Lipid A / Cholesterol / DSPC / PEG2k-DMG) as described in Example 1. LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6. LNPs encapsulated a single RNA species: G019771, G023522, BC22n mRNA, or UGI mRNA.
[0272] Prior to T cell treatment, LNPs encapsulating sgRNA were diluted to 6.64 μg / mL in T cell treatment medium (TCTM): a version of TCGM containing 20 ug / mL rhApoE3 in the absence of interleukin 2, 5 or 7. These LNPs were incubated for 15 min at 37°C and serially diluted 1:4 using TCTM, which resulted in an 8-point dilution series ranging from 6.64 μg / mL to zero. Similarly, single cargo LNPs carrying BC22n mRNA or UGI mRNA were diluted to 3.32 and 1.67 μg / mL in TCTM, respectively, incubated for 15 min at 37°C and mixed in a 1:1 volume with the sgRNA LNPs serially diluted in the previous step. Finally, 50 μL from the resulting mixture was added to T cells in a 96-well plate in a 1:1 volume ratio. The T cells were incubated at 37° C. for 24 hours, at which point they were harvested, centrifuged at 500 g for 5 minutes, resuspended in 200 μL of TCGM, and returned to the incubator.
[0273] Example 7.3. Evaluation of editing results by next generation sequencing (NGS)
[0274] Four days after LNP treatment, T cells were lysed, PCR amplified for each target locus, and then subjected to NGS analysis as described in Example 1. Table 7 and Figure 3 show the editing levels and C to T editing purity in T cells treated with decreasing masses of 100mer or 91mer sgRNAs targeting CD38.
[0275] Compared to the 100mer version, the 91mer sgRNAs resulted in higher editing frequencies when delivered at the same concentration. C to T editing purity was observed to be similar between the 100mer and 91mer sgRNAs. [Table 8]
[0276] Example 7.4. Evaluation of receptor knockout by flow cytometry Seven days after LNP treatment, T cells were assayed by flow cytometry to assess receptor knockout. T cells were incubated with a fixable viability dye (Beckman Coulter, Cat. C36628) and an antibody cocktail targeting the following molecules: CD3 (Biolegend, Cat. 317336), CD4 (Biolegend, Cat. 317434) and CD8 (Biolegend, Cat. 301046), B2M (Biolegend, Cat. 316306), CD38 (Biolegend, Cat. 303516), HLA-A2 (Biolegend, Cat. 343304) and HLA-DR, DP, DQ (Biolegend, Cat. 361714). Cells were then washed and analyzed on a Cytoflex LX instrument (Beckman Coulter) using the FlowJo software package. T cells were gated for size, viability and CD8 positivity before expression of any markers was determined. The resulting data were plotted in GraphPad Prism v.9.0.2 and analyzed using variable slope (four parameter) nonlinear regression.
[0277] As shown in Table 8 and Figure 4, the 91mer sgRNA tested outperformed the 100mer version. [Table 9]
[0278] Example 8. Dose-dependent editing in NK cells Natural killer (NK) cells were edited using either guide RNA or SpyCas9 mRNA at various concentrations. Cryopreserved NK cells from two donors were cultured overnight in NK growth medium (NKGM): CTS OpTmizer medium (Gibco) supplemented with 5% human AB serum, 10 mM HEPES, 1x Glutamax, and 1% Pen-Strep. NK cells were activated by culturing 1:1 with irradiated K5624-1BBL cells for 3 days in NKGM with 500U / ml IL-2 and 5ng / ml IL-15.
[0279] NK cells were treated with two LNPs, one delivering SpyCas9 mRNA (SEQ ID NO:802) and one delivering gRNA G023522 targeting CD38. The LNPs were prepared as described in Example 1 with a lipid composition generally using a molar ratio of 35 lipid A / 15 DSPC / 47.5 cholesterol / 2.5 PEG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6. G023522 LNPs were serially diluted 4-fold starting at 3.3 μg / ml with SpyCas9 mRNA LNPs at a standard concentration of 0.83 μg / ml to 7 points and pre-incubated with recombinant human ApoE3 (Peprotech, 350-02) at 2.5 μg / ml for approximately 10 minutes in NK editing medium (NKEM): CTS OpTmizer medium (Gibco) supplemented with 2.5% human AB serum, 10 mM HEPES, 1×Glutamax, 1% Pen-Strep, 500 U / ml IL-2 and 5 ng / ml IL-15 at 37° C. SpyCas9 mRNA LNPs were also serially diluted 4-fold starting at 3.3 μg / ml with G023522 at a standard concentration of 0.83 μg / ml and pre-incubated with ApoE3 as above.
[0280] Pre-incubated LNPs were added in triplicate to 5e5 NK cells at the mRNA and gRNA concentrations shown in Table 9. Seven days after LNP treatment, cells were assayed by flow cytometry to measure CD38 surface expression. Briefly, NK cells were incubated with antibodies targeting CD3 (Biolegend, Cat. No. 317344), CD56 (Biolegend, Cat. No. 362518), and CD38 (Biolegend, Cat. No. 303510). Cells were then washed, processed on a Cytoflex instrument (Beckman Coulter), and analyzed using the FlowJo software package. NK cells were gated based on size and CD3 / CD56 status. Table 9 and Figures 5A-B show the percentage of NK cells without CD38 surface expression. [Table 10]
[0281] Example 9 Additional Biochemical Off-Target Analysis Guides using the 91 nucleotide format were evaluated for potential off-target DNA cleavage using the methods described in Example 3, with the following exceptions: Genomic DNA was treated with calf intestinal alkaline phosphatase (CIP) prior to use. Biochemical assays were performed with 16 nM Cas9 RNP formed using a molar ratio of 3 guide RNA:1 Cas9 protein. The number of cleavage sites detected for each guide (including on-target sites) is shown in Table 10. These potential off-target sites and computationally predicted off-target sites are verified using targeted sequencing, as described in Example 3. [Table 11]
[0282] Example 10 Dose-response editing in NK cells with a 91-nucleotide guide Editing efficacy was evaluated using 91 nucleotide guides (G028179, G028542, G028543, G028544, G028545 - sequences shown in Table 12) delivered to natural killer (NK) cells using lipid nanoparticles (LNPs). Cells were expanded for 5 days from freshly isolated CD3-depleted cord blood mononuclear cells and activated with EBV-LCL feeder cells in NK MACS medium (Miltenyi) and human AB serum (hAB) supplemented with IL-2 after 2 days of culture. Cells were harvested and resuspended in OpTmizer medium with 2.5% hAB, supplemented IL-2 (500IU / mL) and IL-15 (5ng / mL) cytokines, and 2.5ug / ml ApoE3 (Sigma). Cells were aliquoted at 1e5 cells per well in 96-well tissue culture plates.
[0283] LNPs were generally prepared as described in Example 1 with a lipid composition using a molar ratio of 35 lipid A / 15 DSPC / 47.5 cholesterol / 2.5 PEG and cargo using a 1:1 weight ratio of gRNA:mRNA. LNPs were serially diluted 2-fold in OpTmizer medium with 2.5% hAB and supplemented IL-2 and IL-15 cytokines. LNPs were added to duplicate samples of NK cells from three donors at the concentrations of total RNA cargo weight shown in Table 11. One day after LNP application, the medium was replaced with NK MACS (Miltenyi) supplemented with IL-2 (500 IU / mL) and the cells were returned to culture.
[0284] Eight days after LNP treatment, cells were assessed for the presence of CD38 surface antigen by flow cytometry. Briefly, NK cells were incubated with a mixture of the following antibodies: anti-human CD56 Brilliant Violet 650 (Biolegend #362532), anti-human CD16 Alexa Fluor 700 (Biolegend #302026), anti-human CD38 PerCp-Cy5.5 (Biolegend #356614), anti-human NKG2D Brilliant Violet 421 (Biolegend #320822), and anti-human NKG2A APC (Biolegend #375108). Cells were washed and then processed on a BD FACSCelesta Cytometer and analyzed using the FlowJo software package. Cells were gated based on FSC / SSC, single cells, viability, lack of feeder cells, and CD38-expressing NK cells. Table 11 and Figure 6 show the average CD38KO percentage calculated across the average edits in three donors. Donor averages were calculated across replicates. For each replicate, the percentage of CD38KO is calculated as 100-[(%CD38 positive cells in sample) / (%CD38 positive cells in mock treated donor) x 100]. [Table 12] [Table 13-1]
Table 13-2
Table 13-3
Table 13-4
Table 13-5
Table 13-6
Table 13-7
Table 13-8
Table 13-9
Table 13-10
Table 13-11
Table 13-12
Table 13-13
Table 13-14
Table 13-15
Table 13-16
Table 13-17
Table 13-18
Table 13-19
Table 13-20
Table 13-21
Table 13-22
Table 13-23
Table 13-24
Table 13-25
Table 13-26
Table 13-27
Table 13-28
Table 13-29
Table 13-30
Table 13-31
Table 13-32
Table 13-33
Claims
1. Engineered cells containing a genetic modification in the human CD38 sequence within the genomic coordinates of chr4:15766497-15871496.
2. 2. The engineered cell of claim 1, wherein the genetic modification inhibits expression of the CD38 gene, the function of the CD38 gene product, or both.
3. The genetic modification is within a genomic coordinate selected from: Table 1 2. The engineered cell of claim 1, comprising a modification of at least one nucleotide of:
4. The engineered cell of claim 1, wherein the cell has reduced cell surface expression of CD38 protein.
5. a. the genetic modification comprises an indel; b. the genetic modification comprises the insertion of a heterologous coding sequence; c. the genetic modification comprises a substitution; d. the genetic modification comprises a C to T substitution or an A to G substitution; e. the genetic modification results in an alteration in a nucleic acid sequence that prevents translation of the full-length protein prior to the genetic modification; f. the genetic modification results in an alteration in a nucleic acid sequence that results in a premature stop codon in the coding sequence of the full-length protein; g. the genetic modification results in an alteration in a nucleic acid sequence that results in an alteration in the splicing of pre-mRNA from the genomic locus; h. the genetic modification results in reduced cell surface expression of a protein from the gene that comprises the genetic modification; or i. The engineered cell of claim 1, wherein said genetic modification results in reduced cell surface expression of a protein that is regulated by a gene that comprises the genetic modification.
6. 10. The engineered cell of claim 1, wherein the cell comprises an exogenous nucleic acid encoding a targeting receptor that is expressed on the surface of the engineered cell.
7. i) the targeted receptor is a CAR; ii) the targeting receptor is a TCR, or iii) the targeting receptor is a CAR specific for CD38; The engineered cell of claim 6.
8. The engineered cell of claim 1 , wherein the engineered cell is an immune cell.
9. The immune cells i) a monocyte, macrophage, mast cell, dendritic cell, or granulocyte; ii) is a lymphocyte; iii) is a T cell; or iv) NK cells; The engineered cell of claim 8.
10. A pharmaceutical composition comprising the engineered cells of claim 1.
11. A CD38 guide RNA that specifically hybridizes to a CD38 sequence comprising a nucleotide sequence selected from the following: a. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 3, 8, 9, 10, 11, 16, 23, 25, 26, 27, 28, 31, 34, 35, 36, 37, 38, 48, 53, 58, 59, 71, 74, 79, and 81; b. a guide sequence comprising a nucleotide sequence of at least 17, 18, 19, or 20 contiguous nucleotides of a nucleotide sequence selected from the sequences of SEQ ID NOs: 3, 8, 9, 10, 11, 16, 23, 25, 26, 27, 28, 31, 34, 35, 36, 37, 38, 48, 53, 58, 59, 71, 74, 79, 81; c. a guide sequence comprising a nucleotide sequence at least 95% identical or at least 90% identical to a nucleotide sequence selected from SEQ ID NOs: 3, 8, 9, 10, 11, 16, 23, 25, 26, 27, 28, 31, 34, 35, 36, 37, 38, 48, 53, 58, 59, 71, 74, 79, 81; d. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 28, 31, 34, 35, 36, and 37; e. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 8, 9, 10, 11, 16, 25, 27, 28, 31, 34, 35, and 36; f. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 8, 9, 10, 11, 16, 23, 25, 27, 31, 35, 38, 48, 53, 58, 71, 79, and 81; g. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 3, 8, 11, 28, 35, and 37; h. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 9, 10, 11, 27, and 35; i. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 10, 11, and 35; j. a guide sequence comprising the nucleotide sequence set forth in SEQ ID NO: 10; k. a guide sequence comprising the nucleotide sequence set forth in SEQ ID NO: 11; l. a guide sequence comprising the nucleotide sequence set forth in SEQ ID NO: 35, and m. A guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 8 and 35.
12. A CD38 guide RNA comprising a guide sequence, wherein the guide sequence directs an RNA-guided DNA binding agent to a chromosomal location among those targeted by SEQ ID NOs: 3, 8, 9, 10, 11, 16, 23, 25, 26, 27, 28, 31, 34, 35, 36, 37, 38, 48, 53, 58, 59, 71, 74, 79, and 81.
13. 12. The guide RNA of claim 11, wherein the guide RNA is a dual guide RNA (dgRNA) or a single guide RNA (sgRNA).
14. 14. The guide RNA of Claim 13, further comprising the nucleotide sequence of SEQ ID NO: 201 3' to the guide sequence, wherein the guide RNA comprises a 5' end modification or a 3' end modification.
15. Further comprising a 5'-end modification or a 3'-end modification and a conserved portion of the gRNA, wherein the conserved portion of the gRNA is A. A shortened or substituted and optionally shortened hairpin 1 region relative to SEQ ID NO: 201, 1. At least one of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9 is replaced with a Watson-Crick paired nucleotide in said substituted and optionally shortened Hairpin 1, said Hairpin 1 region optionally comprising: a. Any one or two of H1-5 to H1-8, b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. lacking 1 to 8 nucleotides of the hairpin 1 region, or 2. The shortened Hairpin 1 region lacks 4 to 8 nucleotides, preferably 4 to 6 nucleotides; a. one or more of positions H1-1, H1-2, or H1-3 are deleted or substituted compared to SEQ ID NO: 201; or b. one or more of positions H1-6 to H1-10 is substituted compared to SEQ ID NO: 201; or 3. The hairpin 1 region, wherein the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted compared to SEQ ID NO: 201; or B. A truncated upper stem region, wherein the truncated upper stem region lacks 1 to 6 nucleotides, and wherein 6, 7, 8, 9, 10, or 11 nucleotides of the truncated upper stem region contain no more than 4 substitutions compared to SEQ ID NO:201; or C. A substitution compared to SEQ ID NO: 201 in any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substitution nucleotide is not a pyrimidine followed by an adenine or an adenine preceded by a pyrimidine; or D. SpyCas9 sgRNA-1 (SEQ ID NO: 201) having an upper stem region, wherein the upper stem modification comprises any one or more modifications of US1 to US12 in the upper stem region.
14. The guide RNA of claim 13, comprising one or more of:
16. 14. The guide RNA of Claim 13, further comprising the nucleotide sequence GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 200) 3' to the guide sequence.
17. (1) GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 201) 3' to the guide sequence; (2) GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAAGUGGCACCGAGUCGGUGC 3' to the guide sequence UUUU (SEQ ID NO: 202), or (3) The guide RNA of claim 13, further comprising a nucleotide sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGCU 3' to the guide sequence.
18. The guide RNA is selected from the group consisting of mN*mN*mN*NNNNNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 300), or mN*mN*mN*NNNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmA 17. The guide RNA of claim 16, wherein the guide RNA is modified according to the pattern AmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGmU*mG*mC*mU (SEQ ID NO: 414), wherein "N" can be any natural or unnatural nucleotide, m is a 2'-O-methyl modified nucleotide, and * is a phosphorothioate linkage between nucleotide residues, and wherein the N's collectively are the nucleotide sequence of any preceding claimed guide sequence.
19. The guide RNA is (i) 2'-O-methyl (2'-O-Me) modified nucleotides or 2'-F modified nucleotides; (ii) phosphorothioate (PS) internucleotide bonds; (iii) a modification in one or more of the five nucleotides at the 5' end of the guide RNA; (iv) a modification in one or more of the five nucleotides at the 3' end of the guide RNA; (v) a PS bond between each of the four nucleotides at the 5' end of the guide RNA; (vi) a PS bond between each of the four nucleotides at the 3' end of the guide RNA; (vii) a 2'-O-Me modified nucleotide in each of the first three nucleotides at the 5' end of the guide RNA; and (viii) a 2'-O-Me modified nucleotide in each of the last three nucleotides at the 3' end of the guide RNA.
14. The guide RNA of claim 13, comprising modifications including one or more of:
20. 13. A composition comprising the guide RNA of claim 12 and an RNA-guided DNA binding agent, wherein the RNA-guided DNA binding agent is a polypeptide RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent polypeptide.
21. The RNA-guided DNA binder is (i) Cas9 nuclease; (ii) a polypeptide in which modifications can be made within the DNA sequence; (iii) S. pyogenes Cas9 nuclease; (iv) a nuclease selected from the group consisting of a cleavase, a nickase, and an inactive nuclease.
21. The composition of claim 20, wherein
22. a nucleic acid encoding the RNA-guided DNA binder, a. a DNA coding sequence; b. mRNA with an open reading frame (ORF); c. a coding sequence in an expression vector; d. Coding sequences within viral vectors 21. The composition of claim 20, wherein the composition is selected from:
23. 21. The composition of claim 20, wherein the composition further comprises a pharmaceutically acceptable excipient.
24. 21. The guide RNA of claim 11 or the composition of claim 20, wherein the guide RNA is associated with a lipid nanoparticle (LNP).
25. 12. A method for genetically modifying a CD38 sequence in a cell, the method comprising contacting the cell with a guide RNA or composition described in claim 11.
26. 1. A method for preparing a cell population for immunotherapy, comprising: a. Genetically modifying a CD38 sequence in the cells within the population with the CD38 guide RNA or composition of claim 11; b. Expanding the cell population in culture; The method comprising:
27. (i) contacting the cells with an LNP composition comprising a CD38 guide RNA; (ii) contacting the cell with a second LNP composition comprising a guide RNA; or (iii) Both (i) and (ii) 27. The method of claim 26, further comprising:
28. A cell population comprising a genetic modification of the CD38 gene, wherein at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the cells in said population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CD38 sequence; (a) the genetic modification is as defined in claim 1; (b) CD38 expression is reduced by at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the detection limit of the assay, compared to a suitable control; (c) the population comprises at least 10 3 , 10 4 , 10 5 or 10 6 cells, 10 7 , 2 × 10 7 , 5 x 10 7 , or 10 8 containing cells, (d) at least 70% of the cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CD38 sequence; (e) at least 80% of the cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CD38 sequence; (f) at least 90% of the cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CD38 sequence; (g) at least 95% of the cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CD38 sequence; (h) the expression of CD38 is reduced by at least 70% compared to a suitable control or to below the detection limit of the assay; (i) the expression of CD38 is reduced by at least 80% compared to a suitable control, or to below the detection limit of the assay; (j) the expression of CD38 is reduced by at least 90% compared to a suitable control or to below the detection limit of the assay; or (k) said cell population, wherein expression of CD38 is reduced by at least 95% compared to a suitable control, or to below the detection limit of said assay.
29. A pharmaceutical composition comprising the cell population of claim 28.
30. 30. The engineered cells of claim 1, the pharmaceutical composition of claim 10, the cell population of claim 28 or the pharmaceutical composition of claim 29 for use as an ACT therapy.
31. the genetic modification is within the genomic coordinates of chr4:15778275-15853232; or the genetic modification is within the genomic coordinates of chr4:15778471-15778491; or the genetic modification is within the genomic coordinates of chr4:15778541-15778561; or the genetic modification is within the genomic coordinates of chr4:15778545-15778565; or the genetic modification is within the genomic coordinates of chr4:15778546-15778566; or the genetic modification is within the genomic coordinates of chr4:15778551-15778571; or the genetic modification is within the genomic coordinates of chr4:15778552-15778572; or the genetic modification is within the genomic coordinates of chr4:15778557-15778577; or the genetic modification is within the genomic coordinates of chr4:15778573-15778593; or the genetic modification is within the genomic coordinates of chr4:15778580-15778600; or the genetic modification is within the genomic coordinates of chr4:15778583-15778603; or the genetic modification is within the genomic coordinates of chr4:15778584-15778604; or the genetic modification is within the genomic coordinates of chr4:15778594-15778614; or the genetic modification is within the genomic coordinates of chr4:15778595-15778615; or the genetic modification is within the genomic coordinates of chr4:15778601-15778621; or the genetic modification is within the genomic coordinates of chr4:15778639-15778659; or the genetic modification is within the genomic coordinates of chr4:15816526-15816546; or the genetic modification is within the genomic coordinates of chr4:15824930-15824950; or the genetic modification is within the genomic coordinates of chr4:15824950-15824970; or the genetic modification is within the genomic coordinates of chr4:15824975-15824995; or the genetic modification is within the genomic coordinates of chr4:15838107-15838127; or the genetic modification is within the genomic coordinates of chr4:15840062-15840082; or the genetic modification is within the genomic coordinates of chr4:15840077-15840097; or 2. The engineered cell of claim 1, wherein said genetic modification is within the genomic coordinates of chr4:15840087-15840107.
32. 10. The engineered cell of claim 1 for use in treating cancer in a subject.
33. 33. The engineered cell of claim 32, wherein the treatment of the cancer comprises administering to the subject an additional therapeutic agent.
34. the additional therapeutic agent is (a) anti-CD38 antibody, (b) an anti-CD38 antibody selected from the group consisting of daratumumab, isatuximab, TAK-079, or MOR-202; (c) small molecule inhibitors of CD38; (d) a small molecule inhibitor selected from the group consisting of CD38 inhibitor 78c, CD38 inhibitor 1ah, and CD38 inhibitor 1ai; (e) NAD+ analogue, (f) an NAD analog selected from the group consisting of Ara-F-NAD, Ara-F-NMN, Ara-F-NMN phosphoester / C48, Carba-NAD, and Pseudo-Carba-NAD; (g) flavonoids, (h) a flavonoid selected from the group consisting of quercetin, apigenin, luteolinidin, chromanin, and rhein / K-rhein; (i) a cell containing a chimeric antigen receptor, or (j) cells containing a chimeric antigen receptor that specifically binds to CD38 34. The engineered cell of claim 33, wherein the CD38-targeted therapy is selected from the group consisting of:
35. (a) the cancer is selected from the group consisting of bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gums, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testicle, tongue, or uterus cancer; (b) Foreword, new growth, evil; cancer; cancer, undifferentiated; giant cell and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; rinpa carcinoma; basal cell carcinoma; pilonidal stromal carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrointestinal carcinoma, evil; cholangiocarcinoma; hepatocellular carcinoma; mixed type of hepatocellular carcinoma and cholangiocarcinoma; cord adenocarcinoma; adenocarcinoma; adenomatous polyposis; adenocarcinoma, familial colorectal polyposis; solid carcinoma; carcinoma, evil Sex; pulmonary adenocarcinoma of the endocardium; papillary adenocarcinoma; pigmentophobe carcinoma; acidophilic carcinoma; acidophilic adenocarcinoma; sarcoid carcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary-follicular adenocarcinoma; non-encapsulated sclerosing carcinoma; adrenal cortical carcinoma; endometrioid carcinoma; carcinoma of skin accessory organs; apocynoid adenocarcinoma; sebaceous gland carcinoma; otosclerotic gland carcinoma; mucoepidermal carcinoma; cystic adenocarcinoma; papillary cystic adenocarcinoma; papillary serous cystic adenocarcinoma; mucinous cystic adenocarcinoma; mucinous gland carcinoma; signet ring cell carcinoma; invasive ductal carcinoma; marrow carcinoma; lobular carcinoma; Inflammatory carcinoma; Paget's disease of the breast; Acinic cell carcinoma; Adenosquamous carcinoma; Adenocarcinoma with squamous metaplasia; Malignant thymoma; Malignant ovarian stromal tumor; Malignant theca cell tumor; Malignant granulosa cell tumor; and Malignant roblastoma; Sertoli cell carcinoma; Malignant Leydig cell tumor; Malignant lipid cell tumor; Malignant paraganglioma; Malignant extramammary paraganglioma; Pheochromocytoma; Glomus angiosarcoma; Malignant melanoma; Amelanotic Melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; mixed Müllerian tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; malignant mesenchymoma; malignant Brenner tumor; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; Dysgerminoma; Embryonic carcinoma; Malignant teratoma; Malignant ovarial goiter; Choriocarcinoma; Malignant mesonephroma; Angiosarcoma; Malignant hemangioendothelioma; Kaposi's sarcoma; Malignant hemangiopericytoma; Lymphangiosarcoma; Osteosarcoma; Parosteal osteosarcoma; Chondrosarcoma; Malignant chondroblastoma; Mesenchymal chondrosarcoma; Giant cell tumor of bone; Ewing's sarcoma; Malignant odontogenic tumor; Ameloblastic odontosarcoma; Malignant ameloblastoma; Ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma; ependymoma; astrocytoma; Plasmatic astrocytoma; fibrous astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; Oligodendroblastoma; Primitive neuroectodermal tumor; Cerebellar sarcoma; Ganglioneuroblastoma; Neuroblastoma; Retinoblastoma; Olfactory neurogenic tumor; Malignant meningioma; Neurofibrosarcoma; Malignant schwannoma; Malignant granular cell tumor; Malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; Paragranuloma; Small lymphocytic lymphoma; Diffuse large cell lymphoma; Follicular lymphoma; Mycosis fungoides; Other specified non-Hodgkin's disease the histology is selected from the group consisting of: Johnson & Johnson lymphoma; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphocytic leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia, (c) the cancer comprises a solid tumor; (d) the tumor is an adenocarcinoma, adrenal gland tumor, anal tumor, bile duct tumor, bladder tumor, bone tumor, blood-borne tumor, brain / CNS tumor, breast tumor, cervical tumor, colorectal tumor, endometrial tumor, esophageal tumor, Ewing's tumor, eye tumor, gallbladder tumor, gastrointestinal tumor, kidney tumor, laryngeal or hypopharyngeal tumor, liver tumor, lung tumor, mesothelial tumor, multiple myeloma, muscle tumor, nasopharyngeal tumor, neuroblastoma, oral cavity tumor, osteosarcoma, ovarian tumor, pancreatic tumor, penile tumor, pituitary tumor, primary tumor, prostate tumor, retinoblastoma, rhabdomyosarcoma, salivary gland tumor, soft tissue sarcoma, melanoma, metastatic tumor, basal cell carcinoma, Merkel cell tumor, testicular tumor, thymus tumor, thyroid tumor, uterine tumor, vaginal tumor, vulvar tumor, or Wilms' tumor; or (e) the cancer is selected from the group consisting of multiple myeloma, chronic lymphocytic leukemia, lung cancer, prostate cancer, or melanoma; 33. The engineered cell of claim 32, wherein the cancer is a CD38-expressing cancer.